Small molecule-inducible gene expression switches

Abstract

Provided herein, in some embodiments, are nucleic acid constructs encoding therapeutic nucleic acids (e.g., miRNAs) of interest comprising one or more alternatively-spliced exons that regulate the expression of proteins or RNAs of interest. Such constructs may in some embodiments be useful for delivery in a recombinant viral vector.

Description

[0001] SMALL. MOLECULE-INDUCIBLE GENE EXPRESSION SWITCHES

[0002] RELATED APPLICATIONS

[0003] The application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application number 63 / 373,451 filed August 24, 2022, which is incorporated by reference herein in its entirety.

[0004] BACKGROUND

[0005] Recombinant viruses (e.g., recombinant adeno-associated viruses (AAV) and recombinant lentiviruses, etc.) can be used to express therapeutic proteins (i.e., therapeutic cargoes) in patients as a form of genetic therapy. Controlling expression of therapeutic cargoes can enhance treatment outcomes in patients.

[0006] GOVERNMENT SUPPORT

[0007] This invention was made with government support under Grant Number R01 NS 112291, awarded by the National Institutes of Health. The government has certain rights in the invention.

[0008] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0009] The contents of the electronic sequence listing (U119670102WO00-SEQ-PRW. xml; Size: 2,846,842 bytes; and Date of Creation: August 23, 2023) is herein incorporated by reference in its entirety.

[0010] SUMMARY OF THE INVENTION

[0011] Aspects of the application relate to recombinant nucleic acids containing a transgene comprising a ligand-responsive alternatively spliced exon that controls expression of an mRNA (e.g., encoding a protein of interest) or a functional RNA (e.g., a regulatory' RNA) encoded by the transgene. In some embodiments, the recombinant nucleic acids are delivered to a host cell (e.g., ex vivo or in vivo). In some embodiments, a host cell nucleic acid (e.g., one or more genomic alleles) is edited to introduce a ligand-responsive alternatively spliced exon into a naturally occurring gene. In some aspects, ligand-responsive alternative splicing is used to regulate AAV-delivered gene expression. In some embodiments, ligand-responsive alternative splicing can confer greater control of therapeutic cargoes and also potentially avoid potential toxicides from constitutive over-expression of therapeutic cargoes. Previous aptazyme-based approaches lack modularity and has leaky, non-zero basal expression. Other efforts using drug-responsive alternative splicing patterns to control AAV-mediated gene expression potentially affect many other cryptic splice sites and are restricted to a single specific molecule.

[0012] Aspects of the present invention relate to the use of alternative splicing switches in mammalian cells and sequence designs that allow for ligand-inducible regulation of gene expression or knockdown. The approach uses rational design, coupled to deep sequencing, to characterize behavior of hundreds to thousands of synthetic intron / exon cassettes. Several riboswitch designs that facilitate small molecule-mediated regulation of alternative splicing and multiple sequence variants are described. Unlike switches that promote exon inclusion this design promotes exon skipping upon drug induction. These designed switches can dynamically regulate protein isoforms, protein expression levels, and production of RNA interference triggers. This approach is termed SPlicing by Ligand Induction for Controllable Expression based on Riboswitch (SPLICER). The designs are compact in size and promoter-independent., making them useful regulatory' tools that can be incorporated into gene expression cassettes for basic and translational applications. In turn, the designs can be useful for controlling the expression patterns (e.g., timing of expression by addition of a ligand) of therapeutically useful genes.

[0013] In some embodiments, polynucleotides of the present disclosure comprise a ligand- responsive sequence. In some embodiments, the polynucleotide is a transgene, such as one comprising a cassette which is responsive to certain ligands. To this end, the cassettes comprise ligand-responsive sequences which regulate alternative splicing. For example, cassettes may comprise ligand-responsive aptamers that can bind to exogenous or endogenous ligands which results in conformational changes in the transcript of the transgene that effects splicing patterns. In some embodiments, transgenes of the present disclosures are provided in vectors. In some embodiments, the transgenes are provided in recombinant viral genomes that can be provided in AAV particles. In this manner, the splicing of the transgenes and the expression of different isoforms of the transgenes can be expressed in specific tissues in a chemically-inducible manner. In some aspects, the present disclosure relates to a polynucleotide comprising a transgene, wherein the transgene comprises at least one alternatively spliced exon, at least two introns flanking the alternatively spliced exon, and a ligand-responsive aptamer, wherein the presence of the ligand results in splicing out the at least one alternative exon and the ligand- responsive aptamer along with the introns.

[0014] Aspects of the present disclosure relate to the observation that alternatively-spliced exons may be used in the context of viral vectors (e.g., AA V viral vectors or lentivirus viral vectors) to effectively regulate the expression of a coding region of interest (e.g., a coding region of a transgene that encodes a therapeutic protein). In certain embodiments, the alternatively-spliced exons regulate a coding region of interest in a condition-responsive manner. / \s used herein, “condition-responsive manner” means that the alternatively-spliced exon regulates the expression of a coding region of interest in a manner that is controlled or influenced by one or more conditions, including, but not limited to, environmental conditions, intracellular conditions, extracellular conditions, type of cell (e.g, liver versus kidney cell), gene expression pattern, or disease state. Accordingly, the present disclosure relates to a new approach for regulating expressi on of a coding region of interest (e.g, a coding region of a transgene that encodes a therapeutic protein) from recombinant viral vectors, optionally in a condition-responsive manner, by coupling the expression of a coding region of interest with an alternatively-spliced exon. The present disclosure describes a variety of exemplary configurations and methods of coupling the expression of a coding region of interest (or multiple portions of coding regions) with an alternatively-spliced exon, but any suitable arrangement or configuration is contemplated so long as the expression of the coding region of interest (e.g., a coding region of a transgene that encodes a therapeutic protein) is configured to come under regulatory control of an alternatively- spliced exon.

[0015] In some embodiments, aspects of the present disclosure relate a polynucleotide comprising a sequence encoding a ligand-responsive sequence, wherein the polynucleotide is capable of being alternatively spliced in the presence of a ligand to produce a first RNA or a second RNA. In some embodiments, the polynucleotide comprises an alternative exon operably linked to the ligand-responsive sequence. In some embodiments, the first RNA comprises the alternative exon, wherein the second RNA does not comprise the alternative exon. In some embodiments, the first RNA encodes a long isoform of an RNA of interest and / or the second RNA encodes a short isoform of the RNA of interest.

[0016] In some embodiments, the first RNA encodes an RNA of interest. In some embodiments, the first RNA is not operably linked to a pre-mature stop codon (e.g., does contain a pre-mature stop codon). In some embodiments, the first RNA is operably linked to a start codon (e.g., contains a start codon).

[0017] In some embodiments, the second RNA encodes an RNA of interest. In some embodiments, the second RNA is not operably linked to a pre-mature stop codon (e.g., does not contain a pre-mature stop codon). In some embodiments, the second RNA is operably linked to a start codon (e.g., contains a start codon).

[0018] In some embodiments, the RNA of interest is an interfering RNA. In some embodiments, RNA of interest is a microRNA. In some embodiments, second RNA encodes the microRNA. In some embodiments, the RNA of interest encodes a protein. In some embodiments, the RNA of interest encodes a CRISPR / Cas nuclease or a guide RNA (gRNA). In some embodiments, the RNA of interest encodes a therapeutic RNA and / or a therapeutic protein.

[0019] In some embodiments, the ligand-responsive sequence is a risdiplam-responsive sequence or a branaplam-responsive sequence. In some embodiments, the alternative exon comprises a first portion of the risdiplam-responsive sequence and an intron downstream of the alternative exon comprises a second portion of the risdiplam-responsive sequence. In some embodiments, the first portion of the risdiplam-responsive sequence comprises a WGA sequence and the second portion of the risdiplam-responsive sequence comprises a GTAAGW sequence. In some embodiments, the alternative exon further comprises a AGGAAG sequence which is 5’ to the WGA sequence.

[0020] In some embodiments, the alternative exon further comprises an upstream sequence which is 5’ to the AGGAAG sequence. In some embodiments, the upstream sequence comprises at least 10 nucleotides. In some embodiments, the alternative exon further comprises a downstream sequence which is 3’ to the AGGAAG sequence and 5’ to the WGA sequence. In some embodiments, the downstream sequence comprises at least 6 nucleotides. In some embodiments, the risdiplam-responsive sequence comprises NNNNNNNNNNAGGAAGNNNNNNNNNNAWGAGTAAGW (SIR.) ID NO: 2183), wherein N is any nucleotide and W is A or T. In some embodiments, the risdiplam-responsive sequence comprises YWWKWWWMKYAGGAAGYTAKTWGTTAWGAGTAAGW (SEQ ID NO:

[0021] 2184) or YWWKWWWMKYAGGAAGYTAKTRWGTTAWGAGTAAGW (SEQ ID NO:

[0022] 2185), wherein Y is C or T, K is G or T, W is A or T, M is A or C, and R is A or G. In some embodiments, the risdiplam-responsive sequence comprises

[0023] ATRTCC ACTYAA AAAAATCTGGCGATGGG AGC AGA AWGAGT A AGW (SEQ ID NO :

[0024] 2186), wherein R is A or G, Y is C or T, and W is A or T.

[0025] In some embodiments, the branaplam-responsive sequence comprises ATTTAACATTTTTGAGTCAATCCAAGTAATGCAGGAGGTTCATGATTGTGTAGA (SEQ ID NO: 2187).

[0026] In some embodiments, the ligand-responsive sequence is a tetracycline-responsive sequence. In some embodiments, the tetracycline-responsive sequence is located in a tetracycline-responsive aptamer comprising the sequence TAAAACATACCWDMCGKAAMCGKHWGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2188), wherein W is A or T, wherein D is A, G, or T, wherein M is A or C, wherein K is G or T, and wherein H is A, C, or T.

[0027] In some embodiments, the polynucleotide comprises, from 5’ to 3’, an upstream 3' splice site, a first stem region, a 5' splice site reverse complementary sequence, the tetracyclineresponsive sequence, a 5' splice site, a sequence comprising GT, the second stem region, and a downstream 3’ splice site. In some embodiments, the upstream 3’ splice site is at least 20 nucleotides long and the two nucleotides at the 3’ end are AG. In some embodiments, the downstream 3’ splice site is at least 20 nucleotides long. In some embodiments, the first stem region and the second stem region are at least 2 nucleotides long. In some embodiments, the 5’ reverse complementary sequence and the 5’ splice site are at least 7 nucleotides long.

[0028] In some embodiments, polynucleotides of the present disclosure are transgenes.

[0029] In some embodiments, for example, the present disclosure relates to a polynucleotide comprising a transgene, wherein the transgene comprises: at least one alternative exon, at least two introns flanking the alternative exon, and a ligand-responsive aptamer, wherein the presence of the ligand results in splicing out the alternative exon, the at least two introns, and the ligand- responsive aptamer from the transgene.

[0030] In some embodiments, wherein the at least one alternative exon and the at least two introns are from the same gene. In some embodiments, wherein the alternative exon and the at ieast two introns are from different genes.

[0031] In some embodiments, wherein the transgene further comprises two exons flanking the alternative exon, the at least two introns, and the ligand-responsive aptamer comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity7, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0032] In some embodiments, wherein the transgene further comprises two exons flanking the alternative exon, the at least two introns, and the ligand-responsive aptamer comprising a polynucleotide have a nucleic acid sequence set forth as in SEQ ID NO: 2081 , 2089, 2092, 2097, 2135, 2142, or 2143.

[0033] In some embodiments, wherein the alternative exon comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, 2137, 2236, or 2247-2256.

[0034] In some embodiments, wherein the alternative exon comprises a polynucleotide have a nucleic acid sequence set forth as in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 21 14, 2137, 2236, or 2247-2256.

[0035] In some embodiments, wherein at least one of the introns comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

[0036] In some embodiments, wherein at least one of the introns comprise a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 21 18, 2121 , 2127, 2129, 2130, or 2141.

[0037] In some embodiments, wherein at least one of the exons comprise a polynucleotide having a nucleic acid sequence from a microRNA (miRNA) gene, optionally wherein the miRNA gene is a miRNA- 16 2 gene. In some embodiments, wherein the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2281 .

[0038] In some embodiments, wherein the transgene comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2281.

[0039] In some embodiments, wherein the ligand-response aptamer comprises a polynucleotide comprising a nucleic acid sequence that is 20-60 nucleotides in length.

[0040] In some embodiments, wherein the ligand-responsive aptamer comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2086, 2095, 2112, or 2187-2189.

[0041] In some embodiments, wherein the ligand-responsive aptamer comprises a polynucleotide having at nucleic acid sequence as set forth in either SEQ ID NO: 2086, 2095, 21 12, or 2187-2189.

[0042] In some embodiments, wherein the ligand-responsive aptamer binds to tetracycline.

[0043] In some embodiments, wherein the ligand-responsive aptamer is located in the intron downstream of the alternative exon.

[0044] In some embodiments, wherein the ligand-responsive aptamer is located in the intron upstream of the alternative exon.

[0045] In some embodiments, wherein the ligand-responsive aptamer is located in the alternative exon .

[0046] In some embodiments, wherein the ligand-responsive aptamer in the intron downstream of the alternative exon.

[0047] In some embodiments, wherein the transgene comprises a 3' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239 and a 5' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of Tables 7, 25, 26, or 34.

[0048] In some embodiments, wherein the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 21 12, 2116, 2118, 2120, 2123, 2128, 2131 , 2132, 2138, or 2183-2260.

[0049] In some embodiments, wherein the transgene comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 21 10, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

[0050] In some embodiments, a vector comprises the transgene.

[0051] In some embodiments, wherein the vector is a plasmid.

[0052] In some embodiments, a cell comprises the vector.

[0053] In some embodiments, wherein the cell is a mammalian cell.

[0054] In some embodiments, wherein the cell is a human cell or cell from a human subject.

[0055] In some embodiments, a recombinant viral genome comprises the transgene.

[0056] In some embodiments, wherein the recombinant viral genome is a genome from a recombinant adeno-associated virus (rAAV).

[0057] In some embodiments, wherein the transgene is flanked by AAV inverted terminal repeat (ITR) sequences.

[0058] In some embodiments, wherein the AAV ITR sequences are AAV2 ITR sequences.

[0059] In some embodiments, wherein the recombinant viral genome comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, or 2138.

[0060] In some embodiments, wherein the recombinant viral genome comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

[0061] In some embodiments, an rAAV particle comprises the recombinant viral genome.

[0062] In some embodiments, wherein the rAAV particle comprises AAV serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or AAV derivative or pseudotype AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y73 IF), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHlO, AAV2 (Y~>F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. In some embodiments, further comprising at least one helper plasmid.

[0063] In some embodiments, wherein the helper plasmid comprises a rep gene and a cap gene.

[0064] In some embodiments, wherein the rep gene encodes Rep78, Rep68, Rep52, or Rep40, and / or wherein the cap gene encodes a VP1, VP2, and / or VP3 region of the viral capsid protein.

[0065] In some embodiments, wherein the rAAV particle comprises two helper plasmids.

[0066] In some embodiments, wherein the first helper plasmid comprises a rep gene and a cap gene and the second helper plasmid comprises a El a gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.

[0067] In some embodiments, the present disclosure relates to a method of treating a disease or condition in a subject comprising administering the recombinant viral genome or the rAAV particle. In some embodiments, wherein the subject is a mammal.

[0068] In some embodiments, wherein the mammal is a human.

[0069] In some embodiments, wherein the recombinant viral genome or rAAV particle is administered to the subject at least one time.

[0070] In some embodiments, wherein the viral genome or rAAV particle is administered to the subject 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.

[0071] In some embodiments, wherein the viral genome or rAAV particle is administered to the subject parenterally, subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro-ventricularly, intramuscularly, intrathecally (IT), intraci st ernally, intraperitoneally, enterally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs.

[0072] In some embodiments, the present disclosure relates to a method of regulating the expression of a transgene in a subject comprising administering to a subject a polynucleotide comprising the transgene comprising at least one alternative exon, at least two introns flanking the alternative exon, and a ligand-responsive aptamer, and a ligand, wherein the presence of the ligand results in splicing out the alternative exon, the at least two introns, and the ligand- responsive aptamer from the transgene.

[0073] In some embodiments, wherein the transgene further comprises two exons flanking the alternative exon, the at least two introns, the ligand-responsive aptamer comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0074] In some embodiments, wherein the transgene further comprises two exons flanking the alternative exon, the at least two introns, and the ligand-responsive aptamer comprising a polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0075] In some embodiments, wherein the transgene comprises a polynucleotide having a nucleic acid sequence from a microRNA (miRNA) gene, optionally wherein the miRNA gene is a miRNA-16 2 gene.

[0076] In some embodiments, wherein the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2281 .

[0077] In some embodiments, wherein the transgene comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2281.

[0078] In some embodiments, wherein the at least one alternative exon comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, or 2137.

[0079] In some embodiments, wherein the at least one alternative exon comprise a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, or 2137.

[0080] In some embodiments, wherein at least one of the introns comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

[0081] In some embodiments, wherein at least one of the introns comprise a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

[0082] In some embodiments, wherein the ligand-responsive aptamer comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2086, 2095, 2112, or 2187-2189.

[0083] In some embodiments, wherein the ligand-responsive aptamer comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NOs: 2086, 2095, 2112, or 2187-2189.

[0084] In some embodiments, wherein the transgene comprises a 3' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239 and a 5' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of Tables 7, 25, 26, or 34.

[0085] In some embodiments, wherein the ligand is tetracycline.

[0086] In some embodiments, wherein the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 21 11, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

[0087] In some embodiments, wherein the transgene comprises a polynucleotide having a nucleic acid sequence set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

[0088] In some embodiments, wherein the transgene is provided in a recombinant viral genome.

[0089] In some embodiments, wherein the recombinant viral genome is a genome from a recombinant adeno-associated virus (rAAV).

[0090] In some embodiments, wherein the transgene is flanked by AAV inverted terminal repeat (ITR) sequences.

[0091] In some embodiments, wherein the AAV ITR sequences are AAV2 ITR sequences.

[0092] In some embodiments, wherein the recombinant viral genome comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 21 12, 2116, 21 18, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260. In some embodiments, wherein the recombinant viral genome comprises a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 21 12, 2116, 2118, 2120, 2123, 2128, 2131 , 2132, 2138, or 2183-2260.

[0093] In some embodiments, wherein the recombinant viral genome is provided in a an rAAV particle.

[0094] In some embodiments, wherein the rAAV particle comprises AAV serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or AAV derivative or pseudotype AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y73 IF), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2 (Y~»F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.

[0095] In some embodiments, wherein the rAAV particle further comprises at least one helper plasmid.

[0096] In some embodiments, wherein the helper plasmid comprises a rep gene and a cap gene.

[0097] In some embodiments, wherein the rep gene encodes Rep78, Rep68, Rep52, or Rep40, and / or wherein the cap gene encodes a VP1, VP2, and / or VP3 region of the viral capsid protein.

[0098] In some embodiments 71 , wherein the rAAV'' particle comprises two helper plasmids.

[0099] In some embodiments, wherein the first helper plasmid comprises a rep gene and a cap gene and the second helper plasmid comprises a Ela gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.

[0100] In some embodiments, wherein administration of the ligand to the subject results in a fold increase in the RNA level of the exclusion isoform of about 300-400-fold.

[0101] In some embodiments, wherein administration of the ligand to the subject results in a fold increase in the protein level of the exclusion isoform of about 5-25-fold.

[0102] In some embodiments, splicing out the alternative exon, the at least two introns, and the aptamer from the transgene results in the production of a functional start codon in the transgene.

[0103] In some embodiments, splicing out the alternative exon, the at least two introns, and the aptamer results in the removal of a pre-mature stop codon from the transgene.

[0104] The present disclosure further relates to the following embodiments.

[0105] In some embodiments, aspects relate to a recombinant viral genome capable of delivering expressing) a transgene or coding region thereof in a subject, wherein said recombinant viral genome comprises at least one alternatively-spliced exon and a coding region of the transgene. In various aspects, the alternatively-spliced exon undergoes differential splicing in a condition-responsive manner to result in different spliced transcripts (e.g., mRNA isoforms), whereby the alternatively-spliced exon has been either retained (“spliced in”) or not retained (“spliced-out”) in the resulting spliced transcripts. For example, in a healthy cell environment, the alternatively-spliced exon may be spliced-out of the resulting transcript; however, in a cancer cell, the alternatively-spliced exon may be spliced-in the resulting transcript. And, depending upon the regulator}' sequences present in the alternatively-spliced exon, and whether those regulatory sequences impart a positive or negative regulator}- control on the expression of the coding region of interest, the alternatively-spliced exon regulates the expression of the coding region of interest by virtue of being either present (spliced-in) or not present (spliced-out) in the resulting mRNA transcript isoform.

[0106] In some embodiments, the alternatively-spliced exon may be provided in the form of a transgene comprising the alternatively-spliced exon, one or more introns (or portion(s) thereof), and one or more additional exons (e.g., constitutive exons). Such transgenes comprising an alternatively-spliced exon may be referred to herein as comprising an “alternatively-spliced exon cassettes.” The configuration of the alternatively-spliced exon cassettes and transgenes is not limited in any way, and examples of such configurations are provided in the Figures.

[0107] In some embodiments, the transgene comprises an alternatively-spliced exon, one or more introns (or portion(s) thereof) and one or more exons. In various embodiments, the one or more exons can be constitutive exons (i.e., those that are retained in all mRNA isoforms resulting from splicing). In certain embodiments, the transgene or the alternatively-spliced exon cassette comprises one intron (or portion thereof). In some embodiments, the intron (or portion thereof) is located 3’ or 5’ to an alternatively-spliced exon. In other embodiments, the transgene or the alternatively-spliced exon cassette comprises two introns (or portion(s) thereof) (e.g., whereby the one or more introns are flanking introns, i.e., introns that are immediately upstream or downstream of the alternatively-spliced exon).

[0108] In some embodiments, an alternative exon cassette comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in any one of SEQ ID NOs: 107-778. In some embodiments, an alternative exon cassette comprises a polynucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOs: 107-778.

[0109] In some embodiments, the alternatively-spliced exon comprises at least one modification, relative to a naturally occurring alternatively-spliced exon. In some embodiments, the alternatively-spliced exon comprises at its 3’ end a heterologous start codon or part of a heterologous start codon. In some embodiments, all native start codons located 5’ to the heterologous start codon are disrupted or deleted.

[0110] In some embodiments, the alternatively-spliced exon is located 5’ to the coding region of the transgene. In some embodiments, the alternatively-spliced exon cassette comprises two alternatively-spliced exons, each with flanking introns. In some embodiments, the two alternatively-spliced exons are adjacent. In some embodiments, the constitutive exon is located 5’ to the two alternatively-spliced exons.

[0111] In some embodiments, each alternatively-spliced exon comprises at its 3’ end a heterologous start codon or part of a heterologous start codon. In some embodiments, all native start codons located 5’ to the heterologous start codon of the 5 ’-most alternatively-spliced exon are disrupted or deleted.

[0112] In some embodiments, only one of the two alternatively-spliced exons is retained in the spliced transcript. In some embodiments, the 5 ’-most alternatively-spliced exon is retained in the spliced transcript. In some embodiments, the 3 ’-most alternatively-spliced exon is retained in the spliced transcript.

[0113] In some embodiments, the alternatively-spliced exon(s) and flanking intron(s) are located within the coding region of the transgene.

[0114] In some embodiments, the alternatively-spliced exon comprises a heterologous, in-frame stop codon. In some embodiments, the heterologous, in-frame stop codon is at least 50 nucleotides upstream of the next 5’ splice junction. In some embodiments, the heterologous stop codon elicits nonsense-mediated decay.

[0115] In various embodiments, the alternatively-spliced exon is spliced-in or retained in the presence of one or more conditions (z.e., in a condition-responsive manner) to result in an mRNA isoform comprising the alternatively-spliced exon and a coding region of interest. In some embodiments, the one or more conditions comprise the conditions that define one cell type from another. In other embodiments, the one or more conditions comprise the intracellular conditions that define a healthy cell state from a diseased cell state. In some embodiments, the one or more conditions comprise the presence or absence of activated T cells and / or the presence or absence of a state of inflammation. In still other embodiments, the one or more conditions comprise one or more signs or symptoms of a disease state, and / or the presence or absence of one or more disease markers. In still other embodiments, the one or more conditions comprise the expression level and / or activity of the endogenous protein that corresponds to the protein encoded by the coding region of interest in the alternatively-spliced exon cassette of the recombinant virus genome. For example, in one embodiment, if the endogenous protein has a low level of expression and / or activity (e.g., due to a defective naturally occurring gene encoding the endogenous protein), the alternatively-spliced exon may be spliced-in, and the coding region of interest may be upregulated (e.g., if the alternatively-spliced exon comprises a positive regulatory' sequence). In another embodiment, if the endogenous protein has a low level of expression and / or activity (e.g., due to a defective naturally occurring gene encoding the endogenous protein), the alternatively-spliced exon may be spliced-in, and the coding region of interest may be downregulated (e.g., if the alternatively-spliced exon comprises a negative regulatory' sequence). In still other embodiments, if the endogenous protein has a low level of expression and / or activity (e.g, due to a defective naturally occurring gene encoding the endogenous protein), the alternatively-spliced exon may be spliced-out, and the coding region of interest may be upregulated (e.g., if the alternatively-spliced exon comprises a negative regulatory' sequence that is removed by the splicing-out of the exon). In another embodiment, if the endogenous protein has a low level of expression and / or activity (e.g., due to a defective naturally occurring gene encoding the endogenous protein), the alternatively-spliced exon may be spliced-out, and the coding region of interest may be downregulated (e.g., if the alternatively- spliced exon comprises a positive regulatory sequence that is removed by the splicing-out of the exon).

[0116] In various embodiments, the one or more conditions (e.g., environmental, intracellular, disease state, cell type, expression pattern, etc.) may result in the splicing-in or splicing-out of the alternatively-spliced exon. For example, the one or more conditions may cause the alternatively-spliced exon to be spliced-in, and the coding region of interest may be upregulated (e.g., if the alternatively-spliced exon comprises a positive regulatory sequence). In another embodiment, the one or more conditions may cause the alternatively-spliced exon to be spliced- in, and the coding region of interest may be downregulated (e.g., if the alternatively-spliced exon comprises a negative regulatory / sequence). In still other embodiments, the one or more conditions may cause the alternatively-spliced exon to be spliced-out, and the coding region of interest may be upregulated (e.g, if the alternatively-spliced exon comprises a negative regulatory sequence that is removed by the splicing-out. of the exon). In another embodiment, the one or more conditions may cause the alternatively-spliced exon to be spliced-out, and the coding region of interest may be downregulated (e.g., if the alternatively-spliced exon comprises a positive regulatory sequence that is removed by the splicing-out of the exon).

[0117] In some embodiments, the alternatively-spliced exon comprises an alternatively-spliced exon from a gene selected from the group consisting of: ABCC1, AK 125149, ASCC2, BAT2D1, BBX, BRD8, BRE, C17orf70, CAMKK2, CBFB, CCAR1, CCDC7CD6, CHTF8, COL4A3BP, COL6A3, CUGBP1, CUGBP2, CXorf45, DENND3, DGUOK, DKFZp762G094, DNAJC7, DNASE1, EIF4A2, EIF4G2, EIF4H, EX0C7, EZH2, FAM120A, FAM136A, FAM36A, FARSB, FBXO38, FGFR1OP2, FIPIL1, F0XRED1, FUBP3, GALT, GATA3, G0LGA2, HIF1A, HMMR, HRB, IKZF1, ILF3, 1RAK4, IRF1, KCTD13, LEF1, LUC7L, LYRM1, MALT1 e7, MAP2K7, MAP3K7, MAP4K2, MBNL2, MFF, NAEI, NCSTN, NR4A3, XRI' L NUP98, PARP6, PCM 1, PLAUR, PLSCR3, PPIL5, PPP5C, PTPRC-E4, PTPRC-E6, PTS, RABL5, RAPHl, SEC16A, SFRS3, SFRS7, SLMAP, SNRNP70, STAT6, TBC1D1, TIMM8B, TIR8, TRA2A, TR.OVE2, UGCGL1, VAP-B, VAV1, ZNF384, ZNF496, CAMK2B, PKP2, l.GMX, NRAP, VPS39, KSR1, PDLIM3, BINI, ARFGAP2, KIF13A, and / or PICALM. In some embodiments, the alternatively-spliced exon comprises an alternatively-spliced exon from or derived from an alternatively-spliced exon of a gene selected from the group consisting of CAMK2B, PKP2, LGMN, NRAP, VPS39, KSR1, PDLIM3, BINI, ARFGAP2, KIFI3A, and / or PICALM. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of CAMK2B. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of PKP2. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of LGMN. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of NRAP. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of VPS39. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of KSR1. In some embodiments, the alternatively- spliced exon is or is derived from an alternatively-spliced exon of PDLIM3. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of BINI. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of ARFGAP2. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of KIF13A. In some embodiments, the alternatively-spliced exon is or is derived from an alternatively-spliced exon of PICALM.

[0118] In some embodiments, the alternatively-spliced exon is or is derived from exon 11 of BINI. In some embodiments, the alternatively-spliced exon which is or is derived from exon 1 1 of BINI comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 37. In some embodiments, the alternatively- spliced exon which is or is derived from exon 1 1 of BINI comprises a polynucleotide having a. nucleic acid sequence as set forth in SEQ ID NO: 37. In some embodiments, the alternatively- spliced exon which is or is derived from exon 11 of BINI comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 38. In some embodiments, the alternatively-spliced exon which is or is derived from exon 1 1 of BINI comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 38.

[0119] In some embodiments, a component (e.g., an alternative exon; an intronic sequence) which is “derived from” a gene (e.g., BINI, SMN1) may be derived from the gene in that the component is taken from its wild-type or natural context and put into a non-natural context (e.g., inserted into the nucleic acid sequence of a transgene), but may comprise the wild-type or natural nucleic acid sequence of said component. In some embodiments, a component (e.g., an alternative exon; an intronic sequence) which is “derived from” a gene (e.g., BINI, SMNf) may be derived from the gene in that the component is taken from its wild-type or natural context and put into a non-natural context (e.g., inserted into the nucleic acid sequence of a. transgene), and may also be derived from the gene in that the nucleic acid sequence of the component is modified, relative to the wild-type or natural nucleic acid sequence of said component. Modifications to the various components (e.g., introns, exons, etc.) are described elsewhere herein. In some embodiments, the alternatively-spliced exon comprises an alternatively-spliced exon comprising a polynucleotide sequence as set forth in any one of SEQ ID NOs: 23-44.

[0120] In some embodiments, the flanking intron(s) (or portion(s) thereof) is a native flanking intron(s) (or portion(s) thereof) of the alternatively-spliced exon(s). In some embodiments, the flanking intron(s) (or portion(s) thereof) comprises at its 5’ end a 5’ splice donor site. In some embodiments, the flanking intron(s) (or portion(s) thereof) comprises at its 3’ end a 3’ splice donor site. In some embodiments, the flanking intron(s) (or portion(s) thereof) comprises no modifications, relative to a naturally occurring intron (or portion thereof). In some embodiments, the flanking intron(s) (or portion(s) thereof) comprises at least one modification, relative to a naturally occurring intron (or portion thereof). In some embodiments, the modification is a substitution or deletion of one or more nucleotides. In some embodiments, the flanking intron(s) (or portion(s) thereof) is a regulated intron (or portion thereof).

