Methods of nonspecific target capture of nucleic acids

Abstract

To provide a method for isolating a target nucleic acid from a sample.SOLUTION: The method includes such as a step of mixing a sample containing a target nucleic acid with a nonspecific capture probe made up of an oligonucleotide sequence that hybridizes nonspecifically with the target nucleic acid and means for linking the target nucleic acid to a support, in which the oligonucleotide sequence is selected from a group comprising a poly-U sequence, a random poly-(k) sequence comprising G and T nucleotides or G and U nucleotides, two random oligonucleotide sequences separated by a non-random sequence consisting of 10 or fewer nucleotides, two random oligonucleotide sequences separated by a non-random sequence consisting of 10 or fewer nucleotide base analogs, and two random oligonucleotide sequences separated by a non-nucleotide spacer compound.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This application claims the benefit under §119(e) of Provisional Application No. 60 / 821,078, filed Aug. 17, 2006, the contents of which are incorporated herein by reference.

[0002] FIELD OF THEINVENTION The compositions and methods of the present disclosure relate to molecular biology, and more particularly to methods and compositions for isolating nucleic acids from a mixture, such as a sample, which use nucleic acid oligomers that hybridize non-specifically to the target nucleic acid in order to separate the target nucleic acid from other components of the mixture. [Background technology]

[0003] Many molecular biology processing procedures, such as in vitro amplification and in vitro hybridization of nucleic acids, involve some preparation of the nucleic acid to make it effective in subsequent procedures. Nucleic acid purification methods may isolate all nucleic acids present in a sample, isolate various types of nucleic acids from a sample based on physical characteristics, or isolate specific nucleic acids from a sample. Many methods involve complex procedures, use harsh chemicals or conditions, or require a long time to complete nucleic acid isolation. Some methods involve the use of special oligonucleotides, each specific to a desired target nucleic acid, but this makes the design, optimization, and performance of the method more complicated, especially when isolation of more than one target nucleic acid is desired or when the sequence of the desired target nucleic acid is unknown. Therefore, there is a constant need for simple, efficient, and fast methods for separating nucleic acids of interest from other sample components. Summary of the Invention [Means for solving the problem]

[0004] Disclosed is a method for isolating a target nucleic acid from a sample, comprising: (a) mixing a sample containing a target nucleic acid with a non-specific capture probe composed of an oligonucleotide sequence that hybridizes non-specifically to the target nucleic acid, and means for linking the target nucleic acid to a support, where the oligonucleotide sequence is a polyU sequence, a random poly(k) sequence comprising G and T nucleotides, or G and U nucleotides, two random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotides, two random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotide base analogs, two random oligonucleotide sequences separated by a non-nucleotide spacer compound, a plurality of random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotides or nucleotide base analogs, a plurality of random oligonucleotide sequences separated by a non-nucleotide spacer compound, or a non-random polyGU sequence composed of at least two GU units. The method steps further include incubating a reaction mixture comprising the support, the target nucleic acid, and the non-specific capture probe under hybridization conditions that allow the capture probe and the target nucleic acid to hybridize non-specifically to form a hybridization complex that is linked to the support, and separating the support from the solution phase of the reaction mixture and separating the hybridization complex that is linked to the support from other sample components, thereby isolating the target nucleic acid from other sample components. In one embodiment, the means for linking the target nucleic acid to the support is direct attachment of the capture probe to the support. In another embodiment, the means for linking the target nucleic acid to the support is a specific binding pair composed of a first specific binding partner (SBP) attached to the capture probe and a second specific binding partner (SBP') linked to the support to which the capture probe specifically binds. In one embodiment, the SBP' is part of an immobilized probe that is linked to the support.In this method, the mixing step includes mixing the sample having the SBP attached to the capture probe with the SBP' linked to the support, and the incubation step includes binding the SBP and SBP' to link the hybridization complex to the support. In some embodiments, the SBP and SBP' are substantially complementary nucleic acid sequences, while in other embodiments, the SBP and SBP' are non-nucleic acid moieties. The non-nucleic acid moieties may be selected from the group consisting of (a) receptor and ligand pairs, (b) enzyme and substrate pairs, (c) enzyme and cofactor pairs, (d) enzyme and coenzyme pairs, (e) antibody and antigen pairs, (f) antibody fragment and antigen pairs, (g) sugar and lectin pairs, (h) ligand and chelator pairs, (i) biotin and avidin, (j) biotin and streptavidin, and (k) nickel and histidine. The method may further include a washing step after the separating step to remove other sample components from the support-linked hybridization complexes. In this case, the washing step involves mixing the support-linked hybridization complexes with a washing solution and then separating the support-linked hybridization complexes from the washing solution. The incubation step may be performed for about 5 minutes to about 90 minutes at about 25° C. The method may further include a step of detecting the presence of the target nucleic acid isolated from the other sample components, amplifying in vitro a sequence contained in the target nucleic acid isolated from the other sample components, or determining a sequence contained in the target nucleic acid isolated from the other sample components after the separating step.

