A traditional Chinese medicine composition with the functions of preventing and / or treating respiratory viral infection and its preparation method and application

Abstract

The present application belongs to the technical field of biological medicine, and particularly relates to a medicinal and edible Chinese medicinal composition with the effects of preventing and / or treating respiratory viral infection, and a preparation method and application thereof. The present application provides a Chinese medicinal composition composed of medicinal and edible medicinal materials such as lily, astragalus, jujube, bitter almond, mulberry leaf, agastache, and ginger. After preventive administration, the Chinese medicinal composition can up-regulate the expression of antiviral innate immune factors such as MAVS, TBK1, IFN-alpha, IFN-beta, etc. in lung tissue and liver tissue, so that the body enters an antiviral response state in advance. After viral infection, the Chinese medicinal composition can also down-regulate the excessive expression of inflammatory factors such as NF-kappa B p65, TNF-alpha, and IL-6, etc. caused by viral infection. Thanks to the above mechanism, after preventive administration, the Chinese medicinal composition can effectively inhibit viral replication, significantly reduce serum viral load, reduce the abnormal general state caused by coronavirus infection, and has a significant protective effect on liver injury and lung injury caused by infection.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology. More specifically, it relates to a traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, as well as its preparation method and application. Background Technology

[0002] Epidemics (plagues) are major infectious diseases that seriously endanger public health and social stability. Traditional Chinese medicine believes that epidemics are mostly caused by pathogenic factors invading the body, characterized by rapid onset, rapid transmission, high infectivity, and ease of spread. Respiratory viral infections, represented by coronaviruses, enter the body through the mouth and nose, initially affecting the lungs. Clinically, they are mainly manifested by fever, cough, fatigue, chest tightness, and shortness of breath; severe cases can lead to lung tissue inflammation and damage, as well as multiple organ dysfunction. In recent years, various respiratory viruses have continued to mutate and recur, making viral epidemics a long-term challenge in the field of public health. Existing prevention and control measures mainly include vaccination, antiviral drugs, and symptomatic treatment. However, vaccine effectiveness is easily affected by viral mutations and immune escape. Antiviral drugs are mostly used for post-infection treatment and cannot meet the overall protection needs before infection, and their improvement on the complex pathological processes caused by viral infection (such as inflammatory damage and liver and lung tissue damage) is limited.

[0003] Traditional Chinese medicine (TCM) emphasizes "treating disease before it occurs," "preventing disease before it manifests," and "strengthening the body's resistance and eliminating pathogenic factors" in the prevention and treatment of epidemics. For respiratory epidemics, pathogenic factors enter through the mouth and nose, initially affecting the lungs. Their occurrence and development are closely related to weakened lung defenses, insufficient vital energy, impaired lung function, and internal obstruction by dampness. Therefore, strengthening vital energy, protecting lung defenses, promoting lung function, and eliminating dampness are important TCM treatment methods for preventing respiratory epidemics. TCM compound formulas, with their multi-component, multi-target, and multi-stage comprehensive regulatory characteristics, are suitable for conditioning the body's overall state before infection. Currently, some TCM compositions have been publicly disclosed for the prevention and treatment of coronavirus infection or respiratory epidemics. For example, Chinese patent application CN111773308A discloses a "Xuanfei Paidu Decoction" composition, consisting of ephedra, gypsum, apricot kernel, platycodon, cinnamon twig, white peony root, honeysuckle, forsythia, codonopsis, and licorice, which has the functions of clearing the lungs and consolidating the exterior, supporting the body's vital energy, and resolving dampness and detoxifying. However, the formula contains ephedra and other non-food and medicinal materials, and its medicinal properties are relatively strong, making it unsuitable for daily long-term preventive use. Another example is a traditional Chinese medicine composition disclosed in CN112076262A, consisting of forsythia, honeysuckle, isatis root, rhubarb, patchouli, dryopteris crassirhizoma, and rhodiola rosea, which focuses on clearing heat and detoxifying, and eliminating pathogens. The isatis root and rhubarb in the formula are not food and medicinal materials, making it unsuitable for long-term preventive use, and primarily focused on post-infection treatment.

[0004] Therefore, it is urgent to develop a traditional Chinese medicine composition that can enhance the body's early defense against diseases, reduce the risk of coronavirus infection, and alleviate infection-related liver and lung damage. This is of great significance for improving respiratory disease prevention strategies. Summary of the Invention

[0005] This invention addresses the problem of the lack of traditional Chinese medicine compositions composed of medicinal and edible herbs capable of preventing viral infections in the prior art, and aims to provide a traditional Chinese medicine composition that can be used as both medicine and food and has the effect of preventing and / or treating respiratory viral infections.

[0006] A second objective of this invention is to provide a method for preparing the aforementioned traditional Chinese medicine composition that is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections.

[0007] A third objective of this invention is to provide the application of the aforementioned dual-use (medicinal and edible) traditional Chinese medicine composition with preventive and / or therapeutic effects on respiratory viral infections in the preparation of products for the prevention and / or treatment of respiratory viral infections.

[0008] The fourth objective of this invention is to provide a product.

[0009] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides a traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections. The traditional Chinese medicine composition is composed of any one of the following traditional Chinese medicinal materials: (1) Lily bulb, astragalus root, jujube, bitter almond, mulberry leaf, patchouli, ginger; (2) Lily bulb, astragalus root, jujube, bitter almond, mulberry leaf, patchouli, ginger, honeysuckle; (3) Lily, Astragalus, Jujube, Bitter Almond, Mulberry Leaf, Patchouli, Ginger, Houttuynia cordata.

[0010] Furthermore, lily bulb, astragalus root, jujube, bitter almond, mulberry leaf, patchouli, ginger, honeysuckle, and houttuynia cordata are all substances that are both food and medicine.

[0011] Respiratory viral infectious diseases such as coronavirus infection fall under the categories of "epidemic disease" or "plague" in Traditional Chinese Medicine (TCM). These are exogenous diseases caused by pathogenic factors invading the body. Common clinical manifestations include fever, cough, fatigue, chest tightness, and shortness of breath. In severe cases, pulmonary symptoms may worsen and affect multiple organ functions. TCM believes that pathogenic factors often enter through the mouth and nose. The lungs, acting as a protective canopy, are externally connected to the skin and hair, and open to the nose, governing respiration. Therefore, respiratory epidemics often initially affect the lungs, leading to lung defense deficiency, impaired lung qi circulation, and dysfunction of the lung's dispersing and descending functions. If the body's vital energy is insufficient and its defensive qi is weak, pathogenic factors can easily invade. If dampness obstructs the internal flow of qi, it can further disrupt the normal dispersing and descending functions of lung qi, resulting in symptoms such as cough, chest tightness, shortness of breath, and fatigue, and can further lead to lingering pathogens and prolonged illness. Therefore, the prevention of respiratory diseases should focus on supporting the body's vital energy, strengthening the lungs and diaphragm, promoting lung function and regulating qi, and eliminating dampness and turbidity, so as to strengthen the lungs and diaphragm, regulate qi, and eliminate dampness and turbidity, thereby enhancing the body's ability to resist the invasion of pathogenic factors.

