Microalgae detection method

An improved DNA extraction and novel antisense primer method for microalgae detection addresses underestimation and false negatives in existing techniques, enabling accurate detection and quantification of Ostreopsis and Ostreopsis cf. ovata.

FR3148441B1Active Publication Date: 2026-04-10SUEZ INTERNATIONAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
FR2023004497
Authority / Receiving Office
FR · FR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-05-05
Publication Date
2026-04-10
Estimated Expiration
2043-05-05

AI Technical Summary

Technical Problem

Existing methods for detecting microalgae, particularly Ostreopsis cf. ovata, are inadequate, leading to underestimation of their presence and false negatives due to improper primer usage, necessitating a more effective and accurate detection method.

Method used

A method involving improved DNA extraction and the use of a standard plasmid with a consensus sequence, combined with a novel antisense primer mixture, specifically designed for Ostreopsis and Ostreopsis cf. ovata, to enhance detection and quantification through qPCR.

Benefits of technology

The method provides accurate detection and quantification of microalgae, overcoming underestimation and false negatives, ensuring reliable identification of harmful species in environmental samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000025_0000
    Figure 00000025_0000
  • Figure 00000026_0000
    Figure 00000026_0000
  • Figure 00000027_0000
    Figure 00000027_0000
Patent Text Reader

Abstract

Microalgae Detection Method The present invention relates to a method for detecting at least one microorganism, preferably a microalga, in a sample, preferably a seawater sample, comprising the following steps: filtering the sample, extracting, purifying, and amplifying the DNA, and determining the presence and / or quantifying the microorganism to be detected in the sample. The microorganism is preferably a microalga of the genus Ostreopsis, a microalga of the species Ostreopsis cf. siamensis, or a microalga of the species Ostreopsis cf. ovata. The present invention also relates to a mixture of antisense primers suitable for the detection of a microalga of the genus Ostreopsis and / or a microalga of the species Ostreopsis cf. ovata, a kit comprising said mixture of antisense primers, and their use for the detection of at least one microalga of the genus Ostreopsis and / or a microalga of the species Ostreopsis cf. ovata. ovata.Figure for the abridged version: none.
Need to check novelty before this filing date? Find Prior Art

Description

Title of the invention: Method for detecting microalgae Scope of the invention

[0001] The present invention relates to the detection of microorganisms, in particular microalgae, in samples taken from nature, for example seawater samples. Technological background

[0002] The Basque coastline includes a collection of beaches among the most popular with tourists on the European Atlantic coast, welcoming more than one million people each summer. It forms a stretch of more than 100 km of coastline on both sides of the border, predominantly rocky and home to a remarkable natural heritage, particularly in terms of biodiversity.

[0003] In 2020 and 2021, the Basque coast saw numerous reports to the poison control center of cases of respiratory and skin irritation among swimmers and walkers who frequented the beaches from Hendaye to Biarritz during the summer. Analyses revealed the bloom of a microalga belonging to the genus Ostreopsis, known to cause this type of ENT (ear, nose, and throat) disorder, particularly in the Mediterranean. The simultaneous presence of two species, Ostreopsis cf. siamensis and O. cf. ovata, was identified.

[0004] It is therefore essential to have a method for effectively detecting these microalgae, and more generally for detecting microorganisms that may be toxic to humans.

[0005] The article by Penna et al. (2007, Journal of Plankton Research, vol. 29, no. 1, 19-38) describes a test based on qualitative and semi-quantitative PCR for the detection of harmful algae, in order to monitor their development in the Mediterranean Sea. The authors describe the primer pairs used to detect these algae, including microalgae of the genus Ostreopsis and the species Ostreopsis cf. ovata and Ostreopsis cf. siamensis.

[0006] The article by Drouet et al. (2021, Environmental Microbiology, vol. 23, 4956-4979) focuses on the distribution and potential expansion of Ostreopsis cf. 5 iamensis, including quantitative PCR (qPCR) analysis of different types of filtered seawater samples. The PCR primers and conditions are notably those described in Penna et al.

[0007] There is therefore a need for a rapid detection method that allows for the efficient detection and quantification of microorganisms, in particular microalgae, in samples taken from nature, for example in seawater samples. Description of the invention

[0008] The Inventors have developed an improved method for detecting microorganisms, based on the one hand on improving the extraction yield of DNA present in the starting sample and on the use of a standard plasmid comprising a consensus sequence of the microorganism to be detected for the quantification of said microorganism.

[0009] In particular, after filtering the sample, the lysis step advantageously comprises placing the filter in a container in the presence of a lysis solution, so that the filter and the retentate present on the filter are in contact with the lysis solution, under agitation, and then preferably mechanically grinding the lysate thus obtained. A better DNA extraction yield is thus obtained.

[0010] With regard to quantification by qPCR, the method advantageously includes the use of a standard curve obtained by amplification of serial dilutions of a standard plasmid which includes a consensus sequence of the microorganism to be detected.

[0011] Furthermore, with regard to the detection of microalgae of the genus Ostreopsis or the species Ostreopsis cf. ovata, the Inventors have demonstrated that the primer pair used in the prior art for DNA amplification of these microalgae does not allow for the correct detection of the species Ostreopsis cf. ovata. Consequently, known detection methods underestimate the quantity of microalgae of the genus Ostreopsis or the species Ostreopsis cf. ovata present in a sample, or even erroneously conclude their absence. The Inventors have therefore developed an original antisense primer mixture that improves the detection of microalgae of the genus Ostreopsis and / or the species Ostreopsis cf. ovata.

[0012] A first object of the invention is a method for detecting at least one microorganism in at least one sample, comprising the following steps: a. filtering said sample to obtain a retentate comprising microorganisms, b. extraction of DNA from the microorganisms in the retentate, to obtain a solution comprising extracted DNA, c. Purification of the DNA from the solution containing the extracted DNA, to obtain a purified DNA solution, d. amplification of the DNA from the purified DNA solution with at least one primer pair specific to the microorganism to be detected, and e. determination of the presence and / or quantification of the microorganism to be detected in the sample.

[0013] The microorganism to be detected is preferably a microalga of the genus Ostreopsis, a microalga of the species Ostreopsis cf. siamensis or a microalga of the species Ostreopsis cf. ovata.

[0014] Step b) of extraction preferably includes a chemical lysis step, to obtain a first lysate and, optionally, a mechanical lysis step of said first lysate.

