PROTEIN COMPLEXES COMPRISING A MUTANT SRC FAMILY KINASE AND A STIMULOACTIVABLE PROBE

Controllable protein complexes with SRC family kinases and stimuloactivatable probes address the challenge of immune cell functional control, enabling dynamic therapeutic strategies for cancer treatment by modulating immune cell functions.

FR3164116A1Pending Publication Date: 2026-01-09UNIVERSITE GRENOBLE ALPES +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
FR2024007258
Authority / Receiving Office
FR · FR
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-03
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

Existing cell therapies face challenges in controlling the functional pleiotropy of immune cells, particularly macrophages, due to the complexity of cellular signaling processes and the immunomodulatory effects of the tumor microenvironment, limiting their effectiveness in cancer treatment.

Method used

Development of controllable protein complexes comprising SRC family kinases and stimuloactivatable probes, allowing for spatio-temporal activation or inhibition of these kinases in immune cells, thereby modulating cellular functions such as antitumor and pro-repair responses.

Benefits of technology

Enables dynamic control of immune cell functions, reactivating desired cellular processes like antitumor responses in macrophages, providing promising therapeutic strategies for cancer treatment and prevention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000015_0000
    Figure 00000015_0000
  • Figure 00000015_0001
    Figure 00000015_0001
Patent Text Reader

Abstract

The present invention relates to an immune cell comprising a protein complex, said protein complex comprising a kinase of the SRC family and at least one stimulus-activatable probe for use as a drug. The invention also relates to protein complexes.
Need to check novelty before this filing date? Find Prior Art

Description

Title of the invention: PROTEIN COMPLEXES COMPRISING A MUTANT SRC FAMILY KINASE AND A STIMULOACTIVABLE PROBE FIELD OF INVENTION

[0001] The present invention relates to an innovative therapy. More specifically, it relates to the field of dynamic cell therapy and that implemented in the context of tumor cells. STATE OF THE ART

[0002] Cancer is a disease characterized by the abnormal and uncontrolled growth of cells in the body, which can form tumors. In France, cancer remains a major public health challenge. According to statistics, approximately 400,000 new cases of cancer are diagnosed each year, and more than 150,000 cancer-related deaths occur annually. The most common types of cancer include breast, lung, colon, and prostate cancer. Women and men are affected relatively equally, but the incidence increases with age.

[0003] Cancer treatments have evolved considerably over the years, incorporating multidisciplinary approaches. The main treatment modalities include surgery, radiotherapy, chemotherapy, immunotherapy, and targeted therapies. Surgery aims to remove the tumor, while radiotherapy uses radiation to destroy cancer cells. Chemotherapy involves the use of cytotoxic drugs, while immunotherapy mobilizes the immune system to target cancer cells. Apart from surgery, other cancer treatments help to shift cancers toward the concept of chronic diseases. This implies that these diseases result from dynamic and adaptive cellular behaviors over time. Finally, targeted therapies target specific alterations at the molecular level.The choice of treatment depends on the type of cancer, its stage, and other individual factors. Constant advances in cancer research aim to improve the effectiveness of treatments and develop more personalized approaches to combat this complex disease.

[0004] Among these new approaches, cell therapies represent an innovative category of medical treatments that exploit the properties of cells to fight against various diseases (these therapies apply to cancers but also to other pathologies).

[0005] Part of these cell-based therapeutic strategies involves reactivating immune cells specialized in the antitumor response. This antitumor response is hijacked by the tumor microenvironment's ability to suppress the targeting of cancer cells by immune cells, thus creating an immunosuppressed zone. This is the case, for example, with macrophages, which can differentiate into either antitumor cells (referred to as M1-like macrophages) or protumor cells (referred to as M2-like macrophages). Indeed, macrophages that penetrate and remain within the tumor are subjected to the tumor environment, which diverts M1-like macrophages toward M2-like macrophages (also known as TAMs for "Tumor Associated Macrophages").In this pro-tumor differentiation state, these TAM macrophages secrete multiple pro-tumor and pro-angiogenic cytokines and chemokines to facilitate the delivery of nutrients to cancer cells, thus promoting tumor growth. They also remodel the matrix surrounding cancer cells, promoting matrix regeneration to allow tumor growth and invasion of other tissues, thereby promoting metastasis. Finally, these pro-tumor macrophages contribute to immunosuppression by inhibiting T cells and Natural Killer (NK) cells and promoting the activation of regulatory T cells (Tregs), which are responsible for inhibiting immune functions. Thus, the tumor microenvironment is able to hijack the physiological response of macrophages arriving in damaged tissues to regulate repair processes.

