Methods for purification of messenger RNA

Abstract

To provide methods for purification of messenger RNA.SOLUTION: The present invention provides, among other things, a method for purifying messenger RNA (mRNA), the method comprising: (a) precipitating mRNA from an impure preparation; (b) subjecting the impure preparation containing the precipitated mRNA to a purification step comprising membrane filtration where the precipitated mRNA is captured by the membrane; and (c) eluting the captured precipitated mRNA from the membrane by resolubilization of the mRNA, thereby obtaining a purified mRNA solution. In some embodiments, the purification step comprising membrane filtration suitable for the present invention is a tangential flow filtration.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 61 / 984,503, filed April 25, 2014, the disclosure of which is incorporated herein by reference. [Background technology]

[0002] Messenger RNA therapy is becoming an increasingly important method for treating various diseases. Messenger RNA therapy involves administering messenger RNA (mRNA) to a patient in need of the therapy, and producing the protein encoded by the mRNA in the patient's body. Therefore, there is a high demand for large-scale production of high-purity and high-safety mRNA products suitable for therapeutic use.

[0003] Sequence Listing This specification makes reference to a Sequence Listing (named "Sequence listing.txt" and submitted electronically as a .txt file on April 24, 2015). The .txt file was created on April 22, 2015 and is 11,184 bytes in size. The entire contents of the Sequence Listing are incorporated herein by reference. Summary of the Invention [Means for solving the problem]

[0004] The present invention provides an improved method for the efficient purification of messenger RNA (mRNA), particularly in vitro synthesized mRNA suitable for therapeutic applications. The invention is based, in part, on the surprising discovery that a highly unusual combination, mRNA precipitation followed by membrane filtration, has led to the unexpectedly successful large-scale production of high quality mRNA.

[0005] Thus, in one aspect, the present invention provides a method for purifying messenger RNA (mRNA), comprising the steps of (a) precipitating mRNA from an impure preparation, (b) subjecting the impure preparation containing the precipitated mRNA to a purification step comprising membrane filtration, such that the precipitated mRNA is captured on a membrane, and (c) eluting the captured precipitated mRNA from the membrane by resolubilizing the mRNA, thereby obtaining a purified mRNA solution. In some embodiments, the purification step comprising membrane filtration suitable for the present invention is tangential flow filtration. In some embodiments, the purification step comprising membrane filtration suitable for the present invention is direct flow filtration.

[0006] In some embodiments, the step of precipitating the mRNA comprises treating the impure preparation with a solution containing a reagent selected from the group consisting of lithium chloride, sodium chloride, potassium chloride, guanidinium chloride, guanidinium thiocyanate, guanidinium isothiocyanate, ammonium acetate, and combinations thereof. In some embodiments, the suitable reagent is guanidinium thiocyanate.

[0007] In some embodiments, a solution suitable for mRNA precipitation contains guanidinium thiocyanate at a concentration of about 1 M or more, about 2 M or more, about 3 M or more, about 4 M or more, about 5 M or more, about 6 M or more, about 7 M or more, about 8 M or more, about 9 M or more, or about 10 M or more. In some embodiments, a solution suitable for mRNA precipitation contains guanidinium thiocyanate at a concentration of about 4 M. In some such embodiments, the suitable solution further contains sodium lauryl sarcosyl and / or sodium citrate. For example, in certain embodiments, the suitable solution for mRNA precipitation contains 4M guanidinium thiocyanate, 0.5% sodium lauryl sarcosyl, and 25 mM sodium citrate. In certain embodiments, the suitable solution for mRNA precipitation contains 4M guanidinium thiocyanate and 0.5% sodium lauryl sarcosyl. In certain embodiments, the suitable solution for mRNA precipitation contains 4M guanidinium thiocyanate and 25 mM sodium citrate.

[0008] In some embodiments, the step of precipitating the mRNA further comprises treating the impure preparation with absolute ethanol.

[0009] In some embodiments, the step of precipitating the mRNA further comprises treating the impure preparation with isopropyl alcohol.

[0010] In some embodiments, membranes suitable for the present invention are made from materials selected from the group consisting of polyethersulfone (mPES) (undiluted), polyethersulfone (mPES) hollow fiber membranes, polyvinylidene fluoride (PVDF), cellulose acetate, nitrocellulose, MCE (mixed cellulose esters), ultra-high molecular weight polyethylene (UPE), polyfluorotetraethylene (PTFE), nylon, and combinations thereof.

[0011] In some embodiments, the method further comprises washing the captured precipitated mRNA prior to elution. In some embodiments, the washing step comprises a wash solution containing guanidinium buffer and ethanol, followed by multiple rinse cycles with about 70-80% ethanol (e.g., about 70%, 75%, or 80% ethanol). In some embodiments, the multiple rinse cycles suitable for the present invention are at least 5, or more than 5 cycles (e.g., about 5-10 cycles, or about 5, 6, 7, 8, 9, or 10 cycles).

[0012] In some embodiments, the elution step involves resolubilizing the captured precipitated mRNA with RNAse-free water, which in some embodiments is recirculated for about 5-10 minutes (e.g., about 5, 6, 7, 8, 9, or 10 minutes).

[0013] In some embodiments, the method further comprises dialyzing the purified mRNA solution. In some embodiments, the purified mRNA solution is dialyzed against 1 mM sodium citrate using a 100 kDa molecular weight cut off (MWCO) membrane.

[0014] In various embodiments, the present invention may be used to purify in vitro synthesized mRNA from an impure preparation containing an in vitro mRNA synthesis reaction mixture, in some embodiments, the impure preparation contains incomplete and interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis.

[0015] In some embodiments, the purified mRNA solution contains less than about 5% (e.g., less than about 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, 0.5%, 0.1%) of unfinished and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. In certain embodiments, the purified mRNA solution contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%) of unfinished and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. In certain embodiments, the purified mRNA solution contains less than about 0.5% (e.g., less than about 0.4%, 0.3%, 0.2%, or 0.1%) of prematurely interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. In some embodiments, the purified mRNA solution contains less than about 0.1% of prematurely interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. In some embodiments, the purified mRNA solution is substantially free of prematurely interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis.

[0016] In some embodiments, uncompleted and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis are measured by silver staining, gel electrophoresis, high performance liquid chromatography (HPLC), ultra performance liquid chromatography (UPLC) and / or capillary electrophoresis.

[0017] In some embodiments, the unfinished, interrupted RNA sequence contains fewer than 15 bases (e.g., fewer than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 bases). In some embodiments, the unfinished, interrupted RNA sequence contains about 8-15, 8-14, 8-13, 8-12, 8-11, or 8-10 bases.

[0018] In some embodiments, the enzymatic reagents used in the in vitro synthesis contain T7 RNA polymerase, DNAse I, pyrophosphatase, and / or RNAse inhibitors.

[0019] In some embodiments, mRNA is purified at a scale of 1 gram, 5 gram, 10 gram, 15 gram, 20 gram, 25 gram, 30 gram, 35 gram, 40 gram, 45 gram, 50 gram, 75 gram, 100 gram, 150 gram, 200 gram, 250 gram, 300 gram, 350 gram, 400 gram, 450 gram, 500 gram, 550 gram, 600 gram, 650 gram, 700 gram, 750 gram, 800 gram, 850 gram, 900 gram, 950 gram, 1 kg, 2.5 kg, 5 kg, 7.5 kg, 10 kg, 25 kg, 50 kg, 75 kg, or 100 kg or more per batch. As shown in the examples below, batches containing purified mRNA in amounts of 10 grams or more (25 grams or more) can be easily achieved using the methods of the present invention.

[0020] In some embodiments, the mRNA is purified before a cap and / or tail is added to the mRNA. In some embodiments, the mRNA is purified after a cap and / or tail is added to the mRNA. In some embodiments, the mRNA is purified after a cap is added. In some embodiments, the mRNA is purified both before and after a cap and / or tail is added to the mRNA.

[0021] In some embodiments, the mRNA is about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more in length.

[0022] In some embodiments, the mRNA contains one or more modifications to enhance stability. In some embodiments, the one or more modifications include modified nucleotides and / or modified sugar phosphate backbones. In some embodiments, the mRNA is unmodified.

[0023] In some embodiments, the purified mRNA is greater than about 95% (e.g., about 96% In some embodiments, the purified mRNA has an integrity of about 98% or greater. In some embodiments, the purified mRNA has an integrity of about 99% or greater.

[0024] In some embodiments, the invention provides a method for purifying messenger RNA (mRNA), the method comprising: (a) precipitating mRNA from an impure preparation; (b) subjecting the impure preparation containing the precipitated mRNA to tangential flow filtration, such that the precipitated mRNA is captured by a filtration membrane while impurities are discarded by permeation; and (c) eluting the captured precipitated mRNA by resolubilizing the precipitated mRNA, thereby obtaining a purified mRNA solution.

[0025] In another aspect, the present invention provides a method for producing messenger RNA (mRNA), the method comprising synthesizing mRNA in vitro and purifying the in vitro synthesized mRNA using the methods described herein.

[0026] Among other things, the present invention also provides messenger RNA (mRNA) purified using the methods described herein.

[0027] In another aspect, the present invention also provides a batch of purified mRNA containing 5 grams or more of a single species of mRNA suitable for administration to a human subject. In some embodiments, the batch contains 10 grams or more of a single species of mRNA. In some embodiments, the batch contains 25 grams or more of a single species of mRNA. In some embodiments, the batch is substantially free of impurities from the mRNA synthesis process. In some embodiments, the batch is substantially free of unfinished and interrupted RNA sequences, DNA templates and / or enzymatic reagents used in the in vitro synthesis of the single species of mRNA. In some embodiments, the purified mRNA contains less than about 5% of the enzymatic reagents used in the in vitro synthesis. In some embodiments, the purified mRNA has an integrity of greater than about 95%.

[0028] In other embodiments, the present invention also provides compositions containing messenger RNA purified using the methods described herein.

[0029] In another aspect, the present invention also provides a composition containing in vitro synthesized messenger RNA, wherein the composition contains less than 1% prematurely interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis.