[0012] The traditional Chinese medicine composition of this invention is mainly for preventing epidemics and protecting the lungs and wei qi. Based on the pathogenesis of respiratory epidemics, namely "the lungs and wei qi are affected by pathogens, the body's vital energy is insufficient, dampness obstructs the interior, and the lungs fail to disperse and descend qi", it adopts the method of invigorating qi and resolving dampness, and dispersing and descending qi. The formula uses Astragalus membranaceus to invigorate Qi, strengthen the exterior, and nourish the lungs and spleen, making it a key herb for supporting the body's vital energy and protecting the lungs. Jujube is added to invigorate Qi, strengthen the spleen, and harmonize the Ying and Wei Qi, while also moderating the properties of other herbs to enhance the effect of supporting the body's vital energy. Lily bulbs nourish Yin and moisten the lungs, clearing dryness and helping the lungs to be nourished, alleviating the damage to lung Yin and loss of lung function caused by epidemic pathogens invading the lungs. Bitter almonds promote lung function, lower Qi, stop coughing, and relieve asthma, focusing on restoring the pivotal function of lung Qi's dispersing and descending, improving symptoms of impaired lung Qi such as cough, shortness of breath, and chest tightness. Mulberry leaves disperse wind-heat and clear the lung channels, and can be used for cough and fever caused by external pathogens invading the lungs and excessive lung heat. Patchouli aromatically transforms dampness, harmonizes the middle Jiao, and releases the exterior, addressing the pathological characteristics of epidemic pathogens with dampness, dampness obstruction, and Qi stagnation, thus transforming dampness, harmonizing the spleen and stomach, and restoring the dispersing and descending function of lung Qi. When used together, these herbs replenish without causing stagnation, promote circulation without depleting energy, moisten without becoming greasy, and resolve dampness without harming the body's vital energy. Together, they work to invigorate Qi and resolve dampness, promote lung function and lower Qi, and strengthen the lung defenses. This approach is suitable for preventive interventions against respiratory viral infections such as coronaviruses and epidemic diseases.

[0013] Preferably, the traditional Chinese medicine composition is composed of any one of the following traditional Chinese medicinal materials: (1) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, and 3-8 parts by weight of ginger; (2) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 3-8 parts by weight of ginger, and 5-15 parts by weight of honeysuckle. (3) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 3-8 parts by weight of ginger, and 10-20 parts by weight of houttuynia cordata.

[0014] Preferably, the traditional Chinese medicine composition is composed of any one of the following traditional Chinese medicinal materials: (1) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, and 4-6 parts by weight of ginger; (2) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 4-6 parts by weight of ginger, and 8-12 parts by weight of honeysuckle. (3) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 4-6 parts by weight of ginger, and 12-18 parts by weight of houttuynia cordata.

[0015] The present invention also provides a method for preparing the traditional Chinese medicine composition that is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections, comprising the following steps: Weigh out the appropriate amount of Chinese medicinal herbs, mix them with water, decoct them, filter, and then concentrate the solution.

[0016] Preferably, the decoction is performed 1 to 3 times.

[0017] Preferably, the simmering time is 30-120 minutes.

[0018] Preferably, the concentration of the crude drug in the traditional Chinese medicine composition is 0.5~2 g / mL; more preferably, it is 1~2 g / mL.

[0019] As one specific optional implementation, the preparation method of the traditional Chinese medicine composition that is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections includes the following steps: Weigh the raw materials according to the specified weight, add water and decoct twice. The first decoction is for 60 minutes and the second decoction is for 30 minutes. Combine the filtrates obtained from the two decoctions to obtain the traditional Chinese medicine composition that is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections.

[0020] The present invention also provides the application of the traditional Chinese medicine composition, which is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections, in the preparation of products for preventing and / or treating respiratory viral infections.

[0021] Furthermore, the prevention and / or treatment of respiratory viral infections involves upregulating antiviral innate immune factors.

[0022] Furthermore, the upregulation of antiviral innate immune factors involves upregulating the mRNA of MAVS, TBK1, IFN-α, and IFN-β in lung and liver tissues.

[0023] Furthermore, the prevention and / or treatment of respiratory viral infections involves activating innate immune signaling pathways.

[0024] Furthermore, the activation of the innate immune signaling pathway involves increasing the upregulation of protein phosphorylation levels in lung and liver tissues.

[0025] Furthermore, the prevention and / or treatment of respiratory viral infections involves downregulating excessive inflammatory responses.

[0026] Furthermore, the downregulation of excessive inflammatory response is achieved by inhibiting the expression of inflammatory factors induced by the virus.

[0027] Furthermore, the inflammatory factors include NF-κB p65, TNF-α, and IL-6.

[0028] Furthermore, the prevention and / or treatment of respiratory viral infections involves inhibiting viral replication.

[0029] Furthermore, the prevention and / or treatment of respiratory viral infections aims to improve the slowing or decrease in weight gain caused by viral infection and to improve abnormal fluctuations in body temperature.

[0030] Furthermore, the prevention and / or treatment of respiratory viral infections aims to protect organs and reduce pathological damage caused by the virus.

[0031] Furthermore, the protected organ includes at least one of the following: (1) In the lungs, it reduces inflammatory cell infiltration, alveolar wall thickening, local hemorrhage and alveolar structural damage; (2) In the liver, it reduces hepatocyte degeneration, necrosis and inflammatory cell infiltration, and protects the structural integrity of liver tissue.

[0032] Furthermore, the prevention and / or treatment of respiratory viral infection is to reduce the elevation of serum AST (aspartate aminotransferase) and ALT (alanine aminotransferase) caused by viral infection.

[0033] Preferably, the respiratory virus includes coronaviruses.

[0034] More preferably, the coronavirus includes beta coronavirus.

[0035] The present invention also provides a product comprising the aforementioned medicinal and edible traditional Chinese medicine composition that has the effect of preventing and / or treating respiratory viral infections.

[0036] Preferably, the product further comprises pharmaceutically acceptable excipients.

[0037] Preferably, the dosage form of the product is any one of decoction, granules, capsules, tablets, oral liquid, pills, powders, tea, or medicinal food.

[0038] Preferably, the product includes pharmaceuticals and / or health products.

[0039] The present invention has the following beneficial effects: This invention provides a traditional Chinese medicine composition made from medicinal and edible herbs such as lily bulb, astragalus root, jujube, bitter almond, mulberry leaf, patchouli, and ginger. The composition is mild, safe, and non-toxic. Experimental verification shows that prophylactic administration of this traditional Chinese medicine composition can moderately upregulate the expression of antiviral innate immune factors such as MAVS, TBK1, IFN-α, and IFN-β in lung and liver tissues, enabling the body to enter an antiviral response state earlier. After viral infection, it can downregulate the overexpression of inflammatory factors such as NF-κB p65, TNF-α, and IL-6 caused by viral infection. Benefiting from these mechanisms, prophylactic administration of this traditional Chinese medicine composition can effectively inhibit viral replication, significantly reduce serum viral load, alleviate systemic abnormalities caused by coronavirus infection, and has a significant protective effect against liver and lung damage caused by infection. Attached Figure Description

[0040] Figure 1 Figure A in the figure shows the trend of weight change in mice after coronavirus infection; Figure 1 Figure B in the diagram shows the trend of body temperature changes in mice after coronavirus infection.

[0041] Figure 2 This is a statistical chart of data on the lung, liver, and spleen indices of mice. Figure 2 Figure A in the figure is a statistical chart of the lung index data of mice 3 days after prophylactic administration; Figure 2 Figure B in the figure is a statistical chart of liver index data in mice 3 days after prophylactic administration; Figure 2 Figure C in the figure is a statistical chart of the spleen index data of mice 3 days after prophylactic administration; Figure 2 Figure D in the graph is a statistical chart of liver index data of mice on day 3 after viral infection; Figure 2 Figure E in the figure is a statistical chart of the lung index data of mice on day 3 after viral infection; Figure 2 The F-chart in the figure is a statistical chart of spleen index data of mice on day 3 after viral infection; Figure 2 The G-plot in the figure is a statistical chart of the lung index data of mice on day 6 after viral infection; Figure 2 The H-plot in the figure is a statistical chart of liver index data in mice on day 6 after viral infection; Figure 2 Figure I in the figure is a statistical chart of the spleen index data of mice on day 6 after infection with the virus.