[0005] Disclosed is a non-specific capture probe consisting of a first specific binding partner (SBP) that specifically binds to a second specific binding partner (SBP') linked to a support and an oligonucleotide sequence that hybridizes non-specifically to a target nucleic acid, where the oligonucleotide sequence is a polyU sequence, a random poly(k) sequence containing G and T nucleotides, or G and U nucleotides, two random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotides, two random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotide base analogs, a plurality of random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotides or nucleotide base analogs, two random oligonucleotide sequences separated by a non-nucleotide spacer compound, two random oligonucleotide sequences separated by a non-nucleotide spacer compound, a plurality of random oligonucleotide sequences separated by a non-nucleotide spacer compound, or a non-random polyGU sequence consisting of at least two GU units. The capture probe oligonucleotide sequence may be about 5 to 100 nucleotides in length, and in some embodiments is about 12 to about 25 nucleotides in length. The oligonucleotide sequence may include: (a) standard RNA bases and linkages, (b) standard DNA bases and linkages, (c) RNA bases with 2' modified linkages, (d) DNA bases in a locked nucleic acid (LNA) conformation, at least a portion of the sequence, (e) one or more nucleotide base analogs, (f) one or more abasic residues, (g) one or more non-nucleic acid spacer compounds, or (h) a combination of elements selected from groups (a) to (g) above. In some embodiments, the oligonucleotide sequence includes base analogs that exhibit alternative base pairing properties when compared to standard DNA or RNA base pairing. In some embodiments, these base analogs are inosine or 5-nitroindole. The oligonucleotide sequence may include a mixture of nucleotides in LNA conformational shapes and standard DNA conformations.In some embodiments, the oligonucleotide is composed of poly(k) RNA bases with 2' modified linkages. The SBP of the capture probe that specifically binds to the SBP' is a member of a specific binding pair that may be: (a) a pair of complementary nucleic acid sequences, (b) a receptor and a ligand pair, (c) an enzyme and a substrate pair, (d) an enzyme and a cofactor pair, (e) an enzyme and a coenzyme pair, (f) an antibody and an antigen pair, (g) an antibody fragment and an antigen pair, (h) a sugar and a lectin pair, (i) a ligand and a chelator pair, (j) biotin and avidin, (k) biotin and streptavidin, and (l) nickel and histidine. The oligonucleotide sequence may be linked to the SBP at the 5' terminal position of the oligonucleotide, at the 3' terminal position of the oligonucleotide, or at an internal position of the oligonucleotide via a linker compound. In some embodiments, the oligonucleotide sequence includes at least one random poly(k)6 sequence, while in other embodiments, random poly(k). 12 , Poly(k) 18 , or poly(k) 25 Preferred capture probe embodiments include oligonucleotide sequences comprising the sequence: (n)6-U3-(n)6 sequence, (n)6-Ni5-(n)6 sequence, where "Ni" represents 5-nitroindole, (k)6-Ni5-(k)6 sequence, where "Ni" represents 5-nitroindole, (k)6-C9-C9-(k)6 sequence, where "C9" represents a 9 carbon non-nucleotide spacer, (k)6-C9-(k)6-C9-(k)6 sequence, where "C9" represents a 9 carbon non-nucleotide spacer, (k) 12 array, (k)6-U3-(k)6 array, (k)6-U6-(k)6 array, (k)6-T3-(k)6 array, (k) 18 Array, (k) 24 Sequence, d (G or T) 18 Array, U 18a (GU)9 sequence, or a sequence in which "L" represents a locked nucleic acid conformation, such as an L(k)6-dT3-L(k)6 sequence, an L(k)4-d(k)2-dT3-L(k)4-d(k)2 sequence, an L(k)4-d(k)3-L(k)4-d(k)3-L(k)4 sequence, an L(k)3-d(k)3-L(k)3-d(k)3-L(k)3-d(k)3 sequence, an L(k)6 In another preferred embodiment, any of the above identified oligonucleotide sequences may be linked to a homopolymeric nucleic acid sequence that is the SBP of the capture probe. For example, the present invention provides the following: (Item 1) 1. A method for isolating a target nucleic acid from a sample, comprising: Mixing a sample containing a target nucleic acid with a non-specific capture probe comprised of an oligonucleotide sequence that hybridizes non-specifically to the target nucleic acid and a means for linking the target nucleic acid to a support, the oligonucleotide sequence being: Poly U sequence, a random poly(k) sequence containing G and T nucleotides, or G and U nucleotides; two random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotides; two random oligonucleotide sequences separated by a non-random sequence consisting of 10 or fewer nucleotide base analogues; two random oligonucleotide sequences separated by a non-nucleotide spacer compound; a plurality of random oligonucleotide sequences separated by non-random sequences consisting of 10 or fewer nucleotides or nucleotide base analogues; a plurality of random oligonucleotide sequences separated by non-nucleotide spacer compounds; and a non-random polyGU sequence consisting of at least two GU units; incubating a reaction mixture comprising the support, the target nucleic acid, and the non-specific capture probe under hybridization conditions that allow the capture probe and the target nucleic acid to non-specifically hybridize to form a hybridization complex that is linked to the support; and separating the support from the solution phase of the reaction mixture and separating the hybridization complexes that are linked to the support from other sample components, thereby isolating the target nucleic acid from other sample components; A method comprising: (Item 2) 2. The method of claim 1, wherein the means for linking the target nucleic acid to the support is direct attachment of the capture probe to the support. (Item 3) 2. The method of claim 1, wherein the means for linking the target nucleic acid to the support is a specific binding pair composed of a first specific binding partner (SBP) attached to the capture probe, which specifically binds to a second specific binding partner (SBP') that is linked to the support. (Item 4) 4. The method of claim 3, wherein the SBP' is part of an immobilized probe that is linked to the support. (Item 5) 4. The method of claim 3, wherein the mixing step comprises mixing the sample with the SBP attached to the capture probe and the SBP' linked to the support, and the incubation step comprises binding the SBP and the SBP' to link the hybridization complex to the support. (Item 6) 4. The method of claim 3, wherein the SBP and the SBP' are substantially complementary nucleic acid sequences. (Item 7) The method of claim 3, wherein the SBP and the SBP' are non-nucleic acid moieties. (Item 8) The non-nucleic acid component is: (a) a receptor and ligand pair, (b) an enzyme and substrate pair, (c) an enzyme and cofactor pair, (d) an enzyme and coenzyme pair, (e) an antibody and antigen pair, (f) an antibody fragment and antigen pair, (g) a sugar and lectin pair, (h) a ligand and chelator pair, (i) biotin and avidin, (j) biotin and streptavidin, and (k) nickel and histidine. (Item 9) The method according to item 1, further comprising a washing step for removing other sample components from the hybridization complexes bound to the support after the separation step, the washing step comprising mixing the hybridization complexes bound to the support with a washing solution and then separating the hybridization complexes bound to the support from the washing solution. (Item 10) 2. The method according to claim 1, wherein the incubation step is carried out at about 25° C. for about 5 minutes to about 90 minutes. (Item 11) The method according to item 1, further comprising, after the separation step, detecting the presence of the target nucleic acid isolated from other sample components, amplifying in vitro a sequence contained in the target nucleic acid isolated from other sample components, or determining a sequence contained in the target nucleic acid isolated from other sample components. (Item 12) A non-specific capture probe comprising a first specific binding partner (SBP) that specifically binds to a second specific binding partner (SBP') that is linked to a support, and an oligonucleotide sequence that non-specifically hybridizes to a target nucleic acid, the oligonucleotide sequence being: Poly U sequence, a random poly(k) sequence containing G and T nucleotides, or G and U nucleotides; two random oligonucleotide sequences separated by a non-random sequence of 10 or less nucleotides; two random oligonucleotide sequences separated by a non-random sequence consisting of 10 or fewer nucleotide base analogues; a plurality of random oligonucleotide sequences separated by non-random sequences consisting of 10 or fewer nucleotides or nucleotide base analogues; two random oligonucleotide sequences separated by a non-nucleotide spacer compound; a plurality of random oligonucleotide sequences separated by non-nucleotide spacer compounds; and a non-random polyGU sequence consisting of at least two GU units; A non-specific capture probe selected from the group consisting of: (Item 13) 13. The capture probe of claim 12, wherein the oligonucleotide sequence is about 5 to 100 nucleotides in length. (Item 14) 13. The capture probe of claim 12, wherein the oligonucleotide sequence is from about 12 to about 25 nucleotides in length. (Item 15) 13. The capture probe according to item 12, wherein the oligonucleotide sequence comprises: (a) standard RNA bases and linkages, (b) standard DNA bases and linkages, (c) RNA bases with 2' modified linkages, (d) DNA bases in a locked nucleic acid (LNA) conformation, at least a portion of the sequence being in a locked nucleic acid (LNA) conformation, (e) one or more nucleotide base analogs, (f) one or more abasic residues, (g) one or more non-nucleic acid spacer compounds, or (h) a combination of elements selected from the above groups (a) to (g). (Item 16) 16. The capture probe of claim 15, wherein the base analogue exhibits alternative base pairing properties when compared to standard DNA or RNA base pairing. (Item 17) 17. The capture probe of claim 16, wherein the base analog is inosine or 5-nitroindole. (Item 18) 16. The capture probe of claim 15, wherein the oligonucleotide sequence comprises a mixture of nucleotides in LNA conformation and nucleotides in standard DNA conformation. (Item 19) 16. The capture probe of claim 15, wherein the poly(k) base is an RNA base with a 2' modified linkage. (Item 20) 13. The capture probe of item 12, wherein the SBP that specifically binds to the SBP' is a member of a specific binding pair selected from the group consisting of: (a) a pair of complementary nucleic acid sequences, (b) a receptor and a ligand pair, (c) an enzyme and a substrate pair, (d) an enzyme and a cofactor pair, (e) an enzyme and a coenzyme pair, (f) an antibody and an antigen pair, (g) an antibody fragment and an antigen pair, (h) a sugar and a lectin pair, (i) a ligand and a chelator pair, (j) biotin and avidin, (k) biotin and streptavidin, and (l) nickel and histidine. (Item 21) 13. The capture probe of claim 12, wherein the oligonucleotide sequence is linked to the SBP at the 5' terminal position of the oligonucleotide, at the 3' terminal position of the oligonucleotide, or at an internal position of the oligonucleotide via a linker compound. (Item 22) 13. The capture probe according to item 12, wherein the oligonucleotide sequence comprises at least one random poly(k)6 sequence. (Item 23) The oligonucleotide sequence is a random poly(k) 12 , Poly(k) 18 , or poly(k) 25 13. The capture probe according to item 12, comprising the sequence (Item 24) The oligonucleotide sequence is: (n)6-U3-(n)6, (n)6-Ni5-(n)6, where “Ni” represents 5-nitroindole; (k) 6-Ni5-(k) 6, where “Ni” represents 5-nitroindole; (k)6-C9-C9-(k)6, where "C9" represents a nine carbon non-nucleotide spacer; (k)6-C9-(k)6-C9-(k)6, where "C9" represents a nine carbon non-nucleotide spacer; (k) 12 , (k)6-U3-(k)6, (k)6-U6-(k)6, (k)6-T3-(k)6, (k) 18 , (k) 24 , d (G or T) 18 , L(k)6-dT3-L(k)6, L(k)4-d(k)2-dT3-L(k)4-d(k)2, U 18 , L(k)4-d(k)3-L(k)4-d(k)3-L(k)4, L(k)3-d(k)3-L(k)3-d(k)3-L(k)3-d(k)3, (GU)9, L(k)6-dT3-L(k)6, L(k)4-d(k)2-dT3-L(k)4-d(k)2, L(k)2-d(k)4-L(k)2-d(k)4-L(k)2-d(k)4, d(k)6-dT3-L(k)6, and L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-d(k)3-L(k)4, 13. The capture probe according to item 12, selected from the group consisting of: (Item 25) 25. The capture probe of claim 24, wherein the oligonucleotide sequence is conjugated to a homopolymeric nucleic acid sequence that is the SBP. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0006] Detailed Description of the Invention A method for isolating a target nucleic acid of interest from a sample is disclosed, comprising mixing the sample containing the target nucleic acid with a capture probe that hybridizes non-specifically to the target nucleic acid in the sample in solution phase. In this case, the capture probe preferably comprises a polymeric oligonucleotide sequence that hybridizes non-specifically to the target nucleic acid by using a polymeric sequence that comprises a polyG / U sequence or a poly(k) sequence. The capture probe further comprises a means for attaching it to a support, preferably via a specific binding partner that specifically binds to the immobilized probe attached to the support. A reaction mixture is made that comprises the target nucleic acid and the capture probe in solution phase, and a support that may optionally comprise an immobilized probe. The reaction mixture is incubated under conditions in which the capture probe hybridizes non-specifically to the target nucleic acid and, if an immobilized probe is present, specifically binds to the immobilized probe via binding between the specific binding partners of the capture probe and the immobilized probe. The hybridization complex comprising the target nucleic acid and the capture probe attached to the support is separated from the reaction mixture, and the target nucleic acid is isolated from other sample components.