[0030] In another embodiment, the present invention also provides a composition containing in vitro synthesized messenger RNA (mRNA), wherein the mRNA has greater than or equal to 95% integrity. In certain embodiments, for example, the following items are provided: (Item 1) A method for purifying messenger RNA (mRNA), comprising: (a) precipitating mRNA from impure preparations, and (b) subjecting said impure preparation containing precipitated mRNA to a purification step comprising membrane filtration, in which said precipitated mRNA is captured on a membrane; and (c) eluting the captured precipitated mRNA from the membrane by resolubilizing the mRNA, thereby obtaining a purified mRNA solution; The method comprising: (Item 2) 2. The method according to claim 1, wherein the purification step comprising membrane filtration is tangential flow filtration. (Item 3) 2. The method according to claim 1, wherein the purification step comprising membrane filtration is direct flow filtration. (Item 4) 4. The method of any one of items 1, 2, or 3, wherein the step of precipitating mRNA comprises treating the impure preparation with a solution containing a reagent selected from the group consisting of lithium chloride, potassium chloride, guanidinium chloride, guanidinium thiocyanate, guanidinium isothiocyanate, ammonium acetate, and combinations thereof. (Item 5) 5. The method of claim 4, wherein the reagent is guanidinium thiocyanate. (Item 6) 6. The method of claim 5, wherein the solution contains 4 M guanidinium thiocyanate, 0.5% sodium lauryl sarkosyl, and 25 mM sodium citrate. (Item 7) 6. The method according to claim 5, wherein the solution contains 4 M guanidinium thiocyanate and 0.5% sodium lauryl sarkosyl. (Item 8) 6. The method of claim 5, wherein the solution contains 4 M guanidinium thiocyanate and 25 mM sodium citrate. (Item 9) 2. The method of any one of the preceding claims, wherein precipitating the mRNA comprises treating the impure preparation with absolute ethanol. (Item 10) 2. The method of any one of the preceding claims, wherein the membrane is selected from the group consisting of polyethersulfone (mPES) (undiluted), polyethersulfone (mPES) hollow fiber membrane, polyvinylidene fluoride (PVDF), cellulose acetate, nitrocellulose, MCE (mixed cellulose esters), ultra-high molecular weight polyethylene (UPE), polyfluorotetraethylene (PTFE), nylon, and combinations thereof. (Item 11) The method of any one of the preceding items, wherein the method further comprises washing the captured precipitated mRNA prior to elution. (Item 12) Item 12. The method of item 11, wherein the washing step comprises multiple rinse cycles with a washing solution containing guanidinium buffer and ethanol, followed by about 70-80% ethanol. (Item 13) Item 13. The method of item 12, wherein the multiple rinse cycles is greater than five cycles. (Item 14) 4. The method of any one of the preceding claims, wherein the elution step comprises resolubilizing the captured precipitated mRNA using RNAse-free water. (Item 15) 15. The method of claim 14, wherein the RNAse-free water is recirculated for 5 to 10 minutes. (Item 16) 2. The method of any one of the preceding claims, wherein the method further comprises the step of dialyzing the purified mRNA solution. (Item 17) 17. The method of claim 16, wherein the purified mRNA solution is dialyzed against 1 mM sodium citrate using a 100 kDa molecular weight cut-off (MWCO) membrane. (Item 18) 2. The method of any one of the preceding claims, wherein the mRNA is synthesized in vitro and the impure preparation contains an in vitro mRNA synthesis reaction mix. (Item 19) 19. The method according to item 18, wherein the impure preparation contains prematurely interrupted RNA sequences and / or enzymatic reagents used in in vitro synthesis. (Item 20) 20. The method of claim 19, wherein the purified mRNA solution contains less than 1% of unfinished and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. (Item 21) 20. The method of claim 19, wherein the purified mRNA solution contains less than 0.5% of unfinished and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. (Item 22) 20. The method of claim 19, wherein the purified mRNA solution contains less than 0.1% of unfinished and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis. (Item 23) The method according to claim 19, wherein the purified mRNA solution is substantially free of unfinished and interrupted RNA sequences and / or enzymatic reagents used in in vitro synthesis. 24. The method according to claim 23, wherein the unfinished and interrupted RNA sequences and / or enzyme reagents used in in vitro synthesis are measured by silver staining, gel electrophoresis, HPLC, UPLC, and / or capillary electrophoresis. (Item 25) 25. The method according to any one of items 19 to 24, wherein the unfinished, interrupted RNA sequence contains less than 15 bases. (Item 26) 25. The method according to any one of items 19 to 24, wherein the unfinished interrupted RNA sequence contains about 8 to 12 bases. (Item 27) 25. The method according to any one of items 19 to 24, wherein the enzyme reagent used in the in vitro synthesis contains T7 RNA polymerase, DNAse I, pyrophosphatase, and / or an RNAse inhibitor. (Item 28) 29. The method of any one of the preceding claims, wherein the mRNA is purified at a scale of 1 gram, 10 gram, 100 gram, 1 kg, 10 kg, or 100 kg or more per batch. 2. The method of any one of the preceding items, wherein the mRNA is purified before a cap and tail are added to the mRNA. (Item 30) 29. The method according to any one of items 1 to 28, wherein the mRNA is purified after a cap and a tail are added to the mRNA. (Item 31) 29. The method according to any one of items 1 to 28, wherein the mRNA is purified after being capped. (Item 32) 29. The method according to any one of items 1 to 28, wherein the mRNA is purified both before and after a cap and / or tail is added to the mRNA. (Item 33) 2. The method of any one of the preceding items, wherein the mRNA is about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more in length. (Item 34) 2. The method of any one of the preceding items, wherein the mRNA contains one or more modifications to enhance stability. (Item 35) 35. The method of claim 34, wherein the one or more modifications comprise modified nucleotides and / or modified sugar phosphate backbones. (Item 36) 34. The method according to any one of items 1 to 33, wherein the mRNA is unmodified. (Item 37) 2. The method of any one of the preceding items, wherein the purified mRNA has greater than 95% integrity. (Item 38) 2. The method of any one of the preceding items, wherein the purified mRNA has greater than 98% integrity. (Item 39) 2. The method of any one of the preceding items, wherein the purified mRNA has greater than 99% integrity. (Item 40) A method for purifying messenger RNA (mRNA), comprising the steps of: (a) precipitating mRNA from impure preparations, and (b) subjecting the impure preparation containing precipitated mRNA to tangential flow filtration such that the precipitated mRNA is captured on a filtration membrane while impurities are discarded by permeation; and (c) eluting the captured precipitated mRNA by resolubilizing the precipitated mRNA, thereby obtaining a purified mRNA solution; The method comprising: (Item 41) A method for producing messenger RNA (mRNA), comprising: synthesizing mRNA in vitro; and purifying the in vitro synthesized mRNA using the method according to any one of the preceding paragraphs; The method comprising: (Item 42) Messenger RNA (mRNA) purified using the method according to any one of the preceding items. (Item 43) A batch of purified mRNA containing 5 grams or more of a single species of mRNA suitable for administration to a human subject. (Item 44) 44. The batch according to item 43, containing 10 grams or more of a single species of mRNA. (Item 45) 44. The batch according to item 43, containing 25 grams or more of a single species of mRNA. (Item 46) 46. ​​The batch according to any one of items 42 to 45, which is substantially free of impurities from the mRNA synthesis step. (Item 47) 47. The method of claim 46, wherein the batch is substantially free of unfinished and interrupted RNA sequences, DNA templates, and / or enzymatic reagents used in the in vitro synthesis of the single species of mRNA. (Item 48) 48. The batch according to any one of items 43 to 47, wherein the purified mRNA contains less than about 5% of the enzymatic reagents used in the in vitro synthesis. (Item 49) 49. The batch according to any one of items 43 to 48, wherein the purified mRNA has an integrity of more than about 95%. (Item 50) A composition comprising messenger RNA purified using the method of any one of the preceding items. (Item 51) A composition containing in vitro synthesized messenger RNA, said composition containing less than 1% incomplete and interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis. (Item 52) A composition comprising in vitro synthesized messenger RNA (mRNA), said mRNA having greater than or equal to 95% integrity.

[0031] As used herein, the terms "about" and "approximately" are used as equivalents. All numbers used herein with or without about / approximately are intended to encompass any normal variations recognized by one of ordinary skill in the relevant art.

[0032] Other features, objects, and advantages of the present invention will become apparent in the detailed description that follows. It should be understood, however, that the detailed description, while indicating embodiments of the present invention, is given for illustrative purposes only and is not intended to be limiting. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description.

[0033] The following drawings are for illustrative purposes only and not for limiting purposes. [Brief description of the drawings]

