Transgenic plants containing artificial mirtrons

Abstract

The present application relates to a transgenic plant comprising an integrated host gene capable of being expressed in the plant, the host gene comprising an artificial mirtron capable of silencing a target gene and having a sequence comprising a 5' donor splice site, a branch point, a polypyrimidine tract, a 3' acceptor splice site, and a guide sequence complementary to a target sequence in the target gene, to methods of preparation thereof, and to nucleic acids comprising such artificial mirtrons.

Description

[0001] TRANSGENIC PLANTS CONTAINING ARTIFICIAL MIRTRONS

[0002] FIELD OF THE INVENTION

[0003] The present disclosure is generally directed to gene silencing in plants. Specifically, the invention relates to artificial mirtrons and transgenic plants containing them for gene silencing in plants.

[0004] BACKGROUND OF THE INVENTION

[0005] Crop improvement, a vital pursuit in the face of escalating global food demand, is not without its challenges. These include, inter alia, pathogens threatening agricultural productivity, climate change-induced uncertainties, and balancing increased yield with nutritional quality without depleting soil health or exacerbating environmental degradation. These challenges underscore the urgent need for innovative approaches, like gene editing and precision breeding, to propel crop improvement into an era of greater resilience and abundance.

[0006] Plant crop improvement through gene editing represents a revolutionary leap in agricultural technology, offering targeted methods to enhance desirable traits in crops. This cutting-edge technique allows scientists to modify specific genes within a plant, bypassing the need for traditional breeding methods that often take years to achieve desired results. By harnessing gene editing tools, researchers can precisely insert, delete, or alter even a small number of nucleotides, enabling crops to exhibit traits such as disease resistance, increased yield, improved nutritional content, and adaptability to changing environmental conditions. These editing tools may be used to directly edit genes related to a desired trait, or regulatory elements for controlling gene expression.

[0007] RNA interference (RNAi) is considered a valuable biotechnological tool for control of crop gene regulation. RNA silencing is generally mediated by non-coding RNA molecules including, for example, microRNAs (miRNAs), small interfering RNAs (siRNAs), trans-acting siRNA (ta- siRNA), piwi-interacting RNAs (piRNA), and antisense RNA. However, the biogenesis of these molecules by the cellular machinery gives rise to heterogenic populations having sequence variations and off-target effects or undesired patterns of expression / regulation.

[0008] There is therefore a need for improving the accuracy of gene silencing to more precisely control gene expression without causing harm.

[0009] SUMMARY OF INVENTION

[0010] The following embodiments and aspects thereof are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope. In various embodiments, one or more of the above-described problems have been reduced or eliminated, while other embodiments are directed to other advantages or improvements.

[0011] The present invention is directed to transgenic plants which comprise artificial mirtrons for controlling plant gene expression in order to obtain a desired trait. The artificial mirtrons of the invention are artificial mirtrons which may be incorporated into a gene either instead a natural intron or as a new intron, or generated in the plant cells by gene editing of a natural intron.

[0012] In some embodiments, the present invention provides a transgenic plant comprising an integrated host gene capable of being expressed in the plant, wherein the host gene comprises an artificial mirtron capable of silencing a target gene and having a sequence comprising a 5’ donor splice site; a branch point; a polypyrimidine tract; a 3’ acceptor splice site; a guide sequence complementary to a target sequence in the target gene; and a stem and loop structure comprising a stem region having a 5’ strand and a 3’ strand, and a loop region.

[0013] In some embodiments, the artificial mirtron and / or the host gene are not inhibited or silenced by plant defense systems. In some embodiments, the artificial mirtron is capable of silencing the target gene for a time period of at least one week. In some embodiments, the artificial mirtron is capable of silencing the target gene in all plant tissues. In some embodiments, the artificial mirtron is capable of silencing the target gene is specific plant tissues.

[0014] In some embodiments, the artificial mirtron has a length of about 40-200 nu, 50-150 nu, 50- 120 nu, 50-100 nu, or 50-90 nu.

[0015] In some embodiments, the distance between the stem and loop structure and the 5’ donor splice site and / or the 3’ acceptor splice site is 5 nu or less. In some embodiments, the artificial mirtron is a conventional mirtron. In some embodiments, the artificial mirtron is a 3 ’-tailed mirtron.

[0016] In some embodiments, the guide sequence has a length of about 5-30 nu. In some embodiments, the guide sequence is comprised in the 3’ strand of the stem and loop structure. In some embodiments, the distance between a sequence complementary to the guide sequence at the 5’ strand of the stem and loop structure and the 5’ donor splice site is less than about 10 nu. In some embodiments, the distance between the 3’ end of the guide sequence and the 3’ splice site is 5 nu or less. In some embodiments, there are no intervening nucleotides which form part of the stem region between the guide sequence and the loop region. In some embodiments, the guide sequence is at least 80% identical to a reverse-complement sequence of the target sequence.

[0017] In some embodiments, the artificial mirtron sequence is modified from a sequence of an endogenous intron of the host gene at least by incorporating the guide sequence. In some embodiments, the artificial mirtron sequence has about 50-95% identity with the intron sequence.

[0018] In some embodiments, the artificial mirtron is produced by gene editing of the host gene. In some embodiments, the artificial mirtron is produced by gene editing of an endogenous intron of the host gene. In some embodiments, the artificial mirtron replaces an endogenous intron of the host gene. In some embodiments, the artificial mirtron is inserted into an exon of the host gene. In some embodiments, the artificial mirtron is inserted into the 5’ or the 3’ untranslated region (UTR) of the host gene.

[0019] In some embodiments, the host gene is a gene exogenous to the plant. In some embodiments, the host gene is an endogenous gene of the plant. In some embodiments, the host gene is an essential plant gene. In some embodiments, the host gene is naturally or synthetically operably linked to a promoter selected from a tissue-specific promoter, a stress-responsive promoter, a developmental stage- specific promoter, a pathogen- specific promoter and a parasite- specific promoter. In some embodiments, the host gene has an expression pattern similar to that of the target gene. In some embodiments, the host gene is expressed in plant root, seed, leaf, tuber, or meristem.

[0020] In some embodiments, the host gene is a protein-coding gene. In some embodiments, the host gene is selected from Arabidopsis thaliana CEL1 ((Atcell) gene; soy genes including plasmamembrane intrinsic protein type 2, aquaporin, GmPIP2, stress-induced PR- 10 protein (SAM-22), tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase-related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl); rice genes including 0s03g01700, Os02g37190, 0s01g0762500, 0s02g0268300, and 0s07g0616800; and potato / tuber genes including endo-P- 1,4-glucanases (EGases), St-CEL7, St-CEL9C1, immunoglobulin binding protein (St-BiP3), ADP glucose pyrophosphorylase, and granule-bound starch synthase.

[0021] In some embodiments, the plant is selected from potato, soybean, rice, wheat, tomato, yam, beet, oat, and a sweet potato.

[0022] In some embodiments, the target gene is an endogenous gene of the plant. In some embodiments, the target gene is selected from a plastid-localized polyphenol oxidase (PPG); a gene involved in sugar metabolism, such as vacuolar invertase (VInv) or asparagine synthetase- 1 (StASl and StAS2); a cytochrome P450 encoding gene such as glycoalkaloid metabolism 4 (GAME4); a starch branching enzyme (SBE) encoding gene such as potato SBE1 or SBE2; and a gene of the rice flavone biosynthesis pathway, such as CYP75B3 or CYP75B4.

[0023] In some embodiments, the host gene is an endogenous gene of the plant and the target gene is the host gene. In some embodiments, the target gene is not an endogenous plant gene. In some embodiments, the target gene is a gene previously incorporated into the plant. In some embodiments, the target gene is a gene of a pest, pathogen, or parasite. In some embodiments, expression of the host gene is induced by the pest, pathogen, or parasite. In some embodiments, the pest, pathogen, or parasite is a nematode, fungus, bacterium, virus, or oomycete.

[0024] In some embodiments, the target gene is an essential gene of the nematode and the host gene is a gene induced by the nematode and / or expressed in plant root. In some embodiments, the nematode is selected from root-knot nematode (RKN), soybean cyst nematode (SCN), and potato cyst nematodes (PCN). In some embodiments, the target gene is selected from the nematode gene 16D10, HgY25, HgPrpl7, Gr-Exp, and chorismate mutase.

[0025] In some embodiments, the target gene is 16D10 of the root-knot nematodes (RKNs), and the host gene is CEL1.

[0026] In some embodiments, the target gene is HgY25 or HgPrpl7 of the soybean cyst nematode (SCN), and the host gene is selected from the soybean genes plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, SAM-22, tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase-related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl).

[0027] In some embodiments, the target gene is 16D10, Gr-Exp, or chorismate mutase of the potato cyst nematode (PCN), and the host gene is selected from the potato genes endo-P-l,4-glucanases (EGases), St-CEL7, St-CEL9C1, and immunoglobulin binding protein (St-BiP3).

[0028] In some embodiments, the transgenic plant is a complete plant. In some embodiments, the transgenic plant is a plant part, a plant tissue, or a plant cell.

[0029] In some embodiments, the present application provides a nucleic acid molecule comprising an artificial mirtron sequence comprising: a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in a target gene, and a stem and loop structure comprising at least the guide sequence; wherein the artificial mirtron sequence has about 50-95% sequence identity to a sequence of a natural intron of a plant gene, and the mirtron is capable of silencing the target gene.

[0030] In some embodiments, the nucleic acid molecule is prepared by modifying a plant intron sequence to a mirtron sequence by incorporating the stem and loop structure comprising the guide sequence.

[0031] In some embodiments, the present application provides the nucleic acid molecule disclosed herein for use in silencing or reducing expression of the target gene.

[0032] In some embodiments, the present application provides a method for generating a transgenic plant for silencing or reducing expression of a target gene, the method comprising modifying a host gene capable of being expressed in the plant by generating an artificial mirtron capable of silencing the target gene in the host gene, wherein the artificial mirtron comprises a sequence comprising a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in the target gene, and a stem and loop structure comprising at least the guide sequence; and the host gene is integrated in the plant genome.

[0033] In some embodiments, the method further comprises, prior to modifying the host gene, selecting an intron having a length of no more than about 200 bp; and designing the artificial mirtron based on the selected intron.

[0034] In some embodiments, the method further comprises, prior to modifying the host gene, selecting a intron comprising a sequence at least about 40% identical to a reverse-complement sequence of the target sequence within a distance of at most about 50 bp upstream of the 3’ splice acceptor site or at most about 10 bp upstream of the branch point; and designing the artificial mirtron based on the selected intron.

[0035] In some embodiments, the selected intron is an endogenous intron of the host gene. In some embodiments, the selected intron is an endogenous intron of the plant.

[0036] In some embodiments, generating an artificial mirtron in the host gene is obtained by gene editing such as by prime editing or by a CRISPR / Cas9 system.

[0037] In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the figures and by study of the following detailed descriptions.

[0038] BRIEF DESCRIPTION OF DRAWINGS

[0039] The invention will now be described in relation to certain examples and embodiments with reference to the following illustrative figures.

[0040] Fig. 1 is a schematic overview of canonical miRNA and mirtron biogenesis, taken from taken from Westholm and Lai, 2011, Biochimie 93:1897-1904.

[0041] Fig. 2 shows predicted secondary structures for construct 1094, according to some embodiments. The free energy calculated for the structures is AG = -31.80 Joule. The guide sequence is underlined.

[0042] Fig. 3 shows a schematic representation of the general design of the constructs used for transforming plants, according to some embodiments. The figure shows the mirtron as a triangle which is inserted as an intron into green fluorescent protein (GFP), which is located downstream of a cauliflower mosaic virus 35S promoter and upstream of a cauliflower mosaic virus 35S terminator.

[0043] Fig. 4 shows results of testing transformation products for the presence of splicing and silencing. Shown are representative images of seedlings transformed with the following constructs: 1094 (test, upper panel), 1119 (silencing control, middle panel), and 1095 (splicing control, lower panel), in selection plates (1 / 2 MS containing 50pg / ml Kan). Images were taken with a white light (left side) for PDS silencing, or with a blue flashlight in the dark (right side) for GFP fluorescence (which fluoresces in cyan color). Light circles show the position of GFP-positive seedlings.

[0044] Fig. 5 shows results of an experiment testing whether the 1094 construct would be silenced by plant defense systems. Two months after the germination of the albino seedlings, there was no observable change in the developmental progress of the albino plants. The three panels are three examples showing that the plants maintained their albino phenotype.

[0045] Fig. 6 shows predicted secondary structure for the additional construct 1116, according to some embodiments. The free energy calculated for the structure is AG = -27.20 Joule. The guide sequence is underlined, and the starred “U” is a modification compared to construct 1094.

[0046] Fig. 7 shows results of testing additional constructs for the presence of splicing and silencing. Shown are representative images of seedlings transformed with the constructs: 1094 (upper panel, also shown in Fig. 4) and 1116 (lower panel, modified based on 1094), in selection plates (1 / 2 MS, 50pg / ml Kan). Images were taken with a white light (left side) for PDS silencing, or with a blue flashlight in the dark (right side) for GFP fluorescence (which fluoresces in cyan color). Light circles show the position of positive seedlings.

[0047] Figs. 8A-8F show predicted secondary structure for intron 2 of AT4G34400.1 constructs 1- 6 (SEQ ID Nos: 7-12, respectively), according to some embodiments. The free energy calculated for the structures is AG = -31.30 (construct 1, Fig. 8A), -31.8030 (construct 2, Fig. 8B), -30.6030 (construct 3, Fig. 8C), -33.8030 (construct 4, Fig. 8D), -32.7030 (construct 5, Fig. 8E), and -30.90 Joule30 (construct 6, Fig. 8F). The guide sequence is underlined.