[0006] Furthermore, the immunosuppressive zone generated by the tumor affects several other components of the immune system, in addition to macrophages. This is the case for dendritic cells, which, under normal conditions, present antigens to activate the adaptive immune system, particularly T and B cells. In the tumor context, cancer cells prevent the maturation of dendritic cells, consequently blocking the immune response. As for T and B cells, they are inhibited by the tumor microenvironment and the inhibitory effect of other immune cells. They lose their ability to detect cancer cells. In addition, the tumor's promotion of regulatory T and Breg cell activation also contributes to the inhibition of the immune system.Finally, the remaining immune cells, particularly Natural Killer (NK) cells, neutrophils, eosinophils and basophils, also suffer the inhibitory effects of this immunosuppressive zone.

[0007] The fields of cell therapy have been profoundly modified by the introduction of genetically modified cells, such as CAR-T cells in the case of liquid cancers (cancers where tumor cells are found mainly in blood or lymphatic circulation rather than as a solid tumor mass in a specific organ). Nevertheless, there is a real need to expand the range of cell therapy-based solutions, particularly in the context of cancer prevention and treatment, in order to provide healthcare teams with more options in this regard.

[0008] Dynamic cell therapies represent a field that is still largely unexplored in the context of oncology or other pathologies, such as autoimmunity, chronic inflammatory diseases, and neurodegeneration, despite their very promising prospects in the prevention and treatment of all these pathologies. Indeed, the reactivation of certain functions independently of the immune cell differentiation program and the immunomodulatory capacities of the tumor microenvironment makes it possible to envision so-called "Trojan horse" strategies to modulate and counteract the growth and adaptation dynamics of tumor cells. A real obstacle to the study and development of dynamic cell therapies is the complexity of the dynamics of cellular signaling processes combined with the pleiotropy of the cells in which these cellular processes are implemented.

[0009] The inventors were interested in the roles of all immune cells, and in particular those of macrophages, given their very high functional pleiotropy. Indeed, pathophysiological transitions, such as tumor progression or tissue repair phenomena, are characterized by a very large number of changes in which macrophages have often been described as having a key function comparable to that of a conductor. However, finely controlling the functional pleiotropy of macrophages, as well as of all immune cells, independently of their microenvironment, is a real limitation to the use of these cells in cell therapies, particularly for antitumor cell therapies.

[0010] In this context, the inventors targeted the SRC family of kinases (SFK for Src Family Kinases), many members of which are expressed in different immune cells and in the same immune cell. Macrophages can express six members (Src, Yes, Fyn, Fgr, Lyn, and Hck). This family comprises eight members (Src, Yes, and Fyn, which are ubiquitous, as well as Fgr, Blk, Lyn, Lck, and Hck) that constitute regulatory signaling proteins involved in a variety of cellular processes. Among these members is SRC, the first SRC kinase identified and from which the family is named, which plays a key role in cell signaling, growth, and differentiation. Fyn, a kinase similar to Src, is known for its regulation of cell growth, immune signaling, and synaptic plasticity in the nervous system. Yes, a kinase Similar to Src, it is involved in the regulation of cell growth. Src, Fyn, and Yes are ubiquitous kinases found in all cell types with varying levels of expression. Lyn, a kinase involved in immune signaling, regulates cell proliferation and differentiation. Hck, expressed primarily in immune system cells, participates in the regulation of the immune response. Blk, specific to B lymphocytes, regulates B cell receptor-related signaling. Fgr, similar to Fyn but expressed primarily in immune system cells, is involved in various cellular processes, including growth and differentiation. Finally, Lck, specific to T lymphocytes, plays a crucial role in T cell receptor-related signaling. However, other specific functions of each SFK in immune cells have been very little studied.The activation patterns of each member, or the mechanisms by which they are activated within each immune cell, are still poorly understood. For example, it is not yet known why macrophages express so many different members of the SCR kinase family (6 out of the 8 existing ones) compared to other immune cells.