[0042] Figure 3 This is a statistical chart of viral load data, in which... Figure 3 Figure A in the figure shows the statistical data on the effect of prophylactic administration on viral load on day 3 after MHV-A59 infection. Figure 3 Figure B in the figure is a statistical chart showing the effect of prophylactic administration on viral load on day 6 after MHV-A59 infection.

[0043] Figure 4This is a statistical graph showing the changes in serum ALT and AST activities in mice. Figure 4 Figure A in the figure is a statistical chart of ALT activity data after 3 days of prophylactic administration; Figure 4 Figure B in the figure is a statistical chart of AST activity data after 3 days of prophylactic administration; Figure 4 Figure C in the figure is a statistical chart of ALT activity data on day 3 after viral infection; Figure 4 Figure D in the figure is a statistical chart of AST activity data on day 3 after viral infection; Figure 4 Figure E in the figure is a statistical chart of ALT activity data on day 6 after viral infection; Figure 4 The F-chart in the figure is a statistical chart of AST activity data on day 6 after viral infection.

[0044] Figure 5 This is an image of hematoxylin-eosin staining in mouse lung tissue, where... Figure 5 Figure A in the image shows hematoxylin-eosin staining of mouse lung tissue 3 days after prophylactic administration. Figure 5 Figure B in the image shows hematoxylin-eosin staining of mouse lung tissue on day 3 after viral infection; Figure 5 Figure C in the image shows the hematoxylin-eosin staining of mouse lung tissue on day 6 after viral infection.

[0045] Figure 6 This is an image of hematoxylin-eosin staining in mouse liver tissue, where... Figure 6 Figure A in the image shows hematoxylin-eosin staining of mouse liver tissue 3 days after prophylactic administration; Figure 6 Figure B in the image shows a hematoxylin-eosin staining of mouse liver tissue on day 3 after viral infection. Figure 6 Figure C in the image shows a hematoxylin-eosin staining of mouse liver tissue on day 6 after viral infection.

[0046] Figure 7 Figure A1 in the figure is a statistical graph of MAVS data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure A2 in the figure is a statistical graph of TBK1 data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure A3 in the figure is a statistical graph of IFN-α data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure A4 in the figure is a statistical graph of IFN-β data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure A5 in the figure is a statistical graph of NF-κB p65 data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure A6 in the figure is a statistical graph of TNF-α data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure A7 in the figure is a statistical chart of IL-6 data in mouse lung tissue 3 days after prophylactic administration; Figure 7 Figure B1 in the figure is a statistical chart of MAVS data in mouse lung tissue on day 3 after viral infection; Figure 7 Figure B2 in the figure is a statistical chart of TBK1 data in mouse lung tissue on day 3 after viral infection; Figure 7 Figure B3 in the figure is a statistical chart of IFN-α data in mouse lung tissue on day 3 after viral infection; Figure 7 Figure B4 in the figure is a statistical chart of IFN-β data from mouse lung tissue on day 3 after viral infection; Figure 7 Figure B5 in the figure is a statistical graph of NF-κB p65 data in mouse lung tissue on day 3 after viral infection; Figure 7 Figure B6 in the figure is a statistical chart of TNF-α data in mouse lung tissue on day 3 after viral infection; Figure 7 Figure B7 in the figure is a statistical chart of IL-6 data in mouse lung tissue on day 3 after viral infection; Figure 7 Figure C1 in the figure is a statistical graph of MAVS data in mouse lung tissue on day 6 after viral infection; Figure 7 Figure C2 in the figure is a statistical chart of TBK1 data in mouse lung tissue on day 6 after viral infection; Figure 7 Figure C3 in the figure is a statistical graph of IFN-α data in mouse lung tissue on day 6 after viral infection; Figure 7 Figure C4 in the figure is a statistical graph of IFN-β data in mouse lung tissue on day 6 after viral infection; Figure 7 Figure C5 in the figure is a statistical graph of NF-κB p65 data in mouse lung tissue on day 6 after viral infection; Figure 7 Figure C6 in the figure is a statistical graph of TNF-α data in mouse lung tissue on day 6 after viral infection; Figure 7 Figure C7 in the figure is a statistical chart of IL-6 data in the lung tissue of mice on day 6 after infection with the virus.

[0047] Figure 8 Figure A1 in the figure is a statistical graph of MAVS data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure A2 in the figure is a statistical graph of TBK1 data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure A3 in the figure is a statistical graph of IFN-α data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure A4 in the figure is a statistical graph of IFN-β data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure A5 in the figure is a statistical graph of NF-κB p65 data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure A6 in the figure is a statistical graph of TNF-α data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure A7 in the figure is a statistical chart of IL-6 data in mouse liver tissue 3 days after prophylactic administration; Figure 8 Figure B1 in the figure is a statistical chart of MAVS data in mouse liver tissue on day 3 after viral infection; Figure 8 Figure B2 in the figure is a statistical chart of TBK1 data in mouse liver tissue on day 3 after viral infection; Figure 8Figure B3 in the figure is a statistical chart of IFN-α data in mouse liver tissue on day 3 after viral infection; Figure 8 Figure B4 in the figure is a statistical chart of IFN-β data in mouse liver tissue on day 3 after viral infection; Figure 8 Figure B5 in the figure is a statistical graph of NF-κB p65 data in mouse liver tissue on day 3 after viral infection; Figure 8 Figure B6 in the figure is a statistical chart of TNF-α data in mouse liver tissue on day 3 after viral infection; Figure 8 Figure B7 in the figure is a statistical chart of IL-6 data in mouse liver tissue on day 3 after viral infection; Figure 8 Figure C1 in the figure is a statistical graph of MAVS data in mouse liver tissue on day 6 after viral infection; Figure 8 Figure C2 in the figure is a statistical graph of TBK1 data in mouse liver tissue on day 6 after viral infection; Figure 8 Figure C3 in the figure is a statistical chart of IFN-α data in mouse liver tissue on day 6 after viral infection; Figure 8 Figure C4 in the figure is a statistical graph of IFN-β data in mouse liver tissue on day 6 after viral infection; Figure 8 Figure C5 in the figure is a statistical graph of NF-κB p65 data in mouse liver tissue on day 6 after viral infection; Figure 8 Figure C6 in the figure is a statistical graph of TNF-α data in mouse liver tissue on day 6 after viral infection; Figure 8 Figure C7 in the figure is a statistical chart of IL-6 data in mouse liver tissue on day 6 after viral infection.