[0121] In some embodiments, the flanking intron(s) is or is derived from an intron of a gene selected from the group consisting of ABCC1, AK 125149, ASCC2, BAT2D1, BBX, BRD8, BRE, C17orf70, CAMKK2, CBFB, CCAR1, CCDC7CD6, CHTF8, COL4A3BP, COL6A3, CUGBP1, CUGBP2, CXorf45, DENND3, DGUOK, DKFZp762G094, DNAJC7, DNASE1, EIF4A2, EIF4G2, EIF4H, EXOC7, EZH2, FAM 120 A, FAM136A, FAM36A, FARSB, FBXO38, FGFR1OP2, FIP1L1, FOXRED1, FUBP3, GALT, GATA3, GOLGA2, HIF1A, HMMR, HRB, IKZF1, ILF3, IRAK4, IRF1, KCTD13, LEF1, LUC7L, LYRM1, MALT1 e7, MAP2K7, MAP3K7, MAP4K2, MBNL2, MFF, NAE1, NCSTN, NR4A3, NRF1, NUP98, PARP6, PCM1, PLAUR, PLSCR3, PPIL5, PPP5C, PTPRC-E4, PTPRC-E6, PTS, RABL5, RAPl 11, SEC16A, SFRS3, SFRS7, SI . MAP, SMNI, SNRNP70, STAT6, TBC1D1, T1MM8B, TIR8, TRA2A, TROVE2, UGCGL1, VAP-B, VAV1, ZNF384, ZNF496, CAMK.2B, PKP2, LGMN, NRAP, VPS39, KSR1, PDLIM3, BINI, ARFGAP2, KIF13A, and / or PICALM.

[0122] In some embodiments, the flanking intron(s) is or is derived from an intron of SMNI. In some embodiments, the flanking intron(s) which is or is derived from an intron of SMNI flanks a constitutive exon. In some embodiments, the flanking intron(s) is or is derived from intron 6 and / or intron 7 of SMNI . In some embodiments, the flanking intron which is derived from SMNI intron 6 is a fragment of (e.g., is truncated relative to) the wild-type or naturally occurring sequence of SMNI intron 6, In some embodiments, the flanking intron which is derived from SMNI intron 6 comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 103. In some embodiments, the flanking intron which is derived from SMN1 intron 6 comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 103. In some embodiments, the flanking intron which is derived from SMN 1 intron 7 is a fragment of (e.g., is truncated relative to) the wild-type or naturally occurring sequence of SMN1 intron 7. In some embodiments, the flanking intron which is derived from SMN1 intron 7 comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 104. In some embodiments, the flanking intron which is derived from SMN1 intron 7 comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 104.

[0123] In some embodiments, the flanking intron(s) is or is derived from an intron of BINI . In some embodiments, the flanking intron(s) which is or is derived from an intron of BINI flanks an alternative exon. In some embodiments, the flanking intron(s) is or is derived from intron 10 and / or intron 11 of BINI. In some embodiments, the flanking intron(s) which is or is derived from intron 10 of BINI comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 15. In some embodiments, the flanking intron(s) which is or is derived from intron 10 of BINI comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 15. In some embodiments, the flanking intron(s) which is or is derived from intron 11 of BINI comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 16. In some embodiments, the flanking intron(s) which is or is derived from intron 11 of BINI comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 16.

[0124] In some embodiments, the flanking intron(s) comprises an intron comprising a polynucleotide sequence as set forth in any one of SEQ ID NOs: 1-22, 103, and 104.

[0125] In some embodiments, the constitutive exon is an exon which is natively associated with the coding region of the transgene. In some embodiments, the constitutive exon is not a exon which is natively associated with the coding region of the transgene. In some embodiments, the constitutive exon is or is derived from the same gene as the alternatively-spliced exon(s). In some embodiments, the gene is the gene from which the coding region of the transgene is also derived. In some embodiments, the constitutive exon is not from or derived from the same gene as the alternatively-spliced exon(s).

[0126] In some embodiments, the coding region of the transgene is or is derived from a coding region of a gene selected from the group consisting of MBNLl, MBNL2, MBNL3, hnRNP Al, hnRNP A2B1, hnRNP C, hnRNP D, hnRNP DL, hnRNP F, hnRNP H, hnRNP K, hnRNP L, hnRNP M, hnRNP R, hnRNP U, FUS, TDP43, PABPN1, ATXN2, TAF15, EWSR1, MATR3, TIA1, FMRP, MTM1, MTMR2, LAMP2, KIF5A, a microdystrophin-encoding gene, C9ORF72, HTT, DNM2, BINI, RYR1, NEB, ACTA, TPMS, TPM2, TNNT2, CFL2, KBTBD13, KLHL40, KLHL41, L.MOD3, MYPN, SEPN1, TTN, SPEG, MYH7, TK2. POLGI, GAA, AGL, PYGM:, SLC22A5, OCTN2, ETF, ETFH, PNPLA2, a cytochrome b oxidase-encoding gene, a cytochrome c oxidase-encoding gene, CLCN1, SCN4A, DMPK, CNBP, MYOT, LMNA, CAV3, DNAJB6, DES, TNPO3, HNRPDL, CAPN3, DYSF, an alpha-sarcoglycan-encoding gene, a beta-sarcoglycan-encoding gene, a gamma-sarcoglycan-encoding gene, a delta-sarcoglycan- encoding gene, TCAP, TRIM32, FKRP, FXN, POMT1, FKTN, POMT2, POMGnTl, DAG1, ANO5, PLECl, TRAPPCI 1, GMPPB, ISPD, LIMS2, POPDC1, TOR1AIP1, POGLUT2, LA.MA2, COL6A1, POMT1, POMT2, DUX4, HMD, PAX7, PMP22, MPZ, MFN2, SMCHD1, SMN, Lamin A / C (I. A MN). GJB1, ABCC1, AK125149, ASCC2, BAT2D1, BBX, BRD8, BRE, C17orf70, CAMKK2, CBFB, CCAR1, CCDC7CD6, CHTF8, COL4A3BP, COL6A3, CUGBP1, CUGBP2, C North 5, DENND3, DGUOK, DKFZp762G094, DNAJC7, DNASE1, EIF4A2, EIF4G2, E1F4H, EXOC7, EZH2, FAM 120 A, FAM136A, FAM36A, FARSB, FBXO38, FGFR1OP2, FIP1L1, FOXRED1, FUBP3, GALT, GATA3, GOLGA2, HIF1A, HMMR, HRB, IKZF1, ILF3, IRAK4, IRF1, KCTD13, LEF1, LUC7L, LYRM1, MALTl e7, MAP2K7, MAP3K7, M AP4K2. MBNL2, MFF, NAE1, NCSTN, NR4A3, NRF 1, NUP98, PARI56, PCM 1, PLAUR, PLSCR3, PPIL5, PPP5C, PTPRC-E4, PTPRC-E6, PTS, RABL5, RAPH 1, SEC16A, SFRS3, SFRS7, SLMAP, SNRNP70, STAT6, TBC1D1, TIMM8B, TIR8, TRA2A, TR.OVE2, UGCGL1, VAP-B, VAV1, ZNF384, ZNF496, CAMK2B, PKP2, LGMN, NRAP, VPS39, KSR1, PDLIM3, BINI, ARFGAP2, KIF13A, and / or PIC ALM. In some embodiments, the coding region of the transgene is or is derived from MTM1, CAPN3, or FXN. In some embodiments, the coding region of the transgene is or is derived from FXN. In some embodiments, the coding region of the transgene is or is derived from MTM1 . In some embodiments, the coding region of the transgene which is or is derived from MTM1 comprises a polynucleotide having at least 70%, at least 75%, at ieast 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 1881 . In some embodiments, the coding region of the transgene which is or is derived from MTM1 comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1881.

[0127] In some embodiments, the coding region of the transgene is or is derived from CAPN3. In some embodiments, the coding region of the transgene which is or is derived from CAPN3 comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 1882. In some embodiments, the coding region of the transgene which is or is derived from CAPN3 comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1882.

[0128] In some embodiments, a recombinant viral genome of the present disclosure further comprises a promoter. In some embodiments, the promoter is a native promoter of the coding region of the transgene. In some embodiments, the promoter is not a native promoter of the coding region of the transgene. In some embodiments, the promoter is constitutive. In some embodiments, the promoter is inducible. In some embodiments, the promoter is a cell-specific promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the promoter is selected from the group consisting of an EFI alpha promoter, beta actin promoter, CMV, muscle creatine kinase promoter, C5-12 muscle promoter, MHCK7, CBh, synapsin, MECP2, enolase, GFAP, Desmin, and CAG promoter.

[0129] In some embodiments, the promoter is an MHCK7 promoter. In some embodiments, an MHCK7 promoter comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 1880. In some embodiments, an MHCK7 promoter comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1880.

[0130] In some embodiments, the promoter drives expression of the transgene (e.g., expression of the product encoded by the coding region of interest). In some embodiments, the promoter is a ubiquitous promoter. In some embodiments, a ubiquitous promoter is a promoter selected from the group consisting of: an EFl alpha promoter, a beta actin promoter, CMV, CBh, and CAG promoter. In some embodiments, the promoter is a tissue-specific promoter, such as a muscle- or heart-biased promoter. In some embodiments, a tissue-specific promoter, such as a muscle- or heart-biased promoter, is a promoter selected from the group consisting of: a muscle creatine kinase promoter, a C5-12 muscle promoter, MHCK7, and Desmin. In some embodiments, the promoter is a neuronal -biased promoter. In some embodiments, a neuronal -biased promoter is a promoter selected from the group consisting of: synapsin and VIECP2. In some embodiments, the promoter is an astrocyte-biased promoter. In some embodiments, an astrocyte-biased promoter is a GFAP promoter.

[0131] In some embodiments, the coding region of the transgene comprises at least one modification, relative to a coding region of a naturally occurring gene. In some embodiments, the modification is an addition, substitution or deletion of at least one nucleotide. In some embodiments, the coding region of the transgene comprises a deletion of a native start codon, or a portion thereof. In some embodiments, the coding region of the transgene comprises an addition of a non-native stop codon, or a portion thereof. In some embodiments, the transgene comprises one or more recombinant introns (e.g., a 3’ UTR intron). In some embodiments, the one or more recombinant introns (e.g., a 3' UTR intron), when translated, elicits nonsense mediated decay (NMD).

[0132] In some embodiments, the naturally occurring gene is a gene selected from the group consisting of MBNL1, MBNL2, MBNL3, hnRNP Al, hnRNP A2B1, hnRNP C, hnRNP I), hnRNP DL, hnRNP F, hnRNP I L hnRNP K, hnRNP L, hnRNP M, hnRNP R, hnRNP U, FUS, TDP43, PABPN1, ATXN2, TAFI 5, EWSR1, M ATR3, TIA1, FMRP, MTM1, MTMR.2, LAMP2, KIF5A, a microdystrophin-encoding gene, C9ORF72, HTT, DNM2, BINI, RYR1, NEB, ACTA, TPM3, TPM2, TNNT2, CFL2, KBTBD13, K M 11.40.. K I .Hl .4 L. LMOD3, MYPN, SEPN1, TTN, SPEG, MYH7, TK2, POLG1, GAA, AGE, PYGM, SLC22A5, OCTN2, ETF, ETFH, PNPLA2, a cytochrome b oxidase-encoding gene, a cytochrome c oxidase-encoding gene, CLCN1, SCN4A, DMPK, CNBP, MYOT, LMNA, CAV3, DNA.IB6, DES, TNPO3, HNRPDL, CAPN3, DYSF, an alpha-sarcogly can-encoding gene, a beta-sarcogly can-encoding gene, a gamma-sarcoglycan-encoding gene, a del ta-sarcogly can-encoding gene, TCAP, TRIM32, I K R.P. FXN, POMTI, I K I N. POM 1'2, POMGnTl, DAG1, ANO5, PLEC1, TRAPPCI 1, GMPPB, ISPD, LIMS2, P0PDC1, TORI AIP1, POGLUT2, LAMA2, COL6A1, P0MT1, P0MT2, DUX4, EMD, PAX7, PMP22, MPZ, MFN2, SMCHD1, SMN, Lamin A / C (LAMN), and / or GJ Bl . In some embodiments, the naturally occurring gene is MTM1, CAPN3, or FXN. In some embodiments, the naturally occurring gene is MTM1. In some embodiments, the naturally occurring gene is CAPN3. In some embodiments, the naturally occurring gene is FXN.

[0133] In some embodiments, the coding region of the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 1881 or SEQ ID NO: 1882. In some embodiments, the coding region of the transgene comprises a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 1881 or SEQ ID NO: 1882.

[0134] In some embodiments, the recombinant viral genome is a recombinant genome from an adeno-associated vims (rAAV), lentivirus, retrovirus, or foamyvirus. In some embodiments, the recombinant viral genome is from an AAV, In some embodiments, the transgene is flanked by AAV inverted terminal repeat (ITR) sequences. In some embodiments, the ITR sequences comprise AAV1, AAV2, AAV5, AAV7, AAV8, or AAV9 ITR sequences. In some embodiments, the recombinant viral genome is from a lentivirus. In some embodiments, the alternatively-spliced exon cassette is located on the minus strand of the lentivirus genome.

[0135] In some embodiments, a recombinant viral genome of the present disclosure further comprises a 3’ untranslated region (UTR) that is endogenous or exogenous to the transgene. In some embodiments, the exogenous 3’ UTR is the 3’ UTR from bovine growth hormone, SV40, EBV, or Myc.

[0136] In some embodiments, the exogenous 3’ UTR is SV40. In some embodiments, the SV40 3’ UTR comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set. forth in SEQ ID NO: 1883. In some embodiments, the SV40 3’ UTR comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1883.

[0137] In some embodiments, the exogenous 3’ UTR comprises a polyadenylation (pA) signal. In some embodiments, the pA signal is an SV40 pA signal.

[0138] Aspects of the invention contemplate a viral particle comprising a viral genome according to any embodiment of the present disclosure. In some embodiments, the viral particle is an rAAV particle. In some embodiments, the rAAV particle comprises an AAV serotype selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the rAAV particle comprises AAV serotype 9. In some embodiments, the rAAV particle comprises an AAV derivative or pseudotype selected from the group consisting of an AAV2-AAV3 hybrid, AAVrh.10, AA.Vhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, A AV-H AE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2 (Y">F), AAV8 (Y733F), AAV2. I 5, AAV2.4, AAVM4I, and AAVr3.45.

[0139] In some embodiments, the viral particle further comprises at least one helper plasmid. In some embodiments, the helper plasmid comprises a rep gene and a cap gene. In some embodiments, the rep gene encodes Rep78, Rep68, Rep52, or Rep40. In some embodiments, the cap gene encodes a VP1 , VP2, and / or VP3 region of the viral capsid protein. In some embodiments, the viral particle comprises two helper plasmids. In some embodiments, the first helper plasmid comprises a rep gene and a cap gene and the second helper plasmid comprises a Ela gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.

[0140] In some embodiments, the viral particle is a recombinant lentivirus particle. In some embodiments, the lentivirus is a human immunodeficiency virus (HIV1 or HIV2), a feline immunodeficiency virus (FIV), a bovine immunodeficiency virus (BIV), a caprine arthritis encephalitis virus, an equine infectious anemia virus, a jembrana disease virus, a puma lentivirus, aimian immunodeficiency virus, or a visna-maedi vims. In some embodiments, the viral particle further comprises a viral envelope.

[0141] Aspects of the invention relate to a method of treating a disease or condition in a subject comprising administering a recombinant viral genome or a viral particle according to any embodiment of the present disclosure to the subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human. In some embodiments, the recombinant viral genome or viral particle is administered to the subject at least one time. In some embodiments, the recombinant viral genome or viral particle is administered to the subject 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In some embodiments, the recombinant viral genome or viral particle is administered to the subject parenterally, subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro-ventricularly, intramuscularly, intrathecally (IT), intra ci sternally, intraperitoneally, enterally, via inhalation, topically, or by direct injection to one or more ceils, tissues, or organs. In some embodiments, the recombinant viral genome or viral particle is administered to the subject by intravenous injection, intramuscular injection, intrathecal injection, or intravitreai injection.

[0142] In some embodiments, the disease or condition is a disease or condition selected from the group consisting of Dentatorubrai-pallido-luysian atrophy (DRPLA), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), Fragile X syndrome of mental retardation (FMRI ), Fragile X tremor ataxia syndrome (FXTAS), FRAXE mental retardation (FMR2), Friedreichs ataxia (FRDA), Huntington disease (HD), Huntington disease-like 2 (HDL2), Oculopharyngeal muscular dystrophy (OPMD), Myoclonic epilepsy type 1, Alzheimer’s disease, ALS / FTD, spinocerebellar ataxia type 1 (SCAl), spinocerebellar ataxia type 2 (SCA2), spinocerebellar ataxia type 3 (SCA3), spinocerebellar ataxia type 6 (SCA6), spinocerebellar ataxia type 7 (SCA7), spinocerebellar ataxia type 8 (SC.A8), spinocerebellar ataxia type 10 (SC A 10), spinocerebellar ataxia type 12 (SCA12), spinocerebellar ataxia type 17 (SCAl 7), Syndromic / non-syndromic X-linked mental retardation, Emery-Dreifuss muscular dystrophy type 2, familial partial lipodystrophy, limb girdle muscular dystrophy type IB, dilated cardiomyopathy, familial partial lipodystrophy, Charcot-Marie-Tooth disorder type 2B1, mandibuloacral dysplasia, childhood progeria syndrome (Hutchinson-Gilford syndrome), Werner syndrome, Dilated cardiomyopathy (DCM), Hypertrophic cardiomyopathy (HCM), Restrictive cardiomyopathy (RCM), Left Ventricular Non-compaction (LVNC), Arrhythmogenic Right Ventricular Dysplasia (ARVD), takotsubo cardiomyopathy, Duchenne muscular dystrophy, Becker muscular dystrophy, Limb-girdle muscular dystrophy, Facioscapulohumeral muscular dystrophy, Congenital muscular dystrophy, Oculopharyngeal muscular dystrophy, Distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, dementia, Parkinson's disease (PD), a PD- related disorder, Prion disease, a motor neuron disease (VXD), Progressive bulbar palsy (PBP), Progressive muscular atrophy (PM A), Primary lateral sclerosis (PLS), Spinal muscular atrophy (SMA), a bladder cancer, a breast cancer, a colorectal cancer, a kidney cancer, a lung cancer, a lymphoma, a melanoma, an oral cancer, an ovarian cancer, an oropharyngeal cancer, a pancreatic cancer, a prostate cancer, a thyroid cancer, a uterine cancer, Down syndrome, Prader-Willi Syndrome (PWS), Bloom Syndrome, Cockayne Syndrome Type I -216400, Cockayne Syndrome Type HI, Cockayne Syndrome Type I, Hutchinson-Gilford Progeria Syndrome, Mandibuloacral Dysplasia with Type A Lipodystrophy, Progeria, Adult Onset Progeroid Syndrome, Neonatal Rothmund-Thomson Syndrome, Seip Syndrome, Werner Syndrome, Replication Focus-Forming Activity 1, myotubular myopathy, Danon Disease, and / or centronuclear myopathy.

[0143] Aspects of the invention relate to a method of regulating transgene expression (e.g, comprising a coding region of interest which encodes a protein of interest, such as a therapeutic protein) using a viral vector comprising a recombinant viral genome as described herein, wherein the transgene, or coding region of the transgene, are under the regulatory' control of an alternatively-spliced exon. In some embodiments, the method comprises inserting into the recombinant viral genome at least one alternatively-spliced exon and at least one coding region of interest (e.g., which encodes a therapeutic protein), wherein the expression of the at least one coding region of interest is regulated by the alternative-spliced exon. In turn, how the regulation of the coding region of interest is imparted depends on (a) the presence or absence of positive or negative regulatory control sequences in the alternatively-spliced exon, and (b) whether the alternatively-splice exon is spliced-in (i.e., retained) or spliced-out (i.e., removed) from the final mRNA transcript isoform. The recombinant viral genome may be configured with one or more additional introns, exons, and / or regulatory sequences (e.g., promoters, enhancers, and the like that control transcription from the recombinant viral genome). In addition, the alternatively- splice exon may be comprised on a cassette (which may be referred to as an alternatively-spliced exon cassette), comprising the alternatively-spliced exon(s) and one or more introns, which may be inserted into the recombinant viral genome in a manner that couples it to the coding region of interest, such that the expression of the coding region of interest comes under regulatory control of the alternatively-spliced exon of the cassette.

[0144] In other embodiments, the transgene comprises an alternatively-spliced exon, optionally one or more introns (or portion(s) thereof), optionally one or more constitutive exons, and a coding region of interest.

[0145] Aspects of the invention relate to a method of regulating transgene (e.g., comprising a coding region of interest which encodes a protein of interest, such as a therapeutic protein) expression using a viral vector comprising a recombinant viral genome as described herein. In some embodiments, the method comprises: (a) inserting into the recombinant viral genome at least one transgene, wherein the transgene comprises a constitutive exon, at least one alternatively-spliced exon, at least one flanking intron (or portion thereof), and a coding region of a transgene; (b) introducing a heterologous start codon or part of a heterologous start codon at the 3’ end of the alternatively-spliced exon; (c) disrupting or deleting all native start codons located 5’ to the heterologous start codon; and (d) deleting or disrupting one or more native start codons, or a portion(s) thereof, from the coding region of the transgene. In some embodiments, the method comprises: (a) inserting into the recombinant viral genome at least one transgene, wherein the transgene comprises a constitutive exon, at least one alternatively-spliced exon, at least one flanking intron (or portion thereof), and a coding region of a transgene; (b) introducing a heterologous start codon or part of a heterologous start codon at the 3’ end of the alternatively- spliced exon; (c) disrupting or deleting all native start codons located 5’ to the heterologous start codon; and (d) adding a heterologous 3’ UTR, or a portion thereof, to the coding region of the transgene. In some embodiments, translation of the heterologous 3’ UTR elicits nonsense mediated decay. In some embodiments, (a) inserting into the recombinant viral genome at least one alternatively-spliced exon cassette, wherein the alternatively-spliced exon cassette comprises a constitutive exon, at least one alternatively-spliced exon, at least one flanking intron (or portion thereof), and a coding region of a transgene; (b) introducing a heterologous start codon or part of a heterologous start codon at the 3’ end of the alternatively-spliced exon; (c) disrupting or deleting all native start codons located 5’ to the heterologous start codon, (d) deleting or disrupting one or more native start codons, or a portion(s) thereof, from the coding region of the transgene; and (e) adding a heterologous 3’ UTR, or a portion thereof, to the coding region of the transgene. In some embodiments, translation of the heterologous 3’ UTR elicits nonsense mediated decay. In some embodiments, the constitutive exon, alternatively-spliced exon, and flanking intron (or portion thereof) are each located 5’ to the coding region of the transgene.

[0146] Aspects of the invention relate to a method of regulating transgene (e.g, comprising a coding region of interest which encodes a protein of interest, such as a therapeutic protein) expression using a viral vector comprising a recombinant viral genome as described herein. In some embodiments, the method comprises: (a) inserting into the recombinant viral genome at least one transgene, wherein the transgene comprises an alternatively-spliced exon and at least one flanking intron (or portion thereof) within the coding region of the transgene; and (b) introducing into the alternatively -spliced exon a heterologous, in-frame stop codon upstream of the next 5' splice junction. In some embodiments, the heterologous, in-frame stop codon elicits nonsense-mediated decay. In certain embodiments, the in-frame stop codon is inserted at least 100 nucleotides, at least 95 nucleotides, at least 90 nucleotides, at least 85 nucleotides, at least 80 nucleotides, at least 75 nucleotides, at least 70 nucleotides, at least 65 nucleotides, at least 60 nucleotides, at least 55 nucleotides, at least 50 nucleotides, at least 45 nucleotides, at least 40 nucleotides, at least 35 nucleotides, at least 30 nucleotides, at least 25 nucleotides, at least 20 nucleotides, at least 15 nucleotides, at least 10 nucleotides, or at least 5 nucleotides, or between 1 to 5 nucleotides upstream of the next 5’ splice junction.

[0147] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises a constitutive exon; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous ATG start codon; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (v) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation, wherein the coding region of the transgene comprises at its 5’ end a modification comprising the removal of a native ATG start codon. In some embodiments, all native ATG start codons located upstream of the heterologous ATG start codon are mutated or deleted.

[0148] Other aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first portion of a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising an exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises an alternatively- spliced exon comprising at its 3’ end a heterologous stop codon; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site, and (v) a nucleotide sequence comprising a second portion of a coding region of the transgene having a 5:to 3’ orientation. Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising a positive or negative Gs-acting element; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises a constitutive exon.

[0149] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises a constitutive exon; (ii) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively -spliced exon comprising at its 3’ end a heterologous ATG start codon, and (iii) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation, wherein the coding region of the transgene comprises at its 5’ end a modification comprising the removal of a native ATG start codon. In some embodiments, all native ATG start codons located upstream of the heterologous ATG start codon are mutated or deleted.

[0150] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first portion of a coding region of the transgene having a 5’ to 3’ orientation, (ii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous stop codon; (iii) a nucleotide sequence comprising a second portion of a coding region of the transgene having a 5’ to 3’ orientation; (iv) a nucleotide sequence comprising an intronic sequence having a 5’ to 3’ orientation, wherein the intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site, and (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises a constitutive exon. Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation;

[0151] (ii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising a positive or negative c / s-acting element; and (iii) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises a constitutive exon.

[0152] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises a constitutive exon; (ii) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous ATG start codon;

[0153] (iii) a nucleotide sequence comprising an intronic sequence having a 5’ to 3’ orientation, wherein the intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (iv) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation, wherein the coding region of the transgene comprises at its 5’ end a modification comprising the removal of a native ATG start codon. In some embodiments, all native ATG start codons located upstream of the heterologous ATG start codon are mutated or deleted.

[0154] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first portion of a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising an exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous stop codon; (iii) a nucleotide sequence comprising an intronic sequence having a 5’ to 3’ orientation, wherein the intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (iv) a nucleotide sequence comprising a second portion of a coding region of the transgene having a 5’ to 3’ orientation.

[0155] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises an alternatively-spliced exon comprising a positive or negative as-acting element; (iii) a nucleotide sequence comprising an intronic sequence having a 5’ to 3’ orientation, wherein the intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (iv) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises a constitutive exon.

[0156] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises a constitutive exon; (ii) a nucleotide sequence comprising an intronic sequence having a 5’ to 3’ orientation, wherein the intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous ATG start codon; and (iv) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation, wherein the coding region of the transgene comprises at its 5’ end a modification comprising the removal of a native ATG start codon. In some embodiments, all native ATG start codons located upstream of the heterologous ATG start codon are mutated or deleted.

[0157] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first portion of a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous stop codon; (iv) a nucleotide sequence comprising a second portion of a coding region of the transgene having a 5’ to 3’ orientation; (v) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5' end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (vi) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises a constitutive exon. Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising an intronic sequence having a 5’ to 3’ orientation, wherein the intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising an exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises an alternatively-spliced exon comprising a positive or negative cA-acting element, and (iv) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the exonic sequence comprises a constitutive exon.

[0158] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises a constitutive exon; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3:splice acceptor site; (iii) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous ATG start, codon; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (v) a nucleotide sequence comprising a third exonic sequence having a 5’ to 3’ orientation, wherein the third exonic sequence comprises an alternatively-spliced exon; (vi) a nucleotide sequence comprising a third intronic sequence having a 5’ to 3’ orientation, wherein the third intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (vii) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation, wherein the coding region of the transgene comprises at its 5’ end a modification comprising the removal of a native ATG start, codon. In some embodiments, all native ATG start codons located upstream of the heterologous ATG start codon are mutated or deleted.

[0159] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first portion of a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous stop codon; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively-spliced exon; (vi) a nucleotide sequence comprising a third intronic sequence having a 5’ to 3’ orientation, wherein the third intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site (m); and (vii) a nucleotide sequence comprising a second portion of a coding region of the transgene having a 5’ to 3’ orientation.

[0160] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first, intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site, (iii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation (e), wherein the first exonic sequence comprises a first alternatively-spliced exon comprising a positive or negative cA-acting element; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises a second alternatively-spliced exon; (vi) a nucleotide sequence comprising a third intronic sequence having a 5’ to 3’ orientation, wherein the third intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site, and (vii) a nucleotide sequence comprising a third exonic sequence having a 5’ to 3’ orientation, wherein the third exonic sequence comprises a constitutive exon.

[0161] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises a constitutive exon; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation, (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ spiice donor site and at its 3’ end a 3’ splice acceptor site; and (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises an alternatively -spliced exon.

[0162] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a first, portion of a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (iii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising at its 3’ end a heterologous stop codon; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises a constitutive exon; (vi) a nucleotide sequence comprising a third intronic sequence having a 5’ to 3’ orientation, wherein the third intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (vii) a nucleotide sequence comprising a second portion of a coding region of the transgene having a 5’ to 3’ orientation.

[0163] Aspects of the invention relate to a transgene comprising, in the 5’ to 3’ direction: (i) a nucleotide sequence comprising a coding region of the transgene having a 5’ to 3’ orientation; (ii) a nucleotide sequence comprising a first, intronic sequence having a 5’ to 3’ orientation, wherein the first intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site, (iii) a nucleotide sequence comprising a first exonic sequence having a 5’ to 3’ orientation, wherein the first exonic sequence comprises an alternatively-spliced exon comprising a positive or negative cis-acting element; (iv) a nucleotide sequence comprising a second intronic sequence having a 5’ to 3’ orientation, wherein the second intronic sequence comprises at its 5’ end a 5’ splice donor site and at its 3’ end a 3’ splice acceptor site; and (v) a nucleotide sequence comprising a second exonic sequence having a 5’ to 3’ orientation, wherein the second exonic sequence comprises a constitutive exon. Aspects of the disclosure relate to a transgene comprising: (i) a constitutive exon and one or more intronic sequences, each from a first gene; (ii) an alternatively-spliced exon cassette, and (iii) a coding region of interest from a third gene. In some embodiments, the alternatively- spliced exon cassette comprises: (a) an alternatively-spliced exon, and (b) flanking intronic sequences. In some embodiments, each of (a) and (b) are from a second gene. In some embodiments, the alternatively-spliced exon comprises an ATG start codon at its 3’ end.

[0164] In some embodiments, the first and second gene are the same gene, the first and third gene are the same gene; or all of the first, second, and third genes are the same gene.

[0165] In some embodiments, the first gene is survival motor neuron 1 (SMN1).

[0166] In some embodiments, the constitutive exon comprises exon 6 of SMN1, or a portion thereof. In some embodiments, the constitutive exon comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 102. In some embodiments, the constitutive exon comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 102.

[0167] In some embodiments, the one or more intronic sequences of (i) are or are derived from intron 6 and / or intron 7 of SMN1. In some embodiments, the one or more intronic sequences of (i) comprise(s) a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 103 and / or SEQ ID NO: 104. In some embodiments, the one or more intronic sequences of (i) comprise(s) a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 103 and / or SEQ ID NO: 104.

[0168] In some embodiments, the second gene is a gene selected from the group consisting of: CAMK2B, PKP2, LGMN, \RAP. VPS39, KSR 1, PDLIM3, BINI, ARFGAP2, KIF13A, and / or PIC ALM. In some embodiments, the second gene is bridging integrator 1 (BINI),

[0169] In some embodiments, the alternatively-spliced exon comprises exon 11 of BINI . In some embodiments, the alternatively-spliced exon comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 37 or SEQ ID NO: 38. In some embodiments, the alternatively-spliced exon comprises a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 37 or SEQ ID NO: 38.

[0170] In some embodiments, the flanking intronic sequences of (ii) are or are derived from intron 10 and / or intron 11 of BINI. In some embodiments, the flanking intronic sequences of (ii) each comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 15 or SEQ ID NO: 16, In some embodiments, the flanking intronic sequences of (ii) each comprise a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 15 or SEQ ID NO: 16.

[0171] In some embodiments, the alternatively-spliced exon cassette comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in any one of SEQ ID NOs: 107-778. In some embodiments, the alternatively-spliced exon cassette comprises a polynucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOs: 107-778.

[0172] In some embodiments, the third gene is myotubularin 1 (MTM1) or calpain 3 (CA.PN3).

[0173] In some embodiments, the coding region of interest comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 1881 or SEQ ID NO: 1882. In some embodiments, the coding region of interest comprises a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 1881 or SEQ ID NO: 1882.

