Anti-muc-16 antibodies and methods of use thereof

Abstract

Provided herein is an antibody which specifically binds Muc-16 comprising a light chain variable region and a heavy chain variable region, the light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR- H3, wherein the amino acid sequences of said CDRs are SEQ ID NOs: 38-43, respectively, and methods of use thereof.

Description

ANTI-MUC-16 ANTIBODIES AND METHODS OF USE THEREOFRELATED APPLICATIONS

[0001] This Patent Cooperation Treaty application claims the benefit of priority of United States Provisional Application no. 63 / 431 ,784 filed on December 12, 2022, which is incorporated herein in its entirety.FIELD

[0002] The present disclosure relates to the development of antibodies to Muc-16 and the use of these antibodies for radio-imaging and (radio)therapy of Muc-16-expressing cancers such as ovarian and pancreatic cancers.BACKGROUND

[0003] Ovarian and pancreatic cancers are among the cancers with highest mortality rates. The current standard of care for epithelial ovarian cancer (EOC) is surgery and platinumbased chemotherapy [1], However, nearly 85% of patients relapse with poor prognosis and develop resistance to further chemotherapy[2]. Pancreatic ductal adenocarcinoma (PDAC) has a 5-year survival rate of less than 5%, and a 1 -year survival of just under 25%[3], Surgical resection followed by chemotherapy or radiotherapy improves overall survival (OS)[4], However, most patients are diagnosed with advanced disease with very poor outcomes. Therefore, there is an urgent need for effective therapeutics and diagnostics for early detection of both ovarian and pancreatic cancers.

[0004] Aberrant overexpression of cell-surface receptors in cancer cells can be targeted by monoclonal antibody drugs. In addition, these antibodies can be used as a carrier to deliver contrast agents (for imaging) and / or cytotoxic payloads (for therapy) directly to the site of tumours. There is immense interest in developing antibody-based radiopharmaceuticals using a “theranostics” approach where the same molecule can both be used for non-invasive imaging and targeted therapy. In this study, we seek to develop radiopharmaceuticals targeting overexpression of biomarker, MUC-16 (CA125) that is commonly overexpressed in -80% of EOC and -65% of PDAC.

[0005] MUC-16 belongs to the mucin family of proteins. Mucins are high-molecular weight glycoproteins (>106Da) that are typically expressed on the apical surface of epithelial cells to serve as a protective barrier against stress and infection [5, 6], Some members of the family, such as MUC-16 and MUC-4, are membrane-anchored with short cytoplasmic tails thereby modulating signaling cascades in addition to their barrier functions [7], Epithelial cancers are known tooverexpress aberrant forms of mucins that promote survival, metastasis and immune evasion [8], Elevation of CA125 / MUC-16 in serum is detected in -80% of epithelial ovarian cancers. It is a well-known biomarker for monitoring progression and regression of disease [9, 10], MllC-16 is a frequently mutated gene

[0011] and is associated with increased growth and metastasis [12-13], The interaction of MllC-16 with mesothelin leads to peritoneal metastasis of ovarian cancer cells by facilitating attachment of cancer cells to the mesothelial lining [12, 14], Overexpression of MllC-16 correlates with worse prognosis in EOC [14-17], MllC-16 is not expressed in normal pancreatic ducts but is highly expressed in PDAC and associated metastatic lesions

[0018] , MLIC16 is overexpressed in 80% of epithelial ovarian cancer (EOC) and 65% of pancreatic ductal adenocarcinomas (PDAC), where effective ‘theranostic’ probes are much needed.

[0006] Serum level of CA125 is the most extensively used biomarker for EOC. However, the sensitivity and specificity of detection is 67.39% and 86.79%, respectively

[0031] , A CA125 serum concentration of >= 35 U / rnL is suggestive of potential malignancies / recurrence, with a 47% elevation in EOC early stage and an 80-90% elevations in advanced-stage

[0032] , However, many benign conditions also have high levels of serum CA125

[0033] .. Non-invasive molecular imaging using positron emission tomography (PET) offers many obvious advantages over ex vivo methods such as immunohistochemistry (IHC) or serum CA125 levels [34, 35], Moreover, immunoPET targeting CA125 expression is useful in PDAC where serum CA125 levels are not currently used for diagnosing pancreatic cancer.

[0007] Several MllC-16 antibodies of murine origin have been generated previously and some of these antibodies have been humanized for development as antibody drug conjugates (ADCs) or as immuno-PET imaging probes [19-23], Sharma et. al.

[0024] reported the development of89Zr-labeled PET probe using a murine antibody B43.13 (oregovomab), while Olson et al

[0025] reported the evaluation of a murine antibody AR9.6 labeled with IRDye800CW for image-guided surgery. There are no literature reports of a fully human anti-MUC-16 antibody imaging probe.

[0008] For cancer therapy, unlike humanized antibodies, fully human antibodies are the most desirable format for clinical applications as they do not contain any murine sequences and therefore eliminate the concerns for immunogenicity

[0036]

[0009] Antibodies that recognize cancer biomarkers that can be used as vehicle to deliver contrast agents (imaging) or cytotoxic payloads (therapy) to site of tumours and effective non- invasive imaging probes of ovarian and pancreatic cancers that can be used in the development of theranostic radiopharmaceuticals are desirable.SUMMARY

[0010] Provided herein are fully human monoclonal anti-MUC-16 antibodies that can be used for PET imaging and targeted radioimmunotherapy of MLIC16 expressing cancers.

[0011] Accordingly, an aspect of the disclosure includes an antibody which specifically binds Muc-16 comprising a light chain variable region and a heavy chain variable region, the light chain variable region comprising complementarity determining regions CDR-L1 , CDR-L2, and CDR-L3, and the heavy chain variable region comprising complementarity determining regions CDR-H1 , CDR-H2, and CDR-H3, wherein the amino acid sequences of said CDRs, as identified using IMGT numbering, are:CDR-L1 QSISSY (SEQ ID NO: 38);CDR-L2 AA (SEQ ID NO: 39);CDR-L3 QQSYSTQYT (SEQ ID NO: 40);CDR-H1 GFX1FX2X3YG (SEQ ID NO: 41);CDR-H2 X4ISYDGX5X6KX7 (SEQ ID NO: 42); andCDR-H3 AKDX8YX9DX10AX11 (SEQ ID NO: 43), wherein, Xi is an amino acid selected from T, N, A, I, or S;X2 is an amino acid selected from S, G, R, or Q;X3 is an amino acid selected from T or I;X4 is an amino acid selected from V or A;X5 is an amino acid selected from S or G;Xe is an amino acid selected from N, E, or I;X7 is an amino acid selected from Y, Q, or H;Xs is an amino acid selected from V, I, L, or M;X9 is an amino acid selected from G or D;X is an amino acid selected from F, L, or Y; and / orX11 is an amino acid selected from V, I, or L.

[0012] Another aspect of the disclosure includes a nucleic acid molecule encoding an antibody described herein.

[0013] Accordingly, an aspect includes an expression cassette or a vector, optionally an expression vector, comprising a nucleic acid molecule encoding an antibody described herein.

[0014] Another aspect of the disclosure includes a recombinant cell comprising a nucleic acid molecule described herein, an expression cassette or vector described herein, or expressing an antibody described herein.

[0015] Another aspect of the disclosure includes an immunoconjugate comprising an antibody described herein and a therapeutic agent, and / or detectable label.

[0016] Another aspect of the disclosure includes a composition comprising an antibody described herein, a nucleic acid molecule described herein, a vector described herein, a cell described herein, or the immunoconjugate described herein, and a diluent or pharmaceutically acceptable carrier.

[0017] Another aspect of the disclosure includes a method for detecting Muc-16 expression in a biological sample, the method comprising a) obtaining a biological sample suspected of containing Muc-16, b) contacting the sample with an antibody described herein or an immunoconjugate described herein under conditions permissive for forming an antibody:Muc- 16 complex, and c) detecting the presence of any complex, wherein the presence of detectable complex is indicative that the sample expresses Muc-16.

[0018] Another aspect of the disclosure includes a method of detecting whether a subject has a Muc-16 expressing cancer, the method comprising obtaining a biological sample suspected of containing a Muc-16-expressing cancer cell, the biological sample having been obtained from the subject, contacting the sample with an antibody described herein or the immunoconjugate described herein under conditions permissive for forming an antibody:Muc-16 complex, and detecting the presence of an antibody complex, wherein the presence of an antibody complex indicates that the subject has an Muc-16-expressing cancer, optionally the Muc-16 -expressing cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer.

[0019] Another aspect of the disclosure includes a method for imaging a Muc-16- expressing tumor in a subject, the method comprising administering an antibody described herein, an immunoconjugate described herein, or a composition described herein to the subject, and detecting the presence of the label.

[0020] Another aspect of the disclosure includes a method of determining if a subject has an Muc-16-expressing tumor, the method comprising administering an immunoconjugate described herein, or a composition described herein to the subject, and detecting the presence of the label by imaging, optionally the subject has or is suspected of having an Muc-16-expressing cancer, optionally the Muc-16-expressing cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the subject is a human.

[0021] Another aspect of the disclosure includes a method of treating a cancer, optionally the cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer, in a subject in need thereof, the method comprising administering an effective amount of an antibody described herein, an immunoconjugate described herein, or a composition described herein, to the subject. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the subject is a human. In some embodiments, the composition comprises an immunoconjugate described herein.BRIEF DESCRIPTION OF DRAWINGS

[0022] An embodiment of the present disclosure will now be described in relation to the drawings in which:

[0023] Figs. 1A-C. In vitro flow cytometry binding assay results of M16Ab1 antibody binding on live cells. Different concentrations of M16Ab1 were incubated with (A) MllC-16 expressing SW1990 cells, (B) MLIC16 expressing OVCAR3 cells and (C) MllC-16 negativeSK0V3 cells. Dose dependent binding was observed in both MllC-16 expressing cells (A and B) and not in (C) SKOV3 negative control cell line. Data was analyzed by CytExpert software.

[0024] Fig. 2A-D. In vitro flow cytometry binding assay. MllC-16 expressing OVCAR3 and SW1990 cells were titrated with decreasing concentrations of DFO- M16Ab1 and analyzed by flow cytometry.

[0025] Fig. 3. Internalization of MLIC16 antibody: MLIC16 positive OVCAR3 and MLIC16 negative SKOV3 cells were treated with IncuCyte FabFluor-labeled M16Ab1 antibody (4 pg / mL); HD phase and red fluorescence images (10*) were captured every 2 h for 48 h. All data are shown as a mean of three wells ±SEM.

[0026] Fig. 4. Pharmacokinetics evaluation of89Zr-DFO-M16Ab1 in normal CD-1 nude mice.89Zr-DFO-MUC16 Ab showed a bi-phasic half-life with (distribution) half-life ti / 2a of 4.42h and a slow clearance ti / 2p of 99h. The volume of distribution of the central compartment (V1) was 2.9 mL (116 mL / kg) and the volume of distribution at steady state (Vss) was 7.69 mL (307 mL / kg). The V1 and Vss volumes were 8.1 L and 21.4 L respectively, in a 70 kg standard adult female. The systemic clearance (CLs) was 0.058 mL / h (2.3 mL / h / kg). The CLs values in mice would correspond to 161 mL / h in a 70 kg adult female.

[0027] Figs. 5A-E Biodistribution of89Zr-DFO-M16Ab1 in MUC16-positive SW1990, OVCAR3, and negative control SKOV3 xenografts at 24h and 120h post injection. (A&B) NOD- SCID mice bearing xenografts were injected intravenously with 10 MBq 20 pg of89Zr-DFO- M16Ab1 followed by biodistribution studies. (C) Uptake in SW1990 and OVCAR3 tumors was significantly higher than in negative control SKOV3 at 24h (* p <0.0001) and 120 h (** p < 0.0008) post injection. (D) CD-1 nude mice bearing MUC16 expressing SW1990 xenografts were injected intravenously with 10 MBq 20 pg of89Zr-DFO-M16Ab1 followed by biodistribution studies. (E) Liver uptake in in NOD-SCID mice was significantly higher than in CD-1 nude mice at 24h (* p <0.01) and 120h (** p < 0.01) post injection.

[0028] Figs. 6A-C. PET / CT imaging and image analyses in mice xenografts. (A) Maximum intensity projection (MIP) PET / CT images of a representative NOD-SCID mouse bearing MUC16-positive SW1990 and OVCAR3, (B) Maximum intensity projection (MIP) PET / CT images of mouse bearing negative control SKOV3 xenografts at different time points post89Zr- DFO-MUC16 injection. SW1990 and OVCAR3 xenografts are in the same mouse on the eft and right thigh of the hind leg, respectively. (C) Maximum intensity projection (MIP) PET / CT imagesof a representative CD-1 nude mouse bearing MUC16-positive SW1990 xenografts on the right flank at different time points post89Zr-DFO-MUC16 injection.

