RODENTS WITH HUMANIZED CLUSTER OF THE DIFFERENTIATION 47 GEN

DE602015093512T2Active Publication Date: 2026-06-17REGENERON PHARMACEUTICALS INC

Patent Information

Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
REGENERON PHARMACEUTICALS INC
Filing Date
2015-11-25
Publication Date
2026-06-17
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 087,992, filed December 5, 2014.SEQUENCE LISTING

[0002] A Sequence Listing in the ASCII text file, named 32584_10108WO01_SequenceListing.txt of 96.0 KB and created on November 23, 2015, was submitted to the United States Patent and Trademark Office via EFS-Web.BACKGROUND

[0003] Cancer therapy can be separated into four main categories: chemo / radio therapy, hormone therapy, targeted therapy, and immunotherapy. An intense focus of medical research and development has focused on targeted therapy and significant improvements have been made, yet cancer remains a major challenge to patients and to the healthcare industry worldwide. This major challenge is due, in part, to the ability of cancer cells to evade the monitoring mechanisms of the innate and adaptive immune systems, which is partly the result of inhibition of phagocytic clearance. Currently, no in vivo system exists to optimally determine the therapeutic potential of new cancer therapies that are designed to activate phagocytic clearance of cancer cells and determine the molecular aspects of how cancer cells provide inhibitory signals to macrophages and phagocytic cells. Such a system provides a source for assays in phagocytosis and macrophage functions in vivo, and identification of new cancer therapies that are targeted at providing an anti-tumor environment by promoting pro-phagocytic signals to the immune system.SUMMARY

[0004] The present invention is based on the recognition that it is desirable to engineer non-human animals to permit improved systems for identifying and developing new cancer therapeutics. The present invention is also based on the recognition that it is desirable to engineer non-human animals to permit improved engraftment of human hematopoietic stem cells. Further, the present invention is also based on the recognition that non-human animals having a humanized CD47 gene and / or otherwise expressing, containing, or producing a human or humanized CD47 polypeptide are desirable, for example for use in identifying and developing cancer therapeutics that overcome systemic toxicity associated with blockade of CD47 and overcome CD47-mediated inhibition of phagocytosis of tumor cells, and provide a more efficient in vivo system for engraftment of human hematopoietic stem cells that provides an increase in homeostasis of a broader number of human cell types. The invention is defined by the claims. Accordingly, the present invention provides an isolated rodent embryonic stem (ES) cell, (i) where the genome of the rodent ES cell comprises a humanized CD47 gene, wherein the humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene, and wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter; (ii) wherein the genome of the rodent ES cell further comprises a SIRPα gene that encodes a SIRPα polypeptide comprising the extracellular domain of a human SIRPα polypeptide and the intracellular domain of an endogenous rodent SIRPα polypeptide, and wherein the SIRPα gene comprises exons 1, 5, 6, 7 and 8 of an endogenous rodent SIRPα gene and exons 2-4 of a human SIRPα gene; and (iii) wherein the rodent ES cell is a mouse ES cell or a rat ES cell.

[0005] Also described herein is a rodent having a genome that comprises a humanized CD47 gene that comprises genetic material from two different species (a human and a rodent). The humanized CD47 gene of the rodent encodes a CD47 polypeptide that comprises human and rodent portions, wherein the human and rodent portions are linked together and form a functional CD47 polypeptide.

[0006] A rodent as described herein may comprise a humanized CD47 gene that encodes a polypeptide that comprises an endogenous intracellular portion of a rodent CD47 polypeptide as defined above and a portion of a human CD47 polypeptide as defined above, wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter.

[0007] An intracellular portion of a rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene. The humanized CD47 gene may optionally further comprise exon 1 of a rodent CD47 gene. Exon 1 and the exons downstream of exon 7 of a rodent CD47 gene may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical to the corresponding exon 1 and the exons downstream of exon 7 of a mouse CD47 gene that appears in Table 3. Exon 1 and the exons downstream of exon 7 of a rodent CD47 gene may be identical to the corresponding exon 1 and the exons downstream of exon 7 of a mouse CD47 gene that appears in Table 3.

[0008] A human portion may encode amino acids 16-292 of a human CD47 polypeptide. A human portion may encode amino acids 19-292 of a human CD47 polypeptide. The human portion may encode amino acids 19-141 of a human CD47 polypeptide. The human portion may encode amino acids 19-127 of a human CD47 polypeptide.

[0009] Exons 2-7 of a human CD47 gene may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical to the corresponding exons 2-7 of a human CD47 gene that appears in Table 3. Exons 2-7 of a human CD47 gene may be identical to the corresponding exons 2-7 of a human CD47 gene that appears in Table 3.

[0010] A rodent as described herein may express a CD47 polypeptide comprising the extracellular domain and the transmembrane domains of a human CD47 polypeptide and an intracellular portion of a rodent CD47 polypeptide. A CD47 polypeptide may be translated in a cell of a rodent with a rodent signal peptide. A rodent signal peptide may be a mouse or a rat signal peptide.

[0011] A CD47 polypeptide may be expressed from an endogenous rodent CD47 gene.

[0012] An intracellular portion of a rodent CD47 polypeptide may comprise an intracytoplasmic tail that has an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical to an intracytoplasmic tail of a mouse CD47 polypeptide that appears in Table 3. An intracellular portion of the rodent CD47 polypeptide may comprise an intracytoplasmic tail that has an amino acid sequence that is identical to an intracytoplasmic tail of a mouse CD47 polypeptide that appears in Table 3.

[0013] The extracellular domain of a human CD47 polypeptide may comprise amino acids corresponding to residues 19-141 of a human CD47 polypeptide. The extracellular domain of a human CD47 polypeptide may comprise amino acids corresponding to residues 19-127 of a human CD47 polypeptide. The extracellular domain of a human CD47 polypeptide may comprise an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical to a corresponding amino acid sequence of an extracellular domain of a human CD47 polypeptide that appears in Table 3. The extracellular domain of a human CD47 polypeptide may comprise an amino acid sequence that is identical to a corresponding amino acid sequence of an extracellular domain of a human CD47 polypeptide that appears in Table 3.

[0014] Also described herein is a CD47 polypeptide encoded by the CD47 gene of a rodent as described herein. An encoded CD47 polypeptide may comprise an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20. An encoded CD47 polypeptide may comprise an amino acid sequence that is identical to SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20.

[0015] Also described herein is a humanized CD47 gene comprising exons downstream of exon 7 of a rodent CD47 gene operably linked to exons 2-7 of a human CD47 gene. A humanized CD47 gene described herein may comprise rodent exons downstream of exon 7 of a rodent CD47 gene that encode an intracellular portion of a rodent CD47 polypeptide and human exons 2-7 of a human CD47 gene that encode the extracellular domain and transmembrane domains of a human CD47 polypeptide. A humanized CD47 gene may further comprise rodent exons that encode a signal peptide, in whole or in part.

[0016] Also described herein is an isolated cell or tissue from a rodent of the present invention. The isolated cell or tissue may comprise a CD47 gene as described herein. The cell may be selected from a dendritic cell, lymphocyte (e.g., a B or T cell), macrophage and a monocyte. The tissue may be selected from adipose, bladder, brain, breast, bone marrow, eye, heart, intestine, kidney, liver, lung, lymph node, muscle, pancreas, plasma, serum, skin, spleen, stomach, thymus, testis, ovum, and a combination thereof.

[0017] Also described herein is an isolated rodent embryonic stem cell whose genome comprises a humanized CD47 gene as described herein. The a rodent embryonic stem cell may be a mouse embryonic stem cell and from a 129 strain, C57BL / 6 strain or a BALB / c strain. In some embodiments, a rodent embryonic stem cell is a mouse embryonic stem cell and is from a mixture of 129 and C57BL / 6 strains.

[0018] Also described herein is the use of a rodent embryonic stem cell as described herein to make a rodent. The rodent embryonic stem may be a mouse embryonic stem cell and is used to make a mouse comprising a CD47 gene as described herein. The rodent embryonic stem cell may be a rat embryonic stem cell and is used to make a rat comprising a CD47 gene as described herein.

[0019] The present invention provides a rodent embryo comprising the rodent embryonic stem cell as described herein. A rodent embryo may be a mouse embryo. A rodent embryo may be a rat embryo.

[0020] Also described herein is a method of making a rodent that expresses a CD47 polypeptide from an endogenous CD47 gene, wherein the CD47 polypeptide comprises a human sequence, the method comprising inserting a genomic fragment into an endogenous CD47 gene in a rodent embryonic stem cell, said genomic fragment comprising a nucleotide sequence that encodes a portion of the human CD47 polypeptide comprising the extracellular domain and the transmembrane domains of the human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene; obtaining a rodent embryonic stem cell comprising an endogenous CD47 gene that comprises the nucleotide sequence that encodes the portion of the human CD47 polypeptide; and creating a rodent using the rodent embryonic stem cell comprising said nucleotide sequence that encodes the portion of the human CD47 polypeptide.

[0021] The human sequence may comprise amino acids corresponding to residues 19-141 (or 19-292) of a human CD47 polypeptide. The human sequence may comprise amino acids corresponding to residues 19-127 of a human CD47 polypeptide.

[0022] The nucleotide sequence may comprise exons 2-7 of a human CD47 gene. The nucleotide sequence may comprise one or more selection markers. The nucleotide sequence may comprise site-specific recombination sites.

[0023] The method may further comprise a step of inserting a genomic fragment into an endogenous SIRPα gene of a rodent embryonic stem cell, said genomic fragment comprising a nucleotide sequence that encodes a human SIRPα polypeptide in whole or in part (e.g., encodes an extracellular portion of a human SIRPα polypeptide). A genomic fragment may comprise a nucleotide sequence that encodes a human SIRPα polypeptide in whole or in part (e.g., encodes an extracellular portion of a human SIRPα polypeptide) is inserted into an endogenous SIRPα gene of the rodent embryonic stem cell prior to an insertion into an endogenous CD47 gene.

[0024] Also described herein is breeding a rodent comprising an endogenous CD47 gene that includes a nucleotide sequence that encodes a portion of the human CD47 polypeptide comprising at least the extracellular domain and the transmembrane domains of the human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, with a second rodent, said second rodent having a genome comprising a SIRPα gene that encodes a SIRPα polypeptide comprising an extracellular portion of a human SIRPα polypeptide (e.g., amino acids corresponding to residues 28-362 of a human SIRPα polypeptide) and an intracellular portion of an endogenous SIRPα polypeptide.

[0025] The invention also provides a method comprising: (a) providing a rodent whose genome comprises a humanized CD47 gene wherein the humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene, wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter, and wherein the rodent is a mouse or a rat; (b) exposing the rodent to an antigen; and (c) measuring phagocytosis of the antigen by one or more cells of the rodent. Also described here is a method of providing a rodent whose genome comprises a humanized CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, linked to an intracellular portion of an endogenous CD47 polypeptide, the method comprising modifying the genome of a rodent so that it comprises a humanized CD47 gene that encodes the extracellular domain and transmembrane domains of a human CD47 polypeptide linked to the intracellular portion of an endogenous CD47 polypeptide thereby providing said rodent.

[0026] The modifying of the genome of a rodent may be performed in a rodent embryonic stem cell. The rodent embryonic stem cell may be a mouse embryonic stem cell or a rat embryonic stem cell.

[0027] The method may further comprise modifying the genome of the rodent so that it comprises a SIRPα gene that encodes the extracellular portion of a human SIRPα polypeptide (e.g., amino acids corresponding to residues 28-362 of a human SIRPα polypeptide) linked to the intracellular portion of an endogenous SIRPα polypeptide. The modifying the genome of the rodent so that it comprises a SIRPα gene that encodes the extracellular portion of a human SIRPα polypeptide (e.g., amino acids corresponding to residues 28-362 of a human SIRPα polypeptide) linked to the intracellular portion of an endogenous SIRPα polypeptide may be performed prior to modifying the genome of the rodent so that it comprises a CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide linked to the intracellular portion of an endogenous CD47 polypeptide.

[0028] Also described herein is breeding a rodent whose genome comprises a humanized CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, linked to an intracellular portion of an endogenous CD47 polypeptide, with a second rodent, said second rodent having a genome comprising a SIRPα gene that encodes a SIRPα polypeptide comprising an extracellular portion of a human SIRPα polypeptide (e.g., amino acids corresponding to residues 28-362 of a human SIRPα polypeptide) and an intracellular portion of an endogenous SIRPα polypeptide.

[0029] Also described herein is a rodent obtainable by methods as described herein.

[0030] Also described herein is a method of engrafting human cells into a rodent, the method comprising steps of providing a rodent whose genome comprises a humanized CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, linked to the intracellular portion of an endogenous CD47 polypeptide; and transplanting one or more human cells into said rodent. The method may further comprise a step of assaying engraftment of the one or more human cells in said rodent. A step of assaying may comprise comparing the engraftment of the one or more human cells to the engraftment in one or more wild-type rodents or in one or more rodents whose genome does not comprise a CD47 gene that encodes the extracellular domain and transmembrane domains of a human CD47 polypeptide linked to the intracellular portion of an endogenous CD47 polypeptide.

[0031] Human cells may be hematopoietic stem cells. Human cells may be transplanted intravenously. Human cells may be transplanted intraperitoneally. Human cells may be transplanted subcutaneously.

[0032] Also described herein is a method of assessing the therapeutic efficacy of a drug targeting human cells, the method comprising providing a rodent whose genome comprises a humanized CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, linked to an intracellular portion of an endogenous CD47 polypeptide; transplanting one or more human cells into said rodent; administering a drug candidate to said rodent; and monitoring the human cells in the rodent to determine the therapeutic efficacy of the drug candidate.

[0033] The human cells may be cancer cells and the drug candidate may be an anticancer drug candidate. A drug candidate may be an antibody.

[0034] A rodent may further comprise human immune cells. A drug candidate may be a bi-specific antibody that binds human CD47 and an antigen on transplanted human cancer cells.

[0035] The invention also provides a method comprising: (a) providing rodent cells whose genome comprises a humanized CD47 gene, wherein the humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene, wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter, and wherein the rodent cells are mouse cells or rat cells; (b) incubating the rodent cells of step (a) with a labeled substrate; and (c) measuring phagocytosis of the labeled substrate by the rodent cells of step (b). The substrate may be fluorescently labeled. The substrate may be labeled with an antibody. The substrate may be one or more red blood cells. The substrate may be one or more bacterial cells. The substrate may be one or more tumor cells.