[0034] [Figure 1] An exemplary process for large-scale purification of mRNA is illustrated, including loading, washing, and elution steps. For example, precipitated mRNA can be loaded onto a membrane such that it is captured as retentate, while soluble impurities as well as insoluble impurities below 0.22 um can be discarded by permeation. After capture, the solid precipitate is washed with various buffers and then resolubilized and eluted as a pure messenger RNA product. [Diagram 2] 1 shows an exemplary silver stained protein gel of modified Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA from one gram of initial in vitro transcription (IVT) reaction (using three elutions) and control enzymes included in the IVT reaction according to the presented method. [Diagram 3] 1 shows an exemplary silver stained protein gel of modified CFTR mRNA from 1.5 grams of an initial in vitro transcription (IVT) reaction (using 6 elutions) and control enzymes included in the IVT reaction according to the presented method. [Figure 4] 1 shows exemplary mRNA lengths in in vitro transcribed (IVT) samples of modified CFTR mRNA purified and filtered by the methods presented, as shown by agarose gel electrophoresis. The integrity of the modified CFTR mRNA after large-scale precipitation was fully maintained. [Diagram 5] 1 shows an exemplary silver stained protein gel of argininosuccinate synthetase (ASS1) mRNA from 1 gram of initial in vitro transcription (IVT) reaction (using 5 elutions) and control enzymes included in the IVT reaction according to the presented method. [Figure 6]1 shows an exemplary SYPRO stained protein gel of argininosuccinate synthetase (ASS1) mRNA from 1 gram of initial in vitro transcription (IVT) reaction (using 5 elutions) and control enzymes included in the IVT reaction according to the presented method. [Figure 7] 1 shows exemplary mRNA lengths in in vitro transcribed (IVT) samples of ASS1 mRNA purified and filtered by the presented method as shown by agarose gel electrophoresis. The integrity of ASS1 mRNA was fully maintained after large-scale precipitation. [Figure 8] FIG. 1 shows an exemplary silver stained protein gel of firefly luciferase (FFL) mRNA from the initial in vitro transcription (IVT) reaction (using either single or double precipitation) and control enzymes included in the IVT reaction according to the presented method. [Figure 9] FIG. 1 shows an exemplary SYPRO stained protein gel of firefly luciferase (FFL) mRNA from the initial in vitro transcription (IVT) reaction (using either single or double precipitation) and control enzymes included in the IVT reaction according to the presented method. [Figure 10] 1 shows exemplary mRNA lengths in in vitro transcribed (IVT) samples of firefly luciferase (FFL) mRNA purified and filtered by the presented method as shown by agarose gel electrophoresis. FFL mRNA integrity was fully maintained after large-scale precipitation and reprecipitation. [Figure 11] 1 shows an exemplary silver stained protein gel of argininosuccinate synthetase (ASS1) mRNA from the final capping and tailing reaction (using three elutions) as well as control enzymes included in the capping and tailing reactions. [Figure 12] Figure 1 shows an exemplary final ASS1 mRNA length purified and filtered by the presented method as shown by agarose gel electrophoresis. The integrity of ASS1 mRNA was fully maintained after large-scale precipitation and reprecipitation. [Figure 13]Exemplary luminescence observed in cell lysates of FFL mRNA-treated HEK293T cells. Cells were harvested 24 hours post-transfection. Comparison of translational potential of vendor-produced mRNA, spin-column purified mRNA (commercial kit), and precipitate-TFF purified FFL mRNA is shown. [Figure 14] Illustrates the levels of exemplary CFTR protein observed in cell lysates of HEK293T cells transfected with hCFTR mRNA. Cells were harvested 24 hours after transfection. A comparison of the translational potential of TFF-purified mRNA and spin column (commercial kit) hCFTR mRNA is shown. [Figure 15] Exemplary mRNA lengths from in vitro transcribed (IVT) samples of argininosuccinate synthetase (ASS1) mRNA purified and filtered by the methods presented are shown. The integrity of ASS1 mRNA was fully maintained after large-scale (5 gram) precipitation. [Figure 16] Exemplary mRNA (before and after capping / tailing) lengths from an in vitro transcribed (IVT) sample of argininosuccinate synthetase (ASS1) mRNA purified and filtered by the method presented are shown. The integrity of ASS1 mRNA was fully maintained after large-scale (5 gram) precipitation. [Figure 17] 1 shows an exemplary silver stained protein gel of argininosuccinate synthetase (ASS1) mRNA after final purification (5 grams) by the method presented, as well as the control enzymes included in the reaction. [Figure 18] Figure 1 shows an exemplary human ASS1 protein product observed in cell lysates of HEK293T cells treated with ASS1 mRNA. Cells were harvested 24 hours after transfection. A comparison of the translational potential of spin-column purified mRNA (commercial kit) and precipitate-TFF purified ASS1 mRNA (5 grams) is shown. [Figure 19]1 shows exemplary mRNA lengths (before and after capping / tailing) in an in vitro transcribed (IVT) sample of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA purified and filtered by the presented method as shown by agarose gel electrophoresis. The integrity of CFTR mRNA was fully maintained after large-scale (10 gram) precipitation. [Figure 20] 1 shows an exemplary silver stained protein gel of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA after final purification (10G) by the presented method as well as control enzymes included in the reaction. [Figure 21] 1 shows exemplary CFTR protein levels observed in cell lysates of HEK293T cells transfected with hCFTR mRNA from large-scale production and purification. Cells were harvested 24 hours post-transfection. [Figure 22] FIG. 1 shows exemplary mRNA lengths in in vitro transcription (IVT) samples from a 25 gram scale production of argininosuccinate synthetase (ASS1) mRNA. The integrity of ASS1 mRNA was fully maintained after large scale (25 gram) isolation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0035] definition In order that this invention may be more readily understood, a number of terms are first defined below. Additional definitions of the following terms, as well as other terms, are set forth throughout the specification.

[0036] Animal: As used herein, the term "animal" refers to any species of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs, etc.). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, animals may be transgenic animals, genetically engineered animals, and / or clones.

[0037] Approximately or about: As used herein, "approximately" or "about" when applied to one or more values ​​of interest refers to a value similar to a specified reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction of the specified reference value (greater than the specified reference value or less than the specified reference value), unless otherwise stated or otherwise clear from the context (except when such value exceeds 100% of possible values).

[0038] Biologically active: As used herein, the phrase "biologically active" refers to the property of any agent that has activity in a biological system, particularly in an organism. For example, an agent that has a biological effect on an organism when administered to the organism is considered to be biologically active.

[0039] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into a complete protein, and / or the post-translational modification of a polypeptide or a fully assembled protein. In this application, the terms "expression" and "production," as well as grammatically equivalent terms, are used interchangeably.

[0040] Functional: As used herein, a "functional" biological molecule is one that is in a form in which it exhibits a property and / or activity by which it is characterized.

[0041] Improve, increase, or decrease: As used herein, "improve," "increase" or "decrease" or grammatical equivalents refer to a value relative to a reference measurement, such as, for example, a measurement in the same individual prior to the initiation of a treatment described herein or a measurement in a control subject(s) not receiving a treatment described herein. A "control subject" is a subject suffering from the same form of the disease for which the subject is being treated, and who is about the same age as the subject being treated.

[0042] Impurity: As used herein, the term "impurity" refers to a limited amount of liquid, gas or solid substance that differs from the chemical composition of the target substance or compound. Impurities are also referred to as contaminants.

[0043] In vitro: As used herein, the term "in vitro" refers to events that take place not inside a multicellular organism but in an artificial environment, such as, for example, in a test tube or reactor, in cell culture, etc.

[0044] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism, such as humans and non-human animals. In the context of cell-based systems, the term may be used to refer to events that occur within living cells (as opposed to, for example, in an in vitro system).

[0045] Isolated: As used herein, the term "isolated" refers to substances and / or entities that are (1) separated from at least some of the components that accompany them when they are originally produced (either in a natural environment and / or in an experimental setting) and / or (2) produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% of the other components with which they are originally associated. In some embodiments, an isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, calculations of percent purity of an isolated substance and / or entity are intended to exclude additives (e.g., buffers, solvents, water, etc.).

[0046] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions.

[0047] mRNA integrity: As used herein, the term "mRNA integrity" generally refers to the quality of mRNA. In some embodiments, mRNA integrity refers to the percentage of mRNA that is not degraded after a purification step (e.g., tangential flow filtration). mRNA integrity may be determined using methods known in the art, for example, by RNA agarose gel electrophoresis (e.g., Ausubel et al., John Weley & Sons, Inc., 1997, Current Protocols in Molecular Biology).

[0048] Nucleic Acid: As used herein, the term "nucleic acid" is used in its broadest sense to refer to all compounds and / or molecules that are or can be incorporated into a polynucleotide chain. or substances. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain containing individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA, as well as single-stranded and / or double-stranded DNA and / or cDNA. Furthermore, the terms "nucleic acid", "DNA", "RNA" and / or similar terms include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, so-called "peptide nucleic acids" are known in the art, which have peptide bonds instead of phosphodiester bonds in the backbone, and are considered within the scope of the present invention. The term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and / or that encode the same amino acid sequence. Nucleotide sequences encoding proteins and / or RNA may include introns. Nucleic acids can be purified from natural sources, can be produced using recombinant expression systems, and can be optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can include, e.g., nucleoside analogs having chemically modified bases or sugars, backbone modifications, etc. Nucleic acid sequences are presented in the 5' to 3' direction unless otherwise indicated.In some embodiments, the nucleic acid may be selected from natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 The nucleic acid may be or contain a nucleic acid sequence that is, for example, an alpha-, beta-, beta-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine, chemically modified bases, biologically modified bases (e.g., methylated bases), inserted bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages). In some embodiments, the present invention is specifically directed to "unmodified nucleic acids," which refers to nucleic acids (e.g., polynucleotides, including nucleotides and / or nucleosides, as well as residues) that have not been chemically modified to facilitate or effect delivery.

[0049] Patient: As used herein, the term "patient" or "subject" refers to any organism to which the provided compositions may be administered for experimental, diagnostic, preventative, cosmetic and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates and / or humans). In some embodiments, the patient is a human. Human includes pre- and post-natal forms.

[0050] Pharmaceutically acceptable: As used herein, the term "pharmacologically acceptable" refers to a material that is suitable, within the scope of sound medical judgment, for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0051] Prematurely Aborted RNA Sequence: As used herein, the term "prematurely aborted RNA sequence" refers to an incomplete product of an mRNA synthesis reaction (e.g., an in vitro synthesis reaction). For a variety of reasons, RNA polymerase does not always transcribe the DNA template completely, i.e., RNA synthesis is terminated prematurely. Premature termination of RNA synthesis Possible reasons for closure include DNA template quality, polymerase termination sequences for the specific polymerase present in the template, degraded buffer, temperature, depletion of ribonucleotides, and secondary structure of mRNA. Prematurely terminated RNA sequences can be any length that is shorter than the expected length of the desired transcript. For example, prematurely terminated mRNA sequences can be less than 1000 bases, less than 500 bases, less than 100 bases, less than 50 bases, less than 40 bases, less than 30 bases, less than 20 bases, less than 15 bases, less than 10 bases, or shorter.

[0052] Salt: As used herein, the term "salt" refers to an ionic compound that results or can result from the neutralization reaction between an acid and a base.

[0053] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human. A subject may be a patient, which refers to a human presenting to a health care provider for diagnosis of disease or treatment. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be suffering from or susceptible to a disease or disorder, and may or may not exhibit symptoms of the disease or disorder.

[0054] Substantially: As used herein, the term "substantially" refers to a qualitative state exhibiting a complete or nearly complete degree or extent of a feature or characteristic of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, reach completion and / or proceed to a perfect state or achieve or avoid a perfect result. Thus, the term "substantially" is used herein to express the possible lack of completeness inherent in many biological and chemical phenomena.

[0055] Substantially free: As used herein, the term "substantially free" refers to a state in which the material to be removed (e.g., prematurely interrupted RNA sequences) is present in relatively low amounts or is completely absent. For example, "substantially free of prematurely interrupted RNA sequences" means that the prematurely interrupted RNA sequences are present at approximately less than 5%, less than 4%, less than 3%, less than 2%, less than 1.0%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1% or less levels (w / w) of impurities. Alternatively, "substantially free of prematurely interrupted RNA sequences" means that the prematurely interrupted RNA sequences are present at levels of less than about 100 ng, less than 90 ng, less than 80 ng, less than 70 ng, less than 60 ng, less than 50 ng, less than 40 ng, less than 30 ng, less than 20 ng, less than 10 ng, less than 1 ng, less than 500 pg, less than 100 pg, less than 50 pg, less than 10 pg or less.

[0056] Detailed Description The present invention provides, inter alia, an improved method for purifying mRNA from impure preparations (e.g., in vitro synthesis reaction mixtures) based on a process involving precipitation of the mRNA followed by membrane filtration (e.g., tangential flow filtration).

[0057] Various aspects of the present invention are described in detail in the following sections. The use of the sections is not meant to limit the present invention. Each section may be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise indicated.