[0015] The chemical lysis step defined above preferably includes placing the filter in a container in the presence of a lysis solution, so that the filter and the retentate present on the filter are in contact with the lysis solution and under agitation.

[0016] Step c) of purification preferably includes a clarification step and a precipitation step.

[0017] Step d) preferably includes the amplification of DNA from at least two reference samples, each reference sample comprising a known concentration of a plasmid, said plasmid comprising a consensus sequence of the microorganism to be detected.

[0018] When said at least one microorganism to be detected is a microalga of the genus Ostreopsis and / or a microalga of the species Ostreopsis cf. ovata, the primer pair in step d) preferably comprises a mixture of antisense primers of sequence SEQ ID NO: 1.

[0019] Another object of the invention is a mixture of antisense primers suitable for the detection of a microalga of the genus Ostreopsis and / or a microalga of the species Ostreopsis cf. ovata, characterized in that the antisense primers of said mixture comprise the sequence SEQ ID NO: 1.

[0020] Another object of the invention is a kit suitable for the detection of a microalga of the genus Ostreopsis and / or a microalga of the species Ostreopsis cf. ovata, said kit comprising the mixture of antisense primers as defined above.

[0021] Another object of the invention relates to the use of a mixture of antisense primers as defined above or of a kit as defined above, for the detection of at least one microalga of the genus Ostreopsis and / or at least one microalga of the species Ostreopsis cf. ovata.

[0022] Another object of the invention relates to a plasmid suitable for the quantification of a microalga in a sample, said plasmid comprising the consensus sequence SEQ ID NO: 13 or SEQ ID NO: 14. Microorganism

[0023] The present invention makes it possible to detect the presence of at least one microorganism in a sample.

[0024] The microorganism may, for example, be a toxic microorganism or one that is at risk of toxicity, particularly to humans, and / or a microorganism that presents a risk to the environment.

[0025] The microorganism is preferably a microalga.

[0026] The term “microalga” here refers to a microscopic alga.

[0027] The microalga is for example an alga of the genus Ostreopsis, Alexandrium, Dinophysis, Gambierdiscus and / or Pseudo- nitzschia.

[0028] The microalga is preferably a microalga of the genus Ostreopsis.

[0029] The microalga of the genus Ostreopsis is for example of the species O. siamensis, O. ovata, O. lenticularis, O. heptagona, O. mascarenensis, O. I abens, O. belizeana, O. carribeana, O. marina, O. fattorussoi or O. rhodesiae. The microalgae may also be a microalgae related to these species, such as O. cf. siamensis, O. cf. ovata or even O. cf. lenticularis. Sample

[0030] The sample is a sample capable of including the microorganism(s) to be detected, as defined above, in particular at least one microalga as defined above.

[0031] The sample is preferably a liquid sample.

[0032] If the starting sample is a solid substrate, for example a solid substrate comprising a biofilm capable of comprising the microorganism(s) to be detected, said biofilm is preferably resuspended in a liquid medium, such as filtered seawater, to obtain a liquid sample.

[0033] The sample can be a sample taken from nature, for example a seawater sample, a macroalgae sample, a rock substrate or an artificial substrate (for example a grid).

[0034] The sample may also be a sample taken from a culture medium, for example a culture medium of at least one microorganism as defined above, in particular of at least one microalga as defined above.

[0035] The sample is preferably a seawater sample.

[0036] The seawater sample is, for example, taken from near the surface (in particular from -20 cm to -30 cm) in a water column 1 m to 1.5 m deep. Preferably, the bottle is inserted upside down at the sampling depth and filled by turning it sideways and then upwards to avoid any contamination. On some beaches, where the water column does not reach 1 m, the sample must be taken from a shallower depth.

[0037] The volume of seawater sample taken is preferably at least IL.

[0038] Preferably, the sample does not undergo any treatment before the implementation of the method according to the invention. In particular, the sample is preferably not treated with Lugol's acid or with formaldehyde. Primers and primer pairs

[0039] The microorganism to be detected is preferably detected by amplification of its DNA, after extraction.

[0040] DNA amplification is carried out by any suitable method well known to those skilled in the art, such as PCR (“Polymerase Chain Reaction”) or qPCR (quantitative PCR).

[0041] The amplified DNA region is preferably a conserved region within the genus or species of the microorganism to be detected.

[0042] The amplified DNA region is preferably a region of ribosomal DNA (rDNA).

[0043] A pair of primers specific to the microorganism to be detected is used to amplify the DNA of said microorganism, if present in the sample, in order to detect its presence or not in the starting sample.

[0044] A pair of primers comprises a forward primer and an anti-forward primer.

[0045] A pair of primers suitable for detecting a microalga of the genus Ostreopsis preferably allows amplification of the ITS 1 and 5.8 S region or part of the ITS 1 and 5.8 S region of a microalga of the genus Ostreopsis.

[0046] A suitable primer pair for detecting a microalga of the species Ostreopsis cf. siamensis preferably amplifies the ITS1 and 5.8S regions of the microalga Ostreopsis cf. siamensis. The sense primer and / or the antisense primer are specific to Ostreopsis cf. siamensis. In a preferred embodiment, the sense primer is specific to a microalga of the species Ostreopsis cf. siamensis and the antisense primer is specific to a microalga of the genus Ostreopsis.

[0047] A suitable primer pair for detecting a microalga of the species Ostreopsis cf. ovata preferably amplifies the ITS1 and 5.8S regions or parts of the ITS1 and 5.8S regions of the Ostreopsis cf. ovata microalga. The sense primer and / or the antisense primer are specific to Ostreopsis cf. ovata. In one embodiment, the sense primer is specific to an Ostreopsis cf. ovata microalga and the antisense primer is specific to a microalga of the genus Ostreopsis or of the species Ostreopsis cf. ovata.

[0048] When the method relates to the detection of several species of microorganism of the same genus, it may be advantageous to use a common primer specific to the genus of said microorganisms and a primer specific to the species, in order to reduce the number of primers used.

[0049] A primer according to the invention preferably comprises at least 10 nucleotides, preferably at least 15 nucleotides, more preferably at least 20 nucleotides and / or at most 50 nucleotides, preferably at most 40 nucleotides, at most 30 nucleotides.

[0050] Typically, a primer according to the invention comprises 18 to 28 nucleotides, preferably 20 to 25 nucleotides.