[0029] Fig. 7: SEA11-12 domain of MLIC16 cloned into pMUFV-01-Fc a custom lentiviral vector

[0030] Fig. 8: Clone ELISA illustrating binding specificity of M16-Fab tested with SEA 11- 12 domain recombinant protein and Fc protein as negative control. All 48 clones displayed the same signal and were the same sequence.

[0031] Figs. 9A-C: Bioanalyzer ladder (A) and chromatograms (B) of ladder, MLIC16 A1 and DFO-MUC16 Ab 1. (C) Representative size exclusion (SEC) HPLC chromatograms showing stability of MUC16 AB, DFO-MUC16 AB1 and89Zr-DFO-MUC16 Ab 1. UV channel (280) and radiometric channels are shown.

[0032] Fig. 10: Stability studies of89Zr-DFO-MUC16 Ab1 at room in human plasma and PBS at 37°C.

[0033] Fig. 11 : Single-point competitive ELISA for isolated clones.

[0034] Fig. 12: Summary of mutations observed in MUC16Ab1 variants (SEQ ID Nos 41-43). Mutated positions are highlighted in gray.DETAILED DESCRIPTIONI. Definitions

[0035] As used herein, the following terms may have meanings ascribed to them below, unless specified otherwise. However, it should be understood that other meanings that are known or understood by those having ordinary skill in the art are also possible, and within the scope of the present disclosure. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0036] Unless otherwise defined, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. For example, the term "a cell" includes a single cell as well as a plurality or population of cells. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligonucleotide or polynucleotide chemistry and hybridization described herein are those well-known and commonly used in the art (see, e.g., Green, M. and Sambrook, J. (2012) Molecular Cloning: A Laboratory Manual. 4th Edition, Vol. II, Cold Spring Harbor Laboratory Press, New York.).

[0037] Thus, for example, a composition containing “a compound” includes a mixture of two or more compounds. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise.

[0038] As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise. Thus, for example, a composition containing “a compound” includes a mixture of two or more compounds. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise.

[0039] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the description. Ranges from any lower limit to any upper limit are contemplated. The upper and lower limits of these smaller ranges which may independently be included in the smaller ranges is also encompassed within the description, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the description.

[0040] As used in this application and claim(s), the word “consisting” and its derivatives, are intended to be close ended terms that specify the presence of stated features, elements, components, groups, integers, and / or steps, and also exclude the presence of other unstated features, elements, components, groups, integers and / or steps.

[0041] In understanding the scope of the present disclosure, the term "comprising" and its derivatives, (such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "include" and "includes") or "containing" (and any form of containing, such as "contain" and "contains"), as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and / or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The foregoing also applies to words having similar meanings such as the terms, "including", "having" and their derivatives.

[0042] The terms "about", “substantially” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% or at least ±10% of the modified term if this deviation would not negate the meaning of the word it modifies.

[0043] The phrase "and / or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and / or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related or unrelated to those elements specifically identified.

[0044] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of" or, when used in the claims, "consisting of" will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

[0045] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from anyone or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified.

[0046] It should also be understood that, in certain methods described herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited unless the context indicates otherwise.

[0047] The term “complementarity determining region” or “CDR” as used herein refers to particular hypervariable regions of antibodies that are commonly presumed to contribute to epitope binding. Computational methods for identifying CDR sequences include Kabat, Chothia, Martin, AHo and IMGT. The CDRs listed in the present disclosure are identified using the Kabat definition and the IMGT definition, as indicated. A person skilled in the art having regard to the sequences comprised herein would also be able to identify CDR sequences based on IMGT, Kabat, and Chothia etc

[0043] , Such antibodies are similarly encompassed.

[0048] The term "antibody" as used herein is intended to encompass for example monoclonal antibodies, polyclonal antibodies, fully human antibodies humanized and other chimeric antibodies, and binding fragments thereof, including for example a single chain Fab fragment, Fab’2 fragment, or single chain Fv fragment. The antibody may be from recombinant sources and / or produced in transgenic animals. Also included are human antibodies that can be produced in transgenic animals or using biochemical techniques, or can be isolated from a library such as a phage display library. Antibody backbones may comprise any suitable variable heavy chain or variable light chain sequences. Antibodies, including humanized and / or other chimeric antibodies may include sequences from one or more than one isotype, class, or species. Antibodies may be any class of immunoglobulins including: IgG, IgM, IgD, IgA, or IgE; and any isotype thereof, including lgG1 , lgG2 (e.g. lgG2a, lgG2b), lgG3 and lgG4. Further, these antibodies can be produced as antigen binding fragments such as Fab, Fab' F(ab')2, Fd, Fv and single domain antibody fragments, or as single chain antibodies in which the heavy and light chains are linked by a spacer.

[0049] The phrase "isolated antibody" refers to antibody produced in vivo or in vitro that has been removed from the source that produced the antibody, for example, an animal, hybridoma or other cell line (such as recombinant insect, yeast or bacteria cells that produce antibody). The isolated antibody is optionally "purified", which means at least: 80%, 85%, 90%, 95%, 98% or 99% purity.

[0050] The term "binding fragment" as used herein to a part or portion of an antibody or antibody chain comprising fewer amino acid residues than an intact or complete antibody or antibody chain and which binds the antigen or competes with intact antibody. Exemplary binding fragments include without limitations Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof. Fragments can be obtained via chemical or enzymatic treatment of an intact or complete antibody or antibody chain. Fragments can also be obtained by recombinant means. For example, F(ab')2 fragments can be generated by treatingthe antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be constructed by recombinant expression techniques.

[0051] The term “cell” as used herein refers to a single cell or a plurality of cells.

[0052] A "conservative amino acid substitution" as used herein, is one in which one amino acid residue is replaced with another amino acid residue without abolishing the protein's desired properties. Suitable conservative amino acid substitutions can be made by substituting amino acids with similar hydrophobicity, polarity, and R-chain length for one another. Examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as alanine, isoleucine, valine, leucine or methionine for another, the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of one basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another. The phrase “conservative substitution” also includes the use of a chemically derivatized residue or non-natural amino acid in place of a non-derivatized residue provided that such polypeptide displays the requisite activity.

[0053] As used herein, the terms “peptide,” “polypeptide,” and “protein” refer to any chain of two or more natural or unnatural amino acid residues, regardless of post-translational modifications (e.g., glycosylation or phosphorylation). Included are proteins that are a single polypeptide chain and multisubunit proteins (e.g. composed of 2 or more polypeptides).

[0054] The term "sequence identity" as used herein refers to the percentage of sequence identity between two amino acid sequences or two nucleic acid sequences. To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g. gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e. , % identity = [number of identical overlapping positions] I [total number of positions] X 100%). The determination of percent identity between two sequences can also be accomplished using amathematical algorithm. One non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBI_AST programs of Altschul et al., 1990. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g. for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present disclosure. BLAST protein searches can be performed with the XBLAST program parameters set, e.g. to score-50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule of the present disclosure. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g. of XBLAST and NBLAST) can be used (see, e.g. the NCBI website). Another nonlimiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0055] For antibodies, percentage sequence identities can be determined when antibody sequences are maximally aligned by Kabat, IMGT, or other numbering conventions. The terms “Kabat numbering”, ”IMGT numbering”, etc., which are recognized in the art, refer to systems of numbering amino acid residues which are more variable (i.e. hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody, or antigen binding portion thereof. After alignment, if a subject antibody region (e.g., the entire mature variable region of a heavy or light chain) is being compared with the same region of a reference antibody, the percentage sequence identity between the subject and reference antibody regions is the number of positions occupied by the same amino acid in both the subject and reference antibody region divided by the total number of aligned positions of the two regions, with gaps not counted, multiplied by 100 to convert to percentage. Accordingly, Kabat, IMGT, and other alignment systems can also be used to identify or annotate CDRs in an antibody sequence.

[0056] The term "nucleic acid” or “nucleic acid molecule", as used herein, are intended to include unmodified DNA or RNA or modified DNA or RNA. The nucleic acid molecules of the disclosure may contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. Unless otherwise indicated, standard IUPAC-IUB nomenclature is used herein. "Modified" bases include, for example, tritiated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus "nucleic acid molecule" embraces chemically, enzymatically, or metabolically modified forms. The term "polynucleotide" shall have a corresponding meaning. The nucleic acid can be either double stranded or single stranded, and represents the sense or antisense strand. Further, the term "nucleic acid molecule" includes the complementary nucleic acid sequences as well as codon optimized or synonymous codon equivalents. The term "isolated nucleic acid molecules" as used herein refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized.

[0057] The term "vector" as used herein comprises any intermediary vehicle for a nucleic acid molecule which enables said nucleic acid molecule, for example, to be introduced into prokaryotic and / or eukaryotic cells and / or integrated into a genome, and include plasmids, phagemids, bacteriophages or viral vectors such as retroviral based vectors, Adeno Associated viral vectors and the like. The term "plasmid" as used herein generally refers to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA.

[0058] The term “pharmaceutically acceptable” means compatible with the treatment of animals, in particular, humans.

[0059] The term “treating” or “treatment” as used herein and as is well understood in the art, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, inhibiting spread or progression of disease, delay or slowing of disease progression or onset, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable. “Treating” and “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0060] As used herein, the term “cancer” refers to one of a group of diseases caused by the uncontrolled, abnormal growth of cells that can spread to adjoining tissues or other parts ofthe body. Cancer cells can form a solid tumor, in which the cancer cells are massed together, or exist as dispersed cells. Cancer may include ovarian and pancreatic cancers, among others.

[0061] The term “cancer cell” refers to a cell characterized by uncontrolled, abnormal growth and the ability to invade another tissue or a cell derived from such a cell. Cancer cells include, for example, a primary cancer cell obtained from a patient with cancer or cell line derived from such a cell. In one embodiment, the cancer cell is an ovarian cancer cell or a pancreatic cancer cell.

[0062] The term "administered" as used herein means administration of a therapeutically effective dose of an antibody, immunoconjugate, or composition of the disclosure to a cell or subject.

[0063] As used herein, the phrase "effective amount" or "therapeutically effective amount" means an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example in the context of treating cancer, an effective amount is an amount that for example induces remission, reduces tumor burden, and / or prevents tumor spread or growth of cancer cells compared to the response obtained without administration of the compound. Effective amounts may vary according to factors such as the disease state, age, sex and weight of the subject. The amount of a given compound that will correspond to such an amount will vary depending upon various factors, such as the given antibody or immunoconjugate, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject or host being treated, and the like, but can nevertheless be routinely determined by one skilled in the art.

[0064] The term "subject" as used herein includes all members of the animal kingdom including mammals, and suitably refers to humans. Optionally, the term “subject” includes mammals that have been diagnosed with cancer, such as ovarian cancer or pancreatic cancer, or are in remission. In one embodiment, the term “subject” refers to a human having, or suspected of having, cancer such as ovarian cancer or pancreatic cancer.

[0065] The definitions and embodiments described in particular sections are intended to be applicable to other embodiments herein described for which they are suitable as would be understood by a person skilled in the art.

[0066] The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range (e.g., 1 to 5 includes 1 , 1.5, 2, 2.75, 3, 3.90, 4, and 5). It isalso to be understood that all numbers and fractions thereof are presumed to be modified by the term "about".II. Antibodies, Recombinant Proteins, Nucleic Acids, Immunoconjugates and Cells

[0067] An aspect of the disclosure includes an antibody which specifically binds Muc-16 comprising a light chain variable region and a heavy chain variable region, the light chain variable region comprising complementarity determining regions CDR-L1 , CDR-L2, and CDR-L3, and the heavy chain variable region comprising complementarity determining regions CDR-H1 , CDR-H2, and CDR-H3, wherein the amino acid sequences of said CDRs, as identified using IMGT numbering, are:CDR-L1 QSISSY (SEQ ID NO: 38);CDR-L2 AA (SEQ ID NO: 39);CDR-L3 QQSYSTQYT (SEQ ID NO: 40);CDR-H1 GFX1FX2X3YG (SEQ ID NO: 41);CDR-H2 X4ISYDGX5X6KX7 (SEQ ID NO: 42); andCDR-H3 AKDX8YX9DX10AX11 (SEQ ID NO: 43), wherein, Xi is an amino acid selected from T, N, A, I, or S;X2 is an amino acid selected from S, G, R, or Q;X3 is an amino acid selected from T or I;X4 is an amino acid selected from V or A;X5 is an amino acid selected from S or G;Xe is an amino acid selected from N, E, or I;X7 is an amino acid selected from Y, Q, or H;Xs is an amino acid selected from V, I, L, or M;X9 is an amino acid selected from G or D;X is an amino acid selected from F, L, or Y; and / orX11 is an amino acid selected from V, I, or L.

[0068] In some embodiments, the amino acid sequences of the CDRs are amino acid sequences with at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% sequence identity to SEQ ID NOs: 38-43.

[0069] In some embodiments, one or more of Xi to Xn is / are any amino acid.