[0011] Building on work related to chemogenetic and optogenetic approaches, which are truly revolutionary in the field of signaling biology because they allow the induction of spatial and temporal control of each of these signaling elements via the integration of genetically encoded and specifically activatable elements (for example via a small molecule or light), the inventors succeeded in creating a protein complex comprising the SRC kinase and a photosensitive probe, which was activated by light in these epithelial cells in order to demonstrate the effectiveness of the control of the spatio-temporal activation of this complex (Kerjouan et al., 2021, Control of SRC molecular dynamics encodes distinct cytoskeletal responses by specifying signaling pathway usage). DESCRIPTION OF THE INVENTION

[0012] Unexpectedly and surprisingly, the inventors succeeded in developing controllable protein complexes for each of the kinases in the SRC kinase family. These complexes can be implemented in immune cells to specifically activate or inhibit the kinase in the complex, depending on the desired cellular response within the immune cell concerned. To achieve this, the inventors deconstructed each of the SRC family kinases using synthetic biology and site-directed mutagenesis approaches. The inventors were thus able to determine, surprisingly, that each SRC family kinase does not activate the same cellular responses in immune cells, indicating that they are not completely functionally redundant.

[0013] Building on this discovery, the inventors were able to produce immune cells in which it is possible to activate or inhibit targeted cellular processes remotely and at the desired time. In other words, the protein complexes developed by the inventors allow for dynamic intracellular control of multiple cellular processes involving one or more kinases of the SRC family, thus ultimately making it possible to reactivate cellular functions of interest. For example, the inventors were able to reactivate macrophage functions of interest (antitumor, anti-inflammatory, anti-neurodegenerative, pro-repair, etc.) in a highly dynamic manner via their protein complexes.Through simple light activation (and without the addition of any exogenous activating factor), the inventors successfully mimicked the effect of pro-tumorigenic M2-like macrophages (induced by IL-4) and anti-tumorigenic M1-like macrophages (induced by lipopolysaccharide LPS) in in vitro tumor models (spheroids), thereby making the microenvironment in which the macrophages were located less conducive to tumor growth. Thus, protein complexes and immune cells comprising these complexes offer very promising prospects for the prevention and treatment of pathologies, such as cancers, via dynamic cell therapies based on the immune cells and protein complexes according to the invention.

[0014] An objective of the present invention is therefore to provide new solutions for healthcare teams in the context of dynamic cell therapies, particularly in the context of antitumor dynamic cell therapies.

[0015] Thus, the present invention relates to an immune cell comprising a protein complex, said protein complex comprising a kinase of the SRC family and at least one stimuloactivatable probe for use as a drug.

[0016] The present invention makes a real contribution to the understanding of cellular processes in immune cells involving at least one of the kinases of the SRC family. Furthermore, the invention makes a real contribution to the field of cell therapies and to the solutions available to healthcare teams for providing the most appropriate therapeutic treatment to each patient, particularly cancer patients, especially those with solid tumors for whom treatments involving dynamic cell therapies are rare.

[0017] A "protein complex" is defined as a molecular entity composed of two or more distinct proteins that interact in a specific and coordinated manner to perform a particular biological function. This complex is characterized by stable and reversible physical and biochemical bonds between the different proteins that compose it, thus creating a functional molecular structure. Proteins within the complex can play various roles, such as regulating cellular processes, transmitting signals, or carrying out specific biochemical reactions.