[0058] Synthesis of mRNA Any mRNA may be purified using the present invention. mRNA is generally considered to be a type of RNA that carries information from DNA to ribosomes. The existence of mRNA is generally very short and involves processing, translation, and subsequent degradation. Generally, in eukaryotic organisms, processing of mRNA involves the addition of a "cap" on the N-terminal (5') end and a "tail" on the C-terminal (3') end. A typical cap is the 7-methylguanosine cap, which is a guanosine attached to the first transcribed nucleotide via a 5'-5'-triphosphate bond. The presence of a cap is important in that it provides resistance to nucleases that are present in most eukaryotic cells. The tail is generally a polyadenylation event, whereby a polyadenylyl moiety is added to the 3' end of the mRNA molecule. The presence of this "tail" provides protection of the mRNA from exonuclease degradation. Messenger RNA is translated by ribosomes into a series of amino acids that form proteins.

[0059] The mRNA of the present invention may be synthesized by any of a variety of known methods. For example, the mRNA of the present invention may be synthesized by in vitro transcription (IVT). Briefly, IVT typically involves the synthesis of a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6). The purification is carried out using a variety of reagents, including but not limited to RNA polymerase, DNAse I, pyrophosphatase, and / or RNAse inhibitors. The exact conditions may vary depending on the particular application. The presence of these reagents is undesirable in the final product according to some embodiments and therefore may be referred to as impurities, and preparations containing one or more of these impurities may be referred to as impure preparations.

[0060] According to various embodiments, the present invention may be used to purify in vitro synthesized mRNAs of various lengths. In some embodiments, the present invention may be used to purify in vitro synthesized mRNAs of lengths of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention may be used to purify in vitro synthesized mRNAs ranging in length from about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, or about 8 to 15 kb. For example, a typical mRNA may be about 1 kb to about 5 kb in length. More typically, mRNA has a length of about 1 kb to about 3 kb. However, in some embodiments, the mRNA in the compositions of the invention is much longer (greater than about 20 kb). In some embodiments, the invention may be used to purify mRNA that contains one or more modifications that generally enhance stability. In some embodiments, the one or more modifications are selected from modified nucleotides, modified sugar phosphate backbones, 5' and / or 3' untranslated regions. In some embodiments, the invention may be used to purify unmodified in vitro synthesized mRNA.

[0061] Typically, mRNA is modified to enhance stability. Modifications of mRNA include, for example, modifications of the nucleotides of the RNA. Thus, modified mRNA according to the present invention may contain, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, the mRNA encoding an antibody (e.g., mRNA encoding a heavy and light chain) may contain, but is not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as amino acids such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl ... 6-Isopentenyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methyl The nucleotides may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), including .beta.-D-mannosyl-uracil, 5-aminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine, wybutoxosine and modified nucleotide analogs or derivatives of purines and pyrimidines, such as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated herein by reference in their entirety.

[0062] Generally, the synthesis of mRNA involves the addition of a "cap" on the N-terminal (5') end and a "tail" on the C-terminal (3') end. The presence of the cap is important in that it provides resistance to nucleases that are present in most eukaryotic cells. The presence of the "tail" provides protection of the mRNA from exonuclease degradation.

[0063] Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is generally added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates. Guanosine triphosphate (GTP) is then added to the terminal phosphate via guanylyltransferase, forming a 5'5'5 triphosphate linkage. The 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5'(A,G(5')ppp(5')A, and G(5')ppp(5')G.

[0064] While in some embodiments, mRNA synthesized from an in vitro transcription reaction may be desirable, mRNA from other sources is also contemplated to be within the scope of the invention, including wild-type mRNA produced from bacteria, fungi, plants and / or animals.

[0065] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region contains one or more elements that affect mRNA stability or translation, such as, for example, an iron responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0066] In some embodiments, the 3' untranslated region may contain a polyadenylation signal, a binding site for a protein that affects the stability of the subcellular localization of the mRNA, or a binding site for an miRNA. In some embodiments, the 3' untranslated region can be 50 to 500 or more nucleotides in length.

[0067] The present invention may be used to purify mRNA encoding a variety of proteins, non-limiting examples of which are described in detail in the Examples for the purification of mRNA encoding firefly luciferase, argininosuccinate synthetase, Factor IX, and CFTR.

[0068] Typically, the present invention is used to purify a single species of mRNA, i.e., the purified mRNA preparation contains mRNA derived from one gene or from a single synthetic or expression construct In contrast, total mRNA purified from a cell contains multiple species of mRNA.

[0069] Purification steps according to the invention may occur during synthesis or subsequently after synthesis. For example, the mRNA may be purified as described herein before a cap and / or tail is added to the mRNA. In some embodiments, the mRNA is purified after a cap and / or tail is added to the mRNA. In some embodiments, the mRNA is purified after a cap is added. In some embodiments, the mRNA is purified both before and after a cap and / or tail is added to the mRNA. In general, the purification steps described herein may occur after each step of mRNA synthesis, optionally with other purification steps, such as, for example, dialysis. For example, the mRNA may undergo dialysis after initial synthesis (e.g., with or without a tail) to remove shortmers, then be subjected to precipitation and purification as described herein, and then purified by precipitation and purification again after addition of a cap and / or tail.

[0070] mRNA precipitation According to the present invention, mRNA may be precipitated from impure preparations, such as in vitro synthesis reaction mixtures, using various precipitation methods known in the art. As used herein, the term "precipitation" (or any grammatical equivalent thereof) refers to the formation of a solid in a solution. When used in relation to mRNA, the term "precipitation" refers to the formation of an insoluble or solid form of mRNA in a liquid.

[0071] Any method suitable for precipitation of mRNA can be used to carry out the present invention. Typically, precipitation of mRNA includes denaturing conditions. As used herein, the term "denaturing conditions" refers to any chemical or physical condition that can cause the destruction of the native conformation of mRNA. Since the native conformation of a molecule is usually the most water-soluble, destruction of the secondary or tertiary structure of a molecule can cause changes in solubility and cause precipitation of mRNA from solution.

[0072] For example, a suitable method for precipitation of mRNA from an impure preparation involves treating the impure preparation with a denaturing reagent that precipitates the mRNA. Examples of denaturing reagents suitable for the present invention include, but are not limited to, lithium chloride, sodium chloride, potassium chloride, guanidinium chloride, guanidinium thiocyanate, guanidinium isothiocyanate, ammonium acetate, and combinations thereof. Suitable reagents may be supplied in solid form or in solution.

[0073] As a non-limiting example, guanidinium thiocyanate may be used to precipitate mRNA. Typically, guanidinium thiocyanate may be provided in solution at a concentration of about 1M or more, about 2M or more, about 3M or more, about 4M or more, about 5M or more, about 6M or more, about 7M or more, about 8M or more, about 9M or more, or about 10M or more. In some embodiments, a solution suitable for mRNA precipitation contains guanidinium thiocyanate at a concentration of about 4M.

[0074] In addition to the denaturing reagent, the solution suitable for precipitation of mRNA may contain additional salts, detergents, and / or buffers. For example, the suitable solution may further contain sodium lauryl sarkosyl and / or sodium citrate. As a non-limiting example, the solution suitable for mRNA may contain 4M guanidinium thiocyanate, 0.5% sodium lauryl sarkosyl, and 25mM sodium citrate, or 4M guanidinium thiocyanate and 0.5% sodium lauryl sarkosyl, or 4M guanidinium thiocyanate and 25mM sodium citrate.

[0075] Typically, it is desirable to incubate the impure preparation with one or more of the denaturing reagents described herein for a period of time at a desired temperature that allows for precipitation of a substantial amount of mRNA. For example, the mixture of the impure preparation and the denaturing agent may be incubated at room temperature or ambient temperature for a period of time. Typically, suitable incubation times are for a period of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, or 60 minutes or more. In some embodiments, suitable incubation times are for a period of about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 minutes or less. In some embodiments, the mixture is incubated at room temperature for about 5 minutes. Typically, "room temperature" or "ambient temperature" refers to a temperature in the range of about 20-25°C, such as, for example, about 20°C, 21°C, 22°C, 23°C, 24°C, or 25°C. In some embodiments, the mixture of impure preparation and denaturant may be incubated at a temperature higher than room temperature (e.g., about 30-37°C, or particularly about 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C) or at a temperature lower than room temperature (e.g., about 15-20°C, or particularly about 15°C, 16°C, 17°C, 18°C, 19°C, or 20°C). The incubation period may be adjusted based on the incubation temperature. Typically, higher incubation temperatures require shorter incubation times.

[0076] Alternatively, or in addition, a solvent may be used to facilitate mRNA precipitation. Examples of suitable solvents include, but are not limited to, isopropyl alcohol, acetone, methyl ethyl ketone, methyl isobutyl ketone, ethanol, methanol, denatonium, and combinations thereof. For example, a solvent (e.g., absolute ethanol) may be added to the impure preparation along with a denaturant described herein, or after the addition and incubation of the denaturant, to further enhance and / or facilitate mRNA precipitation. Typically, after the addition of a suitable solvent (e.g., absolute ethanol), the mixture may be incubated at room temperature for a new period of time. Typically, a suitable incubation period is about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, or 60 minutes or more. In some embodiments, a suitable incubation period is about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 minutes or less. Typically, the mixture is incubated again at room temperature for about 5 minutes. Temperatures above or below room temperature may be used with appropriate adjustment of incubation time. Alternatively, incubation for precipitation may be performed at 4°C or -20°C.

[0077] Typically, the methods described herein result in the precipitation of a substantial amount of mRNA from an impure preparation. In some embodiments, the methods described herein result in the precipitation of at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total mRNA from an impure preparation. In some embodiments, the methods described herein result in the precipitation of substantially 100% of the total mRNA from an impure preparation.

[0078] Membrane filtration According to the present invention, an impure preparation containing precipitated mRNA is purified by subjecting the precipitated mRNA to The impure preparation may be subjected to a purification step including membrane filtration, where the impure preparation is captured or retained on a membrane. Thus, in some embodiments, the impure preparation is subjected to membrane filtration after precipitation without prior treatment to remove insoluble matter.

[0079] Various types of membrane filtration may be used to capture or retain precipitated mRNA. Typically, membrane filtration involves separating solids from liquids using one or more intercalated permeable membranes. Membrane filtration may also be used to filter particles from gaseous samples. Generally speaking, there are two main forms of membrane filtration: passive filtration, which proceeds simply by diffusion of the solution, and active filtration, which uses positive or negative pressure (i.e., vacuum) to force liquids or gases through a membrane.

[0080] An example of a process involving membrane filtration for purifying mRNA is shown in Figure 1. Typically, such a process includes loading, washing and elution steps.