[0007] A probe for non-specific capture of a target nucleic acid is disclosed, which comprises at least one nucleic acid sequence that hybridizes non-specifically to the target nucleic acid, and a means for attaching the capture probe to a support, preferably by comprising at least one specific binding partner that specifically binds to another specific binding partner on an immobilized probe attached to the support. That is, the specific binding partner of the capture probe and the specific binding partner of the immobilized probe are members of a specific binding pair. Preferred embodiments of the capture probe include those in which the nucleic acid sequence that hybridizes non-specifically to the target nucleic acid comprises at least one polyGU sequence, or a random poly(k) sequence, or a sequence that comprises at least one nucleic acid analog that exhibits different base pairing properties with respect to the standard base pairing of nucleic acids with respect to the target nucleic acid.

[0008] The disclosed target capture method isolates a target nucleic acid from a sample by non-specific hybridization of a capture probe sequence to the target nucleic acid, where the capture probe contains at least one sequence that exhibits alternative base pairing properties with the target nucleic acid compared to standard base pairing (i.e., G:C and A:T / U bonds). The target nucleic acid may be RNA or DNA, which may be in single-stranded or fully or partially double-stranded form. Preferred capture probe polymer sequences with alternative base pairing properties include sequences that contain one or more non-random or random poly(k) segments or portions, where "k" is guanine (G) and thymine (T) or uracil (U) bases in the oligonucleotide, sequences that contain one or more base analogs or derivatives, and sequences that contain alternative conformations compared to standard RNA or DNA. A sequence of a probe exhibiting different base pairing properties may comprise, in a single oligomer, one or more of the above characteristics, e.g., a poly(k) segment having one or more residues with different conformations, as illustrated by some of the preferred embodiments described herein. A capture probe exhibiting different base pairing properties may be directly or indirectly attached to a support. A preferred capture probe embodiment comprises a specific binding partner (SBP) that specifically binds to another specific binding partner (SBP') in the immobilized probe to link the capture probe to the support. SBP and SBP' are members of a specific binding pair, which may be any of a variety of components that specifically bind. A capture probe comprising at least one sequence with different base pairing properties linked to a specific binding partner (SBP) may link the two components at any position of the capture probe compound, as represented, for example, by the structures "nonspecific polymer-SBP", or "SBP-nonspecific polymer", or "SBP-poly(k)", or "poly(k)-SBP". The SBP of the capture probe may be linked to either terminal position of the polymer sequence or may be linked to an internal position of the capture probe polymer.Some embodiments of the capture probe include multiple random polymeric sequences linked by short nucleotide sequences, e.g., homopolymeric sequences, or linked by non-nucleotide spacer compounds, e.g., 9-carbon spacer compounds (C-9). Some embodiments of the capture probe include standard DNA or RNA binding moieties. However, the capture probe can include a variety of non-standard binding moieties. Some preferred embodiments include one or more bases in the capture probe that have a locked nucleic acid (LNA) conformational shape. This may provide a functional bias to the capture probe, making it more likely to bind to a preferred target nucleic acid form, e.g., DNA. In some embodiments, the SBP of the capture probe is an oligonucleotide sequence that specifically hybridizes to the complementary sequence (SBP') of the immobilized probe, i.e., the specific binding pair is composed of substantially complementary oligonucleotide sequences. In another embodiment, the SBP of the capture probe is a moiety that specifically binds to a ligand moiety, i.e., the two moieties form a specific binding pair. Examples of specific binding pairs are well known and may be, for example, a binding pair consisting of an antibody or antibody fragment and its antigen or ligand, or a binding pair consisting of an enzyme and its substrate or cofactor, or a binding pair consisting of a receptor and its binding partner or analogue, commonly referred to as any pair of compounds that function in a lock and key manner.

[0009] In the disclosed method, the capture probe hybridizes non-specifically to one or more target nucleic acids present in a mixture, such as a sample to be tested, and then the hybridization complex containing the target nucleic acid and the capture probe attached directly or indirectly to the support is separated from other components in the mixture. In a preferred embodiment, the random polymer sequence of the capture probe hybridizes non-specifically to one or more sequences present in the target nucleic acid(s), and the SBP of the capture probe specifically binds to the SBP' of the immobilized probe attached to the support. This separates the support with the attached complex containing the capture probe and the target nucleic acid from other components in the mixture. In a preferred embodiment, the complex attached to the support is washed to further remove other sample components from the captured target nucleic acid. Additionally, additional steps may be performed on the target nucleic acid to identify, quantify, or otherwise use the isolated target nucleic acid. These additional steps may include detection steps, hybridization steps, nucleic acid amplification steps, sequencing steps, and the like. A preferred embodiment uses minimal steps to create a target capture reaction mixture that includes the target nucleic acid, the capture probe, and a support, optionally with an immobilized probe. The reaction mixture is incubated for less than 2 hours under relatively mild conditions, e.g., room temperature to 60° C., to allow non-specific hybridization of the capture probe to the target nucleic acid.

[0010] It will be understood that the methods described herein may be used in parallel or sequentially to selectively capture different target nucleic acids from one or more samples. For example, a sample may be divided into different portions, and the target capture step may be performed in each portion by using different capture probe embodiments that preferentially capture different types of target nucleic acids. For example, target capture may be performed in one portion using a capture probe that preferentially separates DNA from other components of the sample, while target capture may be performed in another portion using a capture probe that preferentially separates RNA from other components of the sample, thereby preferentially separating DNA from RNA components of the same sample. Alternatively, samples may be processed sequentially by using different capture probes that preferentially separate different target nucleic acids. For example, a first target capture may be performed on a sample using a capture probe that preferentially separates DNA from other components of the sample, so that the DNA target is first separated from the solution phase (pellet portion), and then a second target capture may be performed on the solution phase (supernatant portion) using a capture probe that preferentially separates RNA from other components of the sample, so that DNA and RNA targets contained in the same sample are separated in successive target capture reactions.