[0048] Figure 9 Figure A1 in the image is a grayscale image of a Western blot taken 3 days after prophylactic administration. Figure 9 Figure A2 in the figure is a statistical graph showing the expression of MAVS protein in mouse lung tissue 3 days after prophylactic administration; Figure 9 Figure A3 in the figure is a statistical graph showing the expression of TBK1 protein in mouse lung tissue 3 days after prophylactic administration; Figure 9 Figure A4 in the figure is a statistical graph of NF-κB p65 protein expression in mouse lung tissue 3 days after prophylactic administration; Figure 9 Figure B1 in the image is a grayscale image of a Western blot taken on day 3 after viral infection. Figure 9 Figure B2 in the figure is a statistical chart of MAVS protein expression in mouse lung tissue on day 3 after viral infection; Figure 9 Figure B3 in the figure is a statistical chart of TBK1 protein expression in mouse lung tissue on day 3 after viral infection; Figure 9 Figure B4 in the figure is a statistical graph of NF-κB p65 protein expression in mouse lung tissue on day 3 after viral infection; Figure 9 Figure C1 in the image is a grayscale image of a Western blot taken on day 6 after viral infection. Figure 9Figure C2 in the figure is a statistical graph of MAVS protein expression in mouse lung tissue on day 6 after viral infection; Figure 9 Figure C3 in the figure is a statistical graph of TBK1 protein expression in mouse lung tissue on day 6 after viral infection; Figure 9 Figure C4 in the figure is a statistical graph showing the expression of NF-κB p65 protein in the lung tissue of mice on day 6 after viral infection.

[0049] Figure 10 Figure A1 in the image is a grayscale image of a Western blot taken 3 days after prophylactic administration. Figure 10 Figure A2 in the figure is a statistical graph showing the expression data of MAVS protein in mouse liver tissue 3 days after prophylactic administration; Figure 10 Figure A3 in the figure is a statistical graph of TBK1 protein expression in mouse liver tissue 3 days after prophylactic administration; Figure 10 Figure A4 in the figure is a statistical graph of NF-κB p65 protein expression in mouse liver tissue 3 days after prophylactic administration; Figure 10 Figure B1 in the image is a grayscale image of a Western blot taken on day 3 after viral infection. Figure 10 Figure B2 in the figure is a statistical chart of MAVS protein expression in mouse liver tissue on day 3 after viral infection; Figure 10 Figure B3 in the figure is a statistical graph of TBK1 protein expression in mouse liver tissue on day 3 after viral infection; Figure 10 Figure B4 in the figure is a statistical graph of NF-κB p65 protein expression in mouse liver tissue on day 3 after viral infection; Figure 10 Figure C1 in the image is a grayscale image of a Western blot taken on day 6 after viral infection. Figure 10 Figure C2 in the figure is a statistical graph of MAVS protein expression in mouse liver tissue on day 6 after viral infection; Figure 10 Figure C3 in the figure is a statistical graph of TBK1 protein expression in mouse liver tissue on day 6 after viral infection; Figure 10 Figure C4 in the figure is a statistical graph showing the expression of NF-κB p65 protein in the liver tissue of mice on day 6 after viral infection.

[0050] Figure 11 This is a statistical graph showing the viral load in mouse serum. Figure 11 Figure A in the figure is a statistical chart of viral load in mouse serum on day 3 after coronavirus infection; Figure 11 Figure B in the figure is a statistical chart of viral load data in mouse serum on day 6 after coronavirus infection.

[0051] Figure 12 This is a statistical graph showing the secretion of inflammatory mRNA in the lung tissue of a mouse model infected with coronavirus. Figure 12Figure A in the figure is a statistical chart of IL-6 expression data; Figure 12 Figure B in the figure is a statistical chart of TNF-α expression data; Figure 12 Figure C in the figure is a statistical graph of NF-κB p65 expression data. Detailed Implementation

[0052] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0053] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0054] The medicinal materials involved in this invention are all provided by the pharmacy of Guangdong Provincial Hospital of Traditional Chinese Medicine (Fangcun Branch), but this invention is not limited to this source, and the same medicinal materials from other sources are also applicable.

[0055] The formula for calculating the concentration of the medicinal material in this invention is as follows: Raw drug concentration (g / mL) = Total amount of raw materials fed (g) / Actual total volume of final concentrated liquid (mL).

[0056] Example 1: A traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, and its preparation method. A traditional Chinese medicine composition that can be used as both food and medicine, and has significant effects of invigorating qi, resolving dampness, and promoting lung function and lowering qi, is named Gu Jin Yi Wei Fang. It consists of the following components: 15 g of lily bulb, 30 g of astragalus root, 5 g of jujube, 10 g of bitter almond, 10 g of mulberry leaf, 10 g of patchouli, and 5 g of ginger. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate them into three different concentrations of raw medicinal materials: 0.5 g / mL, 1 g / mL and 2 g / mL, and store at 4℃ for later use.

[0057] Example 2: A traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, and its preparation method. A traditional Chinese medicine composition that can be used as both food and medicine, and has significant effects of invigorating qi, resolving dampness, and promoting lung function and lowering qi, is named Gu Jin Yi Wei Fang. It consists of the following components: 10 g of lily bulb, 20 g of astragalus root, 2 g of jujube, 5 g of bitter almond, 5 g of mulberry leaf, 15 g of patchouli, and 5 g of ginger. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate them into three different concentrations of raw medicinal materials: 0.5 g / mL, 1 g / mL and 2 g / mL, and store at 4℃ for later use.

[0058] Example 3: A traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, and its preparation method. A traditional Chinese medicine composition that can be used as both food and medicine, and has significant effects of invigorating qi, resolving dampness, and promoting lung function and lowering qi, is named Gu Jin Yi Wei Fang. It consists of the following components: 25 g of lily bulb, 40 g of astragalus root, 10 g of jujube, 15 g of bitter almond, 15 g of mulberry leaf, 20 g of patchouli, and 5 g of ginger. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate them into three different concentrations of raw medicinal materials: 0.5 g / mL, 1 g / mL and 2 g / mL, and store at 4℃ for later use.

[0059] Example 4: A traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, and its preparation method. The difference from Example 1 is that honeysuckle is also added, and it is named Gujin Yiwei Jia Jinyinhua Fang, which consists of the following components: 15 g of lily bulb, 30 g of astragalus root, 5 g of jujube, 10 g of bitter almond, 10 g of mulberry leaf, 10 g of agastache, 5 g of ginger, and 10 g of honeysuckle. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, and store at 4℃ for later use.

[0060] Example 5: A traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, and its preparation method. The difference from Example 1 is that Houttuynia cordata was added, and it was named Gu Jin Yi Wei Jia Houttuynia cordata Formula, which consists of the following components: 15 g of lily bulb, 30 g of astragalus root, 5 g of jujube, 10 g of bitter almond, 10 g of mulberry leaf, 10 g of agastache rugosa, 5 g of ginger, and 15 g of Houttuynia cordata. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, and store at 4℃ for later use.

[0061] Comparative Example 1: Sijunzi Decoction and its Preparation The Sijunzi Decoction is composed of the following ingredients: ginseng 9 g, atractylodes macrocephala 9 g, poria cocos 9 g, and prepared licorice root 6 g; Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, and store at 4℃ for later use.

[0062] Comparative Example 2: Mung Bean and Licorice Decoction and its Preparation The mung bean and licorice soup is composed of the following ingredients: 120 g of mung beans and 30 g of licorice. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, and store at 4℃ for later use.

[0063] Comparative Example 3: Xiao Chai Hu Tang and its preparation The Xiao Chai Hu Tang is composed of the following ingredients: Bupleurum 24 g, Scutellaria baicalensis 9 g, Ginseng 9 g, Pinellia ternata 9 g, Prepared licorice root 9 g, Ginger 9 g, and Jujube 8 g. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, store at 4℃ for later use.

[0064] Comparative Example 4: Liuwei Dihuang Decoction and its preparation The Liuwei Dihuang Decoction is composed of the following components: 24 g of Rehmannia glutinosa (processed), 12 g of Dioscorea opposita, 12 g of Cornus officinalis (processed with wine), 9 g of Alisma plantago-aquatica, 9 g of Poria cocos, and 9 g of Paeonia suffruticosa. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, and store at 4℃ for later use.