[0048] DETAILED DESCRIPTION OF THE INVENTION

[0049] In the following description, various aspects of the disclosure will be described. For the purpose of explanation, specific configurations and details are set forth in order to provide a thorough understanding of the different aspects of the disclosure. However, it will also be apparent to one skilled in the art that the disclosure may be practiced without specific details being presented herein. Furthermore, well-known features may be omitted or simplified in order not to obscure the disclosure. Current methods for gene silencing in plants include the use of RNA interference (RNAi), which involves non-coding RNA molecules such as siRNA, shRNA, and microRNA (miRNA). However, some of the RNAs are transcribed by the relatively error-prone RNA polymerase III, while canonical miRNAs are transcribed by RNA polymerase II, but processed by Drosha / DGCR8, which has a variable 5’ cleavage site specificity. The results are heterogenic populations of RNA molecules having sequence variations with potential off-target effects and undesired patterns of expression.

[0050] Mirtrons are a specific class of non-canonical miRNAs, which function as introns that are processed following splicing to give rise to RNA silencing molecules similar to the mature miRNAs. Mirtrons are transcribed by RNA polymerase II, which is less error-prone that RNA polymerase III, and spliced by the cellular splicing machinery which provides precise ends, as opposed to Drosha products. Furthermore, since mirtrons are transcribed as part of their host gene (same as regular introns), they have the same tissue specificity as the host gene, which allows for expression control.

[0051] Fig. 1, taken from Westholm and Lai, 2011, Biochimie 93:1897-1904, summarizes the biogenesis of canonical miRNA vs. that of mirtrons. As shown, both pathways converge prior to export form the nucleus and dicing. However, the preceding pathways are different for miRNAs and for mirtrons, with important consequences, as noted above. As shown in Fig. 1, while the canonical miRNA (left side of the diagram) undergoes cleavage by Drosha, the mirtrons do not. Instead, mirtrons are spliced and debranched by lariat debranching enzyme, after which they fold into pre-miRNA hairpins (middle of the diagram). 3’- and 5 ’-tailed mirtrons go through an additional step, following splicing and debranching, which involves trimming of the tails (right side).

[0052] Therefore, in contrast to miRNAs, the first stage of pre-miRNA processing of cleavage by the Drosha / DGCR8 complex is bypassed by mirtrons. DGCR8 (Pasha in invertebrates) recognizes and binds to a sequence at the junction of single and double- stranded RNA at the base of the hairpin (also termed “lower stem” see also below) and recruits Drosha to cleave pri-miRNA approximately one helical turn above the junction, releasing the pre-miRNA. Mirtrons typically lack the approximately one additional helical term at the base of the stem (the lower stem) and the DGCR8 recognition consensus sequence (Starega-Roslan et al., 2015, Int. J. Mol. Sci. 16:8110- 8127), and they are consequently not cleaved by the Drosha / DGCR8 complex.

[0053] Accordingly, using mirtrons for gene silencing has the advantages of obtaining homogenous and predictable RNA silencing molecules with minimal off-target activity, which may be controlled to provide a desired expression pattern. An additional advantage of bypassing of 5’ cleavage by Drosha / DGCR8 is that it may release / reduce a potential molecular / cellular bottleneck.

[0054] More specifically, utilizing the artificial mirtrons of the invention for gene silencing in plants provides several levels of expression control, for example:

[0055] (i) controlling the levels of mirtron expression so as to avoid very high levels of expression or saturation and potential toxicity;

[0056] (ii) defining tissue- specific expression and / or developmental stage specificity of the mirtron;

[0057] (iii) providing spatiotemporal control of RNAi activity;

[0058] (iv) manipulating splicing efficiency of the artificial mirtrons by modifying splice site and other cis splicing sequences or sequences that impact possible secondary structures to achieve control over levels of expression; and

[0059] (v) avoiding self- silencing by plant defense systems, which was an unexpected result, as further explained below.

[0060] While mirtrons have been identified in several species, including certain insects, plant mirtrons have only been predicted based on sequence analysis, and in one case expression of a putative plant mirtron has been demonstrated by a northern analysis and by RT-PCR, with no evidence of actual mirtron activity in plants (Joshi et al., 2012, Genomics 99:370-375). In addition, it has been shown that the activity of the Tailor enzyme, which adds uridines to the terminal AG nucleotides of mirtrons, inhibits their further processing by Dicer (Bortolamiol-Becet et al., 2015, Molecular Cell 59:217-228). It is further noted that plant miRNAs are different from their animal counterparts both in biogenesis and function (Joshi et al., supra). For all the above reasons, it could not be predicted whether using mirtrons for gene silencing in plants would be successful, and whether the sequence requirements are similar to those in other organisms.

[0061] In the present invention, in a proof of concept experiment, the inventors inserted an artificial mirtron specific for silencing the phytoene desaturase (PDS) gene to an exogenous gene, which was then introduced to Arabidopsis. Surprisingly, as shown in Examples 2 and 4 and Figs. 4 and 6, the transgenic plants exhibited an albino phenotype, evidence for silencing of the PDS gene by the artificial mirtron. In a surprising result, the plant defense mechanisms did not silence the mirtron transcribed from the transgenic constructs for a time period of at least 2 months, as shown by Example 3 and Fig. 5.

[0062] Accordingly, the present invention is directed to transgenic plants which comprise artificial mirtrons for controlling plant gene expression in order to obtain a desired trait. Nonlimiting examples for a desired trait include improved taste, smell, color, shape, appearance, size, texture, aroma, nutritional / dietary values, and / or flavor. Additional examples include sensitivity or resistance to biotic or abiotic stress, disease, extreme heat, fresh water, drought, herbicide, pesticide, parasite, insect and / or pathogen.

[0063] In some embodiments, the present invention provides a transgenic plant comprising an integrated host gene capable of being expressed in the plant, wherein the host gene comprises an artificial mirtron capable of silencing a target gene and having a sequence comprising a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, and a guide sequence complementary to a target sequence in the target gene.

[0064] The term “transgenic plant”, as used herein, relates to a modified plant comprising a DNA sequence which comprises the artificial mirtron of the invention and that is not part of the natural or the endogenous DNA content of the plant. The DNA sequence may be an exogenous DNA molecule that is introduced into the plant, such as a DNA molecule having a sequence derived from a different plant or a non-plant organism or a synthetic or artificial DNA molecule. The DNA sequence may also be derived from an endogenous DNA sequence of the plant by modifying a natural intron sequence to a different sequence not natural to the plant, for example, by gene editing or prime editing. This term is also intended to encompass any plant part, tissue, or cell derived from the transgenic plant.

[0065] In some embodiments, the term “transgenic plant” further includes, in addition to a complete transgenic plant, also a transgenic plant part, a transgenic plant tissue, or a transgenic plant cell, which has been modified to include a DNA sequence which comprises the artificial mirtron of the invention and that is not part of the natural or the endogenous DNA content of the plant from which the plant part, plant tissue, or plant cell are derived.

[0066] The term “plant”, relates to an unmodified plant which was modified to generate the transgenic plant. In other words, the term “plant” relates to a plant corresponding to the transgenic plant but not including the artificial mirtron of the invention. The difference between the “plant” and “transgenic plant” depends on the method by which the artificial mirtron is incorporated into the plant genome to make the transgenic plant, e.g., whether by gene editing of an intron into a mirtron (in which case the only difference may be in the mirtron vs. the original intron), or by incorporation of an exogenous host gene comprising the artificial mirtron of the invention (in which case the difference will further include the presence of the host gene in the transgenic plant).

[0067] The term “integrated”, as used herein with reference to the host gene, means that the host gene is integrated in the genome of the plant. In some embodiments also mentioned below, the host gene is an endogenous gene of the plant and therefore naturally integrated in the plant genome. In some embodiments also mentioned below, the host gene is a gene exogenous to the plant, and is artificially integrated into the plant genome, e.g., by genetic engineering methods.

[0068] The term “silencing”, as used herein with respect to silencing a target gene, relates to reducing expression level of a gene compared to expression level of the gene in the corresponding plant not including the artificial mirtron of the invention, herein termed reference expression level. As explained below, the target gene may be a gene expressed in a pathogen or a pest and not a gene expressed in the plant, and in that case the reference expression level is the expression level of the gene in the pathogen or pest when attached to a plant not including the artificial mirtron of the invention.

[0069] In some embodiments, the reduction in expression is complete, such as a complete knockout, and no expression of the silenced gene may be detected when the plant includes the artificial mirtron of the invention. In some embodiments, the reduction in expression is relative, e.g., a knock-down. In some embodiments, the reduction in expression is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, compared to the reference expression level.

[0070] In some embodiments, the % reduction in expression level is an average reduction in expression level over a population of cells. In some embodiments, the % reduction in expression level is the % of cells presenting reduced expression level out of the total number of cells comprising the artificial mirtron.

[0071] As noted above, and further explained below (with reference to the host gene) the artificial mirtron of the invention was surprisingly capable of maintaining silencing of the target gene for a time period of at least about 2 months (when the experiment was stopped), as seen by Example 3 and Fig. 5. Accordingly, in some embodiments, the artificial mirtron of the invention is capable of silencing the target gene for a time period of at least about 1 week, or at least about 2, 3, 4, 5, 6, 7, or 8 weeks. In some embodiments, the artificial mirtron of the invention is capable of silencing the target gene for a time period of at least about 1, 2, 3, or 4 months. In some embodiments, the artificial mirtron of the invention is capable of silencing the target gene in a next generation (offspring, Fl) of the transgenic plant. This ability to silence for a prolonged time period indicates that the artificial mirtron of the invention is not self-silenced by plant defense systems.

[0072] In some embodiments, the artificial mirtron is capable of silencing the target gene in all of the plant parts, plant tissues, or plant cells. In some embodiments, the artificial mirtron is capable of silencing the target gene in specific parts or tissues of the plant. In some embodiments, the artificial mirtron is capable of silencing the target gene in specific developmental stages or conditions.

[0073] Mirtrons are a specific group of miRNAs which comprise a short hairpin structures and are in fact introns of mRNA coding genes. Mirtrons are transcribed by RNA polymerase II as part of the mRNA of the coding genes, and processed by the cellular splicing machinery and by lariat debranching enzymes which convert the lariat into a pre-miRNA structure. The debranched pre- miRNAs are incorporated into the canonical miRNA pathway during nuclear export and processing by Dicer. Similar to miRNAs, the final product is a mature, approximately 22 nu long, RNAi which is associated with AGO (Argonaute) proteins of the RNA induced silencing complex (RISC) complex capable of cleaving the target sequence complementary to the mature miRNAs.

[0074] It is important to note that mirtrons vary between kingdoms, for example: mammalian mirtrons have higher GC content than invertebrate mirtrons, leading to more stable hairpins than those in invertebrates. Additionally, mammalian mirtrons have predominantly 5’ tails while invertebrate mirtrons have predominantly 3’ tails, which may indicate that they are processed by different pathways in mammals and in invertebrates.

[0075] Importantly, as mentioned above, when comparing mirtron sequences and secondary structures to those of canonical miRNAs, mirtrons lack approximately one helical turn at the base of the stem (the lower stem, see below) which includes the DGCR8 recognition sequence and therefore their processing does not include 5’ cleavage by Drosha / DGCR8. Mirtrons can generally be distinguished from canonical miRNAs by machine learning methods and as further explained below.

[0076] It is noted that the term “mirtron”, as used herein, relates to the complete single stranded sequence of the mirtron (the intron) prior to processing, comprising the complete intronic sequence between the 5’ and the 3’ intronic splice sites (inclusive). As used herein, the definition of mirtron does not relate only to the stem and loop structure or to the mature silencing short RNAi product, which are included in the complete mirtron / intron sequence. This definition is based on Ruby et al., 2007, Nature 448:83-86, who first identified an alternative pathway for miRNA biogenesis, in which certain debranched introns mimic the structural features of pre-miRNAs to enter the miRNA-processing pathway without Drosha-mediated cleavage, and called these pre- miRNAs / introns - mirtrons.

[0077] The term “artificial mirtron” relates to a mirtron that does not exist in nature and is obtained by synthetic means such as genetic engineering or gene editing methods. In some embodiments, the artificial mirtron is generated as a DNA molecule or as part of a DNA molecule (e.g. embedded in the host gene) and introduced into the plant. In some embodiments, the artificial mirtron is generated in a plant cell by modifying an existing (natural) intron sequence of the host gene, e.g., by gene editing.

[0078] In some embodiments, the artificial mirtron has a length of at most about 200 nu, 150 nu, 100 nu, or 90 nu. In some embodiments, the artificial mirtron has a length of about 40-200 nu, 40- 150 nu, 40-120 nu, 40-100 nu, 40-90 nu, 50-200 nu, 50-150 nu, 50-120 nu, 50-100 nu, or 50-90 nu.

[0079] In some embodiments, the artificial mirtron is derived from an existing plant intron. In some embodiments, the mirtron is derived from an endogenous plant intron. In some embodiments, the mirtron is derived from an intron of the host gene. In some embodiments, the mirtron replaces an intron of the host gene. In some embodiments, the mirtron replaces an intron of the host gene, from which the mirtron is derived. In some embodiments, the mirtron is designed de novo and is incorporated into a gene of interest.

[0080] The artificial mirtron being derived from an intron means that the design of the artificial mirtron is based on the respective intron, which is modified by incorporating at least a stem and loop structure comprising the guide sequence (explained below), with possible additional modifications.