[0011] A preferred embodiment of the capture probe comprises at least one random polymer sequence that hybridizes non-specifically to the target nucleic acid, and a specific binding partner (SBP). In one embodiment, the random polymer sequence is a poly(k) sequence, where "k" is a random combination of guanine (G) and uracil (U) or thymine (T) bases in the oligonucleotide. The random polymer sequence usually ranges from about 5 to 100 nucleotides in length, but preferably ranges from about 6 to about 25 nucleotides. The SBP specifically binds to another specific binding partner (SBP'), preferably in the immobilized probe, which is attached to the support. The SBP and SBP' of the specific binding pair can be any moieties that specifically bind to each other, such as complementary nucleic acid sequences, an antibody-antigen pair, a receptor-ligand pair, an enzyme-substrate or enzyme-coenzyme pair, biotin and avidin or streptavidin, etc. The random sequence of the capture probe may be linked to the SBP at any position of the compound, for example, at the 5' or 3' terminal position of the oligonucleotide, or at an internal position via a linker compound. A capture probe containing such a moiety may be designated as an SBP-random polymer, or a random polymer-SBP, or, in preferred embodiments, an SBP-poly(k) or poly(k)-SBP structure. Some embodiments of the capture probe include multiple random sequences linked in a linkage compound, for example, random sequences linked by non-random sequences or non-nucleotide spacer compounds. For example, preferred embodiments may include one or more homopolymeric sequences (e.g., dT3) or non-nucleotide spacers (e.g., C-9 compounds) separating multiple segments of random sequences. Some capture probes include standard DNA or RNA binding moieties, while others may include synthetic binding moieties that provide the capture polymer with functional properties, for example, preferential binding to a particular type of target nucleic acid.For example, certain embodiments of the capture probe oligonucleotides contain one or more residues with a locked nucleic acid (LNA) conformational configuration, or a protein / peptide nucleic acid (PNA) conformational configuration, or one or more 2'-methoxy or 2'-fluoro substituted RNA residues, or other nucleic acid analog conformational configuration. Preferred embodiments contain one or more residues with an LNA conformational configuration for capture probes that preferentially bind to DNA targets, or one or more 2'-methoxy substituted RNA residues for capture probes that preferentially bind to RNA targets. In preferred embodiments, the SBP and SBP' are substantially complementary oligonucleotide sequences, i.e., the capture probe contains an SBP sequence that specifically hybridizes to the SBP' sequence of the immobilized probe. In another preferred embodiment, the SBP is a non-nucleic acid moiety that specifically binds to the SBP' ligand moiety of the immobilized probe.

[0012] In some embodiments, the capture probe is a composition used in target capture, preferably as part of a reagent mixture used in the target capture reaction. Such reagents may include other components, such as immobilized probes, SBP' components attached to a support, and / or chemical compounds (e.g., salts, buffering agents) that provide conditions for nucleic acid hybridization in solution phase. The capture probe reagent may be included in a composition, such as a kit, that includes other components used in the target capture step, such as in a wash solution for removing sample components from the captured target nucleic acid. The capture probe reagent may be included in a composition, such as a kit, that includes other components used in a subsequent step for processing the captured nucleic acid, such as in a dye for binding and detecting the captured nucleic acid, a detection probe for hybridizing to and detecting the captured nucleic acid, or an amplification oligonucleotide that binds to the target nucleic acid and acts as a primer for in vitro amplification of the target sequence. A preferred kit embodiment includes a solution that includes the capture probe oligomers described herein along with an immobilized probe that provides an SBP' for the SBP of the capture probe. It will be appreciated that the kit may include more than one capture probe embodiment, for example, a first capture probe comprising a first SBP and a second capture probe comprising a second SBP. Such compositions may be useful for preferentially capturing different target nucleic acids from one or more samples by using different immobilized probes, for example, by using a first immobilized probe with a first SBP' specific for the first SBP and a second immobilized probe with a second SBP' specific for the second SBP.

[0013] The methods and compositions described herein are useful for purifying nucleic acid sequences from complex mixtures, such as nucleic acids or cells that may have been processed by conventional methods to release intracellular nucleic acids into solution.These compositions and methods are useful for preparing nucleic acids for use in many molecular biology processes, such as in vitro amplification and / or detection steps used in diagnostic assays, forensic tests to detect the presence of biological samples, or assays to detect biological contamination in environmental, industrial, or food samples.The target capture methods and compositions concentrate target nucleic acids from samples in which they are only minor components, improving detection sensitivity.The target capture compositions and methods are particularly useful in that they isolate target nucleic acids from mixtures under relatively mild conditions in a relatively short time, making them suitable for use in a variety of laboratory and field conditions, or for screening multiple samples by manual or automated systems.In addition, the target capture compositions and methods are useful for isolating target nucleic acids from samples that may contain one or more different target nucleic acids, such as various unknown nucleic acid sequences (e.g., various virus types or subtypes, RNA transcripts of genes spliced ​​in various ways, or unknown gene mutants). The non-specific capture probes described herein can be used to separate many different gene subtypes, types, mutants, or transcripts from other sample components without having to design, synthesize, or test a specific capture probe for each desired target nucleic acid, and the captured nucleic acids can be individually detected, quantified, or otherwise processed in a subsequent step.

[0014] A "sample" or "specimen" refers to a target nucleic acid that may be present as part of a mixture of components, such as in a water or environmental sample, food, specimen collected for forensic analysis, or as part of a biopsy sample for diagnostic testing. A "biological sample" refers to any tissue or material obtained from a living or dead organism that may contain the target nucleic acid, including, for example, cells, tissues, lysates made from cells or tissues, sputum, peripheral blood, plasma, serum, cervical swab samples, biopsy tissues (e.g., lymph nodes), respiratory tissues or exudates, digestive tissues, urine, stool, semen, or other fluids or materials. Samples may be treated to physically disrupt tissue and / or cellular structures, such as those used to prepare samples for analysis by standard methods, to release intracellular components into solutions that may contain enzymes, buffers, salts, detergents, and other compounds.

[0015] "Nucleic acid" refers to a multimeric compound in which nucleotides or analogs having nitrogenous heterocyclic bases or base analogs are linked to form polymers, such as conventional RNA, DNA, mixed RNA-DNA, and analogs thereof. Nucleic acids comprise a "backbone" that links the nucleotide monomers together, which may comprise a variety of linkages or conformations within the nucleic acid chain, such as sugar-phosphodiester linkages, phosphorothioate or methylphosphonate linkages, peptide-nucleic acid linkages (PNA; Nielsen et al., 1994, Bioconj. Chem. 5(1):3-7; WO 95 / 32305), locked nucleic acid (LNA) conformations in which nucleotide monomers with two-ring furanose units are trapped in an RNA-like sugar conformation (Vester et al., 2004, Biochemistry 43(42):13233-41; Hakansson & Wengel, 2001, Bioorg. Med. Chem. Lett. 11(7):935-8), or combinations of such linkages. The sugar moiety of nucleic acids may be ribose, deoxyribose, or analogs such as compounds with 2' methoxy or 2' halogen substitutions. Nitrogenous bases can be any of the common DNA or RNA bases (A, G, C, T, U), base analogs such as inosine, 5-nitroindazole, and others (The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992; van Aerschott et al., 1995, Nucl. Acids Res. 23(21):4363-70), imidazole-4-carboxamide (Nair et al., 2001, Nucleosides Nucl. Acids, 20(4-7):735-8), pyrimidine or purine derivatives, such as the pyrimidine base modification 6H,8H-3,4-dihydropyrimido[4,5-c][1,2]oxazin-7-one (sometimes designated a "P" base attached to an A or G), and the purine base modification N6-methoxy-2,6-diaminepurine (sometimes designated a "K" base attached to a C or T), hypoxanthine (Hill et al., 1998, Proc. Natl. Acad. Sci. USA 95(8):4258-63, Lin and Brown, 1992, Nucl. Acids Res. 20(19):5149-52), 2-amino-7-deaza-adenine (paired with C and T; Okamoto et al., 2002, Bioorg. Med. Chem. Lett. 12(1):97-9), N-4-methyldeoxyguanosine, -4-ethyl-2'-deoxycytidine (Nguyen et al., 1998, Nucl. Acids Res. 26(18):4249-58), 4,6-difluorobenzimidazole, and 2,4-difluorobenzene nucleoside analogues (Klopffer & Engels, 2005, Nucleosides Nucleotides Nucl. Acids, 24(5-7)651-4), pyrene-functionalized LNA nucleoside analogues (Babu & Wengel, 2001, Chem. Commun. (Camb.) 20:2114-5; Hrdlicka et al., 2005, J. Am. Chem. Soc. 127(38);13293-9), deaza- or aza-modified purines and pyrimidines, pyrimidines with substituents at the 5- or 6-position, and purines with substituents at the 2-, 6-, or 8-position, 2-aminoadenine (nA), 2-thiouracil (sU), 2-amino-6-methylamino Purines, O-6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine-pyrimidines, and O-4-alkyl-pyrimidines (U.S. Pat. No. 5,378,825; WO 93 / 13121; Gamper et al., 2004, Biochem. 43(31):10224-36), and hydrophobic nucleobases that form double-stranded DNA without hydrogen bonding (Berger et al., 2000, Nucl. Acids Res.28(15):2911-4). Many derivatives and modified nucleobases or analogs are commercially available (e.g., Glen Research, Sterling, VA). Nucleic acids may contain one or more "abasic" residues, i.e., the backbone may contain a non-nitrogenous base at one or more positions (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional RNA bases with 2'-O-methyl linkages, or mixtures of conventional bases and analogs). Embodiments that may affect the stability of the hybridization complex include oligomers containing PNA, 2'-methoxy, or 2'-fluoro substituted RNA, or structures that affect the overall charge, charge density, or steric association of the hybridization complex, such as charged linkages (e.g., phosphorothioates), or neutral groups (e.g., methylphosphonates).