[0065] Comparative Example 5: Xiao Chengqi Decoction and its preparation The Xiao Chengqi Decoction is composed of 6 g of Magnolia officinalis, 9 g of Citrus aurantium, and 12 g of raw rhubarb. Weigh the above-mentioned Chinese medicinal materials according to their weight, add 1000 ml of water, decoct for 60 minutes, filter the decoction through 6 layers of gauze, add another 500 ml of water, decoct again for 30 minutes, mix the two decoctions and concentrate to a concentration of 2 g / mL of raw herbs, and store at 4℃ for later use.

[0066] Comparative Example 6: Gu Jin Yi Wei Qu Bai He Formula and its Preparation The difference from Example 1 is that lily bulb is not added, and the resulting formulation is named as Gufin Yiwei lily bulb-free formula, which consists of the following components: 30 g of Radix Astragali, 5 g of Fructus Jujubae, 10 g of Semen Armeniacae Amarum, 10 g of Folium Mori, 10 g of Herba Agastachis, and 5 g of Rhizoma Zingiberis Recens; Weigh the above Chinese medicinal materials according to the weight, add 1000 mL of water, decoct for 60 minutes, filter the medicinal liquid with 6 layers of gauze, add another 500 mL of water, perform re-decoction for 30 minutes, mix the two batches of medicinal liquids and concentrate to a medicinal liquid with a concentration of 2 g crude drug / mL, and store at 4°C for later use.

[0067] Comparative Example 7 Gufin Yiwei lily bulb-free and Lonicerae Japonicae Flos-added formula and preparation thereof The difference from Example 1 is that lily bulb is replaced with Lonicerae Japonicae Flos, and the Gufin Yiwei lily bulb-free and Lonicerae Japonicae Flos-added formula consists of the following components: 30 g of Radix Astragali, 5 g of Fructus Jujubae, 10 g of Semen Armeniacae Amarum, 10 g of Folium Mori, 10 g of Herba Agastachis, 5 g of Rhizoma Zingiberis Recens, and 10 g of Lonicerae Japonicae Flos; Weigh the above Chinese medicinal materials according to the weight, add 1000 mL of water, decoct for 60 minutes, filter the medicinal liquid with 6 layers of gauze, add another 500 mL of water, perform re-decoction for 30 minutes, mix the two batches of medicinal liquids and concentrate to a medicinal liquid with a concentration of 2 g crude drug / mL, and store at 4°C for later use.

[0068] Application Example 1 Evaluation of the effect of the traditional Chinese medicine composition in preventing coronavirus infection The effects of the traditional Chinese medicine compositions obtained in Example 2 to Example 5 are similar to that of the traditional Chinese medicine composition obtained in Example 1, so the results of Example 1 are used as a representative for description.

[0069] I. Experimental materials 1. Test drugs Three batches of medicinal liquids with crude drug concentrations of 0.5 g / mL (low-dose Gufin Yiwei formula), 1 g / mL (medium-dose Gufin Yiwei formula) and 2 g / mL (high-dose Gufin Yiwei formula) obtained in Example 1 are taken as test drugs, and ribavirin is used as the positive drug.

[0070] 2. Experimental animals 108 6-week-old SPF-grade Kunming mice, male, weighing 16 ± 2 g, purchased from the Laboratory Animal Center of Guangzhou University of Chinese Medicine [SCXK (Yue) 2018-0034], housed in the Laboratory Animal Center of Guangzhou University of Chinese Medicine [SYXK (Yue) 2018-0001], with conventional feeding and free access to drinking water.

[0071] 3. Experimental virus strain MHV-A59 strain (a generous gift from Professor Feng Liling, Institute of Tropical Diseases, Guangzhou University of Chinese Medicine).

[0072] 4. Main reagents The main reagents are shown in Table 1.

[0073] Table 1 Main Reagents use Reagent Name source Positive drugs Ribavirin Shanghai Aladdin Biochemical Technology Co., Ltd. Pathological staining Hematoxylin-eosin (HE) staining solution, 4% (w / v) paraformaldehyde Guangzhou Youtian Biotechnology Co., Ltd. Serum biochemistry AST / GOT test kit, ALT / GPT test kit Nanjing Jiancheng Biotechnology Co., Ltd. Protein quantification BCA Protein Concentration Assay Kit Beijing Lanjieke Technology Co., Ltd. / Beiyuntian RNA extraction Trizol RNA Separation Reagent Thermo Fisher (USA) Reverse transcription RevertAid Reverse Transcriptase Thermo Fisher (USA) Quantitative fluorescence SYBR Green Real time PCR Master Mix TAKARA (Japan) PCR primers Quantitative PCR primers (see Table 2) Genewiz Biotechnology Co., Ltd. (Suzhou) Western Blot RIPA protease inhibitor, phosphatase inhibitor, SDS-PAGE protein loading buffer (5×), Tween-20, ECL chemiluminescence solution Azure Sky Western Blot Loading Buffer Azure Sky Western Blot SIRT1, NRF2, NF-κB, HO-1, IL-6, TNF-α, β-actin antibodies Affinity Western Blot HRP-tagged goat anti-rabbit Azure Sky Western Blot Glycine Bio Froxx Western Blot BSA, TBS Guangzhou Yongjin Biotechnology Co., Ltd. Table 2 PCR Primers Primer name upstream primer Downstream primer MAVS CAAGTTTTGCTGTGTTGACGTT GAGATTATTGAAGAGTCCCCAGAGT TBK1 GGCTGCTGTAACAAAGACAGATT AATACTTCCTTTAGGCACCAAGC IFN-α AATGACCTGCAAGGCTGTCT CAGGGGCTGTGTTTCTTCTC IFN-β GCAAGAGGAAAGATTGACGTG TCCAGGCGTAGCTGTTGTACT NF-κB P65 AATGGCTACACAGGACCAGGAAC TGGCTAATGGCTTGCTCCAG TNF-α TGTCTCAGCCTCTTCTCATTCC GGTCTGGGCCAIAGAACTGAT IL-6 CTCCCAACAGACCTGTCTATAC CCATTGCACAACTCTTTTCICA GAPDH GACAACTCACTCAAGATTGTCAGC AGTCTTCTGGGTGGCAGTGAT II. Animal grouping, model establishment, and specimen collection (a) Animal grouping and administration regimen One hundred and eighteen Kunming mice were randomly divided into six groups of 18 mice each: normal control group, model group, low-dose Gu Jin Yi Wei Fang group (5 g / kg), medium-dose Gu Jin Yi Wei Fang group (10 g / kg), high-dose Gu Jin Yi Wei Fang group (20 g / kg), and positive control group (ribavirin 80 mg / kg). Each group was administered the medication once daily by gavage for three consecutive days. The normal control group and model group were administered an equal volume of physiological saline by gavage.

[0074] (II) Establishment of MHV-A59 infection model and specimen collection Establishment of MHV-A59 infection model: After 3 consecutive days of prophylactic administration, mice in all groups except the normal group were anesthetized and infected with MHV-A59 virus solution to establish a mouse model of coronavirus infection. The normal group was given an equal volume of physiological saline. The end of administration and before virus infection was recorded as D0, the 3rd day after infection was recorded as D3, and the 6th day after infection was recorded as D6.