[0018] The term "immune cell" refers to any functional unit of the immune system, a vital component of the human body responsible for defending the organism against pathogens and maintaining cellular health. These immune cells can include various types, such as lymphocytes, monocytes, macrophages, neutrophils, and others, each with specific functions in the immune response. Immune cells can recognize and eliminate pathogens such as bacteria, viruses, and even abnormal or cancerous cells. Their ability to work in a coordinated manner and regulate the immune response is essential for preventing disease and maintaining the balance of bodily homeostasis.

[0019] The term "an SRC family kinase" means a modular protein belonging to the SRC kinase family (SFK) and comprising several functional domains. These domains include a membrane anchoring domain, an SH3 domain (Src Homology 3, facilitating protein-protein interactions by binding to proline-rich motifs, playing a role in the regulation of enzymatic activity and the assembly of protein complexes), an SH2 domain (Src Homology 2, responsible for the specific recognition of phosphotyrosine motifs, allowing the regulation of SRC kinase activity in response to cellular signals), a proline-rich region (PRR), a kinase domain (catalyzing the phosphorylation of specific tyrosine residues on substrate proteins, thereby regulating various cellular processes) and an intramolecular regulatory and binding domain at the C-terminal end.These domains together generate two intramolecular bonds whose dynamics lead to the release of the two lobes of the kinase domain, thus controlling the phosphorylation rate of substrates. These functional domains allow SRC family kinases, particularly when aggregated to form clusters, to participate in extramolecular protein-protein interactions crucial for the regulation of various biological processes, as well as to catalyze phosphorylation reactions involved in cell signaling.

[0020] In the context of the invention, the term "sthnuloactivatable probe" refers to a molecular entity designed to respond specifically to external stimuli, thereby triggering a measurable reaction or a predetermined biological function. "Stimuli" refers to any physical, chemical, or biological signals or factors that elicit a specific response in a system, whether it be an organism, a cell, or a particular mechanism. These stimuli may be The stimuli can be varied and include elements such as light, heat, chemicals, electrical signals, pressure variations, or other forms of external stimulation. The nature of the response depends on the type of stimulus and the sensitivity of the receptor system. In the context of this invention, stimuli are signals that trigger aggregation and conformational responses within the kinase of the relevant protein complex. When a probe is stimulo-activated by light, it is called a photosensitive stimulo-activated probe. Such a probe has the advantage of allowing a very high activation dynamic range (on the order of a second, and this can be sustained for several hours in vivo) and is spatially controllable. It does, however, require the implantation of an illumination system. Nevertheless, a simple LED can activate such photosensitive probes, making their use inexpensive.When a probe is stimulate-activated by the presence of one or more chemical substances, it is called a chemosensitive stimulate-activated probe. This type of probe is advantageous because it does not require the use or implantation of an activation system, but it has a lower activation dynamic range and less precise spatial control than a photosensitive stimulate-activated probe.

[0021] The term "expression vector" means any genetic vector known for implementation in genetic engineering, in particular a plasmid, a cosmid, a virus, a lentivirus, a bacteriophage, and containing the elements necessary for the transcription and translation of one of the sequences encoding the protein complexes according to the invention.

[0022] By the expression "a sequence exhibiting at least 65% identity with a reference sequence" it is understood that the sequence exhibits 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity with said reference sequence.

[0023] Preferably, the present invention relates to an immune cell for use as a medicinal product having the following technical characteristics, taken alone or in combination: - the stimuloactivatable probe is a photosensitive and / or chemosensitive probe; - said immune cell is chosen from: macrophage, T lymphocyte, NK cell, B lymphocyte, plasma cell, mast cell, dendritic cell, osteoclast, megakaryocyte, basophil, eosinophil and neutrophil;

[0024] - the SRC family kinase is selected from:

[0025] - Src, Fyn, Lyn, Hck and Fgr, when said immune cell is a macrophage,

[0026] - Lck, Fyn and Lyn, when said immune cell is a T lymphocyte,

[0027] - Fyn, Src and Lck, when said immune cell is an NK cell,

[0028] - Blk and Lyn, when said immune cell is a B lymphocyte or a plasma cell,

[0029] - Src and Lyn, when said immune cell is a mast cell,

[0030] - Src, Fyn, Lyn, Hck and Fgr, when said immune cell is a cell dendritic

[0031] - Src, Fyn, Lyn, Hck and Fgr, when said immune cell is an osteoclast,

[0032] - Src, Fyn, Lyn, Hck and Fgr, when said immune cell is a megakaryocyte,

[0033] - Lyn, when said immune cell is a basophil,

[0034] - Lyn, Hck, Fgr and Lck, when said immune cell is an eosinophil, or

[0035] - Fgr, Hck and Lyn, when said immune cell is a neutrophil; - said protein complex comprises or consists of an amino acid sequence selected from sequences SEQ ID NO: 1 to 47 or comprises or consists of a sequence exhibiting at least 65% identity with an amino acid sequence selected from sequences 1 to 47;

[0036] - said immune cell comprises several protein complexes, each protein complex comprising an SRC family kinase and at least one stimulus-activatable probe;

[0037] - the use of said immune cell as a medicinal product in the prevention or the treatment of tumor cells.

[0038] The invention also relates to a combination of at least two immune cells according to any one of the variants previously described.

[0039] The present invention also relates to a method for the prevention or treatment of tumor cells in humans comprising the implantation of at least one immune cell according to any one of the variants described above. Preferably, said method is a method for the prevention or treatment of tumor cells in humans. Advantageously, said implanted immune cell is a macrophage.

[0040] Furthermore, some of the protein complexes manufactured by the inventors are novel and inventive in themselves. As such, the present invention also relates to a protein complex comprising a kinase of the SRC family and at least one stimulus-activatable probe comprising or consisting of an amino acid sequence selected from sequences 2 to 47, or comprising or consisting of a sequence having at least 65% identity with an amino acid sequence selected from sequences 2 to 47.

[0041] The present invention also relates to a nucleic acid molecule comprising or consisting of a nucleic acid sequence selected from sequences 49 to 95 or comprising or consisting of a sequence having at least 65% identity with a nucleic acid molecule selected from sequences 49 to 95, said nucleic acid molecule encoding a protein complex according to the invention.

[0042] The present invention also relates to an expression vector comprising a nucleic acid molecule according to the invention.

[0043] The present invention also relates to a host cell comprising a protein complex according to the invention, a nucleic acid molecule according to the invention or an expression vector according to the invention.

[0044] Figure:

[0045] [Fig-1]: represents A / the two pathways of evolution of the microenvironment tumor after macrophage recruitment, B / the results of the evolution of tumor microenvironments within a 3D in vitro model and C / the results of the activation of three protein complexes according to the invention within macrophages on the evolution of a tumor microenvironment.

[0046] The present invention is illustrated in a non-limiting way by the following examples. EXAMPLES OF ACHIEVEMENTS Example 1: Materials and methods

[0047] Obtaining protein complexes and cells comprising said complexes

[0048] Cloning OptoSFKs

[0049] Each expression plasmid was constructed by amplification of the coding nucleic acid sequence of each SFK (species: chicken, mouse or human) by the high-fidelity DNA polymerase PHUSION®, the primers used for PCR are listed in "Table 1" and correspond to the sequences SEQ ID NO: 96 to 119. The said nucleic acid sequences encoding these opto-SFK protein complexes are the sequences SEQ ID NO: 1 to 23. The amplification products (amplicons) were then inserted using the Gibson assembly method (NEB) into a pSico-CRY2-mCherry vector linearized by double enzymatic digestion Nhcl / Pacl.

[0050] Lentivirus production, cell infection and line sorting

[0051] Lentiviruses were produced by co-transfection of the pC57GPBEB GagPol MLV, pSUSVSVG plasmids and each plasmid of interest using Lipofectamin2000® on HEK293 FT cells (generous donation from Dr. Nègre, ANIRA platform) plated in 6-well plates at 50% confluence. The medium was changed after 24 hours. Viral particles present in the culture supernatant were collected 72 hours later and filtered with a 0.45 µm filter. RAW 264.7 cells, a murine macrophage cell line, were plated in 6-well plates at 60% confluence on the day of infection, and the filtered supernatant was used directly to infect these cells of interest. The culture medium was then changed 24 hours after infection. After 10 days of decontamination, the cells were sorted by FACS (Aria cell sorter 2000, BD) based on the expression level of the fluorescent optoSFK mCherry using a 561nm laser.