[0016] "Oligomer" or "oligonucleotide" generally refers to a nucleic acid of a size range less than 1000 nucleotides (nt) with a lower limit of about 2 to 5 nt and an upper limit of about 500 to 900 nt. Certain preferred oligomer embodiments are in a size range with a lower limit of about 5 to 15 nt and an upper limit of about 50 to 600 nt, while other preferred embodiments are in a size range with a lower limit of about 10 to 15 nt and an upper limit of about 18 to 100 nt. Oligomers may be purified from natural sources, but are preferably synthesized by any known enzymatic or chemical method. Oligomers may include "random polymeric" sequences. The random polymer refers to a population of oligomers that are substantially the same in overall length and other characteristics, but that are synthesized by randomly incorporating different bases in a specified length, e.g., a random combination of all four standard bases (A, T, G, and C) in a DNA oligomer, or a random combination of a few bases (U and G) in a specified portion of a larger oligomer. The resulting oligomer is actually a population of oligomers whose finite number of members is determined by the length and number of bases that make up the random portion (e.g., a 2-nt random sequence in a population of oligomers containing a 6-nt random sequence synthesized with two different bases). 6 oligomers).

[0017] "Capture probe", "capture oligonucleotide", or "capture oligomer" refers to a nucleic acid oligomer that non-specifically binds to a target nucleic acid and attaches the capture target nucleic acid to a support for separating the captured target nucleic acid from the solution phase by using a sequence that exhibits alternative base-pairing properties relative to standard DNA or RNA. The capture probe may be attached directly or indirectly to a support to attach the capture target nucleic acid to the support. A preferred capture probe embodiment uses one or more non-random or random polymer moieties base pairing to the target nucleic acid and a specific binding partner (SBP) to attach the capture probe to an immobilized probe attached to a support. The SBP may be directly, cascade-attached to the polymer moiety of the capture probe, or may be attached to the capture probe sequence via a non-nucleotide linker. The "immobilized probe" includes a specific binding partner (SBP') that is attached to the support but specifically binds to the SBP of the capture probe, i.e., the SBP and the SBP' are members of the specific binding partner. Preferred capture probe embodiments include a random polymer portion composed of one or more poly(k) segments, where k is the random sequence G or T / U. Preferred capture probe embodiments act as an SBP and may include an oligonucleotide sequence that is partially or fully complementary to an immobilized probe oligonucleotide, i.e., SBP and SBP' are fully or partially complementary sequences to each other.

[0018] Specific binding partners are members of a "specific binding pair" or "specific binding partner set" that can recognize and specifically bind to each other. Specific binding pairs include, for example, receptors and ligands, enzymes and substrates, enzymes and cofactors, enzymes and coenzymes, antibodies and antigens, sugars and lectins, biotin and avidin or streptavidin, ligands and chelators, nickel and histidine, fully or substantially complementary nucleic acid sequences, e.g., complementary homopolymeric nucleic acid sequences, and the like. The components of a binding partner set are the regions of the members that participate in binding. Members of specific binding pairs may be referred to by the abbreviations SBP and SBP'.

[0019] "Immobilized probe", "immobilized oligomer", or "immobilized nucleic acid" refers to a specific binding partner (SBP') that specifically binds to the SBP of the capture probe and is attached to the support. That is, the SBP' and the SBP specifically bind and join the capture probe and the immobilized probe linked to the support. One embodiment of the immobilized probe is an oligonucleotide that contains a sequence that is fully or partially complementary to the capture probe sequence. The complex containing the immobilized probe and the capture probe facilitates separation of the target nucleic acid that is bound to the capture probe from other sample components that are not bound to the capture probe, the immobilized probe, and the support. Any support may be used (e.g., a matrix or particle in solution phase), and the support may be composed of any of a variety of known materials (e.g., nylon, nitrocellulose, glass, polyacrylate, polyacrylamide, mixed polymers, polystyrene, silane polypropylene, and metal). Preferred supports are magnetically attractable particles, e.g., monodisperse paramagnetic beads (uniform size, 5%), to which immobilized probes are stably attached either directly (via covalent bonds, chelating coordination, or ionic interactions) or indirectly (via linkers).

[0020] "Separate," "purify," or "isolate" refers to selectively removing one or more components of a sample from one or more other components of the sample, e.g., removing nucleic acid from a generally aqueous solution that may further include proteins, carbohydrates, lipids, cellular debris, organelles, or minerals. In preferred embodiments, purification removes at least about 30% of the target nucleic acid, more preferably at least about 50% of the target nucleic acid, and even more preferably at least about 75% of the target nucleic acid. Alternatively, purification may be considered to remove at least about 75% of the other sample components, more preferably at least about 85% of the other sample components, and even more preferably at least about 90% of the other sample components from the target nucleic acid.

[0021] "Hybridization conditions" refers to the cumulative physical and chemical conditions under which fully or partially complementary nucleic acid sequences form hybridization duplexes or complexes. Such conditions are well known to those skilled in the art and can be predicted based on the sequence composition of the nucleic acids involved in the hybridization, or can be empirically determined using routine testing (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989) at §§ 1.90-1.91, 7.37-7.57, 9.47-9.51, 11.12-11.13, and 11.45-11.57).

[0022] By "sufficiently complementary" it is meant that a linked nucleic acid sequence is capable of hybridizing to another sequence through hydrogen bonding between complementary bases (e.g., G:C, A:T, or A:U pairing). A complementary sequence may be complementary to its target sequence by forming standard base pairs at every position of the oligomer sequence, or the sequence may contain one or more positions that are not complementary, such as an abasic residue, but such a sequence is still sufficiently complementary in that the entire sequence is capable of hybridizing to the target sequence under appropriate hybridization conditions.

[0023] "Nucleic acid amplification" refers to any well-known in vitro process that produces multiple copies of a target nucleic acid sequence, or its complement, or a fragment thereof (i.e., the length of the amplified sequence is less than the entire target nucleic acid). Examples of such processes include transcription-associated methods, such as transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), and nucleic acid sequence-based amplification (NASBA). (U.S. Patent Nos. 5,399,491, 5,554,516, 5,437,990, 5,130,238, 4,868,105, and 5,124,246), replicase-mediated amplification (U.S. Patent No. 4,786,600), polymerase chain reaction (PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), ligase chain reaction (LCR) (European Patent Application No. 0320308), and strand displacement amplification (SDA) (U.S. Patent No. 5,422,252).