[0081] In some embodiments, the artificial mirtron is derived from an intron, that may be an endogenous intron, a plant intron, and / or an intron of the host gene, by modifying the intron sequence to include a stem and loop structure comprising the guide sequence. In some embodiments, the modifying further includes adding Dicer recognition sequences. In some embodiments, the modifying further includes modifying splicing motifs to potentially improve splicing, such as the splice donor, splice acceptor, branch point, and / or polypyrimidine tract, or splice enhancers.

[0082] Dicer recognition sequences are generally known, and may be found in Starega-Roslan et al., supra.

[0083] In some embodiments, the artificial mirtron has a length of at most about 200 nu, 150 nu, 100 nu, or 90 nu. In some embodiments, the artificial mirtron has a length of about 40-200 nu, 40- 150 nu, 40-120 nu, 40-100 nu, 40-90 nu, 50-200 nu, 50-150 nu, 50-120 nu, 50-100 nu, or 50-90 nu.

[0084] In some embodiments, the intron (from which the artificial mirtron is derived) has a length of at most about 200 nu, 150 nu, 100 nu, or 90 nu. In some embodiments, the intron (from which the artificial mirtron is derived) has a length of about 40-200 nu, 40-150 nu, 40-120 nu, 40-100 nu, 40-90 nu, 50-200 nu, 50-150 nu, 50-120 nu, 50-100 nu, or 50-90 nu.

[0085] In some embodiments, the intron is an alternatively spliced intron. In some embodiments the intron is constitutively spliced (not alternatively spliced). In some embodiments, the alternatively spliced intron is alternatively spliced only in specific tissues or under specific conditions (such as upon a pathogen attack). In some embodiments, the intron is alternatively spliced and modifying the intron into a mirtron results in the intron / mirtron not being alternatively spliced. In some embodiments, the intron is alternatively spliced, i.e., having at least two alternatively splicing patterns, and modifying the intron into a mirtron results in only one of the splicing patterns being preserved. In some embodiments, the intron is alternatively spliced, i.e., and modifying the intron into a mirtron results in the mirtron corresponding to one of the splice patterns.

[0086] It is understood that the definition of “intron” encompasses any sequence that is capable of being spliced out by the spliceosome in the process of giving rise to an mRNA transcript. Accordingly, alternatively spliced transcripts may include several overlapping introns, and the artificial mirtrons of the invention may replace, or be derived from, any of these introns.

[0087] In some embodiments, the intron comprises a sequence at least about 40% identical to a reverse-complement sequence of the target sequence within a distance of at most about 10 bp upstream of the 3’ splice acceptor site or from the branch point.

[0088] In some embodiments, the intron comprises a sequence at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% identical to a reverse-complement sequence of the target sequence within a distance of at most about 50 bp, 45 bp, 40 bp, 35 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, or 5 bp upstream of the 3’ splice acceptor site, or at most about 10 bp or 5 bp upstream of the branch point.

[0089] In some embodiments, the artificial mirtron sequence has at least about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% sequence identity to a sequence of an endogenous plant intron. In some embodiments, the artificial mirtron sequence has at least about 50%, 60%, or 70% sequence identity to a sequence of an endogenous plant intron.

[0090] In some embodiments, the artificial mirtron is prepared by gene editing of an intron, such as an endogenous intron, a plant intron, and / or an intron of the host gene. The advantage of using gene editing (or prime editing), as opposed to other genetic engineering or gene modification methods, is that the sequence modifications are minimal and hence the adverse effects of the editing. A further advantage of using gene editing may be in that the minimal changes to an existing intron may help evade the plant defense system which targets foreign RNA elements, such as microRNA. Nevertheless, the mirtrons may be prepared by other genetic engineering methods, as disclosed herein.

[0091] In some embodiments, the artificial mirtron is inserted into an exon of the host gene. In some embodiments, the artificial mirtron is inserted into a noncoding region of the host gene, such as a 5’ or a 3’ untranslated region (UTR) of the host gene. In some embodiments, the artificial mirtron is inserted into a 5’ UTR of the host gene. In some embodiments, the artificial mirtron is inserted into a 3 ’ UTR of the host gene. In some embodiments, the artificial mirtron is inserted into a region of the host gene that is closer to the 3’ end of the host gene than to the promoter of the host gene.

[0092] Since mirtrons are introns, the artificial mirtron comprises sequences required for processing by the splicing machinery, including at least a 5’ donor splice site, a branch point, a polypyrimidine tract, and a 3’ acceptor splice site, as explained below.

[0093] 5’ donor splice site: this definition relates to the two 5’ terminal nucleotides of the mirtron, at the junction between the 5’ end of the intron / mirtron and the 3’ end of the preceding exon. Most commonly, the 5’ donor splice site contains GT as the terminal intronic nucleotides. Accordingly, in some embodiments, the terminal 5’ nucleotides of the artificial mirtron are GT.

[0094] Branch point: contained within a degenerate intronic heptamer called the branch point sequence. In the vast majority of introns, this motif resides between about 20 and about 50 bases upstream of the 3' splice site. During pre-mRNA splicing, the branch point sequence undergoes base-pairing with a conserved 6-bp motif (GUAGUA) of the U2 snRNA. All residues of the heptamer except the branch point undergo base-pairing. The unpaired branch point, usually adenine, bulges out of the U2 snRNA-pre-mRNA duplex. An attack of the unpaired branch point nucleotide to the 5' splice site, frees the 5’ exon, and forms a lariat intermediate. Subsequently, the free 5' exon attacks the 3' splice site resulting in exon ligation, and release and degradation of the intron lariat.

[0095] The branch point in mirtrons is generally about 18-24 nu upstream of the 3’ splice site. In some embodiments, the branch point is about 10-50 nu, 10-35 nu, 15-30 nu, or 18-24 nu 5’ of the 3’ splice site.

[0096] Polypyrimidine tract: a rather variable region rich in pyrimidines and especially in uracil (thymidine in DNA), usually about 15-20 nu long and located about 5-40 nu upstream (5’) of the 3’ splice acceptor site.

[0097] 3’ acceptor splice site: this definition relates to the two 3’ terminal nucleotides of the mirtron, at the junction between the 3’ end of the intron / mirtron and the 5’ end of the following exon. Most commonly, the 3’ acceptor splice site contains AG (most commonly CAG / UAG) as the terminal intronic nucleotides. Accordingly, in some embodiments, the terminal 3’ nucleotides of the mirtron are AG.

[0098] Stem and loop structure: also referred to herein as a hairpin structure, is feature related to RNA silencing rather than a feature of introns in general. This structure comprises a first sequence which folds to form base pairing with a second sequence which is located some nucleotides away from the first sequence and is complementary to the first sequence. The base-paired structure is termed “stem” or “stem region”. The sequence between the first and the second sequence forms a looser structure on top of the stem, which is termed “loop”, which may also have some base pairing. The stem has a 5’ strand (generally the first sequence, closer to the 5’ donor splice site) and a 3’ strand (generally the second sequence, closer to the 3’ acceptor splice site). As also explained below, complementary sequences are not necessarily 100% complementary. For example, the stem often comprises interruptions such as 1-2 non-pairing bases on each side of the stem.

[0099] Splice enhancer: optionally, the mirtron may include a splice enhancer.

[0100] Additionally, the guide sequence is mainly located in the stem and loop region and may overlap with a splice site sequence, as further detailed below. The strand of the stem on which the guide sequence is located is termed the “guide strand” and the other strand is termed the “passenger” strand.

[0101] In some embodiments, the stem and loop structure further comprises the branch point. In some embodiments, the branch point is essentially adjacent to the stem and loop structure at the 3’ side of the stem. In some embodiments, the branch point immediately follows the stem and loop structure at the 3’ side of the stem, without intervening nucleotides. In some embodiments, the stem and loop structure further comprises the polypyrimidine tract. In some embodiments, the stem and loop structure further comprises a splice enhancer.

[0102] In some embodiments, the length of the loop is less than about 40 nu, 35 nu, 30 nu, 25 nu, 20 nu, 15 nu, 10 nu, 8 nu, or 5 nu.

[0103] Importantly, some differences exist between mirtrons, which are functional introns processed by the spliceosome complex, and canonical miRNAs, which are generally longer elements that may be independently transcribed and are processed by the Drosha / DGCR8 complexed. These differences, described hereinbelow, apply to the artificial mirtrons of the invention.

[0104] First, the artificial mirtrons of the invention do not comprise a Drosha recognition sequences or structures, such as a “lower stem”, or an additional helical turn at the base of the stem, which is required for Drosha cleavage of miRNA. Drosha recognition sequences are generally known and may be found in Starega-Roslan et al., supra. In some embodiments, the artificial mirtron does not comprise a sequence selected from GCTG, TGTG, or GGTG in the 5’ strand of the stem and a sequence selected from GTCC, GTCG, or GTGG in the 3’ strand of the stem.

[0105] In some embodiments, the stem region is not interrupted by more than a single unpaired nucleotide, i.e., a nucleotide that does not form base pairing with the corresponding nucleotide in the other strand of the stem.

[0106] In some embodiments, the length of the stem region is no more than about 35 bp, 30 bp, 25, bp, 22 bp or 21 bp.

[0107] In some embodiments, the stem and loop structure is essentially adjacent at the 5’ end to a GT dinucleotide. In some embodiments, the stem and loop structure is essentially adjacent at the 3’ end to an AG dinucleotide. In some embodiments, the stem and loop structure is essentially adjacent at the 5’ end to a GT dinucleotide and / or is essentially adjacent at the 3’ end to an AG dinucleotide. In some embodiments, the GT dinucleotide is the 5’ terminal dinucleotide of the mirtron, and / or the AG dinucleotide is the 3’ terminal dinucleotide of the mirtron.

[0108] Additionally, the artificial mirtrons do not comprise an RNA polymerase promoter, a transcription terminator, and / or a polyadenylation signal.

[0109] Nevertheless, mirtrons are processed by Dicer, and therefore may include Dicer recognition motifs (such motifs may be found in Starega-Roslan et al., supra). Accordingly, in some embodiments, the artificial mirtron comprises a Dicer recognition motif.

[0110] In some embodiments, the stem and loop structure of the mirtron has a low minimum free energy. In some embodiments, the stem and loop structure of the mirtron has an initial AG of about -20 to about -40 Joule. In some embodiments, the stem and loop structure of the mirtron has an initial AG of about -30 to about -35 Joule.

[0111] In some embodiments, the guide strand has a high G content, such as at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%. In some embodiments, the passenger strand has a high C content, such as at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%. In some embodiments, the stem has a high GC content. In some embodiments, the stem has a GC content of at least about 30%, 35%, 40%, 45%, or 50%.

[0112] The term “conventional mirtron”, as used herein, refers to a mirtron in which the resultant precursor miRNA (following splicing) begins and ends with splice donor and splice acceptor sites. In other words, the stem and loop structure is essentially adjacent (within about 0-5 nucleotides) to both the splice donor and splice acceptor sites. This imposes strong sequence constraints due to the need to incorporate splicing motifs and guide sequence within the hairpin sequence.

[0113] Accordingly, in some embodiments, the 5’ strand of the stem is essentially adjacent to a 5’ splice donor (GT), and the 3’ strand of the stem is essentially adjacent to a 3’ splice acceptor sequence (AG).

[0114] Alternative designs, which offer some flexibility, are the 5’- and the 3 ’-tailed mirtrons.

[0115] The term “3’-tailed mirtron”, as used herein, refers to a mirtron in which at the 5’ end the stem is essentially adjacent to a 5’ splice donor, as in a conventional mirtron, but the 3’ end includes a sequence longer than 5 nu (3’ tail) separating the 3’ end of the stem and the 3’ splice acceptor. During processing, the 3’ tail is trimmed. This imposes fewer limitations on the 3’ sequence of the mirtron which is not part of the hairpin structure, and therefore allows for an easier design for the intronic 3’ elements, such as the pyrimidine-rich region.

[0116] In some embodiments, in 3 ’-tailed mirtrons, the branch point is essentially adjacent to the stem and loop structure at the 3’ side, or immediately follows the stem and loop structure at the 3’ side, without intervening nucleotides.

[0117] The term “5’-tailed mirtron”, as used herein, refers to a mirtron in which at the 3’ end the stem is essentially adjacent to a 3’ splice donor, as in a conventional mirtron, but the 5’ end includes a sequence longer than 5 nu (5’ tail) separating the 5’ end of the stem and the 5’ splice acceptor. During processing, the 5’ tail is trimmed. The tail adds some design flexibility.

[0118] In some embodiments, the mirtron is a conventional mirtron. In some embodiments, the mirtron is a 3 ’-tailed mirtron. In some embodiments, the mirtron is a 5 ’-tailed mirtron.

[0119] In some embodiments, the mirtron does not have a 5’ tail and a 3’ tail that are both longer than 5 nucleotides.

[0120] In some embodiments, the distance between the 5’ end of the stem and the 5’ splice site is less than about 2-100 nu, 2-50 nu, 2-30 nu, 2-10 nu, 2-5 nu, or about 2 nu or less. In some embodiments, the 5’ splice site is essentially adjacent to the 5’ end of the stem. In some embodiments, there are no intervening nucleotides between the 5’ splice site and the 5’ end of the stem.

[0121] In some embodiments, the distance between the 3’ end of the stem and the 3’ splice site is less than about 2-100 nu, 2-50 nu, 2-30 nu, 2-10 nu, or about 2 nu or less. In some embodiments, the 3’ splice site is essentially adjacent to the 3’ end of the stem. In some embodiments, there are no intervening nucleotides between the 3’ splice site and the 3’ end of the stem.