[0052] [Tables 1] Nom primer Fwd RL primer RLfwd YF primer YF fwd OptoSrc TTATTGTGCTGTCTCATCAG CTAGCCGCCACCATGCGGC GCAGCCTGGAG 175 CCTTCTTGGTCÇTGGAGAG CGÂGACG 527 CCTTCTTGGTCCTGGAGAG ÇGAGACG TTAATTAAGATGAAGATGG ACAAA OptoHck TTA GTG AAC CGT CAG ATC CGC TAG CCG CCA CCA TGG CAA CAT TCT CM AAA C 171 CCTGG GCTCCTTCATGATCC TGGATAGCGAGÀCCAC 522 GCCAGTTCCAACAGCAGCC ATTAATT AAGATG AAG ATG GACAAA OptoFyn TFA GTG AAC CGT CAG ATC CGC TAG CCG CCA CCA TGG CACTGACGG AG6 AS 176 GGT GGT TTC ACTCTC GAG GAT AAG AAA GGT ACCTCFT6 531 CCAACCTGGTGAAAACCTG TTAATTAAGATGAAGATGG ACAAA OptoYes TTA GTG AAC CGT CAG ATC CGC TAG CCG CCA CCA TGG CAA GTC CAG CCATAA AAT AC 183 CGA GGT ATT TTC TTA GTA .CTA GAA AGT GAA ACT ACT GG 535 TTG TCC ATC TTC ATC TTA ATT AAT AAA TTTTCT CCT GGT TGG AAC TGT GG OptoBik TTATTGTGCTGTCTCATCAG CTAGCCGCCACCATGGCCA AGGAAAAGCCG 151 GŒGTAG CTCCACTGACTCACTGATTGATTGATTAA AGGTGÇC 501 TC 3 't H bTCCATCTTCATCT T AATT A AGG G CTGCAGCTC: GAACTG OptoLck TTATTGTGCTGTCTCATCAG CTAGCCGCCACCATGGCAG ATGACTGGATGG 154 cacggctccttcctcatccT GCAGAGGGAGGGGGGG55 CÀGTTCCAGCCTCAGCCTTT AATTAAGATGAAGATGGAC AAAAAGA OptoFgr TTATTGTGCTGTCTCATCAG CTAGCCGCCACCATGGCGC CGGTGGCCACG 171 CAGGGGGCCTTTCATTCATTC.T GGAAAGCGAGAGACCACCAA AGG 523 AGGCCAGCCGTCGCCAT GACAJTÀÂTTAAGATGAAG ATGGàCAààAAG Optalyn TTATTGTGCTGTCTCATCAG CTAG CCGCC ACCATG GCTA GCCTGAGCGAC 156 TTATTGTGCTGTCTCATCAG CTAGCCGCCACCATGGCTA GCCTGAGCGAC 508 CAGCCCATT AGATT GTCGATT ATGGA CAAAAAGA .

[0053] Cell Culture and Experimental Conditions

[0054] The cells were cultured at 37°C and 5% CO2 in RPMI 1640 glutamax medium (Gibco™, Thermo Fisher Scientific), supplemented with 10% fetal bovine serum (GE Healthcare) and 1% (v / v) penicillin-streptomycin (Dutscher, P06-07100) to obtain a complete RPMI medium. The BALB / c mouse colon carcinoma cell line, CT26 (from ATCC™), was kindly donated by Dr. Carole Fournier (HAINAUT team, IAB laboratory, Grenoble). These cancer cells were also cultured in a complete RPMI medium. Mouse embryonic fibroblasts (MEFs) were donated by Prof. Reinhard Fâssler (Martinsried, Germany) and were cultured in complete DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin before being co-cultured with CT26 and RAW cells in complete RPMI medium.