[0036] Also described herein is a method comprising providing a rodent whose genome includes a humanized CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, linked to an intracellular portion of an endogenous CD47 polypeptide; exposing the rodent to an antigen; and measuring phagocytosis of the antigen by one or more cells of the rodent. The step of exposing may comprise exposing the rodent to an antigen that is fluorescently labelled. The step of exposing may comprise exposing the rodent to one or more cells that comprise the antigen. The step of exposing may comprise exposing the rodent to one or more human cells comprising the antigen or to one or more bacterial cells comprising the antigen. The step of exposing may comprise exposing the rodent to one or more cells that have been transformed with the antigen so that the antigen is expressed on the surface of the one or more transformed cells. The step of exposing may comprise exposing the rodent to one or more tumor cells that comprise the antigen.

[0037] Also described herein are methods for identification or validation of a drug or vaccine, the method comprising the steps of delivering a drug or vaccine to a rodent whose genome includes a humanized CD47 gene that encodes the extracellular domain and the transmembrane domains of a human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, linked to an intracellular portion of an endogenous CD47 polypeptide, and monitoring one or more of the immune response to the drug or vaccine, the safety profile of the drug or vaccine, or the effect on a disease or condition. Monitoring the safety profile may include determining if the rodent exhibits a side effect or adverse reaction as a result of delivering the drug or vaccine. A side effect or adverse reaction may be selected from morbidity, mortality, alteration in body weight, alteration of the level of one or more enzymes (e.g., liver), alteration in the weight of one or more organs, loss of function (e.g., sensory, motor, organ, etc.), increased susceptibility to one or more diseases, alterations to the genome of the rodent, increase or decrease in food consumption and complications of one or more diseases.

[0038] Also described herein is use of a rodent as described herein in the development of a drug or vaccine for use in medicine, such as use as a medicament.

[0039] Also described herein is use of a rodent as described herein in the manufacture of a medicament for the treatment of cancer or a neoplasm.

[0040] Also described herein is use of a rodent as described herein to assess the efficacy of a therapeutic drug targeting human cells. A rodent described herein may be transplanted with human cells and a drug candidate targeting said human cells may be administered to the rodent. Efficacy of the drug may be determined by monitoring the human cells in the rodent after the administration of the drug.

[0041] Also described herein is a rodent or cell as described herein for use in the development and / or identification of a drug (e.g., an antibody) for therapy or diagnosis.

[0042] Also described herein is a rodent or cell as described herein for use in the development and / or identification of a drug (e.g., an antibody) for the treatment, prevention or amelioration of cancer or a neoplasm.

[0043] Also described herein is a method of assessing the pharmacokinetics of a drug targeting human CD47, the method comprising the steps of administering the drug to a rodent as described herein, and performing an assay to determine one or more pharmacokinetic properties of the drug targeting human CD47.

[0044] Also described herein is a method of assessing the on-target toxicity of a drug targeting human CD47, the method comprising the steps of administering the drug to a rodent as described herein, and performing an assay for one or more parameters associated with on-target toxicity of a drug.

[0045] Also described herein is a method of assessing the off-target toxicity of a drug targeting human CD47, the method comprising the steps of administering the drug to a rodent as described herein, and performing an assay for one or more parameters associated with off-target toxicity of a drug.

[0046] A rodent as described herein is a rodent whose genome includes a humanized CD47 gene that encodes the extracellular domain and transmembrane domains of a human CD47 polypeptide linked to an intracellular portion of an endogenous CD47 polypeptide; a rodent may be a mouse; a rodent may be a rat.

[0047] A drug targeting human CD47 may be a CD47 antagonist. A CD47 antagonist may be an anti-CD47 antibody. A drug targeting human CD47 may be a CD47 agonist.

[0048] The humanized CD47 gene may include any humanized CD47 gene described herein. The human CD47 polypeptide may include any human CD47 polypeptide described herein.

[0049] A rodent described herein may not detectably express a full-length endogenous rodent CD47 polypeptide. A rodent described herein may not detectably express an extracellular portion of an endogenous CD47 polypeptide. A rodent described herein may not detectably express an extracellular portion of both an endogenous CD47 polypeptide and an endogenous SIRPα polypeptide.

[0050] An extracellular domain of a human CD47 polypeptide may comprise amino acids corresponding to residues 19-141 of a human CD47 polypeptide as described herein.

[0051] An N-terminal immunoglobulin V domain of a human CD47 polypeptide may comprise amino acids corresponding to residues 19-127 of a human CD47 polypeptide as described herein.

[0052] Rodents, cells, tissues, embryonic stem cells and / or embryos of the present invention may have a genome that further comprises a SIRPα gene that encodes a SIRPα polypeptide comprising an extracellular portion of a human SIRPα polypeptide (e.g., amino acids corresponding to residues 28-362 of a human SIRPα polypeptide) and an intracellular portion of an endogenous SIRPα polypeptide.

[0053] A rodent described herein may be a mouse; or a rat.

[0054] As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerals used in this application with or without about / approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art.

[0055] Other features, objects, and advantages described herein are apparent in the detailed description that follows. It should be understood, however, that the detailed description is given by way of illustration only, not limitation. Various changes and modifications will become apparent to those skilled in the art from the detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0057] The Drawings included herein, which are composed of the following Figures, are for illustration purposes only. Figure 1 shows a diagram, not to scale, of the genomic organization of a non-human (e.g., mouse) and human Cluster of Differentiation 47 (CD47) genes. Exons are numbered beneath each exon. Figure 2 shows a diagram, not to scale, of an exemplary method for humanization of a non-human Cluster of Differentiation 47 (CD47) gene. Figure 3 shows a diagram, not to scale, of the genomic organization of a mouse and human Cluster of Differentiation 47 (CD47) genes. Locations of probes used in an assay described in Example 1 are indicated. Figure 4 shows an exemplary histogram of CD47 expression in red blood cells from humanized CD47 mice detected by anti-CD47 antibodies. Ab A, Ab B, Ab C, Ab D and Ab E: anti-CD47 antibodies; hIgG4s: human IgG4 of irrelevant specificity with modified Fc region that has reduced effector function; hIgG4: human IgG4 antibody of irrelevant specificity. Figure 5 shows exemplary hemagglutination of mouse red blood cells from wild-type (n=2) and humanized CD47 (n=2) mice by anti-CD47 antibodies. WT: wild-type; HuCD47: humanized CD47; Ab A, Ab B, Ab C, Ab D and Ab E: anti-CD47 antibodies; hIgG4s: human IgG4 of irrelevant specificity with modified Fc region that has reduced effector function; hIgG4: human IgG4 antibody of irrelevant specificity. Figure 6 shows exemplary pharmacokinetic profiles of anti-CD47 antibodies in humanized CD47 mice represented as antibody concentration (in µg / mL, y-axis) over time (in days, x-axis); Ab F, Ab G, Ab H and Ab I: anti-CD47 antibodies; hIgG4s: human IgG4 antibody of irrelevant specificity with modified Fc region that has reduced effector function. Figure 7 shows exemplary pharmacokinetic profiles of anti-CD47 antibodies in humanized CD47 / SIRPα mice (CD47 hu / hu< SIRPα hu / hu< ) represented as antibody concentration (in mcg / mL, y-axis) over time (in days, x-axis). Ab J, Ab F, Ab GandAb I: anti-CD47 antibodies; hIgG4s: human IgG4 antibody of irrelevant specificity with modified Fc region that has reduced effector function. Figure 8 shows exemplary pharmacokinetic profiles of anti-CD47 antibodies in humanized CD47 / SIRPα mice (CD47 hu / hu< SIRPα hu / hu< ) represented as antibody concentration (in mcg / mL, y-axis) over time (in days, x-axis). Ab J, Ab F: anti-CD47 antibodies; Ab Fs: Ab F with modified Fc region that has reduced effector function; Ab Fmono: monovalent version of Ab F; hIgG4s: human IgG4 antibody of irrelevant specificity with modified Fc region that has reduced effector function. Figure 9 shows exemplary pharmacokinetic profiles of anti-CD47 antibodies in wild type mice represented as antibody concentration (in mcg / mL, y-axis) over time (in days, x-axis). Mice demonstrating mouse anti-human antibody response (MAHA) were excluded. Ab J, Ab F, Ab I and Ab G: anti-CD47 antibodies; hIgG4s: human IgG4 antibody of irrelevant specificity with modified Fc region that has reduced effector function (star: all points after 15 days were excluded from hIgG4s treatment group due to MAHA); Ab J F(ab') 2 : F(ab') 2 fragment of Ab J. DEFINITIONS

[0058] Particular methods and experimental conditions described herein may be varied. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention is defined by the claims.

[0059] Unless defined otherwise, all terms and phrases used herein include the meanings that the terms and phrases have attained in the art, unless the contrary is clearly indicated or clearly apparent from the context in which the term or phrase is used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, particular methods and materials are now described.

[0060] The term "approximately", as applied herein to one or more values of interest, refers to a value that is similar to a stated reference value. The term "approximately" or "about" may refer to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0061] The term "biologically active", as used herein, refers to a characteristic of any agent that has activity in a biological system, in vitro or in vivo (e.g., in an organism). For instance, an agent that, when present in an organism, has a biological effect within that organism, is considered to be biologically active. Where a protein or polypeptide is biologically active, a portion of that protein or polypeptide that shares at least one biological activity of the protein or polypeptide may typically be referred to as a "biologically active" portion.

[0062] The term "comparable", as used herein, refers to two or more agents, entities, situations, sets of conditions, etc. that may not be identical to one another but that are sufficiently similar to permit comparison there between so that conclusions may reasonably be drawn based on differences or similarities observed. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc. to be considered comparable.

[0063] The term "conservative", as used herein to describe a conservative amino acid substitution, refers to substitution of an amino acid residue by another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of interest of a protein, for example, the ability of a receptor to bind to a ligand. Examples of groups of amino acids that have side chains with similar chemical properties include: aliphatic side chains such as glycine, alanine, valine, leucine, and isoleucine; aliphatic-hydroxyl side chains such as serine and threonine; amide-containing side chains such as asparagine and glutamine; aromatic side chains such as phenylalanine, tyrosine, and tryptophan; basic side chains such as lysine, arginine, and histidine; acidic side chains such as aspartic acid and glutamic acid; and, sulfur-containing side chains such as cysteine and methionine. Conservative amino acids substitution groups include, for example, valine / leucine / isoleucine, phenylalanine / tyrosine, lysine / arginine, alanine / valine, glutamate / aspartate, and asparagine / glutamine. A conservative amino acid substitution may be a substitution of any native residue in a protein with alanine, as used in, for example, alanine scanning mutagenesis. A conservative substitution may be made that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Exhaustive Matching of the Entire Protein Sequence Database, Science 256:1443-45. The substitution may be a moderately conservative substitution wherein the substitution has a nonnegative value in the PAM250 log-likelihood matrix.

[0064] The term "control", as used herein, refers to the art-understood meaning of a "control" being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables. A control may be a reaction or assay that is performed simultaneously with a test reaction or assay to provide a comparator. As used herein, a "control" may refer to a "control animal". A "control animal" may have a modification as described herein, a modification that is different as described herein, or no modification (i.e., a wild-type animal). In one experiment, the "test" (i.e., the variable being tested) is applied. In the second experiment, the "control," the variable being tested is not applied. A control may be a historical control (i.e., of a test or assay performed previously, or an amount or result that is previously known). A control may be or may comprise a printed or otherwise saved record. A control may be a positive control or a negative control.

[0065] The term "disruption", as used herein, may refer to the result of a homologous recombination event with a DNA molecule (e.g., with an endogenous homologous sequence such as a gene or gene locus. A disruption may achieve or represent an insertion, deletion, substitution, replacement, missense mutation, or a frame-shift of a DNA sequence(s), or any combination thereof. Insertions may include the insertion of entire genes or fragments of genes, e.g., exons, which may be of an origin other than the endogenous sequence (e.g., a heterologous sequence). A disruption may increase expression and / or activity of a gene or gene product (e.g., of a protein encoded by a gene). A disruption may decrease expression and / or activity of a gene or gene product. A disruption may alter sequence of a gene or an encoded gene product (e.g., an encoded protein). A disruption may truncate or fragment a gene or an encoded gene product (e.g., an encoded protein). A disruption may extend a gene or an encoded gene product; in some such instances, a disruption may achieve assembly of a fusion protein. A disruption may affect level but not activity of a gene or gene product. A disruption may affect activity but not level of a gene or gene product. A disruption may have no significant effect on level of a gene or gene product. A disruption may have no significant effect on activity of a gene or gene product. A disruption may have no significant effect on either level or activity of a gene or gene product.

[0066] The terms "determining", "measuring", "evaluating", "assessing", "assaying" and "analyzing" are used interchangeably herein to refer to any form of measurement, and include determining if an element is present or not. These terms include both quantitative and / or qualitative determinations. Assaying may be relative or absolute. "Assaying for the presence of" can be determining the amount of something present and / or determining whether or not it is present or absent.

[0067] The phrase "endogenous locus" or "endogenous gene", as used herein, refers to a genetic locus found in a parent or reference organism prior to introduction of a disruption, deletion, replacement, alteration, or modification as described herein. The endogenous locus may have a sequence found in nature. The endogenous locus may be a wild type locus. The reference organism may be a wild-type organism. The reference organism may be an engineered organism. The reference organism may be a laboratory-bred organism (whether wild-type or engineered).

[0068] The phrase "endogenous promoter" refers to a promoter that is naturally associated, e.g., in a wild-type organism, with an endogenous gene.

[0069] The term "heterologous", as used herein, refers to an agent or entity from a different source. For example, when used in reference to a polypeptide, gene, or gene product or present in a particular cell or organism, the term clarifies that the relevant polypeptide, gene, or gene product: 1) was engineered by the hand of man; 2) was introduced into the cell or organism (or a precursor thereof) through the hand of man (e.g., via genetic engineering); and / or 3) is not naturally produced by or present in the relevant cell or organism (e.g., the relevant cell type or organism type).