[0024] "Detection probe" refers to a nucleic acid oligomer that hybridizes specifically to a target nucleic acid under hybridization conditions, allowing the target nucleic acid to be detected directly (i.e., the probe hybridizes directly to the target nucleic acid) or indirectly (i.e., the probe hybridizes to the target via an intermediate structure). Detection probes may contain target binding sequences and other components that contribute to their structure (U.S. Patent Nos. 5,118,801, 5,312,728, 6,835,542, and 6,849,412).

[0025] "Label" refers to a moiety or compound that is detected or induces a detectable signal, and may be directly or indirectly attached to a detection probe or to a nucleic acid to be detected. Directly attached labels may use covalent or non-covalent interactions (e.g., hydrogen bonds, hydrophobic or ionic interactions, chelate or coordinate complex formation), and indirectly attached labels may use cross-linking moieties or linkers (e.g., antibodies or oligomers). A label may be any moiety that is detectable, such as a radionuclide, a ligand, an enzyme, an enzyme substrate, a reactive group, a chromophore (e.g., a dye or a particle that gives a color), a luminescent (bioluminescent, phosphorescent, or chemiluminescent) compound, and a fluorescent compound. Preferred labels provide a signal that can be detected in homogeneous assays, i.e., without the need to separate unbound label from bound label for signal detection (U.S. Patent Nos. 5,283,174, 5,656,207, and 5,658,737). Preferred homogeneously detectable labels are chemiluminescent compounds, more preferably acridinium ester (AE) compounds (U.S. Pat. Nos. 5,656,207, 5,658,737, and 5,639,604). Methods for synthesizing labels, attaching labels to nucleic acids, and detecting signals from labels are well known (e.g., Sambrook et al., Molecular Cloning, A, 1999). Laboratory Manual, 2nd ed. Chapter 10, and U.S. Patent Nos. 5,658,737, 5,656,207, 5,547,842, 5,283,174, and 4,581,333).

[0026] Unless otherwise defined, technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art or as defined in the technical literature, e.g., Dictionary of Microbiology and Molecular Biology, 2nd ed. (Singleton et al., 1994, John Wiley & Sons, New York, NY), The Harper Collins Dictionary of Biology (Hale & Marham, 1991, Harper Perennial, New York, NY), and similar publications. Unless otherwise stated, the techniques employed or contemplated by the present invention are standard, well-known methods.

[0027] Unlike the non-specific target capture method disclosed herein, the specific target capture method uses a capture probe that comprises a sequence that specifically hybridizes to a target sequence in a target nucleic acid (see, for example, U.S. Patent Nos. 6,110,678, 6,280,952, and 6,534,273). Briefly, the specific target capture method uses a capture probe that is composed of a target-specific sequence that specifically hybridizes to a target sequence in a target nucleic acid and a tail region that hybridizes to an immobilized probe. This specific target capture method uses a two-step hybridization process, in which a first hybridization condition preferentially promotes the solution-phase hybridization of the target-specific sequence of the capture probe to the target sequence, and then a second hybridization condition that maintains the capture probe:target nucleic acid complex allows the hybridization of the tail region of the capture probe to the immobilized probe on the support, thus forming a complex composed of the immobilized probe, capture probe, and target nucleic acid on the support. The support and attached complexes are separated from other sample components which remain in the solution phase.

[0028] The non-specific target capture method described herein utilizes a capture probe that hybridizes non-specifically to a target nucleic acid in a sample by using alternative base pairing properties (compared to standard DNA or RNA hydrogen bonding) of a portion of the capture probe. The capture probe is attached to a support, preferably by specifically binding to an immobilized probe on the support. This allows separation of a complex containing the non-specific capture probe and the target nucleic acid from other sample components. A preferred capture probe embodiment used in the method includes a non-random or random polymer sequence attached to a specific binding partner (SBP). The polymer sequence hybridizes non-specifically to the target nucleic acid, and the SBP binds to the specific binding partner (SBP'), which may be attached to an immobilized probe or a support. Some embodiments of non-specific capture probes include random polymer sequences composed of all four standard DNA bases (guanine (G), cytosine (C), adenine (A), and thymine (T)) or all four standard RNA bases (G, C, A, and uracil (U)). Some embodiments include one or more base analogs (e.g., inosine, 5-nitroindole), or abasic positions in the random polymer sequence. A preferred embodiment includes one or more sequences of poly(k) bases, i.e., random mixtures of G and U or T bases (see, e.g., WIPO Handbook on Industrial Property Information and Documentation, Standard ST.25 (1998), Table 1). Sequences containing G and U / T bases are selected for their "wobble" properties, i.e., U / T binds to G or A, while G binds to C or U / T. It is understood that non-specific capture probes synthesized with random polymer sequences are actually a finite population of oligonucleotides that contain various random polymer sequences composed of bases included in the synthesis of the random portion. For example, a population of non-specific capture probes that includes a 15 nt random polymer sequence composed of G, C, A, and T, is 4 15 It consists of members.

[0029] The non-specific capture probes described herein may exist in many different embodiments, but may generally be represented by the structure RP-SBP, or SBP-RP. In this textual formula, "RP" represents the "random polymer" sequence portion, and "SBP" represents the "specific binding partner." In these schematic textual formulas, the SBP is represented linearly to the RP, but one of skill in the art will understand that the SBP may be attached at any point to the RP of the capture probe. In embodiments where the RP is composed of G, and U or T bases, the non-specific capture probe may be represented by the schematic structure (k): x -SBP, or SBP-(k) x In this formula, "k" represents the G and U or T bases of the RP portion, "x" represents the length of the k sequence (in nt), and "SBP" represents a "specific binding partner." x Although the sequences are shown linearly, it will be understood that the SBP may be joined to the capture probe at any point.

[0030] The SBP component of the non-specific capture probe may be any member of a specific binding pair that specifically binds to the SBP' that may be part of the immobilized probe. Some embodiments of specific binding pairs suitable as SBP and SBP' members include receptor and ligand pairs, enzyme and substrate or cofactor pairs, enzyme and coenzyme pairs, antibody (or antibody fragment) and antigen pairs, sugar and lectin pairs, biotin and avidin or streptavidin pairs, ligand and chelator pairs, nickel and histidine, and fully or substantially complementary nucleic acid sequences. Some preferred embodiments of the target capture method use substantially complementary nucleic acid sequences, more preferably complementary homopolymeric sequences, as the SBP and SBP', e.g., the capture probe includes a 3' substantially homopolymeric SBP sequence that hybridizes to a complementary, immobilized SBP' sequence linked to a support. Another preferred embodiment uses non-nucleic acid binding pairs as SBP and SBP' members, for example biotin, which specifically binds to avidin or streptavidin.

[0031] Non-specific capture probe embodiments may be synthesized to contain any of a variety of nucleic acid conformations, such as standard DNA or RNA oligonucleotides, or oligonucleotides containing one or more modified linkages in which the sugar moiety has a substitution (e.g., 2' methoxy, or 2' halide), or oligonucleotides containing one or more positions with alternative conformations, such as locked nucleic acid (LNA) or protein nucleic acid (PNA) conformations. Capture probe embodiments may also contain non-nucleotide compounds (e.g., C-9) as spacers joining the random polymer segments of the capture probe. Preferred embodiments of non-specific capture probes include those in which the random polymer portion is synthesized with 2' methoxy substituted RNA residues, or RNA residues containing one or more residues with an LNA conformation. The choice of conformation(s) contained in the oligonucleotide portion of the non-specific capture probe may depend on the target nucleic acid intended to be isolated. For example, non-specific capture probes synthesized as random polymer regions with 2' methoxy substituted RNA residues are preferred for capturing RNA targets, whereas probes synthesized as random polymer regions with an LNA conformation are preferred for capturing single-stranded DNA (ssDNA) targets. Certain preferred embodiments of capture probes include a combination of conformations (e.g., LNA and DNA).