[0055] 3D tumor models (spheroids and organoids) were generated in ultra-low attachment (ULA) culture plates of 96 Wells (174925, Nunclon™ Sphera™ 96-Well, Thermo Fisher Scientific). Three cell lines were used: 800 cells per CT26 condition, 400 cells per MEF condition, and 400 cells per RAW (or optoSFK-RAW) condition. Cells were placed in the 96-well plate with complete RMPI. After centrifugation at 1200 rpm for 5 minutes, the cells were incubated for 7 days. Phase-contrast images were acquired on days 3, 5, and 7. LPS (LPS-EB Ultrapure, InvivoGen, tlrl-3pelps) and IL-4 (recombinant murine IL-4, Peprotech, 214-14) were used at 1.5 pg / mL and 15 ng / mL, respectively. The medium was not changed throughout the experiment. Cells expressing the OptoSFK-RAW construct were illuminated for 3 hours at 0.005 Hz light stimulation and were kept in darkness for 1 hour for rest. Example 2: Results

[0056] As previously stated, macrophages (MOs) infiltrate strongly into solid tumors (called tumor-associated macrophages - TAMs) and can be reprogrammed by the tumor microenvironment (TME) into M2-like MOs, thereby supporting tumor growth (Fig. IA). Other studies have shown that M1-like macrophages can reduce tumor size (Fig. IA). Based on the state of the art, it is extremely difficult to bypass the TME, since it very efficiently reprograms M2-like macrophages. Based on the described 3D in vitro models, a heterotypic tumor spheroid model was developed to test the ability of the protein complexes according to the invention to directly reprogram macrophages into M1-like MOs in a TME model.To achieve this, a mixed spheroid of tumor cells (CT26), fibroblasts (MEF) and macrophages (RAW), simply but effectively mimicking many features of a solid 3D tumor, was constructed (Fig. IB).

[0057] The first step was to test the model to confirm its ability to reproduce certain characteristics of the pro- or antitumor activities of macrophages. To do this, these mixed spheroids were cultured in the presence of IL-4 (inducing the differentiation of macrophages into M2-type MOs) or LPS (inducing the differentiation of macrophages into M1-type MOs). After 7 days of tumor growth, IL-4 treatment specifically increased tumor growth compared to the control, showing the M2-type protumor characteristics of RAW macrophages (Fig. IB). Conversely, LPS treatment reduced the size and homogeneity of the spheroids, thus demonstrating the ability of LPS-treated RAW macrophages to induce M1-type antitumor characteristics (Fig. IB).These highly reproducible results (n=6) confirmed the possibility of modulating tumor growth through different activations of the RAW macrophage cell line.

[0058] Using modified macrophages comprising protein complexes according to the invention (in this case, the following three optogenetic optoSFK complexes: OptoSrc, OptoHck, and OptoLyn), the inventors determined that RAW macrophages comprising the photo-activated optoSFK protein complexes reproduced pro- or antitumor activities in vitro. Using the model described above, in the presence of such RAW macrophages genetically modified to express the OptoSFK complexes, photo-stimulated for 7 days with a cyclic stimulation frequency, the experiments conducted demonstrated that:

[0059] - Activation of RAW OptoSrc macrophages induces a reproducible increase the size of the spheroids (Fig. IC), mimicking the effect of IL-4-dependent M2-type RAW macrophages;

[0060] - Activation of RAW OptoLyn macrophages reduces or blocks the growth of heterotypic spheroids (Fig. IC), mimicking the effect of LPS;

[0061] - Activation of RAW OptoHck macrophages has no significant effect on the growth of spheroids, suggesting that this structure has no pro- or antitumor activity (Fig. IC).