[0051] A pair of primers commonly used in the literature to detect a microalga of the genus Ostreopsis includes the sequence direction primer SEQ ID NO: 4 and the sequence direction reverse primer SEQ ID NO: 5.

[0052] However, the Inventors have demonstrated that the antisense primer with sequence SEQ ID NO: 5 does not allow for the correct detection of Ostreopsis cf. ovata. Therefore, the detection of microalgae of the genus Ostreopsis and microalgae of the species Ostreopsis cf. ovata using this primer may erroneously conclude their absence and underestimate the quantity of these microalgae present in a sample.

[0053] The Inventors then developed an original mixture of antisense primers, said mixture comprising antisense primers incorporating nucleotide variants enabling the efficient detection of the microalga of the species Ostreopsis cf. ovata, and thus avoiding underestimation of the number of microalgae of the genus Ostreopsis present in a sample, nor the number of microalgae of the species Ostreopsis cf. ovata. The nucleotide variants present in the sequence of the primers of said mixture advantageously allow for the inclusion of all polymorphisms observed on the sequences of Ostreopsis cf. ovata.

[0054] The present invention thus relates to a mixture of antisense primers suitable for detecting a microalga of the genus Ostreopsis or a microalga of the species Ostreopsis cf. ovata, characterized in that the primers of said mixture comprise the sequence CCARGAR YATGCCTACATTCAA (sequence SEQ ID NO: 1), in which R represents G or A and Y represents T or C.

[0055] The mixture of reverse primers as defined above preferably comprises at least two reverse primers, more preferably at least four reverse primers, at least six reverse primers or at least seven reverse primers, selected from the group consisting of: CCAGGAG TATGCCTACATTCAA (sequence SEQ ID NO: 5), CCAGGAGCATGCCTACATTCAA (sequence SEQ ID NO: 6), CCAGGAA TATGCCTACATTCAA (sequence SEQ ID NO: 7), CCAGGAA CATGCCTACATTCAA (sequence SEQ ID NO: 8), CCAAGAG TATGCCTACATTCAA (sequence SEQ ID NO: 9), CCAAGAG CATGCCTACATTCAA (sequence SEQ ID NO: 10), CCAAGAATATGCCTACATTCAA (sequence SEQ ID NO: 11) and CCAAGAACATGCCTACATTCAA (sequence SEQ ID NO: 12).

[0056] Preferably, the mixture of antisense primers as defined above comprises the antisense primers of sequence SEQ ID NO: 5, 6, 7, 8, 9, 10, 11 and 12.

[0057] The anti-sense primers of the mixture are preferably present in equal quantities in said mixture.

[0058] An example of a primer pair for detecting a microalga of the genus Ostreopsis thus includes the sequence direction primer SEQ ID NO: 4 and a sequence direction reverse primer SEQ ID NO: 1.

[0059] Preferably, several primer pairs comprising the same sense primer are used to detect a microalga of the genus Ostreopsis. These primer pairs include, for example, the sense primer of sequence SEQ ID NO: 4 and a mixture of antisense primers comprising sequence SEQ ID NO: 1 as defined above, preferably the antisense primers of sequences SEQ ID NO: 5 to 12. These primer pairs allow the amplification of a 92-base-pair amplicon.

[0060] An example of a primer pair for detecting a microalga of the species Ostreopsis cf. siamensis includes the sequence direction primer SEQ ID NO: 2 and the sequence direction reverse primer SEQ ID NO: 5. This primer pair allows amplification of an amplicon of 223 base pairs.

[0061] An example of a primer pair for detecting a microalga of the species Ostreopsis cf. ovata comprises the sense primer with sequence SEQ ID NO: 3 and an antisense primer with sequence SEQ ID NO: 1. Preferably, several primer pairs comprising the same sense primer are used to detect a microalga of the species Ostreopsis cf. ovata. These primer pairs include, for example, the sense primer with sequence SEQ ID NO: 3 and a mixture of antisense primers comprising the sequence SEQ ID NO: 1 as defined above, preferably the antisense primers with sequences SEQ ID NO: 5 to 12. These primer pairs allow the amplification of an amplicon of 210 base pairs. Standard plasmid

[0062] The present invention also relates to a plasmid comprising a consensus sequence of the microorganism to be detected, used to create a standard curve enabling the quantification of said microorganism in the sample. This plasmid is also referred to hereafter as the "standard plasmid".

[0063] If several microorganisms are to be detected, the detection method according to the invention preferably includes the use of several standard plasmids, each standard plasmid corresponding to a microorganism to be detected.

[0064] The term "consensus sequence" here refers to a nucleotide sequence comprising the most frequent nucleotides present at each position. A consensus sequence for a genus or species of microorganism is preferably obtained by a alignment of multiple sequences from different individuals of this genus or species of microorganism.

[0065] The consensus sequence is preferably a conserved region within the genus or species of the microorganism to be detected.

[0066] An advantage of the standard plasmid according to the invention is that the quantification is stable over time and comparable to cellular equivalents.

[0067] The present invention relates particularly to a plasmid comprising a consensus sequence of a microalga, in particular used for the quantification of said microalga in a sample.

[0068] The present invention relates particularly to a plasmid comprising a consensus sequence of Ostreopsis cf. siamensis, preferably used for the quantification of the microalga Ostreopsis or Ostreopsis cf. siamensis in a sample.

[0069] The present invention also relates to a plasmid comprising a consensus sequence of Ostreopsis cf. ovata, preferably used for the quantification of the microalga Ostreopsis or Ostreopsis cf. ovata in a sample.

[0070] For example, a consensus sequence of the microalga O streopsis cf. siamensis includes or consists of the sequence SEQ ID NO: 13.

[0071] For example, a consensus sequence of the microalga O streopsis cf. ovata includes or consists of the sequence SEQ ID NO: 14.

[0072] The plasmid into which the consensus sequence is inserted can be any suitable plasmid well known to those skilled in the art allowing the insertion of the consensus sequence as defined above.

[0073] The plasmid as defined above preferably comprises a consensus sequence of the microorganism to be detected preceded and followed by 20 to 50 nucleotides and a selection region for an antibiotic, for example ampicillin.

[0074] The plasmid as defined above is, for example, the plasmid pEX-A128.

[0075] The plasmid as defined above can be used to establish a standard curve, allowing the microorganism present in the sample to be quantified.

[0076] The invention also relates to the use of a plasmid as defined above for the quantification of at least one microorganism in a sample.