[0174] In some embodiments, if the wild-type alternatively-spliced exon does not comprise an ATG start codon, the alternatively-spliced exon comprises 1-3 nucleic acid substitutions, relative to the wild-type alternatively-spliced exon, to form the ATG start codon within the alternatively- spliced exon. In some embodiments, the ATG start codon is formed in the alternatively-spliced exon by 1 nucleic acid substitution. In some embodiments, the ATG start codon is formed in the alternatively-spliced exon by 2 nucleic acid substitutions. In some embodiments, the ATG start codon is formed in the alternatively-spliced exon by 3 nucleic acid substitutions.

[0175] In some embodiments, the alternatively-spliced exon is retained in the spliced transcript. In some embodiments, all native start codons located 5’ to the ATG start codon located within the alternatively-spliced exon are disrupted or deleted.

[0176] In some embodiments, the alternatively-spliced exon cassette is located 5’, relative to the coding region of interest. In some embodiments, the constitutive exon is located 5’, relative to the alternatively-spliced exon cassette. In some embodiments, the one or more intronic sequences of (i) flank the alternatively-spliced exon cassette.

[0177] In some embodiments, the alternatively-spliced exon comprises a heterologous, in-frame stop codon. In some embodiments, the heterologous, in-frame stop codon is at least 50 nucleotides upstream of the next 5’ splice junction. In some embodiments, the heterologous, inframe stop codon elicits nonsense-mediated decay.

[0178] In some embodiments, the alternatively-spliced exon is retained in the spliced transcript in distinct tissues. In some embodiments, the alternatively-spliced exon is retained in the spliced transcript in skeletal muscle. In some embodiments, the alternatively-spliced exon is not retained in the spliced transcript in heart and / or liver tissue.

[0179] In some embodiments, the flanking intronic sequences of (ii)(b) are or are derived from native flanking introns of the alternatively-spliced exon. In some embodiments, the flanking intronic sequences of (ii)(b) each comprise at least one modification, relative to a naturally occurring intronic sequence. In some embodiments, the modification is a substitution or deletion of one or more nucleic acids.

[0180] In some embodiments, the ATG start codon is located at the 3’ end of the alternatively- spliced exon. In some embodiments, the ATG start codon is in the same reading frame as the coding region of interest. In some embodiments, the ATG start codon is within up to 5, 10, 20, or 30 nucleotides upstream of the 3’ end of the alternative-spliced exon. In some embodiments, the ATG start codon is within up to 5, 10, 20, or 30 nucleotides upstream of the 3’ end of the alternative-spliced exon and is in the same reading frame as the coding region of interest.

[0181] In some embodiments, if the wild-type alternatively-spliced exon does not comprise an ATG start codon at its 3’ end, the first 10 nucleotides of the flanking intronic sequence which is immediately 3’ to the alternatively-spliced exon comprise 1 -5 nucleotide substitutions, relative to the wild-type flanking intronic sequence which is immediately 3’ to the wild-type alternatively- spliced exon. In some embodiments, the one or more intronic sequences of (i) each comprise at least one modification, relative to a naturally occurring intronic sequence. In some embodiments, the modification is a substitution or deletion of one or more nucleic acids.

[0182] In some embodiments, the coding region of interest comprises at least one modification, relative to a naturally occurring coding region of the third gene. In some embodiments, the modification is a substitution or deletion of one or more nucleic acids. In some embodiments, the coding region of interest comprises a deletion or disruption of a native start codon. In some embodiments, the coding region of interest comprises at least one heterologous stop codon. In some embodiments, the at least one heterologous stop codon is at least 50 nucleotides upstream of the next 5’ splice junction. In some embodiments, the at least one heterologous stop codon elicits nonsense-mediated decay.

[0183] In some embodiments, a transgene as described in any embodiment of the disclosure further comprises a 3’ untranslated region (UTR). In some embodiments, the 3’ UTR is SV40. In some embodiments, the SV40 3:UTR comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 1883. In some embodiments, the SV40 3’ UTR comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1883. In some embodiments, the 3’ UTR comprises a polyadenylation (pA) site and a cleavage site. In some embodiments, the polyadenylation site is an SV40 pA site.

[0184] In some embodiments, a transgene as described in any embodiment of the disclosure further comprises a promoter, wherein the promoter is located 5’, relative to all of (i), (ii), and (iii). In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the tissue-specific promoter is an MHCK7 promoter. In some embodiments, an MHCK7 promoter comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 1880. In some embodiments, an MHCK7 promoter comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1880.

[0185] In some embodiments, the alternatively-spliced exon cassette comprises a nucleic acid sequence which is 450 to 650 nucleotides in length. Aspects of the disclosure relate to a recombinant viral genome comprising a transgene as described in any embodiment of the disclosure. In some embodiments, the recombinant viral genome is a genome from a recombinant adeno-associated virus (rAAV). In some embodiments, the transgene is flanked by AAV inverted terminal repeat (ITR) sequences. In some embodiments, the AAV ITR sequences are AAV2 ITR sequences. In some embodiments, an AAV2 ITR comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 1879. In some embodiments, an AAV2 ITR comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 1879.

[0186] In some embodiments, the recombinant viral genome comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ II) NO: 105 or SEQ ID NO: 106. In some embodiments, the recombinant viral genome comprises a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 105 or SEQ ID NO: 106.

[0187] Aspects of the disclosure relate to an rAAV particle comprising a recombinant viral genome as described in any embodiment of the disclosure. In some embodiments, the rAAV particle comprises AAV serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or AAV derivative or pseudotype AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV- HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAA Shi 110, AAV2 (Y-»F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. In some embodiments, the rAAV particle further comprises at least one helper plasmid. In some embodiments, the helper plasmid comprises a rep gene and a cap gene. In some embodiments, the rep gene encodes Rep78, Rep68, Rep52, or Rep40, and / or wherein the cap gene encodes a VP1, VP2, and / or VPS region of the viral capsid protein. In some embodiments, the r,AAV particle comprises two helper plasmids. In some embodiments, the first helper plasmid comprises a rep gene and a cap gene and the second helper plasmid comprises a El a gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.

[0188] Aspects of the disclosure relate to a recombinant viral genome comprising a transgene. In some embodiments, the transgene comprises: (i) a constitutive exon and one or more intronic sequences; (ii) an alternative exon cassette; and (iii) a coding region of interest. In some embodiments, the alternative exon cassette comprises: (a) an alternatively-spliced exon; (b) at least a portion of the intron immediately upstream of the alternatively-spliced exon, and (c) at least a portion of the intron immediately downstream of the alternatively-spliced exon. In some embodiments, if the wild-type alternatively-spliced exon does not comprise an ATG start codon at its 3’ end: (1) the 3’ end of the alternatively-spliced exon comprises 1-3 nucleic acid substitutions relative to the wild-type alternatively-spliced exon to form an ATG start codon, and (2) the first 10 nucleotides of the intron immediately downstream of the alternatively-spliced exon comprise 1-5 nucleic acid substitutions relative to the wild-type intron immediately downstream of the wild-type alternatively-spliced exon.

[0189] In some embodiments, the 1-5 nucleic acid substitutions of (2) increase splice site strength. In some embodiments, any wild-type start codons within the alternatively-spliced exon located upstream of the ATG start codon at the 3’ end of the alternatively-spliced exon are disrupted or deleted. In some embodiments, the recombinant viral genome further comprises a tissue-specific promoter upstream of the alternative exon cassette. In some embodiments, the coding region of interest, is or is derived from a naturally occurring coding region of MTM1 or CAPN3. In some embodiments, the tissue-specific promoter is an MHCK7 promoter. In some embodiments, the alternative exon is exon 11 of the BIN I gene. In some embodiments, the constitutive exon is exon 6 of the SMN1 gene. In some embodiments, the alternative exon cassette promotes skeletal muscle expression of the coding region of interest and reduces cardiac muscle expression of the coding region of interest. In some embodiments, the alternative exon cassette is approximately 600 nucleotides in length.

[0190] Aspects of the disclosure relate to a method of treating a disease or condition in a subject comprising administering a recombinant viral genome or an rAAV particle according to any embodiment, of the present disclosure to the subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human. In some embodiments, the recombinant viral genome or rAAV particle is administered to the subject at least one time. In some embodiments, the viral genome or rAAV particle is administered to the subject 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In some embodiments, the viral genome or rAAV particle is administered to the subject parenterally, subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro-ventricularly, intramuscularly, intrathecally (IT), intraci sternal ly, intraperitoneally, enterally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs. In some embodiments, the viral genome or viral particle is administered to the subject by intravenous injection, intramuscular injection, intrathecal injection, or intravitreal injection. In some embodiments, the disease or condition is a disease or condition selected from the group consisting of Dentatorubral-pallido-luysian atrophy (DRPLA), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), Fragile X syndrome of mental retardation (FMRI), Fragile X tremor ataxia syndrome (FXTAS), FRAXE mental retardation (FMR2), Friedreichs ataxia (FRDA), Huntington disease (HD), Huntington disease-like 2 (HDL2), Oculopharyngeal muscular dystrophy (OPMD), Myoclonic epilepsy type 1, Alzheimer’s disease, ALS / FTD, spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2), spinocerebellar ataxia type 3 (SCA3), spinocerebellar ataxia type 6 (SCA6), spinocerebellar ataxia type 7 (SCA7), spinocerebellar ataxia type 8 (SCA8), spinocerebellar ataxia type 10 (SCA10), spinocerebellar ataxia type 12 (SCA12), spinocerebellar ataxia type 17 (SCA17), Syndromic / non-syndromic X-linked mental retardation, Emery-Dreifuss muscular dystrophy type 2, familial partial lipodystrophy, limb girdle muscular dystrophy type IB, dilated cardiomyopathy, familial partial lipodystrophy, Charcot-Mari e-Tooth disorder type 2B1, mandibuloacral dysplasia, childhood progeria syndrome (Hutchinson-Gilford syndrome), Werner syndrome, Dilated cardiomyopathy (DCM), Hypertrophic cardiomyopathy (HCM), Restrictive cardiomyopathy (RCM), Left Ventricular Non-compaction (LVNC), Arrhythmogenic Right Ventricular Dysplasia (ARVD), takotsubo cardiomyopathy, Duchenne muscular dystrophy, Becker muscular dystrophy, Limb-girdle muscular dystrophy. Facioscapulohumeral muscular dystrophy, Congenital muscular dystrophy, Oculopharyngeal muscular dystrophy, Distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, dementia, Parkinson's disease (PD), a PD-related disorder, Prion disease, a motor neuron disease (VXD), Progressive bulbar palsy (PBP), Progressive muscular atrophy (PM A). Primary lateral sclerosis (PLS), Spinal muscular atrophy (SMA), a bladder cancer, a breast cancer, a colorectal cancer, a kidney cancer, a lung cancer, a lymphoma, a melanoma, an oral cancer, an ovarian cancer, an oropharyngeal cancer, a pancreatic cancer, a prostate cancer, a thyroid cancer, a uterine cancer, Down syndrome, Prader- Willi Syndrome (PWS), Bloom Syndrome, Cockayne Syndrome Type I -216400, Cockayne Syndrome Type III, Cockayne Syndrome Type I, Hutchinson-Gilford Progeria Syndrome, Mandibuloacral Dysplasia with Type A Lipodystrophy, Progeria, Adult Onset Progeroid Syndrome, Neonatal Rothmund-Thomson Syndrome, Seip Syndrome, Werner Syndrome, Replication Focus-Forming Activity 1, myotubular myopathy, Danon Disease, and / or centronucl ear myopathy .

[0191] BRIEF DESCRIPTION OF DRAWINGS

[0192] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0193] FIG. 1 is a schematic illustrating the concept of a recombinant viral genome (e.g., rAAV or lentivirus) modified to include a transgene comprising a coding region of interest (e.g., encoding a therapeutic protein) under regulatory’ control by an alternatively-spliced exon (or an alternatively-spliced exon cassette). Step (b) shows the formation of a pre-mRNA which includes the coding region of interest and the alternatively-spliced exon. Step (c) shows the splicing-out or splicing-in of the alternatively -spliced exon based on one or more conditions (e.g, cell type, disease state, or other intracellular environmental signal). The splicing-out of the alternatively- spliced exon results in mRNA isoform 1 in (d), whereas the splicing-in of the alternatively- spliced exon (ASE) results in mRNA isoform 2 in (e). As shown in (g), the absence of the alternatively-spliced exon removes a positive or negative regulatory' ds-element. The removal of a positive regulatory cA-element, such as a translation start signal, will result in the downregulation or decreased expression of the transgene, i.e., the reduced expression of the product encoded by the coding region of interest. However, the removal of a negative regulatory c / x-element, such as mRNA degradation element, may lead to the upregulation or increased expression of the transgene, i.e., the increased expression of the product encoded by the coding region of interest. As shown in (h), the presence of the alternatively-spliced exon splices-in a positive or negative regulatory / m-element associated with the alternatively-spliced exon. The maintenance of a positive regulatory c / s-element, such as a translation start signal, will result in the upregulation or increased expression of the transgene, i.e., the increased expression of the product encoded by the coding region of the transgene. However, the maintenance of a negative regulatory czs-element, such as mRNA degradation element, may lead to the downregulation or decreased expression of the transgene, i.e., the decreased expression of the product encoded by the coding region of the transgene.

[0194] FIG. 2 shows different models of alternative splicing which could be utilized in the nucleic acid vectors of the present disclosure. From top to bottom: a skipped exon model of alternative splicing, a retained intron model of alternative splicing, an alternative 5’ splice site model of alternative splicing, an alternative 3’ splice site model of alternative splicing, a mutually exclusive exon model of alternative splicing, and an alternative last exon model of alternative splicing. White regions represent constitutive exons throughout. Gray regions represent alternatively-spliced exons. One or more of the constitutive exons may be modified to contain a coding region of interest, e.g., a coding region of a transgene that encodes a therapeutic protein.

[0195] FIGs. 3A-3B show two schematics representing exemplary recombinant viral genomes. FIG. 3A shows a typical recombinant adeno-associated virus (rAAV) genome design. Two AAV inverted terminal repeats (ITRs) flank the transgene. The transgene may comprise a coding region of interest (e.g., encoding a therapeutic protein) under regulator}' control of an alternatively-spliced exon (or cassette comprising an alternatively -spliced exon). In various embodiments, the cassettes (e.g., in the context of a transgene) may take on the architectures shown in any of FIGs. 2 or 3-8, or any other suitable arrangement of elements so long as the alternatively-spliced exon is configured to regulate the expression of the coding region of interest of the transgene. FIG. 3B shows a typical recombinant lentivirus genome design. The 5’ and 3’ sequences of the lentivirus genome flank the packaging signal (PSI), rev response elements (RRE), and transgene. The transgene may comprise a coding region of interest (e.g, encoding a therapeutic protein) under regulator} / control of an alternatively-spliced exon (or cassette comprising an alternatively-spliced exon). When transgenes are introduced using a lentivirus vector genome, the promoter and nucleotide sequence comprising the transgene sequence must be encoded on the minus strand of the lentivirus genome to prevent splicing during virus production and packaging. In various embodiments, the cassettes (e.g., in the context of a transgene) may take on the architectures shown in any of FIGs. 2 or 3-8, or any other suitable arrangement of elements so long as the alternatively-spliced exon is configured to regulate the expression of the coding region of interest of the transgene. FIGs. 4A-4T show seven embodiments contemplated for the structural configuration of the cassettes (e.g., in the context of a transgene) that may inserted into a recombinant viral vector genome and which comprise an alternatively-spliced exon and comprising, in some embodiments, at least one positive or negative regulatory cA-element. Non-limiting examples of positive or negative regulatory cA-elements located within the alternatively-spliced exons can include, without limitation, a translation start codon, a translation stop codon, a binding site for an RNA binding protein that serves to positively regulate mRNA translation, a binding site for an RNA binding protein that serves to negatively regulate mRNA translation, a binding site for a nucleic acid molecule (e.g., an miRNA) that serves to positively regulate mRNA translation, a binding site for a nucleic acid molecule (e.g., an siRNA) that serves to negatively regulate mRNA stability or degradation, a binding site for an RNA binding protein that serves to positively regulate mRNA stability or degradation, a binding site for an RNA binding protein that serves to negatively regulate mRNA stability or degradation, a binding site for a nucleic acid molecule (e.g, an miRNA) that serves to positively regulate mRNA stability or degradation, a ligand-responsive sequence, or a binding site for a nucleic acid molecule (e.g, an siRNA) that serves to negatively regulate mRNA stability or degradation. This list of examples is not intended to place any limitation on the scope and meaning of the positive and negative cis- elements and the disclosure embraces any genetic element or region positioned within, or at least associated with, an alternatively-spliced exon which exerts a positive or negative control on the overall expression of a transgene (e.g, encoding a therapeutic protein or a miRNA). In some cases, the cis-element is within the alternatively -spliced exon, but in other cases, the cis-element is separate from, but at least associated with, the alternatively-spliced exon, such that it becomes spliced-in or spliced-out at the same time as the alternatively-spliced exon. In various embodiments, the cassettes (e.g., in the context of a transgene) may include one or more additional components, including one or more introns. In FIGs, 4A-4C, the constitutive exons not comprising the coding region of interest are represented by narrow rectangles, introns are represented as dashed lines, and the alternatively-spliced exons are represented as shaded narrow rectangles. The exon or exons comprising the coding region (or portions thereof in the case of where the coding region is split into separate exons) are indicated as solid thick white rectangles. FIG. 4A is a schematic of a cassette (e.g, in the context of a transgene) embodiment whereby the alternatively-spliced exon is upstream of the exon encoding the coding region of interest. Said another way, in this embodiment, the alternatively-spliced exon is to the 5’ of the exon encoding the coding region of interest. FIG. 4B is a schematic of a cassette (e.g., in the context of a transgene) embodiment whereby the alternatively-spliced exon is downstream of the exon encoding the coding region of interest. Said another way, in this embodiment, the alternatively- spliced exon is to the 3:of the exon encoding the coding region of interest. FIG. 4C is a schematic of a cassette (e.g, in the context of a transgene) embodiment whereby the alternatively-spliced exon is positioned between two separate exons encoding portions of the coding region of interest. Said another way, in this embodiment, the alternatively-spliced exon is between the exons encoding the portions of the coding region of interest. FIG. 4D shows a nonlimiting embodiment of an approach that puts a gene sequence under control of a ligand- responsive sequence. In this embodiment, a naturally occurring gene can be engineered to become under the control of a ligand by inserting the cassette into the gene. The portions upstream and downstream of the site at which the cassette is inserted then become separate exons, FI€». 4E shows a non -limiting embodiment of a transgene comprising an alternatively- spliced cassette. In this embodiment, the expression cassette comprises a general structure comprising at least, one alternative exon, at least two introns flanking the alternative exon, a ligand-response sequence, and a plurality of splice sites. FIG. 4F shows a non-limiting embodiment of a transgene comprising a non-continuous start codon split by the alternatively spliced cassette. In this embodiment, the exons comprise a non-continuous start, codon such that the 3’ most nucleotides of the upstream exon comprise an A or AT and the 5’ most nucleotides of the downstream exon comprise a TG or G, respectively. FIG. 4G shows a non-limiting embodiment of an alternatively spliced exon cassette comprising a stop codon that is inserted between two consecutive coding sequences of a gene (e.g., two exons of a gene). In this embodiment, the exons flanking the cassette are not translated in the absence of ligand and the presence of a pre-mature stop codon in the alternative exon. FIG. 4H shows a non-limiting embodiment of an alternatively spliced exon cassette that is inserted in a coding sequence for a regulatory RNA molecule. In this embodiment, the two exons encode an interfering RNA, such as a miRNA, such that removal of the alternative exon produces a functional miRNA molecule that is capable of regulating gene expression. FIG. 41 shows a non-limiting embodiment of a nucleic acid design to regulate RNA splicing using a ligand-responsive sequence. In this embodiment, an intron splits two exons. Ligand binding to the ligand-responsive sequence results in alternative splicing, wherein the exons are brought together to form an RNA that encodes the protein of interest. FIG. 4J shows a non-limiting embodiment of a nucleic acid design to regulate RNA splicing using a ligand-responsive sequence. In this embodiment an intron splits two exons. Ligand binding to the ligand-responsive sequence results in alternative splicing, wherein the exons are disrupted and the RNA cannot encode the protein of interest. FIG. 4K shows a non-limiting embodiment of a ligand-responsive nucleic acid that can be used to differentially regulate the expression of protein isoforms. The alternative exon is flanked by introns. Ligand binding results in exclusion of the alternative exon in the spliced RNA thereby encoding the shorter isoform of the protein. The absence of the ligand results in inclusion of the alternative exon from the spliced RNA which encodes the longer isoform of the protein. FIG. 4L shows a non-limiting embodiment of a ligand-responsive nucleic acid that can be used to differentially regulate the expression of protein isoforms. The alternative is flanked by introns. Ligand binding results in inclusion of the alternative exon in the spliced RNA thereby encoding the longer isoform of the protein. The absence of the ligand results in exclusion of the alternative exon from the spliced RNA which encodes the shorter isoform of the protein. FIG. 4M shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates translation of an RNA. The alternative exon comprises a ligand-responsive sequence and prevents a start codon from being in frame with the RNA. Inclusion of the alternative exon in the presence of the ligand leads to production of the protein corresponding to the RNA. FIG. 4N shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates translation of an RNA. The alternative exon comprises a ligand-responsive sequence and prevents a start codon from being in frame with the RNA. Inclusion of the alternative exon in the absence of the ligand leads to production of the protein corresponding to the RNA. FIG. 40 shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates translation of an RNA. Presence of the alternative exon causes a pre-mature stop codon to be in frame with the RNA. Inclusion of the alternative exon in the presence of the ligand leads to an RNA which cannot be translated into a protein. FIG. 4P shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates translation of an RNA. Presence of the alternative exon causes a pre-mature stop codon to be in frame with the RNA. Exclusion of the alternative exon in the presence of the ligand leads to an RNA which can be translated into a protein. FIG. 4Q shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates production of a microRNA. Inclusion of the second sequence in the absence of the ligand results in formation of the complete microRNA which can function to reduce expression of a target transcript. FIG. 4R shows a nonlimiting embodiment of a ligand-responsive nucleic acid that regulates production of a microRNA. Inclusion of the second sequence in the presence of the ligand results in formation of the complete microRNA which can function to reduce expression of a target transcript. FIG. 4S shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates production of a microRNA. Inclusion of the second sequence in the absence of the ligand disrupts microRNA structure thereby inhibiting its ability to reduce expression of a target transcript. FIG. 4T shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates production of a microRNA. Inclusion of the second sequence in the presence of the ligand disrupts microRNA structure thereby inhibiting its ability to reduce expression of a target transcript.

[0196] FIGs. 5A-5G depict various embodiments of the general model of the cassettes (e.g, in the context of a transgene) of FIG, 4A. FIG. 5A depicts an embodiment of the ‘‘skipped exon model.’'’ FIG. 5B depicts an embodiment of the “retained intron model.” FIG. 5C depicts an embodiment of the “alternative 5’ splice site model.” FIG. 5D depicts an embodiment of the “alternative 3’ splice site model.” FIG. 5E depicts an embodiment of the “mutually exclusive exon model.” FIG. 5F depicts an exemplary alternatively spliced transcript. FIG. 5G depicts an exemplary constitutively spliced transcript.

[0197] FIGs. 6A-6G depict various embodiments of the general model of the cassettes (e.g., in the context of a transgene) of FIG. 4B. FIG. 6A depicts an embodiment of the “alternative last exon model.” FIG. 6B depicts an embodiment of the “skipped exon model.” FIG. 6C depicts an embodiment of the “retained intron model.” FIG. 6D depicts an embodiment of the “alternative 5’ splice site model.” FIG. 6E depicts an embodiment of the “alternative 3’ splice site model.” FIG. 6F depicts an embodiment of the “mutually exclusive exon model.” FIG. 6G depicts an embodiment of the “alternative last exon model.”

[0198] FIGs. 7A-7F depict various embodiments of the general model of the cassettes (e.g, in the context of a transgene) of FIG. 4C. FIG. 7A depicts the “skipped exon model.” FIG. 7B depicts the “retained intron model.” FIG. 7C depicts “alternative 5’ splice site model.” FIG. 7D depicts the “alternative 3’ splice site model.” FIG. 7E depicts the “mutually exclusive exon model.” FIG. 7F depicts the “alternative last exon model.” FIGs. 8A-8B show embodiments of the general model of the cassettes (e.g., in the context of a transgene). FIG. 8A shows an embodiment of the general model of the cassettes (e.g, in the context of a transgene) of FIG. 4 A. In the approach shown, the cassette (e.g:, in the context of a transgene) comprises a constitutive exon at the left, an alternatively-spliced exon comprising an ATG (an example of a positive regulatory cA-element) in the middle, and a constitutive exon comprising a coding region of interest (shown with the natural ATG start codon removed to eliminate translation of that exon without further positive control by the alternatively-spliced exon). Black lines indicate intronic sequences (e.g., the flanking introns of the alternatively-spliced exon). Alternative reading frames within the exon comprising the coding sequence may in some embodiments be removed, as appropriate. Under alternative splicing conditions, which are specific to the nature of the chosen alternatively-spliced exon, the alternatively-spliced exon will be included, and productive translation of the coding sequence will result. To the contrary, under homeostatic conditions (normal splicing conditions), only the consti tutive exon will be i ncluded, the presence of the ATG start codon in the alternatively- spliced exon will be eliminated, and the coding sequence will not be translated. The upper dotted lines show the splicing pattern leading to a splicing-in of the alternatively-spliced exon (expression of the coding region). The lower dotted lines show the splicing pattern leading to a splicing-out of the alternative-spliced exon (no or reduced expression of the coding region). FIG. SB shows an embodiment of the general model of the cassettes (e.g, in the context of a transgene) of FIG. 4C. In the approach shown, the cassette (e.g., in the context of a transgene) comprises an alternatively -spliced exon (shown in gray) positioned between two separate constitutive exons each comprising a portion of the desired coding region. The exon to the left comprises the 5’ end of the coding sequence and the exon to the right comprises the 3’ end of the coding region. An in-frame stop codon is inserted into the alternatively-spliced exon at a location which is >50 nucleotides upstream of the next downstream splice site. Under alternative splicing conditions, which are specific to the nature of the chosen alternatively-spliced exon, the alternatively-spliced exon will be included, and NMD (nonsense-mediated mRNA decay) will result. Under homeostatic conditions (normal splicing conditions), only the constitutive exon wall be included, and the 5’ and 3’ ends of the coding sequence will be joined resulting in productive translation of the coding sequence. The upper dotted lines show the splicing pattern leading to a splicing-in of the alternatively-spliced exon (no or reduced expression of the coding region due to active NMD). The tower doted tines show the splicing pattern leading to a splicing-out of the alternative-spliced exon (expression of the coding region).

[0199] FIG. 9 shows a configuration of a gene therapy cargo whose translation can be regulated by alternative splicing. Inclusion of an alternative exon that ends in “ATG” can lead to translation of the downstream coding sequence. Exclusion will prevent appropriate protein translation of the downstream coding sequence.

[0200] FIG. 10 shows a construct design for the screening of alternative exon cassettes with regulatory activity. The construct used the SMN1 exon 6 and intron 6 / 7 context. Test alternative exon cassettes were inserted between portions of SAINI intron 6 and 7. An MHCK7 was used. The coding sequence was derived from the human MTM1 gene. The 3’ UTR contained an SV40 polyadenylation and cleavage site. AAV2 ITRs flanked the construct. Splice site scores of the flanking constitutive exons are listed.

[0201] FIG. 11 show's a strategy to prevent undesired translation of peptides from alternative reading frames of MTM1. Amino acids generated in the MTM 1 reading frame are listed (e.g., GCT encodes Alanine); only the 5’ end of MTM1 sequence is shown. Substitutions that preserve MTM1 reading frame but terminate alternative reading frames are shown. Arrows denote point mutations made to generate stop codons that would terminate open reading frames in the +1 and +2 reading frames. Nucleic acid substitutions are denoted by lower-case letters.

[0202] FIG. 12 shows a strategy to preserve splice site strength following mutation of bases to introduce ATG to the ends of alternative exons by altering 5' splice site sequences. Because the addition of ATG to the end of each alternative exon may change the splice site strength, intronic bases to were altered to maintain splice site strength and preserve splicing activity. All upstream ATGs were also removed from alternative exons. Splice site strengths were scored by MaxEntScan and are shown. Splice sites are listed for the endogenous sequence (top), the endogenous sequence altered such that ATG is introduced (middle), and a “compensated” splice site sequence (botom). Nucleic acid substitutions are denoted by lower-case letters.

[0203] FIG. 13 show's a construct barcoding strategy. For the first round of screening, a barcode strategy was used in which synonymous mutations were made and used to identify each candidate alternative exon uniquely. Barcodes w'ere -350 NT away from the splice site with the intent of not affecting splicing. Barcodes were comprised of 5 wobble positions and generated by randomly cloning in: AAY CTN AGA TTY GCN (SEQ ID NO: 101) (2 * 4 * 2 * 4 = 64 possibilities). Barcode sequences (each 5 nucleotides in length) are shown at the end of each row in parentheses.

[0204] FIGs. 14A-14C show percent spliced in (psi) values for each tested cassette exon in various tissues. Psi values were plotted in heart (H), tibialis anterior (TA), and liver (L). Data for tibialis anterior was obtained from animals injected intramuscularly, and data from the other tissues was obtained from animals injected intravenously. FIG. 14A shows data obtained from the following tested cassette exons (from left to right): ARFGAP2, BINI, CAMK2B, and KIF13A. FIG. 14B show's data obtained from the following tested cassette exons (from left to right): KSR1, LGMN, NRAP, and PDLIM3. FIG. 14C shows data obtained from the following tested cassette exons (from left to right): PICALM, PKP2, and VPS39.

[0205] FIGs. 15A-15B show percent spliced in (psi) values for each tested exon in tibialis anterior at various times following injection. Psi values were plotted for each sample versus every' other sample. The number following the dash indicates the replicate number for that particular week. FIG. ISA show's a first comparison of psi values obtained at different time points following injection. FIG. 15B shows a second comparison of psi values obtained at different time points following injection.

[0206] FIGs. 16A-16B show the ratios of RNA binding protein (RBP) RNA expression in heart vs. skeletal muscle, or vice-versa. RNA expression values for RNA binding proteins were obtained from publicly available databases. The ratio of expression in heart versus skeletal muscle was computed; the RBPs showing the strongest bias in either direction were plotted. FIG. 16A show's the RBPs which were found to be enriched in muscle tissue, relative to heart tissue. FIG. 16B shows the RBPs winch were found to be depleted in muscle tissue, relative to heart tissue.

[0207] FIG. 17 shows that the intronic sequence upstream of BINI exon 11 is enriched for CAC motifs. Top: -250 nucleotides upstream of BINI exon 11 are shown. Every / CAC motif is shown in bold text. Bottom: the last 34 bases of the intron are shown from human, rhesus macaque, mouse, dog, and elephant. Every species shown has 2 CAC motifs within this region except for dog.

[0208] FIG. IS shows percent spliced in (psi) values for BINI exon 11 in human, rhesus macaque, and dog. Psi values for BINI exon 11 for these species were obtained from publicly available datasets and plotted. The dog data includes data from animals modeling XLMTM1, including those also being treated with AAV-MTM1. AAV low, mid, and high denotes AAV- MTM1 treatment in XLMTM1 dogs from Dupont el al. (2020).

[0209] FIG. 19 shows splice site variants which were considered in the high throughput screen to optimize the BINI exon 11 cassette. The endogenous BINI 3’ splice site is listed (top), along with the endogenous BINI 5’ splice site (second row from top), the endogenous BINI 5’ splice site sequence altered such that ATG is introduced (third row from top), and the “compensated” version characterized in the first screen (bottom). Additional splice sites tested are listed below. Nucleic acid substitutions are denoted by lower-case letters.

[0210] FIG. 20 shows intronic variants which were considered in the high throughput screen to optimize the BINI exon 11 cassette. Sequence from the downstream intron of BINI exon 1 1 is shown (top). Putative MBNL binding sites (YGCY motifs) are bolded. Putative RBFOX binding sites (TGCATG) are underlined. Sequence that includes 4 possible alterations is shown (bottom). The alterations, denoted with lower-case letters, either generate additional MBNL binding sites (the first, second, and third alterations, from 5’ to 3’) or an additional RBFOX site (the fourth alteration). Consideration of 0, 1, 2, 3, or 4 alterations in all combinations yields 16 possible sequences to test.