[0070] In some embodiments, one or more of the amino acid sequences of the CDRs comprise at least one, at least two, at least three, or at least four amino acid substitutions. In some embodiments, one or more of the amino acid sequences of the CDRs comprise one, two, three, or four amino acid substitutions. In some embodiments, one or more of the amino acid sequences of the CDRs comprise one amino acid substitution. In some embodiments, one or more of the amino acid sequences of the CDRs comprise two amino acid substitutions. In some embodiments, one or more of the amino acid sequences of the CDRs comprise three amino acid substitutions. In some embodiments, one or more of the amino acid sequences of the CDRs comprise four amino acid substitutions.

[0071] In some embodiments, CDRH1 comprises the amino acid sequence GFTFSTYG (SEQ ID NO: 44). In some embodiments, CDRH2 comprises the amino acid sequence VISYDGSNKY (SEQ ID NO: 45). In some embodiments, the CDRH3 comprises the amino acid sequence AKDVYGDFAV (SEQ ID NO: 46).

[0072] In some embodiments, the Xi amino acid is T. In some embodiments, the Xi amino acid is N. In some embodiments, the Xi amino acid is A. In some embodiments, the Xi amino acid is I. In some embodiments, the Xi amino acid is S.

[0073] In some embodiments, the X2 amino acid is S. In some embodiments, the X2 amino acid is G. In some embodiments, the X2 amino acid is R. In some embodiments, the X2 amino acid is Q.

[0074] In some embodiments, the X3 amino acid is T. In some embodiments, the X3 amino acid is I.

[0075] In some embodiments, the X4amino acid is V. In some embodiments, the X4 amino acid is A.

[0076] In some embodiments, the Xsamino acid is S. In some embodiments, the X4 amino acid is G.

[0077] In some embodiments, the Xe amino acid is N. In some embodiments, the Xeamino acid is E. In some embodiments, the Xe amino acid is I.

[0078] In some embodiments, the X?amino acid is Y. In some embodiments, the X? amino acid is Q. In some embodiments, the X? amino acid is H.

[0079] In some embodiments, the Xsamino acid is V. In some embodiments, the Xs amino acid is I. In some embodiments, the Xs amino acid is L. In some embodiments, the Xs amino acid is M.

[0080] In some embodiments, the X9 amino acid is G. In some embodiments, the Xgamino acid is D.

[0081] In some embodiments, the X10 amino acid is F. In some embodiments, the X10 amino acid is L. In some embodiments, the X10 amino acid is Y.

[0082] In some embodiments, the Xn amino acid is V. In some embodiments, the Xn amino acid is I. In some embodiments, the Xn amino acid is L.

[0083] In some embodiments, the light chain variable region comprises i) a polypeptide having an amino acid sequence of SEQ ID NO: 7; ii) a polypeptide having an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to SEQ ID NO: 7, wherein the CDR sequences are as set forth in SEQ ID NOs: 38-43; or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NOs:38-43.

[0084] In some embodiments, the heavy chain variable region comprises i) a polypeptide having an amino acid sequence of SEQ ID NOs: 8 or 16-37; ii) a polypeptide having an amino acid sequence with at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NOs: 8 or 16-37, wherein the CDR sequences are as set forth in SEQ ID NOs: 41-43; or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NOs: 41-43.

[0085] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 8 or 16-37.

[0086] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 29-31 .

[0087] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 8.

[0088] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 16.

[0089] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 17.

[0090] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 18.

[0091] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 19.

[0092] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 20.

[0093] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 21.

[0094] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 22.

[0095] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 23.

[0096] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 24.

[0097] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 25.

[0098] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 26.

[0099] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 27.

[0100] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 28.

[0101] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 29.

[0102] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 30.

[0103] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 31.

[0104] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 32.

[0105] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 33.

[0106] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 34.

[0107] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 35.

[0108] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 36.

[0109] In some embodiments, the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 37.

[0110] In some embodiments, the antibody is a humanized or a human antibody. In some embodiments, the antibody is a fully human antibody. In some embodiments, the antibody is a single chain antibody. In some embodiments, the antibody is an antibody fragment selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof. In some embodiments, the antibody is an IgG. In some embodiments, the antibody is a lgG1.

[0111] Another aspect of the disclosure includes a nucleic acid molecule or molecules encoding an antibody described herein, a light chain variable region, a heavy chain variable region or both a light chain and heavy chain variable region. The nucleic acid molecule(s) may be comprised in a vector. The nucleic acid molecule may for example be incorporated into an expression cassette or expression vector for expression of the antibody. Accordingly, an aspect includes an expression cassette or a vector, optionally an expression vector, comprising a nucleic acid molecule encoding an antibody described herein. Suitable expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adenoviruses and adeno-associated viruses). In an embodiment the expression vector is a plasmid, such as a mammalian expression plasmid.

[0112] Another aspect of the disclosure includes a recombinant cell comprising a nucleic acid molecule described herein, an expression cassette or vector described herein, or expressingan antibody described herein. The recombinant cell can be prepared by introducing the nucleic acid molecule, expression cassette, vector, optionally expression vector, into a suitable host cell. Preferably, the host cell is suitable for antibody expression or for producing large quantities of the expression cassette or the vector. As would be known to the skilled artisan, a vector compatible with the particular host cell is used.

[0113] The recombinant cell can be generated using any host cell suitable for producing a polypeptide, for example suitable for producing an antibody and / or binding fragment thereof. For example, to introduce a nucleic acid and / or a vector into a cell, the host cell may be transfected, transformed or infected, depending upon the vector employed. Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the antibodies described herein may be expressed in bacterial cells such as E. coli, insect cells (using baculovirus), yeast cells or mammalian cells, such as CHO cells, optionally Horizon Discovery CHO-K1 (HD-BIOP3) derived production cell lines.

[0114] The antibodies described herein may be provided as immunoconjugates. Accordingly, another aspect of the disclosure includes an immunoconjugate comprising an antibody described herein and a therapeutic agent, and / or detectable label. Suitable reagents can be identified by the skilled person depending on the application. In the context of radioimmunotherapy (RIT), the therapeutic agent may be a radionuclide, for example an alpha- or beta-emitting radionuclide or Auger electron emitting radionuclide. Other therapeutic agents are contemplated for use for example as chemotherapeutic agents. Radionuclides may also be suitable labels in the context of in vivo imaging or diagnostic imaging, including for example positron emission tomography (PET), scintigraphic imaging or SPECT, and other imaging techniques. The label can also be a fluorescence molecule which when conjugated to the antibody can be used for surgical removal of a solid tumor that expresses Muc16. Examples of such fluorescence molecules include IRDye 800CW or IRDye 700dx. An antibody conjugated with IRDye 700dx can also be used for both surgical removal and treatment - photoimmunotherapy following selective tumor accumulation and laser irradiation. The choice of the particular radioisotope with which the antibody is labeled could depend on the size of the tumor to be treated and its localization in the body. Important characteristics to consider in the choice of the radioisotope are - emission range in the tissue, the energy of the emission, the emission characteristics (e.g. particular or non-particular emissions, Auger, beta or alpha or a mixture of these) and the half-life. Alpha emitters, which have a short emission range in comparison to beta emitters, may be preferable for treatment of small tumors or tumors that are disseminated in thebody. Examples of alpha emitters include 213-Bismuth (half-life 46 minutes), 223-Radium (halflife 11.3 days), 224-Radium (half-life 3.7 days), 225-Radium (half-life 14.8 days), 225-Actinium (half-life 9.9 days), 212-Lead (half-life 10.6 hours), 212-Bismuth (half-life 60 minutes), 211-Astatin (half-life 7.2 hours), and 255-Fermium (half-life 20 hours), 149-Terbium (half-life 4.12 hours), 227- Thorium (half-life 18.7 days), 212-Lead (half-life 10.6 hours).

[0115] Beta emitters, with their longer emission range, may be preferable for the treatment of a large tumor(s) e.g. greater than 2mm in diameter. Examples of beta emitters include 188- Rhenium (half-life 16.7 hours), 90-Yttrium (half-life 2.7 days), 32-Phosphorous (half-life 14.3 days), 47-Scandium (half-life 3.4 days), 67-Copper (half-life 62 hours), 64-Copper (half-life 13 hours), 77-Arsenic (half-life 38.8 hours), 89-Strontium (half-life 51 days), 105-Rhodium (half-life 35 hours), 109-Palladium (half-life 13 hours), 111-Silver (half-life 7.5 days), 131-lodine (half-life 8 days), 177-Lutetium (half-life 6.7 days), 153-Samarium (half-life 46.7 hours), 159-Gadolinium (half-life 18.6 hours), 186-Rhenium (half-life 3.7 days), 166-Holmium (half-life 26.8 hours), 166- Dysprosium (half-life 81.6 hours), 140-Lantanum (half-life 40.3 hours), 194-lrridium (half-life 19 hours), 198-Gold (half-life 2.7 days), and 199-Gold (half-life 3.1 days), 161-Terbium (half-life 6.89 days). The majority of the beta-emitting radioisotopes that are used for radioimmunotherapy can also be used simultaneously for radioimmunoimaging with conventional nuclear medicine equipment such as scintigraphic imaging or SPECT.

[0116] Auger electron emitters similar to alpha particles may be used for small volume disease such as metastatic lesions. Examples include 161-Terbium (half-life 6.89 days), 111- Indium (half-life 2.8 days), 67-Gallium (half-life 78.3 hours), 99m-Technetium (half-life 6.2 hours), 125-lodine (half-life 60 days) and 123-lodine (half-life 13.2 hours).

[0117] In some embodiments, the detectable label and / or therapeutic agent is a radionuclide, optionally an alpha- beta- or gamma-emitting radionuclide.

[0118] In an embodiment, the immunoconjugate has a specific activity of about 0.5 MBq / 1 ug.

[0119] In an embodiment, the immunoconjugate is an imaging probe, for example a nuclear imaging probe. In some embodiments, the isotope, e.g. PET isotope, selected has a long physical half-life, such as89Zr, that for example correspond to the antibody pharmacokinetics distribution probe.

[0120] In some embodiments, the antibody is labeled with the radionuclide using a bifunctional chelator. The chelator is optionally a desferrioxamine (DFO), NOTA (2,2',2”-(1 ,4,7-triazacyclononane-1 ,4,7-triyl)triacetic acid), DOTA (1 ,4,7,10-Tetraazacyclododecane-1 ,4,7,10- tetraacetic acid), NODAGA (1 ,4,7-triazacyclononane,1-glutaric acid-4, 7-acetic acid), TETA (T riethylenetetramine), TCMC (1 ,4,7, 10-tetraaza-1 ,4,7, 10-tetra(2- carbamoylmethyl)cyclododecane), DTPA (diethylenetriamine pentaacetic acid), macropa, NETA (4-[2-(bis-carboxymethyl-amino)-ethyl]-7-carboxymethyl-[1], [4], [7]triazonan-1-yl}-acetic acid), 3p-C-NETA (4-[2-(bis-carboxy-methylamino)-5-(4-nitrophenyl)-entyl]-7-carboxymethyl-[1 ,4,7]tri- azonan-1-yl} acetic acid), 3p-C-DEPA (2-[(carboxymethyl)][5-(4-nitrophenyl-1-[4,7,10- tris(carboxymethyl)-1 ,4,7,10-tetraazacyclododecan-1-yl]pentan-2-yl)amino]acetic acid), DEPA (7-[2-(bis-carboxymethyl-amino)-ethyl]-4, 10-bis-carboxymethyl-1 , 4,7,10-tetraazacyclododec-1- yl-acetic acid), or HBED (N,N'-Di(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid monohydrochloride) chelator. In an embodiment, the chelator is a DFO chelator.

[0121] In some embodiment, the chelator-antibody ratio (CAR) is 10-20: 1 , optionally about 15:1.

[0122] In some embodiments, the radionuclide is selected from Fluorine-18 (half-life 109.8 min), copper-64 (half-life 12.7h), In-111 (half-life 2.8 days), terbium-152 (half-life 17.5 hours), terbium-156 (half-life 5.3 days), iodine-124, gallium-68 (half-life 68 min), gallium-67 (half-life 78.3 hours), and zirconium-89 (half-life 78.4 h). In some embodiments, the radionuclide is zirconium- 89.

[0123] In another embodiment the MllC-16 antibody is conjugated to a cytotoxin to form an antibody drug conjugate (ADC) to treat cancer cells in vitro and vivo. In some embodiments, the cytotoxin is selected from the group comprising or consisting of maytansine and derivatives thereof (maytansinoids), auristatins, calicheamicins, duocarmycins, doxorubicin, anthracyclines, amanitins and camptothecins. In some embodiments, the antibody drug conjugate comprises a plurality of cytotoxins conjugated to the antibody, preferably 4 - 8 cytotoxins.