[0122] The guide sequence comprised in the mirtron is complementary to a target sequence in the target gene. Because the guide sequence must be part of the mature mirtron, it is mostly or completely comprised in the stem and loop structure, as mentioned above. For the purpose of the invention, when the guide sequence is said to be in, or comprised in, the stem (or stem and loop) structure, or when the stem and loop structure is said to comprise the guide sequence, it means that essentially the entire guide sequence is comprised in the stem or in the stem and loop structure, with a possible 1-3 nucleotides not being part of the stem or the stem and loop structure. However, the guide sequence being “completely comprised” in the stem, or in the stem and loop structure, means that all of the guide sequence is comprised in the stem, or in the stem and loop structure, respectively, without any part of the guide sequence not also forming part of the stem, or the stem and loop structure, respectively.

[0123] Accordingly, in some embodiments, the guide sequence is comprised, or completely comprised, in the stem and loop structure. In some embodiments, the guide sequence is comprised, or completely comprised, in the stem structure. In some embodiments, the guide sequence is comprised, or completely comprised, in the 3’ strand of the stem structure. In some embodiments, the guide sequence is comprised, or completely comprised, in the 5’ strand of the stem structure.

[0124] The guide sequence is sometimes referred to as a seed sequence.

[0125] In some embodiments, the guide sequence has a length of about 5-30 nu, 10-30 nu, 15-30 nu, 10-25 nu, or 15-25 nu.

[0126] The possible distance between the guide sequence and the splice sites may generally be derived from other disclosed measurements such as distances between the stem and the splice sited, lengths of the stem region, and lengths or the guide region. However, some situations in which the guide sequence is especially close to the splice sites, not leaving place for stem regions, tail regions, or secondary structures between the guide sequence and the splice sites or the branch point, may sometimes be advantageous at least since they may prevent additional secondary structures and possible Drosha recognition, and are therefore worth noting separately.

[0127] Accordingly, in some embodiments, the guide sequence is comprised in the 5’ strand of the stem, and the distance between the 5’ end of the guide sequence and the 5’ splice donor site is less than about 10 nu, 5 nu, or 2 nu. In some embodiments, the guide sequence is comprised in the 5’ strand of the stem, and the distance between the 3 ’ end of the sequence complementary to the guide sequence (in the 3’ strand of the stem) and the 3’ splice acceptor site is less than about 10 nu, 5 nu, or 2 nu.

[0128] In some embodiments, the guide sequence is comprised in the 3’ strand of the stem, and the distance between the 5’ end of the sequence complementary to the guide sequence (in the 5’ strand of the stem) and the 5’ splice donor site is less than about 10 nu, 5 nu, or 2 nu. In some embodiments, the guide sequence is in the 3’ strand of the stem, the distance between the 3’ end of the guide sequence and the 3’ splice acceptor site is less than about 10 nu, 5 nu, or 2 nu.

[0129] In some embodiments, the guide sequence follows the 5’ donor splice site without intervening nucleotides. In some embodiments, the guide sequence is followed by the 3’ acceptor splice site without intervening nucleotides. In some embodiments, the guide sequence is essentially adjacent to the branch point. In some embodiments, there are no intervening nucleotides between the guide sequence and the branch point.

[0130] In some embodiments, there are no intervening nucleotides which form part of the stem between the guide sequence and the loop region.

[0131] In some embodiments, the guide sequence has at least about 2-8 nu, 3-8 nu, 4-8 nu, 5-8, nu, 6-8 nu, or about 8 nu identical with a reverse-complement sequence of the target sequence. In some embodiments, the guide sequence is at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a reverse-complement sequence of the target sequence. In some embodiments, the guide sequence is identical to a reversecomplement sequence of the target sequence. In some embodiments, the guide sequence is at least about 80% identical to a reverse-complement sequence of the target sequence.

[0132] The term “target sequence”, as used herein, relates to a sequence of the target gene which is complementary to the guide sequence, and to which the guide sequence in the mature RNAi binds when silencing the target gene. The target sequence is present in the expressed RNA sequence of the target gene.

[0133] In some embodiments, the target sequence is part of a protein-coding sequence. In some embodiments, the target sequence is part of a noncoding region of the target gene, such as a 5’ or 3’ UTR. In some embodiments, the target sequence is part of a 5’ UTR of the target gene. In some embodiments, the target sequence is part of a 3’ UTR of the target gene.

[0134] The term “complementary” is used to indicate complementary base pairing between two nucleic acid sequences, sufficient to form a double stranded stretch (such as a stem), but not necessarily 100%. For example, complementarity determines whether a stem (of a stem and loop structure) is formed between two sequences, and whether the target sequence and the guide sequence are capable of forming base pairing to produce a double stranded nucleic acid region. In contrast, the term “reverse-complement sequence” refers to a sequence that is the exact reversecomplement of a given sequence.

[0135] In some embodiments, the target sequence is at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a reverse-complement sequence of the guide sequence.

[0136] The term “host gene”, as used herein, relates to a gene which carries the mirtron. In order for the mirtron to be expressed and processed, the host gene must be capable of being expressed in the plant, and in the desired plant tissues. However, the promoter driving the expression may or may not be the natural promoter of the gene.

[0137] One of the problematic issues with introducing RNAi-type constructs into plants is the plant defense system, which often methylates inverted repeats in the DNA thereby causing inhibition or self- silencing of RNAi constructs (Zhang, et al., 2022, Nature Communications, 13(1): 3926). However, as shown in Example 3 and Fig. 5, the artificial mirtron of the invention was surprisingly not silenced or inhibited by the plant defense systems. Without wishing to be bound by any theory, it is possible that embedding the artificial mirtron in the host gene contributed to reducing the effect of recognition and silencing of the artificial mirtron by the plant defense systems. It is also possible that this effect was due to the small size of the mirtron (e.g., up to about 200 bp, compared to the larger microRNAs or 300-400 bp), or to its being a mirtron and therefore processed by different pathways compared to microRNA.

[0138] In some embodiments, the artificial mirtron and / or the host gene are not inhibited or silenced by plant defense systems.

[0139] In some embodiments, the host gene is a protein-coding gene.

[0140] In some embodiments, the host gene is exogenous to the plant, meaning that the host gene does not naturally exist in the plant (e.g., a gene from a different plant, or not a plant gene). In some embodiments, the host gene is endogenous to the plant, meaning that the host gene is a gene that is naturally found in the plant. In some embodiments, the host gene contain natural introns. In some embodiments, the host gene is intronless.

[0141] In some embodiments, the host gene is endogenous to the plant and has an expression pattern suitable for silencing of the target gene.

[0142] In some embodiments, the host gene is endogenous to the plant and the artificial mirtron is produced by modifying an endogenous intron sequence of the host gene.

[0143] In some embodiments, the host gene is endogenous to the plant and has an expression pattern similar to that of the target gene. In some embodiments, the host gene and the target gene are expressed in the same tissues. In some embodiments, the host gene is expressed in a tissue in which the target gene is expressed.

[0144] In some embodiments, the host gene is expressed in a plant part, cell, or tissue selected from root, tuber, meristem, stem, leaf, flower, seed, and fruit. In some embodiments, the host gene is expressed in plant roots, tuber, seed, or meristem.

[0145] In some embodiments, the host gene is an essential plant gene.

[0146] In some embodiments, the host gene confers to the plant a trait that may be selected for.

[0147] In some embodiments, the host gene is selected from Arabidopsis thaliana CEL1 ((Atcell) gene; soy genes including plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, stress- induced PR- 10 protein (SAM-22), tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase- related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl); rice genes including Gs03g01700, Os02g37190, Gs01g0762500, Gs02g0268300, and Gs07g0616800; and potato / tuber genes including endo-P-l,4-glucanases (EGases), St-CEL7, St-CEL9C1, immunoglobulin binding protein (St-BiP3), ADP glucose pyrophosphorylase, and granule-bound starch synthase.

[0148] As explained above, the host gene may be operably linked to its natural promoter or to a different promoter, which drives transcription of the host gene and obtains a desired expression pattern.

[0149] In some embodiments, the host gene is operably linked to a promoter selected from a tissuespecific promoter, a stress-responsive promoter, a developmental stage-specific promoter, a pathogen- specific promoter and a parasite-specific promoter.

[0150] In some embodiments, the promoter is the natural promoter of the host gene. In some embodiments, the promoter is not the natural promoter of the host gene. In some embodiments, the promoter is a synthetic promoter.

[0151] The term “target gene”, as used herein, relates to a gene that is desired to be silenced, and for which the mirtron guide sequence is specific, i.e., the target sequence complementary to the guide sequence is part of the target gene.

[0152] In some embodiments, the target gene is completely silenced by the artificial mirtron of the invention. In some embodiments, the target gene is partly silenced, or downregulated, by the artificial mirtron of the invention. In some embodiments, the target gene is silenced in specific tissues, structures, developmental states, or other conditions, by the artificial mirtron of the invention.

[0153] In some embodiments, the target gene is an endogenous gene of the plant.

[0154] In some embodiments, the target gene is selected from a plastid-localized polyphenol oxidase (PPO); a gene involved in sugar metabolism, such as vacuolar invertase (VInv) or asparagine synthetase-1 (StASl and StAS2); a gene of the rice flavone biosynthesis pathway, such as CYP75B3 or CYP75B4; a cytochrome P450 encoding gene such as glycoalkaloid metabolism 4 (GAME4); a starch branching enzyme (SBE) encoding gene such as potato SBE1 or SBE2; and a rice fatty acid desaturase 2 (FAD2) gene such as OsFAD2-l, OsFAD2-2, OsFAD2-3 or OsFAD2-4.

[0155] In some embodiments, the target gene is not an endogenous gene of the plant. In some embodiments, the target gene is a gene exogenous to a natural (wild-type) version of the plant, which has previously been incorporated into the plant, and the plant is a GMO (genetically modified) plant.

[0156] In some embodiments, the target gene is a gene of a pathogen, a pest, or a parasite.

[0157] The pathogen, pest or parasite may be any relevant organism which comes into contact with the plant and to which RNA may be transferred to the plant to silence genes in that organism. Nonlimiting examples include nematodes, fungi, bacteria, viruses, and oomycetes. In some embodiments, the nematode is a root-knot nematodes (RKN, genus Meloidogyne), a soybean cyst nematode (SCN, genus Heteroderd), or a potato cyst nematode (PCN, genus Globoderd). In some embodiments, the pathogen is a plant disease-causing pathogen. In some embodiments, the disease is blight.

[0158] In some embodiments, the target gene is an essential pest, parasite, or pathogen gene. In some embodiments, the target gene is an essential nematode gene. In some embodiments, the target gene is selected from 16D10, HgY25, HgPrpl7, Gr-Exp, and chorismate mutase.

[0159] Nonlimiting examples for virus pathogens against which the artificial mirtrons of the invention may be useful include wheat pathogen wheat streak mosaic virus (WSMV); rice pathogens rice tungro, bacilliform virus (RTBV), rice dwarf virus (RDV), and rice stripe virus (RSV); potato pathogens potato virus X (PVX), potato virus Y (PVY), potato leaf roll virus (PLRV), and potato virus S (PVS); tobacco pathogens African cassava mosaic virus (ACMV), soybean mosaic virus (SMV), bean yellow mosaic virus (BYMV), Ugandan cassava brown streak virus (UCBSV), cassava brown streak virus (CBSV), tomato leaf curl Gujarat virus (ToLCGV), and cucumber necrosis virus (CNV); cowpea pathogens cowpea severe mosaic virus (CPSMV) and cowpea aphid-borne mosaic virus (CABMV); and soybean pathogen soybean mosaic virus (SMV).

[0160] Nonlimiting examples for bacteria pathogens against which the artificial mirtrons of the invention may be useful include A. tumefaciens, which infects Arabidopsis, tobacco, rice, walnut, plum, and apricot; and P ectobacterium carotovorum (Soft rot), which infects potato.

[0161] Nonlimiting examples for fungi pathogens against which the artificial mirtrons of the invention may be useful include pathogens listed in Table 3 of Bilir et al., 2022, Frontiers in Plant Science, DOI: 10.3389 / fpls.2022.951097, which is incorporated herein by reference.

[0162] Nonlimiting examples for nematode pathogens against which the artificial mirtrons of the invention may be useful include pathogens listed in Table 4 of Bilir et al. supra).

[0163] Nonlimiting examples for target genes that may be silenced in the above pathogens are listed in Tables 1-4 of Bilir et al. supra).

[0164] In some embodiments, the target gene is the host gene.

[0165] In some embodiments, the plant is a tuber or a storage root plant. In some embodiments, the tuber or storage root plant is a potato, yam, or a sweet potato. In some embodiments, the plant is a crop plant. In some embodiments, the plant is selected from potato, soybean, rice, wheat, tomato, yam, beet, oat, sweet potato, blueberry, canola, citrus, and grape. In some embodiments, the plant is selected from potato, soybean, rice, wheat, tomato, yam, beet, oat, and sweet potato.