[0211] FIG. 21 show's a strategy to use PCR amplicons to read the association between barcodes and variants (the codebook). Given short read Illumina sequencing (-75 nucleotides), a PCR strategy was used to associate the downstream barcode with upstream sequence variants.

[0212] FIG. 22 shows the number of barcodes encoding each variant. A histogram of the number of barcodes encoding each variant is shown for the plasmid library. On average, -8 barcodes encode each variant.

[0213] FIGs. 23A-23C show scatters of percent spliced in (psi) values for each variant in different tissues. Each point represents the mean psi for each variant across all barcodes representing that variant. Data from selected tissues is shown. FIG. 23A shows scatter between 2 heart samples, which lies along the diagonal (indicating reproducibility). FIG. 23B shows scatter between 2 gastrocnemius samples, which also lies along the diagonal (indicating reproducibility). FIG. 23C shows scatter between heart and skeletal muscle samples, which lies above the diagonal. This is because psi for most variants is higher in skeletal muscle than in heart. FIGs. 24A-24B show scatters of mean percent spliced in (psi) as computed across multiple animals. Each point represents the mean psi for each variant across multiple animals (n=4 for all tissues). FIG. 24A shows data obtained from tibialis anterior (y-axis) versus heart (x-axis) tissue. FIG 24B shows data obtained from gastrocnemius (y-axis) versus heart (x-axis) tissue.

[0214] FIGs. 25A-25D show percent spliced in (psi) values as a function of splice site strength for selected samples. Psi values for each variant were grouped by 3:or 5’ splice site strength; data is shown only for heart sample I and gastrocnemius sample 1. There is a trend such that strong splice sites tend to yield higher inclusion levels. FIG. 25. A shows the 3' splice site strength relative to the psi in heart tissue for heart sample 1 . FIG. 25B shows the 5’ splice site strength relative to the psi in heart tissue for heart sample 1. FIG. 25C shows the 3’ splice site strength relative to the psi in gastrocnemius tissue for gastrocnemius sample 1. FIG. 251) shows the 5’ splice site strength relative to the psi in gastrocnemius tissue for gastrocnemius sample I .

[0215] FIGs. 26A-26B show scatters of mean percent spliced in (psi) for each variant as computed across multiple animals when linked to a CAPN3 cargo. Each point represents the mean psi for each variant across multiple animals (u -4 for all tissues). FIG. 26A shows data obtained from tibialis anterior (y-axis) versus heart (x-axis) tissue. FIG. 26B shows data obtained from gastrocnemius (y-axis) versus heart (x-axis) tissue.

[0216] FIGs. 27A-27B show7scatters of mean percent spliced in (psi) for each variant when linked to an MTM1 cargo versus a CAPN3 cargo. Each point represents the mean psi for each variant across multiple animals (n:==4 for all tissues). The psi value for variants linked to the MTM1 cargo is shown on the x-axis and the psi value for the same variants linked to the CAPN3 cargo is shown on the y-axis. FIG. 27A shows data for heart tissue. FIG. 27B shows data for gastrocnemius tissue.

[0217] FIG. 28 shows an exemplary' riboswitch-regulated alternative exon library design. MBNL1 exon 5 is flanked by 39 different 3’ splice sites and 20 different 5’ splice sites in different construct variants. The 5 ’splice site is incorporated into the communication stem of the downstream riboswitch. In the absence of the drug, the 5’ splice site is recognized by U1 snRNP and the exon is included to yield full length MBN. In the presence of the drug, the 5’ splice site is occluded and causes exon 5 skipping. FIG. 29 shows an exemplary workflow for the massively parallel barcoded splicing assay. The barcoded synthetic plasmid library / was sequenced to obtain the codebook that links barcode sequences to specific splice site variants. The plasmid library was transfected to analyze splicing patterns for each barcode in the presence and absence of drug. The codebook was then used to decode barcodes, to characterize splicing patterns for individual variants.

[0218] FIG. 30 shows Psi data for barcodes and variants. For the left-side panel, psi for uniquely identifiable barcodes in the presence and absence of drug is shown. Barcodes that appear in all six samples (3x drug-, 3x drug+) and in the codebook were plotted. Error bars are shown for three biological replicates. For the right-side panel, psi for 780 variants with / without drug is shown. Psi for barcodes linked to the same variants were averaged, and error bars are shown for three biological replicates. The triangle highlights variants with Apsi >0.3, representing promising candidates with large dynamic splicing changes in response to drug treatment.

[0219] FIGs. 31A-31C show?analyses of psi and delta psi for various 3’ and 5’ splice site variants. FIG. 31A shows variants that were grouped according to 3’ splice site identity and sorted by mean psi in the absence of tetracycline. FIG. 31B shows variants that were grouped according to 5’ splice site identity and sorted by mean psi in the absence of tetracycline. FIG. 31C shows delta psi plotted in a heatmap format, in which row / columns denote specific 3’ and 5’ splice site combinations. Splice sites were sorted by mean psi in the absence of tetracycline.

[0220] FIG. 32 shows protein isoform regulation from a single variant. The left-side panel shows gel electrophoresis analysis of RT-PCR products analyzed by fragment analyzer. The right-side pane shows western blot analysis of MBNL protein using an anti-HA tag antibody.

[0221] FIG. 33 show's an exemplary / cassette configuration for alternative splicing-regulated protein expression. The alternative splicing cassette was placed between an ATG and downstream coding sequence for the protein of interest. An HA tag was placed before the ATG for protein immunoblotting.

[0222] FIG. 34 shows exonic splicing switch variants. Nucleotides that base-pair within the communication stem of the riboswitch are underlined.

[0223] FIG. 35 shows skipping percentage of exonic splicing switch variants with / without drug.

[0224] RNA splicing assays were performed by RT-PCR and fragment analyzer. FIG. 36 shows exclusion percentages of AltEx9 following different tetracycline concentrations. Variant AltEx9 was tested against different concentrations of tetracycline, and exon-skipping RNA isoform percentages were calculated.

[0225] FIGs. 37A-37B show RNA splicing and protein expression regulation of three variant constructs. FIG. 37 A shows RT-PCR analysis of RNA splicing patters of three constructs that \vere fused to a nano-luciferase reporter in response to drug treatment. FIG. 37B show's nanoluciferase enzymatic activity for three variants, along with exclusion and inclusion isoform controls. Nano-luciferase signal was normalized by co-transfected firefly luciferase (fLuc).

[0226] FIG. 38 show's alternative splicing regulated protein expression by reconstructing translation initiation. Exon inclusion disrupts translation initiation sites and exon skipping reconstructs strong Kozak sequences for translation of a downstream protein of interest.

[0227] FIG. 39 show's exemplary designs for alternative splicing-regulated RNA interference. An exemplary' pri-miR 16_2 scaffold bearing the miRNA-targeting luciferase reporter is shown. The dashed box denotes the sequence location in which the alternative splicing cassette should be placed.

[0228] FIG. 40 shows riboswitch-regulated RNAi. Firefly Luciferase reporter signal was normalized by co-transfected renilla luciferase. RNAi (+) was from the pri-miR 16_2 scaffold bearing fLuc miRNA;RNAi while (-) is from a non-functional control RNA. The RNAi AltEx9 has alternative splicing cassette AltEx9 inserted in the pri-miR scaffold.

[0229] FIG. 41 shows a non-limiting example of a nucleic acid design to regulate 5. aureus Cas9 by tetracycline.

[0230] FIGs. 42A-42B show representative cellular screening results for the nucleic acid shown in FIG. 41. FIG. 42A shows a scatter plot of PSI for each of 2760 variants analyzed in a high throughput screen in HEK293T cells. Each point represents the behavior of an individual variant at a particular dose of tetracycline (y-axis) relative to no tetracycline (x~axis). Circles, squares and triangles denote treatment with 25 uM, 50 pM and 100 pM tetracycline, respectively. FIG. 42B show's a heat map of delta PSI (no tetracycline minus 100 pM tetracycline) as a function of aptamer stem length and splice site strength.

[0231] FIG. 43 shows a non-limiting example of a nucleic acid design to regulate erythropoietin (EPO) expression by a risdiplam-responsive sequence. FIG. 44 shows representative cellular screening results for the nucleic acid design shown in FIG. 43. The scatter plot shows percent intron removal for 30,455 variants analyzed in a high throughput screen in HEK293T cells. Each point represents the behavior of an individual variant at a particular dose of risdiplam (y-axis) relative to no risdiplam (x-axis). Circles, squares and triangles denote treatment with 250 nM, 500 nM, and 1000 nM risdiplam, respectively.

[0232] FIGs. 45A-45B show representative data from real-time PCR (RT-PCR) analyses of individual variants shown in FIG. 44. FIG. 45A shows products made from cloning seven distinct variants and testing the expression of said said sequences with RT-PCR. Fragment analysis shows the abundance of intron retained product (top band) or intron spliced product (bottom band) in the presence (1 pM) or absence of risdiplam. FIG, 45B shows quantitation of the data shown in FIG. 45A.

[0233] FIGs. 46A-46C show a non-limiting example of a strategy for using risdiplam- responsive motifs to regulate GABRG2 isoforms. FIG. 46A shows an overview of the mechanism through which risdiplam-responsive sequences identified from the screen performed in FIGs. 44 and 45A-45B (variants 3 and 7) were incorporated into an alternatively spliced gene that allows for production of either the exon 9-containing (long) i soform of GABRG2 or the exon 9-skipped (short) isoform. The gray box indicates GABRG2 exons 1 through 8. The white box indicates exons 9 and 10, and the dotted box indicates the risdiplam-responsive sequence. The black box indicates exon 10 alone. The introns are synthetic. Addition of risdiplam leads to inclusion of the alternative exon and production of GABRG2L. FIG. 46B shows representative data of tw'O different risdiplam-responsive motifs that were tested in Neuro2A cells using RT- PCR. Primers that target the gray and black boxes was performed to evaluate splicing behavior in the presence (1 pM) or absence of risdiplam. FIG. 46C shows quantitation of the data shown in FIG. 45B.

[0234] FIGs. 47A-47D show a non-limiting example of a strategy for using a risdiplam- responsive motif from POMT2 exon l ib to regulate CSNK1D isoforms. FIG. 47A shows an overview of the mechanism through which risdiplam-responsive sequences were incorporated into an alternatively spliced gene that allows for production of either the exon 9-containing (long) isoform of CSNK1D or the exon 9-skipped (short) isoform. The gray box indicates CSNK1D exons 1 through 8. The white box indicates exons 9 and 10, and the dotted box indicates the risdiplam-responsive sequence derived from POMT2. The black box indicates exon 10 alone. The upstream intron is CSNK1D intron 8, and downstream intron is synthetic. Addition of risdiplam leads to inclusion of the alternative exon and production of the long isoform of CSNKID. FIG. 47B shows representative data from testing a nucleic acid in HEK293T and Neuro2A cells using RT-PCR. Primers that target the gray and black boxes were evaluated for splicing behavior in the presence (1 uM) or absence of risdiplam. FIG. 47C shows quantitation of the RT-PCR data in FIG. 47B. FIG. 47D shows a non-limiting example of strategy wherein the construct tested in FIGs. 47B-47C was further optimized by an A:C mutation at the +10 position in the intron downstream of POMT2 El IB and then a Western blot was performed against protein tags incorporated into the ends of the white and black boxes, respectively. Isoform A indicates the exon 9-skipped isoform. Isoform B indicates the exon 9- included isoform.

[0235] FIGs. 48A-48C show a non-limiting example of a strategy for repurposing exon 1 lb in POMT2 to regulate CasMini. FIG. 48A shows a non-limiting example of a nucleic acid design for a risdiplam-responsive splicing cassette that regulates translation of the N-terminal portion of CasMini. Exon 1 lb and flanking introns from POMT2 were modified to contain a start codon in frame with downstream CasMini. Inclusion of this exon leads to production of an N-terminal portion of CasMini fused to nanoluciferase. FIG, 48B shows representative data from testing the nucleic acid shown in FIG. 48A for responsiveness to varying concentrations of risdiplam in HEK293T. Top: fragment analyzer bands, bottom: quantitation. FIG. 48C shows additional nonliming examples of variants that were cloned and assayed for nanoluciferase signal in the presence (l uM) and absence of risdiplam in Neuro2A cells. CTRL denotes a control plasmid which encodes firefly luciferase but not nanoluciferase, to serve as nanoluciferase substrate control .

[0236] FIGs. 49A-49C show a non-limiting example of a strategy which leverages tetracycline aptamer-regulated splicing to control microRNA biogenesis via exon skipping. FIG. 49 A shows a non-limiting example of a tetracycline-responsive exon cassette placed between two halves of a primary' microRNA sequence. Exon inclusion leads to suboptimal recognition of the microRNA precursor by Dicer and thus lower production of a mature microRNA. Exon skipping leads to proper recognition of the microRNA precursor by Dicer and thus higher production of the mature microRNA. FIG. 49B shows representative data from assaying the nucleic acid shown in FIG. 49A in a Drosha knockout HEK293 cell line. FIG. 49C show's representative Northern Blot data from assaying HEK293T transfected with the nucleic acid shown in FIG. 49A and testing in FIG.

[0237] 49B.

[0238] FIGs. 50A-50C show a non-limiting example of a strategy which leverages branaplam- regulated splicing to control microRNA biogenesis via exon inclusion. FIG. 50A shows a nonlimiting example of a cassette such that branaplam is capable of enhancing exon inclusion via recognition of certain sequences near the 5’ splice site of the alternatively spliced exon. The primary microRNA sequence was split across the 2nd intron of a cassette exon event derived from SF3B3 such that inclusion of the cassette exon facilitates formation of the full microRNA base stem, which can enhance Drosha recognition and processing. FIG. 50B shows representative Northern blot data from testing several branaplam-responsive cassettes. YZ230 is a control that encodes the sequence expected with exon inclusion. YZ231 is a control that encodes the sequence expected with exon skipping. YZ232 is a variant in which the exon cassette is present and can respond to branaplani. FIG. 50C shows representative data from luciferase assay analysis of knockdown by microRNAs encoded by branaplam-responsive cassettes. In each case, luciferase transcript is targeted by the microRNA. 95 is a construct that constitutively generates a microRNA active against luciferase. 259 is a construct that does not generate a microRNA active against luciferase. 231 and 232 are the constructs as shown in (b), both with and without branaplam.

[0239] FIGs, 51A-51B show7a non-limiting example of a strategy for controlling leaky microRNA production due to basal recognition of an incomplete microRNA stem. FIG. 51A shows non-limiting examples of microRNA scaffolds. YZ95 is a potent primary microRNA scaffold that is effectively recognized by Drosha and can downregulate a GFP reporter transcript comprising a target site. YZ293 was produced by mutating bases in the stem of YZ95 which are recognized by Drosha. YZ301 was produced by re-constituting the complete microRNA stem. FIG. 51B shows analyses of GFP silencing in HEK293 cells using YZ95, YZ293, and YZ301.

[0240] DETAILED DESCRIPTION

[0241] The present disclosure relates to the use of alternatively-spliced exons to control the expression of one or more genes of interest (e.g., genes that are useful therapeutically and / or diagnostically). In some embodiments, alternative splicing of an exon can be placed under the control of a ligand by introducing a ligand-binding sequence (e.g., a sequence encoding a ligand- binding aptamer) into an alternatively spliced exon and / or into at least one of the introns flanking the alternatively spliced exon. In some embodiments, a ligand-responsive alternatively spliced exon is introduced into a naturally occurring gene (e.g., at one or both alleles of the gene in the genome of a host cell). In some embodiments, a synthetic gene construct is provided that includes a ligand-responsive alternatively spliced exon. Accordingly, in some embodiments of the application, alternatively spliced exons can be used to regulate one or more aspects of gene expression (e.g., of mRNA translation and / or RNA function) by including one or more translation stop codons, interrupting a start codon, and / or interrupting a functional RNA sequence (e.g., a mRNA, a regulatory RNA, such as an interfering RNA, and / or a ribozyme).

[0242] In some embodiments, one or more aspects of the application (e.g., one or more ligand- responsive alternatively spliced exons) can be used in the context of viral vectors (e.g., AAV viral vectors or lentivirus viral vectors) to effectively regulate the expression of a coding region of interest (e.g., a coding region of a transgene that encodes a therapeutic protein). In certain aspects, the alternatively-spliced exons regulate the expression of a coding region of interest in a condition-sensitive manner (e.g., expression in one type of cell but not another, expression in a diseased condition, or expression in the presence of certain intracellular conditions, such as the presence of a ligand). Accordingly, the present disclosure relates to a new approach for regulating expression of a transgene (or a coding region thereof) from a recombinant viral vector that couples alternatively-spliced exons with the expression of a coding region of interest (e.g., a coding region of a transgene encoding a therapeutic protein). The present disclosure describes a variety of exemplary configurations as to how to combine or otherwise pair the expression of a coding region of interest (or multiple portions of coding regions) with an alternatively-spliced exon, but any suitable arrangement or configuration is contemplated so long as the expression of the coding region of interest (or portions thereof) is configured to come under regulatory control of the alternatively-spliced exon.

[0243] In other aspects, the present disclosure relates to that the use of inducibly-spliced exon cassettes in the context of viral vectors (e.g., AAV viral vectors or lentivirus viral vectors) to effectively regulate the expression of a transgene encoding a therapeutic cargo such as microRNAs (miRNA) and proteins. In certain aspects, the transgene regulates the expression of an inducibly-spliced exon cassette in a condition-sensitive manner (e.g., the presence of a drug or ligand). In some embodiments, the inducibly-spliced cassette encodes an RNA comprising a ligand-responsive sequence which is alternatively spliced (e.g., to exclude or include an alternative exon) in response to ligand binding. In certain aspects, the inducibly-spliced cassette comprises a tnicroRNA (miRNA) sequence and a ligand-responsive aptamer controlling the splicing of the said cassette. Accordingly, the present disclosure relates to a new approach for regulating splicing of a transgene comprising, for example, a miRNA from a recombinant viral vector in a chemically-inducible manner.

[0244] It will be understood that the inducibly-spliced exon cassette will be either spliced out or not spliced in a manner that can be dependent on one or more environmental conditions, e.g., the presence of an external factor (such as, for example, an administered agent such as a drug or ligand). Thus, whether the inducibly-spliced exon cassette is alternatively spliced can be dependent upon the condition of the cell in which the splicing machinery operates.

[0245] Thus, in some embodiments a recombinant nucleic acid (e.g., recombinant viral genome) of the present disclosure comprises a transgene comprising at least two exons and the alternatively -spliced cassette comprising at least two introns flanking an alternative exon, and a ligand-responsive aptamer. In other embodiments, a recombinant nucleic acid (e.g., a recombinant viral genome) comprises a transgene comprising one or more ligand-responsive sequences that do not comprise an aptamer (e.g., a ligand-responsive exon). In some embodiments, the transgene comprising the inducibly-spliced cassette comprises other regulatory' sequences including, but not limited to, 3’ UTRs, 5’ UTRs, poly A sequences, promoters, enhances, etc. In some embodiments, the inducibly-spliced cassette comprises a sequence that is capable of regulating the expression of another gene such as a miRNA.

[0246] Accordingly, compositions and methods described herein can be useful to regulate expression of therapeutic transcripts (e.g., in the context of viral vector-based treatments for diseases or disorders). In some embodiments, the transgene can be spliced in an inducible manner to form a functional miRNA that modulates the expression of a mutated or variant protein or a misexpressed protein that is implicated in a disease or disorder. In some aspects, the present application provides compositions and methods that are useful for delivering genes and gene products (such as RNAs and proteins) that retain or restore therapeutically effective levels of regulation of a protein or variant thereof implicated in a disease or disorder.

[0247] A schematic representing the disclosed new approach for regulating expressi on of a transgene (or a coding region of a transgene, e.g., a transgene encoding a therapeutic protein) in a recombinant viral genome using alternatively-spliced exons is provided in FIG. 1 . As shown in FIG. 1, a viral genome may be configured to include a transgene that comprises a coding region of interest (e.g., encoding a therapeutic protein) and an alternatively-spliced exon (or a cassette comprising an alternatively-spliced exon) which regulates the expression of the coding region of the transgene. In addition, a number of exemplary embodiments of recombinant nucleic acid molecule constructs that comprise an alternatively-spliced exon and a coding region of interest (e.g., encoding a therapeutic protein) are shown in FIG. 2. FIG. 3 depicts, in general, typical AAV and lentivirus vector constructs comprising a coding region of interest whose expression is driven by a promoter, and which further include the insertion (at any suitable location) of a nucleotide sequence comprising an alternatively-spliced exon (or a cassette comprising an alternatively-spliced exon) to further regulate the expression of the coding region (e.g., by controlling translation or mRNA homeostasis, e.g., mRNA levels). In some embodiments, the nucleotide sequence comprising an alternatively-spliced exon may be in the form of a “cassette.” Examples of this are provided in FIGs. 2 and 4-7.

[0248] Such constructs represent embodiments that enable the disclosed new approach for regulating transgene expression (e.g., the expression of a therapeutic protein) from recombinant viral vectors in a condition-responsive manner, whereby the condition-responsive expression is controlled by alternatively-spliced exons which are included in the recombinant genome of the expression vector in such a manner that imparts a level of control on the expression of a coding region of interest (e.g., encoding a therapeutic protein). It will be understood that alternatively- spliced exons are spliced-in or spliced-out in a manner that can be dependent on one or more environmental conditions, e.g., intracellular conditions, such as a disease state (e.g., cancer) or even a type of cell (e.g., a liver cell versus a neuron, each of which have different intracellular conditions), or the presence of an external factor (such as, for example, an administered agent). Thus, whether the alternatively -spliced exon is spliced-in or spliced-out can be dependent upon the condition of the cell in which the splicing machinery operates.

[0249] Turning to FIG. 1, a generalized schematic of a recombinant AAV is provided in (a) which comprises a transgene located between the left and right ITRs. The transgene is indicated as comprising a coding region of interest (e.g., which encodes a therapeutic protein) and an alternatively-spliced exon that regulates the expression of the transgene (or the product encoded by the coding region of interest). While the drawing depicts a recombinant AAV genome, other recombinant viral vector genomes may be used, such as recombinant lentivirus genomes. The recombinant viral genomes may be delivered or administered to subjects packaged in a viral vector, which refers to an infectious viral particle comprising a recombinant viral genome within a viral capsid, and in addition which may further include a lipid / protein envelope layer for enveloped viruses. In various embodiments, such as those provided in FIG. 2, or FIGs. 4-8, the coding region (or exon comprising the coding region) may be combined or arranged with the alternatively-spliced exon in the form of a transgene comprising any suitable arrangement of additional components, including one or more constitutive exons (i.e., those exons present in all spliced mRNA isoforms that result from the initial pre-mRNA transcript) and one or more introns. In other embodiments, an alternative exon cassette (comprising the alternatively-spliced exon) may be linked with or coupled to any coding region of interest to impart regulator}- control on that coding region of interest.

[0250] The alternatively-spliced exon may be any naturally-occurring alternatively-spliced exon or any recombinant alternatively-spliced exon. A variety of configurations are contemplated, and no limitation is implied by FIG. 1 as to the possible configurations that may be employed. For instance, the alternatively-spliced exon may be located between two exons that each separately comprise a portion of the coding region of interest. In other instances, the alternatively-spliced exon is located outside of the exon comprising the coding region of interest. In such embodiments, the alternatively-spliced exon may be located downstream of the exon encoding the coding region of interest. In other such embodiments, the alternatively-spliced exon may be located upstream of the exon encoding the coding region of interest. The general descriptions of the configuration of the cassettes comprising the alternatively-spliced exon and the coding region of interest (or the exon comprising the coding region of interest) embrace any suitable configuration, including those embodiments described in FIGs. 2 and 4-8.

[0251] In FIG. 1, step (b) show's the formation of a pre-mRNA (i.e., a primary transcription product which has not yet been processed by splicing) which includes the coding region of interest and the alternatively-spliced exon. Step (c) shows the splicing-out or splicing-in of the alternatively-spliced exon based on one or more conditions (e.g., cell type, disease state, or other intracellular environmental signal). The splicing-out of the alternatively-spliced exon results in mRNA isoform 1 in (d), whereas the splicing-in of the alternatively-spliced exon results in mRNA isoform 2 in (e). As shown in (g), the absence of the alternatively-spliced exon removes a positive or negative regulatory civ-element. The removal of a positive regulatory civ-element, such as a translation start signal, will result in the downregulation or down-expression of the transgene, i.e., the reduced expression of the product encoded by the coding region of interest. However, the removal of a negative regulatory civ-element, such as mRNA degradation element, may lead to the upregulation or up-expression of the transgene, i.e., the increased expression of the product encoded by the coding region of interest. As shown in (h), the presence of the alternatively-spliced exon splices-in a positive or negative regulatory' cA-elernent associated with the alternatively-spliced exon. The maintenance of a positive regulatory cA-element, such as a translation start signal, will result in the upregulation or up-expression of the transgene, i.e., the increased expression of the product encoded by the coding region of the transgene. However, the maintenance of a negative regulatory’ c / x-element, such as mRNA degradation element, may lead to the downregulation or down-expression of the transgene, i.e., the decreased expression of the product encoded by the coding region of the transgene. Other configurations are also possible and contemplated herein and exemplified below in various embodiments provided in FIGs. 2-8.

[0252] In certain aspects, the disclosure provides methods and compositions for regulating gene expression using viral vectors comprising a recombinant viral genome described herein. Viral vectors can be used to deliver one or more transgenes (comprising a coding region of interest w'hich encodes a protein of interest, such as a therapeutic protein) for therapeutic, diagnostic, or other purposes. In some aspects, expression of a transgene in a recombinant viral genome can be regulated using alternative splicing of an RNA expressed from the viral genome.

[0253] Thus, aspects of the disclosure relate to methods and compositions for regulating expression of a transgene (comprising a coding region of interest which encodes a protein of interest, such as a therapeutic protein) using viral vectors comprising a recombinant viral genome described herein, A recombinant viral genome can be engineered to include one or more exons (e.g., one or more of a constitutive exon, an alternatively-spliced exon, and / or engineered versions thereof) that (a) can be either spliced-in or spliced-out of a pre-mRNA encoded by the genome, and (b) include one or more positive or negative regulatory cA-elements that affect protein expression (e.g., mRNA stability and / or translation of the coding region of interest).

[0254] Different intron and exon configurations can be used to provide for alternatively-spliced exon splicing, as discussed in greater detail herein, and shown in FIG. 2 and FIGs. 4-8 as examples. Non-limiting examples include the following models of alternative splicing: skipped exons, retained introns, alternative 5’ splice sites, alternative 3’ splice sites, mutually exclusive exons, and alterative last exons as illustrated in FIGs. 2 and 4-8. Each of these different intron / exon configurations can be used to leverage alternatively-spliced exons which may, in some embodiments, include one or more positive or negative regulatory civ-elements that promote or limit expression of the coding region of interest. For example, such sequences may promote translation and / or stability, or inhibit or terminate RNA translation and / or promote RNA degradation. Such c / x-acting elements may in some embodiments be sequences that form secondary' structures (e.g., that slow translation), bind to one or more regulatory' RNAs (e.g., siRNAs), and / or be targeted by one or more intracellular enzymes (e.g, nucleases).

[0255] It will be appreciated that different types of splice sites exist which may result in splicing under specific conditions. Such splice sites can be chosen for their ability to regulate splicing under conditions of interest. Alternatively or additionally, splice sites may be chosen based upon their relative strength, as calculated using a variety of published methods (see, e.g., Yeo & Burge (2004), Maximum entropy' modeling of short sequence motifs with applications to RNA splicing signals, J. Compul. Biol, 11(2-3):377-94). Such relative strength may in some embodiments reflect the efficiency of recognition by the core spliceosomal machinery (e.g., U1 and U2 snRNPs). In some embodiments, splice sites may be altered to enhance or diminish recognition by the core spliceosomal machinery. Such alterations may be performed, in some embodiments, to achieve the desired regulatory' behavior in conditions of interest. For example, splice sites may be used to make splicing responsive to certain endogenous or exogenous factors such that the alternative splicing of the DNA is specific to, such as, for example, certain tissues, certain diseases, certain intracellular conditions, etc. In some embodiments, splicing may be additionally or alternatively responsive to an exogenous agent (e.g., a small molecule, antibody, or other compound) which regulates splicing of the pre-rnRNA.

[0256] Alternatively-spliced exons as described herein may in some embodiments be contained within an alternatively-spliced exon cassette, as shown in the various embodiments of FIGs. 2 and 4-8.

[0257] Thus, in some embodiments a recombinant viral genome of the present disclosure comprises a transgene comprising at least one alternatively-spliced exon (or “regulatory'”) cassette. In some embodiments, a transgene comprising an alternatively-spliced exon cassette comprises at least one alternatively-spliced exon, intronic sequences flanking the alternatively- spliced exon, and an exon comprising a coding region of interest. However, a transgene comprising a regulatory' cassette may in some embodiments also contain additional components, such as a constitutive exon, additional intronic sequences, or both. Accordingly, in some embodiments, a transgene comprising an alternatively-spliced exon cassette comprises any one or more of the following components: an alternatively-spliced exon, a flanking intron, an exon comprising a coding region of interest, and / or a constitutive exon.

[0258] In some aspects, alternative splicing regulation can be used to help control the expression of a coding region of interest encoded by a recombinant viral genome (e.g., an rAAV recombinant genome, a lentivirus recombinant genome). Thus, aspects of the invention relate to a method of regulating expression of a coding region of interest using a viral vector comprising a recombinant viral genome described herein. In some embodiments, the method comprises: (i) inserting into the recombinant viral genome at least one transgene comprising an alternatively- spliced exon cassette (e.g., such as any of those shown in FIGs. 2 and 4-8); (ii) introducing a heterologous start codon or part of a heterologous start codon at the 3' end of the alternatively- spliced exon, (iii) disrupting or deleting all native start codons located 5' to the heterologous start codon; and (iv) deleting a native start codon, or a portion thereof, from, and / or introducing heterologous stop codons into, the exon comprising a coding region of interest. In some embodiments, the constitutive exon, alternatively-spliced exon, and flanking intron are each located 5' to the coding region of interest. In some embodiments, the method comprises: (i) inserting into the recombinant viral genome at least one transgene comprising an alternatively- spliced exon cassette; and (ii) introducing into the alternatively-spliced exon a heterologous, inframe stop codon at least 50 nucleotides upstream of the next 5' splice junction.

[0259] In some embodiments, the heterologous, in-frame stop codon elicits nonsense-mediated decay. In some embodiments, a transgene comprising an alternatively-spliced exon cassette comprises any one or more of the following components: an alternatively-spliced exon, a flanking intron, a coding region of interest, and / or a constitutive exon.

[0260] Accordingly, compositions and methods described herein can be useful to regulate expression of therapeutic transcripts in the context of viral vector-based treatments for diseases or disorders. Abnormal cellular regulation (e.g., abnormal regulation of intron splicing of one or more genes) can lead to changes in gene regulation and subsequent protein expression associated with a disease state. Some aspects of the invention therefore concern a method of treating a disease or condition in a subject comprising administering a viral vector of the disclosure to a subject, wherein the viral vector comprises a recombinant viral genome described herein. In some aspects, the present application provides compositions and methods that are useful for delivering genes that retain or restore therapeutically effective levels of regulation (e.g., therapeutically effective regulation of intron splicing).

[0261] In some aspects, a viral vector (e.g., an r.AAV vector; a lentivirus vector, etc.) comprises a recombinant viral genome that includes a nucleic acid that encodes an RNA (e.g., an mRNA) comprising one or more introns. In some embodiments, splicing of at least one intron is regulated by one or more intracellular factor(s). Regulation of intron splicing can control the expression level of the RNA and / or of the type of RNA (e.g., of an RNA splice alternative) inside a cell.