[0124] In another embodiment the MllC-16 antibody drug conjugate (ADC) is further conjugated to a therapeutic payload and / or an imaging isotope such as an alpha emitter, an auger electron emitter, and / or a beta-emitting isotope to treat cancer cells in vitro and vivo. Therapeutic payloads can be of different classes. For example, therapeutic payloads include chemotherapeutic drug (maytansinoids), auristatins, calicheamicins, duocarmycins, doxorubicin, anthracyclines, amanitins, and camptothecins and / or any of the isotopes mentioned above. For example, examples of alpha emitters include 213-Bismuth (half-life 46 minutes), 223-Radium (half-life 11.3 days), 224-Radium (half-life 3.7 days), 225-Radium (half-life 14.8 days), 225- Actinium (half-life 9.9 days), 212-Lead (half-life 10.6 hours), 212-Bismuth (half-life 60 minutes),211 -Astatin (half-life 7.2 hours), and 255-Fermium (half-life 20 hours), 149-Terbium (half-life 4.12 hours), 227-Thorium (half-life 18.7 days), 212-Lead (half-life 10.6 hours). Examples of beta emitters include 188-Rhenium (half-life 16.7 hours), 90-Yttrium (half-life 2.7 days), 32- Phosphorous (half-life 14.3 days), 47-Scandium (half-life 3.4 days), 67-Copper (half-life 62 hours), 64-Copper (half-life 13 hours), 77-Arsenic (half-life 38.8 hours), 89-Strontium (half-life 51 days), 105-Rhodium (half-life 35 hours), 109-Palladium (half-life 13 hours), 111-Silver (half-life 7.5 days), 131 -Iodine (half-life 8 days), 177-Lutetium (half-life 6.7 days), 153-Samarium (half-life 46.7 hours), 159-Gadolinium (half-life 18.6 hours), 186-Rhenium (half-life 3.7 days), 166-Holmium (half-life 26.8 hours), 166-Dysprosium (half-life 81.6 hours), 140-Lantanum (half-life 40.3 hours), 194- Irridium (half-life 19 hours), 198-Gold (half-life 2.7 days), and 199-Gold (half-life 3.1 days), 161- Terbium (half-life 6.89 days). Examples of Auger electron emitters include 161-Terbium (half-life 6.89 days), 111-lndium (half-life 2.8 days), 67-Gallium (half-life 78.3 hours), 99m-Technetium (half-life 6.2 hours), 125-lodine (half-life 60 days) and 123-lodine (half-life 13.2 hours).

[0125] Other detectable labels, such as fluorescent dyes, enzymes, or biotin may be used depending on the application, and are contemplated herein.

[0126] Immunoconjugates may be generated using any suitable technique. Common conjugation techniques include N-hydroxysuccinimide ester (NHS ester) or maleimide crosslinking, but other techniques are known in the art. In the case of radionuclide-conjugated antibodies, bifunctional chelating agents may be used. Suitable bifunctional chelating agents are known in the art, including desferrioxamine (DFO). Other suitable chelating agents include DTPA (diethylenetriamine pentaacetic acid), TCMC (1 ,4, 7,10-tetraaza-1 , 4,7,10-tetra(2- carbamoylmethyl)cyclododecane), TETA (1 ,4,8,11-Tetraazacyclotetradecane-1 ,4,8,11- tetraacetic acid), DOTA (1 ,4,7,10-tetraazacyclododecane tetraacetic acid), macropa (N,N'-bis[(6- carboxy-2-pyridil)methyl]-4, 13-diaza-18-crown-6).

[0127] As will be understood by the skilled person, the molar ratio or chelator-antibody ratio (CAR) refers to the ratio of chelator to antibody in the conjugate. The CAR for example may depend on various factors such as the antibody and the linker used, as well as the initial molar ratio of each used in the conjugation reaction.

[0128] In some embodiments, an immunoconjugate described herein, or a composition described herein, for use in treating cancer, optionally the cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer, in a subject in need thereof. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer,and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the subject is a human. In some embodiments, the antibody is a fully human antibody.III. Compositions

[0129] Another aspect of the disclosure includes a composition comprising an antibody described herein, a nucleic acid molecule described herein, a vector described herein, a cell described herein, or the immunoconjugate described herein, and a diluent or pharmaceutically acceptable carrier.

[0130] In an embodiment the composition comprises a diluent. Suitable diluents for nucleic acids include but are not limited to water, saline solutions and ethanol. Suitable diluents for polypeptides, including antibodies or fragments thereof and / or cells include but are not limited to saline solutions, pH buffered solutions and glycerol solutions or other solutions suitable for freezing polypeptides and / or cells.

[0131] The composition may be formulated for use or prepared for administration to a subject using pharmaceutically acceptable formulations known in the art. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2003 - 20th edition) and in The United States Pharmacopeia: The National Formulary (USP 24 NF19) published in 1999.

[0132] The compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions that can be administered to subjects such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle.

[0133] Pharmaceutical compositions include, without limitation, lyophilized powders or aqueous or non-aqueous sterile injectable solutions or suspensions, which may further contain antioxidants, buffers, bacteriostats and solutes that render the compositions substantially compatible with the tissues or the blood of an intended recipient. Other components that may be present in such compositions include water, surfactants (such as Tween), alcohols, polyols, glycerin and vegetable oils, for example. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. The composition may be supplied, for example but not by way of limitation, as alyophilized powder which is reconstituted with sterile water or saline prior to administration to the patient.

[0134] In some embodiments, an immunoconjugate described herein, or a composition described herein, for use in treating cancer, optionally the cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer, in a subject in need thereof. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the subject is a human. In some embodiments, the antibody is a fully human antibody.IV. Methods

[0135] Another aspect of the disclosure includes a method for detecting Muc-16 expression in a biological sample, the method comprising a) obtaining a biological sample suspected of containing Muc-16, b) contacting the sample with an antibody described herein or an immunoconjugate described herein under conditions permissive for forming an antibody:Muc- 16 complex, and c) detecting the presence of any complex, wherein the presence of detectable complex is indicative that the sample expresses Muc-16.

[0136] Another aspect of the disclosure includes a method of detecting whether a subject has a Muc-16 expressing cancer, the method comprising obtaining a biological sample suspected of containing a Muc-16-expressing cancer cell, the biological sample having been obtained from the subject, contacting the sample with an antibody described herein or the immunoconjugate described herein under conditions permissive for forming an antibody:Muc-16 complex, and detecting the presence of an antibody complex, wherein the presence of an antibody complex indicates that the subject has an Muc-16-expressing cancer, optionally the Muc-16 -expressing cancer is selected from ovarian cancer, optionally epithelial ovarian cancer, non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer and pancreatic cancer. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer.

[0137] Suitable biological samples include, without limitation a tissue sample such as a tumor sample, which can be a solid tissue biopsy. A blood sample or plasma sample may be used for example for detecting circulating tumour cells or circulating exosomes. In an embodiment, the biological sample is a tumor sample. Suitable methods for obtaining tissue samples include tissue biopsy, fine needle aspiration cytology, fluid cytology, needle biopsy, CT-guided biopsy, ultrasound-guided biopsy. Testing for Muc-16 expression can be done by any suitable analytic technique, including immunohistochemistry or flow cytometry.

[0138] In some embodiments, the biological sample is obtained from a subject having or suspected of having a cancer, optionally ovarian cancer or pancreatic cancer, optionally the biological sample is a tumor sample.

[0139] Another aspect of the disclosure includes a method for imaging an Muc-16- expressing tumor in a subject, the method comprising administering an antibody described herein, an immunoconjugate described herein, or a composition described herein to the subject, and detecting the presence of the label.

[0140] In some embodiments, the antibodies, immunoconjugates, compositions, etc. described herein can be administered for example, by parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraventricular, intrathecal, intraorbital, ophthalmic, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol or oral administration.

[0141] Another aspect of the disclosure includes a method of determining if a subject has an Muc-16-expressing tumor, the method comprising administering an immunoconjugate described herein, or a composition described herein to the subject, and detecting the presence of the label by imaging, optionally the subject has or is suspected of having an Muc-16-expressing cancer, optionally the Muc-16-expressing cancer is selected from ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the subject is a human. In some embodiments, the composition comprises an immunoconjugate described herein.

[0142] Another aspect of the disclosure includes a method of treating a cancer, optionally the cancer is selected from ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer, in a subject in need thereof, the method comprising administering an effective amount of an antibody described herein, an immunoconjugate described herein, or a composition describedherein, to the subject. In some embodiments, the cancer is ovarian cancer, optionally epithelial ovarian cancer, and / or pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the subject is a human. In some embodiments, the composition comprises an immunoconjugate described herein.

[0143] In some embodiments, the method further comprises a) detecting Muc-16 expression in a biological sample according to a method described herein, wherein the biological sample is obtained from the subject, and / or b) imaging an Muc-16 -expressing tumor in the subject according to a method described herein, wherein the detecting and / or imaging is done before, during, or following administering the antibody, immunoconjugate, or composition.

[0144] In some embodiments, the antibody is fully human.

[0145] Any suitable imaging technique may be used and will depend on the label. For example, SPECT / CT can be used to image immunoconjugates labeled with radionuclides such as 111 lndium. Other suitable imaging techniques include for example SPECT, PET, PET / CT, PET / MRI, scintigraphy, and planar imaging. In an embodiment, the detection method is used to monitor disease state, burden, progression, or remission in a subject.

[0146] Also provided are uses of the antibodies, immunoconjugates, and compositions for detecting and / or treating cancer such as ovarian or pancreatic cancer. Also provided are use of immunoconjugates described herein for radioimmunotherapy (RIT).V. Kits

[0147] Also provided are kits comprising the antibody, nucleic acid, vector, cell, immunoconjugate, or composition as described herein, along with suitable container or packaging and / or instructions for the use thereof, such as for the detection or treatment of cancer in a subject.

[0148] In an embodiment, the kit comprises reagents and / or instructions for use in a method of Muc-16 detection such as ELISA or IHC.

[0149] Further, the definitions and embodiments described in particular sections are intended to be applicable to other embodiments herein described for which they are suitable as would be understood by a person skilled in the art. For example, in the following passages, different aspects of the disclosure are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular,any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0150] The above disclosure generally describes the present application. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the application. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

[0151] The following non-limiting examples are illustrative of the present disclosure:EXAMPLESExample 1

[0152] Fully human antibodies against MUC16 and their evaluation as immuno-PET imaging probes for detecting ovarian and pancreatic cancers are described.

[0153] A fully human monoclonal antibody, M16Ab, against MUC16 was developed using phage display. Additionally, M16Ab was conjugated with p-SCN-Bn-DFO and radiolabeled with89Zr.89Zr-DFO-M16Ab was then evaluated for binding specificity and affinity using flow cytometry. In vivo evaluation of89Zr-DFO-M16Ab was performed by microPET / CT imaging at different time points at 24 - 120 h post injection (p.i.) and ex vivo biodistribution studies in mice bearing MUC16 expressing OVCAR3, SKOV3 (ovarian) and SW1990 (pancreatic) xenografts.

[0154] 89Zr-DFO-M16Ab bound specifically to MUC16 expressing cancer cells with an ECso of 10nM.89Zr-DFO-M16Ab was stable in serum and showed specific uptake and retention in tumor xenografts even after 120 h p.i. (microPET / CT) with tumor-to-blood ratios > 43 for the SW1990 xenograft. Specific tumor uptake was observed for SW1990 / OVCAR3 xenografts but not in MUC-16 negative SKOV3 xenograft. Pharmacokinetic study shows that a relatively short distribution (ti / 2a) and elimination half-life (ti / 2is) of 4.4 h and 99 h respectively.

[0155] The89Zr-labeled human antibody was developed and evaluated in murine models of MUC-16 positive EOC and PDAC using microPET / CT and ex vivo biodistribution.