[0166] Nonlimiting examples for crop plants include apple (Malus genus), corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare). lettuce (Lactuca genus), millet (e.g., pearl millet (Pennisetum glaucum). proso millet (Panicum meliaceous), foxtail millet (Setaria italic a), finger millet (Eleusine coracana), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aeslivum). soybean (Glycine max'), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), tomato (Solanum lycopersicum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), yam (Dioscorea genus), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), grapes (Vitis vinifera), palm trees from the Arecaceae (e.g, coconut palm (Cocos mucifera), oil palm (Elaeis guineensis), date palm (Phoenix spp.), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentals), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), Eucalyptus sp., Pinus spp., beets (Beta vulgaris), sugarcane (Saccharum spp.), cereals, oats, barley, vegetables, ornamentals, lawn grasses (poaceae family) and conifers. In some embodiments, the crop plant is from a species selected from Solanum tuberosum (potato), Ipomoea batatus (sweet potato), Solanum lycopersicum (tomato), and beans (Fabaceae family).

[0167] In some embodiments, the transgenic plant has at least one improved feature compared to the corresponding plant not including the artificial mirtron, the feature being selected from yield, growth rate, yield quality, percentage of water content, taste, smell, color, shape, appearance, size, texture, aroma, dietary / nutritional values, and flavor; and / or sensitivity or resistance to at least one factor selected from biotic or abiotic stress, disease, extreme heat, fresh water, drought, herbicide, pesticide, parasite, insect, and pathogen.

[0168] In some embodiments, the improved feature includes improved nutritional features such as higher oleic acid / low linoleic acid ratio in the seeds; reduced glycoalkaloids in tubers; improved dietary features of starch in tubers such as fewer calories, prolonged satiety, and better blood sugar control.

[0169] In some embodiments, the improved feature includes reduced enzymatic browning; reduced acrylamide accumulation during high-temperature food processing; and / or improved nitrogen fixation by bacteria.

[0170] In some embodiments, the improved feature includes resistance to a pest, pathogen, or parasite such as root-knob nematode (RKN), soybean cyst nematode (SCN), and / or potato cyst nematode (PCN). In some embodiments, there is provided a nucleic acid molecule comprising an artificial mirtron sequence comprising: a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in a target gene, and a stem and loop structure comprising at least the guide sequence; wherein the artificial mirtron sequence has about 30-95%, or about 50-95% sequence identity to a sequence of a natural intron of a plant gene, and the mirtron is capable of silencing the target gene.

[0171] It is noted that the artificial mirtron defined in the above paragraph is of the same scope as the artificial mirtrons defined in previous embodiments elsewhere in the present application, and therefore definitions and embodiments included above which are relevant, also apply to the nucleic acid molecule embodiments, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated.

[0172] In some embodiments, the artificial mirtron is a conventional mirtron. In some embodiments, the artificial mirtron is a 3 ’-tailed mirtron.

[0173] In some embodiments, the stem and loop further comprises the branch point, the polypyrimidine tract, and / or a Dicer recognition motif.

[0174] In some embodiments, the artificial mirtron is prepared by modifying a plant intron sequence to a mirtron sequence by incorporating at least a stem and loop structure comprising a guide sequence complementary to a target sequence in the target gene.

[0175] In some embodiments, the nucleic acid molecule is used for silencing or reducing expression of the target gene.

[0176] Sequences used in the present application include:

[0177] SEQ ID NO: 1 (Construct 1119):

[0178] GTAAGTTGTTTAAACATGTGGGACATTTTTGTATTTGTGTTACAATTGTTTTGGTTAT AGAAAAGTTGGGCTCCCTGTTGCAG

[0179] SEQ ID NO: 2 (Construct 1094):

[0180] GTATCTGCGGCGACTTTGCTTTATTAATTATTTTTATTTGTGTTAATTGTTTTCCGATA

[0181] AGGCAAATTCGCCGCAGAAG

[0182] SEQ ID NO: 3 (GUIDE):

[0183] GATAAGGCAAATTCGCCGCAGA

[0184] SEQ ID NO: 4 (Construct 1095):

[0185] CCATCTGCGGCGACTTTGCTTTATTAATTATTTTTATTTGTGTTAATTGTTTTCCGATA AGGCAAATTCGCCGCACAAA

[0186] SEQ ID NO: 5 (Construct 1116):

[0187] GTATCTGCGGCGACTTTGCTTTATTAATTATTTTTATTTGTGTTAATTGTTTTCCGATA AGGCAAATTCGCCGCTGAAG

[0188] SEQ ID NO: 6 (Intron M17):

[0189] GTTCATTGTTAGCTTTTTTTCCCATCACTTGCTTTTATGTGATTTTGCTTGTTTTGACT TTTGAGATTTTTGTTTGCAG

[0190] SEQ ID NO: 7 (Construct 1):

[0191] GTATCTGCGGCGACTTTGCTTTATTTTTTGACTTTTTTTTGATAAGGCAAATTCGCCG CAGAAG

[0192] SEQ ID NO: 8 (Construct 2):

[0193] GTATCTGCGGCGACTTTGCTTTATTAATTATTTTTATTTGTGTTAATTGTTTTCCGATA AGGCAAATTCGCCGCAGAAG

[0194] SEQ ID NO: 9 (Construct 3):

[0195] GTATCTGCGGCGACTTTGCTTTATTAATTATTTTTATTTTCCGATAAGGCAAATTCG

[0196] CCGCAGAAGACTTTTGAGATTTTTGTTTGCAG

[0197] SEQ ID NO: 10 (Construct 4):

[0198] GTATCTGCGGCGACTTTGCTTTATTTTTATTTTGCTTGTTTTGACTTTTGAGATTTTTG

[0199] ATAAGGCAAATTCGCCGCAGAAG

[0200] SEQ ID NO: 11 (Construct 5):

[0201] GTATCTGCGGCGACTTTGCTTTATTAATTTATTTTGCTTGTTTTGACTTTTGAGATTTT

[0202] TCCGATAAGGCAAATTCGCCGCAGAAG

[0203] SEQ ID NO: 12 (Construct 6):

[0204] GTATCTGCGGCGACTTTGCTTTATTAATTTATTTTGCTTGTTTTGCCGATAAGGCAAA TTCGCCGCAGAAGACTTTTGAGATTTTTCAG

[0205] In some embodiments, the nucleic acid molecule comprises a sequence selected from SEQ ID NO: 2, 5, 7, 8, 9, 10, 11, and 12. In some embodiments, the nucleic acid molecule comprises a sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 5.

[0206] In some embodiments, the present invention provides a transgenic plant, a transgenic plant part, a transgenic plant tissue, or a transgenic plant cell (that may be part of a cell culture), comprising the artificial mirtron or the nucleic acid molecule disclosed herein.

[0207] In some embodiments, the present invention provides a transgenic plant, a transgenic plant part, a transgenic plant tissue, or a transgenic plant cell, comprising an integrated host gene capable of being expressed in the plant, plant part, plant tissue, or plant cell, wherein the host gene comprises an artificial mirtron capable of silencing a target gene and having a sequence comprising a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, and a guide sequence complementary to a target sequence in the target gene.

[0208] In some embodiments, the transgenic plant cells are cultured plant cells.

[0209] In some embodiments, the plant part is selected from a plant seed, a plant cell, a plant tissue, and a plant organ such as, but not limited to, roots, tubers, seeds, meristems, stems, leaves, flowers, or fruits.

[0210] The design of the artificial mirtron determines its function in that the guide sequence defines the target gene to be silenced, and the expression pattern of the host gene (defined by the host gene promoter) defines in which tissues or conditions the target gene silencing will take place. In addition to the known mechanisms of RNA silencing of endogenous plant genes, it has been shown that plants also have host-induced defense mechanisms (HIGS, see Bilir et al., 2022, Frontiers in Plant Science, DOI: 10.3389 / fpls.2022.951097) which facilitate silencing genes in pathogens or pests by plant small RNAs. Accordingly, by taking advantage of such mechanisms, the mirtrons of the invention may also be used for silencing target genes in pests or pathogens, thereby protecting the transgenic plants.

[0211] Some nonlimiting examples for using the artificial mirtron are described below.

[0212] In some embodiments, the target gene is an endogenous plant gene, and the host gene is expressed in a specific tissue of the plant, wherein silencing the target gene in the specific tissue results in a desired phenotype.

[0213] In some embodiments, the target gene is an endogenous plant gene, and the host gene is expressed at a specific developmental stage of the plant, or the host gene is expressed in or localized to a specific organelle in the plant cell, wherein silencing the target gene in the specific tissue results in a desired phenotype.

[0214] In some embodiments, the artificial mirtron is used for preventing or reducing enzymatic browning in certain crops, such as apples, bananas, lettuce, and potatoes. In some embodiments, the target gene is a plastid-localized polyphenol oxidase (PPOs). In some embodiments, the host gene is a plant gene such as the tuber genes ADP glucose pyrophosphorylase and granule-bound starch synthase.

[0215] In some embodiments, the artificial mirtron is used for reducing acrylamide accumulation during high-temperature food processing in certain plants such as potatoes, cereal, and coffee. In some embodiments, the target gene is a plant gene involved in sugar metabolism such as vacuolar invertase (VInv) or asparagine synthetase-1 (StASl and StAS2). In some embodiments, the host gene is a plant gene such as the tuber genes ADP glucose pyrophosphorylase or granule-bound starch synthase. In some embodiments, the artificial mirtron is used for improving nitrogen fixation by bacteria (Biological Nitrogen Fixation, BNF). In some embodiments, the target gene is a flavone biosynthesis pathway gene such as CYP75B3 or CYP75B4. In some embodiments, the host gene is a root-specific plant gene. In some embodiments, the host gene is 0s03g01700 or Os02g37190.

[0216] In some embodiments, the artificial mirtron is used for generating high oleic acid / low linoleic acid in rice seeds. In some embodiments, the target gene is a fatty acid desaturase 2 (FAD2) gene such as OsFAD2-l, OsFAD2-2, OsFAD2-3 or OsFAD2-4. In some embodiments, the host gene is a seed-specific rice gene such as 0s01g0762500, 0s02g0268300, or 0s07g0616800.

[0217] In some embodiments, the artificial mirtron is used for specifically reducing the levels of glycoalkaloids in potato tubers. In some embodiments, the target gene is a cytochrome P450 encoding gene such as glycoalkaloid metabolism 4 (GAME4). In some embodiments, the host gene is a tuber specific gene such as ADP glucose pyrophosphorylase or granule -bound starch synthase.

[0218] In some embodiments, the artificial mirtron is used for modifying starch properties in potato tubers to have improved dietary features including fewer calories, prolonged satiety, and better blood sugar control. In some embodiments, the target gene is a starch branching enzyme (SBE) encoding gene such as SBE1 or SBE2. In some embodiments, the host gene is a tuber specific gene such as ADP glucose pyrophosphorylase or granule-bound starch synthase.

[0219] In some embodiments, the target gene is a gene of a pest, pathogen, or parasite, and the host gene is expressed at least in the tissue or tissues which are infected or in contact with the pest, pathogen, or parasite, wherein silencing the target gene in the pest, pathogen, or parasite results in killing of the pest, pathogen, or parasite, or arresting or inhibiting its growth and / or activity.

[0220] In some embodiments, the target gene is a gene of a pest, pathogen, or parasite, and the host gene is induced, targeted, or affected by the pest, pathogen, or parasite, wherein silencing the target gene in the pest, pathogen, or parasite results in killing of the pest, pathogen, or parasite, or arresting or inhibiting its growth and / or activity.

[0221] In some embodiments, the target gene is a gene of root-knob nematode (RKN) and the host gene is a gene induced or targeted by the RKN. In some embodiments, the target gene is the RKN 16D10 gene. In some embodiments, the host gene is CEL1. In some embodiments, the host gene is Arabidopsis thaliana Atcell. In some embodiments, the host gene is a gene expressed in roots. In some embodiments, the intron is an endogenous intron of the host gene CEL1 or Atcell.

[0222] In some embodiments, the target gene is a gene of soybean cyst nematode (SCN) and the host gene is a gene induced or targeted by the SCN, such as plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, and SAM-22. In some embodiments, the host gene is a gene expressed in soybean roots, such as tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase-related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl). In some embodiments, the target gene is the SCN gene HgY25 or HgPrpl7.

[0223] In some embodiments, the target gene is a gene of potato cyst nematode (PCN) and the host gene is a gene induced or targeted by the SCN, such as endo-P-l,4-glucanases (EGases), St-CEL7, and St-CEL9C1. In some embodiments, the host gene is a gene expressed in potato roots, such as immunoglobulin binding protein (St-BiP3). In some embodiments, the target gene is the PCN gene 16D10, Gr-Exp, or chorismate mutase.

[0224] In some embodiments, the host gene is naturally induced by the pest, pathogen, or parasite. In some embodiments, the host gene being induced by the pest, pathogen, or parasite results from the host gene being operably linked to a promoter induced by the pest, pathogen, or parasite.

[0225] In some embodiments, there is provided a method for generating a transgenic plant for silencing or reducing expression of a target gene, the method comprising modifying a host gene capable of being expressed in the plant by generating an artificial mirtron capable of silencing the target gene in the host gene, wherein the artificial mirtron comprises a sequence comprising a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in the target gene, and a stem and loop structure comprising at least the guide sequence, and wherein the host gene is integrated in the plant genome.

[0226] In some embodiments, there is provided a method for generating a transgenic plant for silencing or reducing expression of a target gene, the method comprising: a) selecting an intron for modifying; b) designing an artificial mirtron capable of silencing the target gene based on the selected intron; and c) modifying a host gene capable of being expressed in the plant by generating the designed artificial mirtron in the host gene, wherein the artificial mirtron comprises a sequence comprising a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in the target gene, and a stem and loop structure comprising at least the guide sequence, and wherein the host gene is integrated in the plant genome.