[0262] A. Definitions

[0263] Unless otherwise defined herein, all scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms are clear, however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In this disclosure, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including,” as well as other forms, such as “includes” and “included,” is not limiting. Things described as “including” or “comprising” can also be configured as “consisting of” or similar language. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit unless specifically stated otherwise.

[0264] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present disclosure unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art. or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of subjects.

[0265] That the present disclosure may be more readily understood, select terms are defined below.

[0266] (i) Polynucleotide

[0267] As used herein, “polynucleotide” refers to any nucleic acid comprising naturally- occurring sequences, engineered sequences, or a combination thereof. In some instances, the term “polynucleotide” may be used interchangeably with the term “nucleic acid”. In some embodiments, a polynucleotide may be DNA, In some embodiments, a polynucleotide may be RNA. Accordingly, in some embodiments, the term “polynucleotide” may be used to refer to both DNA and an RNA encoded by or corresponding to said DNA (e.g., an RNA that is alternatively spliced in the presence of a ligand). In some embodiments, a polynucleotide (e.g., a guide RNA) is a chemically modified nucleic acid.

[0268] In some embodiments, polynucleotides of the present disclosure comprise a sequence encoding ligand-responsive sequence. In some embodiments, the polynucleotide is capable of being expressed in a cell and alternatively spliced in the presence of the ligand. In some embodiments, a ligand induces alternative splicing to produce a first RNA. In some embodiments, a ligand induces splicing to produce a second RNA. Accordingly, in some embodiments, a polynucleotide comprises all of the sequence information to encode the first and the second RNA, such that one of the RNAs will be more highly expressed in the presence of the ligand and the other RNA will more highly expressed in the absence of the ligand.

[0269] In some embodiments, the presence of the ligand results in increased expression of the first RNA. In some embodiments, the increase in expression of the first RNA in the presence of the ligand is on the order of 2- to 500-fold relative to the expression of the first RNA and / or second RNA in the absence of the ligand. In some embodiments, the increase is approximately 2- f old, 3-fold, 4-fold, 5-fold, 6-fold, 7-fbld, 8-fold, 9-fold, 10-fold, 1-fold to 3-fold, 1-fold to 4- fold, 1-fold to 5-fold, 1-fold to 6-fold, 1-fold to 7-fold, 1-fold to 8-fold, 1-fold to 9-fold, 1-fold to 10-fold, 10-fold to 20-fold, 20-fold to 30-fold, 30-fold to 40-fold, 40-fold to 50-fold, 50-fold to 60-fold, 60-fold to 70-fold, 70-fold to 80-fold, 80-fold to 90-fold, 90-fold to 100-fold, 100-fold to 200-fold, 200-fold to 300-fold, 300-fold to 400-fold, 400-fold to 500-fold, 500-fold to 600- fold, 600-fold to 700-fold, 700-fold to 800-fold, 800-fold to 900-fold, or 900-fold to 1000-fold. In some embodiments, the increase in expression of the first RNA in the presence of the ligand is on the order of 5- to 25-fold relative to the expression of the first RNA and / or the second RNA in the absence of the ligand.

[0270] In some embodiments, the presence of the ligand results in increased expression of the second RNA. In some embodiments, the increase in expression of the second RNA in the presence of the ligand is on the order of 2-fold to 500-fold relative to the expression of the first RNA and / or the second RNA in the absence of the ligand. In some embodiments, the increase in the second RNA is approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10- fold, 1-fold to 3-fold, 1-fold to 4-fold, 1-fold to 5-fold, 1-fold to 6-fold, 1 -fold to 7-fold, 1-fold to 8-fold, 1-fold to 9-fold, 1-fold to 10-fold, 10-fold to 20-fold, 20-fold to 30-fold, 30-fold to 40- fold, 40-fold to 50-fold, 50-fold to 60-fold, 60-fold to 70-fold, 70-fold to 80-fold, 80-fold to 90- fold, 90-fold to 100-fold, 100-fold to 200-fold, 200-fold to 300-fold, 300-fold to 400-fold, 400- fold to 500-fold, 500-fold to 600-fold, 600-fold to 700-fold, 700-fold to 800-fold, 800-fold to 900-fold, or 900-fold to 1000-fold. In some embodiments, the increase in expression of the second RNA in the presence of the ligand is on the order of 5-fold to 25-fold relative to the expression of the first RNA and / or the second RNA in the absence of the ligand.

[0271] In some embodiments, polynucleotides nucleotides may comprise one or more exons. In some embodiments, the polynucleotide may comprise one or more introns. In some embodiments, the polynucleotide may comprise the full sequence of a gene, such as one comprising a plurality of exons. In some embodiments, the first RNA and the second RNA differ by at least one exon. In some embodiments, for example, the first RNA comprises an exon that is not found in the second RNA. In some embodiments, binding of a ligand to the ligand- responsive sequence may promote inclusion of one or more alternative exons in the first. RNA. In some embodiments, binding of a ligand to the ligand-responsive sequence may promote exclusion of one or more alternative exons in the second RNA. In some embodiments, each of the one or more alternative exons is flanked by an intron.

[0272] In some embodiments, exons found polynucleotides correspond to an RNA of interest. In some embodiments, the first RNA encodes an RNA of interest (e.g., one that can lead to synthesis of a corresponding protein) and the second RNA does not. In some embodiments, the second RNA encodes an RNA of interest (e.g., a microRNA that can bind a target transcript of interest) and the first RNA does not.

[0273] In some embodiments, polynucleotides comprise one or more splice sites. In some embodiments, a 3’ splice site is at least 2 nucleotides long. In some embodiments, a 3’ splice site is 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in long. In some embodiments, a 5’ splice site is 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-20, 20- 30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in long. In some embodiments, a 5’ splice site is at least 7 nucleotides long. In some embodiments, a 5’ splice site is at least 9 nucleotides long. In some embodiments, the polynucleotide may comprise one or more 5’ splice sites and 3’ splice sites which are used differentially used in the splicing of the RNA encoded by the polynucleotide depending on the presence or absence of the ligand.

[0274] Non-limiting examples of polynucleotides and sequences encoded therein are found in the drawings presented herein, such as in FIGs. 1-8, 28, 33, 38, 39, 41, 43, 46A, 47A, 48A, 49A, 50A, and 51 A, and Tables 7-34, respectively. For example, in some embodiments, a polynucleotide, comprises at least one alternative exon, at least two introns flanking an alternative exon, and a ligand-responsive aptamer, wherein the presence of the ligand results in splicing out the at least one alternative exon, the at least two introns flanking the at least one alternative exon, and the ligand-responsive aptamer. Non-limiting examples of such polynucleotides are disclosed in FIGs. 4E-4H. However, such disclosures should not be considered limiting as, in other embodiments, it may be desirable to use a ligand to retain an alternatively spliced exon in the spliced RNA. Non-limiting examples of such polynucleotides are disclosed in FIGs. 4L, 4N, 4P, 46A, 47 A, and 48A.

[0275] In some embodiments, polynucleotides of the present disclosure are transgenes. In some embodiments, polynucleotides (e.g., transgenes) comprise cassettes described herein. In some embodiments, polynucleotides of the present disclosure are provided in a vector (e.g., a plasmid, phage, transposon, cosmid, chromosome, or artificial chromosome). In some embodiments. vectors are single-stranded or double-stranded. In some embodiments, vectors are circular (e.g., circular plasmids, nanoplasmids, and minicircle plasmids) or linear. In some embodiments, vectors are self-complementary. In some embodiments, polynucleotides of the present disclosure are provided in recombinant viral genome.

[0276] In some embodiments, the polynucleotide comprises a sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, 2183-2255, or 2259-2260. In some embodiments, the polynucleotide comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2080, 2091 , 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, 2183-2255, or 2259- 2260.

[0277] In some embodiments, the polynucleotide comprises an exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to an exon set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143. In some embodiments, the polynucleotide comprises an exon comprising a nucleic acid sequence of an exon as set forth in any one of SEQ ID NOs: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0278] In some embodiments, the polynucleotide comprises an alternative exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an alternative exon as set forth in SEQ ID NOs: 2084, 2094, 2100, 2103, 2106, 2114, 2137, 2236, or 2247-2256. In some embodiments, the polynucleotide comprises an alternative exon comprising a nucleic acid sequence of an alternative exon as set forth in any one of SEQ ID NOs: 2084, 2094, 2100, 2103, 2106, 2114, or 2137.

[0279] In some embodiments, the polynucleotide comprises an intron having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of intron as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141. In some embodiments, the polynucleotide comprises an intron comprising a nucleic acid sequence of an intron as set forth in any one of SEQ ID NOs: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

[0280] In some embodiments, the polynucleotide comprises a 3' splice site comprising having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 3’ splice site as set forth in SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239. In some embodiments, the polynucleotide comprises at least one 3' splice site comprising a nucleic acid sequence of a 3’ splice site as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239.

[0281] In some embodiments, the polynucleotide comprises a 5' splice site having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 5’ splice site as set forth in Tables 7, 25, 26, or 34. In some embodiments, the polynucleotide comprises a 5' splice site comprising a nucleic acid sequence of a 5’ splice site as set forth in any one of Tables 7, 25, 26, or 34.

[0282] In some embodiments, the polynucleotide comprises a ligand-responsive sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a ligand-responsive sequence as set forth in SEQ ID NOs: 2086, 2095, 21 12, 2138, 2183, 2186, 2206-2211, 2213- 2220, or 2236-2260. In some embodiments, the polynucleotide comprises at least one ligand- responsive sequence comprising a nucleic acid sequence of a ligand-responsive sequence as set forth in SEQ ID NOs: 2086, 2095, 2112, 2138, 2183, 2186, 2206-2211, 2213-2220, or 2236- 2260.

[0283] In some embodiments, the polynucleotide comprises a ligand-responsive aptamer having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a ligand-responsive aptamer as set forth in SEQ ID NOs: 2086, 2095, 2112, or 2187-2189. In some embodiments, the polynucleotide comprises at least one ligand-responsive aptamer comprising a nucleic acid sequence of a ligand-responsive aptamer as set forth in SEQ ID NOs: 2086, 2095, 2112, or 2187- 2189.

[0284] In some embodiments, a polynucleotide comprises an intron, exon (e.g., alternative exon), and / or a splice site corresponding to a gene selected from the group consisting of: MBNL1; MBNL2; MBNL3; hnRNP Al; hnRNP A2B1; hnRNP ( : hnRNP D; hnRNP DL; hnRNP F; hnRNP H; hnRNP K, hnRNP L; hnRNP M; hnRNP R; hnRNP U; FUS; TDP43;

[0285] PABPN1; ATXN2; TAF15; EWSR1; MATR3; TIA1; FMRP; MTM1; MTMR2; L AMP?: KIF5A; a microdystrophin-encoding gene; C9ORF72; HTT; DNM2; BIN1 ; RYR1; NEB; ACTA; TPM3; TPM2; TNNT2; CFL2; KBTBD13; KLHL40; KLHL41; LM0D3; MYPN; SEPN1; T I N. SPEG; MYH7; TK2; P0LG1; GAA; AGE, PYGM; SLC22A5; OCTN2; ETF, ETFH; PNPLA2; a cytochrome b oxidase-encoding gene; a cytochrome c oxidase-encoding gene; CLCN1 ; SCN4A; DMPK, CNBP; MYOT; LMNA; CAV3; DNAJB6; DES; TNPO3, HNRPDL; CAPN3; DYSF; an alpha-sarcogly can-encoding gene; a beta-sarcoglycan-encoding gene; a gamma-sarcogly can-encoding gene; a delta-sarcogly can-encoding gene; TCAP;

[0286] TRIM32; FKRP; FXN; PO.MT1; FKTN, P0MT2; POMGnTl ; DAG1 ; AN05; PLEC1;

[0287] TRAPPCI 1; GMPPB; ISPD; LIMS2; POPDC1; TOR1AIP1; POGLUT2; LAMA2; COL6A1; P0MT1; P0MT2; DUX4; EMD; PAX7; PMP22; MPZ, MFN2, SMCHD1; SMN; Lamin A / C (LAMN); GJB1; ABCC1; AK 125149; ASCC2; BAT2D1; BBX; BRD8; BRE; C17orf70;

[0288] CAMKK2; CBFB; CC ARI ; CCDC7CD6; CHTF8; COL4A3BP, COL6A3; CUGBP1, CUGBP2; CXorf45; DENND3; DGUOK; DKFZp762G094; DNAJC7; DNASE1; E1F4A2; EIF4G2; EH <411; EXOCT; EZH2, FAM120A; FAM136A; FAM36A, FARSB; FBXO38; FGFR1OP2; FIP1L1; FOXRED1 ; FUBP3; GALT; GATA3; GOLGA2; HIF1A; HMMR; HRB; IKZF1; ILF3; IRAK4; IRF1; KCTD13; LEF1; LUC7L; LYRM L MAl . i l e7; MAP2K7;

[0289] MAP3K7; MAP4K2; MBNL2; MFF; NAE1; NCSTN; NR4A3; NRF1 ; NUP98; PARP6; PCM1 ; PLAUR; PLSCR3; PPIL5; PPP5C; PTPRC-E4; PTPRC-E6; PTS; RABL5; RAPH1; SEC16A; SFRS3; SFRS7; SLMAP; SNRNP70; STAT6; TBC1D1; TIMM8B; IIR8; TRA2A; TROVE2; UGCGLI ; VAP-B: VAVI ; ZNF384; ZNF496; CAMK2B: PKP2; LGMN; NRAP; VPS39; KSR1 ; PDLIM3; BINI; ARFGAP2; KIF13A; and PICALM.

[0290] (ii) Transgene

[0291] As used herein, the term “transgene” refers to any recombinant gene or a segment thereof that includes a non-naturally occurring sequence. The non-naturally occurring sequence may in some embodiments be from a different organism, but it need not be. For example, in some embodiments a transgene is a recombinant gene, or segment thereof, from one organism or infectious agent (e.g., a virus) that is introduced into the genome of another organism or infectious agent. By contrast, in some embodiments, the transgene may contain segments of DNA taken from the same organism, but the segments are arranged in a non-natural configuration. In some embodiments, the non-naturally occurring sequence is an engineered nonnatural ly occurring sequence. As used herein, a transgene may comprise any combination of naturally-occurring and engineered DNA sequences.

[0292] A transgene may be introduced into the genome of another organism or infectious agent using recombinant DNA techniques. In some embodiments, a transgene may include or may be modified to include one or any combinati on of regulatory' sequences, including, but not limited to, transcription regulatory' sequences (e.g., promoter, enhancer, silencer, transcription factor binding sequence, 5’ UTR, or 3’ UTR), post-transcriptional regulatory sequences (e.g., acceptor / donor splicing sites and splicing regulatory sequences), ligand-responsive sequences (e.g., aptamers), and / or translation regulatory' sequences (e.g., translation initiation signals, translation termination signals, mRNA degradation or decay signals, polyadenylation signals). In some embodiments, a regulatory' sequence, such as a ligand-responsive aptamer or a ligand- responsive exon, is located in an alternatively-spliced expression cassette between two exon regions of the transgene thereby separating a single exon into two non-continuous stretches of nucleotides. In some embodiments, the transgene encodes an RNA product that plays a regulatory' role effecting gene expression in the cell such as a miRNA. In some embodiments, wherein a transgene is introduced into the genome of another organism using a recombinant adeno associated virus (AAV), the transgene comprises all components (e.g., exons, introns, regulatory' sequences, alternative exons, ligand-responsive aptamers, etc.) which are located between the .AAV inverted terminal repeat sequences (see, e.g., FIG. 3 A).

[0293] In some embodiments, the transgene encoded a sequence encoding a ligand-responsive sequence (e.g., a ligand-responsive aptamer). In some embodiments, the transgene comprises a sequence encoding an RN A of interest. In some embodiments, a transgene comprises two or more discontinuous sequences encoding distinct portions of an RNA of interest.

[0294] In some embodiments, a transgene may be modified to comprise an alternatively-spliced exon, defined below, such that the regulation of the expression of the transgene, the product encoded by the transgene, or the target of a miRN A encoded by the transgene comes under control of the alternatively-spliced exon. In some embodiments, the alternative splicing of an exon of the transgene is dependent upon the presence of a ligand to which a ligand-responsive aptamer sequence within the transgene binds to. In some embodiments, the alternative splicing of an exon of the transgene is dependent upon the presence of a iigand to which a ligand-responsive exon within the transgene binds to. The alternatively-spliced exon may be configured in a “cassette,” defined below.

[0295] In some embodiments, the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260. In some embodiments, the transgene comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 21 12, 2116, 2118, 2120, 2123, 2128, 2131 , 2132, 2138, or 2183-2260

[0296] In some embodiments, the transgene comprises an exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity', relative to a nucleic acid sequence of an exon as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143. In some embodiments, the transgene comprises an exon comprising a nucleic acid sequence of an exon as set forth in any one of SEQ ID NOs: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0297] In some embodiments, the transgene comprises at least two exons having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to the nucleic acid sequences of two exons as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143. In some embodiments, the transgene comprises at least two exons comprising a nucleic acid sequence of two exons as set forth in any one of SEQ ID NOs: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0298] In some embodiments, the transgene comprises an alternative exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an alternative exon as set forth in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, 2137, 2236, or 2247-2256. In some embodiments, the transgene comprises at least two exons comprising a nucleic acid sequence of an alternative exon as set forth in any one of SEQ ID NOs: 2084, 2094, 2100, 2103, 2106, 2114, 2137, 2236, or 2247-2256.

[0299] In some embodiments, the transgene comprises an intron having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an intron as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141 . In some embodiments, the transgene comprises an intron comprising a nucleic acid sequence of an intron as set forth in any one of SEQ ID NOs: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121 , 2127, 2129, 2130, or 2141.

[0300] In some embodiments, the transgene comprises at least two introns having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity', relative to the nucleic acid sequences of trvo introns as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141. In some embodiments, the transgene comprises at least two introns comprising the nucleic acid sequences of two introns as set forth in any one of SEQ ID NOs: 2082, 2088, 2093, 2096, 2101 , 2104, 2107, 2113, 2115, 21 17, 2118, 2121, 2127, 2129, 2130, or 2141.

[0301] In some embodiments, the transgene comprises at least one 3' splice site having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 3’ splice site as set forth in SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239. In some embodiments, the transgene comprises at least one 3' splice site comprising a nucleic acid sequence of a 3’ splice site as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239.

[0302] In some embodiments, the transgene comprises at least one 5' splice site having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 5’ splice site as set forth in Tables 7, 25, 26, or 34. In some embodiments, the transgene comprises at least one 5' splice site comprising a nucleic acid sequence of a 5’ splice site as set forth in Tables 7, 25, 26, or 34.

[0303] In some embodiments, the transgene comprises at least one ligand-responsive sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a ligand-responsive sequence as set forth in SEQ ID NOs: 2086, 2095, 2112, 2138, 2183, 2186, 2206-2211, 2213-

[0304] 2220, or 2236-2260. In some embodiments, the transgene comprises at least one ligand- responsive sequence a nucleic acid sequence of a ligand-responsive sequence as set forth in SEQ ID NOs: 2086, 2095, 2112, 2138, 2183, 2186, 2206-2211 , 2213-2220, or 2236-2260. In some embodiments, the transgene comprises at least one ligand-responsive aptamer having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a ligand-responsive aptamer as set forth in SEQ ID NOs: 2086, 2095, 2112, or 2187-2189. In some embodiments, the transgene comprises at least one ligand-responsive aptamer comprising a nucleic acid sequence of a ligand-responsive aptamer as set forth in SEQ ID NOs: 2086, 2095, 2112, or 2187-2189.

[0305] (Hi) Regulatory sequence

[0306] Overview of Regulatory Sequences

[0307] As used herein, a “regulatory sequence” or, equivalently, a “regulatory element,” may refer to a nucleotide sequence that regulates, directly or indirectly, any aspect of the expression of a gene or transgene, including regulatory sequences that effect transcription of a gene or transgene into one or more mRNAs, the processing of mRNA (e.g., the splicing of a pre-mRNA comprising exons and introns to produce one or more mRNA isoforms), and / or the translation of a coding region in a mRNA to form a polypeptide product. Non-limiting examples of positive or negative regulatory sequences, such as m-elements can include, for instance, (1) a nucleotide sequence element that regulates, modulates, or otherwise controls the amount, stability, and / or degradation of an mRNA encoding a coding region of interest (or portions thereof); and / or (2) a nucleotide sequence element that regulates, modulates, or otherwise controls the translation of a coding region of interest (or portions thereof) encoded by an mRNA.

[0308] In some embodiments, a ligand-responsive sequence may function as a cA-element which is capable of binding to an exogenously administered ligand. In some embodiments, a ligand- responsive sequence functions as a cA-element by regulating alternative splicing of the nucleic acid it is provided in (such as an inducibly-spliced cassette of a transgene). In some embodiments, a ligand-responsive sequence functions as a positive regulator (e.g., increasing expression or the function transgene). In some embodiments, a ligand-responsive sequence functions as a negative regulator (e.g., reducing expression or the function transgene).

[0309] In some embodiments, a ligand-responsive aptamer may function as a cA-element which is capable of binding to an exogenously administered ligand. In some embodiments, the ligand- responsive aptamer functions as a m-element by regulating alternative splicing of the nucleic acid it is provided in (such as an inducibly-spliced cassette of a transgene). In some embodiments, a ligand-responsive aptamer functions as a positive regulator (e.g, increasing expression or the function transgene). In some embodiments, a ligand-responsive aptamer functions as a negative regulator (e.g, reducing expression or the function transgene).

[0310] Non-Limiting Embodiments of Other Regulatory Sequences

[0311] In some embodiments, polynucleotides of the present disclosure (e.g., transgenes) are operably linked to at least one other regulator}' sequence in addition to at least one operably linked ligand-responsive sequence described herein. As used herein, a polynucleotide and regulatory sequences are said to be “operably linked” (which may be used interchangeably with “operatively linked”) when they are covalently linked in such a way as to place the expression (e.g., transcription and / or translation) of the nucleic acid sequence under the influence or control of the regulator} / sequences. For example, a promoter region would be operably linked to a nucleic acid sequence if the promoter region w'ere capable of effecting transcription of that DNA sequence such that the corresponding RNA (e.g., a pre-mRNA, a mRNA, a miRNA, etc.) might be present at increased levels in a cell and / or translated into the desired protein or polypeptide. Similarly, two or more coding regions are operably linked when they are linked in such a way that their transcription from a common promoter result in the expression of two or more proteins having been translated in frame.

[0312] Non-limiting examples of other regulatory sequences which may be located in polynucleotides (e.g., transgenes) comprising ligand-responsive sequences (e.g., a transgene comprising a cassette wherein alternative splicing of RNA encoded by the cassette is regulated by an operably linked ligand-responsive sequence) include transcriptional regulatory sequences (e.g., promoters, enhancers, silencers, transcription factor binding sequences, 5’ UTRs, or 3’ UTRs), post-transcriptional regulatory sequences (e.g., accept or / donor splicing sites and splicing regulatory sequences), and / or translation regulatory sequences (e.g., translation initiation signals, translation termination signals, mRNA degradation or decay signals, polyadenylation signals). In some embodiments, regulatory' sequences include, without limitation, promoter sequences, ribosome binding sites, ribozymes, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5’ and 3’ untranslated regions (UTRs), transcriptional start sites, transcription terminator sequences, polyadenylation sequences, introns, and premature stop codons. In some embodiments, for example, a pre-mature stop codon may be found in an RNA such that it is in-frame with a sequence encoding an RNA of interest (e.g., located within an exon) which results in production of a truncated protein corresponding to the RNA. In some embodiments, the pre-mature stop codon can be UAA, UAG, or UGA.

[0313] The promoter driving expression of polynucleotides of the present disclosure can be, but is not limited to, a constitutive promoter, an inducible promoter, a tissue-specific promoter, or a synthetic promoter.

[0314] In some embodiments, a constitutive promoter maintains constant expression of RNAs regardless of the conditions or physiological state of a host cell. In some embodiments, a constitutive promoter can be, but is not limited to, a Herpes Simplex virus (HS V) promoter, a thymidine kinase (TK) promoter, a Rous Sarcoma Virus (RSV) promoter, a Simian Virus 40 (SV40) promoter, a Mouse Mammary Tumor Virus (MMTV) promoter, an Adenovirus El A promoter, a cytomegalovirus (CMV) promoter (see, e.g,, Boshart et al.. Cell, 41 :521-530 (1985)), the phosphoglycerol kinase (PGK) promoter, the CAG promoter, and the human elongation factor-1 alpha (EFl a) promoter [Invitrogen], the dihydrofolate reductase promoter, a mammalian housekeeping gene promoter, or a P-actin promoter.

[0315] In some embodiments, inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state. In some embodiments, an inducible promoter can be, but is not limited to, an IPTG-inducible promoter, a cytochrome P450 gene promoter, a heat shock protein gene promoter, a metallothionein gene promoter, a hormone-inducible gene promoter, an estrogen gene promoter, or a tetVP16 promoter, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088), the ecdysone insect promoter (No et al., Proc. Natl. .Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline- repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268: 1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Then, 4:432-441 (1997)), the rapamycin- inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still, in other embodiments, inducible promoters which may be useful in this context are those which are regulated by a specific physiological state.

[0316] In some embodiments, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. In some embodiments, tissue-specific promoters include, but are not limited to, retinoschisin proximal promoter, interphotoreceptor retinoid-binding protein enhancer (RS / IRBPa), rhodopsin kinase (RK), liverspecific thyroxin binding globulin (TBG) promoter, an trypsin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a a-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B virus core promoter. Sandig et al., Gene Ther., 3: 1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al.. Hum. Gene Ther., 7: 1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24 : 185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11 :654-64 (1996)), CD2 promoter (Hansal et ah, J. Immunol., 161 : 1063-8 (1998); immunoglobulin heavy chain promoter ; T cell receptor a-chain promoter, neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al.. Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 ( 1995)), among others which will be apparent to the skilled artisan.

[0317] In some embodiments, polynucleotides of the present disclosure are operably linked to a native promoter of a gene which endogenous to a cell (e.g., a cell comprising a polynucleotide described herein). In some embodiments, the native promoter may be preferred when it is desired that expression of the polynucleotide should mimic the native expression of a gene of interest. In some embodiments, the native promoter may be used when expression of the polynucleotide must be regulated temporally, developmentally, in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native regulatory / sequences, such as enhancer elements, poly adeny lation sites, and / or Kozak consensus sequences may also be used to mimic the native expression.

[0318] In some embodiments, the regulatory sequence driving expression of a polynucleotide is an RNA pol II promoter. In some embodiments, the regulatory sequence is an RNA pol III promoter, such as U6 or Hl. In some embodiments, the regulatory sequence is an RNA pol II promoter. In some embodiments, the regulatory sequence is a CMV enhancer (CMVe). In some embodiments, the regulatory' sequence is a chicken P-actin (CBA) promoter. In some embodiments, the regulatory sequence is a CMVe and a CBA promoter. In some embodiments, the regulatory sequence is a CAG promoter. Other examples of regulatory' sequence which maybe operably linked to a sequence encoding an polynucleotide described herein include a BDNF promoter, an NGF promoter, an EGF promoter, a growth factor promoter, an axon-specific promoter, a dendrite-specific promoter, a brain-specific promoter, a hippocampal-specific promoter, a kidney-specific promoter, an elafin promoter, a cytokine promoter, an interferon promoter, an al antitrypsin promoter, a brain cell-specific promoter, a neural cell-specific promoter, a central nervous system cell-specific promoter, a peripheral nervous system cellspecific promoter, an interleukin promoter, a serpin promoter, a hybrid CMV promoter, a hybrid P-actin promoter, an EFl promoter, a Ula promoter, a Ulb promoter, a Tet-inducible promoter, a VP 16 Lex A promoter, or a mammalian or avian p-actin promoter.

[0319] Non-1 Amiting EAibodiments of 3 ’ Sequences

[0320] In some embodiments, a polynucleotide comprises a polyadenylation sequence following the sequence encoding the polynucleotide and before any other 3’ regulatory- sequence (e.g., a 3’ AAV ITR). In some embodiments, a poly(A) signal sequence is inserted following the sequence encoding the polynucleotide and before any other 3’ sequence (e.g., a 3’ AAV ITR), which signals for the polyadenylation of transcribed mRNA molecules. Examples of poly(A) signal sequences include, but are not limited to, bovine growth hormone (bGH) poly(A) signal sequence, SV-40 poly(A) signal sequence, and synthetic poly(A) signal sequences, which are known to cause polyadenylation of eukaryotic transgenes and efficient termination of translation ( Azzoni A R et al., J Gene Med. 2007; 9(5):392-402).

[0321] In some embodiments, a regulatory sequence that enhances expression of the polynucleotide may further be inserted following the sequence encoding the RNA of interest and before the 3’ AAV ITR and poly(A) signal sequences. .An exemplary regulatory sequence includes, but is not limited to, a woodchuck hepatitis virus (WHV) post-transcriptional regulatory' element (WPRE) (Higashimoto T et al., Gene Ther. 2007, 14(17): 1298-304), (iv) Alternatively-spliced exon

[0322] An “exon” refers to certain nucleotide sequences comprising exon sequences in addition to exon regions which are either retained (e.g., spliced-in), excluded (e.g., spliced-out), or spliced together (such as forming one continuous exon from an exon that was previously split into two non-continuous regions) during post-transcriptional splicing of a pre-mRNA or pri-miRNA.

[0323] Whether an exon is spliced-in or spliced-out may depend on a number of different factors, including, but not limited to one or more cellular conditions, such as the presence or absence of a disease state (e.g., cancer), type of cell (e.g., liver cell versus skeletal cell), other intracellular conditions, or an external engineered factor (e.g., the administration of an agent such as a ligand). In some embodiments, the term exon may be used interchangeably with the term “alternatively-spliced exon” or “alternative exon.” Differential splicing events can result in different spliced transcripts (e.g, mRNA isoforms) that either retain or exclude the alternative exon. Further, as disclosed herein, exons may comprise one or more positive or negative regulatory c / .s-elements that exert a positive or negative regulatory control on the expression of a coding region of interest (or portions thereof). Separately, exons may comprise one or more positive or negative regulatory cxs’-elements that exert positive or negative regulatory control on the expression of an RNA, such as one encoding a protein (e.g., an mRNA encoding a therapeutic protein) or a miRNA.

[0324] Exons may be found in nature in a naturally-occurring gene, or may be modified by changing or altering the sequence thereof, including adding or changing the splice site, and / or adding or changing a positive or negative regulatory' cis-element (e.g., a ligand-responsive sequence). Such altered exons may be referred to as “recombinant” or “synthetic” exons. “Recombinant” or “synthetic” may in some embodiments include naturally occurring exons that have been placed into a heterologous gene (e.g, an unmodified exon placed into a non-natural context). In some embodiments, the c / .v-elements mediate localization to a specific cellular compartment, such as, for example, an organelle, the cytoskeleton, plasma membrane, the endoplasmic reticulum, the mitochondria, the nucleus, etc.

[0325] In some embodiments, the polynucleotide (e.g., a transgene or a cassette) comprises an alternative exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an alternative exon as set forth in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, 2137, 2236, or 2247-2256. In some embodiments, the polynucleotide (e.g., a transgene or a cassette) comprises an alternative exon comprising a nucleic acid sequence of an alternative exon as set forth in any one of SEQ ID NOs: 2084, 2094, 2100, 2103, 2106, 21 14, 2137, 2236, or 2247- 2256.

[0326] (v) Cassette

[0327] As used herein, the term “cassette'’ refers to any set of introns and / or exons (including an alternatively-spliced exon) capable of exhibiting a splicing pattern to produce different spliced transcript (e.g., mRNA isoforms).

[0328] In some embodiments, the cassette comprises an alternatively-spliced exon. In some embodiments, sequence comprising the intronic sequences (or portions thereof) flanking the alternatively-spliced exon may be referred to as an “alternative splicing cassette” or equivalently, “alternatively-spliced exon cassette” or “alternative exon cassette.” When situated in an alternatively-spliced exon cassette, an alternative-spliced exon may be alternatively referred to as a “cassette exon.” For purposes of clarity, a “cassette,” and in particular, an “alternatively- spliced exon cassette,” may exclude a coding region of interest, but also may be configured to be operatively linked to any coding region of interest such that the alternatively-spliced exon cassette regulates the expression of the coding region of interest.