[0077] The invention relates particularly to the use of a plasmid as defined above to establish a standard curve for the quantification of at least one microorganism in a sample.

[0078] Preferably, the plasmid includes the SEQ ID NO: 13 sequence for the quantification of the microalga O streopsis or O streopsis cf. siamensis.

[0079] Preferably, the plasmid includes the SEQ ID NO: 14 sequence for the quantification of the microalga O streopsis or O streopsis cf. ovata.

[0080] A reference sample is thus defined here. A reference sample comprises a known concentration (for example, in number of copies per volume) of a plasmid comprising a consensus sequence of a microorganism to be detected.

[0081] In order to produce a standard curve, the DNA of at least two reference samples (preferably at least three reference samples, at least four reference samples or at least five reference samples) comprising different concentrations of said plasmid is amplified at the same time as the DNA of the sample(s) to be analyzed.

[0082] The amplified DNA from the reference samples thus makes it possible to establish a standard curve.

[0083] The standard range includes, for example, points corresponding to the amplified DNA of reference samples, said reference samples comprising, before amplification, serial dilutions of the plasmid, for example, 10th dilutions of the plasmid.

[0084] The first point of the standard range may for example correspond to a reference sample comprising a starting concentration (i.e. before amplification) of plasmid of 106 to 107 copies of plasmids per pl, for example 4.106 copies / pl.

[0085] An example of a standard range includes seven points corresponding to 10th dilutions, ranging from 4.106 copies / pl to 4 copies / pl.

[0086] The number of copies of the plasmid can be calculated using the following formula:

[0087] Number of copies = (A x 6,022.1023) / (L x 109x660)

[0088] where A is the mass of plasmid in ng, L is the length (in bases) of the plasmid comprising the consensus sequence, 6.022.1023 is Avogadro's number and 660 is the average molecular weight of a base pair.

[0089] Method for detecting at least one microorganism in at least one sample

[0090] The present invention also relates to a method for detecting at least one microorganism in at least one sample, comprising the following steps: a. filtration of said sample, to obtain a retentate comprising microorganisms, b. extraction of DNA from the microorganisms in the retentate, to obtain a solution comprising extracted DNA, c. Purification of the DNA from the solution containing extracted DNA, to obtain a purified DNA solution, d. amplification of the DNA from the purified DNA solution with at least one pair of primers specific to the microorganism to be detected, and e. determination of the presence and / or quantification of the microorganism to be detected in the sample.

[0091] The method according to the invention may include detecting one or more microorganisms in one or more samples.

[0092] Whether or not the sample may include the microorganism(s) to be detected, the method as defined above is a method for detecting at least one microorganism likely to be present in the sample.

[0093] The sample is as defined above in the "Sample" section.

[0094] The sample is preferably a seawater sample.

[0095] The microorganism is in particular as defined above.

[0096] The microorganism is preferably a microalga as defined above, such as a microalga of the genus Ostreopsis, a microalga of the species Ostreopsis cf. siamensis or a microalga of the species Ostreopsis cf. ovata.

[0097] The detection method as defined above relates for example to the detection of one, two or three microalgae selected from the group consisting of Ostreopsis, Ostreopsis cf. siamensis and Ostreopsis cf. ovata. Step a)

[0098] Step a) includes filtering the sample to obtain a retentate comprising microorganisms.

[0099] The microorganisms in the retentate are all the microorganisms present in the sample. These microorganisms may or may not include the microorganism(s) to be detected.

[0100] This filtration step allows the sample to be concentrated.

[0101] The filter is indeed suitable for retaining microorganisms present in the sample and, optionally, the extracellular DNA present in the sample.

[0102] The retentate thus includes the microorganisms present in the sample and, optionally, the extracellular DNA present in the sample.

[0103] The filtered sample volume is, for example, from 0.25 to 1 liter, preferably from 0.5 to 1 liter. The filtered sample volume is, for example, equal to 1 liter.

[0104] The filter preferably has pores with a diameter of 0.45 pm to 10 pm, preferably 3 pm to 10 pm. The filter has, for example, pores with a diameter of 3 pm.

[0105] The filter is preferably a polycarbonate or nylon filter.

[0106] A polycarbonate filter, preferably with pores of a diameter of 3 pm, advantageously allows recovery of both microorganisms and extracellular DNA present in the sample.

[0107] The filter preferably has a small diameter to facilitate the DNA extraction step, in particular the lysis step. The filter has, for example, a diameter between 40 mm and 50 mm, for example a diameter of 47 mm. Step b)

[0108] Step b) includes the extraction of DNA from the microorganisms of the retentate, to obtain a solution comprising extracted DNA.

[0109] Step b) of DNA extraction from the microorganisms in the retentate comprises: - a chemical and, optionally, enzymatic lysis step, notably using a lysis solution, to obtain a first lysate, and - optionally, a mechanical lysis step of the first lysate, for example by grinding, to obtain a second lysate.

[0110] The chemical and, optionally, enzymatic lysis step preferably comprises placing the filter in a container in the presence of a lysis solution, such that the filter and the retentate present on the filter are in contact with the lysis solution. The container is preferably agitated, preferably using a vortex mixer, for example for one minute.

[0111] Placing the filter itself in the lysis solution increases the extraction yield.

[0112] Any lysis solution well known to those skilled in the art for DNA extraction may be used.

[0113] For example, the lysis solution comprises at least one chaotropic agent, at least one denaturing agent and / or at least one detergent.

[0114] For example, the lysis solution includes guanidinium chloride and / or SDS (sodium dodecyl sulfate) and / or CTAB (cetyltrimethylammonium bromide).

[0115] The lysis solution may further comprise at least one enzyme, for example proteinase K and / or lysozyme. In this case, it is both a chemical and enzymatic lysis.

[0116] The extraction step preferably further includes a mechanical lysis step of the first lysate, for example by grinding, to obtain a second lysate.

[0117] The mechanical lysis step, in particular by grinding, also makes it possible to increase the yield of the extraction.

[0118] The mechanical lysis step is carried out for example by placing the first lysate in a container in the presence of beads, and then grinding the whole.

[0119] The beads are for example glass beads, for example with a diameter of 0.5 mm.

[0120] The grinding can for example include several cycles, for example 3 grinding cycles, for example of a duration of 30 seconds, for example at about 8000 g (for example at 5500 rpm in a Precellys Evolution grinder) interspersed with a pause, for example of 30 seconds.