[0081] load Typically, the loading step involves loading the feed (e.g., an impure preparation containing precipitated mRNA) onto the membrane, forcing the feed through by positive or negative pressure, and capturing or retaining the retentate on the membrane. As used herein, the term "retentate" refers to any non-permeable solute and / or insoluble material that is retained by the membrane. According to the present invention, precipitated mRNA is captured on the membrane as the retentate. As used herein, the term "membrane" refers to any porous layer or sheet of material. In this application, the term "membrane" is used interchangeably with filter.

[0082] In some embodiments, a suitable membrane has a pore size suitable for trapping or retaining the precipitated mRNA while allowing impurities (including soluble impurities and / or insoluble impurities smaller than the size of the pores) to pass through. In some embodiments, a suitable membrane has an average pore size of about 0.10 μm, 0.20 μm, 0.22 μm, 0.24 μm, 0.26 μm, 0.28 μm, 0.30 μm, 0.40 μm, 0.50 μm, or 1.0 μm or more. In certain embodiments. A suitable membrane has an average pore size of about 0.22 μm. In certain embodiments, the pore size suitable for retaining the precipitated mRNA can be determined by the nominal molecular weight limits (NMWL), also referred to as molecular weight cut off (MWCO), of the precipitated mRNA. Typically, a membrane with a pore size smaller than the NMWL or MWCO of the precipitated mRNA is used. In some embodiments, a membrane with a pore size between 2-6 (eg, 2, 3, 4, 5, or 6) times smaller than the NMWL or MWCO of the precipitated mRNA is used. In some embodiments, membranes suitable for the present invention may have pore sizes of about 100 kilodaltons (kDa), 300 kDa, 500 kDa, 1,000 kDa, 1,500 kDa, 2,000 kDa, 2,500 kDa, 3,000 kDa, 3,500 kDa, 4,000 kDa, 4,500 kDa, 5,000 kDa, 5,500 kDa, 6,000 kDa, 6,500 kDa, 7,000 kDa, 7,500 kDa, 8,000 kDa, 8,500 kDa, 9,000 kDa, 9,500 kDa, or 10,000 kDa or greater.

[0083] Membranes suitable for the present invention may be made from any material. Exemplary membrane materials include, but are not limited to, polyethersulfone (mPES) (undiluted), polyethersulfone (mPES) hollow fiber membrane, polyvinylidene fluoride (PVDF), cellulose acetate, nitrocellulose, MCE (mixed cellulose esters), ultra-high molecular weight polyethylene (UPE), polyfluorotetraethylene (PTFE), nylon, polysulfone, polyethersulfone, polyacrylonitrile, polypropylene, polyvinyl chloride, and combinations thereof.

[0084] Membranes suitable for the present invention may have a variety of surface areas. In some embodiments, a suitable membrane has a surface area large enough to facilitate large-scale production of mRNA. For example, a suitable membrane may have a surface area of ​​about 2,000 cm. 2 , 2,500cm 2 , 3,000cm 2 , 3,500cm 2 , 4,000cm 2 , 4,500cm 2 , 5,000cm 2 , 7,500cm 2 , 10,000cm 2 , 5m 2 , 10m 2 , 12m 2 , 15m 2 , 20m 2 , 24m 2 , 25m 2 , 30m 2 , or 50m 2 The surface area may be greater than or equal to 100 nm.

[0085] Membrane filtration may be performed in a variety of formats to capture precipitated mRNA, hi some embodiments, membrane filtration is performed as part of tangential flow filtration (TFF).

[0086] Tangential flow filtration (TFF), also called cross-flow filtration, is a type of filtration in which the material to be filtered moves tangentially across the filter rather than through it. In TFF, undesired permeate passes through the filter, while desired retentates (e.g., precipitated mRNA) pass along the filter and are captured or retained on the filter or membrane downstream.

[0087] The main advantage of tangential flow filtration is that the non-permeable residue (sometimes referred to as "filter cake") that may aggregate and plug the filter in traditional "dead-end" filtration is instead swept along the filter surface. This advantage makes tangential flow filtration particularly suitable for large-scale purification of precipitated mRNA. In some embodiments, throughputs of about 1 gram, 10 grams, 50 grams, 100 grams, 200 grams, 300 grams, 400 grams, 500 grams, 600 grams, 700 grams, 800 grams, 900 grams, 1 kg, 5 kg, 10 kg, 50 kg, or 100 kg or more of mRNA per batch may be applied.

[0088] At least three process variables are important in a typical TFF process: transmembrane pressure, feed rate, and permeate flow rate. Transmembrane pressure is the force that forces a liquid through a filter, carrying with it permeable molecules. In some embodiments, the transmembrane pressure is greater than or equal to 1 pound per square inch (psi) and less than or equal to 30 pounds per square inch (psi).

[0089] The feed rate (also known as the cross-flow rate) is the rate of flow of the solution through the feed channel and across the filter. The feed rate determines the force that sweeps away molecules that may block or clog the filter, thereby limiting the filtration rate. In some embodiments, the feed rate is 1-500 L / min. In some embodiments, the feed rate is 50-800 mL / min. In some embodiments, the feed rate is 50-750 mL / min. In some embodiments, the feed rate is 50-300 mL / min. In some embodiments, the feed rate is 50-200 mL / min. In some embodiments, the feed rate is 75-200 mL / min. In some embodiments, the feed rate is 100-200 mL / min. In some embodiments, the feed rate is 125-175 mL / min. In some embodiments, the feed rate is 130 mL / min. In some embodiments, the feed rate is 60 mL / min to 220 mL / min. In some embodiments, the feed rate is 60 mL / min or more. In some embodiments, the feed rate is 100 mL / min or more. In some embodiments, the feed rate is 150 mL / min or more. In some embodiments, the feed rate is 200 mL / min or more. In some embodiments, the feed rate is 220 mL / min or more.

[0090] Permeate flow rate is the rate at which permeate is removed from the system. For a constant feed rate, increasing the permeate flow rate can increase the pressure through the filter, which While this increases the filtration rate, it may also increase the risk of filter blockage or clogging. The principles, theory, and equipment used in TFF are described in "Tangential Flow Filtration" by Michaels et al. in Separations Technology, Pharmaceutical and Biotechnology Applications (WP Olson (ed.), Interpharm Press, Inc., Buffalo Grove, Ill. 1995). Also see U.S. Patent Nos. 5,256,294 and 5,490,937 for a description of high-pressure tangential flow filtration (HP-TFF), which describes improvements to TFF. In some embodiments, the flow rate is 1-100 L / min. In some embodiments, the flow rate is 10-100 mL / min. In some embodiments, the flow rate is 10-90 mL / min. In some embodiments, the flow rate is 10-80 mL / min. In some embodiments, the flow rate is 10-70 mL / min. In some embodiments, the flow rate is 10-60 mL / min. In some embodiments, the flow rate is 10 to 50 mL / min. In some embodiments, the flow rate is 10 to 40 mL / min. In some embodiments, the flow rate is 20 to 40 mL / min. In some embodiments, the flow rate is 30 mL / min.

[0091] Any combination of the various process variables described herein may be used. In some embodiments, the tangential flow filtration is performed at a feed rate of about 100-200 mL / min (e.g., about 100-180 mL / min, 100-160 mL / min, 100-140 mL / min, 110-190 mL / min, 110-170 mL / min, or 110-150 mL / min) and / or a flow rate of about 10-50 mL / min (e.g., about 10-40 mL / min, 10-30 mL / min, 20-50 mL / min, or 20-40 mL / min). In some embodiments, the tangential flow filtration is performed at a feed rate of about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mL / min, and / or a flow rate of about 10, 20, 30, 40, or 50 mL / min. In other embodiments, the tangential flow filtration is performed at a feed rate of about 500, 750 mL / min, 1, 2, 3, 4, or 5 L / min, and / or a flow rate of 100, 200, 250, 500, 750 mL / min, or 1 L / min.

[0092] Washing Typically, the captured insoluble mRNA may be washed prior to elution to remove impurities retained on the membrane. In some embodiments, the washing step includes multiple rinse cycles with one or more wash solutions. For example, the washing step may be performed with guanidinium buffer and ethanol followed by multiple rinse cycles with 70-80% ethanol (e.g., about 70%, 75%, or 80% ethanol). In certain embodiments, the multiple rinse cycles are more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, or more than 10 cycles.

[0093] Elution Typically, the captured or retained mRNA is eluted by resolubilizing the precipitated mRNA back into solution. For example, the captured mRNA may be eluted using RNAse-free water. In certain embodiments, elution of the captured mRNA includes recirculating the RNAse-free water. For example, the RNAse-free water may be circulated for about 5-30 minutes (e.g., about 5-25 minutes, about 5-20 minutes, or about 5-15 minutes). In certain embodiments, the RNAse-free water is recirculated for about 5-10 minutes (e.g., about 5, 6, 7, 8, 9, or 10 minutes).

[0094] In some embodiments, the resolubilized mRNA is lysed with a desired sequence at a desired concentration. The purified mRNA solution may be dialyzed into a combined composition. Various combined compositions may be used for dialysis. In some embodiments, the purified mRNA solution is dialyzed with 1 mM sodium citrate. In some embodiments, the purified mRNA solution is dialyzed with sodium acetate, ammonium carbonate, ammonium bicarbonate, pyridinium acetate, pyridinium formate, ammonium acetate, urea, potassium chloride, etc. Depending on the size of the target mRNA, a dialysis membrane with an appropriate molecular weight cut-off (MWCO) may be used. For example, a suitable dialysis membrane may have a MWCO of about 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, 450 kDa, or 500 kDa.

[0095] Characterization of purified mRNA A particular advantage provided by the present invention is the ability to purify mRNA, particularly in vitro synthesized mRNA, on a large scale or industrial scale. For example, in vitro synthesized mRNA can be purified at a scale of about 1 gram, 1 gram, 10 gram, 50 gram, 100 gram, 200 gram, 300 gram, 400 gram, 500 gram, 600 gram, 700 gram, 800 gram, 900 gram, 1 kg, 5 kg, 10 kg, 50 kg, or 100 kg or more per batch. In one particular embodiment, in vitro synthesized mRNA can be purified at a scale of 10 grams per batch. In another particular embodiment, in vitro synthesized mRNA can be purified at a scale of 100 grams per batch. In yet another particular embodiment, in vitro synthesized mRNA can be purified at a scale of 1 kg per batch.

[0096] In various embodiments, mRNA purified by the present invention is substantially free of impurities from the mRNA synthesis process, including, but not limited to, prematurely terminated RNA sequences, DNA templates and / or enzymatic reagents used in the in vitro synthesis.