[0070] The cells according to the invention are rodent cells. The term "host cell", as used herein, refers to a cell into which a heterologous (e.g., exogenous) nucleic acid or protein has been introduced. Persons of skill upon reading this disclosure will understand that such terms refer not only to the particular subject cell, but also is used to refer to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. Host cells as generally described herein comprise a prokaryotic or eukaryotic cell. In general, a host cell is any cell that is suitable for receiving and / or producing a heterologous nucleic acid or protein, regardless of the Kingdom of life to which the cell is designated. Exemplary cells include those of prokaryotes and eukaryotes (single-cell or multiple-cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.), mycobacteria cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions such as, for example, hybridomas or quadromas. The cell may be a human, monkey, ape, hamster, rat, or mouse cell. The cell may be eukaryotic and may be selected from the following cells: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cell, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cell, C127 cell, SP2 / 0, NS-0, MMT 060562, Sertoli cell, BRL 3A cell, HT1080 cell, myeloma cell, tumor cell, and a cell line derived from an aforementioned cell. The cell may comprise one or more viral genes, e.g., a retinal cell that expresses a viral gene (e.g., a PER.C6 ™< cell). A host cell may be or may comprise an isolated cell. A host cell may be part of a tissue. A host cell may be part of an organism.

[0071] The term "humanized", is used herein in accordance with its art-understood meaning to refer to nucleic acids or proteins whose structures (i.e., nucleotide or amino acid sequences) include portions that correspond substantially or identically with structures of a particular gene or protein found in nature in a non-human animal, and also include portions that differ from that found in the relevant particular non-human gene or protein and instead correspond more closely with comparable structures found in a corresponding human gene or protein. A "humanized" gene described herein encodes a polypeptide having substantially the amino acid sequence as that of a human polypeptide (e.g., a human protein or portion thereof - e.g., characteristic portion thereof). To give but one example, in the case of a membrane receptor, a "humanized" gene may encode a polypeptide having an extracellular portion having an amino acid sequence as that of a human extracellular portion and the remaining sequence as that of a non-human (e.g., mouse) polypeptide. A humanized gene may comprise at least a portion of a DNA sequence of a human gene. A humanized gene may comprise an entire DNA sequence of a human gene. According to the invention, a humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene. A humanized protein described herein comprises a sequence having a portion that appears in a human protein. According to the invention, a humanized CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, encoded by exons 2-7 of a human CD47 gene, and the intracellular portion of the rodent CD47 polypeptide, encoded by the exons downstream of exon 7 of a rodent CD47 gene.

[0072] The term "identity", as used herein in connection with a comparison of sequences, refers to identity as determined by a number of different algorithms known in the art that can be used to measure nucleotide and / or amino acid sequence identity. Identities as described herein may be determined using a ClustalW v. 1.83 (slow) alignment employing an open gap penalty of 10.0, an extend gap penalty of 0.1, and using a Gonnet similarity matrix (MACVECTOR ™< 10.0.2, MacVector Inc., 2008).

[0073] The term "isolated", as used herein, refers to a substance and / or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and / or in an experimental setting), and / or (2) designed, produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated. Isolated agents may be about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As will be understood by those skilled in the art, a substance may still be considered "isolated" or even "pure", after having been combined with certain other components such as, for example, one or more carriers or excipients (e.g., buffer, solvent, water, etc.); in such instances, percent isolation or purity of the substance is calculated without including such carriers or excipients. To give but one example, a biological polymer such as a polypeptide or polynucleotide that occurs in nature may be considered to be "isolated" when: a) by virtue of its origin or source of derivation is not associated with some or all of the components that accompany it in its native state in nature; b) it is substantially free of other polypeptides or nucleic acids of the same species from the species that produces it in nature; or c) is expressed by or is otherwise in association with components from a cell or other expression system that is not of the species that produces it in nature. Thus, for instance, a polypeptide that is chemically synthesized or is synthesized in a cellular system different from that which produces it in nature may be considered to be an "isolated" polypeptide. Alternatively or additionally, a polypeptide that has been subjected to one or more purification techniques may be considered to be an "isolated" polypeptide to the extent that it has been separated from other components: a) with which it is associated in nature; and / or b) with which it was associated when initially produced.

[0074] The phrase "non-human animal", as used herein, refers to any vertebrate organism that is not a human. A non-human animal may be acyclostome, a bony fish, a cartilaginous fish (e.g., a shark or a ray), an amphibian, a reptile, a mammal, or a bird. A non-human mammal may be a primate, a goat, a sheep, a pig, a dog, a cow, or a rodent. A non-human animal of the present invention is a rodent, such as a rat or a mouse.

[0075] The phrase "nucleic acid", as used herein, in its broadest sense, refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. A "nucleic acid" may be a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, "nucleic acid" may refer to individual nucleic acid residues (e.g., nucleotides and / or nucleosides); "nucleic acid" may refer to an oligonucleotide chain comprising individual nucleic acid residues. A "nucleic acid" may be or may comprise RNA; a "nucleic acid" may be or may comprise DNA. A "nucleic acid" may be, may comprise, or may consist of one or more natural nucleic acid residues. A "nucleic acid" may be, may comprise, or may consist of one or more nucleic acid analogs. A nucleic acid analog may differ from a "nucleic acid" in that it does not utilize a phosphodiester backbone. For example, a "nucleic acid" may be, may comprise, or may consist of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone. Alternatively or additionally, a "nucleic acid" may have one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester bonds. A "nucleic acid" may be, may comprise, or may consist of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine). A "nucleic acid" may be, may comprise, or may consist of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). A "nucleic acid" may comprise one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. A "nucleic acid" may have a nucleotide sequence that encodes a functional gene product such as an RNA or protein. A "nucleic acid" may include one or more introns. A "nucleic acid" may be prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. A "nucleic acid" may be at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. A "nucleic acid" may be single stranded; or a "nucleic acid" may be double stranded. A "nucleic acid" may have a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. A "nucleic acid" may have enzymatic activity.

[0076] The phrase "operably linked", as used herein, refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. "Operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. The term "expression control sequence", as used herein, refers to polynucleotide sequences, which are necessary to effect the expression and processing of coding sequences to which they are ligated. "Expression control sequences" include: appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism. For example, in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence, while in eukaryotes, typically, such control sequences include promoters and transcription termination sequence. The term "control sequences" is intended to include components whose presence is essential for expression and processing, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.

[0077] The term "polypeptide", as used herein, refers to any polymeric chain of amino acids. A polypeptide may have an amino acid sequence that occurs in nature. A polypeptide may have an amino acid sequence that does not occur in nature. A polypeptide may have an amino acid sequence that contains portions that occur in nature separately from one another (i.e., from two or more different organisms, in particular, human and rodent portions). A polypeptide may have an amino acid sequence that is engineered in that it is designed and / or produced through action of the hand of man.

[0078] The term "recombinant", as used herein, is intended to refer to polypeptides (e.g., CD47 polypeptides as described herein) that are designed, engineered, prepared, expressed, created or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell, polypeptides isolated from a recombinant, combinatorial human polypeptide library (Hoogenboom H. R., (1997) TIB Tech. 15:62-70; Azzazy H., and Highsmith W. E., (2002) Clin. Biochem. 35:425-445; Gavilondo J. V., and Larrick J. W. (2002) BioTechniques 29:128-145; Hoogenboom H., and Chames P. (2000) Immunology Today 21:371-378), antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes (see e.g., Taylor, L. D., et al. (1992) Nucl. Acids Res. 20:6287-6295; Kellermann S-A., and Green L. L. (2002) Current Opinion in Biotechnology 13:593-597; Little M. et al. (2000) Immunology Today 21:364-370; Murphy, A.J.,et al. (2014) Proc. Natl. Acad. Sci. U.S.A. 111(14):5153-5158) or polypeptides prepared, expressed, created or isolated by any other means that involves splicing selected sequence elements to one another. One or more of such selected sequence elements may be found in nature. One or more of such selected sequence elements may be designed in silico. One or more such selected sequence elements may result from mutagenesis (e.g., in vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source. For example, a recombinant polypeptide is comprised of sequences found in the genome of a source organism of interest (e.g., human, mouse, etc.). A recombinant polypeptide may have an amino acid sequence that resulted from mutagenesis (e.g., in vitro or in vivo, for example in a non-human animal), so that the amino acid sequences of the recombinant polypeptides are sequences that, while originating from and related to polypeptides sequences, may not naturally exist within the genome of a non-human animal in vivo.

[0079] The term "replacement" is used herein to refer to a process through which a "replaced" nucleic acid sequence (e.g., a gene) found in a host locus (e.g., in a genome) is removed from that locus, and a different, "replacement" nucleic acid is located in its place. The replaced nucleic acid sequence and the replacement nucleic acid sequences may be comparable to one another in that, for example, they are homologous to one another and / or contain corresponding elements (e.g., protein-coding elements, regulatory elements, etc.). A replaced nucleic acid sequence may include one or more of a promoter, an enhancer, a splice donor site, a splice receiver site, an intron, an exon, an untranslated region (UTR); a replacement nucleic acid sequence may include one or more coding sequences. A replacement nucleic acid sequence may be a homolog of the replaced nucleic acid sequence. A replacement nucleic acid sequence may be an ortholog of the replaced sequence. A replacement nucleic acid sequence may be or may comprise a human nucleic acid sequence. In some instances, including where the replacement nucleic acid sequence is or comprises a human nucleic acid sequence, the replaced nucleic acid sequence may be or may comprise a rodent sequence (e.g., a mouse or rat sequence). The nucleic acid sequence so placed may include one or more regulatory sequences that are part of source nucleic acid sequence used to obtain the sequence so placed (e.g., promoters, enhancers, 5'- or 3'-untranslated regions, etc.). For example, the replacement is a substitution of an endogenous sequence with a heterologous sequence that results in the production of a gene product from the nucleic acid sequence so placed (comprising the heterologous sequence), but not expression of the endogenous sequence; the replacement is of an endogenous genomic sequence with a nucleic acid sequence that encodes a protein that has a similar function as a protein encoded by the endogenous sequence. An endogenous gene or fragment thereof may be replaced with a corresponding human gene or fragment thereof. A corresponding human gene or fragment thereof is a human gene or fragment that is an ortholog of, or is substantially similar or the same in structure and / or function, as the endogenous gene or fragment thereof that is replaced. According to the invention, a humanized CD47 gene may be formed from a replacement of a genomic fragment comprising exons 2-7 of an endogenous rodent CD47 gene at an endogenous rodent CD47 locus, with a genomic fragment comprising exons 2-7 of the human CD47 gene.

[0080] The phrase "cluster of differentiation 47protein" or "CD47 protein", as used herein, refers to a multi-pass transmembrane protein that belongs to the immunoglobulin superfamily and has an extracellular amino-terminal immunoglobulin V domain, five transmembrane domains and a short carboxyl-terminal intracellular tail. CD47 is expressed on the cell surface and is involved in interactions between membrane surface proteins such as, for example, integrins, SIRPα and thrombospondin-1 (TSP-1). CD47 is expressed in normal tissues and up-regulated in many human cancers. CD47 has been shown to be involved in several cellular processes such as, for example, apoptosis, proliferation, adhesion and migration. Several alternatively spliced CD47 isoforms have been identified between mouse and man. By way of illustration, nucleotide and amino acid sequences of mouse and human CD47 genes are provided in Table 3. Persons of skill upon reading this disclosure will recognize that one or more endogenous CD47 genes in a genome (or all) can be replaced by one or more heterologous CD47 genes (e.g., polymorphic variants, subtypes or mutants, genes from another species, humanized forms, etc.).

[0081] A "CD47-expressing cell", as used herein, refers to a cell that expresses a CD47 transmembrane protein. A CD47-expressing cell may express a CD47 transmembrane protein on its surface. A CD47 protein may be expressed on the surface of the cell in an amount sufficient to mediate cell-to-cell interactions via the CD47 transmembrane protein expressed on the surface of the cell. Exemplary CD47-expressing cells include neurons, immune cells, keratinocytes, and circulating cells. CD47-expressing cells regulate the interaction of immune cells and circulating cells to regulate various cellular processes such as adhesion, cell proliferation and / or apoptosis, angiogenesis and inflammation. Rodents of the present invention may demonstrate regulation of various cellular processes (as described herein) via humanized CD47 proteins expressed on the surface of one more cells of the rodent.

[0082] The term "reference" is used herein to describe a standard or control agent, cohort, individual, population, sample, sequence or value against which an agent, animal, cohort, individual, population, sample, sequence or value of interest is compared. A reference agent, cohort, individual, population, sample, sequence or value may be tested and / or determined substantially simultaneously with the testing or determination of the agent, cohort, individual, population, sample, sequence or value of interest. A reference agent, cohort, individual, population, sample, sequence or value may be a historical reference, optionally embodied in a tangible medium. A reference may refer to a control. As used herein, a "reference" may refer to a "reference animal". A "reference animal" may have a modification as described herein, a modification that is different as described herein or no modification (i.e., a wild-type animal). Typically, as would be understood by those skilled in the art, a reference agent, animal, cohort, individual, population, sample, sequence or value is determined or characterized under conditions comparable to those utilized to determine or characterize the agent, animal (e.g., a mammal), cohort, individual, population, sample, sequence or value of interest.

[0083] The term "substantially", as used herein, refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0084] The phrase "substantial homology", as used herein, refers to a comparison between amino acid or nucleic acid sequences. As will be appreciated by those of ordinary skill in the art, two sequences are generally considered to be "substantially homologous" if they contain homologous residues in corresponding positions. Homologous residues may be identical residues. Alternatively, homologous residues may be non-identical residues will appropriately similar structural and / or functional characteristics. For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as "hydrophobic" or "hydrophilic" amino acids, and / or as having "polar" or "non-polar" side chains. Substitution of one amino acid for another of the same type may often be considered a "homologous" substitution. Typical amino acid categorizations are summarized in Table 1 and 2. TABLE 1 AlanineAlaANonpolarNeutral1.8ArginineArgRPolarPositive-4.5AsparagineAsnNPolarNeutral-3.5Aspartic acidAspDPolarNegative-3.5CysteineCysCNonpolarNeutral2.5Glutamic acidGluEPolarNegative-3.5GlutamineGlnQPolarNeutral-3.5GlycineGlyGNonpolarNeutral-0.4HistidineHisHPolarPositive-3.2IsoleucineIleINonpolarNeutral4.5LeucineLeuLNonpolarNeutral3.8LysineLysKPolarPositive-3.9MethionineMetMNonpolarNeutral1.9PhenylalaninePheFNonpolarNeutral2.8ProlineProPNonpolarNeutral-1.6SerineSerSPolarNeutral-0.8ThreonineThrTPolarNeutral-0.7TryptophanTrpWNonpolarNeutral-0.9TyrosineTyrYPolarNeutral-1.3ValineValVNonpolarNeutral4.2 TABLE 2 Ambiguous Amino Acids3-Letter1-LetterAsparagine or aspartic acidAsxBGlutamine or glutamic acidGlxZLeucine or IsoleucineXleJUnspecified or unknown amino acidXaaX

[0085] As is well known in this art, amino acid or nucleic acid sequences may be compared using any of a variety of algorithms, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences. Exemplary such programs are described in Altschul et al. (1990) Basic local alignment search tool, J. Mol. Biol., 215(3): 403-410; Altschul et al. (1997) Methods in Enzymology; Altschul et al., "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402; Baxevanis et al. (1998) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley; and Misener et al. (eds.) (1999) Bioinformatics Methods and Protocols (Methods in Molecular Biology, Vol. 132), Humana Press. In addition to identifying homologous sequences, the programs mentioned above typically provide an indication of the degree of homology. Two sequences may be considered to be substantially homologous if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of their corresponding residues are homologous over a relevant stretch of residues. The relevant stretch may be a complete sequence. The relevant stretch may be at least 9, 10, 11, 12, 13, 14, 15, 16, 17 or more residues. The relevant stretch may include contiguous residues along a complete sequence. The relevant stretch may include discontinuous residues along a complete sequence. The relevant stretch may be at least 10, 15, 20, 25, 30, 35, 40, 45, 50, or more residues.