[0121] The solution comprising the extracted DNA is the solution obtained at the end of the chemical and, optionally, enzymatic lysis step, i.e. the first lysate, or, if a mechanical lysis step is carried out, the solution obtained at the end of the mechanical lysis step, i.e. the second lysate.

[0122] In a preferred embodiment, step b) of extracting DNA from the microorganisms in the retentate comprises: - a chemical lysis step, using a lysis solution, to obtain a first lysate, and - a mechanical lysis step of the first lysate, preferably by grinding, to obtain a second lysate.

[0123] In this preferred embodiment, there is therefore no enzymatic lysis. Step c)

[0124] Step c) includes the purification of the DNA from the solution comprising the extracted DNA, to obtain a purified DNA solution.

[0125] Step c) of purification makes it possible to obtain a solution of purified DNA, in particular which is free from compounds that inhibit the step d) of DNA amplification.

[0126] Step c) of purification preferably includes a clarification step and a precipitation step.

[0127] The clarification step preferably includes clarification on a column comprising a silica membrane, of the solution comprising the extracted DNA obtained in step b).

[0128] For example, the solution comprising the extracted DNA is transferred to a column comprising a silica membrane and the clarification eluate is recovered.

[0129] The solution obtained after clarification, in particular the clarification eluate, is then transferred to a new column comprising a silica membrane to retain the DNA.

[0130] DNA fixation is carried out by adding a binding buffer to the solution obtained after clarification, to obtain a mixture.

[0131] Any DNA-binding buffer well known to those skilled in the art may be used.

[0132] For example, the binding buffer comprises guanidinium chloride, salts and ethanol.

[0133] The column used to retain the DNA is then washed with at least one wash buffer.

[0134] Preferably, the column is washed with a first wash pad, then washed once or twice with a second wash pad.

[0135] The first wash buffer allows the removal of proteins, metabolites and other inhibitory compounds.

[0136] The first wash buffer includes, for example, guanidinium chloride and isopropanol.

[0137] The second wash buffer makes it possible to remove the last contaminants including traces of isopropanol and to ensure optimal drying of the silica membrane.

[0138] The second washing pad includes, for example, ethanol.

[0139] The DNA is then eluted with an elution buffer.

[0140] Any DNA elution buffer well known to a person skilled in the art may be used.

[0141] For example, the elution buffer comprises water and trisaminomethane.

[0142] For elution, the column is preferably placed in a container containing the hot elution buffer, for example at 65°C, for example for 5 minutes.

[0143] Optionally, more elution buffer is added to the container and the container is placed in a warm incubation, for example at 65°C, for example for 5 minutes.

[0144] The assembly is centrifuged to recover the eluate comprising the purified DNA.

[0145] This eluate comprising the purified DNA is the purified DNA solution.

[0146] The purified DNA solution may optionally be stored at -80°C before carrying out step d). Step d)

[0147] Step d) includes the amplification of the DNA from the purified DNA solution with at least one pair of primers specific to the microorganism to be detected.

[0148] Step d) makes it possible to obtain a solution comprising amplified DNA if the purified DNA solution includes DNA from the microorganism to be detected.

[0149] DNA amplification can be carried out from a volume of the purified DNA solution and, optionally, from a volume of the purified DNA solution diluted, for example to 10.

[0150] Dilution of the purified DNA solution is particularly advantageous when there is suspicion of the presence of amplification-inhibiting compounds in said purified DNA solution.

[0151] Amplification is preferably by PCR or qPCR.

[0152] If the detection method relates to the detection of two microorganisms, step d) includes the use of at least one pair of primers specific to the first microorganism to be detected and at least one pair of primers specific to the second microorganism to be detected.

[0153] If the detection method relates to the detection of at least two microorganisms, step d) includes the use of at least one pair of primers specific to each of the microorganisms to be detected.

[0154] It is possible to use the same primer in primer pairs intended to detect different microorganisms. This is particularly the case when a primer one pair of primers is specific to one species of microorganism and the other primer is specific to the genus of that microorganism.

[0155] The specific primer pair for a microorganism to be detected is, for example, as defined above in the section "Primers and primer amplifications".

[0156] When the microorganism is the microalga Ostreopsis or the microalga Ostreopsis cf. ovata, step d) preferably comprises the amplification of the DNA from the purified DNA solution with a specific sense primer of said microorganism and a mixture of antisense primers, said antisense primers comprising the sequence SEQ ID NO: 1.

[0157] When the microorganism to be detected is the microalga Ostreopsis, step d) preferably comprises the amplification of the DNA from the purified DNA solution with an Ostreopsis-specific sense primer and a mixture of antisense primers, said antisense primers comprising the sequence SEQ ID NO: 1.

[0158] When the microorganism is the microalga Ostreopsis cf. ovata, step d) preferably comprises the amplification of DNA from the purified DNA solution with a specific Ostreopsis cf. ovata sense primer and a mixture of antisense primers, said antisense primers comprising the sequence SEQ ID NO: 1.

[0159] The mixture of antisense primers is in particular as defined above.

[0160] The amplification step can be implemented using a kit as defined below in the "kit" section.

[0161] A person skilled in the art knows how to determine the appropriate conditions for a DNA amplification step.

[0162] By way of example, the amplification cycle may include: - 10 minutes at 95°C for the initial denaturation phase, - 40 hybridization cycles including 95°C for 15 seconds, 60°C for 15 seconds, 72°C for 15 seconds, and - 1 minute at 95°C for the final phase.

[0163] If the amplification is qPCR, fluorescence acquisition is, for example, performed every 5 seconds during the hybridization cycles. A melting curve is preferably obtained over a temperature range of 65 to 95 °C, in particular with 0.5 °C increments.

[0164] When the amplification is a qPCR, step d) preferably includes the amplification of a DNA standard range, for quantification.

[0165] Advantageously, the DNA standard range consists of DNA from reference samples as defined above in the section “Standard Plasmid”.

[0166] Step d) therefore preferably includes the amplification of DNA present in reference samples as defined above.

[0167] In this case, for each microorganism to be detected, the DNA from reference samples comprising known concentrations of a plasmid comprising a consensus sequence of the microorganism to be detected are also amplified in step d).

[0168] Reference samples corresponding to the microorganism to be detected allow a range of quantification to be obtained for this microorganism.