[0075] Specimen collection: Specimens were collected at three time points: D0, D3, and D6. Blood was separated into serum for viral load and ALT / AST detection. Liver, lung, and spleen tissues were weighed for organ index calculation. Some liver and lung tissues were fixed with 4% (w / v) paraformaldehyde for pathological observation. Some liver and lung tissues were stored at -80 ℃ for RT-qPCR and Western Blot detection.

[0076] III. Evaluation of the efficacy in preventing coronavirus infection (a) General state observation 1. Experimental Methods During the experiment, the mice's mental state, activity level, coat color, food and water intake were observed daily, and their weight and body temperature were dynamically recorded.

[0077] 2. Experimental Results Experimental results are as follows Figure 1As shown, after MHV-A59 infection, mice in the model group exhibited slowed or decreased weight gain and abnormal temperature fluctuations, indicating that viral infection significantly affected the overall condition of the mice. After continuous prophylactic administration for 3 days to the low-dose, medium-dose, and high-dose groups of the Gu Jin Yi Wei Fang obtained in Example 1, the general condition of MHV-A59-infected mice was improved. Compared with the model group, the medium-dose group (10 g / kg) and high-dose group (20 g / kg) of Gu Jin Yi Wei Fang obtained in Example 1 showed reduced weight loss and improved abnormal temperature fluctuations, indicating that the traditional Chinese medicine composition provided by this invention has a significant ameliorative effect on the abnormal overall condition caused by coronavirus infection.

[0078] (II) Organ Index Measurement 1. Experimental Methods After the mice were euthanized, the liver, lung, and spleen tissues were quickly separated, and after removing surface blood and connective tissue, they were weighed. The organ index was calculated using the following formula: Organ Index = Organ Weight / Body Weight × 100%; The organ indices include the liver index, lung index, and spleen index.

[0079] 2. Experimental Results Experimental results are as follows Figure 2 As shown, after infection with MHV-A59, the liver, lung, and spleen indices of the model group mice were all elevated compared to the normal group, indicating damage or inflammation of organs such as the liver, lungs, and spleen. Compared with the model group, the low, medium, and high doses of the Gu Jin Yi Wei Fang formula obtained in Example 1 all reduced the above organ indices, with the medium and high doses showing more significant effects. Compared with the model group, the liver, lung, and spleen indices of the ribavirin group mice were also reduced, but only the spleen index showed a significant difference compared to the model group (P<0.001 or P<0.01). The above results indicate that the traditional Chinese medicine composition provided by this invention has a significant preventive and protective effect on the lung, liver, and spleen tissues of virus-infected mice, and the overall effect is superior to that of the positive control drug ribavirin.

[0080] (III) Serum MHV-A59 viral load detection 1. Experimental Methods Serum samples were collected from each group of mice, viral RNA was extracted, cDNA was obtained by reverse transcription, and the viral load of MHV-A59 in the serum was detected by probe-based real-time quantitative PCR.

[0081] 2. Experimental Results Experimental results are as follows Figure 3 As shown, after infection with MHV-A59, the model group mice underwent viral replication and amplification in vivo, and the viral load in their serum was significantly higher than that in the normal group. On the 3rd day after infection ( Figure 3(Figure A in the figure) The serum viral load in the model group was significantly increased. The low, medium, and high dose groups of Gu Jin Yi Wei Fang obtained in Example 1 all reduced the serum viral load, with the medium and high dose groups showing a more significant reduction. On the 6th day after infection ( Figure 3 As shown in Figure B, the viral replication level continued to increase, and the serum viral load in the model group further increased. The Gu Jin Yi Wei Fang formula obtained in Example 1 continued to reduce serum viral load after intervention, with the high-dose group showing a more significant effect. These results indicate that the traditional Chinese medicine composition provided by this invention can inhibit the replication of MHV-A59 in vivo and has a sustained and stable preventive effect against coronavirus infection.

[0082] (iv) Serum biochemical markers (AST / ALT) measurement 1. Experimental Methods Serum samples were collected from each group of mice, and the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured.

[0083] 2. Experimental Results Experimental results are as follows Figure 4 As shown, the serum AST and ALT levels in the model group mice were significantly higher than those in the normal group (P<0.05). The low, medium, and high dose groups of the Gu Jin Yi Wei Fang obtained in Example 1 could effectively reduce the transaminase levels in mice, and showed a certain dose-dependent effect. Among them, the high dose group mice showed the most significant reduction in AST and ALT.

[0084] (V) Observation of liver and lung tissue pathological sections and HE staining 1. Experimental Methods Liver and lung tissues were fixed in 4% (w / v) paraformaldehyde for 48 h, and then dehydrated, cleared, paraffin-embedded, and embedded sequentially. The paraffin block was cut into 4 μm thick slices at the largest cross-section of the embedded tissue, spread in warm water at 39 ℃, and baked at 50 ℃. After dewaxing to water, the slices were stained in hematoxylin solution for 15 min, rinsed with running water, differentiated in 0.5% (v / v) hydrochloric acid alcohol solution for 8 s, in distilled water for 10 s, blue-inverted in PBS for 2 min, dehydrated in 70% (v / v) alcohol for 2 min, stained in eosinol solution for 10 s, stained in 95% (v / v) alcohol for 10 s, dehydrated and cleared, and then mounted with neutral resin.

[0085] 2. Experimental Results (1) Lung tissue pathology Experimental results are as follows Figure 5As shown, the alveolar structure of normal mice was intact, the alveolar walls were thin, and no obvious inflammatory exudation, hemorrhage, or alveolar structural damage was observed. After infection with MHV-A59, the lung tissue of model mice showed pathological changes such as inflammatory cell infiltration, alveolar wall thickening, local hemorrhage, and alveolar structural damage. The low-dose and medium-dose groups of Gu Jin Yi Wei Fang mice showed reduced inflammatory infiltration and alveolar structural damage compared to the model group; the high-dose group showed significantly improved pathological changes in lung tissue, with relatively intact alveolar structure and significantly reduced inflammatory cell infiltration and hemorrhage. These results indicate that the traditional Chinese medicine composition provided by this invention can alleviate lung tissue inflammatory damage caused by coronavirus infection.

[0086] (2) Liver histopathology Experimental results are as follows Figure 6 As shown, the liver tissue structure of normal mice was clear, with hepatocytes arranged neatly, and no obvious pathological changes such as inflammatory cell infiltration, hemorrhage, and necrosis were observed. After infection with MHV-A59, the liver tissue of model mice showed obvious pathological damage such as inflammatory cell infiltration, local hemorrhage, hepatocyte degeneration, and necrosis. The pathological damage to the liver tissue of mice in the low-dose and medium-dose groups of the Gu Jin Yi Wei Fang formula was reduced compared to the model group, with a decrease in the degree of inflammatory cell infiltration, hemorrhage, and hepatocyte necrosis. In contrast, the liver tissue structure of mice in the high-dose group of the Gu Jin Yi Wei Fang formula was relatively intact, with a significantly smaller range of inflammatory cell infiltration and necrosis than the model group. Ribavirin also improved the pathological damage to the liver tissue to some extent, but the overall improvement was not as significant as that in the medium- and high-dose groups of the traditional Chinese medicine composition. These results indicate that the traditional Chinese medicine composition provided by this invention has a significant effect on protecting liver tissue and alleviating liver damage related to coronavirus infection.