[0227] It is noted that the methods defined herein are related to the artificial mirtrons defined in previous embodiments elsewhere in the present application, and therefore definitions and embodiments included above which are relevant, also apply to the methods, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. As noted above, in some embodiments, the term “transgenic plant” encompasses a complete transgenic plant as well as a transgenic plant part, plant cell, or plant tissue.

[0228] The goal of the methods of the invention is silencing or reducing expression of the target gene, in order to obtain a desired trait by using an artificial mirtron specific for silencing a target gene. Nonlimiting examples for a desired trait include improved yield, taste, smell, color, shape, appearance, size, texture, aroma, dietary / nutritional values, and / or flavor. Additional examples include sensitivity or resistance to biotic or abiotic stress, disease, extreme heat, fresh water, drought, herbicide, pesticide, parasite, insect and / or pathogen.

[0229] As explained in more detail above, the artificial mirtron is designed as an intron of a host gene having an expression pattern suitable for silencing the target gene, while the mirtron comprises a guide sequence specific for the target gene, together facilitating achieving the desired effect.

[0230] Step (a) comprises identifying or selecting plant introns suitable for use in the present invention. This step mainly focuses on finding plant introns having a length of no more than about 200 bp, 150 bp, 100 bp, or 50 bp. In some embodiments, introns were selected so as to minimize the number of modifications needed in order to obtain mirtrons for targeting a specific target gene, or in other words, introns which have high sequence identity to sequences in the target gene. The introns are identified by using bioinformatic software for intron and miRNA design such as online splice prediction software (Spliceport: http: / / spliceport.cbcb.umd.edu) and Human Splice Finder (http: / / www.umd.be / HSF3 / HSF.shtml).

[0231] In some embodiments, the selected intron comprises a sequence at least about 40% identical to a reverse-complement sequence of the target sequence within a distance of at most about 50 bp upstream of the 3’ splice acceptor site.

[0232] In some embodiments, the selected intron comprises a sequence at least about 40% identical to a reverse-complement sequence of the target sequence within a distance of at most about 10 bp upstream of the 3’ splice acceptor site or of the branch point.

[0233] In some embodiments, the selected intron comprises a sequence at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% identical to a reverse-complement sequence of the target sequence within a distance of at most about 50 bp, 45 bp, 40 bp, 35 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, or 5 bp upstream of the 3’ splice acceptor site, and / or at most about 10 bp, or 5 bp upstream of the branch point.

[0234] In some embodiments, the selected intron is an endogenous intron of the plant. In some embodiments, the selected intron is an endogenous intron of the host gene. In some embodiments, the selected intron is a mirtron. In some embodiments, the selected intron is not a mirtron. In step (b), bioinformatic tools, such as those mentioned above, are used to design, based on the selected intron, a mirtron specific to the target gene, such that the mirtron includes the important RNAi elements including a guide sequence specific for a target sequence in the target gene (detailed above), where the guide sequence is in a stem and loop structure, and a Dicer recognition sequence, while maintaining intronic splice cis elements such as the donor and acceptor splice sites, poly pyrimidine tract, and branch point, although they may also be somewhat modified. There is an emphasis on trying to keep modifications to a minimum, so as to avoid plant defense mechanisms, and other potential side effect.

[0235] More specific details about the mirtron elements, their definitions, and relevant embodiments, are detailed above.

[0236] The modifications introduced to the intron are mainly directed to adding a stem and loop structure comprising the guide sequence while preserving the splice elements. However, in some embodiments, modifications to the sequence of the selected intron (or to the sequence of the host gene if the intron is part of the host gene) may include, but are not limited to, changes to a donor 5' splice site, changes to a branch point, changes to a polypyrimidine tract, changes to an acceptor 3' splice site, changes that affect the release of an artificial mirtron from the transcript, changes to generate a new or improved donor 5’ splice site or a new or improved acceptor 3' splice site, changes to intronic splicing enhancers (ISE), changes to intronic splicing silencers (ISS), changes to exonic splicing enhancers (ESE), changes to exonic splicing silencers (ESS), changes that influence nucleic acid binding proteins such as splicing activators, splicing repressors, and other factors that regulate the splicing and / or an alternative splicing process by binding to a pre-mRNA or mRNA transcript, and / or changes to sequences that affect exon recognition, or sequences that affect nonsense-mediated decay (NMD).

[0237] Once the artificial mirtron design is complete, the host gene is modified in step (c), to include the designed artificial mirtron.

[0238] In some embodiments, the selected intron is part of the host gene, and is modified by modifying the host gene.

[0239] In some embodiments, the selected intron is modified first to become the designed artificial mirtron, and then the designed artificial mirtron is incorporated into the host gene. In this case, the method further comprises a step (b’) between step (b) and step (c), including modifying the selected intron sequence into the designed artificial mirtron sequence. This may be the case, for example, when the selected intron is not an endogenous part of the host gene and may therefore be modified separately, or it may be done for convenience, buy first preparing the artificial mirtron and later replacing the endogenous host gene intron with the artificial mirtron. The modification of the host gene or of the selected intron is conducted by genetic engineering, molecular biology, and / or gene editing methods such as prime editing, all well known in the art, and some exemplified in the examples section. For example, any of the sequences used for the process may be synthesized, built from shorter fragments, or a combination of both. Examples for such sequences include the complete mirtron or parts thereof, the host gene or parts thereof, parts of the original intron, exon sequences bordering the selected intron, and / or a suitable cloning or delivery vector or parts thereof. The above sequences, combinations thereof, or constructs including them, may be used for modification of the selected intron by methods such as genetic engineering or gene editing, including prime editing.

[0240] In some embodiments, the host gene is an endogenous plant gene and therefore naturally integrated in the plant genome. In some embodiments, the host gene is not an endogenous plant gene and is therefore integrated in the plant genome by genetic engineering methods.

[0241] In some embodiments, the host gene is modified, such as by using gene editing, directly in the plant cells, i.e., in the plant genome. The host gene may be directly modified in the plant cells, when the host gene is already integrated into the plant genome, such as when the host gene is a plant endogenous gene, or when the host gene has previously been integrated into the plant genome, for example, as part of a previous attempt for modifying the host gene.

[0242] In some embodiments, the host gene is modified, such as by using gene editing, when not in the plant cells, and only after the host gene is modified it is incorporated into the plant cells (i.e., into the plant genome). Accordingly, in some embodiments, the method further comprises a step (d), after step (c), including integrating the host gene into the plant genome.

[0243] In some embodiments, modifying the host gene comprises modifying an intron of the host gene to become the artificial mirtron. In some embodiments, modifying the host gene comprises incorporating the artificial mirtron into the host gene. In some embodiments, modifying the host gene comprises replacing an endogenous intron of the host gene with the artificial mirtron.

[0244] In some embodiments, modifying the host gene or the selected intron is obtained by gene editing. As also explained above, using gene editing has advantages both in terms of potentially causing fewer adverse effects, and potentially escaping the plant defense system.

[0245] In some embodiments, modifying the host gene or the intron by gene editing involves using a system selected from meganucleases, zinc finger nucleases (ZFN), transcription-activator like effector nucleases (TALEN), clustered regularly interspaced short palindromic repeats (CRISPR) system, and a prime editing system, or any other system known in the art for gene editing.

[0246] In some embodiments, the gene editing is performed by prime editing. In some embodiments, the gene editing is performed by CRISPR / Cas9. In some embodiments, the present application provides a transgenic plant, plant part, plant cell, or plant tissue prepared by the method disclosed herein.

[0247] In some embodiments, the transgenic plant, plant part, plant cell, or plant tissue disclosed herein have at least one improved feature compared to the original plant, the feature being selected from yield, growth rate, yield quality, percentage of water content, taste, smell, color, shape, appearance, size, texture, aroma, dietary / nutritional value, and flavor; and / or sensitivity or resistance to at least one factor selected from biotic or abiotic stress, disease, extreme heat, fresh water, drought, herbicide, pesticide, parasite, insect and pathogen.

[0248] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.

[0249] The term "a" and "an" refers to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0250] The term “nu” is short for “nucleotides” or “nucleotide”.

[0251] The term “bp” is short for “base pairs” or “base pair”.

[0252] The term “essentially adjacent”, when used herein with respect to distance between two sequences, means a distance of no more than a distance of 5 nucleotides. In some embodiments, this distance may be no more than 2 nucleotides. In some embodiments, this term relates to no distance (0 nucleotides) between the two sequences, or that the two referenced sequences are directly linked to each other, or that one of the two sequences directly follows the other.

[0253] The terms “stem and loop” and “hairpin” are used herein interchangeably.

[0254] The term "about" when referring to a measurable value such as an amount, a ratio, and the like, is meant to encompass variations of ±10% of the indicated value, as such variations are also suitable to perform the disclosed invention. Any numerical values appearing in the application are intended to be construed as if preceded by “about”, unless indicated otherwise.

[0255] While certain embodiments of the invention have been illustrated and described, it will be clear that the invention is not limited to the embodiments described herein. Numerous modifications, changes, variations, substitutions, and equivalents will be apparent to those skilled in the art without departing from the spirit and scope of the present invention as described by the claims, which follow.

[0256] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

[0257] EXAMPLES

[0258] Materials and Methods

[0259] Plant material and growth conditions

[0260] Experiments were conducted using Arabidopsis thaliana (Columbia, Col-0), plants were grown on half-strength Murashige and Skoog medium (1 / 2 MS; Duchefa Biochemie, The Netherlands) agar plates, in a culture room at 22 °C, with a 16 h light / 8 h dark photoperiod.

[0261] Plasmid construction.

[0262] Sequences of intron 15 of the C2 calcium / lipid-binding endonuclease / exonuclease / phosphatase gene (AT3G60950.1, SEQ ID NO: 1) and of intron 2 of the AP2 / B3-like transcriptional factor family protein (AT4G34400.1, SEQ ID NO: 6) were obtained from The Arabidopsis Information Resource (TAIR). Mirtrons were designed based on sequences, as explained in Example 1. To generate the plasmids containing the designed mirtron constructs, DNA segments according to the mirtron sequences were synthesized and cloned into a green fluorescent protein (GFP) gene under the control of cauliflower mosaic virus 35S promoter in the binary vector Ppzp by Genscript™.

[0263] Generation of transgenic plants.

[0264] Electrocompetent Agrobacterium tumefaciens (GV3101 strain) bacteria were transformed with 100 ng plasmid by electroporation. Arabidopsis WT plants were transformed with the bacteria using the floral-dip method (Clough and Bent, 1998, Plant J. Cell Mol. Biol. 16:735-743). Screening was performed on 1 / 2 MS selection media containing 1% sucrose (Sue, Duchefa) and 50 pg / ml kanamycin (Kan; Duchefa).

[0265] RNA secondary structure and free energy calculations.

[0266] Free energy calculations and predictions of secondary structures were done using the Mfold web server (Mfold web server for nucleic acid folding and hybridization prediction. Nucleic acids research, 2003, 31(13):3406-3415).

[0267] Example 1: Intron selection and construct design for intron 15 of AT3G60950.1

[0268] Intron 15 of the C2 calcium / lipid-binding endonuclease / exonuclease / phosphatase gene (AT3G60950.1, SEQ ID NO: 1, 99 bp long, construct No. 1119) of Arabidopsis thaliana was selected on the basis of having a small length (about 50-200bp). A mirtron was designed based on intron 1119: construct 1094 (SEQ ID NO: 2), the predicted secondary structure of the construct is provided in Fig. 2. The guide sequence of the designed mirtron (GATAAGGCAAATTCGCCGCAGA, SEQ ID NO: 3) was incorporated as part of the 3’ strand of the stem (underlined sequence in Fig. 2), and was designed to target the phytoene desaturase (PDS) gene of Arabidopsis thaliana, which when silenced results in an albino phenotype.

[0269] In order to show that silencing occurred by the mirtron pathway, i.e., by splicing of the mirtron, the designed mirtron sequence was inserted into a sequence of the Green Fluorescent Protein (GFP, MK896905, region: 1236..1939), under the control of the cauliflower mosaic virus 35S promoter MN519522, region: 9638..9982, Fig 3). The construct was then cloned into the Agrobacterium binary vector Ppzp (Hajdukiewicz and Maliga, 1994, Plant Mol Biol 25(6):989- 994) which contains resistance to Kanamycin (Kan).

[0270] Splicing of the mirtron is expected to result both in GFP expression (manifested by detectable green fluorescent color) and in silencing of the PDS gene - visualized as an albino phenotype. As controls, the original AT3G60950.1 intron 15 (1119, SEQ ID NO: 1) sequence was tested, which was expected to result in green fluorescence (indicating correct splicing) but no an albino phenotype. In addition, construct 1095 (SEQ ID NO: 4) was prepared, modified to prevent splicing by modifying the 5’ terminal dinucleotide (the splice donor) from GT to CC and by modifying the 3’ terminal four nucleotides (the splice acceptor) from GAAG to CAAA. The expected outcome for construct 1095 was no splicing (no green fluorescence) and no silencing (no albino phenotype).

[0271] Example 2: Testing for splicing-dependent silencing of PDS

[0272] Plasmids containing the prepared constructs were transformed by floral dip to Arabidopsis thaliana plants, ecotype Columbia-0. TO seeds were sowed in 1 / 2 MS plates containing 50 pg / ml kanamycin. The resulting plants were screened for albino phenotype.

[0273] As shown in Fig. 4, construct 1094 (upper panel) successfully showed both correct splicing (GFP fluorescence, right plate) and correct silencing of the PDS gene (albino phenotype, left plate). As expected, construct 1119 (the original intronic sequence, middle panel) resulted in splicing but no silencing. Additionally, the splicing control construct 1095 (lower panel) showed neither splicing nor silencing, as also expected.