[0097] In particular, the present invention provides high removal or elimination of prematurely interrupted RNA sequences (also known as "shortmers"). In some embodiments, the methods according to the present invention remove more than about 90%, 95%, 96%, 97%, 98%, 99%, or substantially all prematurely interrupted RNA sequences. In some embodiments, mRNA purified by the present invention is substantially free of prematurely interrupted RNA sequences. In some embodiments, mRNA purified by the present invention contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) prematurely interrupted RNA sequences. In some embodiments, mRNA purified by the present invention contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) prematurely interrupted RNA sequences. In some embodiments, mRNA purified by the present invention contains uncompleted, interrupted RNA sequences below the limit of detection, e.g., as measured by ethidium bromide staining and / or coomassine staining. In some embodiments, the uncompleted, interrupted RNA sequences contain fewer than 15 bases (e.g., fewer than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 bases). In some embodiments, the uncompleted, interrupted RNA sequences contain about 8-15, 8-14, 8-13, 8-12, 8-11, or 8-10 bases.

[0098] In some embodiments, the methods of the invention remove or eliminate a high percentage of enzymatic reagents used in in vitro synthesis, including, but not limited to, T7 RNA polymerase, DNAse I, pyrophosphatase, and / or RNAse inhibitors. In some embodiments, the invention is particularly effective at removing T7 RNA polymerase. In some embodiments, the methods of the invention remove greater than about 90%, 95%, 96%, 97%, 98%, 99%, or substantially all of the enzymatic reagents used in in vitro synthesis. In some embodiments, the mRNA purified by the invention is purified from in vitro The mRNA purified by the present invention is substantially free of the enzyme reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by the present invention contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) of the enzyme reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by the present invention contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) of the enzyme reagents used in the in vitro synthesis. In some embodiments, the mRNA purified by the present invention contains less than the limit of detection of the enzyme reagents used in the in vitro synthesis, as measured, for example, by ethidium bromide staining and / or coumacin staining.

[0099] The levels of prematurely terminated RNA sequences and / or enzymatic reagents in the purified mRNA can be measured using a variety of methods known in the art, for example, the levels of prematurely terminated RNA sequences and / or enzymatic reagents used in in vitro synthesis can be measured via silver staining, electrophoresis, high performance liquid chromatography (HPLC), ultra performance liquid chromatography (UPLC), and / or capillary electrophoresis.

[0100] In various embodiments, the mRNA purified using the methods described herein maintains a high degree of integrity. As used herein, the term "mRNA integrity" generally refers to the quality of the mRNA after purification. In some embodiments, mRNA integrity refers to the percentage of mRNA that is not degraded after tangential flow filtration. mRNA integrity can be measured using methods known in the art, such as, for example, RNA agarose gel electrophoresis (e.g., Ausubel et al., John Weley & Sons, Inc., 1997, Current Protocols in Molecular Biology). In some embodiments, the mRNA purified by the present invention has an integrity of greater than about 95% (e.g., greater than about 96%, greater than 97%, greater than 98%, greater than 99%, or more). In some embodiments, the mRNA purified by the present invention has an integrity of greater than 98%. In some embodiments, the mRNA purified by the present invention has an integrity of greater than 99%. In some embodiments, the mRNA purified by the present invention has an integrity of approximately 100%.

[0101] Large-scale batch production of mRNA for therapeutic applications The present invention addresses the urgent need for large-scale production of purified mRNA with the high degree of purity and integrity required for therapeutic applications. Conventional methods are generally small-scale and cannot be scaled up to the scale required for industrial-scale mRNA production that is sufficiently cost-effective and suitable for administration to human subjects. In contrast, the method of the present invention is fully scalable, as shown in the examples, to enable cost-effective large-scale production of pharmaceutical-grade mRNA.

[0102] Each batch of purified mRNA produced according to the present invention contains 5 grams or more of a single species of mRNA suitable for administration to a human subject. In some embodiments, a batch contains 10 grams or more of a single species of mRNA. In certain embodiments, a batch contains 25 grams or more of a single species of mRNA.

[0103] The method of the present invention produces purified mRNA batches that are substantially free of impurities from the mRNA synthesis process. In particular, the batches are substantially free of prematurely interrupted RNA sequences, DNA templates, and / or enzymatic reagents used in the in vitro synthesis of a single species of mRNA. For example, a batch of purified mRNA produced according to the present invention contains less than about 5% of the enzymatic reagents used in the in vitro synthesis. Each batch of purified mRNA typically has an integrity of greater than about 95%.

[0104] The mRNA batches produced according to the methods of the present invention can be used to prepare therapeutic agents that require one or more downstream processing steps. Typically, each mRNA batch is formulated by encapsulating the mRNA into, for example, lipid nanoparticles, liposomes, polymer-based polyplexes, etc., which can be administered to a patient. Exemplary routes of administration include, but are not limited to, intravenous or pulmonary delivery of purified mRNA. EXAMPLES

[0105] Example 1. Production and purification of messenger RNA (mRNA) Messenger RNA synthesis Messenger RNAs for firefly luciferase (FFL), argininosuccinate synthetase (ASS1), and human cystic fibrosis transmembrane conductance regulator (CFTR) were synthesized by in vitro transcription from plasmid DNA templates encoding the genes, followed by the addition of a 5' cap structure (Cap1) (Fechter, P.; Brownlee, GG "Recognition of mRNA cap structures by viral and cellular proteins" J. Gen. Virology 2005, 86, 1239-1249) and a 3' poly(A) tail of approximately 200 nucleotides in length, as determined by gel electrophoresis. The 5' and 3' untranslated regions present in each mRNA product are designated X and Y, respectively, and are defined as described (see below). Synthesis of the target messenger RNA constructs involved a two-step process in which an initial strand was synthesized consisting of the coding sequence flanked by the 5' and 3' untranslated regions. This uncapped and untailed construct was purified and further treated with a capping step followed by a poly-A tailing step. At the end of the tailing reaction, a second purification step was performed in a manner similar to the initial purification step.

[0106] Exemplary codon-optimized cystic fibrosis transmembrane conductance regulator (CFTR) mRNA Structure Design: X1-SEQ ID NO:1-Y1 AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUCGUGUCCAAACUCUUCUUCUCUAUGGACUCGGGCCUAUCCUAUUCCAGUACCUACCAUGUCCCUCGUAGAUUCGGCGGAUAACCUCUCGGAGAAGCUCGGAAUGGGACCGCGAACUCGCGUCUAAAGAAAACCCGAGCUCAUCACCAGUGAGAAGGUGCUUCUUCUGGGCGGUUCAUCUUCUGGUCGGUUCAUCUCGGUCUAUCGGUAUCUUGGUAUCUCGGUAUCUCGGUAUCUCGGUAUCUCGGUAUCA CAUCGGUAUGCAGAUGCGAAUCGCUAUGUUUAGCUUGAUCUACAAAAGACACUGAAACUCUCGUCCGGGGUUGGUUGGAUAAGAUUUCCAUCGUCAGUUGGUGUCCCUGCUUAGUAAUAACCUCAACAAAUUCGAUGGAGGCAUGGCCGCUGGCACAUUUCGUGGAUUGCCCCGUUGCAAGUCGCCCUUUUGAUGGGCCUUAUUUGGGAGCUUGGUUGGCAUUGUUUCAGGCCUUGGGCUUGGGCGGAUGAUGAUGAGUAUCGCGACAGAGAGCGGGUAAAUUCUCGGUAAAUUCCGUAAUUCCGUAAUUCCGUAAUUCCGUAAUUCCGGAAUUGGAAUUGGAAAACCUCCGCCAAACUGAGCU

[0107] Exemplary codon-optimized firefly luciferase (FFL) mRNA Structure Design: X1-SEQ ID NO:2-Y1 AUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCAGCGCCAUUCUACCCACUCGAAGACGGGACCGCCGGCGAGCAGCUGCACAAAGCCAUGAAGCGCUACGCCCUGGUGCCCGGCACCAUC GCCUUUACCGACGCACAUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGUUCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAUCGGAUCGUGGUG

[0108] Exemplary codon-optimized human argininosuccinate synthetase (ASS1) mRNA Structure Design: X1-SEQ ID NO:3-Y2 AUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGUGUUC AUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUCUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCAGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGGCGCCAAGUACGUGAGCCACGGCGCCACCGGC AAGGGCAACGACCAGGUGCGCUUCGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCAUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCUGAUGGAGUACGCCAAGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAGAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGGCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCCGACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUGAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGGUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCGGCAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGCCCACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAGGGCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCGAGUGCGAGUUCGUGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAAGGUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCCCUGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAGCCCACCGACGCCACCGGCUUCAUCAACAUCAACAGCCUGCGCCUGAAGGAGUACCACCGCCUGCAGAGCAAGGUGACCGCCAAGUGA (SEQ ID NO: 3)

[0109] 5' and 3' UTR sequences X1 = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 4) Y1= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 5) Y2= GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 6)

[0110] Synthesis of mRNA In each of the following examples, mRNA synthesis was carried out in the complete absence of RNAse: all test tubes, vials, pipette tips, pipettes, buffers, etc. were required to be nuclease-free unless otherwise specified.

[0111] In the following examples, unless otherwise indicated, mRNA was synthesized in situ from a linear DNA template. To generate the desired pre-mRNA (IVT) constructs, a mixture of approximately 8 mg of linear DNA, rNTPs (7.25 mM), DTT (10 mM), T7 RNA polymerase, RNAse inhibitor, pyrophosphatase, and reaction buffer (10x, 800 mM Hepes, pH 8.0, 20 mM spermidine, 250 mM MgCl2, pH 7.7) was diluted in RNase-free water. The reaction mixture is incubated at 37° C. for a time period ranging from 20 to 60 minutes. Once complete, the mixture is treated with DNase I for an additional 15 minutes and appropriately quenched.

[0112] Addition of 5' cap and 3' tail The purified mRNA product from the IVT step above (and optionally the first TFF filtrate as well) was denatured at 65°C for 10 minutes. Separately, an aliquot of GTP (1.0 mM), S-adenosylmethionine, RNAse inhibitor, 2'-O-methyltransferase, and guanylyltransferase were mixed with reaction buffer (10x, 500 mM Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl2) to a final concentration of 1.6 L. Once denaturation was achieved, the mRNA was cooled on ice and then added to the reaction mixture. The mixture was incubated at 37°C for a time period ranging from 25 to 90 minutes. Upon completion, ATP (2.0 mM), polyA polymerase, and an aliquot of tailing reaction buffer (10x, 500 mM Tris-HCl (pH 8.0), 2.5 M NaCl, 100 mM MgCl2) were added and the total reaction mixture was further incubated at 37°C for a time range between 20-45 min. Upon completion, the final reaction mixture was quenched and appropriately purified.