[0062] These experiments demonstrate that a better understanding of the cellular processes of immune cells involving at least one of the SRC family kinases ultimately makes it possible to establish and propose highly dynamic preventive and therapeutic treatment strategies based on dynamic cell therapies involving immune cells and the protein complexes according to the invention. In this regard, the inventors have highlighted the following correlations between the different members of the SRC kinase family and the associated biological processes:

[0063] - Src kinase: macrophage-dependent activation of an anti-inflammatory response and pro-regenerative tissues, control of bone degradation,

[0064] - Fyn kinase: activation of NK cells,

[0065] - kinase Yes: regulation of differentiation and self-renewal properties stem cells,

[0066] - Hck kinase: regulation of neutrophil activation,

[0067] - Kinase Fgr: regulation of lipid metabolism via macrophages,

[0068] - Kinase Blk: regulation of proliferation, differentiation and secretion of antibodies by B cells, involvement in the processes of autoimmune diseases,

[0069] - Lyn kinase: regulation of B cell functions, activation of an action antitumor activity of macrophages, regulation of mast cells, negative regulation of autoimmunity and inflammatory processes,

[0070] - Lck kinase: regulation and activation of T lymphocytes to induce a response CD4 or CD8 downstream of the TCR receptor.

Claims

Demands

1. Immune cell comprising a protein complex, said protein complex comprising an SRC family kinase and at least one stimulus-activatable probe for use as a drug.

2. Immune cell for use according to claim 1, wherein the stimulus-activatable probe is a photosensitive and / or chemosensitive probe.

3. Immune cell for use according to any one of claims 1 or 2, said immune cell being selected from: macrophage, T lymphocyte, NK cell, B lymphocyte, plasma cell, mast cell, dendritic cell, osteoclast, megakaryocyte, basophil, eosinophil and neutrophil.

4. Immune cell for use according to the preceding claim, wherein the SRC family kinase is selected from: - Src, Fyn, Lyn, Hck, and Fgr, when said immune cell is a macrophage, - Lck, Fyn, and Lyn, when said immune cell is a T lymphocyte, - Fyn, Src, and Lck, when said immune cell is an NK cell, - Blk and Lyn, when said immune cell is a B lymphocyte or a plasma cell, - Src and Lyn, when said immune cell is a mast cell, - Src, Fyn, Lyn, Hck, and Fgr, when said immune cell is a dendritic cell, - Src, Fyn, Lyn, Hck, and Fgr, when said immune cell is an osteoclast, - Src, Fyn, Lyn, Hck, and Fgr, when said immune cell is a megakaryocyte, - Lyn, when said immune cell is a basophil, - Lyn, Hck, Fgr, and Lck, when said immune cell is an eosinophil, or - Fgr, Hck and Lyn,when said immune cell is a neutrophil.

5. Immune cell for use according to any one of the preceding claims, wherein said protein complex comprises or consists of an amino acid sequence selected from sequences SEQ ID NO: 1 to 47 or comprises or consists of a sequence having at least 65% identity with an amino acid sequence selected from sequences 1 to 47.

6. Immune cell for use according to any one of the preceding claims, comprising several protein complexes, each protein complex comprising an SRC family kinase and at least one stimulus-activatable probe.

7. Immune cell for use according to any of the preceding claims, in the prevention or treatment of tumor cells.

8. Combination of at least two immune cells as defined in any of the preceding claims for use as a medicinal product.

9. Protein complex comprising an SRC family kinase and at least one stimulus-activatable probe comprising or consisting of an amino acid sequence selected from sequences 2 to 47 or comprising or consisting of a sequence exhibiting at least 65% identity with an amino acid sequence selected from sequences 2 to 47.

10. Nucleic acid molecule comprising or consisting of a nucleic acid sequence selected from sequences 49 to 95 or comprising or consisting of a sequence having at least 65% identity with a nucleic acid selected from sequences 49 to 95, said nucleic acid molecule encoding a protein complex according to claim 9.

11. Expression vector comprising a nucleic acid molecule according to claim 10.

12. Host cell comprising a protein complex according to claim 9, a nucleic acid molecule according to claim 10 or an expression vector according to claim 11.

Citation Information

Patent Citations

  • Small molecule compounds for amplifying hematopoietic stem cells, and combination thereof

    US20230027247A1

  • Optogenetic induction of neurodegenerative disease pathologies

    WO2018165293A1

  • Light-inducible protein aggregation system for modeling proteinopathies and neurodegenerative disorders

    WO2020006630A1