[0087] (vi) Real-time quantitative RT-PCR detection of liver and lung tissues 1. Experimental Methods Total RNA was extracted from mouse liver and lung tissues using the Trizol method. 2 μL of total RNA was reverse transcribed into cDNA. The cDNA was diluted 10-fold, and GAPDH was used as an internal reference gene. An equal volume of cDNA (2 μL) was used for dye-based PCR. Reaction conditions: 95 ℃ pre-denaturation for 30 s; 95 ℃ for 5 s, 60 ℃ for 30 s, 40 cycles; melting curve: 95 ℃ for 15 s, 60 ℃ for 30 s, 95 ℃ for 15 s. The mRNA expression levels of MAVS, TBK1, IFN-α, IFN-β, NF-κB p65, TNF-α, and IL-6 were detected (primer sequences are shown in Table 2). The ratio of the target gene to the internal reference gene was used as the final relative quantitative value.

[0088] 2. Experimental Results After prophylactic administration (D0, before infection), Figure 7 Figures A1-A7 in the text Figure 8(Figures A1-A7 in the original text): Compared with the normal group, the Gu Jin Yi Wei formula obtained in Example 1 upregulated the mRNA expression of antiviral innate immune factors MAVS, TBK1, IFN-α, IFN-β and inflammatory factors NF-κB p65, TNF-α, IL-6 in the liver and lung tissues of mice, with more significant changes in the high-dose group. These results indicate that the traditional Chinese medicine composition provided by this invention can pre-activate antiviral innate immune-related signals before viral infection, enabling the body to enter an antiviral response state earlier.

[0089] Post-infection days 3 and 6 ( Figure 7 Figures B1-B7 and C1-C7 in the text Figure 8 (Figures B1-B7 and C1-C7 in the original text): The above indicators were continuously abnormally elevated in the liver and lung tissues of the model group mice. Compared with the model group, the various dosage groups of the Gu Jin Yi Wei Fang obtained in Example 1 could downregulate their abnormal expression to varying degrees, with the high-dose group showing a more significant effect. The above results indicate that the traditional Chinese medicine composition provided by the present invention may play a role in preventing coronavirus infection and reducing liver and lung tissue damage by pre-activating MAVS / TBK1 / NF-κB p65-related antiviral innate immune signals before infection and reducing excessive activation of inflammation after infection.

[0090] (vii) Western Blot analysis of liver and lung tissues 1. Experimental Methods Proteins were extracted from mouse liver and lung tissues, and protein concentrations were determined using the BCA method to prepare Western blot (WB) samples. Target proteins were transferred to PVDF membranes via SDS-PAGE electrophoresis and membrane transfer. After blocking, primary antibodies (SIRT1, NRF2, NF-κB, HO-1, IL-6, TNF-α, β-actin, etc.) and HRP-labeled goat anti-rabbit secondary antibody were added sequentially for incubation. The membranes were washed and developed using ECL luminescence buffer. The relative protein expression levels of MAVS, TBK1, p-TBK1, NF-κB p65, and p-NF-κB p65 were calculated by reading the gray values ​​of the protein bands on the membrane.

[0091] 2. Experimental Results After prophylactic administration (D0, before infection), Figure 9 Figures A1-A4 in the text Figure 10 (Figures A1-A4 in the text): The Gu Jin Yi Wei Fang obtained in Example 1 can upregulate the expression or phosphorylation levels of key proteins such as MAVS, p-TBK1, and p-NF-κB p65 in mouse liver and lung tissues.

[0092] Post-infection days 3 and 6 ( Figure 9 Figures B1-B4 and C1-C4 in the text Figure 10Figures B1 to B4 and Figures C1 to C4): the expression of the above-mentioned proteins in the model group was significantly increased, while the medium and high dose groups of the Gujin Yiwei Formula obtained in Example 1 could significantly down-regulate their abnormally elevated levels. This result further verifies from the protein expression level that the traditional Chinese medicine composition of the present invention exerts the effects of preventing coronavirus infection and protecting liver and lung tissues by pre-initiating the antiviral innate immune response and reducing the excessive inflammatory response after infection.

[0093] In summary, the traditional Chinese medicine composition provided by the present invention shows a good preventive effect in a coronavirus infection model. In the preventive stage (before infection), the traditional Chinese medicine composition provided by the present invention can activate the MAVS / TBK1 / NF-κB signaling pathway, up-regulate the expression of antiviral innate immune factors, and enable the body to establish an antiviral response state in advance; in the infection stage (after infection), the traditional Chinese medicine composition provided by the present invention can inhibit excessive inflammatory response and reduce the pathological damage of liver and lung tissues caused by the virus. The effects of the medium and high dose groups are even better than that of the positive control drug ribavirin. The above results indicate that the traditional Chinese medicine composition provided by the present invention is suitable for the preparation of drugs for the prevention and / or treatment of coronavirus infection.

[0094] Application Example 2 Evaluation of the effect of the traditional Chinese medicine composition on preventing coronavirus infection The effects of the traditional Chinese medicine compositions obtained in Example 2 and Example 3 are similar to those of Example 1, so the results of Example 1 are used as a representative for description.

[0095] 1. Experimental materials, reagents and equipment Test drugs: The high-dose (crude drug concentration 2 g / mL) traditional Chinese medicine composition medicinal solutions obtained from Example 1 (Gujin Yiwei Formula), Example 4 (Gujin Yiwei plus Lonicerae Japonicae Flos Formula), Example 5 (Gujin Yiwei plus Houttuyniae Herba Formula), Comparative Example 1 (Sijunzi Decoction), Comparative Example 2 (Mung Bean and Glycyrrhizae Radix Decoction), Comparative Example 3 (Xiaochaihu Decoction), Comparative Example 4 (Liuwei Dihuang Decoction), Comparative Example 5 (Xiaochengqi Decoction), Comparative Example 6 (Gujin Yiwei Formula without Lilii Bulbus), and Comparative Example 7 (Gujin Yiwei Formula without Lilii Bulbus plus Lonicerae Japonicae Flos) were used as the test medicinal solutions.

[0096] Experimental reagents: MHV-A59 strain (a gift from Professor Feng Liling, Institute of Tropical Diseases, Guangzhou University of Chinese Medicine); Ribavirin (Shanghai Aladdin Biochemical Technology Co., Ltd.); Experimental animals: 160 6-week-old SPF-grade Kunming mice, male, weighing 16±2g, purchased from the Laboratory Animal Center of Guangzhou University of Chinese Medicine [SCXK (Yue) 2018-0034], housed in the Laboratory Animal Center of Guangzhou University of Chinese Medicine [SYXK (Yue) 2018-0001], with conventional feeding and free access to drinking water.

[0097] 2. Experimental method (1) Animal grouping and administration regimen One hundred and sixty Kunming mice were randomly divided into 12 groups: normal control group, model group, Sijunzi Decoction group (20 g / kg) in Comparative Example 1, Mung Bean and Licorice Decoction group (20 g / kg) in Comparative Example 2, Xiaochaihu Decoction group (20 g / kg) in Comparative Example 3, Liuwei Dihuang Decoction group (20 g / kg) in Comparative Example 4, Xiaochengqi Decoction group (20 g / kg) in Comparative Example 5, high-dose Gujin Yiwei Decoction group (20 g / kg) in Example 1, Gujin Yiwei Decoction plus Honeysuckle Decoction group (20 g / kg) in Example 4, Gujin Yiwei Decoction plus Houttuynia cordata Decoction group (20 g / kg) in Example 5, Gujin Yiwei Decoction without Lily bulb group (20 g / kg) in Comparative Example 6, and Gujin Yiwei Decoction without Lily bulb plus Honeysuckle Decoction group (20 g / kg) in Comparative Example 7. The herbal combination group and each comparative group were given the above-mentioned doses of drugs at 10 The normal group and the model group were given an equal volume of physiological saline by gavage once a day for 3 consecutive days.