[0156] Provided herein is the development and the preclinical evaluation of89Zr-DFO- M16Ab1 as a PET imaging probe of MUC16 expressing cancers. Unlike the murine origin mAb, the anti-MUC-16 antibody described herein is fully human and is expected to be less immunogenic which is useful for translation into effective drugs. This will enable early detectionof EOC and PDAC and provides a reliable prognosis tool for monitoring the progression of the disease. The specificity of targeting and the high tumor uptake make the developed anti-MUC-16 antibody a great contrast agent for non-invasive imaging and shows potential for further development as radiopharmaceuticals for targeted therapy of MLIC16 expressing cancers.Materials and Methods:Table 1 : Amino acid Sequences of MUC16Ab Parent CloneCloning of domains SEA11-12 of MUC16

[0157] mRNA was isolated from OVCAR3 cells (obtained from ATCC) using mRNA isolation kit (Roche by Sigma Aldrich) according to the manufacturer's instructions. The cDNA was synthesized from 500 ng mRNA using Maxima First Strand cDNA Synthesis Kit for RT-PCR, with dsDNase (Thermo Fisher Scientific) following the manufacturer's instructions. The predicted DNA sequence of SEA11-12 domain of MUC16 was obtained from the NCBI (GenBank Accession #: AF414442 and NM_024690). The following primers were used to amplify the coding sequence with overhangs for Gibson assembly into a custom vector pMUFV01-Fc;HB103 (5’ to 3’)GCATTGCACTAAGTCTTGCACTTGTCACGAATTCGATAAATGGTTTCACCCAGCGG (SEQ I D NO: 9)HB104 (5’ to 3’)GGCATGTGTGAGTTTTGTCAGATCTAACCATGGCCGATGATAAATTCTGGGGTGCATAGC (SEQ ID NO: 10)This vector (Figure 7) is a lentiviral compatible vector that contains a strong EF alpha promoter and encodes proteins with IL2 secretion signal and C-terminal Fc fusion.Expression and purification of recombinant SEA11-12-FC protein:

[0158] The recombinant protein for SEA11-12 Fc fusion was expressed and purified using transient transfection of sequence verified plasmids in Expi293F suspension cells (Gibco). Expi293F cells were cultured using Expi293F complete media (Gibco). 75 x 106Expi293F cells were transfected with 30ug of SEA11-12 Fc DNA at 37°C. Cells were harvested and pelleted after five days, and recombinant protein was purified from the supernatant using affinity chromatography (MabSelectSure resin, GE Healthcare) following manufacturer recommended protocol. The integrity and the purity of the protein was confirmed using SDS-PAGEScreening naive antibody libraries using phage display

[0159] A previously developed naive antibody library

[0026] was used. This library was panned against the recombinant SEA11-12 Fc fusion protein using previously described protocols

[0027] , Three rounds of selection were performed, and the selection pool was tested for specific binding to SEA11-12 protein. Clonal ELISA was performed using 24 clones isolated from round 3 pool to test for specific binding to the target protein following standard protocols

[0027] , Clones specific to target recombinant SEA 11-12 domains were identified by DNA sequencing.Expression of M16 Ab1 antibody in lgG1 format

[0160] For the expression of lead anti-MUC16 antibody, M16Ab1 , in lgG1 format, the VL and VH coding sequences were cloned into pFUSE2ss-CLIg-hK vector and pFUSE2ss-CHIg-hG1 vectors respectively (Invivogen). Expi293F cells were used for secreted expression of full length MLIC16 IgG following previously described protocols

[0028] , MLIC16 Ab1 was purified using MabSelectSure (GE Healthcare) affinity resin using manufacturer recommended protocols. Bioanalyzer (Agilent 2100 Bioanalyzer using Agilent High Sensitivity Protein 230 Kit) was used to analyze the purity of the protein following manufacturer's protocol.Flow Cytometry

[0161] In a 96 well non-binding plate, different concentrations of the M16Ab1 IgG diluted in 1X PBS buffer (300 nM, 100 nM and 3 nM) were added to OVCAR3, SW1990 and SKOV3 cells seeded at 3 x 105cells / well. M16Ab1 was allowed to bind for 30 min at 4°C. Cells were washed and re-suspended in ice-cold 1X PBS twice. Goat anti-Human IgG PE-conjugated secondary antibody (eBioscience, cat. #12-4998-82) was added to cells in (1 in 500) dilution and allowed to bind for 30 min at 4°C. Cells were washed three times with ice-cold 1X PBS. To verify the expression of MllC-16 in both cell lines, the commercial anti-MUC16 antibody X75 (Invitrogen) was used as a positive control at a concentration of 30 and 10 nM. The plate was read using a CytoFLEX machine (Beckman Coulter, add location) on the FL1 channel and flow cytometry data were analyzed using FlowJoV10.6. The ECso and KD were determined using GraphPad Prism software.Antibody Internalization

[0162] MllC-16 expressing OVCAR3 and SW1990 cells and MllC-16 negative SKOV3 cells were seeded in a flat-bottom 96-well plate and allowed to adhere at 37°C. The following day,89Zr-DFO-M16Ab1 with a final concentration of 4 ug / ml was incubated with a 3X molar-excess of FabFluor pH red antibody internalization reagent (Essen Bioscience) for 15 minutes at 37°C. The labelled antibody was then added to the cells, and images were taken at 10X magnification every 2 hours with phase contrast and red fluorescence filters in an IncuCyte Zoom (Essen BioScience, add location). The mean red object area (pm2 / well) was calculated using the IncuCyte software which is used to quantify internalization uptake.Cell Lines and Xenografts

[0163] Human ovarian (OVCAR3; SKOV3) and pancreatic (SW1990) cancer cell lines were purchased from ATCC (Rockville, MD). OVCAR3 cells were cultured in 1X RPMI medium (HyClone Laboratories, Logan, Utah), supplemented with 20 % fetal bovine serum (FBS) (Biochrom) and 1% bovine insulin. SW1990 cells were propagated using Leibovitz's L-15 medium (HyClone Laboratories, Logan, Utah) supplemented with 10% FBS. SKOV3 cells were cultured using McCoy medium (HyClone Laboratories, Logan, Utah) supplemented with 10% FBS. Both OVCAR3 and SKOV3 cells were incubated at 37 °C in a humidified atmosphere of 5 % CO2, while SW1990 cells didn't require CO2. Female NOD-SCID and CD-1 nude mice of 4 weeks of age were obtained from Charles River Canada (St-Constant, Quebec). Animals used in this study were maintained following the guidelines of the University of Saskatchewan Animal Care Committee (protocol # 20170084). At five weeks of age, NOD-SCID mice were subcutaneously co-injected with both 7 x 106SW1990, 20 x 106OVCAR3 at the right and left hind limb, respectively andseparate NOD-SCID mice were injected with 10 x 106SKOV3 cells. All cells were prepared in 100 pL suspension of a 1 :1 mixture of medium and Matrigel matrix basement membrane (Discovery Laboware, Inc. Bedford, MA). Only for OVCAR3 xenografts, a second injection was performed at the same site using 15 x 106OVCAR3 cells. CD-1 nude mice were injected with 7 x 106SW1990 cells in 100 pL suspension of a 1 :1 mixture of medium and Matrigel matrix basement membrane. Tumor growth was measured using a digital calliper.Conjugation of anti-MUC-16 Ab1 with p-SCN-Bz-deferoxamine

[0164] 0.1 M NaHCOs (pH 9) was prepared to buffer exchange (6.5 mg / mL) M16Ab1 inPBS using (Amicon Ultra-4 Centrifugal Filter 10K NMCO, EMD Millipore) and was concentrated to 10 mg / mL. To keep the final volume of DMSO below 5%, a high concentration of 20 mg / mL p- SCN-Bz-Deferoxamine (DFO Macrocyclics, Plano, TX) in DMSO was prepared. A 10X molar excess of p-SCN-Bz-Deferoxamine) in DMSO was added to M16Ab1 in the sodium bicarbonate solution. The reaction mixture was incubated at 37°C on a thermo-shaker at 700 RPM for 90 min. Centrifugation with the same 10K Amicon filters was performed to buffer exchange the reaction mixture into 1xPBS and to remove excess DFO remaining in the mixture. DFO-M16Ab1 in PBS (12 mg / mL) was aliquoted and stored at -80 °C. The purity of M16Ab1 and DFO-M16Ab1 was determined using size exclusion HPLC (SEC-HPLC Waters 2796 Bioseparations Module, Waters 2487 Dual A Absorbance Detector, XBridge® BEH 200A SEC 3.5 pm 7.8 x 150 mm column, Waters Corporation). The solvent system used was 1x PBS at a 0.4 mL / min flow rate, and the UV-Detector was adjusted to 220 and 280 nm. The analysis of MW and purity of DFO-conjugated M16Ab1 were performed using Agilent 2100 Bioanalyzer (Agilent High Sensitivity Protein 230 Kit) using manufacturer's protocol

[0029] , Briefly, 5 ug of each sample were mixed in non-reducing buffer and heated to 95 °C for 5 minutes prior to the analysis. The size and relative peak area were calculated using Agilent 2100 Expert software. The difference in molecular weight between the M16Ab1 and DFO- M16Ab1 was used to determine the average number of chelator (DFO) on the antibody.Radiolabeling with89Zr

[0165] 89Zr in oxalic acid was produced by Saskatchewan Center of Cyclotron Sciences (University of Saskatchewan) as previously reported

[0030] , 1 M HEPES pH 7.4 (Ge Hyclone) was added to89Zr and incubated at room temperature for ten min. 2 M NaCO3 pH 11 was added dropwise in several steps to neutralize the oxalic acid in the mixture (pH 7 ± 0.2). One hundred MBq of89Zr was used to label 200 ug of DFO-M16Ab1 at a specific activity of (0.5 MBq / ug). The reaction mixture was incubated at 37°C on a thermo shaker at 700 RPM for 90 min. To determinethe radiolabeling efficiency, an aliquot of 2 M Bq of the labelled product was injected onto the same SEC-HPLC system mentioned above.89Zr- M16Ab11 with a radiochemical purity of more than 95% was used for PET / CT imaging and biodistribution experiments. Radiochemical purity was also confirmed after spotting a small aliquot (0.5 pL) on a strip of instant thin-layer chromatography silica gel impregnated paper (iTLC-SG, Agilent Technologies, Santa Clara, CA) using a mobile phase of 50 mM of sodium citrate (pH 5.2).MicroPET / CT Imaging and Biodistribution

[0166] Female NOD-SCID mice with MllC-16 positive OVCAR3 and SW1990 and MUC- 16 negative SKOV3 xenografts were injected via a tail vein with 12 ± 1 MBq (21-26 ug)89Zr-DFO- M16Ab1. CD-1 nude mice bearing SW1990 xenografts were injected intravenously with 12 ± 1 MBq (21-26 ug)89Zr-DFO-M16Ab1. PET / CT imaging was performed at different time points of 24, 48, 72, 96, and 120 h post-injection using the Vector4CT scanner (MILabs B.V., Utrecht). PET scans were acquired in a list-mode data format with a high-energy ultra-high resolution (HE-UHR- 1.0 mm) mouse / rat pinhole collimator. Images were constructed using PMOD 3.8 software (PMOD, Switzerland). Mice were sacrificed 24 and 120 h post-injection, and major organs and blood were harvested and collected in tubes then weighted. The radioactivity in all organs and blood were measured using an automated gamma counter (Wallac Wizard 1480, PerkinElmer, Waltham, MA) and expressed as injected radioactive activity per gram (% lA / g).Pharmacokinetics

[0167] Healthy male CD-1 nude mice and mice bearing MUC-16 positive SW1990 xenografts (n = 4 per group) were injected vial a tail vein with 5 - 6 MBq of89Zr-DFO-M16Ab1 (~ 10-12 ug of M16Ab1). Blood samples were collected from the saphenous vein into heparinized capillary tubes at different time points (5 min - 5 days). The height of the capillary tube occupied by blood was determined using a digital ruler. The blood volume in the capillary tube (mL) was measured using this equation V= n h. The radioactivity in blood samples was measured using gamma counter and expressed as % injected activity / mL (% lA / mL). Pharmacokinetic parameters, including the distribution and elimination half-lives (ti / 2O and ti / 2p), volume of distribution at steady-state (Vss), clearance (CL) and volume of the central compartment (Vi), were calculated by fitting the blood radioactivity versus time curve to a two-compartment model with i.v. bolus input.Statistical Analysis

[0168] All data were expressed as the mean ± Stdev of at least three independent experiments. A two-tailed Student's t-test or analysis of variance (ANOVA) with Bonferoni post hoc test were used to assess the statistical significance between the groups. All graphs were prepared and analyzed using GraphPad Prism (version 9; GraphPad, La Jolla, CA).Stability of89Zr-MUC-16 Ab1

[0169] The stability of89Zr-MUC-16 Ab 1 at 37 °C was determined by analyzing aliquots of the radiolabeled antibody using iTLC. The stability of89Zr-M16Ab1 was evaluated in 1X PBS solution and human plasma at 37 °C for five days (n = 3).89Zr-M16Ab1 was added to the 1X PBS solution and human plasma to a 15 MBq / mL final concentration. An aliquot of89Zr- M16Ab1 (triplicates) was drawn every 24 h for five days and analyzed for radiochemical purity using iTLC.Results:Generation and in vitro Characterization of M16Ab1 Antibody

[0170] Anti-MUC-16, M16Ab1 , was selected after phage library panning using a human naive Fab phage library. Clonal phage ELISA confirmed specific binding of selected M16Ab1 Fab- phage to SEA11-12-Fc protein and not to negative control Fc fusion proteins (Figure 8). The full- length lgG1 version of M16Ab1 was expressed in human origin Expi293F cells at a yield of 5 mg / L. The bioanalyzer and HPLC confirmed the purity and integrity of the purified M16Ab1 (Figure 9A & 3B). In vitro binding of M16Ab1 to high MUC-16 expressing SW1990, OVCAR3, and negative MUC-16 SKOV3 cell lines was determined using flow cytometry. The results showed dose dependent specific binding with MUC-16 positive SW1990 and OVCAR3 and no specific binding was observed with MUC-16 negative SKOV3 cell (Figure 1).Conjugation ofM16Ab1 and Quality Control of Immunoconjugate