[0329] In some embodiments, the term “cassette” refers to a set of introns, alternative exon(s) and ligand-responsive aptamer capable of exhibiting a splicing pattern to produce differentially spliced transcript (e.g., miRNA or mRNA isoforms). In some embodiments, the term “cassette” refers to a set of introns, alternative exon(s) and ligand-responsive sequence that is not an aptamer (e.g., a ligand-responsive exon) capable of exhibiting a splicing pattern to produce differentially spliced transcript (e.g., miRNA or mRNA isoforms).

[0330] In some embodiments, the terms “cassette,” “expression cassette,” “inducibly-spliced cassete,” “inducibly-spliced exon cassette” or “alternatively-spliced cassette” may be used equivalently or interchangeably. As such, the inducibly-spliced cassettes of the present disclosure can be considered to be “ligand-responsive” as the presence of the ligand-responsive sequence, such as a ligand-responsive exon or a ligand-responsive aptamer, in the cassette induces the splicing of the transgene comprising the cassette. When situated in an inducibly- spliced cassette, an alternative exon may be alternatively referred to as a “cassette exon.” For purposes of clarity, a “cassette,” and in particular, an “inducibly-spliced cassette,” may exclude a coding region of interest, but also may be configured to be operatively linked to any coding region of interest such that the inducibly-spliced exon cassette regulates the expression of the coding region of interest. Such an example would be an indicubly-spliced exon cassette comprising in its non-spliced form a crt-regulatory element that either negatively or positively regulates the expression of a coding sequence to which it is operatively linked. In this way, the presence of a ligand which binds to the ligand-responsive sequence (e.g., an aptamer) of the cassette would result in a splicing reaction which would alter the functionality of the cassette acting as a czk-regulatory element thereby inducibly changing the expression patterns of the coding region to which the cassette is operatively linked. In this way, the cassette comprising the introns, alternative exon, and the ligand-responsive sequence (e.g., aptamer) may act as a riboswitch by regulating the splicing patterns of the transgene based on the presence or absence of the ligand.

[0331] Alternatively, another example would be a non-functional start codon (e.g., a start, codon provided in the two non-continuous regions of an exon or provided in two separate exons), wherein upon inducing splicing, a functional start codon is produced which promotes protein translation of the downstream sequence. In some embodiments, the intronic sequences that split the exon are positioned near an alternative exon and a ligand-responsive aptamer which regulates splicing of the inducibly-spliced cassette. In some embodiments, the cassette comprises a premature stop codon which regulates the translation of the transgene and is spliced out only in the presence of a ligand. In some embodiments, the inducibly-spliced cassette comprises a miRNA gene which is n on-functional in the absence of the ligand and functional only upon splicing of the cassette in the presence of the ligand.

[0332] In some embodiments, the cassette is inserted without making any changes to the sequence flanking the insertion site (e.g., at a genomic site in a host cell). However, in some embodiments one or more nucleotide sequence changes are made in one or both flanking regions (e.g., at the positions immediately flanking the site of insertion). In some embodiments, the one or more nucleotide changes render either or both flanking sequences more compatible with splicing. In some embodiments, the one or more nucleotide changes result in either or both flanking sequences becoming effective 3’ and / or 5’ splice sites. In some embodiments, the one or more nucleotide changes include introducing one or more sequences that support an effective dynamic range between alternative splicing events of a ligand-induced alternatively spliced exon described in this application. In some embodiments, the one or more nucleotide changes include introducing one or more flanking sequence described in this application.

[0333] In some embodiments, the cassette comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260. In some embodiments, the cassette comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 21 16, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

[0334] In some embodiments, the cassette comprises an exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an exon as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143. In some embodiments, the cassette comprises at least two exons comprising a nucleic acid sequence of an exon as set forth in any one of SEQ ID NOs: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0335] In some embodiments, the cassette comprises at least two exons having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to the nucleic acid sequences of two exons as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143. In some embodiments, the cassette comprises at least two exons comprising the nucleic acid sequences of two exons as set forth in any one of SEQ ID NOs: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

[0336] In some embodiments, the cassette comprises an alternative exon having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an alternative exon as set forth in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, or 2137, 2236, or 2247-2256. In some embodiments, the cassette comprises an alternative exon comprising a nucleic acid sequence of an alternative exon as set forth in any one of SEQ ID NOs: 2084, 2094, 2100, 2103, 2106, 21 14, or 2137, 2236, or 2247-2256.

[0337] In some embodiments, the cassette comprises an intron having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of an intron as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141. In some embodiments, the cassette comprises an intron comprising a nucleic acid sequence of an intron as set forth in any one of SEQ ID NOs: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 21 15, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

[0338] In some embodiments, the cassette comprises at least two introns having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity', relative to the nucleic acid sequences of tw?o introns as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141. In some embodiments, the cassette comprises at least two introns comprising a nucleic acid sequence of two introns as set forth in any one of SEQ ID NOs: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 21 13, 2115, 2117, 21 18, 2121, 2127, 2129, 2130, or 2141.

[0339] In some embodiments, the cassette comprises at least one 3' splice site having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 3’ splice site as set forth in SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239. In some embodiments, the cassette comprises at least one 3' splice site comprising a nucleic acid sequence of a 3’ splice site as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239.

[0340] In some embodiments, the cassette comprises at least one 5' splice site having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 5’ splice site as set forth in Tables 7, 25, 26, or 34. In some embodiments, the cassette comprises at least one 5' splice site comprising a nucleic acid sequence of a 5’ splice site as set forth in any one of Tables 7, 25, 26, or 34.

[0341] In some embodiments, the cassette comprises at least one ligand-responsive sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a ligand-responsive sequence as set forth in SEQ ID NO: 2086, 2095, or 2112. In some embodiments, the cassette comprises at least one ligand-responsive sequence comprising a nucleic acid sequence of a ligand-responsive sequence as set forth in SEQ ID NO: 2086, 2095, or 2112. In some embodiments, the cassette comprises at least one ligand-responsive aptamer having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a ligand-responsive aptamer as set forth in SEQ ID NOs: 2086, 2095, 2112, 2138, 2183, 2186, 2206-2211, 2213- 2220, or 2236-2260. In some embodiments, the cassette comprises at least one ligand-responsive aptamer comprising a nucleic acid sequence of a ligand-responsive aptamer as set forth in SEQ ID NOs: 2086, 2095, 2112, 2138, 2183, 2186, 2206-2211 , 2213-2220, or 2236-2260.

[0342] (vi) Ligand-responsive sequences

[0343] Overview of Ligand-Responsive Sequences

[0344] In some embodiments, polynucleotides of the present disclosure comprise a ligand- responsive sequence. As used herein, a “ligand-responsive sequence” refers to a polynucleotide (e.g., an RNA sequence found in a pre-mRNA) having a sequence capable of binding a ligand.

[0345] In some embodiments, a ligand-responsive sequence binds a ligand to regulate alternative splicing of an RNA comprising said ligand-responsive sequence. In some embodiments, binding of a ligand to a ligand-responsive sequence induces a specific combination of 5’ and 3’ splice sites to be used during splicing. In some embodiments, polynucleotides that comprise ligand- responsive sequences have a balance of splice strengths, such that addition of a ligand sufficiently changes the way that the spliceosome recognizes the sequences involved in regulating splicing.

[0346] In some embodiments, a ligand-responsive sequence comprises approximately 2-200 nucleotides in length. In some embodiments, a ligand-responsive sequence comprises approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-20, 20-30, 30-40, 40-50, 50-60, 70-80, 80-90, 90-100, 100-125, 125-150, 150-175, 175-200, 200-250, or 250-300 nucleotides in length. However, in other embodiments, a ligand-responsive sequence may be greater than 300 nucleotides.

[0347] In some embodiments, a ligand-responsive sequence is generated by modifying a natural exon, natural intron, and / or natural splice site. In some embodiments, such modifications comprise substituting, deleting, and / or inserting one or more nucleotides (e.g., nucleotides in a sequence known to bind to ligands) to enhance ligand binding. In some embodiments, a ligand- responsive sequence is generated by completely replacing an exon, intron, and / or splice site with a sequence not naturally found in the gene. In some embodiments, a ligand-responsive sequence, or a portion thereof, is found in an exon. In some embodiments, a ligand-responsive sequence, or a portion thereof, is found in an intron. In some embodiments, a ligand-responsive sequence, or a portion thereof, is found in a 5’ splice site. In some embodiments, a ligand-responsive sequence, or a portion thereof, is found in a 3:splice site. In some embodiments, a ligand-responsive sequence, or a portion thereof, is placed in an intron downstream of a 5’ splice site. In some embodiments, a ligand-responsive sequence, or a portion thereof, is placed in an intron upstream of a 3’ splice site. In some embodiments, a ligand-responsive sequence, or a portion thereof, spans an exon-intron boundary (e.g., a first portion of the ligand-responsive sequence is found in an exon and a separate portion thereof is found in an adjacent intron). For example, in some embodiments, a first portion of a ligand-responsive sequence comprises approximately 1-10, 10-20, 20-30, 30-40, 40-50, or more nucleotides and may be located in an exon which is located immediately 5’ of an intron comprising a second portion of the ligand-responsive sequence comprising approximately 1-10, 10-20, 20-30, 30-40, 40-50 or more nucleotides. In some embodiments, a ligand-responsive sequence, or a portion thereof, is found 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 30, or more nucleotides upstream or downstream from a 5’ splice. In some embodiments, a ligand-responsive sequence, or a portion thereof, is found 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 30, or more nucleotides upstream or downstream from a 3’ splice site. In some embodiments, the ligand-responsive sequence, or a portion thereof, is found in an intron, an exon (e.g., an alternative exon), and / or a splice site.

[0348] In some embodiments, a polynucleotide may comprise at least one ligand-responsive sequence. In some embodiments, a polynucleotide may comprise a plurality (e.g., 2, 3, 4, or more) of ligand-responsive sequences. In some embodiments, a polynucleotide comprising a plurality of ligand-responsive sequences may be responsive to more than one ligand.

[0349] Non-limiting examples of ligand responsive sequences are found in Examples 7 and 10 (e.g., SEQ ID NOs: 2086, 2095, 2112, 2138, 2183, 2186, 2206-2211, 2213-2220, or 2236-2260, and those in Table 34).

[0350] Non-l dmitlng Embodiments of Ligand Binding In some embodiments, a ligand-responsive sequence encodes an RNA sequence that is capable of binding RNA. In some embodiments, such a ligand may be capable of binding an RNA (e.g., a sequence in a splice site, exon, intron, and / or aptamer, or a sequence wherein distinct portions thereof are found in a splice site, exon, and / or intron, such as sequences found in pre-mRNA) and / or one or more components of the spliceosome. In some embodiments, the binding affinity' may be characterized by a dissociation constant in the micromolar, nanomolar, or femtomolar range.

[0351] In some embodiments, ligand-responsive sequences bind biomolecules such as, but not limited to, proteins, peptides, carbohydrates, lipids, nucleic acids, and combinations thereof such as glycoproteins or lipidated proteins. In some embodiments, the ligand is a small molecule (e.g., a drug molecule). In some embodiments, the ligand is a nucleic acid (e.g., an antisense oligonucleotide, such as an exon-skipper).

[0352] In some embodiments, a ligand-responsive sequence comprises affinity to a non-toxic ligand. For example, in some embodiments, such a ligand will be tolerable (e.g., does not result in cytotoxicity) across a broad range of concentrations that are sufficient to regulate alternative splicing. In some embodiments, a ligand-responsive sequence comprises binding affinity to a ligand that is cell permeable. In some embodiments, a ligand-responsive sequence comprises binding affinity to a ligand that is expressed in a cell (e.g., an ASO encoded by a nucleic acid in the cell). In some embodiments, for example, a. ligand-responsive sequence may comprise an exon from a gene that exhibits alternative splicing in the presence of an exon-skipping ASO (e.g., an exon 7 from a SMN2 gene further comprising flaking introns which may be derived from the SMN2 gene or an alternatively spliced exon from a dystrophin gene).

[0353] In some embodiments, a ligand-responsive sequence comprises a sequence with binding affinity to a specific ligand when it is expressed as an RNA and adopts a three-dimensional conformation that specifically binds the ligand. In some embodiments, such sequences facilitate alternative splicing of polynucleotides as described herein. However, in other embodiments, a ligand-responsive sequence (e.g., one found in an RNA capable of binding a ligand) comprises a sequence with binding affinity to a plurality of ligands.

[0354] In some embodiments, the ligand-responsive sequence binds risdiplam. In some embodiments, a sequence capable of binding risdiplam comprises WGAGTAAGW, wherein W is A or T. In some embodiments, the ligand-responsive sequence binds branaplam. In some embodiments, a sequence capable of binding branaplam comprises ATTTAACATTTTTGAGTCAATCCAAGTAATGCAGGAGGTTCATGATTGTGTAGA (SEQ ID NO: 2187)

[0355] In some embodiments, the ligand-responsive sequence binds tetracycline. In some embodiments, a sequence capable of binding tetracycline comprises TAAAACATACCWDMCGKAAMCGKHWGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2188), wherein W is A or T, wherein D is A, G, or T, wherein M is A or C, wherein K is G or T, and wherein H is A, C, or T. In some embodiments, a sequence capable of binding tetracycline comprises TAAAACATACCAYMCGKAAMCGKMTGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2189), wherein Y is C or T, M is A or C, and K is G or T. lJgaHd~Resp()nsive Aptamers

[0356] In some embodiments, ligand-responsive sequences are aptamers. The term “aptamer” or “ligand-responsive aptamer” as used herein, refers to an oligonucleotide (e.g., single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA) that can specifically bind to a ligand. As used herein, the term “ligand-responsive aptamer” may be used to describe an aptamer which changes its structural confirmation as a result of binding to a ligand. In some embodiments, whether the aptamer is spliced out or retained in the transgene is not a direct result of binding to the ligand. In some embodiments, it is dependent on the splice site strength which is regulated by the aptamer (and the location of the aptamer relative to the intron and / or exon sequences that are either spliced out or retained).

[0357] An aptamer binds to its target with high affinity, selectivity, and specificity (see., e.g., Keefe et al., Aptamers as therapeutics. Nat. Rev. Drag Discov. 2010;9:537-550; Jayasena S.D. Aptamers: .An emerging class of molecules that rival antibodies in diagnostics. Clin. Chem. 1999:45: 1628- 1650). Aptamer binding is determined by its tertiary structure. Target recognition and binding of an aptamer involves three-dimensional, shape-dependent interactions as well as hydrophobic interactions, base-stacking, and intercalation. It will be known to those in the art that a ligand refers to a target, molecule to which a separate molecule (e.g., an aptamer) binds with specific chemical affinity7. In some embodiments, ligands of aptamers include biomolecules such as, but not limited to, proteins, peptides, carbohydrates, lipids, nucleic acids, and combinations thereof such as glycoproteins or lipidated proteins. In some embodiments, a target molecule of an aptamer is a small molecule or a toxin. In some embodiments, aptamers bind cells (e.g., live cells). In some embodiments, an aptamer binds to drug molecules, such as tetracycline, branaplam, or risdiplam.

[0358] In some embodiments, aptamers are screened for their ability to bind to ligands through various methods known in the art such as SELEX (see, e.g., Ruscito & DeRosa. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications. Front. Chem. 2016:4; 1.). As such, an aptamer is said to be “ligand-responsive” if it binds to a ligand target molecule. In some embodiments, the terms “aptamer” and “ligand-responsive aptamer” can be used interchangeably. Responding to a ligand may entail a confirmational change in the ligand- responsive aptamer thereby altering the 3-D shape of the aptamer upon assuming its bound-state in the presence of its ligand.

[0359] In some embodiments, an aptamer comprises between 20 and 60 nucleotides, between 25 and 55 nucleotides, between 30 and 50 nucleotides, between 35 and 45 nucleotides, between 20 and 50 nucleotides, between 20 and 40 nucleotides, between 25 and 40 nucleotides, between 20 and 30 nucleotides, between 30 and 40 nucleotides, between 30 and 60 nucleotides, between 40 and 60 nucleotides, or between 50 and 60 nucleotides. However, in other embodiments, aptamers may comprise more than 60 nucleotides (e.g., approximately 80, 100, 120, 140, etc).

[0360] In some embodiments, an aptamer comprises a first stem region and a second stem region. In some embodiments, for example, ligand-responsive aptamer stem length influences the sensitivity of an RNA to ligand binding to effect splicing. In some embodiments, a stem region comprises at least two nucleotides. In some embodiments, a stem region comprises 1-5 nucleotides. In some embodiments, a stem region may comprise approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, a stem region comprises more than 15 nucleotides. In some embodiments, the first stem region and the second stem region are the same length. In some embodiments the first stem region and the second stem region are different lengths. In some embodiments, the first stem region and the second stem region differ in length by approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides.

[0361] In some embodiments, an aptamer comprises a loop region. In some embodiments, a loop region may comprise 1-10, 10-20, 20-30, 30-40, 40-50, or more nucleotides (e.g., 50-75, 75-100, etc,). In some embodiments, an aptamer comprises a plurality of stems and loops. For example, in some embodiments, an aptamer may comprise 2, 3, 4, 5, or more loops each associated with their own respective first stem region and second stem region.

[0362] In some embodiments, an aptamer regulates the activity of 3’ and 5' splice sites. In some embodiments, splice sites may be part of the aptamer structure (e.g., to influence its 3D conformation to effect splicing). In some embodiments, splices sites are not found in an aptamer sequence but are located within 1-5, 5-10, 10-15, 15-20, or 20-30 nucleotides of a sequence capable of binding a ligand.

[0363] In some embodiments, a first stem region is located downstream of a 3’ splice site. In some embodiments, a first stem region is located upstream of a 3’ splice site. In some embodiments, a sequence that is not a stem region comprising approximately 1-10, 10-20, 20-30, or more nucleotides is found downstream of the 3’ splice site and first stem region and upstream of the remaining aptamer sequence. In some embodiments, a stem region is located upstream of a 5’ splice site. In some embodiments, a stem region is located downstream of a 5’ splice site. In some embodiments, a sequence that is not a stem region approximately, I, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides long is found between the 5’ splice site and the second stem region.

[0364] In some embodiments, a polynucleotide comprising a ligand-responsive aptamer is comprises a general structure of: [upstream 3’ splice site]-[first stem region]-[5’ splice site reverse complementary sequence]-[Ligand-Binding Sequence]-[5’ splice site]-[second stem region].

[0365] In some embodiments, a polynucleotide comprising a ligand-responsive aptamer comprises a general structure of: [upstream 3’ splice site]-[first stem region]-[5’ splice site reverse complementary sequence]-[Ligand-Binding Sequence]-[5’ splice site] -[sequence comprising at least 2 nucleotides]-[second stem region]. In some embodiments, said sequences may be flanked by one or more introns and / or exons.

[0366] In some embodiments, for example, a polynucleotide comprising a ligand-responsive aptamer comprises a general structure of: [EXON]-[INTRON]-[upstream 3' splice site]-[first stem region]-[5’ splice site reverse complementary' sequence]-[Ligand-Binding Sequence]-[5’ splice site]-[sequence comprising at least 2 nucleotides]-[second stem region] -[INTRON] - [downstream 3' splice site]~[EXON]. In some embodiments, an aptamer binds risdiplam. In some embodiments, the aptamer comprises WGAGTAAGW (SEQ ID NO: 2261), wherein W is A or T.

[0367] In some embodiments, an aptamer binds branaplam. In some embodiments, the aptamer comprises ATTTAACATTTTTGAGTCAATCCAAGTAATGCAGGAGGTTCATGATTGTGTAGA (SEQ ID NO: 2187).

[0368] In some embodiments, an aptamer binds tetracycline. In some embodiments, the aptamer comprises TAAAACATACCWDMCGKAAMCGKHWGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2188), wherein W is A or T, wherein D is A, G, or T, wherein M is A or C, wherein K is G or T, and wherein H is A, C, or T. In some embodiments, the aptamer comprises TAAAACATACCAYMCGKAAMCGKMTGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2189), wherein Y is C or T, M is A or C, and K is G or T.

[0369] In some embodiments, a transgene comprises at least one ligand-responsive aptamer that comprises a sequence that is part of a 5' splice site comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence of a 5’ splice site as set forth in SEQ ID NOs: 2086, 2095, 2138, 2188-2189, 2212-2220, or 2236-2239. In some embodiments, the transgene comprises at least one ligand-responsive aptamer comprising a polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NOs: 2086, 2095, 2138, 2188-2189, 2212-2220, or 2236-2239.

[0370] In some embodiments, a ligand-responsive aptamer is provided in a polynucleotide wherein the aptamer sequence is flanked by non-aptamer nucleic acid sequences (e.g., exons and / or introns). In some embodiments, the aptamer is provided in an intron of the transgene. In some embodiments, the aptamer is provided in an alternative exon of the transgene. In some embodiments, the aptamer spans an intron-exon boundary of the transgene.

[0371] In some embodiments, upon binding to a ligand, the aptamer alters its 3D conformation thereby conveying ligand-dependent regulator}- effects on the polynucleotide within which it is provided. In some embodiments, binding to a ligand enables the aptamer to regulate the alternative splicing of a polynucleotide within which it is provided. In some embodiments, the presence of a ligand increases the translation of an mRNA comprising the ligand-responsive aptamer. In some embodiments, the presence of a ligand decreases the translation of an mRNA comprising the ligand-responsive aptamer. In some embodiments, the presence of a ligand may enhance the expression of a particular isoform of an mRNA sequence or protein upon binding its cognate ligand-responsive aptamer. In some embodiments, the presence of a ligand forces the aptamer to be spliced out of the transgene thereby forming a functional RNA product such as a miRNA. In some embodiments, the ligand-responsive aptamer is present in the intron and, therefore, is spliced out of the transgene regardless of the presence or absence of ligand. In such an embodiment, ligand addition also results in splicing out the alternative exon of the transgene. In some embodiments, splicing out an aptamer from the transgene as a result of ligand addition causes two regions of a non-continuous exon to be spliced together forming a continuous exon sequence. In some embodiments, the ligand-responsive aptamer is alternatively-spliced out of the transgene wherein the presence of the ligand results in the formation of a transgene which does not comprise the ligand-responsive aptamer.

[0372] In some embodiments, the transgene comprises at least one ligand-responsive aptamers comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2086, 2095, 2138, 2188-2189, 2212-2220, or 2236-2239. In some embodiments, the transgene comprises at least one ligand-responsive aptamer comprising a polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NOs: 2086, 2095, 2138, 2188-2189, 2212-2220, or 2236-2239.

[0373] Risdiplam-Responsive Sequences

[0374] In some embodiments, a ligand-responsive sequence is a risdiplam-responsive sequence.

[0375] In some embodiments, risdiplam enhances recognition of 5’ splice sites (e.g., suboptimal or weak 5’ splice sites) by a component of the spliceosome (e.g., the U1 snRNP). In some embodiments, risdiplam enhances pre-mRNA interactions with the U1 snRNP at a 5’ splice site. In some embodiments, risdiplam interacts with exon sequence upstream of a 5’ splice site to either preclude interaction with splicing silencers or recruit splicing enhancers. Accordingly, in some embodiments, a risdiplam-responsive sequence occurs in an alternative exon at. the 5’ splice site and upstream of the downstream intron. In some embodiments, binding of risdiplam to a risdiplam-responsive sequence will lead to intron exclusion. In some embodiments, for example, when the RNA comprises one intron flanked by exons, the presence of risdiplam results in intron removal. A non-limiting example of such embodiments is diagrammed in FIG. 43. In other embodiments, binding of risdiplam to a risdiplam-responsive sequence will lead to alternative exon inclusion. In some embodiments, for example, when the RNA comprises two introns flanking one or more alternative exons, the presence of risdiplam results in inclusion of the one or more alternative exons. A non-limiting example of such embodiments is diagrammed in FIG. 47 A.

[0376] In some embodiments, a risdiplam-responsive sequence comprises a sequence of WGA wherein W corresponds to T or A. In some embodiments, a risdiplam-responsive sequence comprises a sequence of GTAAGW wherein W corresponds to T or A. In some embodiments, a risdiplam-responsive sequence is in an exon-intron boundary with a sequence comprising WGA|gtaagw wherein W corresponds to T or A and indicates the exon-intron boundary' (introns may be shown in lower case letter in some instances herein). In some embodiments, a risdiplam-responsive sequence comprises the sequence of AGGAAG which may be located in an exon (e.g., an alternative exon).

[0377] In some embodiments, a risdiplam-responsive sequence comprises AGGAAG which is 5’ of the sequence AWGAgtaagw (SEQ ID NO: 2190), wherein W is A or T. In some embodiments, the AGGAAG is preceded by any 5’ sequence and proceeded by any 3’ sequence. In some embodiments, the sequence 5’ sequence preceding the AGGAAG can be 1-5, 5-10, 10- 15, 15-20, or more nucleotides in length. In some embodiments, the sequence 3’ sequence proceeding the AGGAAG can be 1-5, 5-10, 10-15, 15-20, or more nucleotides in length. In some embodiments, the 5’ sequence comprises ATAATTTTTT (SEQ ID NO: 2191), CACTTTTATT (SEQ ID NO: 2192), CATTATAATC (SEQ ID NO: 2193), CCATAAGTTT (SEQ ID NO: 2194), TACTATTTAT (SEQ ID NO: 2195), TCATATCT AT (SEQ ID NO: 2196), or TTAGTATCGT (SEQ ID NO: 2197). In some embodiments, the 3’ sequence comprises GTTACGCTTT (SEQ ID NO: 2198), TTGTGTTGTT (SEQ ID NO: 2199), TTAGTGTGTT (SEQ ID NO: 2200), TGATGTATAT (SEQ ID NO: 2201), TTTATCTATC (SEQ ID NO: 2202), TTTTTTACAG (SEQ ID NO: 2203), or CTATTAGTTA (SEQ ID NO: 2204).

[0378] In some embodiments, a risdiplam-responsive sequence comprises the general structure: NNNNNNNNNNAGGAAGNNNNNNNNNNAWGAgtaagw (SEQ ID NO: 2183), wherein N is any nucleotide and W is A or T. In some embodiments, a risdiplam-responsive sequence comprises the general structure: NNNNNNNNNNAGGAAGNNNNNNh\T\n\LAWGAgtaagw?(SEQ ID NO: 2205), wherein N is any nucleotide and W is A or T. In some embodiments, a risdiplam-responsive sequence comprises the general structure YWWKWWWMKYAGGAAGYTAKT(R)WGTTAWGAgtaagw (SEQ ID NO: 2206), wherein Y is C or T, K is G or T, VV is A or T, M is A or C, R is A or G, and (R) is optionally present.

[0379] In some embodiments, for example, a risdiplam-responsive sequence comprises CATTATAATCAGGAAGTTAGTGTGTTAAGAgtaagt (SEQ ID NO: 2207). In some embodiments, a risdiplam-responsive sequence comprises TTAGTATCGTAGGAAGCTATTAGTTAATGgtaagt (SEQ ID NO: 2208). In some embodiments, a risdiplam-responsive sequence comprises ATRTCCACTYAAAAAAATCTGGCGATGGGAGCAGAAWGAgtaagw (SEQ ID NO: 2186), wherein R is A or G, Y is C or T, and W is A or T. In some embodiments, for example, a risdiplam-responsive sequence comprises, ATGTCCACTTAAAAAAATCTGGCGATGGGAGCAGAAAGAgtaagt (SEQ ID NO: 2209), ATGTCCACTCAAAAAAATCTGGCGATGGGAGCAGAAAGAgtaagt (SEQ ID NO: 2210), or ATATCCACTTAAAAAAATCTGGCGATGGGAGCAGAAAGAgtaagt (SEQ ID NO: 2211).

[0380] In some embodiments, a risdiplam-responsive sequence comprises a sequence in Variant 3 or Variant 7 (see, e.g., Example 10). In some embodiments, a risdiplam-responsive sequence comprises a sequence in a variant of exon 1 lb (El IB ) of a POMT2 gene (see, e.g., Example 10). In some embodiments, a risdiplam-responsive sequence comprises an A:C mutation at the +10 position in the intron downstream of POMT2 El IB. In some embodiments, a risdiplam- responsive sequence comprises a sequence in YZ312, YZ316, YZ317, or a variant thereof (see, e.g., Example 10).

[0381] Branaplam-Re spoi tsive Sequences

[0382] In some embodiments, a ligand-responsive sequence is a branapl am -responsive sequence. In some embodiments, a branaplam-responsive sequence binds to a ligand to promote alternative exon inclusion. In some embodiments, a branaplam-responsive sequence binds to a ligand to promote alternative exon exclusion. In some embodiments, branaplam enhances exon inclusion via recognition of sequences near the 5’ splice site of an alternative exon. In some embodiments, branaplam regulates interaction (e.g., directly or indirectly) between a 5’ splice site and a splicesome component (e.g., the U1 snRNP).

[0383] In some embodiments, a branaplam-responsive sequence comprises a sequence in YZ231 or YZ232 (see, e.g., Example 10). In some embodiments, a branaplam-responsive sequence comprises a sequence in YZ301 (see, e.g., Example 10). In some embodiments, for example, when the RNA comprises one intron flanked by at least two exons, the presence of branaplam results in intron removal. In other embodiments, for example, when the RNA comprises two introns flanking one or more alternative exons, the presence of branaplam results in inclusion of the one or more alternative exons. In some embodiments, a branaplam-responsive sequence comprises ATTTAACATTTTTGAGTCAATCCAAGTAATGCAGGAGGTTCATGATTGTGTAGA (SEQ ID NO: 2187).

[0384] Tetracycline-Responsive Sequences

[0385] In some embodiments, a ligand-responsive sequence is a tetracycline-responsive sequence.

[0386] In some embodiments, a tetracycline-responsive sequence comprises TAAAACATACCWDMCGKAAMCGKHWGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2188), wherein W is A or T, wherein D is A, G, or T, wherein M is A or C, wherein K is G or T, and wherein H is A, C, or I'.

[0387] In some embodiments, a tetracycline-responsive sequence comprises TAAAACATACCAYMCGKAAMCGK.MTGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2189), wherein Y is C or T, M is A or C, and K is G or T.

[0388] In some embodiments, a tetracycline-responsive sequence comprises TAAAACATACCTACCGTAACCGGTAGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2212), TAAAACATACCATCCGTAACCGGATGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2095), or TAAAACATACCAGACGGAAACGTCTGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2086). In some embodiments, a tetracycline-responsive sequence is an aptamer. In some embodiments, a tetracycline-responsive aptamer is found in a sequence comprising the general structure of: [upstream 3’ splice site]-[first stem region]-[5’ splice site reverse complementary sequence]-[Tetracycline-Binding Sequence]-[5’ splice site]gt[second stem region].

[0389] In some embodiments, the upstream 3’ splice site and downstream 3’ splice site are at least 20 nucleotides long, wherein the last two nucleotides are AG. In some embodiments, the upstream 3‘ splice site comprises nnnnnnnnnnnnnnnnnnag wherein n is any nucleotide. In some embodiments, the first stem region and the second stem region are at least two nucleotides long. In some embodiments, the first stem region comprises the sequence NN and the second stem region comprises the sequence nn, wherein N / 'n is any nucleotide. In some embodiments, the 5' splice site reverse complementary sequence and the 5' splice site are at least 7 nucleotides long. In some embodiments, the 5' splice site reverse complementary sequence comprises NNNNNNN and the 5' splice site comprises NNNnnnn, wherein N / n is any nucleotide.