[0086] The phrase "substantial identity", as used herein, refers to a comparison between amino acid or nucleic acid sequences. As will be appreciated by those of ordinary skill in the art, two sequences are generally considered to be "substantially identical" if they contain identical residues in corresponding positions. As is well known in this art, amino acid or nucleic acid sequences may be compared using any of a variety of algorithms, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences. Exemplary such programs are described in Altschul et al. (1990) Basic local alignment search tool, J. Mol. Biol., 215(3): 403-410; Altschul et al., Methods in Enzymology; Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402; Baxevanis et al. (1998) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley; and Misener et al., (eds.) (1999) Bioinformatics Methods and Protocols (Methods in Molecular Biology, Vol. 132), Humana Press. In addition to identifying identical sequences, the programs mentioned above typically provide an indication of the degree of identity. Two sequences may be considered to be substantially identical if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of their corresponding residues are identical over a relevant stretch of residues. The relevant stretch may be a complete sequence. The relevant stretch may be at least 10, 15, 20, 25, 30, 35, 40, 45, 50, or more residues.

[0087] The phrase "targeting vector" or "targeting construct", as used herein, refers to a polynucleotide molecule that comprises a targeting region. A targeting region comprises a sequence that is identical or substantially identical to a sequence in a target cell, tissue or animal and provides for integration of the targeting construct into a position within the genome of the cell, tissue or animal via homologous recombination. Targeting regions that target using site-specific recombinase recognition sites (e.g., loxP or Frt sites) are also included. A targeting construct described herein may comprise a nucleic acid sequence or gene of particular interest, a selectable marker, control and or regulatory sequences, and other nucleic acid sequences that allow for recombination mediated through exogenous addition of proteins that aid in or facilitate recombination involving such sequences. Other targeting constructs described herein may comprise a gene of interest in whole or in part, wherein the gene of interest is a heterologous gene that encodes a protein, in whole or in part, that has a similar function as a protein encoded by an endogenous sequence. Other targeting constructs described herein may comprise a humanized gene of interest, in whole or in part, wherein the humanized gene of interest encodes a protein, in whole or in part, that has a similar function as a protein encoded by the endogenous sequence.

[0088] The term "variant", as used herein, refers to an entity that shows significant structural identity with a reference entity, but differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared with the reference entity. A "variant" may also differ functionally from its reference entity. In general, whether a particular entity is properly considered to be a "variant" of a reference entity is based on its degree of structural identity with the reference entity. As will be appreciated by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. A "variant", by definition, is a distinct chemical entity that shares one or more such characteristic structural elements. To give but a few examples, a small molecule may have a characteristic core structural element (e.g., a macrocycle core) and / or one or more characteristic pendent moieties so that a variant of the small molecule is one that shares the core structural element and the characteristic pendent moieties but differs in other pendent moieties and / or in types of bonds present (single vs. double, E vs. Z, etc.) within the core, a polypeptide may have a characteristic sequence element comprised of a plurality of amino acids having designated positions relative to one another in linear or three-dimensional space and / or contributing to a particular biological function, a nucleic acid may have a characteristic sequence element comprised of a plurality of nucleotide residues having designated positions relative to on another in linear or three-dimensional space. For example, a "variant polypeptide" may differ from a reference polypeptide as a result of one or more differences in amino acid sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone. A "variant polypeptide" may show an overall sequence identity with a reference polypeptide that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. Alternatively or additionally, a "variant polypeptide" may not share at least one characteristic sequence element with a reference polypeptide. The reference polypeptide may have one or more biological activities. A "variant polypeptide" may share one or more of the biological activities of the reference polypeptide. A "variant polypeptide" may lack one or more of the biological activities of the reference polypeptide. A "variant polypeptide" may show a reduced level of one or more biological activities as compared with the reference polypeptide. A polypeptide of interest may be considered to be a "variant" of a parent or reference polypeptide if the polypeptide of interest has an amino acid sequence that is identical to that of the parent but for a small number of sequence alterations at particular positions. Typically, fewer than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% of the residues in the variant are substituted as compared with the parent. A "variant" may have 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substituted residue as compared with a parent. Often, a "variant" has a very small number (e.g., fewer than 5, 4, 3, 2, or 1) number of substituted functional residues (i.e., residues that participate in a particular biological activity). Furthermore, a "variant" typically has not more than 5, 4, 3, 2, or 1 additions or deletions, and often has no additions or deletions, as compared with the parent. Moreover, any additions or deletions are typically fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and commonly are fewer than about 5, about 4, about 3, or about 2 residues. The parent or reference polypeptide may be one found in nature. As will be understood by those of ordinary skill in the art, a plurality of variants of a particular polypeptide of interest may commonly be found in nature, particularly when the polypeptide of interest is an infectious agent polypeptide.

[0089] The term "vector", as used herein, refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is associated. Vectors may be capable of extra-chromosomal replication and / or expression of nucleic acids to which they are linked in a host cell such as a eukaryotic and / or prokaryotic cell. Vectors capable of directing the expression of operatively linked genes are referred to herein as "expression vectors."

[0090] The term "wild-type", as used herein, has its art-understood meaning that refers to an entity having a structure and / or activity as found in nature in a "normal" (as contrasted with mutant, diseased, altered, etc.) state or context. Those of ordinary skill in the art will appreciate that wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0091] The present invention relates to, among other things, improved and / or engineered rodents having humanized genetic material encoding a cluster of differentiation 47 (CD47) gene for determining the therapeutic efficacy of CD47 antagonists (e.g., an anti-CD47 antibody) for the treatment of cancer, and assays in transplant engraftment, activation and phagocytosis and signal transduction. It is contemplated that such rodents provide an improvement in determining the therapeutic efficacy of CD47 antagonists and their potential for CD47 blockade. It is also contemplated that such rodents provide an improvement in transplant engraftment of human cells. Therefore, the present invention is particularly useful for the development of anti-CD47 therapies for the treatment of various cancers, as well as for maintaining human hematopoietic cells in rodents. In particular, the present disclosure relates to the humanization of a murine CD47 gene resulting in expression of a humanized CD47 protein on the surface of cells of the rodent. Such humanized CD47 proteins have the capacity to provide a source of human CD47 +< cells for determining the efficacy of anti-CD47 therapeutics to activate phagocytosis of tumor cells. Further, such humanized CD47 proteins have the capacity to recognize engrafted human cells via engagement of other cell surface proteins and ligands present on the surface of the engrafted human cells (e.g., SIRPα). Rodents described herein may be capable of activating phagocytosis via blockade of CD47 signaling through the humanized CD47 protein expressed on the surface of cells of the rodent. Rodents described herein may be capable of receiving transplanted human hematopoietic cells; such rodents may develop and / or have an immune system comprising human cells. According to the invention, humanized CD47 proteins comprise a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprise the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and encoded by exons 2-7 of a human CD47 gene, and wherein the intracellular portion of the rodent CD47 polypeptide encoded by the exons downstream of exon 7 of a rodent CD47 gene. A humanized CD47 protein described herein may have a sequence corresponding to the N-terminal immunoglobulin V domain of a human CD47 protein. A humanized CD47 protein described herein may have a sequence corresponding to an N-terminal portion of a human CD47 protein that comprises the extracellular domain and the transmembrane domains of a human CD47 protein, wherein the extracellular domain may include the N-terminal immunoglobulin V domain of the human CD47 protein and the transmembrane domain includes the five transmembrane domains of the human CD47 protein. A humanized CD47 protein described herein may have a sequence corresponding to the intracytoplasmic tail of a rodent (e.g., murine) CD47 protein. Humanized CD47 proteins described herein may have a sequence corresponding to amino acid residues 19-292 (or 19-141, or 19-127) of a human CD47 protein. Rodents described herein may comprise a humanized endogenous CD47 gene that may contain genetic material from the rodent and a human. A humanized CD47 gene described herein may comprise exons of a human CD47 gene that encode an extracellular portion including the N-terminal immunoglobulin V domain of a human CD47 gene. A humanized CD47 gene described herein may comprise human CD47 exons 2-7, encoding an N-terminal portion of a human CD47 protein that comprises the extracellular domain and the transmembrane domains of a human CD47 protein, wherein the extracellular domain includes the N-terminal immunoglobulin V domain of the human CD47 protein and the transmembrane domain includes the five transmembrane domains of the human CD47 protein. A humanized CD47 gene described herein may comprise rodent CD47 exons that encode the signal peptide, in whole or in part, and the intracytoplasmic tail of a rodent CD47 protein. A humanized CD47 gene described herein may comprise rodent CD47 exon 1 and exon(s) downstream of exon 7 that encode the intracytoplasmic tail and the 3' UTR. Depending on the isoforms, there may be one or more exons downstream of exon 7, with the stop codon and the 3' UTR being present in the last exon for all isoforms. For example, isoform 2 of both mouse and human CD47 shown in Table 3 have two exons downstream of exon 7, designated as exon 8 and 9.

[0092] Various aspects of the invention are described in detail in the following sections. In this application, the use of "or" means "and / or" unless stated otherwise.Cluster of Differentiation 47 (CD47) Gene

[0093] CD47, originally named integrin-associated protein (IAP) for its role in signal transduction from integrins on immune cells, is a transmembrane protein that includes an N-terminal immunoglobulin V (IgV) domain, five transmembrane domains, and a short C-terminal intracytoplasmic tail. The intracytoplasmic tail differs in length according to four alternatively spliced isoforms that have been identified. CD47 (or IAP) was initially described as being expressed on all tissues (isoform 2), neurons (isoform 4) and keratinocytes and macrophages (isoform 1; see Reinhold et al. (1995) J. Cell Sci. 108:3419-3425). Little is known about isoform 3 despite this form having the second longest intracytoplasmic tail among the four isoforms. In addition to integrins, CD47 is known to interact with several other cell surface proteins such as, for example, thrombospondin and members of the SIRP family. Most notably, CD47 interacts with SIRPα and leads to bidirectional signaling that regulates a variety of cell-to-cell responses such as, for example, inhibition of phagocytosis and T cell activation. Indeed, CD47-SIRPα interaction has come into focus in recent years for its role in providing tumor cells with the capacity to evade immune surveillance. CD47 binding to SIRPα normally provides protection through anti-phagocytic signals ("don't eat me") for normal cells. However, it has been discovered that tumors also express anti-phagocytic signals, including CD47, to evade destruction by phagocytosis. Interestingly, CD47 is known to be upregulated in several hematologic cancers and contribute to both the growth and dissemination of tumors (Chao et al. (2012) Curr Opin Immunol.24(2): 225-232).

[0094] The complete effects of targeting CD47 and the CD47-SIRPα pathway as a new treatment for cancer are unknown and some possible toxicities have been explored. A more thorough and detailed understanding of CD47 signaling and the CD47-SIRPα pathway is needed to develop better targeted therapies for cancer treatment of the future.CD47 Sequences

[0095] Exemplary CD47 sequences for mouse and human are set forth in Table 3. For mRNA sequences, bold font indicates coding sequence, and consecutive exons, where indicated, are separated by alternating underlined text. For mouse and human protein sequences, signal peptides are underlined, extracellular sequences are bold font and intracytoplasmic sequences are italicized. For humanized protein sequences, non-human sequences are indicated in regular font, human sequences are indicated in bold font, and signal peptides are underlined. As shown, the isoforms differ in the number of exons. For example, isoforms 1-4 of the human CD47 gene have a total of 8, 9, 10 and 11 exons, respectively, with exons 2-7 of each isoform encoding the extracellular domain and the five transmembrane domains. TABLE 3 Mouse CD47 mRNA isoform 1 (XM_006521810.1) Mouse CD47 amino acid isoform 1 (XP_006521873.1) Mouse CD47 mRNA isoform 2 (XM_006521811.1) Mouse CD47 amino acid isoform 2 (XP_006521874.1) Mouse CD47 mRNA isoform 3 (XM_006521807.1) Mouse CD47 amino acid isoform 3 (XP_006521870.1) Mouse CD47 mRNA isoform 4 (XM_006521808.1) Mouse CD47 amino acid isoform 4 (XP_006521871.1) Human CD47 mRNA isoform 1 (XM_005247909.1) Human CD47 amino acid isoform 1 (XP_005247966.1) Human CD47 mRNA isoform 2 (NM_198793.2) Human CD47 amino acid isoform 2 (NP_942088.1) Human CD47 mRNA isoform 3 (XM_005247908.1) Human CD47 amino acid isoform 3 (XP_005247965.1) Human CD47 mRNA isoform 4 (NM_001777.3) Human CD47 amino acid isoform 4 (NP_001768.1) Humanized CD47 amino acid isoform 1 Humanized CD47 amino acid isoform 2 Humanized CD47 amino acid isoform 3 Humanized CD47 amino acid isoform 4 Humanized CD47 Rodents

[0096] Rodents are described herein that express humanized CD47 proteins on the surface of cells of the rodents resulting from a genetic modification of an endogenous locus of the rodent that encodes a CD47 protein. Suitable examples described herein include, in particular, mice.