[0274] Together those results indicate successful splicing dependent mirtron silencing of the PDS gene by the designed mirtron 1094. Example 3: Avoidance of transgenic RNA silencing by plant defense systems

[0275] A known problem of RNA silencing in plants is that transgenic RNAi containing stem and loop structures is known to become methylated by plant self-defense systems, causing transcriptional self- silencing (Zhang, et al., 2022, Nature Communications, 13(1): 3926). To test for this possibility, 20 albino seedlings that were generated by transformation with construct 1094 were transferred from the selection plates to fresh 1 / 2 MS medium not containing kanamycin. Two months following the germination of albino seedlings, there was no observable change in the developmental progress of the albino plants, i.e., none of the plants developed rosette leaves. Furthermore, none of the plants reverted from the albino phenotype back to a more greenish phenotype, indicating strong and stable silencing of the PDS gene by the transgenic mirtron.

[0276] This result importantly and unexpectedly indicates that no self- silencing of the transgenic construct (the artificial mirtron and / or the host gene) by the plant defense systems (that would have prevented silencing of the target gene by the artificial mirtron) took place in this case (Fig. 5). This is yet another advantage of the system of the invention, which appears to also solve the problem of transgene silencing. Without being bound to a mechanism, it is suggested that introducing the short mirtron sequence as part of an intron in a protein-coding sequence, as opposed to other RNAi systems in which the RNA is transcribed independently and is much larger, may prevent silencing by the plant cell.

[0277] Example 4: Modifications to examine the essentials mirtron design

[0278] In order to investigate which the crucial elements for mirtron design are, an additional mirtron construct 1116 (SEQ ID NO: 5) was designed based on the successful construct 1094 (the corresponding predicted secondary structure is presented in Fig. 6). The construct was designed by a change of one nucleotide at the 3’ end of the 1094 mirtron from A to T (bolded / starred U in the corresponding RNA in Fig. 6) towards the 3’ end of the guide sequence region. Construct 1116 showed an albino phenotype upon splicing, as can be seen by the GFP fluorescence and the albino phenotype (Fig. 7, lower panel).

[0279] Example 5: Replacement of an AT3G60950.1 endogenous intron by an artificial mirtron

[0280] In this example, the endogenous intron 15 of AT3G60950.1 is replaced by the artificial mirtron designed construct 1094 (SEQ ID NO: 2). The replacement is conducted by two methods: synthesis and gene editing. In the first method, Arabidopsis plants are transformed with a synthesized version of the AT3G60950.1 gene having intron 15 replaced by the mirtron of construct 1094 and including its endogenous promoter, using agrobacterium floral dip. In the second method the endogenous AT3G60950.1 gene is replaced by gene editing using the CRISPR / Cas9 system with the mirtron construct 1094. In both cases, an albino phenotype of the plant is expected, due to silencing of the PDS gene. Since the AT3G60950.1 gene is expressed in all tissues, the albino phenotype is expected to encompass the complete plant.

[0281] Example 6: Intron selection, construct design, and testing for Intron 2 of AT4G34400.1

[0282] Intron 2 of AP2 / B3-like transcriptional factor family protein (AT4G34400.1, SEQ ID NO: 6, 79 bp long, construct No. M17) of Arabidopsis thaliana was selected as a basis for mirtron design, similar to Example 1. Six mirtrons were designed based on SEQ ID NO: 6: namely construct Nos. 1-6 (SEQ ID NOs: 7-12, respectively). The same guide sequence (GATAAGGCAAATTCGCCGCAGA, SEQ ID NO: 3) was incorporated as part of the 3’ strand of the stem. The constructs included different variations such as including a 3’ tail (nos. 3 and 6), adding bases around the loop, adding nucleotides to create a Dicer recognition sequence, having a larger or a smaller loops, etc. The secondary structure predicted for the constructs are presented in Figs. 8A-8F.

[0283] As in Example 1, the designed mirtron sequences were inserted into a GFP sequence under the control of the cauliflower mosaic virus 35S promoter, and the constructs were cloned into the Agrobacterium binary vector Ppzp.

[0284] The constructs were tested by the same method described in Example 2. Briefly, plasmids containing the constructs were transformed by floral dip to Arabidopsis thaliana plants, TO seeds were sowed in 1 / 2 MS plates containing 50 pg / ml kanamycin, and the resulting plants were screened for albino phenotype.

[0285] Splicing of the mirtron is expected to result both in GFP expression (manifested by detectable green fluorescent color) and in silencing of the PDS gene - visualized as an albino phenotype.

[0286] Example 7: Replacement of an AT4G34400.1 endogenous intron by an artificial mirtron

[0287] In a similar strategy to that described above for intron 15 of AT3G60950.1, the endogenous intron 2 of AT4G34400.1 is replaced by the artificial mirtrons designed construct 1-6 (SEQ ID NO: 7-12). The replacement is conducted by either synthesis or gene editing. In the first, Arabidopsis plants are transformed with synthesized versions of the AT4G34400.1 gene having intron 2 replaced by mirtrons of constructs 1-6 and including its endogenous promoter, using agrobacterium floral dip. In the second method the endogenous AT4G34400.1 gene is replaced by gene editing using the CRISPR / Cas9 system with mirtron constructs 1-6. In both cases, an albino phenotype of the plant is expected, due to silencing of the PDS gene. Since the AT4G34400.1 gene is expressed in meristem, the albino phenotype is expected to be manifested at least in meristem.

[0288] Example 8: Use of mirtrons for plant-parasitic nematode control

[0289] Root-knot nematodes (RKN) are plant-parasitic nematodes from the genus Meloidogyne, which have devastating effects on crop yields. These parasites take advantage of plant cells by converting them into nutrient-rich feeding cells for the nematodes by activating specific plant genes. In order to combat the RKN nematodes, mirtrons are designed by modifying endogenous intron sequences of plant genes induced by the nematode, or of tissue- specific plant genes that are targeted by the nematodes. An advantage of the first approach is that the resulting mirtrons are highly expressed in the region of nematode infection, thereby providing spatial and temporal respond to the nematode infection. In both cases, the endogenous introns are modified into mirtrons which produce RNAi directed to targeting crucial nematode genes.

[0290] The Arabidopsis thaliana CEL1 (Atcell) gene encodes elongation-specific EGase that belongs to family 9 glycosyl hydrolases. Evidence suggests that both cyst and root-knot nematodes recruit plant EGase activity as one component of the extensive remodeling of cell walls that occurs within their respective feeding cells. Atcell is also expressed specifically within the root elongation zone, which is the preferred initial infection site of both root-knot and cyst nematodes.

[0291] The 16D10 gene is a conserved Root-knot nematodes (RKNs) gene, which encodes a secretory 13 amino acids peptide expressed in RKN sub- ventral esophageal gland cells. The 16D10 peptide plays an important role in establishing feeding sites for the endoparasite RKNs, and therefore knockdown of 16D10 gene expression in RKNs offers a broad spectrum of resistance against all the major RKN species in transgenic Arabidopsis plants.

[0292] Accordingly, an intron of Arabidopsis thaliana CEL1 (Atcell, AT1G70710.1) is modified by any suitable method (such as synthesis or gene editing) to a mirtron having a guide sequence targeting the RKN 16D10 gene. Reduction of RKN 16D10 gene expression is confirmed by molecular tools such as quotative RT-PCR. The effect of the successful function of the mirtron in the CEL1 gene is expected to be manifested by resistance of the transgenic Arabidopsis thaliana plant to RKN.

[0293] Example 9: Use of mirtrons for soybean cyst nematode control

[0294] Soybean cyst nematode (SCN, Heterodera glycines'), is the cause of one of the most economically important biotic stresses in global soybean production, resulting in over 1 billion dollars in yield losses annually in the USA alone. When the second juvenile stage (J2) stage of the nematode reaches the root vascular tissue, nematode secretions modify selected plant cells into an elaborate feeding site called a syncytium, upon which the J2 depends for continued development. The syncytium is a large, metabolically active feeding site that becomes multinucleate as neighboring plant cells are incorporated into the syncytium by cell wall dissolution and cell fusion. Formation of the syncytium is induced by manipulation of the expression of several host genes such as plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, and stress-induced PR- 10 protein (SAM-22), by the nematode.

[0295] Accordingly, an intron of a soybean gene selected from genes induced by SCN, such as plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, and SAM-22, or of a soybean rootspecific gene such as tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase-related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl), is modified by any suitable method (such as synthesis or gene editing) to a mirtron having a guide sequence targeting SCN essential genes such as HgY25 or HgPrpl7. Reduction of syncytium-related gene expression is confirmed by molecular tools such as quantitative RT-PCR and Small RNAs sequencing. The effect of the successful function of the mirtron in the host gene is expected to be manifested by resistance of the transgenic soybean plant to SCN.

[0296] Example 10: Use of mirtrons for potato cyst nematode control

[0297] The potato cyst nematodes (PCN) Globodera pallida (pale potato cyst nematode) and Globodera rostochiensis (golden potato cyst nematode) are highly specialized and economically important pest of potato plants. Worldwide PCN alone causes estimated losses of up to 30% in potato crop yield.

[0298] During the nematode life cycle and after infection by the second-stage juveniles (J2), a syncytium is formed, as explained in the soybean Example 9. Similar to SCN, PCN induces the formation of syncytia by manipulating the expression of several host genes, such as endo-P-1,4- glucanases (EGases), St-CEL7, and St-CEL9C1, within the host plant.

[0299] Accordingly, an intron of a potato gene selected from genes induced by PCN, such as endo- P-l,4-glucanases (EGases), St-CEL7, and St-CEL9C1, or of a potato root-specific gene such as immunoglobulin binding protein (St-BiP3), is modified by any suitable method (such as synthesis or gene editing) to a mirtron having a guide sequence targeting PCN essential genes such as 16D10, Gr-Exp, or chorismate mutase. Reduction of syncytium-related gene expression is confirmed by molecular tools such as quantitative RT-PCR and Small RNAs sequencing. The effect of the successful function of the mirtron in the host gene is expected to be manifested by resistance of the transgenic potato plant to PCN. Example 11: Use of mirtrons for reducing enzymatic browning

[0300] Enzymatic browning is an undesirable phenomenon happening in particular crops, such as apples, bananas, lettuce, and potatoes. This process is triggered by plastid-localized polyphenol oxidases (PPOs) coming into contact with vacuole-localized phenolic substrates such as tyrosine and caffeic acid, as a result of mechanical damage of tissues and / or cells during poor post-harvest handling. A similar outcome is observed when precut, pureed, or juiced fruits or vegetables are exposed to oxygen. Decreasing the activity of PPOs may inhibit or eliminate enzymatic browning, thus reducing food waste and the use of harmful preservatives.

[0301] In this example, an intron of a tuber specific gene such as ADP glucose pyrophosphorylase or granule-bound starch synthase is modified by any suitable method (such as synthesis or gene editing) into an artificial mirtron in a potato plant. The artificial mirtron includes a guide sequence targeting one or more PPO genes. As a result, the targeted PPO gene is silenced or inhibited, thereby preventing or reducing enzymatic browning in the potato plant.

[0302] Example 12: Use of mirtrons for reducing acrylamide levels in plants

[0303] Acrylamide is a carcinogen with significant neurotoxicological effects, which is formed and accumulates during high-temperature food processing in the preparation of potato and wheat-based products such as French fries, chips, and toasted bread.

[0304] In this example, an intron of a tuber specific gene such as ADP glucose pyrophosphorylase or granule-bound starch synthase is modified by any suitable method (such as synthesis or gene editing) into an artificial mirtron in a potato plant. The artificial mirtron includes a guide sequence targeting one or more genes involved in sugar metabolism such as vacuolar invertase (VInv) and asparagine synthetase-1 (StASl and StAS2). As a result, acrylamide accumulation in the plant is prevented or reduced.

[0305] Example 13: Use of mirtrons for nitrogen fixation

[0306] Plants rely on nitrogen for growth, yet they cannot use the abundant nitrogen gas in the atmosphere. Instead, they absorb inorganic forms like ammonium and nitrate from the soil. Modern agriculture heavily relies on chemical fertilizers to enhance productivity. Unfortunately, about half of the nitrogen fertilizer used in agriculture is lost to the environment, contributing to greenhouse gas emissions and water pollution. Nitrogen fertilizers, through volatilization and leaching, impact air and water quality, leading to environmental and health concerns. Additionally, industrial ammonia production for fertilizers is energy-intensive and predicted to consume 2% of global energy by 2050. An alternative approach to nitrogen fertilizers is the conversion of atmospheric N2 to ammonia by bacteria (Biological Nitrogen Fixation, BNF). N2-fixing bacteria (diazotrophs) produce nitrogenase, an enzyme complex that mediates the reduction of N2 to ammonia. Diazotrophs can interact with plant roots symbiotically or not symbiotically. In symbiotic interactions, such as those between legumes and rhizobia, bacteria are located in differentiated root cells, called nodules, where nitrogen fixation occurs. The root-bacteria interactions in the soil can be supported by the formation of biofilms, a bacteria self-produced matrix of extracellular polymeric substances (EPS) containing polysaccharides, proteins and lipids. In some cases, the formation of biofilms is essential for successful root colonization (Yan et al., 2022, Plant Biotechnology Journal, 20(11): 2135-2148).