[0390] In some embodiments, a tetracycline-responsive aptamer is found in a sequence comprising the general structure of: [EXON] -[INTRON] -[up stream 3' splice site]-[first stem region]-[5' splice site reverse complementary sequence]-[Tetracycline-Binding Sequence]-[5' splice site]gt[second stem region]-[INTRON]-[downstream 3' splice site]-[EXON],

[0391] In some embodiments, the upstream 3' splice site may comprise the sequence TCCTCATIGCCTCTCCTT (SEQ ID XO 2213), TTTCCAACTTATTTCCCT (SEQ ID NO: 2214), CTTACTTTGTATTCCCAT (SEQ ID NO: 2215), AATCTTTATCTCTATTTC (SEQ ID NO: 2216), TGCXICTATCTTACCTTAT (SEQ ID NO: 2217), TGCACTTTCATTCATTTT (SEQ ID NO: 2218), CCACCTTTTTTTATTTTC (SEQ ID NO: 2219), or CCCCCATTTGTCT TCCC X (SEQ ID NO: 2220).

[0392] In some embodiments, the upstream 5' splice site reverse complementary sequence may comprise the reverse complement of CAGGTAA, AACGTAA, CAGGTAC, CCGGTAC, ATCGTAA, GCGGTAC, GAGGTAC, ACGGTAG, CAAGTAA, GAGGTGA, CGCGI AA, GTCGTAA, GAGGTAT, AAGGTAT, TTCGTAA, CCGGTGC, GAGGTAG, CTCGTAA, CTGGTAC, AACGTGA, GCGGTAT, CCGGTAG, or C ACC d TGA.

[0393] In some embodiments, the variable sequence for stem region NN and the variable sequence for stem region nn may comprise CA and ac, CC and ac, AC and ac, AC and cc, or AC and ct. In some embodiments, the downstream variable region for 3' splice site nnnnnnnnnnnnnnnnnnnn may comprise the sequence tttctttttctctttttcag (SEQ ID NO: 2237), tttcttattctccctttcag (SEQ ID NO: 2238), or tttcttcttctacctttcag (SEQ ID NO: 2239).

[0394] In some embodiments, a tetracycline-responsive aptamer comprises a sequence in YZ150 or a variant thereof (see, e.g., Example 10).

[0395] In some embodiments, a tetracycline-responsive aptamer comprises the sequence of SEQ ID NOs: 2086, 2095, 2112 or 2188.

[0396] (vii) RNAs Encoded by Polynucleotides

[0397] Overview of RNAs Encoded by Polynucleotides

[0398] In some embodiments, polynucleotides of the present disclosure comprise a sequence encoding an RNA (e.g., an RNA comprising the sequence of an RNA of interest). As used herein, “RNA of interest” refers to a functional RNA (e.g., an mRNA that can encode a full- length protein, such as a therapeutic protein, or an interfering RNA that can bind to a target transcript).

[0399] In some embodiments, the RNA of interest is functional when present in what is referred to herein as a “first RNA”. In other embodiments, the RNA of interest is functional when present in what is referred to herein as a “second RNA”. In some embodiments, the RNA of interest is functional in either form corresponding to the “first RNA” and the “second RNA”, wherein the first RNA and second RNA encode different isoforms of the RNA of interest. In some embodiments, an RNA of interest corresponds to any gene or protein sequence described herein (see, e.g., Examples 1-10).

[0400] In some embodiments, a sequence encoding an RNA of interest comprises at least 1-5000 nucleotides in length. In some embodiments, a sequence encoding an RNA of interest, is approximately 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-3, 1-4, 1-5, 1 -6, 1-7, 1 -8, 1-9, 1 10, 10-20, 20-30, 30- 40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1,000, 1,000-1,100, 1,100-1 ,200, 1,200-1,300, 1,300-1,400, 1,400-1,500, 1,500-1,600, 1,600-1,700, 1,700-1,800, 1,800-1,900, 1,900-2,000, 2,000-2,100, 2,100-2,200, 2,200-2,300, 2,300-2,400, 2,400-2,500, 2,500-2,600, 2,600-2,700, 2,700-2,800,

[0401] 2,800-2,900, 2,900-3,000, 3,000-3, 100, 3,100-3,200, 3,200-3,300, 3,300-3,400, 3,400-3,500, 3.500-3,600, 3,600-3,700, 3,700-3,800, 3,900-4,000, 4,000-4,100, 4,100-4,200, 4,200-4,300, 4,300-4,400, 4,400-4,500, 4,500-4,600, 4,600-4,700, 4,700-4,800, 4,800-4,900, or 4,900-5,000 nucleotides long. In some embodiments, a sequence encoding an RNA of interest is approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 100-200, 200-300, 300-400, 400-500, 500- 600, 600-700, 700-800, 800-900, 900-1000, 1000-1 100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700-2800, 2800-2900, or 2900- 3000 nucleotides long.

[0402] In some embodiments, a polynucleotide comprises two or more sequences encoding distinct portions of an RNA of interest. In some instances, said sequences may be referred to as a “first sequence”, a “second sequence”, or a “third sequence”. In some embodiments, a portion of an RNA of interest comprises at least 1-5000 nucleotides in length. In some embodiments, a portion of an RINA of interest comprises approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 110, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1,000, 1,000-1,100, 1,100-1,200, 1,200-1,300, 1 ,300-1,400, 1,400-1,500, 1,500-1,600, 1,600-1,700, 1,700-1,800, 1,800-1,900, 1,900-2,000, 2,000-2,100, 2,100-2,200, 2,200-2,300, 2,300-2,400, 2,400-2,500,

[0403] 2.500-2,600, 2,600-2,700, 2,700-2,800, 2,800-2,900, 2,900-3,000, 3,000-3,100, 3, 100-3,200, 3,200-3,300, 3,300-3,400, 3,400-3,500, 3,500-3,600, 3,600-3,700, 3,700-3,800, 3,900-4,000, 4,000-4,100, 4,100-4,200, 4,200-4,300, 4,300-4,400, 4,400-4,500, 4,500-4,600, 4,600-4,700, 4,700-4,800, 4,800-4,900, or 4,900-5,000 nucleotides long. In some embodiments, a portion of an RNA of interest comprises approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100- 1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900- 2000, 2000-2100, 2100-2200, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700- 2800, 2800-2900, or 2900-3000 nucleotides long. In some embodiments, when the sequence of the RNA of interest in the polynucleotide (e.g., in an RNA that has not undergone splicing, such as a pre-mRNA) is discontinuous (e.g., interrupted by a sequence comprising a ligand-responsive sequence), the RNA of interest may be split into two or more portions each comprising 1-10, hundreds, or thousands of nucleotides in length. In some embodiments, for example, the polynucleotide may encode an RNA of interest that is 4000 nucleotides in length, wherein the first sequence comprises 1000 nucleotides of the RNA of interest (e.g., the 5’-most 1000 nucleotides) and the third sequence may comprise 3000 nucleotides of the RNA of interest (e.g., the 3 ’-most 3000 nucleotides).

[0404] In some embodiments, the first sequence, the second sequence, and / or the third sequence comprises at least one exon. In some embodiments, the second sequence comprises at least one alternative exon. In some embodiments, the first sequence, the second sequence, and / or the third sequence comprises at least one intron. In some embodiments, the first sequence, the second sequence, and / or the third sequence comprises at least one splice site. In some embodiments, the first sequence, the second sequence, and / or the third sequence comprises a ligand-responsive sequence. In some embodiments, the second sequence, and / or the third sequence comprise distinct portions of a ligand-responsive sequence.

[0405] In some embodiments, the first RNA comprises the first sequence, the second sequence, and the third sequence. In some embodiments, the second RNA comprises the first sequence and the third sequence. In some embodiments, the second RNA lacks the second sequence (e.g., as a result of alternative splicing).

[0406] Non-Limiting Embodiments ofRNAs Encoded by Polynucleotides

[0407] In some embodiments, an RNA of interest encodes a marker. Non-limiting examples of markers include cell surface proteins (e.g., an antibody or antigen-binding fragment thereof, receptors, membrane proteins which become glycosylated upon expression in a cell, etc.), luciferase or variants thereof, alkaline phosphatase or variants thereof, beta-galactosidase or variants thereof, and fluorescent markers (e.g., mNeonGreen, GFP (e.g., SEQ ID NO: 28), EGFP, Superfold GFP, Azami Green, m Wasabi, TagGFP, TurboGFP, acGFP, zsGreen, T- sapphire, EBFP, EBFP2, Azurite, TagBFP, ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl , TagCFP, mTFPl, EYFP, mCitrine, TagYFP, phiYFP, zsYellowl, mBanana, Kusabira Orange, mOrange, dTomato, DsRed, mTangerine, mRuby, m Apple, mStrawberry, AsRed2, mRFPl, mCherry, HcRedl, iRFP720, smURFP, and AQ143).

[0408] In some embodiments, an RNA of interest comprises corresponds to a gene selected from the group consisting of: MBNL1; MBNL2; MBNL3; hnRNP Al; hnRNP A2B1; hnRNP C; hnRNP D, hnRNP DL; hnRNP F; hnRNP H; hnRNP K , hnRNP L, hnRNP M; hnRNP R; hnRNP U; FUS; TDP43; PABPN1; ATXN2; TAF15; EWSR1; MATR3; TIA1; FMRP; MTM1; MTMR2; LAMP2; KIF5A; a microdystrophin-encoding gene; C9ORF72; HTT; DNM2; BINI , RYR1; NEB; ACTA; TPM3; TPM2; TNNT2; CFL2; KBTBD13; KLHL40; KLHL41; LM0D3; MYPN; SEPN1 ; TTN; SPEG; MYH7; TK2; POLG1; GAA; AGE; PYGM; SLC22A5; OCTN2; ETF; ETFH; PNPLA2; a cytochrome b oxidase-encoding gene; a cytochrome c oxidase- encoding gene; CLCN1 ; SCN4A; DMPK, CNBP; MYOT; LMNA, CAV3; DNAJB6; DES;

[0409] TNPO3; HNRPDL; CAPN3; DYSF; art alpha-sarcoglycan-encoding gene; a beta-sarcoglycan- encoding gene; a gamma-sarcoglycan-encoding gene; a delta-sarcoglycan-encoding gene; TCAP; TRIM32; FKRP; FXN; POMT1; FK TN; POMT2; POMGnTl; DAG1; ANO5; PLEC1;

[0410] TRAPPCI 1; GMPPB; ISPD; LIMS2; POPDC1; TOR1AIP1; POGLUT2; LAMA2; COL6A1; POMT1; POMT2; DUX4; EMD; PA.X7; PMP22; MPZ; MFN2; SMCHD1 ; SMS. Lamin A'C (LAMN); GJB1; ABCC1; AK125149; ASCC2; BAT2D1; BBX; BRD8; BRE; C17orf70;

[0411] CAMKK2; CBFB; CCAR1; CCDC7CD6; CHTF8; COL4A3BP; COL6A3; CUGBP1; CUGBP2; CXorf45; DENND3; DGUOK; DKFZp762G094; DNAJC7; DNASE 1; EIF4A2; EIF4G2; EIF4H; EXOC7, EZH2; FA.M120A; FAM 136 A, FAM36A; FA.RSB; FBXO38; FGFR1OP2; FIP1L1; FOXRED1; FUBP3; GALT; GATA3; GOLGA2; HIF1A; HMMR; HRB; IKZF1; ILF3; IRAK4; IRF1; KCTD13; LEF1 ; LUC7L, LYRM1; MALT1 e7; MAP2K7;

[0412] MAP3K7; MAP4K2; MBNL2; MFF; NAEI , NCSTN; NR4.A3; NRFI , NIJP98; PARP6; PCM1; PLAUR; PLSCR3; PPIL5; PPP5C; PTPRC-E4; PTPRC-E6; PTS; RABL5; RAPH1; SEC16A; SFRS3; SFRS7; SI. MAP. SNRNP70; STAT6; TBC1D1; TIMM8B; TIR8; TRA2.A; TROVE2; UGCGL1; VAP-B; VAV1; ZNF384; ZNF496; CAMK2B; PKP2; LGMN; NRAP; VPS39;

[0413] KSR1; PDLIM3; BINI; ARFGAP2; KIF13 A, and PICALM.

[0414] In some embodiments, an RNA of interest corresponds to a gene encoding a component of a “CRISPR / Cas system” which may be alternatively referred to as a “CRISPR / Cas” molecule. In some embodiments, a CRISPR / Cas molecule comprises a Cas nuclease (e.g., Cas9 or a variant thereof, Cas 12a or a variant thereof, Cas fusion protein comprising CasPhi, CasMini, etc.). In some embodiments, the CRISPR'Cas molecule binds to a guide RNA (gRNA) described herein. In some embodiments, the CRISPR / Cas molecule binds to a gRNA encoded by a polynucleotide regulated by an alternatively spliced sequence described herein. In some embodiments, the CRISPR / Cas molecule binds to a gRNA encoded by a separate polynucleotide that does not comprise an alternatively spliced sequence described herein. In some embodiments, the RNA of interest corresponds to a gRNA. In some embodiments, the gRNA binds to a CRISPR / Cas molecule described herein. In some embodiments, the gRNA binds to a CRISPR / Cas molecule encoded by a polynucleotide regulated by an alternatively spliced sequence described herein. In some embodiments, the gRNA binds to a CRISPR / Cas molecule encoded by a separate polynucleotide that does not comprise an alternatively spliced sequence described herein.

[0415] In some embodiments, a CRISPR / Cas molecule is of, or derived from, Streptococcus Staphylococcus aureus (e.g., A aureus Cas9). In some embodiments, a CRISPR / Cas molecule comprises a Cas nuclease variant that encoded by a shorted variant sequence (e.g., CasMini). In some embodiments, such a Cas nuclease may be selected in order to fit within the packaging capacity of an rAAV genome.

[0416] In some embodiments, a CRISPR / Cas molecule may be selected to promote genomic editing with a suitable gRNA. In some embodiments, the gRNA may bind to a target domain in the genome of a host cell (e.g., when present in a ribonucleoprotein complex with a CRISPR / Cas nuclease). In some embodiments, the gRN A may comprise a targeting domain that may be partially or completely complementary to the target domain. In some embodiments, the gRNA comprise a targeting domain that may be partially or completely complementary to the target domain located in a genomic sequence (e.g., a gene) implicated in a disease or disorder (e.g., a mutated gene). In some embodiments, a gRNA can be unimolecular (having a single RNA molecule), sometimes referred to herein as sgRNAs (comprising more than one, and typically two, separate RNA molecules, such a single RNA molecule including both crRNA and tracrRNA sequences covalently bound to each other). In some embodiments, the targeting domain is 15 to 25 nucleotides in length. In some embodiments, the gRNA is chemically modified.

[0417] In some embodiments, the RNA of interest corresponds to an erythropoietin (EPO) gene.

[0418] In some embodiments, the RNA of interest corresponds to a GARBRG2 gene. In some embodiments, the RNA of interest corresponds to a long protein isoform of GARBRG2. In some embodiments, the RNA of interest corresponds to a short protein isoform of a GARBRG2. In some embodiments, the long protein isoform of GABRG2 comprises a sequence corresponding to exon 9 of the GABRG2 gene. In some embodiments, the short protein isoform of GABRG2 does not comprise a sequence corresponding to exon 9 of the GABRG2 gene. In some embodiments, the RNA of interest corresponds to the CSNK1 D gene. In some embodiments, the RNA of interest corresponds to a long protein isoform of CSNK1D. In some embodiments, the RNA of interest corresponds to a short protein isoform of CSNK1D. In some embodiments, the long protein isofomi of CSNK1D comprises a sequence corresponding to exon 9 of the CSNK1D gene. In some embodiments, the short protein isofonn does not comprise a sequence corresponding to exon 9 of the CSNK1D gene.

[0419] Non-Limiting Embodiments of Therapeutic RNAs and Therapeutic Proteins

[0420] In some embodiments, an RNA of interest is a therapeutic RNA and / or encodes a therapeutic protein. ,As used herein, a “therapeutic RNA” or “therapeutic protein” leads to a physiological change that is associated with or expected to at least partially, if not fully, remedy at least one symptom associated with a disease, disorder, or condition. A therapeutic RNA may refer to an RNA expressed from a transgene that is therapeutic as an RNA upon expression in a target cell and without being translated into a protein. A therapeutic protein may refer to any proteinaceous molecule that is translated from an RNA expressed from a transgene which is therapeutic upon translation in a target cell. A therapeutic RNA or protein may be therapeutic for any disease, disease, or condition described herein upon administration to a subject in need thereof.

[0421] In some embodiments, therapeutic RNAs can be, but are not limited to, interfering RNAs (e.g., shRNAs, siRNAs, miRNAs, ncRNAs, piRNAs, pro-siRNAs, etc.), exon-skipping RNAs, enzymatic RNAs, guide RNAs or gRNAs (e.g., sgRNAs) of a CRISPR / Cas editing system (e.g., Cas9-based genome editing and derivatives thereof, such as base editing and prime editing), small nuclear RNAs (snRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), and niRNAs.

[0422] As used herein, “miRNA” refers to a nucleic acid which comprises several structural and functional characteristics. miRNAs are single-stranded RNAs of about 19-25 nucleotides that regulate the expression, stability, and / or translation of other mRNAs comprising complementary sequences. miRNAs are cleaved from a longer endogenous double-stranded hairpin precursors by the enzymes Drosha and dicer. miRNAs match genomic regions that can potentially encode precursor RNAs in the form of double-stranded hairpins. miRNAs and their predicted precursor secondary structures are phylogenetically conserved. Drosha, dicer, and Argonaute are crucial regulators of miRNA biosynthesis, maturation, and function. Canonical miRNA biogenesis involves Drosha cleavage on hairpin shaped primary miRN A to generate hairpin precursor with 2 or 3 nucleotide overhangs in the 3' end, and then Dicer cleavage on precursor miRNA to generate miRNA duplex. Additionally, the stem-loop structure of pre-miRNA is crucial for miRNA processing wherein disruption of such structures inhibits the Drosha cleavage reaction and, thus, the production of functional miRNAs. Cofactors bind to the pre-miRNA to form a pre-micro ribonucleoprotein (pre-miRNP) and unwind the pre- miRNAs into single-stranded miRNAs. The pre-miRNP is then transformed to miRNP. miRNAs play crucial roles in eukaryotic gene regulation. For instance, miRNAs are thought to interact with target mRNAs through complementary base-pairing which leads to suppressed translation. Separately, miRNAs promote RNA degradation.

[0423] Due to their small size of 19-25 nucleotides, the use of quantitative real-time PCR for monitoring expression of mature miRNAs is excluded. Therefore, most miRNA researchers currently use Northern blot analysis combined with polyacrylamide gels to examine expression of both the mature and pre-miRNAs. Primer extension has also been used to detect the mature miRNA. Alternatively, miRNA expression may be assessed by measuring the levels of the target mRNA and / or its protein product.

[0424] Examples of miRNAs include, but are not limited to miRNA-16 2 gene. In some embodiments, the transgene comprises the scaffold of primary miRNA 16-2 and an miRNA seed sequence of HSUR4 miRNA. In some embodiments, the transgene comprising the pri-miRNA 16-2 scaffold can further comprise a miRNA seed sequence of any miRNA of interest. In some embodiments, the miRNA comprises a sequence of YZ150, YZ232, or YZ301.

[0425] In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one miRNAs comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 60, 61, or 64. In some embodiments, for example, a miRNA having at least 70% sequence identity relative to SEQ ID NO: 60, 61. Or 64 may comprise targeting ability (e.g., reverse complementarity) to a different RNA target but is regulated by a ligand-responsive sequence described herein. In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one miRNA comprising a polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 60, 61, or 64. In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one exon comprising a niiRNA sequence comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 60, 61, or 64. In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one exon comprising a miRNA sequence comprising a polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 60, 61, or 64.

[0426] In some embodiments, therapeutic proteins can be, but are not limited to, enzymes (such as proteases, signaling proteins, transcriptional regulators (e.g., MECP2), Cas9, base editors, prime editors, etc.), enzymatic domains, enzyme substrates, secreted proteins (e.g., progranulin), hormones (e.g., erythropoietin, insulin or a variant thereof, such as a furin-cleavale pro-insulin, etc.), receptors (e.g., chimeric antigen receptors), components of gene editing ribonucleoprotein complexes (e.g., CRISPR / Cas molecules, such as Cas9, base editors, such as adenine base editors and cytidine base editors, prime editors, etc.), a zinc finger nuclease, a TALEN, peptibodies, growth factors, RNA-binding proteins, clotting factors, cytokines, chemokines, activating or inhibitor} / peptides acting on cell surface receptors or ion channels, cell-permeable peptides targeting intracellular processes, thrombolytics, bone morphogenetic proteins, Fc-fusion proteins, anticoagulants, and antibodies or antigen-binding fragments thereof In some embodiments, a therapeutic RNA or protein is selected for the purposes of gene replacement therapy. In some embodiments, the therapeutic protein is selected for the purposes of vaccine production against a human pathogen (e.g., a protein, or fragment thereof, comprising an antigen of a human pathogen).

[0427] (viii) Introns

[0428] As used herein, an “intron” or “intronic sequence” or “intronic regions” can refer to a nucleotide sequence that does not code for a therapeutic protein or therapeutic RNA and is spliced out of the transgene transcript. In some instances, an “intron” or “intronic sequence” or “intronic regions” can refer to alternatively spliced sequence (e.g., an intron found in a polynucleotide comprising a risdiplam-responsive sequence). In some embodiments, such splicing may be regulated by the presence or absence of a ligand. In some embodiments, the terms “intron” and “intronic sequence” may be used interchangeably. In some embodiments, the transgene comprises at least two introns or intronic sequences. An intron, alternatively referred to as a flanking component, may in some embodiments be immediately adjacent to the central component. For example, a central ligand-responsive aptamer may, in some embodiments, be flanked by two introns, wherein such introns are positioned immediately adjacent to the central ligand-responsive aptamer. In other embodiments, for example, a central ligand-responsive sequence (e.g., one comprising an alternative exon) may be flanked by two introns. In some embodiments, the transgene comprises a polynucleotide comprising an exon or exon region at the 5' and 3' ends with a central region comprising at least two introns, an alternative exon and a ligand-responsive aptamer. In some embodiments, introns of the transgene are spliced out of the transgene along with the ligand-responsive aptamer in the presence of the ligand thereby forming a transgene lacking both the at least one intron and the aptamer. In some embodiments, in the absence of ligand, only the introns are spliced out.

[0429] In some embodiments, the polynucleotide (e.g., a transgene) comprises at least two introns comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 21 13, 2115, 2117, 2118, 2121, 2130, 2141 , or 2232-2233. In some embodiments, the polynucleotide (e.g., a transgene) comprises at least two introns comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2130, 2141, or 2232-2233.

[0430] In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one intron that comprises a sequence that is part of a 3' splice site comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239. In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one intron that comprises a sequence that is part of a 3' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239.

[0431] In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one intron that comprises a sequence that is part of a 5' splice site comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in Tables 7, 25, 26, or 34. In some embodiments, the polynucleotide (e.g., a transgene) comprises at least one intron that comprises a sequence that is part of a 5' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of Tables 7, 25, 26, or 34.

[0432] (viii) Additional Terms

[0433] As used herein, an “engineered intron” is an intron which comprises at least one modification, relative to a native intron. For example, an engineered intron may comprise one or more nucleotide deletions, and thus be truncated, relative to a native intron.

[0434] As used herein, an “engineered exon” is an exon which comprises at least one modification, relative to a native exon. For example, an engineered exon may comprise one or more nucleotide deletions, and thus be truncated, relative to a native exon.

[0435] As used herein, a “flanking” component (e.g., a flanking intron) refers to a component which is located upstream (e.g., 5’) or downstream (e.g., 3’) of a central component (e.g., an exon). A flanking component may in some embodiments be immediately adjacent to the central component, but that is not required by the methods and compositions of the present disclosure. For example, a central alternatively-spliced exon may, in some embodiments, be flanked by two introns, wherein such introns are immediately adjacent to the central alternatively-spliced exon. The same central alternatively-spliced exon may also be flanked by two additional exons, which are located upstream and downstream of the central alternatively-spliced exon, respectively, but which are not immediately adjacent to the central alternatively-spliced exon.

[0436] As used herein, a “constitutive exon” is an exon that is present in all spliced transcripts (e.g., mRNA isoforms) formed as a result of splicing a pre-mRNA or miRNA transcripts that are transcribed from a gene. A constitutive exon is therefore common to different mRNA isoforms of a gene.

[0437] Additional terms are defined throughout the disclosure.

[0438] Ik Alternative splicing and models used herein

[0439] Through alternative splicing of pre-mRNAs, individual mammalian genes often produce multiple mRNAs (i.e., mRNA isoforms) and resultant protein isoforms that may have related, distinct or even opposing functions. The mRNA and protein isoforms produced by alternative splicing (or equivalently, alternative processing) of primary RNA transcripts may differ in structure, function, localization or other properties. Alternative splicing in particular is known to affect more than half of all human genes, and has been proposed as a primary driver of the evolution of phenotypic complexity in mammals. The number of variants of a gene ranges from two to potentially thousands. The resulting proteins may exhibit different and sometimes antagonistic functional and structural properties, and may inhabit the same cell with the resulting phenotype representing a balance between their expression levels. Defects in splicing have been implicated in human diseases, including cancer.

[0440] Aspects of the invention utilize alternative splicing mechanisms as a method of regulating the expression of a transgene (e.g., encoding a therapeutic protein or miRNA). Thus, by manipulating the composition and arrangement of an inducibly-spliced exon cassette, a recombinant viral genome of the present disclosure comprising the inducibly-spliced exon cassette may behave in a predictable manner, and the transgene and / or coding region of interest may be expressed in specific conditions which are therapeutically beneficial (e.g., in a specific cell type, a specific tissue, a disease state, and / or upon an inflammatory response). Thus, aspects of the invention contemplate inducibly-spliced exon cassettes for regulating the expression of coding regions of interest (e.g., encoding therapeutic nucleic acids such as miRNAs and / or therapeutic proteins).

[0441] Aspects of the invention utilize alternative splicing mechanisms as a method of regulating the expression of a transgene (e.g.., encoding a therapeutic protein). However, unlike naturally occurring alternatively-spliced exons, the alternatively-spliced exons of the application do not necessarily result in alternative sequence isoforms of the encoded protein. In many embodiments, an alternatively-spliced exon impacts the level of protein expression without impacting the sequence of the protein that is expressed. That is, the alternatively-spliced exon is utilized as a means of regul ation of the expression of the protein of interest. In some embodiments, retention of the alternatively-spliced exon in the spliced transcript results in the productive translation of a coding region of interest. In some embodiments, exclusion of the alternatively-spliced exon from the spliced transcript results in the coding region of interest not being translated (e.g., the alternatively-spliced exon is spliced out). In some embodiments, retention of the alternatively-spliced exon in the spliced transcript results in nonsense mediated decay. In some embodiments, exclusion of the alternatively-spliced exon from the spliced transcript results in the productive translation of the coding region of interest.

[0442] Thus, by manipulating the composition and arrangement of an alternatively-spliced exon cassette, a recombinant viral genome of the present disclosure comprising the alternatively- spliced exon cassette may behave in a predictable manner, and the transgene and / or coding region of interest may be expressed in specific conditions which are therapeutically beneficial (e.g., in a specific cell type, a specific tissue, a disease state, and / or upon an inflammatoiy response). Transgenes comprising alternatively-spliced exon cassettes may be designed according to any one of several non-limiting models of alternative splicing (shown in FIGs. 2 or 4-8), each of which is specifically contemplated herein, in addition to other models of alternative splicing. Thus, aspects of the invention contemplate alternatively-spliced exon cassettes for regulating the expression of coding regions of interest (e.g., encoding therapeutic proteins).

[0443] In various aspects, the alternatively-spliced exons are spliced-in or spliced-out in a manner that, is dependent upon one or more environmental cues, e.g., cell or tissue type, disease state, or intracellular conditions such as the presence of a ligand. The alternatively-spliced exons can be sourced from a naturally occurring gene or may be recombinant, for example, in order to add one or more genetic regulatory / elements for influencing expression levels of the transgene and / or coding region of the transgene. Examples of alternatively-spliced exons are disclosed herein.

[0444] In various embodiments, the alternatively-spliced exons may comprise one or more regulatory' sequences that modulate the expression of a coding sequence of interest. Such regulatory sequences may be referred to a cis-elements. Further, m-elements that impart a positive regulatory control on a coding sequence of interest may be referred to as a positive regulatory czs-element. To the contrary, czs-elements that impart a negative regulatory control on a coding sequence of interest may be referred to as a negative regulatory cis-element.

[0445] Alternatively-spliced exons may be found in nature in a naturally-occurring genes, or may be modified by changing or altering the sequence thereof (e.g., derived from a naturally- occurring gene), including adding or changing the splice site, and / or adding or changing a positive or negative regulatory' cis-element. The one or more positive or negative regulatory cis- elements may be located within an alternatively-spliced exon, and may influence the level of expression of a coding region of interest through positive and / or negative controls, and may include any regulatory' sequence which exerts as a consequence being spliced-in or spliced-out of the final niRNA — either a positive or negative regulation on the expression of the coding region.

[0446] FIG. 4 shows seven non-limiting embodiments contemplated for the structural configuration of a cassette (e.g., comprised within a transgene) for use with a recombinant virus genome, wherein the cassette (e.g, comprised within a transgene) comprises an alternatively- spliced exon and a coding region, wherein the alternatively-spliced exon further comprises at least one positive or negative regulatory czs-element. Non-limiting examples of positive or negative regulatory’ czx-elements can include, for instance, (1) a nucleotide sequence element that regulates, modulates, or otherwise affects the stability and / or degradation of a mRNA, and (2) a nucleotide sequence element that regulates, modulates, or otherwise affects the translation of a mRNA into one or more encoded polypeptide products (e.g., a therapeutic product). Without limitation, positive or negative regulatory' czs-elements may include, but are not limited to, a translation start, codon, a translation stop codon, a ligand-responsive aptamer, a binding site for an RNA binding protein that serves to positively regulate transgene expression, a binding site for an RNA binding protein that serves to negatively regulate transgene expression, a binding site for a nucleic acid molecule (e.g., an miRNA) that serves to positively regulate transgene expression, a binding site for an RNA binding protein that serves to negatively regulate transgene expression, a binding site for a nucleic acid molecule (e.g., an miRNA) that serves to positively regulate transgene expression, or a binding site for a nucleic acid molecule (e.g., an siRNA or miRNA). This list of examples is not intended to place any limitation on the scope or meaning of the positive and negative regulatory czx-elements and the disclosure embraces any genetic element or region positioned within or at least associated with an alternatively-spliced exon which exerts a positive or negative control on the overall expression of a transgene (e.g., encoding a therapeutic protein).

[0447] In some embodiments, the one or more czx-elements can include, but are not limited to, a translation start codon, a translation stop codon, a ligand-responsive aptamer, an siRNA binding site, a miRNA binding site, a sequence forming a stem-loop structure, a sequence forming an RNA dimerization motif, a sequence forming a hairpin structure, a sequence forming an RNA quadruplex, polypurine tract, a sequence forming a pair of kissing loops, and a sequence forming a tetral oop / tetraloop receptor pair. In some embodiments, cA-elements include binding sites recognized by regulatory elements, such as, for example, RNA binding proteins. In some embodiments, an RNA binding protein capable of exerting regulatory' control once bound is an RNA binding protein described in Van Nostrand, et al. (2020), A large-scale binding and functional map of human RNA-binding proteins, Nature, 583: 711-719, which is herein incorporated by reference with respect to its description of RNA binding proteins.

[0448] In some embodiments, a transgene comprising an inducibly-spliced exon cassette comprises a polynucleotide sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260. In some embodiments, a transgene comprising an inducibly-spliced cassette comprises a polynucleotide sequence as set forth in any one of SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 21 18, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

[0449] In various embodiments, the cassettes (e.g., comprised within a transgene) may include one or more additional components, including one or more other constitutive exons, and one or more introns. In FIGs. 4A-4C, the constitutive exons not comprising the coding region of interest are represented by narrow rectangles, introns are represented as dashed lines, and the alternatively-spliced exons are represented as shaded narrow rectangles. In some embodiments, the exon or exons comprising the coding region (or portions thereof, in embodiments wherein the coding region is split into separate exons) are indicated as solid thick white rectangles. In other embodiments, the alternatively-spliced exon may contain portions of a coding region of interest.