[0097] A humanized CD47 gene comprises genetic material from a heterologous species (humans), wherein the humanized CD47 gene encodes a CD47 protein that comprises the encoded portion of the genetic material from the heterologous species. A humanized CD47 gene described herein comprises genomic DNA of a heterologous species that encodes the extracellular portion of a CD47 protein that is expressed on the plasma membrane of a cell. A humanized CD47 gene described herein comprises genomic DNA of a human that encodes the extracellular domain and the transmembrane domains of a CD47 protein that is expressed on the plasma membrane of a cell. According to the invention, a humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, and wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene. Rodents, embryos, cells and targeting constructs for making rodents, rodent embryos, and cells containing said humanized CD47 gene are also described herein.

[0098] An endogenous CD47 gene may be deleted. An endogenous CD47 gene may be altered, wherein a portion of the endogenous CD47 gene is replaced with a heterologous sequence (All or substantially all of an endogenous CD47 gene may be replaced with a heterologous gene a human CD47 gene)A portion of a heterologous CD47 gene may be inserted into an endogenous rodent CD47 gene at an endogenous CD47 locus to form a humanized CD47 gene according to the invention. The modification or humanization may be made to one of the two copies of the endogenous CD47 gene, giving rise to a rodent that is heterozygous with respect to the humanized CD47 gene. A rodent may be provided that is homozygous for a humanized CD47 gene.

[0099] A rodent described herein may contain a humanized CD47 gene according to the invention at an endogenous rodent CD47 locus. Thus, such rodents can be described as having a heterologous CD47 gene. The replaced, inserted, modified or altered CD47 gene at the endogenous CD47 locus can be detected using a variety of methods including, for example, PCR, Western blot, Southern blot, restriction fragment length polymorphism (RFLP), or a gain or loss of allele assay. The rodent may be heterozygous with respect to the humanized CD47 gene. The rodent may be homozygous for the humanized CD47 gene.

[0100] A humanized CD47 gene described herein includes a CD47 gene that has a second, third, fourth, fifth, sixth and seventh human exon, each of which may have a sequence at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to a second, third, fourth, fifth, sixth and seventh exon that appear in a human CD47 gene of Table 3.

[0101] A humanized CD47 gene described herein includes a CD47 gene that has a first exon and exon(s) downstream of exon 7 (e.g., eighth and ninth exons of isoform 2), each of which may have a sequence at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to a respective exon that appears in a mouse CD47 gene of Table 3.

[0102] A humanized CD47 gene described herein may include a CD47 gene that has a 5' untranslated region and a 3' untranslated region each having a sequence at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to a 5' untranslated region and a 3' untranslated region that appear in a mouse CD47 gene of Table 3.

[0103] A humanized CD47 gene described herein may include a CD47 gene that has a nucleotide coding sequence (e.g., a cDNA sequence) at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to a nucleotide coding sequence that appears in a human CD47 nucleotide coding sequence of Table 3.

[0104] A humanized CD47 protein produced by a rodent of the present invention may have a human extracellular portion having an amino acid sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to an extracellular portion of a human CD47 protein that appears in Table 3.

[0105] A humanized CD47 protein produced by a rodent of the present invention may have an extracellular portion having an amino acid sequence that is identical to amino acid residues 19-141 that appear in a human CD47 protein of Table 3.

[0106] A humanized CD47 protein produced by a rodent of the present invention may have an N-terminal immunoglobulin V domain having an amino acid sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to an N-terminal immunoglobulin V domain of a human CD47 protein that appears in Table 3.

[0107] A humanized CD47 protein produced by a rodent of the present invention may have an N-terminal immunoglobulin V domain having an amino acid sequence that is identical to amino acid residues 19-127 that appear in a human CD47 protein of Table 3.

[0108] A humanized CD47 protein produced by a rodent of the present invention may have an N-terminal immunoglobulin V domain and five transmembrane domains each having a sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to an N-terminal immunoglobulin V domain and five transmembrane domains of a human CD47 protein that appears in Table 3.

[0109] A humanized CD47 protein produced by a rodent of the present invention may have an intracytoplasmic tail having a sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to an intracytoplasmic tail of a mouse CD47 protein that appears in Table 3.

[0110] A humanized CD47 protein produced by a rodent of the present invention may have an amino acid sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to amino acid residues 16-292 that appear in a human CD47 protein of Table 3.

[0111] A humanized CD47 protein produced by a rodent of the present invention may have an amino acid sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to amino acid residues 19-292 that appear in a human CD47 protein of Table 3.

[0112] A humanized CD47 protein produced by a rodent of the present invention may have an amino acid sequence that is identical to amino acid residues 19-292 (or 16-292) that appear in a human CD47 protein of Table 3.

[0113] A humanized CD47 protein produced by a rodent of the present invention may have an amino acid sequence that is at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to an amino acid sequence of a humanized CD47 protein that appears in Table 3.

[0114] A humanized CD47 protein produced by a rodent of the present invention may have an amino acid sequence that is identical to an amino acid sequence of a humanized CD47 protein that appears in Table 3.

[0115] Compositions and methods for making rodents that express a humanized CD47 protein, including specific polymorphic forms, allelic variants (e.g., single amino acid differences) or alternatively spliced isoforms, are described, including compositions and methods for making rodents that express such proteins from a human promoter and a human regulatory sequence. Compositions and methods for making rodents that express such proteins from an endogenous promoter and an endogenous regulatory sequence are also described. The methods include inserting the genetic material encoding a portion of a human CD47 protein comprising at least the extracellular domain and the transmembrane domains of the human CD47 protein at a precise location in the genome of a rodent that corresponds to an endogenous CD47 gene thereby creating a humanized CD47 gene that expresses a humanized CD47 protein comprising at least the extracellular domain and the transmembrane domains of the human CD47 protein, and an intracellular portion of a rodent CD47 polypeptide. The methods include inserting genomic DNA corresponding to exons 2-7 of a human CD47 gene into an endogenous CD47 gene of the rodent thereby creating a humanized gene that encodes a CD47 protein that contains a human portion containing amino acids encoded by the inserted exons and comprising at least the extracellular domain and the transmembrane domains of the human CD47 protein.

[0116] Where appropriate, the coding region of the genetic material or polynucleotide sequence(s) encoding a portion of the human CD47 protein comprising at least the extracellular domain and the transmembrane domains of the human CD47 protein may be modified to include codons that are optimized for expression in the rodent (e.g., see U.S. Patent No.'s 5,670,356 and 5,874,304). Codon optimized sequences are synthetic sequences, and preferably encode the identical polypeptide (or a biologically active fragment of a full length polypeptide which has substantially the same activity as the full length polypeptide) encoded by the non-codon optimized parent polynucleotide. The coding region of the genetic material encoding a portion of a human CD47 protein comprising at least the extracellular domain and the transmembrane domains of the human CD47 protein may include an altered sequence to optimize codon usage for a particular cell type (a rodent cell). For example, the codons of the genomic DNA corresponding to exons 2-7 of a human CD47 gene to be inserted into an endogenous CD47 gene of a rodent may be optimized for expression in a cell of the rodent. Such a sequence may be described as a codon-optimized sequence.

[0117] A humanized CD47 gene approach employs a relatively minimal modification of the endogenous gene and results in natural CD47-mediated signal transduction in the rodent, because the genomic sequence of the CD47 sequences are modified in a single fragment and therefore retain normal functionality by including necessary regulatory sequences. Thus, in such instances, the CD47 gene modification does not affect other surrounding genes or other endogenous CD47-interacting genes (e.g., thrombospondin, SIRPs, integrins, etc.). Further, the modification does not affect the assembly of a functional CD47 transmembrane protein on the plasma membrane and maintains normal effector functions via binding and subsequent signal transduction through the cytoplasmic portion of the protein which is unaffected by the modification.

[0118] A schematic illustration (not to scale) of the genomic organization of an endogenous murine CD47 gene and a human CD47 gene is provided in Figure 1. An exemplary method for humanizing an endogenous murine CD47 gene using a genomic fragment containing exons 2-7 of a human CD47 gene is provided in Figure 2. As illustrated, genomic DNA containing exons 2-7 of a human CD47 gene is inserted into an endogenous murine CD47 gene locus by a targeting construct. This genomic DNA includes the portion of the gene that encodes an extracellular portion and transmembrane domains (e.g., amino acid resides 16-292) of a human CD47 protein responsible for ligand binding.

[0119] A rodent (e.g., a mouse) having a humanized CD47 gene at the endogenous CD47 locus can be made by any method known in the art. For example, a targeting vector can be made that introduces a human CD47 gene in whole or in part with a selectable marker gene. Figure 2 illustrates an endogenous CD47 locus of a mouse genome comprising an insertion of exons 2-7 of a human CD47 gene. As illustrated, the targeting construct contains a 5' homology arm containing sequence upstream of exon 2 of an endogenous murine CD47 gene (~39 Kb), followed by a genomic DNA fragment containing exons 2-7 of a human CD47 gene (~23.9 Kb), a drug selection cassette (e.g., a neomycin resistance gene flanked on both sides by loxP sequences; ~5 Kb), and a 3' homology arm containing sequence downstream of exon7 of an endogenous murine CD47 gene (~99 Kb). The targeting construct contains a self-deleting drug selection cassette (e.g., a neomycin resistance gene flanked by loxP sequences; see U.S. Patent No.'s 8,697,851, 8,518,392 and 8,354,389). Upon homologous recombination, exons 2-7 of an endogenous murine CD47 gene are replaced by the sequence contained in the targeting vector (i.e., exons 2-7 of a human CD47 gene). A humanized CD47 gene is created resulting in a cell or non-human animal that expresses a humanized CD47 protein that contains amino acids encoded by exons 2-7 of a human CD47 gene. The drug selection cassette is removed in a development-dependent manner, i.e., progeny derived from mice whose germ line cells containing the humanized CD47 gene described above will shed the selectable marker from differentiated cells during development.

[0120] The rodents of the present disclosure may be prepared as described above, or using methods known in the art, to comprise additional human or humanized genes, oftentimes depending on the intended use of the rodent. Genetic material of such additional human or humanized genes may be introduced through the further alteration of the genome of cells (e.g., embryonic stem cells) having the genetic modifications as described above or through breeding techniques known in the art with other genetically modified strains as desired. Rodents of the present disclosure are prepared to further comprise one or more human or humanized genes selected from SIRPα (CD172a), IL-3, M-CSF, GM-CSF and TPO. Rodents of the present disclosure may be prepared by introducing a targeting vector, as described herein, into a cell from a modified strain. To give but one example, a targeting vector, as described above, may be introduced into a mouse that is Rag2-deficient and IL-2Rγ-deficient and include four human cytokines (Rag2 - / -< IL-2Rγc - / -< ; M-CSF Hu< ; IL-3 / GM-CSF Hu< ; hSIRPα tg< ; TPO Hu< ). Rodents of the present disclosure may be prepared to further comprise a human or humanized signal-regulatory protein alpha (SIRPα) gene. Rodents of the present disclosure comprise a humanized CD47 gene, as described herein, and genetic material from a heterologous species (humans), wherein the genetic material encodes one or more heterologous proteins selected from SIRPα (CD172a), IL-3, M-CSF, GM-CSF and TPO. Rodents of the present disclosure may comprise a humanized CD47 gene as described herein and genetic material from a heterologous species (humans), wherein the genetic material may encode a heterologous (human) SIRPα (CD172a) protein. Rodents of the present disclosure may further comprise a SIRPα gene that comprises an endogenous portion and a human portion (e.g., exons 2-4 of a human SIRPα gene), wherein the human portion encodes the extracellular domain of a SIRPα protein (e.g., amino acids corresponding to residues 28-362 of a human SIRPα protein) and the endogenous portion encodes the intracellular domain of an endogenous SIRPα protein; the human portion and the endogenous portion may be operably linked to an endogenous SIRPα promoter.

[0121] For example, as described herein, rodents comprising a humanized CD47 gene may further comprise (e.g., via cross-breeding or multiple gene targeting strategies) one or more modifications as described in PCT / US2010 / 051339, filed October 4, 2010; PCT / US2013 / 058448, filed September 6, 2013; PCT / US2013 / 045788, filed June 14, 2013; PCT / US2014 / 056910, filed September 23, 2014; PCT / US2014 / 060568, filed October 15, 2014; the PCT / US2012 / 025040, filed February 14, 2014; PCT / US2012 / 062379, filed October 29, 2012; PCT / US2014 / 064806, filed November 10, 2014; and PCT / US2014 / 064810, filed November 10, 2014. As described herein, a rodent comprising a humanized CD47 gene (i.e., exons 2-7 of a human CD47 gene operably linked to exon 1 and exon 8 (and hence any downstream exons) of an endogenous rodent CD47 gene so that the humanized CD47 gene encodes a CD47 polypeptide having the extracellular domain and the transmembrane domains from a human CD47 protein and an intracellular portion from a rodent CD47 protein) may be crossed to a rodent comprising a humanized SIRPα gene (e.g., exons 2-4 of a human SIRPα gene operably linked to exons 1 and 5-8 of an endogenous rodent SIRPα gene so that the humanized SIRPα gene encodes a SIRPα polypeptide having an extracellular portion from a human SIRPα protein (e.g., amino acids corresponding to residues 28-362) and an intracellular portion from a rodent SIRPα protein; see, e.g., PCT / US2014 / 056910, filed September 23, 2014).

[0122] Although embodiments employing a humanized CD47 gene in a mouse (i.e., a mouse with a CD47 gene that encodes a CD47 protein that includes a human portion and a mouse portion) are extensively discussed herein, other rodents that comprise a humanized CD47 gene are also described. Such rodents may comprise a humanized CD47 gene operably linked to an endogenous CD47 promoter. Such rodents may express a humanized CD47 protein from an endogenous locus, wherein the humanized CD47 protein comprises amino acid residues 16-292 (or 19-141 or 19-127) of a human CD47 protein. Such rodents include any of those which can be genetically modified to express a CD47 protein as disclosed herein, including, e.g., mouse, rat, etc. For example, for those rodents for which suitable genetically modifiable ES cells are not readily available, other methods are employed to make a rodent comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing somatic cell nuclear transfer (SCNT) to transfer the genetically modified genome to a suitable cell, e.g., an enucleated oocyte, and gestating the modified cell (e.g., the modified oocyte) in a rodent under suitable conditions to form an embryo.

[0123] Methods for modifying a rodent genome include, e.g., employing a zinc finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN) to modify a genome to include a humanized CD47 gene.

[0124] A rodent of the present disclosure may be selected from a mouse, a rat, and a hamster. A rodent of the present disclosure may be selected from the superfamily Muroidea. A genetically modified rodent of the present disclosure may be from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). A genetically modified rodent of the present disclosure may be selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. A genetically modified mouse of the present disclosure may be from a member of the family Muridae. In one aspect, the rodent of the present disclosure is selected from a mouse and a rat. In one aspect, a rodent of the present disclosure is a mouse.