[0098] (2) Establishment of MHV-A59 infection model After 3 days of continuous prophylactic administration, except for the normal control group, mice in the other groups were anesthetized and a mouse model of coronavirus infection was established using MHV-A59 virus solution; the normal control group was given an equal volume of physiological saline. Day 0 before infection was recorded after the end of administration, day 3 after infection was recorded as D3, and day 6 after infection was recorded as D6.

[0099] (3) General condition observation and specimen collection During the experiment, the mice were observed daily for their mental state, activity level, coat color, food and water intake, and changes in body weight and body temperature were dynamically recorded. Samples were collected at time points D0, D3, and D6. Serum was separated from the collected blood samples to detect serum MHV-A59 viral load.

[0100] (4) Serum MHV-A59 viral load detection Mouse serum samples were collected, viral RNA was extracted, and cDNA was obtained by reverse transcription. The viral load of MHV-A59 in the serum was detected by real-time quantitative PCR.

[0101] 3. Experimental Results Experimental results are as follows Figure 11 , Figure 12 As shown. Day 3 after infection with the virus ( Figure 11 (See Figure A in the table). The serum MHV-A59 viral load in the model group mice was significantly increased. Compared with the model group, the Gu Jin Yi Wei Fang obtained in Example 1 significantly reduced the serum viral load in mice, and the difference was statistically significant. The Gu Jin Yi Wei Fang obtained in Example 1 had the best effect in reducing viral load.

[0102] Day 6 after infection with the virus ( Figure 11(See Figure B in the table). The serum MHV-A59 viral load in the model group mice remained at a high level. Compared with the model group, the Gu Jin Yi Wei Fang obtained in Example 1 could still significantly reduce the serum viral load in mice, indicating that it has a relatively stable inhibitory effect on MHV-A59 replication in vivo. Although the traditional Chinese medicine composition obtained in Comparative Example 1 still showed a certain reducing effect, the effect was weaker than that in Example 1; the viral load reducing effect of the traditional Chinese medicine compositions obtained in Comparative Examples 2-5 was not obvious or lacked stability at this time point. It can be seen that after prophylactic administration of the Gu Jin Yi Wei Fang obtained in Example 1, the serum MHV-A59 viral load in mice was significantly reduced on the 3rd and 6th days after viral infection, and its effect in reducing viral load was superior to that of the traditional Chinese medicine compositions obtained in Comparative Examples 1-5 in terms of both strength and persistence. The above results indicate that the formulation of the traditional Chinese medicine composition obtained in this invention has a good synergistic effect. Compared with classic traditional Chinese medicine compound formulas with different treatment methods, such as Sijunzi Decoction for invigorating the spleen and replenishing qi, mung bean and licorice decoction for clearing heat and detoxifying, Xiaochaihu Decoction for harmonizing shaoyang, Liuwei Dihuang Decoction for nourishing yin and replenishing qi, or Xiaochengqi Decoction for purging the bowels and relieving heat, the traditional Chinese medicine composition of this invention, which takes replenishing qi and resolving dampness, and promoting lung qi, has a more prominent comprehensive effect in preventing coronavirus infection and is more suitable for preventive intervention of respiratory viral diseases such as viral infections.

[0103] Day 6 after infection with the virus ( Figure 12 In the model group, the expression levels of IL-6, TNF-α, and NF-κB p65 mRNA in the lung tissue of mice were significantly increased compared with those in the control group, and the differences were statistically significant. In the Gu Jin Yi Wei Fang group obtained in Example 1, compared with the model group, the expression levels of IL-6, TNF-α, and NF-κB p65 mRNA in the lung tissue of mice were significantly decreased compared with those in the control group, and the differences were statistically significant. These results indicate that prophylactic administration of the Gu Jin Yi Wei Fang obtained in Example 1 can significantly reduce the pathological damage to lung tissue caused by respiratory diseases. Compared with Example 1 (Gu Jin Yi Wei Fang group), in Comparative Example 6 (Gu Jin Yi Wei Fang without Baihe) and Comparative Example 7 (Gu Jin Yi Wei Fang without Baihe plus Honeysuckle), the expression levels of IL-6, TNF-α, and NF-κB p65 mRNA in the lung tissue of mice were significantly increased on the sixth day after viral infection, and the differences were statistically significant.

[0104] On the sixth day after viral infection, the expression levels of IL-6, TNF-α, and NF-κBp65 mRNA in the lung tissue of mice in Example 4 (Gu Jin Yi Wei formula plus honeysuckle) and Example 5 (Gu Jin Yi Wei formula plus houttuynia cordata) showed no significant difference compared with those in Example 1 (Gu Jin Yi Wei formula group). These results indicate that adding honeysuckle or houttuynia cordata to Example 1 (Gu Jin Yi Wei formula) still has a preventive effect against respiratory viral infections.

[0105] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A traditional Chinese medicine composition that can be used as both food and medicine, and has the effect of preventing and / or treating respiratory viral infections, characterized in that, The traditional Chinese medicine composition is composed of any one of the following traditional Chinese medicinal materials: (1) Lily bulb, astragalus root, jujube, bitter almond, mulberry leaf, patchouli, ginger; (2) Lily bulb, astragalus root, jujube, bitter almond, mulberry leaf, patchouli, ginger, honeysuckle; (3) Lily, Astragalus, Jujube, Bitter Almond, Mulberry Leaf, Patchouli, Ginger, Houttuynia cordata.

2. The traditional Chinese medicine composition according to claim 1, characterized in that, The traditional Chinese medicine composition is composed of any one of the following traditional Chinese medicinal materials: (1) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, and 3-8 parts by weight of ginger; (2) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 3-8 parts by weight of ginger, and 5-15 parts by weight of honeysuckle. (3) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 3-8 parts by weight of ginger, and 10-20 parts by weight of houttuynia cordata.

3. The traditional Chinese medicine composition as described in claim 2, characterized in that, The traditional Chinese medicine composition is composed of any one of the following traditional Chinese medicinal materials: (1) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, and 4-6 parts by weight of ginger; (2) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 4-6 parts by weight of ginger, and 8-12 parts by weight of honeysuckle. (3) 10-25 parts by weight of lily, 20-40 parts by weight of astragalus, 2-10 parts by weight of jujube, 5-15 parts by weight of bitter almond, 5-15 parts by weight of mulberry leaf, 10-20 parts by weight of patchouli, 4-6 parts by weight of ginger, and 12-18 parts by weight of houttuynia cordata.

4. A method for preparing the traditional Chinese medicine composition according to any one of claims 1 to 3, which is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections, characterized in that, Includes the following steps: Weigh out the appropriate amount of Chinese medicinal herbs, mix them with water, decoct them, filter, and then concentrate the solution.

5. The use of the traditional Chinese medicine composition according to any one of claims 1 to 3, which is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections, in the preparation of products for preventing and / or treating respiratory viral infections.

6. The application as described in claim 5, characterized in that, The respiratory viruses mentioned include coronaviruses.

7. The application as described in claim 6, characterized in that, The coronaviruses mentioned include beta-coronaviruses.

8. A product characterized in that, A traditional Chinese medicine composition comprising any one of claims 1 to 3, which is both medicinal and edible and has the effect of preventing and / or treating respiratory viral infections.

9. The product as described in claim 8, characterized in that, The product also contains pharmaceutically acceptable excipients.

10. The product as described in claim 8, characterized in that, The dosage form of the product is any one of the following: decoction, granules, capsules, tablets, oral liquid, pills, powders, tea, or medicinal diet.

Images