[0450] FIG. 4A is a schematic of an embodiment wherein the alternatively-spliced exon is upstream of the exon encoding the coding region of interest. Said another way, in this embodiment, the alternatively-spliced exon is to the 5’ of the exon encoding the coding region of interest.

[0451] FIG. 4B is a schematic of an embodiment wherein the alternatively-spliced exon is downstream of the exon encoding the coding region of interest. Said another way , in this embodiment, the alternatively-spliced exon is to the 3’ of the exon encoding the coding region of interest.

[0452] FIG. 4C is a schematic of an embodiment wherein the alternatively-spliced exon is positioned between two separate exons encoding portions of the coding region of interest.. Said Ill another way, in this embodiment, the alternatively-spliced exon is between the exons encoding the portions of the coding region of interest.

[0453] Exemplary Uses of Ligands

[0454] In some embodiments, polynucleotides encode an RNA of interest corresponding to any gene described herein (see, e.g., Examples 1-10). In some embodiments, the RNA of interest becomes functional as a result of alternative splicing. In some embodiments, alternative splicing is induced by binding of a ligand (e.g., a small molecule).

[0455] In some embodiments, for example, the presence of a ligand results in exclusion of an alternatively spliced sequence (e.g., an intron, exon, aptamer, etc.) from the RNA encoded by the polynucleotide which enables the RNA of interest encoded therein to comprise a continuous, n on-interrupted sequence, adopt a functional three-dimensional structure (e.g., such as that of a microRNA), and / or be translated into a protein (e.g., a therapeutic protein).

[0456] In some embodiments, as a further example, the presence of ligand results in inclusion of an alternatively spliced sequence (e.g., one or more exons) in the RNA encoded by the polynucleotide which enables the RNA of interest encoded therein to comprise a sequence encoding an RNA of interest, adopt a functional three dimensional structure (e.g., such as that of a microRNA), and / or be translated into a protein (e.g., a therapeutic protein).

[0457] In other embodiments, ligand-depending inclusion or exclusion of an alternatively spliced sequence (e.g., one or more exons) in the RNA encoded by the polynucleotide which enables the RNA of interest encoded therein to be differentially expressed (e.g., to be translated into a long or short protein isoform, respectively).

[0458] FIG. 4D shows a non-limiting embodiment, of an approach that puts a gene sequence under control of a ligand-responsive aptamer. In this embodiment, a naturally occurring gene can be engineered to become under the control of a ligand by inserting the cassette into the gene. The portions upstream and downstream of the site at which the cassette is inserted then become separate exons. In some embodiments, the cassette is inserted without making any changes to the sequence flanking the insertion site. However, in some embodiments one or more nucleotide sequence changes are made in one or both flanking regions (e.g., at the positions immediately flanking the site of insertion). In some embodiments, the one or more nucleotide changes render either or both flanking sequences more compatible with splicing. In some embodiments, the one or more nucleotide changes result in either or both flanking sequences becoming effective 3’ and / or 5' splice sites. In some embodiments, the one or more nucleotide changes include introducing one or more sequences that support an effective dynamic range between alternative splicing events of a ligand-induced alternatively spliced exon described in this application. In some embodiments, the one or more nucleotide changes include introducing one or more flanking sequence described in this application. FIG. 4E shows a non-limiting embodiment of a transgene comprising an alternatively-spliced cassette. In this embodiment, the expression cassette comprises a general structure comprising at least one alternative exon, at least two introns flanking the alternative exon, a ligand-response aptamer, and a plurality of splice sites. In this embodiment, one exon is positioned 5’ to the cassette sequence and one exon is positioned 3’ to the cassette sequence thereby flanking the intervening at least two introns, alternative exon, ligand-responsive aptamer, and plurality of splice sites. In this embodiment, at least two exons flanking the cassette are always present in the RNA molecule transcribed from the transgene regardless of the presence of the ligand or splicing reaction outcomes. In this embodiment, the alternative exon comprises the ligand-responsive aptamer wherein the ligand-responsive aptamer regulates the splicing (i.e., removal) of the alternative exon. In this embodiment, when the ligand which binds to the aptamer is absent, the alternative exon is present in the spliced RNA molecule transcribed from the transgene. In this embodiment, the presence of a ligand which binds to the aptamer results in removal of the alternative exon such that the spliced RNA molecule comprises only the at least two exons and lacks the alternative exon, the two introns, and the ligand- responsive aptamer. In this embodiment, when two introns are present, for example, the most 5’ intron is downstream (3’) of the most upstream exon and the 3 ’ most intron is upstream (5’) of the most downstream exon such that the exons exist at the 5’ and 3’ termini of the cassete sequences which include the introns, alternative exon, and the ligand-responsive aptamer. In this embodiment, the boundaries of an exon-intron sequence comprise splice sites that regulate the splicing of the cassette. In this embodiment, the splicing of the introns occurs regardless of the presence of ligand such that the spliced RNA molecule comprising the cassette sequence lacks the at least tw'O introns. However, only in the presence of ligand are the introns spliced out in addition to the alternative exon and the ligand-responsive aptamer. As illustrated in FIG. 4E, the ligand-responsive aptamer may be located in either one of the introns, in the alternative exon, or may span an intron-exon boundary occurring between the alternative exon and one of the introns. However, in some embodiments, a ligand-responsive aptamer may be included in one of the flanking exon sequences provided that it is configured such that binding of the ligand affects the splicing of the alternatively spliced exon and the ligand-responsive aptamer. In the embodiment illustrated in FIG. 4E, the splice sites are provided in multiples of two such that two splice sites (a 5’ site and a 3:site) are always required to regulate the splicing of a sequence. In this embodiment, the 3’ splice site that is 5’ of the alternative exon comprises intronic sequences. In this embodiment, the 5’ splice site that is 3’ of the alternative exon comprises both intronic and exonic sequences such that when the alternative exon is included in the RNA molecule it will comprise a partial sequence that is part of the original 5’ splice site. Non-limiting examples of embodiments illustrating this configuration can be found in Example 7 and SEQ ID NO: 2081 .

[0459] FIG. 4F shows a non-limiting embodiment of a transgene comprising a non-continuous start codon split by the alternatively spliced cassette. In this embodiment, the exons comprise a non-continuous start codon such that the 3’ most nucleotides of the upstream exon comprise an A or AT and the 5’ most nucleotides of the downstream exon comprise a TG or G, respectively. In this embodiment, the absence of a ligand results in splicing reactions that includes the alternative exon and thereby produces an RNA molecule that contains a non-continuous start codon that is disrupted by the alternative exon and is not translated into the full-length protein product. In this embodiment, the presence of a ligand results in splicing reactions that removes the alternative exon and thereby produces an RNA molecule that comprises a continuous start codon provided by the nucleotides of the first and last exon resulting in translation of the full- length protein product of the transgene. Non-limiting examples of embodiments illustrating this configuration can be found in Example 7. SEQ ID NO: 2131 represents a non-limiting example of a control construct that can be used to assess the inducibility of alternative splicing of a transgene comprising a non-continuous start codon. In this embodiment, the transgene lacks the aptamer and alternative exon. Here, the intron sequence is spliced out thereby converting the non-continuous start codon into a continuous start codon resulting in translation of the transgene. SEQ ID NO: 2132 represents another non-limiting example of a control construct that can be used to assess the inducibility of alternative splicing of a transgene comprising a non-continuous start codon. Here, the alternative exon comprising an aptamer disrupts the start codon thereby preventing translation of the transgene. FIG. 4G shows a non-limiting embodiment of an alternatively spliced exon cassette comprising a pre-mature stop codon that is inserted between two consecutive coding sequences of a gene (e.g., two exons of a gene). In this embodiment, the exons flanking the cassette are not translated in the absence of ligand due to the presence of a pre-mature stop codon in the alternative exon (e.g., in frame with the reading frame of the upstream exon). In this embodiment, the presence of the stop codon in the alternative exon results in pre-mature termination of translation of the transgene when the alternative exon is not spliced out of the RNA molecule. In this embodiment, the presence of a ligand induces splicing upon binding to the aptamer such that the alternative exon comprising the pre-mature stop codon is removed thereby allowing translation to produce the full-length protein product encoded by the transgene. Non limiting examples of embodiments illustrating this configuration can be found in Example 7 and SEQ ID NOs: 2091, 2099, 2102, 2105, 2108, 2109-2112, 2116, 2118, 2120, 2123, and 2128. In some embodiments, the pre-mature stop codon can be UAA, UAG, or UGA provided that it is in frame with the reading frame of the first exon. In some embodiments, the stop codon may be provided within the aptamer sequence if the aptamer is provided in the alternative exon. In some embodiments, the stop codon may be upstream or downstream of the aptamer and provided in the alternative exon.

[0460] FIG. 4H shows a non-limiting embodiment of an alternatively spliced exon cassette that is inserted in a coding sequence for a regulatory RNA molecule. In this embodiment, the at least two exons encode an interfering RNA, such as a miRNA, such that removal of the alternative exon produces a functional miRNA molecule that is capable of regulating gene expression. Nonlimiting examples of embodiments illustrating this configuration can be found in Example 7 and SEQ ID NO: 2138. In some embodiments, the aptamer may be provided in an intron sequence, the alternative exon sequence, or may span the alternative exon and a flanking intron. In some embodiments, the sequences encoding the regulatory RNA may comprise a pri-miRNA scaffold and / or miRNA seed sequence.

[0461] FIG. 41 shows a non-limiting embodiment of a nucleic acid design to regulate RNA splicing using a ligand-responsive sequence. In this embodiment, an intron splits tw'O exons. Ligand binding to the ligand-responsive sequence results in alternative splicing, wherein the exons are brought together to form an RNA that encodes the protein of interest. FIG. 4J shows a non-limiting embodiment of a nucleic acid design to regulate RNA splicing using a ligand-responsive sequence. In this embodiment, an intron splits two exons. Ligand binding to the ligand-responsive sequence results in alternative splicing, wherein the exons are disrupted and the RNA cannot encode the protein of interest.

[0462] FIG. 4K shows a non-limiting embodiment of a ligand-responsive nucleic acid that can be used to differentially regulate the expression of protein isofomis. The alternative exon is flanked by introns. Ligand binding results in exclusion of the alternative exon in the spliced RNA thereby encoding the shorter isoform of the protein. The absence of the ligand results in inclusion of the alternative exon from the spliced RNA which encodes the longer isoform of the protein.

[0463] FIG. 4L shows a non-limiting embodiment of a ligand-responsive nucleic acid that can be used to differentially regulate the expression of protein isoforms. The alternative is flanked by introns. Ligand binding results in inclusion of the alternative exon in the spliced RNA thereby encoding the longer i soform of the protein. The absence of the li gand results in exclusion of the alternative exon from the spliced RNA which encodes the shorter isoform of the protein.

[0464] FIG. 4M shows a non-limiting embodiment of a ligand-responsive nucleic acid that regulates translation of an RNA. The alternative exon comprises a ligand-responsive sequence and prevents a start codon from being in frame with the RNA. Inclusion of the alternative exon in the presence of the ligand leads to production of the protein corresponding to the RNA. In some embodiments, said nucleic acid is useful in providing an inducible ON switch for regulating synthesis of a protein of interest.

[0465] FIG. 4N shows a non-limiting embodiment of a ligand-responsi...

Claims

CLAIMSWhat is claimed is:1 . A polynucleotide comprising a sequence encoding a ligand-responsive sequence, wherein the polynucleotide is capable of being alternatively spliced in the presence of a ligand to produce a first RNA or a second RNA.

2. The polynucleotide of claim I, wherein the polynucleotide comprises an alternative exon flanked by at least two introns, wherein the alternative exon is operably linked to the ligand- responsive sequence.

3. The polynucleotide of claim 2, wherein the first KN A comprises the alternative exon, wherein the second RNA does not comprise the alternative exon.4, The polynucleotide of any one of claims 1-3, wherein the first RNA encodes a long isoform of an RNA of interest and / or the second RNA encodes a short isoform of the RNA of interest.5 The polynucleotide of any one of claims 1-3, wherein the first RNA encodes an RNA of interest.

6. The polynucleotide of claim 5, wherein the first RNA is not operably linked to a premature stop codon.

7. The polynucleotide of claim 5, wherein the first RNA is operably linked to a start codon.

8. The polynucleotide of any one of claims 1-3, wherein the second RNA encodes an RNA of interest.9 The polynucleotide of claim 8, wherein the second RNA is not operably linked to a pre- mature stop codon.

10. The polynucleotide of claim 9, wherein the second RNA is operably linked to a start codon.

11. The polynucleotide of claim 9, wherein the RNA of interest i s an interfering RNA.

12. The polynucleotide of claim 5 or 8, wherein the RNA of interest is a microRNA.

13. The polynucleotide of claim 12, wherein the second RNA encodes the microRNA.

14. The polynucleotide of any one of claims 5-10, wherein the RNA of interest encodes a protein.

15. The polynucleotide of any one of claims 5-10, wherein the RNA of interest encodes a CRISPR / Cas nuclease or a guide RNA (gRNA).

16. The polynucleotide of claim any one of claims 5-15, wherein the RNA of interest encodes a therapeutic RNA and / or a therapeutic protein.

17. The polynucleotide of any one of claims 1-16, wherein the ligand-responsive sequence is a risdiplam-responsive sequence or a branaplam-responsive sequence.

18. The polynucleotide of claim 17, wherein the alternative exon comprises a first, portion of the risdiplam-responsive sequence and an intron downstream of the alternative exon comprises a second portion of the risdiplam-responsive sequence.

19. The polynucleotide of claim 17 or 18, wherein the first portion of the risdiplam- responsive sequence comprises a WGA sequence and the second portion of the risdiplam- responsive sequence comprises a GTAAGW sequence.

20. The polynucleotide of any one of claims 17-19, wherein the alternative exon further comprises a AGGAAG sequence which is 5’ to the WGA sequence.21 . The polynucleotide of any one of claims 17-20, wherein the alternative exon further comprises an upstream sequence which is 5’ to the AGGAAG sequence.

22. The polynucleotide of claim 21, wherein the upstream sequence comprises at least 10 nucleotides.

23. The polynucleotide of any one of claims 20-22, wherein the alternative exon further comprises a down stream sequence which is 3’ to the AGGAAG sequence and 5’ to the WGA sequence.

24. The polynucleotide of claim 23, wherein the downstream sequence comprises at least 6 nucleotides.

25. The polynucleotide of any one of claims 17-24, wherein the risdiplam-responsive sequence comprises NNNNNNNNNNAGGAAGNNNNNNNNNN AWGAGTAAGW (SEQ ID NO: 2183), wherein N is any nucleotide and W is A or T.

26. The polynucleotide of any one of claims 17-24, wherein the risdiplam-responsive sequence comprises YWWKWWWMKYAGGAAGYTAKTWGTTAWG AGTAAGW (SEQ ID NO: 2184) or YWWKWWWMKY AGGAAGYTAKTRWGTT AWGAGTAAGW (SEQ ID NO: 2185), wherein Y is C or T, K is G or T, W is A or T, M is A or C, and R is A or G.

27. The polynucleotide of claim 25 or 26, wherein the upstream sequence comprises ATAATTTTTT (SEQ ID NO: 2191), CACTTTTATT (SEQ ID NO: 2192), CATTATAATC (SEQ ID NO: 2193), CCATAAGTTT (SEQ ID NO: 2194), TACTATTTAT (SEQ ID NO: 2195), TCATATCTAT (SEQ ID NO: 2196), or TTAGTATCGT (SEQ ID NO: 2197) and / or the downstream sequence comprises GTTACGCTTT (SEQ ID NO: 2198), TTGTGTTGTT (SEQ IDNO: 2199), TTAGTGTGTT (SEQ ID NO: 2200), TGATGTATAT (SEQ ID NO: 2201), TTTATCTATC (SEQ ID NO: 2202), TTTTTTACAG (SEQ ID NO: 2203), or CTATTAGTTA (SEQ ID NO: 2204).

28. The polynucleotide of claim 26 or 27, wherein the risdiplam-responsive sequence comprisesCATTATAATCAGGAAGTTAGTGTGTTAAGAGTAAGT (SEQ ID NO: 2207) or TTAGT ATCGT AGGAAGCT ATT AGTTAATGGT AAGT (SEQ ID NO : 2208).

29. The polynucleotide of claim 17 or 18, wherein the risdiplam-responsive sequence comprises ATRTCCACTYAAAAAAATCTGGCGATGGGAGCAGAAWGAGTAAGW (SEQ ID NO: 2186), wherein R is A or G, Y is C or T, and W is A or T.

30. The polynucleotide of claim 29, wherein the risdiplam-responsive sequence comprises ATGTCC ACT TAAAAAAATCTGGCGATGGGAGCAGAAAGAGr AAGT (SEQ ID NO: 2209), ATGTCCACTCAAAAAAATCTGGCGATGGGAGCAGAAAGAGTAAGT (SEQ ID NO : 2210), or ATATCC ACTTAA AA AA ATCTGGCG ATGGG AGO AGA A AGAGTAAGT (SEQ ID NO: 2211).

31. The polynucleotide of claim 17, wherein the branaplam-responsive sequence comprises ATTTAACATTTTTGAGTCAATCCAAGTAATGCAGGAGGTTCATGATTGTGTAGA (SEQ ID NO: 2187).

32. The polynucleotide of any one of claims 1-4 or 9-16, wherein the ligand-responsive sequence is a tetracycline-responsive sequence.

33. The polynucleotide of claim 32, wherein the tetracycline-responsive sequence is located in a tetracycline-responsive aptamer comprising the sequenceTAAAACATACCWDMCGKAAMCGKHWGGAGAGGTGAAGAATACGACCACCTA (SEQ ID NO: 2188), wherein W is A or T, wherein D is A, G, or T, wherein M is A or C, wherein K is G or T, and wherein H is A, C, or T.

34. The polynucleotide of claim 32 or 33, wherein the polynucleotide comprises, from 5’ to 3’, an upstream 3' splice site, a first stem region, a 5' splice site reverse complementary sequence, the tetracycline-responsive sequence, a 5' splice site, a sequence comprising GT, the second stem region, and a downstream 3’ splice site.

35. The polynucleotide of claim 34, wherein the upstream 3’ splice site is at least 20 nucleotides long and the two nucleotides at the 3’ end are AG.

36. The polynucleotide of claim 35, wherein the 18 nucleotides 5’ of the AG nucleotides in the upstream 3' splice site comprises TCCTCATTTCCTCTCCTT (SEQ ID NO: 2213), TTTCCAACTTATTTCCCT (SEQ ID NO: 2214), CTTACTTTGTATTCCCAT (SEQ ID NO: 2215), AATCTTTATCTCTATTTC (SEQ ID NO: 2216), TGCCCTATCTTACCTTAT (SEQ ID NO: 2217), TGCACTTTCATTCATTTT (SEQ ID NO: 2218), CCACCTTTTTTTATTTTC (SEQ ID NO: 2219), or CCCCCATTTGTCTTCCCC (SEQ ID NO: 2220).

37. The polynucleotide of any one of claims 34-36, wherein the downstream 3’ splice site is at least 20 nucleotides long.

38. The polynucleotide of any one of claims 34-37, wherein the downstream 3’ splice site comprises TTTCTTTTTCTCTTTTTCAG (SEQ ID NO: 2237), TTTCTTATTCTCCCTTTCAG (SEQ ID NO: 2238), or TTTCTTCTTCTACCTTTCAG (SEQ ID NO: 2239).

39. The polynucleotide of any one of claims 34-38, wherein the first stem region and the second stem region are at least 2 nucleotides long.

40. The polynucleotide of any one of claims 34-39, wherein the first stem region and second stem region are selected from: CA and AC, CC and AC, AC and AC, AC and CC, or AC and CT.41 . The polynucleotide of any one of claims 34-40, wherein the 5’ reverse complementary' sequence and the 5’ splice site are at least 7 nucleotides long.

42. The polynucleotide of any one of claims 34-41, wherein the upstream 5' splice site comprises the CAGGTAA, AACGTAA, CAGGTAC, CCGGTAC, ATCGTAA, GCGGTAC, GAGGTAC, ACGGTAG, CAAGTAA, GAGGTGA, CGCGTAA, GTCGTAA, GAGGTAT, AAGGTAT, TTCGTAA, CCGGTGC, GAGGTAG, CTCGTAA, CTGGTAC, AACGTGA, GCGGTAT, CCGGTAG, or CACGTGA and the 5’ splice site reverse complementary sequence comprises the reverse complement thereof.

43. The polynucleotide of any one of claims 1-42, wherein the polynucleotide is a transgene.

44. The polynucleotide of claim 43, wherein the transgene comprises the polynucleotide of any one of claims 32-42.

45. A polynucleotide comprising a transgene, wherein the transgene comprises: at least one alternative exon, at least two introns flanking the alternative exon, and a ligand-responsive aptamer; wherein the presence of the ligand results in splicing out the at least one alternative exon, the at least two introns flanking the alternative exon, and the ligand-responsive aptamer from the transgene.

46. The transgene of claim 44 or 45, wherein the at least one alternative exon and the at least two introns are from the same gene.

47. The transgene of claim 44 or 45, wherein the at least one alternative exon and the at least two introns are from different genes.

48. The transgene of any one of claims 44 to 47, wherein the transgene further comprises two exons flanking the at least one alternative exon, the at least two introns flanking the alternative exon, and the ligand-responsive aptamer comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99%sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

49. The transgene of any one of claims 44 to 48, wherein the transgene further comprises two exons flanking the transgene further comprises two exons flanking the at least one alternative exon, the at least two introns flanking the alternative exon, and the ligand-responsive aptamer comprising a polynucleotide have a nucleic acid sequence set forth as in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

50. The transgene of any one of claims 44 to 49, wherein the alternative exon comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, or 2137, 2236, or 2247-2256.51 . The transgene of any one of claims 44 to 49, wherein the alternative exon comprises a polynucleotide having a nucleic acid sequence set forth as in SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, 2137, 2236, or 2247-2256.

52. The transgene of any one of claims 44 to 51, wherein at ieast one of the introns comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at ieast 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 21 15, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

53. The transgene of any one of claims 44 to 51, wherein at least one of the introns comprise a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2082, 2088, 2093, 2096, 2101, 2104, 2107, 2113, 2115, 2117, 2118, 2121, 2127, 2129, 2130, or 2141.

54. The transgene of claims 48 or 49, wherein at least one of the exons comprise a polynucleotide having a nucleic acid sequence from a microRNA (miRNA) gene, optionally wherein the miRNA gene is a miRNA- 16_2 gene.

55. The transgene of any one of claims 44 to 54, wherein the ligand-response aptamer comprises a polynucleotide comprising a nucleic acid sequence that is 20-60 nucleotides in length,56. The transgene of any one of claims 44 to 55, wherein the ligand-responsive aptamer comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2086, 2095, 2112, or 2187-2189.

57. The transgene of any one of claims 44 to 55, wherein the ligand-responsive aptamer comprises a polynucleotide having at nucleic acid sequence as set forth in either SEQ ID NO: 2086, 2095, 2112, or 2187-2189.

58. The transgene of any one of claims 44 to 57, wherein the ligand-responsive aptamer binds to tetracycline.

59. The transgene of any one of claims 44 to 57, wherein the ligand-responsive aptamer is located in the intron downstream of the alternative exon.

60. The transgene of claim 44 or 45, wherein the ligand-responsive aptamer is located in the intron upstream of the alternative exon.

61. The transgene of claim 44 or 45, wherein the ligand-responsive aptamer is located in the alternative exon .

62. The transgene of claim 44 or 45, wherein the ligand-responsive aptamer is located in the intron downstream of the alternative exon.

63. The transgene of any one of claims 44 to 62, wherein the transgene comprises a 3' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239 and a 5' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: Tables 7, 25, 26, or 34.

64. The transgene of claim 44 or 45, wherein the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 211 1 , 2112, 21 16, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

65. The transgene of claim 44 or 45, wherein the transgene comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

66. A vector comprising the polynucleotide of any one of claims 1-45 or the transgene of anyone of claims 46-65.

67. The vector of claim 66, wherein the vector is a plasmid.

68. A cell comprising the vector of claim 66 or claim 67.

69. The cell of claim 68, wherein the cell is a mammalian cell.

70. The mammalian cell of claim 69, wherein the cell is a human cell or cell from a human subject.

71. A recombinant viral genome comprising the polynucleotide of any one of claims 1 to 70.

72. The recombinant viral genome of claim 71, wherein the recombinant viral genome is a genome from a recombinant adeno-associated virus (rAAV).

73. The recombinant viral genome of claim 72, wherein the transgene is flanked by AAV inverted terminal repeat (ITR) sequences.

74. The recombinant viral genome of claim 73, wherein the A AV ITR sequences are AAV2 ITR sequences.

75. The recombinant viral genome of any one of claims 71 to 74, wherein the recombinant viral genome comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 21 10, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

76. The recombinant viral genome of any one of claims 71 to 74, wherein the recombinant viral genome comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131 , 2132, 2138, or 2183-2260.

77. An rAAV particle comprising the recombinant viral genome according to any one of claims 71 to 74.

78. The rAAV particle of claim 77, wherein the rAAV particle comprises AAV serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or AAV' derivative or pseudotype AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a. / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt- P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y73 IF), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, A.AV2 (Y"»F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.

79. The rAA V particle of claim 77 or 78, further comprising at least one helper plasmid.

80. The rAAV particle of any one of claims 77 to 79, wherein the helper plasmid comprises a rep gene and a cap gene.81 . The rA AV particle of claim 80, wherein the rep gene encodes Rep78, Rep68, Rep52, or Rep40, and / or wherein the cap gene encodes a VP1, VP2, and / or VP3 region of the viral capsid protein.

82. The rAAV particle of any one of claims 77 to 81, wherein the rAAV particle comprises two helper plasmids.

83. The rAAV particle of claim 82, wherein the first helper plasmid comprises a rep gene and a cap gene and the second helper plasmid comprises a El a gene, a E lb gene, a E4 gene, a E2a gene, and a VA gene.

84. A method of treating a disease or condition in a subject comprising administering a recombinant viral genome according to any one of claims 71-76 or an rAAV particle according to any one of claims 77-83, to the subject.

85. The method of claim 84, wherein the subject is a mammal.

86. The method of claim 85, wherein the mammal is a human.

87. The method of any one of claims 84 to 86, wherein the recombinant viral genome or rAAV particle is administered to the subject at least one time.

88. The method of claim 87, wherein the viral genome or rAAV particle is administered to the subject 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.

89. The method of any one of claims 84-88, wherein the viral genome or rAAV' particle is administered to the subject parenterally, subcutaneously, intraocularly, intravitreally,subretinally, intravenously (IV), intracerebro-ventricularly, intramuscularly, intrathecally (IT), intracistemally, intraperitoneally, enterally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs.

90. A method of regulating the expression of a polynucleotide in a subject comprising administering to a subject the polynucleotide of any one of claims 1-44 and the ligand which binds the ligand-responsive sequence.

91. A method of regulating the expression of a transgene in a subject comprising administering to a subject(i) a polynucleotide comprising a transgene comprising:(a) at least one alternative exon,(b) at least two introns flanking the alternative exon, and(c) a ligand-responsive aptamer; and(ii) a ligand, wherein the presence of the ligand results in splicing out ( a. )-( c ) from the transgene.

92. The method of claim 91, wherein the transgene further comprises two exons flanking (a)- (c) comprising a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

93. The method of claim 91, wherein the transgene further comprises two exons flanking (a)~ (c) comprising a polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 2081, 2089, 2092, 2097, 2135, 2142, or 2143.

94. The method of claim 91, wherein the transgene comprises a polynucleotide having a nucleic acid sequence from a microRNA (miRNA) gene, optionally wherein the miRNA gene is a miRNA- 16 2 gene.

95. The method of claim 94, wherein the transgene comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in SEQ ID NO: 2281 .

96. The method of claim 94, wherein the transgene comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 2281.

97. The method of any one of claims 91 to 96, wherein the at least one alternative exon comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, or 2137, 2236, or 2247-2256.

98. The method of any one of claims 91 to 96, wherein the at least one alternative exon comprise a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 2084, 2094, 2100, 2103, 2106, 2114, or 2137, 2236, or 2247-2256.

99. The method of any one of claims 91 to 98, wherein at least one of the introns comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2082, 2088, 2093, 2096, 2101 , 2104, 2107, 2113, 2115, 21 17, 2118, 2121, 2127, 2129, 2130, or 2141.

100. The method of any one of claims 91 to 99, wherein at least one of the introns comprise a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 2082, 2088, 2093, 2096, 2101 , 2104, 2107, 2113, 2115, 21 17, 2118, 2121, 2127, 2129, 2130, or 2141.

101. The method of any one of claims 91 to 100, wherein the ligand-responsive aptamer comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2086, 2095, 2112, or 2187-2189.

102. The method of any one of claims 91 to 101, wherein the ligand-responsive aptamer comprises a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NOs: 2086,2095, 2112, or 2187-2189.

103. The method of any one of claims 91 to 102, wherein the transgene comprises a 3' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239and a 5' splice site comprising a polynucleotide comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: SEQ ID NOs: 2083, 2144-2182, 2213-2220, or 2237-2239.

104. The method of any one of claims 91 to 103, wherein the ligand is tetracycline.

105. The method of claim 91, wherein the transgene compri ses a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%>, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 21 10, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

106. The method of claim 91, wherein the transgene comprises a polynucleotide having a nucleic acid sequence set forth in SEQ ID NOs: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

107. The method of any one of claims 91-106, wherein the transgene is provided in a recombinant viral genome.

108. The method of claim 107, wherein the recombinant viral genome is a genome from a recombinant adeno-associated virus (rAAV).

109. The method of claim 108, wherein the transgene is flanked by AAV inverted terminal repeat (ITR) sequences.

110. The method of claim 109, wherein the AAV ITR sequences are AAV2 ITR sequences.

111. The method of any one of claims 107 to 110, wherein the recombinant viral genome comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity, relative to a nucleic acid sequence as set forth in either SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 2110, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.1 12. The method of any one of claims 107 to 110, wherein the recombinant viral genome comprises a polynucleotide having a nucleic acid sequence as set forth in either SEQ ID NO: 2080, 2091, 2099, 2102, 2105, 2108, 2109, 21 10, 2111, 2112, 2116, 2118, 2120, 2123, 2128, 2131, 2132, 2138, or 2183-2260.

113. The method of any one of claims 107 to 112, wherein the recombinant viral genome is provided in a an rAAV particle.

114. The method of claim 113, wherein the rAAV particle comprises AAA7serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or AAV derivative or pseudotype AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt- P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41 , AAV9.45, AAV6(Y445F / Y73 IF), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.

115. The method of claim 1 13 or 114, wherein the rAAV' particle further comprises at least one helper plasmid.1 16. The method of claim 115, wherein the helper plasmid comprises a rep gene and a cap gene.1 17. The method of claim 116, wherein the rep gene encodes Rep78, Rep68, Rep52, or Rep40, and / or wherein the cap gene encodes a VP1, VP2, and / or VP3 region of the viral capsid protein.

118. The method of claim 113 or claim 114, wherein the rAAV particle comprises two helper plasmids.

119. The method of claim 118, wherein the first helper plasmid comprises a rep gene and a cap gene and the second helper plasmid comprises a Ela gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.

120. The method of any one of claims 91 to 119, wherein administration of the ligand to the subject results in a fold increase in the RNA level of the exclusion isoform of about 300-400- fold.

121. The method of any one of claims 91 to 120, wherein administration of the ligand to the subject results in a fold increase in the protein level of the exclusion isoform of about. 5-25-fold.

122. The transgene of any one of claims 44 to 65, the recombinant viral genome of any one of claims 71 to 76, the rAAV particle of any one of claims 77-83, or the method of any one of claims 84 to 121, wherein splicing out the alternative exon, the at least two introns, and the aptamer results in the production of a functional start codon in the transgene.

123. The transgene of any one of claims 44 to 65, the recombinant viral genome of any one of claims 71 to 76, the rAAV particle of any one of claims 77-83, or the method of any one of claims 84 to 121, wherein splicing out the alternative exon, the at least two introns, and the aptamer results in the removal of a pre-mature stop codon from the transgene.

Images