[0125] A rodent of the present disclosure may be a mouse of a C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. A mouse of the present disclosure may be a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129 / SvJae, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2 (see, e.g., Festing et al., 1999, Mammalian Genome 10:836; Auerbach, W. et al., 2000, Biotechniques 29(5):1024-1028, 1030, 1032). A genetically modified mouse of the present disclosure may be a mix of an aforementioned 129 strain and an aforementioned C57BL / 6 strain. A mouse of the present disclosure may be a mix of aforementioned 129 strains, or a mix of aforementioned BL / 6 strains. A 129 strain of the mix as described herein may be a 129S6 (129 / SvEvTac) strain. A mouse of the present disclosure may be a BALB strain, e.g., BALB / c strain. A mouse of the present disclosure may be a mix of a BALB strain and another aforementioned strain.

[0126] In one aspect, a rodent of the present disclsure is a rat. A rat of the present disclosure may be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. A rat strain as described herein may be a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.Methods Employing Rodents Having Humanized CD47 Genes

[0127] CD47 mutant and transgenic non-human animals (e.g., miniature swine) and cells have been reported (Koshimizu H. et al. (2014) PLoS One, 9(2):e89584; Lavender, K.J. et al. (2014) J. Immunol. Methods, 407:127-134; Tena, A. et al. (2014) Am. J. Transplant. doi: 10.1111 / ajt.12918; Lavender K.J. et al. (2013) Blood, 122(25):4013-4020; Tena, A. et al. (2012) Transplantation 94(10S):776; Wang, C. et al. (2011) Cell Transplant. 20(11-12):1915-1920; Johansen, M.L. and Brown, E.J. (2007) J. Biol. Chem. 282:24219-24230; Wang, H. et al. (2007) Proc. Nat. Acad. Sci. U.S.A. 104:13744-13749; Tulasne D. et al. (2001) Blood, 98(12):3346-52; Oldenborg, P.et al. (2000) Science 288:2051-2054; Verdrengh, M. et al. (1999) Microbes Infect. 1(10):745-751; Chang, H.P. et al. (1999) Learn Mem. 6(5):448-457; Wang, X.Q. et al. (1999) J. Cell Biol. 147(2):389-400; Lindberg, F.P. et al. (1996) Science 274(5288):795-798). Such animals have been employed in a variety of assays to determine, for example, the molecular aspects of CD47 expression, function and regulation. Considerable species differences have been discovered. Indeed, nonobese diabetic / severe combined immunodeficient (NOD / SCID) mice express a SIRPα protein that is capable of interacting with human CD47 and, therefore, have been used extensively for the development of mouse models with components of the human immune system (e.g., see Takenaka, K. et al. (2007) Nat. Immunol. 8(120:1313-1323). The SIRPα allele present in these mice is not representative of the SIRPα allele present in other mouse strains and, generally, there is little cross-reaction between CD47 and SIRPα between species. Also, CD47 on mouse cells has been reported to have a near-complete mobility, while CD47 on human cells demonstrate only about 30-40% (Bruce, L. et al. (2003) Blood 101:4180-4188; Mouro-Chanteloup, L. et al. (2000) VoxSanguinis 78:P030; Mouro-Chanteloup, L. et al. (2003) Blood 101:338-344). Thus, NOD / SCID mice are not without limitation. For example, although multi-lineage human hematopoietic development can be supported in some genetic backgrounds (e.g., BALB / c Rag2 - / -< IL-2Rγc - / -< ), homeostasis of other cell types remains inefficient (e.g., T and NK cells; see e.g., Gimeno, R. et al. (2004) Blood 104:3886-3893; Traggiai, E. et al. (2004) Science 304:104-107; Legrand, N. et al. (2006) Blood 108:238-245). Further, CD47 is also known to interact with other cell surface proteins and provide bidirectional signaling. Thus, existing mice represent an inefficient in vivo system for elucidation of CD47-dependent functions in various biological processes such as, for example, engraftment and phagocytosis. Further, existing mice represent a suboptimal in vivo system for development of CD47 targeted therapies.

[0128] Rodents of the present disclosure provide an improved in vivo system and source of biological materials (e.g., cells) expressing human CD47 that are useful for a variety of assays. Rodents of the present disclosure may be used to develop therapeutics that target CD47 and / or modulate CD47-SIRPα signaling. Rodents of the present disclosure may be used to screen and develop candidate therapeutics (e.g., antibodies) that bind human CD47. Rodents of the present disclosure may be used to screen and develop candidate therapeutics (e.g., antibodies) that block interaction of human CD47 with human SIRPα. Rodents of the present disclosure may be used to determine the binding profile of antagonists and / or agonists of a humanized CD47 on the surface of a cell of a rodent as described herein. Rodents of the present disclosure may be used to determine the epitope or epitopes of one or more candidate therapeutic antibodies that bind human CD47.

[0129] Rodents of the present disclosure may be used to determine the pharmacokinetic profiles of anti-CD47 antibodies. One or more rodents of the present disclosure and one or more control or reference rodents may be each exposed to one or more candidate therapeutic anti-CD47 antibody at various doses (e.g., 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / mg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, or 50 mg / kg or more). Candidate therapeutic antibodies may be dosed via any desired route of administration (e.g., subcutaneously, intravenously, intramuscular, intraperitoneal, etc.). Blood may be isolated from rodents (humanized and control) at various time points (e.g., 0 hr, 6 hr, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or up to 30 or more days). Various assays may be performed to determine the pharmacokinetic profiles of administered candidate therapeutic antibodies using samples obtained from rodents as described herein including, but not limited to, total IgG, anti-therapeutic antibody response, agglutination, etc.

[0130] Rodents of the present disclosure may be used to measure the therapeutic effect of blocking or modulating CD47 signaling and the effect on gene expression as a result of cellular changes. A rodent of the present disclosure or cells isolated therefrom may be exposed to a candidate therapeutic that binds to a humanized CD47 protein (or a human portion of a CD47 protein) on the surface of a cell of the rodent and, after a subsequent period of time, analyzed for effects on CD47-dependent processes, for example, adhesion, angiogenesis, apoptosis, inflammation, migration, phagocytosis, proliferation and clearance of tumors (or tumor cells).

[0131] Rodents of the present disclosure expressing humanized CD47 protein are described. Thus cells, cell lines, and cell cultures can be generated to serve as a source of humanized CD47 for use in binding and functional assays, e.g., to assay for binding or function of a CD47 antagonist or agonist, particularly where the antagonist or agonist is specific for a human SIRPα sequence or epitope. CD47 epitopes bound by candidate therapeutic antibodies can be determined using cells isolated from rodents of the present disclosure.

[0132] Cells from rodents of the present disclosure may be isolated and used on an ad hoc basis, or can be maintained in culture for many generations. Cells from a rodent of the present disclosure may be immortalized and maintained in culture indefinitely (e.g., in serial cultures).

[0133] Cells and / or rodents of the present disclosure may be used in a survival and / or proliferation assay (e.g., employing B or T cells) to screen and develop candidate therapeutics that modulate human CD47 signaling. Activation or loss of CD47 can play an important role in the regulation of cell proliferation, and induction of apoptosis by CD47 may result from the activation of specific epitopes of the extracellular domain of CD47, therefore, candidate CD47 modulators (e.g., antagonists or agonists) may be identified, characterized and developed using cells of rodents of the present disclosure. Cells and / or rodents of the present disclosure may be used in survival or death assay(s) to determine the effect on proliferation or apoptosis of a specific cell(s) (e.g., cancer cells) in the presence and absence of CD47.

[0134] Cells and / or rodents of the present disclosure may be used in xenotransplantation of heterologous (e.g., human) cells to determine the CD47-mediated functions in the physiological (e.g., immune) response to the transplanted human cells. Candidate therapeutics that bind, or block one or more functions of, human CD47 may be characterized in a rodent of the present disclosure. Suitable measurements include various cellular assays, proliferation assays, serum immunoglobulin analysis (e.g., antibody titer), cytotoxicity assays, and characterization of ligand-receptor interactions (immunoprecipitation assays). Rodents of the present disclosure may be used to characterize the CD47-mediated functions regulating an immune response to an antigen. The antigen may be associated with a neoplasm. The antigen may be associated with an autoimmune disease or condition. The antigen may be a target associated with a disease or condition suffered by one or more human patients in need of treatment.

[0135] Rodents of the present disclosure may be used in transplantation or adoptive transfer experiments to determine the therapeutic potential of compounds or biological agents to modulate CD47-dependent regulation of new lymphocytes and their immune function. Rodents of the present disclosure may be transplanted with human B cells.

[0136] Cells of rodents of the present disclosure may be used in a cell migration or spreading assay to screen and develop candidate therapeutics that modulate human CD47. Such processes are necessary for many cellular processes including wound healing, differentiation, proliferation and survival.

[0137] Cells of rodents of the present disclosure may be used in phagocytosis assays to determine the therapeutic potential of compounds or biological agents to modulate CD47-dependent regulation of phagocytosis.

[0138] Cells of rodents of the present disclosure may be used in tumor cell growth (or proliferation) assays to determine the therapeutic potential of compounds or biological agents to modulate CD47-dependent regulation and / or apoptosis of tumor cells.

[0139] An inflammatory disease or condition may be induced in one or more rodents of the present disclosure to provide an in vivo system for determining the therapeutic potential of compounds or biological agents to modulate CD47-dependent regulation of one or more functions of the inflammatory disease or condition. The inflammatory disease or condition may be associated with a neoplasm.

[0140] An anti-angiogenic condition may be induced in one or more rodents of the present disclosure to provide an in vivo system for determining the therapeutic potential of compounds or biological agents to modulate CD47-dependent regulation of one or more functions of the anti-angiogenic condition. Exemplary functions that can be evaluated to determine therapeutic efficacy include chemokine expression, nitric oxide (NO)-stimulated responses and blood flow recovery.

[0141] Rodents of the present disclosure may provide an in vivo system for the analysis and testing of a drug or vaccine. A candidate drug or vaccine may be delivered to one or more rodents of the present disclosure, followed by monitoring of the rodents to determine one or more of the immune response to the drug or vaccine, the safety profile of the drug or vaccine, or the effect on a disease or condition. Exemplary methods used to determine the safety profile include measurements of toxicity, optimal dose concentration, efficacy of the drug or vaccine, and possible risk factors. Such drugs or vaccines may be improved and / or developed in such rodents.

[0142] Rodents of the present disclosure provide an in vivo system for assessing the pharmacokinetic properties of a drug targeting CD47. A drug targeting human CD47 may be delivered or administered to one or more rodents of the present disclosure, followed by monitoring of, or performing one or more assays on, the rodents (or cells isolated therefrom) to determine the effect of the drug on the rodent. Pharmacokinetic properties include, but are not limited to, how an animal processes the drug into various metabolites (or detection of the presence or absence of one or more drug metabolites, including, toxic metabolites), drug half-life, circulating levels of drug after administration (e.g., serum concentration of drug), anti-drug response (e.g., anti-drug antibodies), drug absorption and distribution, route of administration, routes of excretion and / or clearance of the drug. Pharmacokinetic and pharmacodynamic properties of drugs (e.g., CD47 modulators) may be monitored in or through the use of rodents of the present disclosure.

[0143] Rodents of the present disclosure provide an in vivo system for assessing the on-target toxicity of a drug targeting CD47. A drug targeting CD47 may be delivered or administered to one or more rodents of the present disclosure, followed by monitoring of or performing one or more assays on the rodents (or cells isolated therefrom) to determine the on-target toxic effect of the drug on the rodent. Typically, drugs are intended to modulate one or more functions of their targets. To give but one example, a CD47 modulator is intended to modulate CD47-mediated functions (e.g., CD47 induced apoptosis) through interacting in some way with the CD47 molecule on the surface of one or more cells. Such a modulator may have an adverse effect that is an exaggeration of the desired pharmacologic action(s) of the modulator. Such effects are termed on-target effects. Exemplary on-target effects include too high of a dose, chronic activation / inactivation, and correct action in an incorrect tissue. On-target effects of a drug targeting CD47 identified in or through the use of rodents of the present disclosure may be used to determine a previously unknown function(s) of CD47.

[0144] Rodents of the present disclosure may provide an in vivo system for assessing the off-target toxicity of a drug targeting CD47. A drug targeting CD47 may be delivered or administered to one or more rodents of the present disclosure, followed by monitoring of or performing one or more assays on the rodents (or cells isolated therefrom) to determine the off-target toxic effect of the drug on the rodent. Off-target effects can occur when a drug interacts with an unintended target (e.g., cross-reactivity to a common epitope). Such interactions can occur in an intended or unintended tissue. To give but one example, mirror image isomers (enantiomers) of a drug can lead to off-target toxic effects. Further, a drug can inappropriately interact with and unintentionally activate different receptor subtypes. Exemplary off-target effects include incorrect activation / inhibition of an incorrect target regardless of the tissue in which the incorrect target is found. Off-target effects of a drug targeting CD47 may be determined by comparing the effects of administering the drug to rodents of the present disclosure to one or more reference rodents.

[0145] Performing an assay may include determining the effect on the phenotype (e.g., change in body weight) and / or genotype of the non-human animal to which the drug is administered. Performing an assay may include determining lot-to-lot variability for a CD47 modulator (e.g., an antagonist or an agonist). Performing an assay may include determining the differences between the effects of a drug targeting CD47 administered to a rodent of the present disclosure and a reference rodent. Reference rodents may have a modification as described herein, a modification that is different as described herein (e.g., one that has a disruption, deletion or otherwise non-functional CD47 gene) or no modification (i.e., a wild-type rodent).

[0146] Exemplary parameters that may be measured in rodents (or in and / or using cells isolated therefrom) for assessing the pharmacokinetic properties, on-target toxicity, and / or off-target toxicity of a drug targeting CD47 include, but are not limited to, agglutination, autophagy, cell division, cell death, complement-mediated hemolysis, DNA integrity, drug-specific antibody titer, drug metabolism, gene expression arrays, hematocrit levels, hematuria, metabolic activity, mitochondrial activity, oxidative stress, phagocytosis, protein biosynthesis, protein degradation, protein secretion, stress response, target tissue drug concentration, non-target tissue drug concentration, transcriptional activity and the like. Rodents of the present disclosure may be used to determine a pharmaceutically effective dose of a CD47 modulator.