[0169] Typically, reference samples comprising known concentrations of a plasmid including a consensus sequence of Ostreopsis cf. siamensis are used to establish a standard curve for the quantification of Ostreopsis cf. siamensis. The consensus sequence of Ostreopsis cf. siamensis, for example, includes or consists of the sequence SEQ ID NO: 13.

[0170] Similarly, reference samples comprising known concentrations of a plasmid including a consensus sequence of Ostreopsis cf. ovata are used to establish a standard curve for the quantification of Ostreopsis cf. ovata. The consensus sequence of Ostreopsis cf. ovata, for example, includes or consists of the sequence SEQ ID NO: 14.

[0171] Furthermore, reference samples comprising known concentrations of a plasmid comprising a consensus sequence of Ostreopsis cf. siamensis (e.g., comprising or consisting of sequence SEQ ID NO: 13) or of Ostreopsis cf. ovata (e.g., comprising or consisting of sequence SEQ ID NO: 14) may be used to establish a standard curve for the quantification of Ostreopsis. Step e)

[0172] Step e) includes determining the presence and / or quantifying the microorganism to be detected in the sample.

[0173] If DNA is amplified at the end of step d), using a primer pair specific to the microorganism to be detected, then said microorganism is present in the sample. Detection of the amplified DNA can be carried out by electrophoresis, for example on an agarose gel. Quantification can, for example, be performed when the amplification in step d) is qPCR.

[0174] If no DNA is amplified at the end of step d), using a pair of primers specific to the microorganism to be detected, then said microorganism is not present in the sample.

[0175] When step d) is a qPCR, the quantity or concentration of the microorganism to be detected in the sample is determined, in particular from the DNA standard range.

[0176] In an advantageous embodiment, the present invention relates to a method of detection as defined above of at least one microalga, preferably a microalga of the genus Ostreopsi s, an Ostreopsis cf microalga. siamensis and / or a microalga Ostreopsis cf. ovata, in at least one sample, preferably at least one seawater sample, including the following steps: a. Filtration of said sample, to obtain a retentate comprising microorganisms, b. extraction of DNA from the microorganisms in the retentate, to obtain a solution comprising extracted DNA, c. Purification of the DNA from the solution containing extracted DNA, to obtain a purified DNA solution, d. amplification of the DNA from the purified DNA solution with at least one pair of primers specific to the microalga to be detected, and e. determination of the presence and / or quantification of said microalga in the sample. Kit

[0177] The present invention also relates to a kit suitable for the detection of at least one microorganism as defined above, in particular suitable for the implementation of a method for detecting at least one microorganism as defined above.

[0178] The kit as defined above is preferably suitable for the detection of a microalga of the genus Ostreopsis and / or a microalga Ostreopsis cf. ovata.

[0179] The kit as defined above preferably includes at least one pair of primers for amplifying DNA (i) of microalgae of the genus Ostreopsis and / or microalgae of the species Ostreopsis cf. ovata.

[0180] Preferably, the kit as defined above further includes at least one pair of primers for amplifying DNA from microalgae of the species Ostreopsis cf. siamensis.

[0181] The kit as defined above preferably comprises a mixture of reverse primers, in which the reverse primers comprise the sequence SEQ ID NO: 1.

[0182] The kit as defined above preferably comprises a mixture of antisense primers, said primers comprising the sequences SEQ ID NO: 5 to 12.

[0183] The kit as defined above preferably includes: - a mixture of antisense primers, said primers comprising the sequences SEQ ID NO: 5 to 12, - a primer with sequence direction SEQ ID NO: 3 and / or a primer with sequence direction SEQ ID NO: 4, - optionally, a sequence direction primer SEQ ID NO: 2, and - optionally, a reverse sequence primer SEQ ID NO: 5.

[0184] A preferred kit as defined above includes:

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194] - a mixture of antisense primers, said primers comprising the sequences SEQ ID NO: 5 to 12, - a primer sequence direction SEQ ID NO: 3, - a primer sequence direction SEQ ID NO: 4, - a primer sequence direction SEQ ID NO: 2, and - an antisense primer of sequence SEQ ID NO: 5. Preferably, the kit as defined above also includes: - at least one polymerase enzyme, - dNTPs, - a tampon - magnesium ions and / or - a dye for DNA or RNA. The kit as defined above may also include: - at least one filter, preferably a polycarbonate or nylon filter, - at least one lysis buffer, - at least one binding buffer, - at least one precipitation buffer, and / or - at least one elution buffer. The filter, lysis buffer, binding buffer, precipitation buffer and elution buffer are specifically as defined above. Using a primer mix or kit The present invention also relates to the use of a mixture of antisense primers as defined above, for the detection of at least one microalga of the genus Ostreopsis and / or at least one microalga of the species Ostreopsis cf. ovata. The mixture of antisense primers is notably as defined above. The antisense primer mixture preferably includes antisense primers of SEQ ID NO: 5 to 12 sequences. The mixture of antisense primers is for example used with the sense primer of sequence SEQ ID NO: 4 to detect a microalga of the genus Ostreopsis. The mixture of antisense primers is used, for example, with the sense primer sequence SEQ ID NO: 3 to detect a microalga of the species Ostreopsis cf. ovata The present invention also relates to the use of a kit as defined above in the "kit" section, for the detection of at least one microalga of the genus Ostreopsis and / or at least one microalga of the species Ostreopsis cf. ovata. The present invention also relates to the use as defined above for the detection of (i) at least one microalga of the genus Ostreopsis and / or at least a microalga of the species Ostreopsis cf. ovata and (ü) optionally, for the detection of at least one microalga of the species Ostreopsis cf. siamensis.

[0195] Other features and advantages of the invention will become clearer from the following examples, which are given by way of illustration and not limitation. Sequence listing

[0196] The SEQ ID NO: 1 sequence corresponds to the sequence of antisense primers specific to Ostreops is cf. ovata.

[0197] The sequence SEQ ID NO: 2 corresponds to the sequence of a specific sense primer of Ostreops is cf. siamensis.

[0198] The SEQ ID NO: 3 sequence corresponds to the sequence of a specific sense primer of Ostreops is cf. ovata.

[0199] The sequence SEQ ID NO: 4 corresponds to the sequence of a specific sense primer of Ostreops is.

[0200] The sequence SEQ ID NO: 5 corresponds to the sequence of a specific antisense primer of Ostreops is.