[0113] Purification of mRNA Purification of mRNA Messenger RNA can be precipitated using a variety of methods, for example, lithium chloride, potassium chloride, guanidinium chloride, guanidinium thiocyanate, guanidinium isothiocyanate, ammonium acetate, and other salts effectively precipitate mRNA from the reaction mixture.

[0114] Tangential Flow Filtration In the following examples, unless otherwise stated, the tangential flow filtration (TFF) system consisted of a membrane filter and a peristaltic pump (Spectrum Systems, Inc.), with a tangential circulation of the liquid through the membrane at a feed rate of approximately 130 mL / min and a flow rate for the permeate of 30 mL / min. The TFF membrane used was a MidiKros 500 kDa mPES 115 cm 2(Spectrum Labs). Prior to use, the filter cartridges were washed with nuclease-free water and further clarified with 0.2 N NaOH. Finally, the system was clarified with nuclease-free water until the pH of the permeate and retentate reached approximately pH 6. Isolation of mRNA via TFF can be performed as described in FIG. 1.

[0115] 2. Purification of Firefly Luciferase mRNA As a representative example of mRNA purification, a 1 gram batch of firefly luciferase (FFL) mRNA was transcribed using an in vitro method to produce the intermediate construct described above without the cap and polyA tail. The reaction was maintained at a total volume of approximately 180 mL and was quenched upon completion by adding DNAseI (approximately 9.0 KU). The resulting solution was treated with a homogenous solution (1500 mL) of 4 M guanidinium thiocyanate, 0.5% sodium lauryl sarkosyl, and 25 mM sodium citrate to a total volume of 1.68 L. The resulting mixture was left at ambient temperature for approximately 5 minutes and then further treated with 1.1 L of absolute ethanol. The mRNA slowly precipitated and the suspension was left at ambient temperature for approximately 5 minutes. Upon completion, the entire heterogeneous suspension was pumped through a filtration membrane using tangential flow filtration (TFF).

[0116] In this embodiment, 2600 cm 2 A modified polyethersulfone (mPES) hollow fiber membrane with a surface area of ​​750 nm was used. The resulting heterogeneous mixture (after precipitation) was divided into small portions and The membrane was pumped through the filter system at a flow rate of 100 mL / min for approximately 8 minutes. Upon completion, the resulting captured precipitate was rinsed with a guanidinium buffer / ethanol mixed buffer, followed by 80% ethanol (500 mL, 750 mL / min), which was repeated multiple times (>5 times). Upon completion of the washes, the mRNA solid dispersed in the membrane was treated with RNAse-free water (250 mL) and recirculated for 5-10 minutes to ensure dissolution. This process was repeated until no more mRNA was recovered. Upon completion, the resulting mRNA solution was further dialyzed using a 100 kDa MWCO membrane with 1 mM sodium citrate (pH 6.4) to remove any residual ethanol and obtain the final mRNA product in a suitable storage solution. The final concentration was 260 nm (λ max ) for each chromatogram. Messenger RNA purity was measured by UV absorbance (260 / 280 ratio) and protein gels (silver stain, SYPRO stain, coomassin, etc.). Messenger RNA integrity was measured by gel electrophoresis and in vitro / in vivo analysis of protein products.

[0117] Purification of ASS1 mRNA As a second representative example of mRNA purification, a 1 gram batch of ASS1 mRNA was transcribed using an in vitro method to produce the intermediate construct described above without the cap and polyA tail. The reaction was maintained at a total volume of approximately 180 mL and was quenched upon completion by adding DNAseI (approximately 9.0 KU). The resulting solution was treated with a homogenous solution of 4 M guanidinium thiocyanate, 0.5% sodium lauryl sarkosyl, and 25 mM sodium citrate (1500 mL) to a total volume of 1.68 L. The resulting mixture was allowed to sit at ambient temperature for approximately 5 minutes and then further treated with 1.1 L of absolute ethanol. The messenger RNA slowly precipitated and the suspension was allowed to sit at ambient temperature for approximately 5 minutes. Upon completion, the entire heterogeneous suspension was pumped through a filtration membrane using tangential flow filtration (TFF) and isolated as described above.

[0118] Purification of CFTR mRNA As a third representative example of mRNA purification, a 1.5 gram batch of modified CFTR mRNA was transcribed using an in vitro method to produce the intermediate construct described above without the cap and polyA tail. The reaction was maintained at a total volume of approximately 270 mL and was quenched upon completion by adding DNAseI (approximately 13.5 KU). The resulting solution was treated with a homogenous solution of 4 M guanidinium thiocyanate, 0.5% sodium lauryl sarkosyl, and 25 mM sodium citrate (1500 mL) to a total volume of 1.77 L. The resulting mixture was left at ambient temperature for approximately 5 minutes and then further treated with 1.1 L of absolute ethanol. The mRNA slowly precipitated and the suspension was left at ambient temperature for approximately 5 minutes. Upon completion, the entire heterogeneous suspension was pumped through a filtration membrane using tangential flow filtration (TFF) and isolated as described above.

[0119] Example 2. Analysis of purified mRNA Verification of the presence of the enzyme in purified mRNA SYPRO stained gel A standard SYPRO stained protein gel was run to determine the presence of any residual reagent enzymes before and after purification. Gels were run for 35 minutes at 200V.

[0120] Silver stained gel Silver staining of all mRNA batches and fractions was performed using SilverQuest® (Life Technologies, Catalog No. LC6070) using the manufacturer's protocol. Briefly, samples were loaded (with or without RNAse treatment) and monitored relative to the loaded enzyme control lane. Gels were run for 35 minutes at 200V. Exposure time was allowed for 8 minutes.

[0121] Assessment of mRNA integrity using agarose gel electrophoresis analysis Unless otherwise stated, mRNA size and integrity were assessed using gel electrophoresis. Either self-poured 1.0% agarose gels or Invitrogen's E-Gel precast 1.2% agarose gels were used. Messenger RNA was loaded at 1.0-1.5 μg per well. Upon completion, mRNA bands were visualized using ethidium bromide.

[0122] In vitro analysis of mRNA integrity Unless otherwise stated, in vitro transfection of firefly luciferase (FFL), argininosuccinate synthetase (ASS1) and CFTR mRNA was performed using HEK293T cells. Transfection of one microgram of each mRNA construct was performed in separate wells using lipofectamine. Cells were harvested at selected time points (e.g., 4 hours, 8 hours, etc.) and analyzed for each protein product. For FFL mRNA, cell lysates were analyzed for luciferase production using a bioluminescence assay. For ASS1 mRNA, cell lysates were analyzed for ASS1 production using an ELISA assay. For CFTR mRNA, cell lysates were analyzed for CFTR production using Western blotting.

[0123] Luciferase assay Bioluminescence assays were performed using Promega's Luciferase Assay System (product no. E1500). Luciferase assay reagent was prepared by adding 10 mL of luciferase assay buffer to luciferase assay substrate and mixing by vortexing. 20 μL of homogenous samples were loaded onto a 96-well plate, followed by 20 μL of plate controls for each sample. Separately, 120 μL of luciferase assay reagent (prepared as described above) was loaded into each well of a 96-well flat-bottom plate. Each plate was inserted into the appropriate chamber using a Molecular Device's Flex Station instrument, and luminescence was measured in relative light units (RLU).

[0124] ASS1 ELISA assay Standard ELISA was then performed using mouse anti-ASS1 2D1-2E12 as the capture antibody. IgG was performed using rabbit anti-ASS1 #3285 IgG (Shire Human Genetic Therapies) as the secondary (detection) antibody. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG was used for activation of 3,3',5,5'-tetramethylbenzidine (TMB) substrate solution. After 20 min, the reaction was quenched with 2N H2SO4. Detection was monitored by absorbance (450 nm) on a Molecular Device SpectraMax instrument. Untreated mouse serum and organs, as well as human ASS1 protein, were used as negative and positive controls, respectively.

[0125] Western blot analysis of CFTR Western blots were performed on the resulting protein samples using immunoprecipitation (DynabeadsG). Briefly, cell and tissue homogenates were treated with Dynabead G pre-coupled with anti-human CFTR antibody (R&D Systems, MAB25031). Detection of human CFTR protein was performed with Ab570.

[0126] Example 3. Purification Results In this example, the enzyme reagent was purified by using tangential flow filtration after precipitation. We demonstrate the successful purification of firefly luciferase (FFL) mRNA, argininosuccinate synthetase (ASS1) mRNA, and cystic fibrosis transmembrane conductance regulator (CFTR) mRNA by removing short mercury and short mercury. Many typical chaotropic conditions were successfully used to precipitate the mRNAs listed above.

[0127] To demonstrate this success, a large scale product (approximately 1 gram) of the modified CFTR mRNA IVT reaction mixture was subjected to 4M guanidinium buffer (described above). The resulting mixture was then treated with absolute ethanol and incubated at room temperature for 5 minutes. Isolation of precipitated mRNA was obtained by TFF as described above. Figure 2 represents a silver stained protein gel showing that the resulting mRNA was isolated after TFF using the conditions described above. There was no detectable enzyme (T7 polymerase, DNAseI, pyrophosphatase, RNAse inhibitor) at completion. Lanes 1-3 were modified CFTR after elution 1 (E1), elution 2 (E2), and elution 3 (E3). Lanes 4-7 were control enzymes present in the IVT reaction. Figure 3 represents a silver stained protein gel showing that the pure mRNA obtained from the larger scale (1.5 gram batch) precipitation and filtration steps was free of residual enzyme. Lanes 1-6 were mRNA after elutions 1-6. Lanes 7-10 were the control enzymes present in the IVT reaction (T7 polymerase, DNAseI, RNAse inhibitor and pyrophosphatase). Figure 4 shows that the modified CFTR mRNA was completely intact after such purification. Figure 4 shows the results of agarose (1.0%) gel electrophoresis of the modified CFTR mRNA after purification by precipitation and filtration. Lane 1 was the RiboRuler HR ladder. Lanes 2-7 were the modified CFTR mRNA purified by precipitation followed by filtration.