[0171] The conjugation of p-SCN-Bn-DFO to M16Ab1 resulted in >98% pure immunoconjugate with <2% aggregates as evaluated by HPLC (Figure 9C). Bioanalyzer was used to characterize the size and purity of DFO conjugated MUC-16 Ab1. Bioanalyzer showed that M16Ab1 and DFO-M16Ab1 were >91 % and >96% pure with molecular weights of 171.3 and 174.6 kDa, respectively (Figure 9A & 9B). Antibodies were conjugated with an average of two DFO molecules per antibody when the ratio of a chelator to antibody used in the conjugation reaction was 10:1. Like the bioanalyzer results, HPLC profiles were identical between conjugated and unconjugated M16Ab1 , showing >95% purity. Saturation binding of DFO- M16Ab1 on MUC- 16 expressing cells was performed using flow cytometry to study the effect of DFO conjugationon M16Ab1 binding. Mean fluorescence intensity (MFI) was plotted against concentration to calculate the binding constant KD and EC50 values of immunoconjugate for MllC-16 expressing SW1990 and 0VCAR3 cells. The estimated KD values for M16Ab1 and DFO- M16Ab1 were 10.9 and 12.7 nM, respectively (Figure 2A & 2B). The estimated EC50 values for M16Ab1 and DFO- M16Ab1 were 9.1 and 10.3 nM, respectively (Figure 2C & 2D).Internalization of MUC-16 Ab1

[0172] Rapid internalization of M16Ab1 was observed in the positive OVCAR3 cells compared to the 13-fold lower internalization observed in the negative SKOV3 cells following two hours of incubation. After 12, 30 and 48 h incubation, M16Ab1 showed 180-, 351- and 721-fold higher internalization in OVCAR3 cells compared to the negative SKOV3 cells. No internalization was observed in the media control for up to 48 h. Most of M16Ab1 was internalized in OVCAR3 cells by the first 30 h which showed 1.5-fold higher internalization compared to 48 h. (Figure 3).Radiolabeling and Characterization

[0173] The radiolabeling of DFO- M16Ab1 with89Zr at a specific activity of 0.5 MBq / pg resulted in a radiochemical yield of >98% (Figure 9C ). The stability of89Zr- M16Ab1 was evaluated at different time points by iTLC at 37 °C in 1xPBS and human plasma. In both human plasma and PBS, > 97% and 96%, respectively of89Zr- M16Ab1 remained intact for 72 h of incubation at 37°C but decreased slightly after 5 days. Overall, the radioimmunoconjugate was stable in human plasma and PBS after incubation at 37 C for 5 days (Figure 10).Pharmacokinetics of M16 Ab1 in CD-1 mice

[0174] Pharmacokinetics of89Zr- M16Ab1 was studied in non-tumor bearing and tumor bearing CD-1 nude mice to understand if antigen shedding would influence the binding and hence the kinetics of the antibody.89Zr- M16Ab1 showed a bi-phasic half-life with distribution half-life ti / 2a of 5.8 ± 2.6 and 2.64 ± 1.3 and a moderate clearance ti / 2p of 92.4 h ± 15.2 and 63.58 h ± 19.5 (Table 2) in mice bearing MLIC16 expressing tumors and healthy mice, respectively (Figure 4).Table 2: Pharmacokinetics of89Zr-M16Ab1 in non-tumor bearing and mice bearing pancreatic SW1990 MUC-16 positive tumorBiodistribution and MicroPET / CT Imaging in Tumor Bearing Mice

[0175] 89Zr- M16Ab1 biodistribution was determined at 24 and 120h p.i. in NOD-SCID mice bearing xenografts with high MllC-16 expression (SW1990, OVCAR3) and a control negative for MllC-16 expression (SKOV3) (Figure 5A & 5B). Additionally, the biodistribution was measured at the same time points p.i. in CD-1 nude mice bearing SW1990 xenograft. In NOD- SCID mice, tumor uptake in %IA / g was slightly higher in SW1990 (8.6 ± 0.6 %IA / g) than for OVCAR3 at 24 h p.i. (6.5 ± 1.2 %IA / g) and was not significant. This uptake decreased to (7.1 ± 0.7 %IA / g) and (3.17 ± 3.5 % lA / g) respectively at 120h p.i. Negative control xenograft had significantly lower tumor uptake at 24h p.i (2.4 ± 0.1 % lA / g) and 120h p.i. (2.5 ± 1.3 % lA / g) (Figure 5C). There was a significantly high uptake in the spleen followed by the liver (spleen: 28.6 ± 18.39 % lA / g; liver: 22.8 ± 2.5 % lA / g) of the labeled antibody at 24h p.i. However, this increased to (47.8 ± 5.6 %l A / g) for the spleen and remained the same (22.5 ± 9.6 %IA / g) for the liver at 120 h p.i. There was a high uptake observed in the heart at the early time point of 24 h of (7.67 ± 8.9 % lA / g) due to blood pool, however, this was decreased over time to (2.6 ± 0.19 % lA / g) at the 120 h p.i. Tumor to blood ratio for SW1990 and OVCAR3 was 5.7 and 4.3, respectively at 24 h p.i. However, at 120 h p.i the ratio increased to 46.6 and 21 , respectively. Tumor / muscle ratio at 24 h was 16- and 10-fold higher for SW1990 and OVCAR3, respectively compared with negative control SKOV3 and at 120 h, the ratio was 10- and 11 -fold higher.

[0176] In CD-1 nude mice bearing high MllC-16 expressing SW1990 xenograft, tumor uptake increased overtime from (7.9 ± 1.0 %IA / g) at 24 h p.i. to 11.6 ± 2.1 %IA / g at 120h p.i. (Figure 5D). There was almost no uptake in the liver (0.25 ± 0.21 %IA / g) at 24h p.i. but this increased to (17.3 ± 7.6 %IA / g) at 120 h p.i. The spleen had an uptake of (16.9 ± 3.6 %IA / g) at 24 h p.i. However, this decreased to (12.1 ± 0.54 %IA / g) at 120 h p.i. This showed that the uptake in the spleen and liver was significantly lower than what was observed in the NOD-SCID mice (Figure 5E). At the early time point of 24 h, the lungs and heart uptake were observed to be (lungs: 4.9 ± 1.0 % lA / g; heart: 3.2 ± 0.8 % lA / g) but this uptake was decreased to (lungs: 0.8 ± 0.2 % lA / g; heart: 0.4 ± 0.1 % lA / g) at 120 h p.i. The highest tumor to blood ratio was 3.3 at 120h p.i. Tumor to muscle ratio was 8.2 and 7.6 at 24 and 120 h, respectively.

[0177] PET imaging showed high tumor uptake in MUC- 16-positive xenografts as seen in the maximum intensity projection images of the NOD-SCID mice at 24 - 120 h p.i. (Figure 6A) There was no significant difference (p > 0.9999) in uptake between the two MUC-16-expressing xenografts at 24 h or 120 h p.i. Tumor uptake was higher at 24 h p.i and then decreased overtime. Up to 120 h p.i, there was no uptake observed in the negative control xenografts on microPET (Figure 6B). Unlike the observation in NOD-SCID mice, the maximum intensity projection images of the CD-1 nude mice showed increased accumulation of89Zr-M16Ab1 in MUC-16 expressing SW1990 tumors overtime in which, the highest tumor uptake was observed at 120 h p.i (Figure 6C).

[0178] M16Ab1 , a fully human antibody, is shown herein to target the MUC-16 / CA125 antigen expressed on epithelial ovarian cancer (EOC) and pancreatic ductal adenocarcinoma (PDAC).

[0179] 89Zr has become a popular choice for preclinical and clinical immunoPET imaging owing to its desirable decay properties. Its sufficiently long physical half-life (78.4 h) and its emission of positrons result in higher resolution imaging

[0037] , As described herein, M16Ab1 was conjugated with p-SCN-Bn-DFO, which resulted in a highly pure immunoconjugate with low nanomolar affinity (11 nM), as shown by bioanalyzer / HPLC, and flow cytometry. DFO-M16Ab1 was efficiently labeled with89Zr and was stable for up to 5 days. The in vivo specificity and tumor uptake of89Zr-M16Ab1 were assessed using microPET and biodistribution studies.89Zr-M16Ab1 showed early high uptake in MUC-16 positive tumor xenografts in the NOD-SCID mice. The highest tumor uptake of (8.6% I A / g) was observed at 24 h p.i and this uptake decreased over time to (7.1 % lA / g) by the end of imaging at 120 h p.i. Fast clearance of89Zr-M16Ab1 from blood (2% lA / g) was observed as early as 24 h p.i, and increasing spleen and liver uptake were observed up to 120h p.i. These results were in accordance with the findings from mouse studies showing that mice with SCID mutation could substantially reduce the tumor uptake, due to low endogenous IgG levels, through rapid clearance of the radiolabeled antibody from the blood into the non-target organs such as spleen, liver, and bones

[0038] and

[0039] , In contrast, these observations were reversed in our imaging and biodistribution results of CD-1 nude mice. The tumor uptake increased over time from 7.9% I A / g at 24 h p.i. to -12% I A / g at 120 h p.i. The radiotracer uptake in the spleen and liver was significantly lower than what was observed in the NOD-SCID mice. This may be attributed to the -5 fold slower blood clearance of89Zr-M16Ab1 from blood in nude mice compared to NOD-SCID. The specificity of tumor uptake was validated by imaging and biodistribution studies of mice bearing MUC-16 negative SKOV3 xenografts.

[0180] In comparison to other antibody-based immunoPET probes developed against CA125 / MUC-16, provided herein is a fully human monoclonal antibody for the non-invasive imaging of MllC-16 expressing cancers. Unlike the89Zr-DFO-mAb-B43.13 by Sharma et al.

[0023] , the present antibody was efficiently labeled with89Zr at a high specific activity of 0.5 MBq / 1 ug. This allowed administration of a minimal dose of89Zr-MUC-16 Ab1 of 10 - 12 MBq and 20 - 24 ug compared with their 10 - 12 M Bq and 40 - 50 ug dose and to get highly specific tumor targeting while minimizing the amount of radiotracer residing in off-target organs such as liver. Without wishing to be bound by theory, this may be due to the conjugation efficiency between the M16Ab1 antibody and the bifunctional chelator that complexes the isotope, and also due to a more homogenous conjugate, which may be due in part to the location of the lysine amino acids on the M16Ab1 antibody described herein which allows for efficient conjugation with the chelator. Although they had higher tumor uptake in OVCAR3 xenografts at 12 h p.i, the uptake of our radiotracer was higher at 24 h p.i with almost no uptake observed in the liver resulting in a high tumor to liver ratio of 32 at 24 h. These results were demonstrated not only in EOC but also in PDAC models. Therefore, imaging probes for MUC-16 expressing cancers were developed.

[0181] One concern about MUC-16 as a therapeutic / imaging target is that the cleavage and shedding of the extracellular domain of MUC-16 in serum or in the peritoneal fluid of patients may reduce or inhibit the accumulation of M16Ab1 in the tumor and obscure the visualization of small lesions

[0040] , The therapeutic potential of M16Ab1 was evaluated by conducting a pharmacokinetic (PK) study to compare the PK behaviour of M16Ab1 in mice with large MUC-16 overexpressing xenografts vs healthy mice. The PK profile of radiolabeled M16Ab1 was similar for both models with fast distribution half-life ti / 2a of 5.8 h and a moderate clearance ti / 2p of 92.4 h. Additionally, the present antibody showed a 13-fold higher internalization in MUC-16 expressing OVCAR3 cells compared to negative control SKOV3 cells in the first 2 h of incubation and this internalization was 721 fold higher by the end of 48 h incubation, indicating the therapeutic potential of M16Ab1 via antibody-drug conjugates or the delivery of highly toxic radiation dose to the tumor site. Due to its slow internalization, MUC-16 is considered a poor therapeutic target for the immunoconjugates or ADCs that act inside tumor cells

[0041] , However, its overexpression on the surface of cancer cells makes it a desirable therapeutic biomarker for targeted radioimmunotherapy (T-RIT) using high-energy short-range radioisotopes, where internalization is not a limiting factor. Immunoconjugates with high specificity and affinity to MUC- 16 can deliver a tumouricidal radiation dose to cancer cells

[0042] ,In this study, it was demonstrated that by conjugating a high contrast agent such as89Zr with the M16Ab1 disclosed herein, effective and specific delivery of this contrast agent into MUC- 16 expressing tumors was achieved while restricting the distribution to normal organs, therefore, reducing the potential for off-target toxicities. The high-resolution images and reduced background non-target (except for the liver and spleen) uptake of the89Zr-M16Ab1 probe would allow for better visualization of metastatic lesions. Therapeutic potential of the antibodies described herein will be evaluated by radiolabeling with potent therapeutic isotopes. The potential / effectiveness of such a radioimmunoconjugate will be evaluated in animal models that closely resemble EOC and PDA cancers in patients by using patient-derived xenografts (PDX) models.Example 2

[0182] Fully human antibodies against MLIC16 that have been subjected to affinity maturation by site-directed mutagenesis to establish tolerance of changes in CDR loops are described.Materials and Methods:Affinity maturation library construction

[0183] A phagemid encoding the parent clone M16Ab1 , was used as a template for site- directed mutagenesis, and stop codons were introduced in CDRH3 using the following oligonucleotides (Integrated DNA Technologies):5’- CTATTACTGTGCGAAATAATAAGACTCCTGGGGCCAG-3’ (SEQ ID NO: 11)