[0147] Rodents of the present disclosure may provide an improved in vivo system for the development and characterization of candidate therapeutics for use in cancer. Rodents of the present disclosure may be implanted with a tumor, followed by administration of one or more candidate therapeutics. Candidate therapeutics may include a multi-specific antibody (e.g., a bi-specific antibody) or an antibody cocktail; candidate therapeutics may include combination therapy such as, for example, administration of mono-specific antibodies dosed sequentially or simultaneously. The tumor may be allowed sufficient time to be established in one or more locations within the rodents. Tumor cell proliferation, growth, etc. may be measured both before and after administration with the candidate therapeutic(s). Cytotoxicity of candidate therapeutics may also be measured in the rodent as desired.

[0148] Rodents of the present disclosure may provide improved in vivo system elucidating mechanisms of human cell-to-cell interaction through adoptive transfer. Rodents of the present disclosure may be implanted with a tumor xenograft, followed by a second implantation of tumor infiltrating lymphocytes could be implanted in the rodents by adoptive transfer to determine the effectiveness in eradication of solid tumors or other malignancies. Such experiments may be done with human cells due to the exclusive presence of human CD47 without competition with endogenous CD47 of the rodent. Alternatively, such experiments may include the use of mouse cells from a NOD / SCID or BRG (BALB / c Rag2 - / -< IL-2Rγc - / -< ) background. Further, therapies and pharmaceuticals for use in xenotransplantation can be improved and / or developed in such rodents.

[0149] Rodents of the present disclosure may provide an improved in vivo system for maintenance and development of human hematopoietic stem cells through engraftment. Rodents of the present invention may provide improved development and maintenance of human stem cells within the rodent. Increased populations of differentiated human B and T cells may be observed in the blood, bone marrow, spleen and thymus of the rodent. Optimal T and NK cell homeostasis may be observed in cells in the blood, bone marrow, spleen and thymus of the rodent. Rodents of the present disclosure may demonstrate an increase in the level or amount of red blood cells (RBCs) as compared to one or more reference rodents.

[0150] Rodents of the present disclosure can be employed to assess the efficacy of a therapeutic drug targeting human cells. A rodent of the present disclosure may be transplanted with human cells, and a drug candidate targeting such human cells is administered to such rodent. The therapeutic efficacy of the drug is then determined by monitoring the human cells in the rodent after the administration of the drug. Drugs that can be tested in the rodents include both small molecule compounds, i.e., compounds of molecular weights of less than 1500 kD, 1200 kD, 1000 kD, or 800 daltons, and large molecular compounds (such as proteins, e.g., antibodies), which have intended therapeutic effects for the treatment of human diseases and conditions by targeting (e.g., binding to and / or acting on) human cells.

[0151] The drug may be an anti-cancer drug, and the human cells may be cancer cells, which can be cells of a primary cancer or cells of cell lines established from a primary cancer. In these instances, a rodent of the present disclosure may be transplanted with human cancer cells, and an anti-cancer drug may be given to the rodent. The efficacy of the drug can be determined by assessing whether growth or metastasis of the human cancer cells in the rodent is inhibited as a result of the administration of the drug.

[0152] The anti-cancer drug may be an antibody molecule, which binds to an antigen on human cancer cells. The anti-cancer drug may be a bi-specific antibody that binds to an antigen on human cancer cells, and to an antigen on other human cells, for example, cells of the human immune system (or "human immune cells") such as B cells and T cells.

[0153] A rodent of the present disclosure may be engrafted with human immune cells or cells that differentiate into human immune cells. Such rodent with engrafted human immune cells is transplanted with human cancer cells, and is administered an anti-cancer drug, such as a bi-specific antibody that binds to an antigen on human cancer cells and to an antigen on human immune cells (e.g., T cells). The therapeutic efficacy of the bi-specific antibody can be evaluated based on its ability to inhibit growth or metastasis of the human cancer cells in the rodent. The rodent of the present disclosure may be engrafted with human CD34 +< hematopoietic progenitor cells which give rise to human immune cells (including T cells, B cells, NK cells, among others). Human B cell lymphoma cells (e.g., Raji cells) are transplanted into such rodent with engrafted human immune cells, which is then administered with a bi-specific antibody that binds to tumor antigen (e.g., an antigen on normal B cells and certain B cell malignancies such as CD20) and to the CD3 subunit of the T cell receptor, to test the ability of the bi-specific antibody to inhibit tumor growth in the rodent.EXAMPLES

[0154] The following examples are provided so as to describe to those of ordinary skill in the art how to make and use methods and compositions of the invention, and are not intended to be limiting. Unless indicated otherwise, temperature is indicated in Celsius, and pressure is at or near atmospheric.Example 1. Humanization of an endogenous Cluster of Differentiation 47 (CD47) gene.

[0155] This example illustrates exemplary methods of humanizing an endogenous gene encoding cluster of differentiation 47 (CD47) in a rodent (e.g., a mouse). The methods described in this example can be employed to humanize an endogenous CD47 gene of a rodent using any human sequence, or combination of human sequences (or sequence fragments) as desired. In this example, a human CD47 gene that appears in bacterial artificial chromosome (BAC) clone RP11-69A17 is employed for humanizing an endogenous CD47 gene of a mouse.

[0156] A targeting vector for humanization of the genetic material encoding an extracellular N-terminal IgV domain and five transmembrane domains of an endogenous CD47 gene was constructed using VELOCIGENE ®< technology (see, e.g., U.S. Patent No. 6,586,251 and Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21(6):652-659).

[0157] Briefly, mouse bacterial artificial chromosome (BAC) clone RP23-230L20 (Invitrogen) was modified to delete the sequence containing exons 2-7 of an endogenous CD47 gene and insert exons 2-7 of a human CD47 gene using human BAC clone RP11-69A17 (Invitrogen), which encodes amino acids 16-292 of a human CD47 polypeptide. Endogenous DNA containing genomic DNA corresponding to exons 1, 8 and 9 of isoform 2 as well as the 5' and 3' untranslated regions (UTRs) were retained. Sequence analysis of the human CD47 sequence contained in BAC clone RP11-69A17 confirmed all CD47 exons and splicing signals. Sequence analysis revealed that the sequence matched the reference genome and CD47 transcripts NM_001777.3 and NM_198793.2. The genomic DNA corresponding to exons 2-7 of an endogenous CD47 gene (~30.8 kb) was replaced in BAC clone RP23-230L20 by homologous recombination in bacterial cells to insert a DNA fragment containing ~23.9 kb of genomic human DNA corresponding to exons 2-7 of a human CD47 gene from BAC clone RP11-69A17and ~4995 bp corresponding to a self-deleting neomycin cassette flanked by recombinase recognition sites (loxP-hUb1-em7-Neo-pA-mPrm1-Crei-loxP; see U.S. Patent No.'s 8,697,851, 8,518,392 and 8,354,389). The self-deleting neomycin cassette was added to the end of the ~23.9 kb human DNA fragment containing exons 2-7 of the human CD47 gene (Figure 2). The targeting vector contained, from 5' to 3', a 5' homology arm containing ~39 kb of mouse genomic DNA from BAC clone RP23-230L20, ~29.3 kb of human genomic DNA from BAC clone RP11-69A17 (containing exons 2-7 of a human CD47 gene), a self-deleting neomycin cassette flanked by loxP sites, and ~98.8 kb of mouse genomic DNA from BAC clone RP23-230L20. After homologous recombination in bacterial cells with the targeting vector described above, a modified RP23-230L20 BAC clone was created that resulted in a humanized CD47 gene which contained a mouse 5' UTR, a mouse exon 1, human exons 2-7, mouse exons 8-9 and a mouse 3'UTR. Protein sequences of four projected alternatively spliced isoforms of humanized CD47 are provided in Table 3 which indicate the resulting mouse and human amino acids encoded by the mouse and human DNA, respectively.

[0158] The modified BAC clone described above was used to electroporate F1H4 (50% 129 / S6 / SvEv / Tac, 50% C57BL / 6NTac; Auerbach, W. et al. (2000) Biotechniques 29(5):1024-8, 1030, 1032) mouse embryonic stem (ES) cells to create modified ES cells comprising an endogenous CD47 gene that is humanized from exons 2-7. Positively targeted ES cells containing a humanized CD47 gene were identified by an assay (Valenzuela et al., supra) that detected the presence of the human CD47 sequences (e.g., exons 2-7) and confirmed the loss and / or retention of mouse CD47 sequences (e.g., exons 1, 8 and 9 and / or exons 2-7). Table 4 sets forth the primers and probes that were used to confirm humanization of an endogenous CD47 gene as described above (Figure 3). The nucleotide sequence across the upstream insertion point included the following, which indicates endogenous mouse sequence upstream of the insertion point (contained within the parentheses below with an AsiSI restriction site italicized) linked contiguously to a human CD47 sequence present at the insertion point: (GCAGACATGA TTACTTCAGA GCTTTCAAAG CTAGATACTG TACCTTGCAT ATTCCAACAC) GCGATCGC ATTTTAAGAT TTTCCATCCT AGTGGAAAGA TATGATTTGA TTCATCCTAT TTACTTTGTA TATTAAAGTA CAGTAGAACC TGCCACTTTT (SEQ ID NO: 33). The nucleotide sequence across the downstream insertion point at the 5' end of the self-deleting neomycin cassette included the following, which indicates human CD47 genomic sequence contiguous with cassette sequence downstream of the insertion point (contained within the parentheses below with loxP sequence italicized): GGATCCATTT TAAGTAATAG AATAGGATTT TTAATTGTTC CAGTGTTTCT GTGATAGAGC TGTCCTGCAC AGACCTGTTT (CTCGAGATAA CTTCGTATAA TGTATGCTATACGAAGTTAT ATGCATGGCC TCCGCGCCGG GTTTTGGCGC CTCCCGCGGG) (SEQ ID NO: 34). The nucleotide sequence across the downstream insertion point at the 3' end of the neomycin cassette included the following, which indicates cassette sequence contiguous with mouse genomic sequence 3' of exon 7 of an endogenous CD47 gene (contained within the parentheses below with loxP sequence italicized): CATGTCTGGA ATAACTTCGT ATAATGTATG CTATACGAAG TTATGCTAGT AACTATAACG GTCCTAAGGT AGCGACTAGC (ATTAGTATGG AAGGTCCGTC CACTGTCCAG GTTCCTCTTG CGGAGCTCTT TGTCTCTCTG GACTCTGTAT ACACTGCTTG) (SEQ ID NO: 35). The nucleotide sequence across the downstream insertion point after deletion of the neomycin cassette (76 bp remaining) included the following, which indicates human and mouse genomic sequence juxtaposed with remaining cassette sequence loxP sequence (contained within the parentheses below with loxP sequence italicized): GGATCCATTT TAAGTAATAG AATAGGATTT TTAATTGTTC CAGTGTTTCT GTGATAGAGC TGTCCTGCAC AGACCTGTTT (CTCGAGATAA CTTCGTATAA TGTATGCTAT ACGAAGTTAT GCTAGTAACT ATAACGGTCC TAAGGTAGCG ACTAGC)ATT AGTATGGAAG GTCCGTCCAC TGTCCAGGTT CCTCTTGCGG AGCTCTTTGT CTCTCTGGAC TCTGTATACA CTGCTTGCAT (SEQ ID NO: 36).

[0159] Positive ES cell clones were then used to implant female mice using the VELOCIMOUSE ®< method (see, e.g., U.S. Pat. No. 7,294,754 and Poueymirou et al., F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses, 2007, Nature Biotech. 25(1):91-99) to generate a litter of pups containing an insertion of exons 2-7 of a human CD47 gene into an endogenous CD47 gene of a mouse. Mice bearing the humanization of exons 2-7 of an endogenous CD47 gene were again confirmed and identified by genotyping of DNA isolated from tail snips using a modification of allele assay (Valenzuela et al., supra) that detected the presence of the human CD47 gene sequences. Pups are genotyped and cohorts of animals heterozygous for the humanized CD47 gene construct are selected for characterization. TABLE 4 Name Primer Sequence (5'-3') ForwardTGCAGAAGTCACTAGGAGGAAT(SEQ ID NO:21)7190mTUProbe(SEQ ID NO:22)ReverseGTGCCAGACTCACTTTCTATCCA(SEQ ID NO:23)ForwardTGCTGCCAATATACGGCTTCTG(SEQ ID NO:24)7190mTDProbe(SEQ ID NO:25)ReverseTCAAGCAGAGCCTGGTTATCTG(SEQ ID NO:26)ForwardGTCGTCATTCCATGCTTTGTTAC(SEQ ID NO:27)7190hTUProbe(SEQ ID NO:28)ReverseGGACAGTGGACTTGTTTAGAGC(SEQ ID NO:29)ForwardGGCTTGGTGGCTGATTGTTCT(SEQ ID NO:30)7190hTDProbe(SEQ ID NO:31)ReverseTGGGAACTGGTGTTTCAAGTCTA(SEQ ID NO:32) Example 2. Expression of humanized CD47 polypeptide by mouse red blood cells.

[0160] This Example demonstrates that rodents modified to contain a humanized CD47 gene according to Example 1 can be used to screen CD47 modulators (e.g., anti-CD47 antibodies) and determine various characteristics such as, for example, pharmacokinetics and safety profiles. In this Example, several anti-CD47 antibodies are screened on mouse red blood cells (RBCs) isolated from rodents made in accordance with Example 1, which rodents express a humanized CD47 polypeptide as described herein.

[0161] Briefly, 2 mL of whole blood from humanized CD47 mice (n=2) was transferred to a 15 mL tube and centrifuged at 200xg for 10 minutes at 4°C. The plasma and buffy coat were aspirated and then 15 mL of PBS was added and the cells were mixed gently. The mixture was centrifuged again at 200xg for five minutes at 4°C. The supernatant was aspirated and the cells were washed two additional times. Pelleted RBCs were resuspended to a final volume in 10 mL of PBS. The resuspended RBCs were centrifuged a final time at 200xg for 10 minutes at 4°C. The volume of packed RBCs was estimated 0.5 mL and diluted to a concentration of 0.5% with PBS (0.5 mL packed RBC / 100 mL PBS). Actual RBC concentration was determined with a Cellometer Auto T4 (1.5x10 7< / mL; Nexcelom Bioscience).