[0032] The non-specific target capture method is relatively fast and simple to perform, and typically takes less than an hour to complete, since the target capture reaction requires only a 5 minute incubation. Optional capture steps, such as washing the captured nucleic acid to further purify the nucleic acid, may be performed, but require additional time (e.g., about 20 minutes). Non-specific target capture involves mixing a sample containing the target nucleic acid in a substantially aqueous solution with a non-target capture probe under conditions that allow the capture probe to non-specifically hybridize to the target nucleic acid in the mixture, as described herein. Such conditions may include a short period of elevated temperature (e.g., about 60° C. for about 15 minutes), followed by incubation at room temperature (e.g., about 20-25° C. for about 10 to 90 minutes), although the total incubation may be substantially shorter (e.g., 5 minutes) at room temperature. The mixture may further include an immobilized probe that specifically binds to the non-specific capture probe via the SBP-SBP' specific binding pair. The immobilized probe may be introduced into the mixture at the same time as the capture probe, or before or after the capture probe is mixed with the sample. In a preferred embodiment, the immobilized probe is introduced into the mixture of the sample and the non-specific capture probe after the capture probe is incubated with the sample, allowing the capture probe and the target nucleic acid to hybridize non-specifically in the solution phase before the capture probe binds to the immobilized probe. In another preferred embodiment, the immobilized probe is introduced into the mixture at about the same time as the capture probe to minimize the mixing step, which is particularly useful for automated systems. In an embodiment using a capture probe with a tail sequence as the SBP, the capture probe specifically binds to a complementary sequence (SBP') contained in the immobilized probe under nucleic acid hybridization conditions, thereby allowing the target nucleic acid that is non-specifically bound to the capture probe and linked to the support via the immobilized probe to be separated from other sample components.After incubation, where the capture probe hybridizes non-specifically to the target nucleic acid and specifically binds to the immobilized probe, the complex consisting of the immobilized probe, the capture probe, and the target nucleic acid is separated from other sample components. This is done by separating the support to which the complex is attached from the solution phase. Then, if necessary, a washing step or steps may be performed to remove non-nucleic acid sample components, components of the complex, or the support that may be attached to the complex. In a preferred embodiment, a washing step is performed in which the complex attached to the support is washed with a substantially aqueous washing solution that maintains the hybridization complex on the support, and then the complex attached to the support is separated from the washing solution containing the other sample components. The captured target nucleic acid may be separated from one or more other complex components before a subsequent assay step is performed, or the complex attached to the support may be used directly in a subsequent step or steps. Subsequent steps may include, for example, detection of the captured nucleic acid and / or in vitro amplification of one or more sequences contained in the captured nucleic acid.

[0033] Based on the non-specific capture probes designed and tested under various conditions, the following general conclusions were made regarding non-specific target capture using these compositions: Non-specific capture probes containing randomized G and U bases are more effective at target capture than probes containing non-random repeat (GU) sequences with the same total number of nucleotides in their random G / U polymeric portion. Non-specific capture probes containing randomized poly(k) sequences synthesized with 2'-methoxy RNA bases are more effective at target capture than probes of similar structure synthesized with deoxy bonds. Non-specific capture probes containing randomized poly(k) sequences are more effective at target capture than probes containing randomized DNA segments (randomized G, A, T, and C bases) in their random polymeric portion. Non-specific capture probes containing randomized poly(k) sequences are more effective at target capture than probes containing poly-inosine, poly-U, or randomized C and A bases (i.e., poly(m) sequences) of the same length. The length of one or more random consecutive sequences contained in the non-specific capture probe may vary, but a poly(k) sequence of about 12 nt or more is sufficient for efficient target capture. The presence of non-random oligonucleotides in the non-specific capture probe or the presence of non-nucleotide spacers between the random poly(k) sequences may affect the target capture efficiency. In capturing ssDNA targets, a non-specific capture probe that contains at least a portion of the random poly(k) sequence in LNA conformation is more effective than a non-specific capture probe of the same length in DNA conformation, and a probe that contains a mixture of LNA and DNA residues is more effective than a probe that contains all poly(k) sequences in LNA conformation. A non-specific capture probe that contains at least a portion of the random poly(k) sequence in LNA conformation is more effective for capturing RNA and ssDNA than for capturing double-stranded DNA (dsDNA) targets. Non-specific capture probes that contain at least a portion of a random poly(k) sequence in an LNA conformation are more effective at capturing RNA targets than capture probes of the same length in which the random poly(k) sequence is synthesized with 2'-methoxy RNA bases.These general parameters can be used to design and optimize non-specific capture probe embodiments for capture of an intended target nucleic acid, or type of target nucleic acid, and can be tested using standard procedures, described in the Examples below, to select non-specific capture probes and conditions that give the desired target capture results.

[0034] The immobilized probe may be connected to the support by any bond that is stable under the hybridization conditions used in the target capture method. A preferred embodiment uses a monodisperse particle support that can be recovered from solution by known methods, such as centrifugation, filtration, magnetic attraction, or other physical or electrochemical separation. The captured target nucleic acid is isolated and concentrated on the support, i.e., the target nucleic acid is concentrated on the support compared to its concentration in the initial sample, which may improve the sensitivity of subsequent assay steps performed with the captured nucleic acid.

[0035] The target capture methods described herein may be used to simultaneously isolate two or more target nucleic acids from the same sample, since the non-specific capture probes bind to one or more types of nucleic acids in the sample. In some embodiments, the non-specific capture probes may be designed and selected for use in preferentially capturing a particular type of nucleic acid (e.g., RNA) from a sample containing a mixture of nucleic acids (e.g., DNA and RNA). In some embodiments, the non-specific capture probes may be designed to selectively bind to different immobilized probes, thereby allowing them to be selectively removed from the mixture. That is, the immobilized probes are introduced into the mixture and then separated by an attachment complex comprising the capture probe and the target nucleic acid. For example, a first non-specific capture probe that preferentially binds to RNA in a DNA and RNA mixture may bind to a first immobilized SBP' on a first support via the first SBP, and a second non-specific capture probe that preferentially binds to DNA in a DNA and RNA mixture may bind to a second immobilized SBP' on a second support via the second SBP. The attachment complexes then allow the first and second supports to be selectively moved to different regions of an assay system or selectively removed at different times during an assay, thereby selectively separating the RNA component of a sample from the DNA component of the same sample. Methods for determining the optimal structure and conditions of non-specific capture probes for each use are described in the Examples below.

[0036] A model system is used to test the efficiency of non-specific target capture. In this system, a variety of different capture probes and conditions are used for the capture of RNA (Chlamydia trachomatis rRNA) and DNA (synthetic oligonucleotide) target nucleic acids. In a typical test, a target nucleic acid (e.g., a labeled probe) labeled with a detectable marker of known concentration is prepared by mixing with a substantially aqueous solution (e.g., a buffer solution containing salts and chelating agents). A portion of the sample is mixed with a reagent containing a known amount of the non-specific target capture probe to be tested and a known amount of immobilized probe attached to a support (e.g., magnetic particles) in a substantially aqueous solution to create a target capture mixture. The target capture mixture is incubated at a specified temperature(s) for a specified time(s) to allow the formation of a capture complex consisting of the non-specific capture probe, the target nucleic acid, and the immobilized probe attached to the support. The complex on the support is then separated from the solution phase. The complex on the support is washed as necessary to remove residual portions of the solution phase, and the complex on the support is separated from the wash solution. The label associated with the support is detected, providing a measure of the target capture efficiency, i.e., a quantitative value of the amount of target nucleic acid separated from other sample components. The label associated with the solution phase, which is initially separated from the complex on the support, is also detected, providing a measure of the labeled target nucleic acid that remains in solution after the target capture step. Although the model system is designed to include a minimum number of components so that different non-specific capture probes and conditions can be compared with each other, it will be understood that the target capture mixture may include additional oligonucleotides, such as helper oligonucleotides (U.S. Pat. No. 5,030,557, Hogan et al.), and / or amplification primers.