[0184] This step eliminates the high prevalence of parent clone in the library, as site- directed mutagenesis usually results in >10% of the library being the unmutated template. Using the CDRH3-stop codon plasmid as a template, two libraries were constructed using the following mutagenic random oligonucleotides (Integrated DNA technologies):CDRL3:5’-CTTACTACTGTCAACAG (N 1 :70101010) (N3: 10107010) (N4:10101070) (N4)(N1)(N2:10701010) (N1)(N3)(N4) (N1)(N2)(N2) (N2)(N1)(N3) (N4)(N1)(N2) ACTTTT-GGCCAGGGG-3' (SEQ ID NO: 12)CDRH1 :5’-GCAGCCTCTGGATTC (N1 :70101010)(N2: 10701010)(N2) TTC (N1)(N3:10107010)(N4:10101070) (N1)(N2)(N2) TATGGCATGCACTGG- 3’ (SEQ ID NO: 13)CDRH2:5’-CTGGAGTGGGTGGCA (N3:10107010)(N4:10101070)(N4) ATATCA (N4)(N1 :70101010)(N4) (N3)(N1)(N4) GGA (N1)(N3)(N4) (N1)(N1)(N4) AAA (N4)(N1)(N4) TATGCAGACTCCGTG-3’ (SEQ ID NO: 14)CDRH3:5’-CTATTACTGTGCGAAA (N3: 10107010)(N 1 :70101010)(N4: 10101070) (N3)(N4)(N2: 10701010) (N4)(N1)(N2) (N3)(N3)(N4) (N3)(N1)(N2) (N4)(N4)(N2) (N3)(N2)(N3) (N3)(N4)(N4) GACTCCTGGGGCCAG-3’ (SEQ ID NO: 15)

[0185] For Library 1 , CDRL3 and CDRH3 were mutated. For Library 2, CDRH1 , H2 and H3 were mutated. Both libraries were constructed using established protocols as described previously (Fellouse et.al.) and resulted in ~ 3 x 109transformants for each library.Panning of libraries and characterization of individual clones

[0186] Three rounds of library panning were performed using standard protocols. The recombinant protein SEA11-12-Fcwas immobilized at 2 pg / ml concentration on Nunc MaxiSorp™ (Invitrogen™) plates and each library was panned separately. After three rounds, 48 clones were picked and characterized by single-point competitive ELISA at 10 nM inhibition. Clones were ranked for highest inhibition of binding and top 24 clones from each library were sequenced.Results and DiscussionLibrary Design

[0187] Upon sequence alignment with germline genes in the IMGT repertoire, MUC16Ab1 is closely aligned with genes IGHV3-30*5 and IGKV1-39*01 for VH and VL respectively. We used the crystal structure PDB 3F12 (representing an antibody derived from IGHV3-30*5) as a guide to ascertain solvent exposed residues in CDRH1 and H2. Based on this structure, IMGT positions 29, 35, 36 in CDRH1 and 55, 59, 63, 64, 66 in CDRH2 were selected for mutagenesis. IMGT positions representing the loops of CDRL3 (107-116) and CDRH3 (107-115) were mutated. A soft-randomization scheme was used where nucleotide sequences for the corresponding amino acids were biased with hand-mixed nucleotides where:A replaced with a mix of (70%A,10%C, 10%G, 10%T)-Named (N1)C replaced with a mix of (10%A, 70%C, 10%G, 10%T)-Named (N2)G replaced with a mix of (10%A, 10%C, 70%G, 10%T)-Named (N3)T replaced with a mix of (10%A. 10%C, 10%G, 70%T)-Named (N4)

[0188] This allows for a bias of -40% for native amino acid found in the parent clone while still allowing for other 19 amino acids to occur in this position in the library of mutants.Library panning and characterization of individual clones

[0189] Single-point competitive ELISA showed that clones from Library 2 (mutations in CDRH1 , H2 and H3) had better inhibition at 10 nM competition when compared to clones from Library 1 (mutations in CDRL3 and H3) on average (see Figure 11), reflecting higher affinity for Library 2 clones. Clones 1-13 were derived from Library 1 and clones 14-22 were derived from Library 2. Interestingly, none of the clones from Library 1 selected as having the highest inhibition of binding had mutations in CDRL3, suggesting strong conservation of residues in the light chain, as mutations were deleterious for binding. The amino acid sequences of the VH regions of newly identified clones are listed in Table 3 with difference compared to the parent sequence identified with bold and underlined text.

[0190] Table 3: Amino acid sequences of VH regions.

[0191] A summary of this mutagenesis study is shown in Figure 12. Several of the mutated residues in VH are important for binding (IMGT position 59 in CDRH2 and IMGT positions 107, 109, 112 and 114 of CDRH3) and are conserved among the sequences. Hydrophobic amino acids are preferred in IMGT positions 108, 113 and 115 of CDRH3.

[0192] While the present application has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the application is not limited to the disclosed examples. To the contrary, the application is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0193] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Specifically, the sequences associated with each accession numbers provided herein including for example accession numbers for proteins and / or nucleic acid provided in the Tables or elsewhere, are incorporated by reference in its entirely.

[0194] The scope of the claims should not be limited by the preferred embodiments and examples but should be given the broadest interpretation consistent with the description as a whole.REFERENCES1. Lheureux S, Gourley C, Vergote I, Oza AM. Epithelial ovarian cancer. Lancet. 2019;393:1240-53. doi:10.1016 / S0140-6736(18)32552-2.2. Corrado G, Salutari V, Palluzzi E, Distefano MG, Scambia G, Ferrandina G. Optimizing treatment in recurrent epithelial ovarian cancer. Expert Rev Anticancer Ther. 2017;17:1147-58. doi: 10.1080 / 14737140.2017.1398088.3. Gupta N, Yelamanchi R. Pancreatic adenocarcinoma: A review of recent paradigms and advances in epidemiology, clinical diagnosis and management. World J Gastroenterol. 2021;27:3158-81. doi:10.3748 / wjg.v27.i23.3158.4. Elsayed M, Abdelrahim M. The Latest Advancement in Pancreatic Ductal Adenocarcinoma Therapy: A Review Article for the Latest Guidelines and Novel Therapies. Biomedicines. 2021 ;9. doi:10.3390 / biomedicines9040389.5. Corfield AP. Mucins: a biologically relevant glycan barrier in mucosal protection. Biochim Biophys Acta. 2015;1850:236-52. doi:10.1016 / j.bbagen.2014.05.003.6. Kufe DW. Mucins in cancer: function, prognosis and therapy. Nat Rev Cancer. 2009;9:874-85. doi: 10.1038 / nrc2761.7. van Putten JPM, Strijbis K. Transmembrane Mucins: Signaling Receptors at the Intersection of Inflammation and Cancer. J Innate Immun. 2017;9:281-99. doi: 10.1159 / 000453594.8. Reynolds IS, Fichtner M, McNamara DA, Kay EW, Prehn JHM, Burke JP. Mucin glycoproteins block apoptosis; promote invasion, proliferation, and migration; and cause chemoresistance through diverse pathways in epithelial cancers. Cancer Metastasis Rev. 2019. doi: 10.1007 / sl 0555-019-09781-w.9. Bast RC, Jr., Klug TL, St John E, Jenison E, Niloff JM, Lazarus H, et al. A radioimmunoassay using a monoclonal antibody to monitor the course of epithelial ovarian cancer. N Engl J Med. 1983;309:883-7. doi:10.1056 / NEJM198310133091503.10. Cohen JG, White M, Cruz A, Farias-Eisner R. In 2014, can we do better than CA125 in the early detection of ovarian cancer? World journal of biological chemistry. 2014;5:286-300. doi: 10.4331 / wjbc.v5.i3.286.11. Kim N, Hong Y, Kwon D, Yoon S. Somatic mutaome profile in human cancer tissues. Genomics Inform. 2013;11:239-44. doi: 10.5808 / GI.2013.11.4.239.12. Gubbels JA, Belisle J, Onda M, Rancourt C, Migneault M, Ho M, et al. Mesothelin-MUC16 binding is a high affinity, N-glycan dependent interaction that facilitates peritoneal metastasis of ovarian tumors. Mol Cancer. 2006;5:50. doi: 10.1186 / 1476-4598-5-50.13. Theriault, C.; Pinard, M.; Comamala, M.; Migneault, M.; Beaudin, J.; Matte, I.; Boivin, M.;Piche, A.; Rancourt, C. MLIC16 (CA125) regulates epithelial ovarian cancer cell growth, tumorigenesis and metastasis. Gynecol Oncol 2011, 121, 434-443, doi: 10.1016 / j.ygyno.2011.02.020.14. Chen SH, Hung WC, Wang P, Paul C, Konstantopoulos K. Mesothelin binding to CA125 / MUC16 promotes pancreatic cancer cell motility and invasion via MMP-7 activation. Sci Rep. 2013;3: 1870. doi:10.1038 / srep01870.15. Higashi M, Yamada N, Yokoyama S, Kitamoto S, Tabata K, Koriyama C, et al. Pathobiological implications of MUC16 / CA125 expression in intrahepatic cholangiocarcinoma- mass forming type. Pathobiology. 2012;79:101-6. doi: 10.1159 / 000335164.16. Liang C, Qin Y, Zhang B, Ji S, Shi S, Xu W, et al. Oncogenic KRAS Targets MUC16 / CA125 in Pancreatic Ductal Adenocarcinoma. Mol Cancer Res. 2017;15:201-12. doi : 10.1158 / 1541 -7786. MCR- 16-0296.17. Shimizu A, Hirono S, Tani M, Kawai M, Okada K, Miyazawa M, et al. Coexpression of MLIC16 and mesothelin is related to the invasion process in pancreatic ductal adenocarcinoma. Cancer Sci. 2012; 103:739-46. doi: 10.1111 / j.1349-7006.2012.02214.x.18. Haridas D, Chakraborty S, Ponnusamy MP, Lakshmanan I, Rachagani S, Cruz E, et al. Pathobiological implications of MLIC16 expression in pancreatic cancer. PLoS One. 2011;6:e26839. doi:10.1371 / journal.pone.0026839.19. Chen Y, Clark S, Wong T, Chen Y, Chen Y, Dennis MS, et al. Armed antibodies targeting the mucin repeats of the ovarian cancer antigen, MLIC16, are highly efficacious in animal tumor models. Cancer Res. 2007;67:4924-32. doi:10.1158 / 0008-5472.CAN-06-4512.20. Junutula JR, Raab H, Clark S, Bhakta S, Leipold DD, Weir S, et al. Site-specific conjugation of a cytotoxic drug to an antibody improves the therapeutic index. Nat Biotechnol. 2008;26:925-32. doi: 10.1038 / nbt.1480.21. Marcos-Silva L, Narimatsu Y, Halim A, Campos D, Yang Z, Tarp MA, et al. Characterization of binding epitopes of CA125 monoclonal antibodies. J Proteome Res. 2014; 13:3349-59. doi: 10.1021 / pr500215g.22. Nemieboka B, Sharma SK, Rao TD, Edwards KJ, Yan S, Wang P, et al. Radiopharmacologic screening of antibodies to the unshed ectodomain of MLIC16 in ovarian cancer identifies a lead candidate for clinical translation. Nucl Med Biol. 2020;86-87:9-19. doi: 10.1016 / j.nucmedbio.2020.04.006.23. Sharma SK, Mack KN, Piersigilli A, Pourat J, Edwards KJ, Keinanen O, et al. ImmunoPET of Ovarian and Pancreatic Cancer with AR9.6, a Novel MUC16-Targeted Therapeutic Antibody. Clin Cancer Res. 2022;28:948-59. doi:10.1158 / 1078-0432. CCR-21-1798.24. Sharma SK, Sevak KK, Monette S, Carlin SD, Knight JC, Wuest FR, et al. Preclinical 89Z r Immuno-PET of High-Grade Serous Ovarian Cancer and Lymph Node Metastasis. J Nucl Med. 2016;57:771-6. doi: 10.2967 / jnumed.115.167072.25. Olson MT, Wojtynek NE, Talmon GA, Caffrey TC, Radhakrishnan P, Ly QP, et al. Development of a MUC16-Targeted Near-Infrared Fluorescent Antibody Conjugate for Intraoperative Imaging of Pancreatic Cancer. Mol Cancer Ther. 2020;19:1670-81. doi: 10.1158 / 1535-7163. MCT-20-0033.26. Broqueza J, Prabaharan CB, Andrahennadi S, Allen KJH, Dickinson R, MacDonald- Dickinson V, et al. Novel Human Antibodies to Insulin Growth Factor 2 Receptor (IGF2R) for Radioimmunoimaging and Therapy of Canine and Human Osteosarcoma. Cancers (Basel). 2021 ; 13. doi: 10.3390 / cancersl 3092208.27. Fellouse FA, Sidhu SS. Making Antibodies in Bacteria. In: Howard GC, Kaser MR, editors. Making and Using Antibodies. Boca Raton: CRC Press; 2006.28. Vazquez-Lombardi R, Nevoltris D, Luthra A, Schofield P, Zimmermann C, Christ D. Transient expression of human antibodies in mammalian cells. Nat Protoc. 2018;13:99-117. doi:10.1038 / nprot.2017.126.29. Alizadeh, E.; Behlol Ayaz Ahmed, K.; Raja Solomon, V.; Gaja, V.; Bernhard, W.; Makhlouf, A.; Gonzalez, C.; Barreto, K.; Casaco, A.; Geyer, C.R.; et al. (89)Zr-Labeled Domain Il-Specific scFv-Fc ImmunoPET Probe for Imaging Epidermal Growth Factor Receptor In Vivo. Cancers (Basel) 2021, 13, doi: 10.3390 / cancersl 3030560.30. Gaja V, Cawthray J, Geyer CR, Fonge H. Production and Semi-Automated Processing of (89)Zr Using a Commercially Available TRASIS MiniAiO Module. Molecules. 2020;25. doi: 10.3390 / molecules25112626.31. Yang ZJ, Zhao BB, Li L. The significance of the change pattern of serum CA125 level for judging prognosis and diagnosing recurrences of epithelial ovarian cancer. J Ovarian Res. 2016;9:57. doi: 10.1186 / s13048-016-0266-3.32. Giampaolino P, Foreste V, Della Corte L, Di Filippo C, Iorio G, Bifulco G. Role of biomarkers for early detection of ovarian cancer recurrence. Gland Surg. 2020;9:1102-11. doi:10.21037 / gs-20-544.33. Buamah P. Benign conditions associated with raised serum CA-125 concentration. J Surg Oncol. 2000;75:264-5. doi: 10.1002 / 1096-9098(200012)75:4<264::aid-jso7>3.0.co;2-q.34. Lovqvist A, Humm JL, Sheikh A, Finn RD, Koziorowski J, Ruan S, et al. PET imaging of (86)Y-labeled anti-Lewis Y monoclonal antibodies in a nude mouse model: comparison between (86)Y and (111)ln radiolabels. J Nucl Med. 2001 ;42:1281-7.35. Wright BD, Lapi SE. Designing the magic bullet? The advancement of immuno-PET into clinical use. J Nucl Med. 2013;54:1171-4. doi:10.2967 / jnumed.113.126086.36. Harding FA, Stickler MM, Razo J, DuBridge RB. The immunogenicity of humanized and fully human antibodies: residual immunogenicity resides in the CDR regions. MAbs. 2010;2:256- 65. doi:10.4161 / mabs.2.3.11641.37. Deri MA, Zeglis BM, Francesconi LC, Lewis JS. PET imaging with (8)(9)Zr: from radiochemistry to the clinic. Nucl Med Biol. 2013;40:3-14. doi:10.1016 / j.nucmedbio.2012.08.004.38. Sharma SK, Chow A, Monette S, Vivier D, Pourat J, Edwards KJ, et al. Fc-Mediated Anomalous Biodistribution of Therapeutic Antibodies in Immunodeficient Mouse Models. Cancer Res. 2018;78:1820-32. doi:10.1158 / 0008-5472.CAN-17-1958.39. Michel RB, Ochakovskaya R, Mattes MJ. Rapid blood clearance of injected mouse lgG2a in SCID mice. Cancer Immunol Immunother. 2002;51 :547-56. doi:10.1007 / s00262-002-0319-x.40. Aithal A, Rauth S, Kshirsagar P, Shah A, Lakshmanan I, Junker WM, et al. MLIC16 as a novel target for cancer therapy. Expert Opin Ther Targets. 2018;22:675-86. doi: 10.1080 / 14728222.2018.1498845.41. Xiang X, Feng M, Felder M, Connor JP, Man YG, Patankar MS, et al. HN125: A Novel Immunoadhesin Targeting MLIC16 with Potential for Cancer Therapy. J Cancer. 2011;2:280-91. doi:10.7150 / jca.2.280.42. Larson SM, Carrasquillo JA, Cheung NK, Press OW. Radioimmunotherapy of human tumours. Nat Rev Cancer. 2015;15:347-60. doi:10.1038 / nrc3925.43. Dondelinger, Mathieu et al. “Understanding the Significance and Implications of Antibody Numbering and Antigen-Binding Surface / Residue Definition.” Frontiers in immunology vol. 9 2278. 16 Oct. 2018.