[0162] Eighty (80) µL of 0.5% mouse RBCs were added to each well of a 96-well V-bottom plate. Anti-CD47 antibodies were added into each well (20 µL at 33 nM). The plate was gently tapped to mix and incubated on ice for 30 minutes. The plate was then washed twice with staining buffer (PBS with 2% FBS). Secondary antibody Fab-488 (Alexa Fluor 488-conjugated AffiniPure mouse anti-human IgG, F(ab') 2 fragment specific, Jackson Immuno Research) was added to each well at a concentration of 10 µg / mL. The plate was incubated again on ice for 30 minutes, followed by washing once with staining buffer. The cells in each well were resuspended in 200 µL of staining buffer and filtered through a 96-well filter plate. The cells in the plate were analyzed using the BD ACCURI ™< C6 system (BD Biosciences). Exemplary results are shown in Figure 4. The mean fluorescence intensity (MFI) above isotype control for each tested antibody is shown in Table 5. TABLE 5 AntibodyMFIFold above isotype controlAb A, hIgG4s28898258Ab B, hIgG4s27545246Ab C, hIgG4s24620220Ab D, hIgG129882267Ab E, hIgG433423298Control, hIgG4s112-Control, hIgG4112-hIgG4s: human IgG4 with modified Fc region that has reduced effector function

[0163] As shown in Figure 4, all anti-CD47 antibodies bound to RBCs from humanized CD47 mice. Taken together, this Example demonstrates that (1) rodents engineered to contain a humanized CD47 gene as described herein express a humanized CD47 polypeptide on the surface of cells (e.g., RBCs) of the rodent, and (2) such cells are useful for screening CD47 modulators (e.g., CD47 antibodies) and determining the pharmacokinetic profiles of such modulators.Example 3. Hemagglutination of mouse red blood cells expressing humanized CD47 polypeptide.

[0164] This Example further demonstrates that rodents modified to contain a humanized CD47 gene according to Example 1 can be used in various assays (e.g., hemagglutination assay) to screen CD47 modulators (e.g., anti-CD47 antibodies) and determine various characteristics such as, for example, pharmacokinetics and safety profiles. In this Example, several anti-CD47 antibodies are screened on mouse red blood cells (RBCs) that express a humanized CD47 polypeptide as described herein to determine antibody concentration that promotes hemagglutination.

[0165] Briefly, RBCs from wild-type and humanized CD47 mice (n = 2) were prepared as described in Example 2. Twenty (20) µL of anti-CD47 antibody (at 5-fold serial dilution) was added into wells 1-12 across a 96-well V-bottom plate followed by the addition of 80 µL of 0.5% mouse RBCs to all wells of the plate. The plates were tapped gently to mix and incubated at room temperature (24-27°C) for 30 minutes. Agglutination endpoint was observed visually (i.e., RBCs settle to the bottom in negative samples, while RBCs agglutinate in positive samples). Exemplary results are shown in Figure 5, with boxes to outline the wells that show hemagglutination.

[0166] As shown in Figure 5, only lectin caused agglutination in wild-type mice. However, two anti-CD47 antibodies (Ab E and Ab C) in addition to lectin induced agglutination in RBCs from two humanized CD47 rodents made according to Example 1. The concentration at which these two antibodies induced agglutination started from 11 nM. Taken together, this Example demonstrates that rodents engineered to contain a humanized CD47 gene as described herein can be used to assess one or more properties (e.g., hemagglutination) of CD47 modulators (e.g., CD47 antibodies).Example 4. Pharmacokinetic clearance of CD47 modulators in humanized CD47 rodents.

[0167] This Example illustrates a method of assessing the pharmacokinetic clearance of CD47 modulators (e.g., anti-CD47 antibodies) in rodents modified to contain a humanized CD47 gene according to Example 1. In this Example, wild-type and humanized CD47 rodents (e.g., mice) were administered anti-CD47 antibodies and serum levels of antibodies were determined using an ELISA assay.

[0168] Briefly, wild-type (n=5) or mice homozygous for humanized CD47 (n=5; as described above) were administered four anti-CD47 antibodies (Ab F, Ab G,Ab Hand Ab I) and an IgG4s isotype control antibody (IgG4s). The genetic background of the mice were 75% CD57BL / 6 and 25% 129Sv. Each antibody was tested in five humanized CD47 rodents. All antibodies were administered subcutaneously at a dose of 50 mg / kg. One pre-bleed was collected one day prior to administration of antibody (day 0). Post-injection bleeds were collected at 6 hours, 1 day, 2 days, 3 days, 4 days, 7 days, 10 days and 14 days. Serum fractions from bleeds were separated and subjected to total human antibody analysis using an ELISA immunoassay.

[0169] Briefly, a goat anti-human IgG polyclonal antibody (Jackson ImmunoResearch) was coated onto 96-well plates to capture the tested human antibodies in the sera, and then plate bound antibodies were detected using a goat anti-human IgG polyclonal antibody conjugated with horseradish peroxidase (Jackson ImmunoResearch) and TMB substrate (BD Pharmingen). The serum samples were in six-dose serial dilutions and reference standards of the respective antibodies in 12-dose serial dilutions. Drug antibody concentrations in the sera were calculated based on the reference standard curve generated using Graphpad Prism software. Exemplary results are shown in Figure 6 and Table 6.

[0170] The data demonstrated that the antibodies administered to wild-type and humanized mice as described herein were well tolerated. Taken together, this Example demonstrates that rodents described herein can be used to assess one or more pharmacokinetic properties of a drug targeting CD47 (e.g., an anti-CD47 antibody) such as, for example, circulating drug levels. Moreover, rodents described herein can be used to assess the toxicity of a drug targeting CD47 by determining adverse effects after administration. TABLE 6 Serum antibody concentrations (µg / mL ± SEM) Antibody 6 hour Day 1 Day 2 Day 3 Day 4 Day 7 Day 10 Ab F116.7±14.0196.4±10.696.0±13.324.7±7.03.7±0.42<0.35<0.35Ab G115.0±22.1198.8±23.4118.4±20.948.3±16.02.9±1.97<0.35<0.35Ab H64.5±3.85108.0±5.1332.0±6.081.0±0.20.4±0.030.06±0.030.05±0.02Ab I51.1±16.6115.2±14.863.8±8.311.1±4.20.5±0.10.1±0.02<0.35IgG4sIsotype control458.2±34.4702.5±32.3616.6±27.0567.1±39.5488.9145.0357.0±51.1307.6±61.1 Example 5. Pharmacokinetic profiles of CD47 modulators in humanized CD47 / SIRPα rodents.

[0171] This Example illustrates a method of assessing the pharmacokinetic clearance of CD47 modulators (e.g., anti-CD47 antibodies) in rodents modified to contain humanized CD47 (according to Example 1) and SIRPα genes. In particular, humanized CD47 rodents described herein were modified to further contain a humanized SIRPα gene that contains an endogenous portion and a human portion, which human portion encodes the extracellular domain of a human SIRPα protein (e.g., amino acids 28-362 of a human SIRPα protein) and which endogenous portion encodes an intracellular domain of an endogenous SIRPα protein (e.g., amino acids encoding transmembrane and intracellular portions of a murine SIRPα protein) as described in PCT / US14 / 56910, filed September 23, 2014. Double humanized CD47 / SIRPα mice were made by breeding humanized SIRPα mice to humanized CD47 mice. In this Example, double humanized CD47 / SIRPα rodents (e.g., mice) were administered various anti-CD47 antibodies and their corresponding pharmacokinetic profiles were determined.

[0172] Briefly, groups of wild type (n=5) and mice homozygous for humanized CD47 and SIRPα genes (CD47 hu / hu< SIRPα hu / hu< ; n=5 per group) were administered selected anti-CD47 antibodies and an IgG4 isotype control antibody (hIgG4s). The genetic background of the mice were 75% CD57BL / 6 and 25% 129Sv. All antibodies were administered in a single subcutaneous dose of 50 mg / kg. One pre-bleed was collected one day prior to administration of antibody (day 0). Post-injection bleeds were collected at 6 hours, 1 day, 2 days, 3 days, 4 days, 7 days and 10 days. Serum fractions from bleeds were separated and subjected to total human antibody analysis using an ELISA immunoassay (described above). Additionally, hematocrit levels were measured at 6 hours, 1 day, 2 days, 3 days, 4 days, 7 days and 10 days and a urine test was performed as needed (at 6 hours and when urine color deviated from yellow color) to determine red blood cell counts. Exemplary results are shown in Figures 7-9.

[0173] As shown in Figures 7 and 8, all anti-CD47 antibodies demonstrated target-mediated clearance in CD47 hu / hu< SIRPα huhu< mice and, in particular, many demonstrated similar pharmacokinetic profiles. Further, a monovalent version of one anti-CD47 antibody (Ab F) demonstrated greater bioavailability than its bivalent equivalent (Figure 8). The inventors observed similar pharmacokinetic profiles for the antibodies among multiple experiments with humanized CD47 and double humanized animals (i.e., CD47 hu / hu< SHIPα hu / hu< mice).

[0174] Ab J had less of an effect on hematocrit levels than other anti-CD47 antibodies tested (Ab F, Ab G, Ab I, etc.) and comparable changes in hematocrit levels to control (hIgG4s) in CD47 hu / hu< SIRPα hu / hu< mice. Measurements of hematocrit on days 2-4 showed the largest drop from normal range (~38.5-45.1%), which included groups administered Abs F, G and I. In particular, a monovalent form of Ab F demonstrated a delayed lowering effect on hematocrit as compared to other antibodies tested. The inventors reasoned that differences in hematocrit levels among the various treatment groups could be attributed to a difference in epitope recognized by the various antibodies. Also, mice dosed with selected anti-CD47 antibodies demonstrated positive urine dipstick tests for heme at 6 hours. For example, Ab J and Ab F treatment groups each had one mouse positive for heme on day 1, while all other timepoints were negative. No significant weight loss (>20%) was observed in any treatment group.

[0175] Taken together, this Example demonstrates that rodents of the present invention provide an in vivo system for assessing the pharmacokinetic properties and / or profiles of one or more drugs targeting CD47 (e.g., one or more anti-CD47 antibodies) such as, for example, circulating drug levels. Moreover, rodents as described herein engineered to further contain other humanized genes (e.g., humanized SIRPα) can be used to assess the target-mediated clearance of one or more drugs targeting CD47.EQUIVALENTS

[0176] Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated by those skilled in the art that various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the scope of the invention. Accordingly, the foregoing description and drawing are by way of example only and the invention is defined by the claims that follow.

[0177] Use of ordinal terms such as "first," "second," "third," etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements.

[0178] The articles "a" and "an" as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes aspects in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure also includes aspects in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where elements are presented as lists, (e.g., in Markush group or similar format) it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the disclosure, is / are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the disclosure consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth in so many words herein. It should also be understood that any aspect of the disclosure can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification.

[0179] Those skilled in the art will appreciate typical standards of deviation or error attributable to values obtained in assays or other processes described herein.

Claims

1. An isolated rodent embryonic stem (ES) cell, (i) where the genome of the rodent ES cell comprises a humanized CD47 gene, wherein the humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene, and wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter; (ii) wherein the genome of the rodent ES cell further comprises a SIRPα gene that encodes a SIRPα polypeptide comprising the extracellular domain of a human SIRPα polypeptide and the intracellular domain of an endogenous rodent SIRPα polypeptide, and wherein the SIRPα gene comprises exons 1, 5, 6, 7 and 8 of an endogenous rodent SIRPα gene and exons 2-4 of a human SIRPα gene; and (iii) wherein the rodent ES cell is a mouse ES cell or a rat ES cell.

2. The rodent ES cell of claim 1, wherein the humanized CD47 gene is formed from a replacement of a genomic fragment comprising exons 2-7 of an endogenous rodent CD47 gene at an endogenous rodent CD47 locus, with a genomic fragment comprising exons 2-7 of the human CD47 gene.

3. The rodent ES cell of claim 1 or 2, wherein the genomic fragment comprising exons 2-7 of a human CD47 gene encodes a polypeptide comprising an amino acid having at least 98% identity with the amino acid sequence as set forth in amino acids 16-292 of SEQ ID NO: 10.

4. A rodent embryo comprising the rodent ES cell according to any one of claims 1-3.

5. A method comprising: (a) providing rodent cells whose genome comprises a humanized CD47 gene, wherein the humanized CD47 gene encodes a humanized CD47 polypeptide which comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene, wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter, and wherein the rodent cells are mouse cells or rat cells; (b) incubating the rodent cells of step (a) with a labeled substrate; and (c) measuring phagocytosis of the labeled substrate by the rodent cells of step (b).

6. The method of claim 5, wherein the humanized CD47 gene is formed from a replacement of a genomic fragment comprising exons 2-7 of an endogenous rodent CD47 gene at an endogenous rodent CD47 locus, with a genomic fragment comprising exons 2-7 of the human CD47 gene.

7. The method of claim 5 or 6, wherein the substrate is fluorescently labeled.

8. The method of claim 5 or 6, wherein the substrate is labeled with an antibody.

9. The method of claim 5 or 6, wherein the substrate is one or more red blood cells, one or more bacterial cells, or one or more tumor cells.

10. A method comprising: (a) providing a rodent whose genome comprises a humanized CD47 gene wherein the humanized CD47 gene encodes a humanized CD47 polypeptidewhich comprises a portion of a human CD47 polypeptide, and an intracellular portion of a rodent CD47 polypeptide, wherein the portion of the human CD47 polypeptide comprises the extracellular domain and the transmembrane domains of the human CD47 polypeptide, and is encoded by exons 2-7 of a human CD47 gene, wherein the intracellular portion of the rodent CD47 polypeptide is encoded by the exons downstream of exon 7 of a rodent CD47 gene, wherein the humanized CD47 gene is operably linked to an endogenous rodent CD47 promoter, and wherein the rodent is a mouse or a rat; (b) exposing the rodent to an antigen; and (c) measuring phagocytosis of the antigen by one or more cells of the rodent.

11. The method of claim 10, wherein the humanized CD47 gene is formed from a replacement of a genomic fragment comprising exons 2-7 of an endogenous rodent CD47 gene at an endogenous rodent CD47 locus, with a genomic fragment comprising exons 2-7 of the human CD47 gene.

12. The method of claim 10 or 11, wherein the step of exposing comprises exposing the rodent to an antigen that is fluorescently labeled.

13. The method of claim 10 or 11, wherein the step of exposing comprises exposing the rodent to one or more cells that comprise the antigen.

14. The method of claim 10 or 11, wherein the step of exposing comprises exposing the rodent to one or more human cells comprising the antigen or to one or more bacterial cells comprising the antigen.

15. The method of claim 10 or 11, wherein the step of exposing comprises exposing the rodent to one or more tumor cells that comprise the antigen.