[0128] This process is broadly applicable to multiple different mRNA constructs. For example, a second mRNA construct was synthesized and purified using this method. In this example, argininosuccinate synthetase (ASS1) mRNA was made and precipitated using the method described above. The solid precipitate was loaded into the TFF system and isolated following the steps described. Figure 5 represents the silver stain analysis of the resulting ASS1 mRNA, showing the absence of residual enzymes (T7 polymerase, DNAseI, RNAse inhibitor, pyrophosphatase). Lanes 1-5 were the mRNA after elutions 1-5. Lanes 6-9 were the control enzymes present in the IVT reaction. Lane 10 contained RNaseA as a control, since the mRNA sample was pretreated with RNAseA before loading. As shown in Figure 5, after extensive exposure to silver stain development, it was shown that no enzymes were present. This was further confirmed using SYPRO stain for residual enzymes, as shown in Figure 6. Using this method, we can again demonstrate the purity of the ASS1 mRNA isolated using this process. Lanes 1-5 were the mRNA after elutions 1-5. Lanes 6-9 were the control enzymes that were present during the IVT reaction. In addition to this, RNA gel electrophoresis showed that the integrity of the ASS1 mRNA was maintained and the full length ASS1 mRNA was completely intact after this step (Figure 7). In Figure 7, lane 1 contained the RiboRuler HR ladder and lanes 2-6 contained the ASS1 mRNA after elutions 1-5.

[0129] To further demonstrate that the purification technique is broadly applicable to multiple different mRNA constructs, FFL mRNA was synthesized and purified using the method. The mRNA was precipitated using a 4M guanidinium buffer system and filtered. Figure 8 represents the silver stain analysis of the isolated FFL mRNA obtained, showing that no residual enzyme was present. Lanes 1-4 are FFL mRNA purified by one precipitation (XL1) or two precipitations (XL2), and lanes 2-4 are the separate eluates from the second precipitation recovery. Lanes 6-9 were the control enzymes present in the IVT reaction. As shown in Figure 8, no enzyme was present even after extensive exposure to the silver stain color development. Furthermore, it can be seen that a single precipitation appears to be sufficient to remove all unwanted residual enzymes. This is shown in Figure 9, where no residual enzymes were present. This was further confirmed by SYPRO staining for XL1. Using this method, the purity of FFL mRNA isolated using this process can be shown again. In Figure 9, lanes 1-4 are FFL mRNA purified by one precipitation (XL1) or two precipitations (XL2), and lanes 2-4 were the separate eluates from the second precipitation recovery. Lanes 6-9 were the control enzymes present in the IVT reaction. In addition to this, RNA gel electrophoresis showed that the integrity of FFL mRNA was maintained and full-length FFL mRNA was completely intact after this process (Figure 10). Furthermore, the mRNA is not different even after multiple reprecipitations. In Figure 10, lane 1 is RiboRuler HR ladder, and lanes 2-5 are FFL mRNA purified by one precipitation (XL1) or two precipitations (XL2). It was mRNA.

[0130] Once this isolated mRNA was further capped and tailed to the final product, the TFF method was further used to purify the final target mRNA. Figure 11 shows that we were successful in obtaining a pure final mRNA product by using tangential flow filtration for capture and elution after precipitation. In Figure 11, lanes 1-3 were ASS1 mRNA from the cap / tail reaction purified in a single precipitation (E1-3 = elution 1-3). Lanes 4-6 were the main control enzymes present in both reaction steps. Lane 7 contained an RNaseI control since the mRNA sample was pretreated with RNAseI before loading. In addition to this, RNA gel electrophoresis showed that the integrity of the FFL mRNA was still intact after this step with no loss of full-length FFL mRNA (Figure 12). In Figure 12, lanes 1-3 were capped and tailed ASS1 mRNA.

[0131] While such characterization provides information on purity and size / integrity of mRNA, the true measure of mRNA quality lies in its ability to produce the desired protein. Therefore, a comparison (TFF and spin column) of each of the isolated FFL mRNA constructs was performed. Each of the three constructs listed below was transfected into HEK293T cells, and the production of the corresponding FFL protein was evaluated by FFL protein activity in the form of FFL luminescence upon exposure to luciferin (see above). Cells were harvested 24 hours after transfection. FFL Constructs: 1. FFL mRNA purchased from an external supplier 2. FFL mRNA purified using a commercial kit 3. FFL mRNA Purified by Precipitation-TFF Method

[0132] A comparison of the luminescence yield of FFL protein produced from each is shown in Figure 13. The integrity of TFF-purified FFL mRNA was maintained throughout the precipitation and tangential flow filtration steps under the conditions described.

[0133] Furthermore, successful detection of human CFTR protein was achieved from transfection of hCFTR mRNA isolated using the above steps. In Figure 14, we show successful production of human CFTR protein after transfection of hCFTR mRNA purified either by commercial kit or by the TFF-based precipitation method described above. The visualization of this "C-band" for CFTR protein, which is indicative of properly transported full-length CFTR protein, fully supports the integrity and active state of the mRNA isolated by such conditions. This process is easily scalable further. For example, another mRNA construct was synthesized and purified on a 5 gram scale using this method. In this example, argininosuccinate synthetase (ASS1) mRNA was produced and precipitated using the method described above. The solid precipitate was loaded onto the TFF system and isolated according to the steps described.

[0134] The integrity of the produced mRNA drug substance was demonstrated using two separate methods. Typical mRNA lengths from in vitro transcribed (IVT) samples of argininosuccinate synthetase (ASS1) mRNA purified and filtered according to the presented method are shown. The length of the mRNA was demonstrated by agarose gel-on-a-chip electrophoresis. For both the IVT precursor and the capped and tailed final construct, intact, full-length mRNA was confirmed using gel electrophoresis (Figure 16). Full integrity was retained for ASS1 mRNA after large-scale (5 gram) precipitation.

[0135] As previously shown, Figure 17 shows that capture and elution using tangential flow filtration after precipitation successfully produced a pure final mRNA product. Lane 1 was ASS1 mRNA from the cap / tail reaction purified in a single precipitation. Lanes 2-8 were the main control enzymes present in both reaction steps. Lane 9 contained an RNaseI control since the mRNA sample was pretreated with RNAseI before loading. The silver staining shows that no residual enzyme is present.

[0136] While such characterization provides information on purity and size / integrity of mRNA, the true measure of mRNA quality lies in its ability to produce the desired protein. Therefore, a comparison of isolated ASS1 mRNA constructs (TFF and spin column) was performed (Figure 18). Each of the constructs listed below was transfected into HEK293T cells, and the production of the corresponding ASS1 protein was evaluated by ELISA. Cells were harvested approximately 18 hours after transfection.

[0137] Further evidence of scalability was obtained using the synthesis and purification of CFTR mRNA at 10 gram scale using this method. In this example, Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA was produced and precipitated using the method described above. The solid precipitate was loaded onto a TFF system and isolated according to the steps described. The integrity of the produced mRNA drug substance was demonstrated using agarose gel electrophoresis. Intact full-length mRNA was confirmed for both the IVT precursor and the capped and tailed final construct (Figure 19). Full integrity was retained for CFTR mRNA after large-scale (10G) precipitation.

[0138] The purity of the product made at the 10 gram scale was again demonstrated by silver staining shown in Figure 20. Lane 1 was CFTR mRNA from the cap / tail reaction purified from a single precipitation. Lanes 2-8 were the main control enzymes present in both reaction steps. Lane 9 contained an RNaseI control since the mRNA sample was pretreated with RNAseI prior to loading. The silver staining shows that no residual enzyme is present.

[0139] Although such characterization provided information on purity and size / integrity of the mRNA, the true measure of mRNA quality is still in its ability to produce the desired protein. Therefore, various amounts of CFTR mRNA were transfected into HEK293T cells and the production of the corresponding CFTR protein was assessed by Western blot (Figure 21). Cells were harvested approximately 18 hours after transfection.

[0140] In another embodiment, further evidence of scalability was obtained by synthesizing and purifying ASS1 mRNA at 25 gram scale using this method. In this example, argininosuccinate synthetase (ASS1) mRNA was produced and precipitated using the method described above. The solid precipitate was loaded onto a TFF system and isolated according to the steps described. The integrity of the produced mRNA drug substance was demonstrated using agarose gel electrophoresis. Intact full-length mRNA was confirmed for ASS1 mRNA after large-scale (25 gram) precipitation (Figure 22).

[0141] Equality and scope Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not limited to the above detailed description, but is as set forth in the following claims.

Claims

1. A composition containing in vitro synthesized messenger RNA (mRNA), said composition containing less than 5% unfinished and interrupted RNA sequences and / or enzymatic reagents used in the in vitro synthesis.

2. The composition of claim 1 , wherein the in vitro synthesized mRNA has greater than 95% integrity.

3. The composition of claim 1 , wherein the composition contains less than 1% of uncompleted and interrupted RNA sequences and / or enzymatic reagents used in in vitro synthesis.

4. The composition according to any one of claims 1 to 3, wherein the amount of unfinished and interrupted RNA sequences and / or enzymatic reagents used in in vitro synthesis are measured by silver staining, gel electrophoresis, high performance liquid chromatography (HPLC), ultra performance liquid chromatography (UPLC), and / or capillary electrophoresis.

5. The composition of any one of claims 1 to 4, wherein the enzyme reagent is selected from T7 RNA polymerase, DNAse I, pyrophosphatase, or an RNAse inhibitor.

6. 6. The composition of claim 1, wherein the in vitro synthesized mRNA is 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb or more in length.

7. The composition of any one of claims 1 to 6, wherein the in vitro synthesized mRNA contains one or more modifications to enhance stability.

8. The composition of claim 7 , wherein the one or more modifications comprise a backbone modification, a sugar modification, or a base modification.

9. The in vitro synthesized mRNA is 9. The composition of claim 7 or 8, comprising one or more nucleotide analogs independently selected from C5-amino-3-methyl-2-cytidine, ...

10. 10. The composition of any one of claims 7 to 9, wherein the in vitro synthesized mRNA contains one or more modified sugars selected from 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose.

11. The composition of any one of claims 7 to 10, wherein the in vitro synthesized mRNA contains modified phosphate groups selected from phosphorothioate and 5'-N-phosphoramidite linkages.

12. The in vitro synthesized mRNA may be selected from the group consisting of 1-methyladenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl -2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, beta.

12. The composition of any one of claims 7 to 11, comprising one or more nucleotide analogues selected from D-mannosyl-queuosine, wybutoxosine and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.

13. The composition of claim 12, wherein the nucleotide analog is 1-methyl-pseudouracil.

14. The composition according to any one of claims 1 to 13, wherein the in vitro synthesized mRNA contains a 5' untranslated region and / or a 3' untranslated region.

15. The composition of any one of claims 1 to 14, wherein the in vitro synthesized mRNA contains a 5' cap and / or a 3' poly A tail.

16. The composition of any one of claims 1 to 6, wherein the in vitro synthesized mRNA is unmodified.

17. The composition according to any one of claims 1 to 16, suitable for administration to a human subject as a pharmaceutical product.

18. 1 gram or more, 10 grams or more, or 5 grams or more of the in vitro synthesized mRNA.

18. The composition of any one of claims 1 to 17, containing a batch of 0 grams or more.

Images