[0201] Sequences SEQ ID NO: 6 to SEQ ID NO: 12 correspond to the sequence of a specific antisense primer of Ostreopsis cf. ovata.

[0202] The SEQ ID NO: 13 sequence corresponds to a consensus sequence of the microalga Ostreopsis cf. siamensis.

[0203] The SEQ ID NO: 14 sequence corresponds to a consensus sequence of the microalga Ostreopsis cf. ovata. Figures

[0204] [Fig.1] Fig.1 describes the DNA extraction protocols tested on cultures of O. cf. siamensis and D. cf. ovata, where protocol A is the reference protocol and protocols B, C and D are variants thereof.

[0205] [Fig. 2] Figure 2 describes the means and standard deviations of the number of copies per cell of O. cf. siamensis at several dilution levels extracted with protocols A, B, C, and D. This analysis provides information on the extraction performance of the protocols as a function of the cell concentration of D. cf. siamensis. The three analytical series are shown separately to assess the repeatability of the protocols. Each dilution was performed in triplicate (n). Ct: threshold cycle.

[0206] [Fig. 3] Figure 3 describes the means and standard deviations of the number of copies per cell of O. cf. ovata at several dilution levels extracted with protocols A, B, C, and D. This analysis provides information on the extraction performance of the protocols as a function of the cell concentration of O. cf. ovata. The four analytical series are shown separately to assess the repeatability of the protocols. Each dilution was performed in triplicate (n). Ct: threshold cycle.

[0207] [Fig.4] Fig.4 describes the means and standard deviations of the differences between two Dilution levels extracted with protocols A, B, C and D on cultures of O. cf. siamensis and O. cf. ovata. Concentration differences are expressed as base-10 logarithms. The number of analytical series (n) is indicated in the figure.

[0208] [Fig.5] Fig.5 describes the amplification curves of an O. cf. ovata plasmid standard range (number of copies) with the primer pairs SEQ ID NO: 3 / SEQ ID NO: 1 and SEQ ID NO: 3 / SEQ ID NO: 5.

[0209] [Fig. 6] Figure 6 describes the standard range for O. cf. siamensis (n=12 qPCR runs). The number of copies per dilution is transformed by a base-10 logarithm. The qPCR parameters are represented by the equation on the right (y), linearity (R²), and efficiency (E). Ct: Cycle threshold. RFU: Relative fluorescence unit.

[0210] [Fig.7] The [Fig.7] describes the standard range for O. cf. ovata (n=l 1 runs of qPCR). The number of copies per dilution is transformed by a base-10 logarithm. The qPCR parameters are represented by the equation on the right (y), linearity (R²), and efficiency (E). Ct: Cycle threshold. RFU: Relative fluorescence unit. Examples

[0211] The method deployed aims to detect and quantify Ostreopsis spp., Ostreopsis cf. siamensis, and Ostreopsis cf. ovata by qPCR from DNA extracted from cultures or environmental matrices. The DNA extraction protocol is performed using a commercial kit, the NucleoSpin Plant II Mini from Macherey-Nagel. Briefly, a sample volume (preferably 1 liter) is filtered through a 3 µm polycarbonate membrane with a diameter of 47 mm. The membrane is vortexed for 1 minute in a lysis buffer containing chaotropic agents, denaturing agents, and a detergent. The lysate is then ground in the presence of glass beads with a diameter of 0.5 mm, following 3 grinding cycles of 30 seconds at 5500 rpm interspersed with a 30-second pause, in a Precellys Evolution grinder.The DNA in the lysate is clarified on a silica membrane and then fixed to a new silica membrane using a binding buffer. It is then purified using wash buffers containing increasing concentrations of isopropanol and ethanol. The DNA is finally eluted in 100 µL of elution buffer containing 5 mM trisaminomethane. The SybrGreen qPCR protocol is from the publication by Drouet et al. (2021). The three primer pairs on the ITS-5.8 rDNA region, designed by Penna et al. (2007) or according to the invention (see Example 2), were used for the quantification of Ostreopsis spp., O. cf. siamensis, and O. cf. ovata. The qPCRs were performed on the basis of the commercial Platinum® SYBR® Green qPCR SuperMix-UDG kit (Invitrogen) of which . The reaction mix consists of 0.4 iiM of each primer, 1 Mg of MgCl2, 9 µL of SybrGreen mix, 2 µL of DNA extract, and molecular-grade water. Each qPCR run is performed with a standard range (O. cf. siamensis or O. cf. ovata, using the standard plasmids according to the invention in Example 3) and two negative controls (qPCR and extraction). The DNA extracts are loaded in simplicital mode. The amplification cycle conditions are as follows: 10 minutes at 95°C for the initial denaturation phase, followed by 40 hybridization cycles (95°C for 15 seconds, 60°C for 15 seconds, 72°C for 15 seconds including the fluorescence acquisition phase), and concludes with a 1-minute phase at 95°C. The melting curve is performed over a temperature range from 65 to 95 °C (0.5°C increment) with acquisition taking place every 5 seconds. Example 1: Improvement of the lysis step

[0212] The reference protocol and three of its variants were tested to determine the best DNA extraction method for O. cf. siamensis and O. cf. ovata. The modalities of the different protocols are represented in [Fig. 1], protocol A being the reference protocol developed by Ifremer and protocol D corresponding to the method according to the invention.

[0213] In protocol A, the membrane is placed in the lysis buffer without agitation and this is a chemical and enzymatic lysis.

[0214] In protocol B, the membrane is placed in the lysis buffer under agitation (vortexing) and this is a chemical and enzymatic lysis.

[0215] In protocol C, the membrane is placed in the lysis buffer without agitation and this is a chemical and mechanical lysis (by grinding).

[0216] Protocol D includes both placing the membrane in the lysis buffer under agitation (vortexing) for one minute and chemical and mechanical (by grinding) lysis. The yields of extracted DNA are evaluated for each experimental condition (mechanical and enzymatic lysis, with or without additional steps) carried out in triplicate on cultures of D. cf. siamensis and O. cf. ovata.

[0217] For protocols A, B, and C, the number of copies per cell is heterogeneous between dilutions. A decrease in extraction performance is observed with increasing cell concentration ([Fig. 2], [Fig. 3], and [Fig. 4]). Regarding protocol D, the number of copies per cell remains stable regardless of the dilution and appears reproducible between the different experiments conducted on the two species ([Fig. 2] and [Fig. 3]). This protocol induces less variability and allows for reliable DNA extraction ([Fig. 4]).