Claims

CLAIMS1. An antibody which specifically binds Muc-16 comprising a light chain variable region and a heavy chain variable region, the light chain variable region comprising complementarity determining regions CDR-L1 , CDR-L2, and CDR-L3, and the heavy chain variable region comprising complementarity determining regions CDR-H1 , CDR-H2, and CDR-H3, wherein the amino acid sequences of said CDRs, as identified using IMGT numbering, are:CDR-L1 QSISSY (SEQ ID NO: 38);CDR-L2 AA (SEQ ID NO: 39);CDR-L3 QQSYSTQYT (SEQ ID NO: 40);CDR-H1 GFX1FX2X3YG (SEQ ID NO: 41);CDR-H2 X4ISYDGX5X6KX7 (SEQ ID NO: 42); andCDR-H3 AKDX8YX9DX10AX11 (SEQ ID NO: 43) wherein, Xi is an amino acid selected from T, N, A, I, or S;X2 is an amino acid selected from S, G, R, or Q;X3is an amino acid selected from T or I;X4 is an amino acid selected from V or A;X5 is an amino acid selected from S or G;Xe is an amino acid selected from N, E, or I;X7 is an amino acid selected from Y, Q, or H;Xs is an amino acid selected from V, I, L, or M;X9 is an amino acid selected from G or D;X is an amino acid selected from F, L, or Y; and / orX11 is an amino acid selected from V, I, or L.

2. The antibody of claim 1 , wherein the light chain variable region comprises i) a polypeptide having an amino acid sequence of SEQ ID NOs: 7; ii) a polypeptide having an amino acid sequence with at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NOs: 7, wherein the CDR sequences are as set forth in SEQ ID NOs: 38-40; or iii) aconservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NQs:38-40. The antibody of claim 1 or 2, wherein the heavy chain variable region comprises i) a polypeptide having an amino acid sequence of SEQ ID NOs: 8 or 16-37; ii) a polypeptide having an amino acid sequence with at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NOs: 8 or 16-37, wherein the CDR sequences are as set forth in SEQ ID NOs: 41-43; or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NOs: 41-43. The antibody of any one of claims 1 to 3, wherein the heavy chain variable region comprises a polypeptide having an amino acid sequence of SEQ ID NOs: 8 or 16-37. The antibody of any one of claims 1 to 4, wherein the antibody is a humanized or human antibody. The antibody of any one of claims 1 to 5, wherein the antibody is a single chain antibody. The antibody of any one of claims 1 to 6, wherein the antibody is an antibody fragment selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof. The antibody of any one of claims 1 to 6, wherein the antibody is an IgG, optionally I gG 1. A nucleic acid molecule encoding the antibody of any one of claims 1 to 8. A vector comprising the nucleic acid molecule of claim 9. A cell comprising the nucleic acid molecule of claim 9, the vector of claim 10, or expressing the antibody of any one of claims 1 to 8. An immunoconjugate comprising the antibody of any one of claims 1 to 8 and a therapeutic agent and / or detectable label. The immunoconjugate of claim 12, wherein the detectable label and / or therapeutic agent is a radionuclide, optionally an alpha- beta- or gamma-emitting radionuclide.The immunoconjugate of claim 13, wherein the radionuclide is conjugated to the antibody using a bifunctional chelator, optionally a desferrioxamine (DFO), NOTA (2,2',2”- (1 ,4,7-triazacyclononane-1 ,4,7-triyl)triacetic acid), DOTA (1 ,4,7,10-Tetraazacyclododecane-1 ,4,7, 10-tetraacetic acid), NODAGA (1 ,4,7- triazacyclononane, 1 -glutaric acid-4, 7-acetic acid), TETA (Triethylenetetramine), TCMC (1 ,4,7, 10-tetraaza-1 ,4,7,10-tetra(2-carbamoylmethyl)cyclododecane), DTPA (diethylenetriamine pentaacetic acid), macropa, NETA (4-[2-(bis- carboxymethyl-amino)-ethyl]-7-carboxymethyl-[1 ], [4], [7]triazonan-1 -yl}-acetic acid), 3p-C-NETA (4-[2-(bis-carboxy-methylamino)-5-(4-nitrophenyl)-entyl]-7- carboxymethyl-[1 ,4,7]tri-azonan-1 -yl} acetic acid), 3p-C-DEPA (2- [(carboxymethyl)][5-(4-nitrophenyl-1 -[4,7, 10-tris(carboxymethyl)-1 ,4,7, 10- tetraazacyclododecan-1 -yl]pentan-2-yl)amino]acetic acid), DEPA (7-[2-(bis- carboxymethyl-amino)-ethyl]-4, 10-bis-carboxymethyl-1 ,4,7, 10- tetraazacyclododec-1 -yl-acetic acid), or HBED (N,N'-Di(2- hydroxybenzyl)ethylenediamine-N,N'-diacetic acid monohydrochloride) chelator, preferably a desferrioxamine (DFO) chelator, optionally at a chelator-antibody ratio (CAR) of 10-20:1 , optionally 15:

1. The immunoconjugate of claim 13 or claim 14 wherein the radionuclide is89Zirconium. A composition comprising the antibody of any one of claims 1 to 8, the nucleic acid molecule of claim 9, the vector of claim 10, the cell of claim 11 , or the immunoconjugate of any one of claims 12 to 15, and a diluent or pharmaceutically acceptable carrier. The antibody of any one of claims 1 to 8, the immunoconjugate of any one of claims 12 to 15, or the composition of claim 16, for use in treating cancer. The antibody, immunoconjugate or composition for use of claim 17, wherein the cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer, in a subject in need thereof. The antibody, immunoconjugate, or composition for use of claim 17 or 18, wherein the subject is a human.A method for detecting Muc-16 expression in: 1) a biological sample, the method comprising a) obtaining a biological sample suspected of containing Muc-16, b) contacting the sample with the antibody of any one of claims 1 to 8 or the immunoconjugate of any one of claims 12 to 15 under conditions permissive for forming an antibody:Muc-16 complex, and c) detecting the presence of any complex, wherein the presence of detectable complex is indicative that the sample expresses Muc-16; or 2) in a subject, the method comprising administering the immunoconjugate of any one of claims 12 to 15, or the composition of claim 16 to the subject, and detecting the presence of the label. The method of claim 21 for detecting whether a subject has a Muc-16 expressing cancer, the method comprising obtaining a biological sample suspected of containing a Muc-16- expressing cancer cell, the biological sample having been obtained from the subject, contacting the sample with the antibody of any one of claims 1 to 8 or the immunoconjugate of any one of claims 12 to 15 under conditions permissive for forming an antibody:Muc-16 complex, and detecting the presence of an antibody complex, wherein the presence of an antibody complex indicates that the subject has an Muc-16-expressing cancer, optionally the Muc-16 -expressing cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer. The method of claim 21 , wherein the biological sample is obtained from a subject having or suspected of having a cancer, optionally wherein the cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, and pancreatic cancer, optionally wherein the biological sample is a tumor sample. The method of claim 20 for imaging a Muc-16-expressing tumor in a subject, the method comprising administering the immunoconjugate of any one of claims 12 to 15, or the composition of claim 16 to the subject, and detecting the presence of the label. The method of claim 20 for determining if a subject has an Muc-16-expressing tumor, the method comprising administering the immunoconjugate of any one of claims 12 to 15, or the composition of claim 16 to the subject, and detecting the presence of the label by imaging, optionally the subject has or is suspected of having an Muc-16-expressing cancer, optionally the Muc-16-expressing cancer is selected from non-small cell lungcancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer. The method of claim 23 or 24, wherein the subject is a human. The method of any one of claims 23 to 25, wherein the immunoconjugate is the immunoconjugate of claim 15 or the composition comprises the immunoconjugate of claim 15. A method of treating a cancer, optionally the cancer is selected from non-small cell lung cancer, breast cancer, cervical cancer, endometrial cancer, stomach cancer, thyroid cancer, ovarian cancer, optionally epithelial ovarian cancer, and pancreatic cancer, in a subject in need thereof, the method comprising administering an effective amount of the antibody of any one of claims 1 to 8, the immunoconjugate of any one of claims 12 to 15, or the composition of claim 16 to the subject. The method of claim 27, wherein the subject is a human. The method of claim 27 or claim 28, wherein the immunoconjugate is the immunoconjugate of claim 15 or the composition comprises the immunoconjugate of claim 15. The method of any one of claims 27 to 29, wherein the method further comprises a) detecting Muc-16 expression in a biological sample according to the method of any one of claims 20 to 22, wherein the biological sample is obtained from the subject, and / or b) imaging an Muc-16 -expressing tumor in the subject according to the method of claim 23 or 24, wherein the detecting and / or imaging is done before, during, or following administering the antibody, immunoconjugate, or composition. The method of any one of claims 20 to 30, wherein the antibody is fully human.

Images