[0307] In the present example, an intron of a root-specific gene in rice, such as 0s03g01700 or Os02g37190, is modified by any suitable method (such as synthesis or gene editing) into a mirtron having a guide sequence targeting CYP75B3 and / or CYP75B4 of the rice flavone biosynthesis pathway. Silencing of these genes increases root compounds which stimulate formation of biofilm in diazotrophic bacteria in the soil, thereby promoting bacterial colonization of plant tissues, and improving BNF in rice.

[0308] Example 14: Use of mirtrons for generation of high oleic acid / low linoleic acid rice seeds

[0309] Rice bran oil (RBO), a staple in Asian countries, boasts health-promoting elements such as antioxidants (tocopherols, tocotrienols, phytosterol, and y-oryzanol). It primarily consists of three fatty acids: palmitic acid, oleic acid, and linoleic acid, with varying proportions depending on rice variety and environmental conditions. Oleic acid, known for its stability, can aid in preventing conditions like cardiovascular diseases. Enhancing the molecular pathways of fatty acid synthesis can elevate oleic acid levels, leading to more valuable RBO.

[0310] Fatty acid desaturase 2 (FAD2) catalyzes the conversion of oleic acid to linoleic acid in plants. Four FAD2 genes, designated OsFAD2-l, OsFAD2-2, OsFAD2-3 and OsFAD2-4, have been identified in the rice genome, The OsFAD2-l gene is the most highly expressed FAD2 gene in rice seeds.

[0311] In order to produce high oleic acid / low linoleic acid rice seeds, an intron of a rice seed specific gene such as 0s01g0762500, 0s02g0268300, or 0s07g0616800 is modified into a mirtron including a guide sequence targeting a FAD2 gene such as OsFAD2-l, OsFAD2-2, OsFAD2-3 or OsFAD2-4, which is expected to lead to a decrease in FAD2, resulting in high oleic acid / low linoleic acid rice seeds. Example 15: Use of mirtrons for reduction of glycoalkaloids in potato tubers

[0312] Glycoalkaloids are compounds found in potatoes which cause bitterness and are toxic to humans. The primary glycoalkaloids, a-solanine and a-chaconine, constitute about 90% of the total glycoalkaloids in current potato varieties. However, these compounds also serve as deterrents, deterring attacks from herbivorous insects like the Colorado potato beetle. Reducing these compounds in the above-ground part of the plant may result in increased vulnerability to pests. As glycoalkaloid levels vary within the plant, there is interest in specifically inhibiting their biosynthesis in the tuber without affecting their levels in the foliage. Reducing the expression of glycoalkaloid metabolism 4 (GAME4), a gene encoding cytochrome P450 and involved in an oxidation step in the conversion of cholesterol to steroidal glycoalkaloid aglycones in a potato tuber specific manner, can reduce glycoalkaloids in the tubers without affecting glycoalkaloids levels in the foliage.

[0313] In this example, an intron of a tuber specific gene such as ADP glucose pyrophosphorylase or granule-bound starch synthase is modified by any suitable method (such as synthesis or gene editing) into an artificial mirtron in a potato plant. The artificial mirtron includes a guide sequence targeting the GAME4 gene. As a result, the targeted GAME4 gene is silenced or inhibited, thereby reducing glycoalkaloid levels in potato tubers.

[0314] Example 16: Use of mirtrons for modification of starch properties in potato tubers

[0315] Resistant starch (RS), abundant in amylose and long-chain amylopectin molecules, can be altered by inhibiting starch branching enzymes (SBEs). These enzymes typically create branches in starch, altering its structure. Inhibiting SBE activity increases amylose content while reducing branching in amylopectin. This modified starch, with a low glycemic index (GI), offers fewer calories, prolonged satiety, and better blood sugar control compared to regular starch. Undigested RS that reaches the colon becomes a substrate for beneficial gut bacteria, generating short-chain fatty acids (SCFAs). SCFAs play a crucial role in various biological activities, such as supporting pancreatic P-cell function, cell proliferation, and maintaining gut health and communication with the brain.

[0316] In this example, an intron of a tuber specific gene such as ADP glucose pyrophosphorylase or granule-bound starch synthase is modified by any suitable method (such as synthesis or gene editing) into an artificial mirtron in a potato plant. The artificial mirtron includes a guide sequence targeting SBE encoding genes such as the potato SBE1 and SBE2 genes. As a result, the targeted SBE gene is silenced or inhibited, and the resulting tubers are expected to show increases amylose content while reducing branching in amylopectin.

Claims

CLAIMS1. A transgenic plant comprising an integrated host gene capable of being expressed in the plant, wherein the host gene comprises an artificial mirtron capable of silencing a target gene and having a sequence comprising a 5’ donor splice site; a branch point; a polypyrimidine tract; a 3’ acceptor splice site; a guide sequence complementary to a target sequence in the target gene; and a stem and loop structure comprising a stem region having a 5’ strand and a 3’ strand, and a loop region.

2. The transgenic plant of claim 1, wherein the artificial mirtron and / or the host gene are not inhibited or silenced by plant defense systems.

3. The transgenic plant of claim 1 or 2, wherein the artificial mirtron is capable of silencing the target gene for a time period of at least one week.

4. The transgenic plant of any one of claims 1-3, wherein the artificial mirtron is capable of silencing the target gene in all plant tissues.

5. The transgenic plant of any one of claims 1-3, wherein the artificial mirtron is capable of silencing the target gene is specific plant tissues.

6. The transgenic plant of any one of claims 1-5, wherein the artificial mirtron has a length of about 40-200 nu, 50-150 nu, 50-120 nu, 50-100 nu, or 50-90 nu.

7. The transgenic plant of any one of claims 1-6, wherein the distance between the stem and loop structure and the 5’ donor splice site and / or the 3’ acceptor splice site is 5 nu or less.

8. The transgenic plant of claim 7, wherein the artificial mirtron is a conventional mirtron.

9. The transgenic plant of claim 7, wherein the artificial mirtron is a 3 ’-tailed mirtron.

10. The transgenic plant of any one of claims 1-9, wherein the guide sequence has a length of about 5-30 nu.

11. The transgenic plant of any one of claims 1-10, wherein the guide sequence is comprised in the 3’ strand of the stem and loop structure.The transgenic plant of claim 11, wherein the distance between a sequence complementary to the guide sequence at the 5’ strand of the stem and loop structure and the 5’ donor splice site is less than about 10 nu. The transgenic plant of claim 11 or 12, wherein the distance between the 3’ end of the guide sequence and the 3’ splice site is 5 nu or less. The transgenic plant of any one of claims 1-13, wherein there are no intervening nucleotides which form part of the stem region between the guide sequence and the loop region. The transgenic plant of any one of claims 1-14, wherein the guide sequence is at least 80% identical to a reverse-complement sequence of the target sequence. The transgenic plant of any one of claims 1-15, wherein the artificial mirtron sequence is modified from a sequence of an endogenous intron of the host gene at least by incorporating the guide sequence. The transgenic plant of claim 16, wherein the artificial mirtron sequence has about 50-95% identity with the intron sequence. The transgenic plant of any one of claims 1-17, wherein the artificial mirtron is produced by gene editing of the host gene. The transgenic plant of claim 18, wherein the artificial mirtron is produced by gene editing of an endogenous intron of the host gene. The transgenic plant of any one of claims 1-19, wherein the artificial mirtron replaces an endogenous intron of the host gene. The transgenic plant of any one of claims 1-19, wherein the artificial mirtron is inserted into an exon of the host gene. The transgenic plant of any one of claims 21, wherein the artificial mirtron is inserted into the 5’ or the 3’ untranslated region (UTR) of the host gene. The transgenic plant of any one of claims 1-22, wherein the host gene is a gene exogenous to the plant.The transgenic plant of any one of claims 1-22, wherein the host gene is an endogenous gene of the plant. The transgenic plant of claim 24, wherein the host gene is an essential plant gene. The transgenic plant of any one of claims 1-25, wherein the host gene is naturally or synthetically operably linked to a promoter selected from a tissue- specific promoter, a stress- responsive promoter, a developmental stage-specific promoter, a pathogen-specific promoter and a parasite- specific promoter. The transgenic plant of any one of claims 1-26, wherein the host gene has an expression pattern similar to that of the target gene. The transgenic plant of any one of claim 1-27, wherein the host gene is expressed in plant root, seed, leaf, tuber, or meristem. The transgenic plant of any one of claims 1-28, wherein the host gene is a protein-coding gene. The transgenic plant of claim 29, wherein the host gene is selected from Arabidopsis thaliana CEL1 ((Atcell) gene; soy genes including plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, stress-induced PR- 10 protein (SAM-22), tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase-related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl); rice genes including Gs03g01700, Os02g37190, Gs01g0762500, Gs02g0268300, and Gs07g0616800; and potato / tuber genes including endo-P-l,4-glucanases (EGases), St- CEL7, St-CEL9C1, immunoglobulin binding protein (St-BiP3), ADP glucose pyrophosphorylase, and granule-bound starch synthase. The transgenic plant of any one of claims 1-30, wherein the plant is selected from potato, soybean, rice, wheat, tomato, yam, beet, oat, and a sweet potato. The transgenic plant of any one of claims 1-31, wherein the target gene is an endogenous gene of the plant. The transgenic plant of claim 32, wherein the target gene is selected from a plastid-localized polyphenol oxidase (PPG); a gene involved in sugar metabolism, such as vacuolar invertase (VInv) or asparagine synthetase- 1 (StAS 1 and StAS2); a cytochrome P450 encoding gene such as glycoalkaloid metabolism 4 (GAME4); a starch branching enzyme (SBE) encoding genesuch as potato SBE1 or SBE2; and a gene of the rice flavone biosynthesis pathway, such as CYP75B3 or CYP75B4. The transgenic plant of claim 32 or 33, wherein the host gene is an endogenous gene of the plant and the target gene is the host gene. The transgenic plant of any one of claims 1-31, wherein the target gene is not an endogenous plant gene. The transgenic plant of claim 35, wherein the target gene is a gene previously incorporated into the plant. The transgenic plant of claim 35, wherein the target gene is a gene of a pest, pathogen, or parasite. The transgenic plant of claim 37, wherein expression of the host gene is induced by the pest, pathogen, or parasite. The transgenic plant of claim 37 or 38, wherein the pest, pathogen, or parasite is a nematode, fungus, bacterium, virus, or oomycete. The transgenic plant claim 39, wherein the target gene is an essential gene of the nematode and the host gene is a gene induced by the nematode and / or expressed in plant root. The transgenic plant of claim 39 or 40, wherein the nematode is selected from root-knot nematode (RKN), soybean cyst nematode (SCN), and potato cyst nematodes (PCN). The transgenic plant of claim 41, wherein the target gene is selected from the nematode gene 16D10, HgY25, HgPrpl7, Gr-Exp, and chorismate mutase. The transgenic plant of claim 42, wherein the target gene is 16D10 of the root-knot nematodes (RKNs), and the host gene is CEL1. The transgenic plant of claim 42, wherein the target gene is HgY25 or HgPrpl7 of the soybean cyst nematode (SCN), and the host gene is selected from the soybean genes plasma-membrane intrinsic protein type 2, aquaporin, GmPIP2, SAM-22, tonoplast intrinsic protein (GmTIP), alcohol dehydrogenase-related 1 (GmADRl), and bifunctional-transfer protein 1 (GmBTPl).The transgenic plant of claim 42, wherein the target gene is 16D10, Gr-Exp, or chorismate mutase of the potato cyst nematode (PCN), and the host gene is selected from the potato genes endo-P-l,4-glucanases (EGases), St-CEL7, St-CEL9C1, and immunoglobulin binding protein (St-BiP3). The transgenic plant of any one of claims 1-45, wherein the transgenic plant is a complete plant. The transgenic plant of any one of claims 1-45, wherein the transgenic plant is a plant part, a plant tissue, or a plant cell. A nucleic acid molecule comprising an artificial mirtron sequence comprising: a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in a target gene, and a stem and loop structure comprising at least the guide sequence; wherein the artificial mirtron sequence has about 50-95% sequence identity to a sequence of a natural intron of a plant gene, and the mirtron is capable of silencing the target gene. The nucleic acid molecule of claim 48, prepared by modifying a plant intron sequence to a mirtron sequence by incorporating the stem and loop structure comprising the guide sequence. The nucleic acid molecule of claim 48 or 49 for use in silencing or reducing expression of the target gene. A method for generating a transgenic plant for silencing or reducing expression of a target gene, the method comprising modifying a host gene capable of being expressed in the plant by generating an artificial mirtron capable of silencing the target gene in the host gene, wherein the artificial mirtron comprises a sequence comprising a 5’ donor splice site, a branch point, a polypyrimidine tract, a 3’ acceptor splice site, a guide sequence complementary to a target sequence in the target gene, and a stem and loop structure comprising at least the guide sequence; and the host gene is integrated in the plant genome. The method of claim 51, wherein the method further comprises, prior to modifying the host gene, selecting an intron having a length of no more than about 200 bp; and designing the artificial mirtron based on the selected intron. The method of claim 51 or 52, wherein the method further comprises, prior to modifying the host gene, selecting a intron comprising a sequence at least about 40% identical to a reverse-complement sequence of the target sequence within a distance of at most about 50 bp upstream of the 3 ’ splice acceptor site or at most about 10 bp upstream of the branch point; and designing the artificial mirtron based on the selected intron. The method of any one of claims 51-53, wherein the selected intron is an endogenous intron of the host gene. The method of any one of claims 51-54, wherein the selected intron is an endogenous intron of the plant. The method of any one of claims 51-55, wherein generating an artificial mirtron in the host gene is obtained by gene editing such as by prime editing or by a CRISPR / Cas9 system.

Images