[0218] Protocol D is generalizable to the extraction of DNA from any microorganism, in particular any microalgae.

[0219] Example 2: Improving the detection of Ostreopsis and Ostreopsis cf. ovata using a mixture of anti-sense primers

[0220] The primer pairs used for each target microalgae to be detected, their sequence and the size of the amplicon obtained are shown in Table 1 .

[0221] [Tables 1] Primer Name Primer and Probe Sequence (5' - 3') Target Size Amp licon Ostreopsis_F AAAACGATATGAAGAGTGCAGC (SEQ ID NO: 4) 5.8S Ostreopsis sp P- 92 bp Ostreopsis_R_ dO CCARGARYAT RGCATSEQU = IDCAQY; NO: 1) Siamensis_F TGTTACCATTGCTGAGTTTG (SEQ ID NO: 2) ITS1-5.8S O. cf. siamens is 223 bp Ostreopsis_R CCAGGAGTATGCCTACATTCAA (SEQ ID NO: 5) Ovata_F CAATGCTCATGTCAATGATG (SEQ ID NO: 3) ITS1-5.8S O. cf. ovata 210 bp Ostreopsis_R_ dO CCARGARYATGCCTACATTCAA R = GouA;Y = TouC (SEQ ID NO: 1)

[0222] The primer pairs SEQ ID NO: 3 / SEQ ID NO: 1 and SEQ ID NO: 3 / SEQ ID NO: 5 were tested simultaneously on the same range of O. cf. ovata plasmids. A shift of approximately 6 Ct, or 2 log, was observed between SEQ ID NO: 3 / SEQ ID NO: 1 and SEQ ID NO: 3 / SEQ ID NO: 5 (see [Fig. 5]). The primer pair SEQ ID NO: 3 / SEQ ID NO: 1 allows for more comprehensive detection of O. cf. ovata sequences and therefore greater sensitivity in quantification.

[0223] Example 3: Improving the quantification of the microorganism using a standard plasmid

[0224] The consensus sequence for each plasmid was obtained from the 18S-ITS1-5.8S ribosomal cluster sequences extracted from the Genbank database for each of the two species. These sequences were aligned using ClustalO on Seaview and then selected based on their length and quality. The alignment for O. cf. siamensis comprises 179 sequences and 1,482 characters; the alignment for O. cf. ovata comprises 67 sequences and 1,091 characters.

[0225] A consensus sequence was performed for each of the alignments and SEQ ID NO: 2, 3 and 5 sequence primers were placed to visualize the region of interest. For each delimited region, the 5' and 3' ends were lengthened by 50 bp.

[0226] The extracted sequences are as follows: - the consensus sequence SEQ ID NO: 13 for Ostreopsis cf. siamensis, and - the consensus sequence SEQ ID NO: 14 for Ostreopsis cf. ovata.

[0227] These sequences were synthesized by the Eurofins Genomics service in a pEX-A128 plasmid. The initial copy concentration is determined from the amount of plasmids synthesized using the following formula:

[0228] Number of copies = (A x 6,022.1023) / (L x 109x660)

[0229] where A is the plasmid mass in ng, L is the length (in bases) of the plasmid comprising the consensus sequence, 6.022.1023 is Avogadro's number and 660 is the average molecular weight of a base pair.

[0230] In our case, 1.2 pg of plasmid (A) were resuspended in 100pl of molecular grade water, giving 3.95 x 1011 copies / 100pl (plasmid size: 2450 bp; fragment size: 323 bp) for O. cf. siamensis and 3.97 x 1011 copies / 100pl (plasmid size: 2450 bp; fragment size: 311 bp) for O. cf. ovata.

[0231] These plasmids allowed the establishment of new standard curves for each of the two species (see [Fig. 6] and 7). The first point of each curve is diluted to a concentration of 4.0 x 10⁶ copies.pl'. A series of 10⁻¹ dilutions is then carried out to obtain a total of 7 reference points ranging from 4.0 x 10⁶ to 4 copies.pl'.

Claims

Demands

1. A method for detecting at least one microorganism in at least one sample, comprising the following steps: a. filtering said sample, to obtain a retentate comprising microorganisms, b. extracting DNA from the microorganisms of the retentate, to obtain a solution comprising extracted DNA, c. purifying DNA from the solution comprising the extracted DNA, to obtain a purified DNA solution, d. amplifying DNA from the purified DNA solution with at least one primer pair specific to the microorganism to be detected, and e. determining the presence and / or quantifying the microorganism to be detected in the sample, characterized in that said at least one microorganism to be detected is a microalga of the genus Ostreopsis or a microalga of the species Ostreopsis cf. ovata and in that, in step d), the primer pair comprises a mixture of antisense primers of sequence SEQIDNO:

1.

2. Detection method according to claim 1, characterized in that the method comprises the detection of a microalga of the species streopsis cf. siamensis.

3. Detection method according to claim 1 or 2, characterized in that step b) of extraction comprises a chemical lysis step, to obtain a first lysate and, optionally, a mechanical lysis step of said first lysate.

4. Detection method according to claim 3, characterized in that the chemical lysis step comprises placing the filter in a container in the presence of a lysis solution, so that the filter and the retentate present on the filter are in contact with the lysis solution, and under agitation.

5. A detection method according to any one of claims 1 to 4, wherein the purification step c) comprises a clarification step and a precipitation step.

6. A detection method according to any one of claims 1 to 5, wherein step d) comprises the amplification of DNA of at least two reference samples, each reference sample comprising a known concentration of a plasmid, said plasmid comprising a consensus sequence of the microorganism to be detected.

7. Antisense primer mixture suitable for the detection of a microalga of the genus Ostreopsis and / or a microalga of the species Ostreopsis cf. ovata, characterized in that the antisense primers of said mixture comprise the sequence SEQ ID NO:

1.

8. Kit suitable for the detection of a microalga of the genus Ostreopsis of a microalga of the species Ostreopsis cf. ovata, said kit comprising the mixture of antisense primers according to claim 7.

9. Use of the antisense primer mixture according to claim 7 or the kit according to claim 8, for the detection of at least one microalga of the genus Ostreopsis and / or at least one microalga of the species Ostreopsis cf. ovata.

10. Plasmid suitable for the quantification of a microalga in a sample, said plasmid comprising the consensus sequence SEQ ID NO: 13 or SEQ ID NO: 14.