[0037] In some cases, for comparison, target capture is performed on a sample by using a specific target capture probe that specifically hybridizes to a target nucleic acid according to known procedures, which include a first incubation to allow hybridization of the specific capture probe to the target nucleic acid, and a second incubation to allow hybridization of an immobilized oligonucleotide probe to a complementary sequence in the specific capture probe (U.S. Pat. No. 6,110,678, Weisburg et al.). Typically, the specific target capture process involves incubating a sample containing a target nucleic acid labeled with a detection probe with a capture probe (e.g., 1.75 pmoles) that specifically binds to the target nucleic acid, and a dT attached to approximately 100:g immobilized probe (e.g., 0.7-1.05 F magnetic particles (Seradyne)) attached to paramagnetic particles by carbodiimide chemistry (Lund et al., 1988, Nuc. Acids Res. 16:10861-10880). 14 The capture probe is mixed with a 500 μl immobilized probe (probe) and the mixture is incubated at 55-60° C. for about 15-30 minutes, then at room temperature for 5-15 minutes to allow sequential hybridization of the capture probe with the target nucleic acid, and then of the immobilized probe with the capture probe:target nucleic acid complex. The particles with attached complexes are separated from the solution phase in one portion of the vessel by applying a magnetic field (U.S. Pat. No. 4,895,650) and the supernatant is removed. The particles are suspended in a wash solution (e.g., 1 ml at room temperature) and the magnetic separation step is repeated.

[0038] Non-specific target capture probes are synthesized by standard in vitro methods well known in the art (Caruthers et al., Methods in Enzymology, vol. 154, p. 287 (1987); U.S. Pat. No. 5,252,723, Bhatt; WO 92 / 07864, Klem et al.). Synthetic oligonucleotides are made using standard RNA bases and linkages, DNA bases and linkages, RNA bases with 2' methoxy linkages, DNA bases with LNA conformations, or oligonucleotides containing combinations of such structures. Some oligonucleotides are synthesized to include non-nucleotide spacers (e.g., C-9), or nucleic acid analogs (e.g., inosine, or 5-nitroindole). The non-specific portion of the capture probe usually contains one or a series of random "k" residues, i.e., G or U for RNA bases, or G or T for DNA or LNA bases. Unless otherwise indicated, the random k residues are synthesized with an equal amount of G and U bases, or a mixture containing G and T bases. Many embodiments of non-specific probes have a 5' portion that contains a non-specific sequence that hybridizes non-specifically to the target nucleic acid, and a 5' portion that contains a non-specific sequence, usually dT3dA. 30 , or dA 30 The capture probe comprises a 3' DNA "tail" sequence consisting of the sequence: This tail portion is complementary to the poly-dT oligomer attached to the support so that the capture probe (with or without bound target nucleic acid) is associated with the support and separated from the solution phase of the target capture mixture. It will be understood that the "tail" sequence attached to the non-specific capture probe can be any "tail" sequence, i.e., a non-nucleic acid specific binding partner (SBP), and that the selected specific binding partner (SBP') on the support is a member of a specific binding pair for an SBP.

[0039] The embodiments of non-specific capture probes described herein use the following nomenclature to simplify the construction of oligonucleotide components in the 5' to 3' direction. Oligonucleotides that contain one or more residues consisting of random G or U / T bases are referred to by the term "(k)x In this term, "k" represents a random combination of G and U, or G and T, and "x" indicates the number of positions in the random combination of G and U, or G and T bases. When the oligonucleotide uses a standard RNA backbone, the term can further include "r" to represent the RNA in the random combination of G and U bases, e.g., r(k) x On the other hand, if the oligomer uses RNA bases with a backbone of 2'-methoxy linkages, the term can further include "2'-Omer" to denote modified linkages of random combinations of G and U bases, e.g., 2'-Ome-(k) x If the oligonucleotide uses standard DNA binding, the term may include a "d" to represent DNA in a random combination of G and T bases, e.g., d(k). x whereas, if the oligomer uses DNA bases having a locked nucleic acid (LNA) conformation, the term may include an "L" to denote the LNA conformation in a random combination of G and T bases, e.g., L(k) x An oligonucleotide composed of a combination of different moieties may include one or more of these terms to define its overall structure. For example, in the 5' to 3' direction, 6 random G and T bases with standard DNA linkages, 3 T bases with standard DNA linkages, and 5 random G and T bases with standard DNA linkages (k bases) would be abbreviated as d(k)6-dT3-d(k)5. As another example, an oligonucleotide composed of 5 random G and T bases with LNA linkages, 3 A bases with DNA linkages, and 4 random G and T bases with DNA linkages in the 5' to 3' direction would be abbreviated as L(k)5-dA3-d(k)4. As another example, an oligonucleotide composed of 10 random G and U bases with 2'-methoxy linkages in the 5' to 3' direction, and a 3' tail of 15 A bases with standard DNA linkages would be abbreviated as 2'-Ome-(k)10 -dA 30 It is considered to be simplified as follows.

[0040] In a few cases, synthetic oligonucleotides of relatively complex structure are examined by quantifying the actual molecular weight of the synthetic oligonucleotide compared to the predicted molecular weight (MW) of the oligonucleotide based on the intended structure. For example, L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA, which has a predicted MW of 16,308 D, 30 Two different batches of oligonucleotides synthesized to produce the construct of (SEQ ID NO:18) were found to have MWs of 16263 D and 16248 D. The slightly lower MW measurements indicate that a minority of oligonucleotides in the population contain primarily T, rather than a T / G mixture.

[0041] The relative efficiency of target capture probe and conditions is quantified by measuring the signal emitted by the detection probe that binds to the capture target after the complex that includes the capture probe, the target nucleic acid, and the immobilization probe that is attached to the support is separated from the mixture.The detection probe can be attached to any point of the target nucleic acid, but for convenience and consistency in labeling the target nucleic acid in the sample in the model system to be tested, the detection probe is specifically hybridized to the target nucleic acid during the sample preparation process.Those skilled in the art will understand that the capture target nucleic acid can also be detected by other standard nucleic acid detection methods, for example, by binding a dye to the target nucleic acid before or after capture, or by incorporating a detectable label (e.g., a radioactive label) directly into the target nucleic acid.

[0042] Based on the results obtained by using different capture probes with different target nucleic acids in model systems, non-specific capture probes work with different efficiencies even under the same conditions.This shows that the structure of non-specific capture probes affects their relative affinity to a certain type of target nucleic acid.Based on these findings, a person skilled in the art can design and optimize target capture probes to bias the efficiency of the capture reaction to select a certain type of target nucleic acid, for example, to bias the reaction to preferentially capture DNA targets rather than RNA targets.Using the methods described herein, a person skilled in the art can design a variety of different but structurally related capture probes and test them to optimize the capture reaction for efficient capture of a certain type of target nucleic acid.

[0043] The examples are included to describe embodiments of the disclosed non-specific target capture methods and compositions. The reagents typically used in the assays described below are as follows, but those skilled in the art of molecular biology will understand that many alternative reagents are available to carry out the basic steps of the reactions and tests described. Sample Transport Reagents : 110 mM lithium lauryl sulfate (LLS), 15 mM NaH2PO4, 15 mM Na2HPO4, 1 mM EDTA, 1 mM EGTA, pH 6.7. Target Capture Reagents (TCR): 250mM HEPES, 1.88M LiCl, 310mM LiOH, 100 mM EDTA, pH 6.4, and 250 Fg / ml of paramagnetic particles ((dT) 14 Oligomers covalently attached, 0.7-1.05F particles, Sera-Mag™ MG-CM). Cleaning solution : 10 mM HEPES, 150 mM NaCl, 1 mM EDTA, 0.3% (v / v) ethanol, 0.02% (w / v) methylparaben, 0.01% (w / v) propylparaben, and 0.1% (v / v) sodium lauryl sulfate, pH 7.5. Hybridization Reagents : 100 mM succinic acid, 2% (w / v) LLS, 100 mM LiOH, 15 mM aldrithiol-2, 1.2 M LiCl, 20 mM EDTA, and 3.0% (v / v) ethanol, pH 4.7. Selection Reagent : 600 mM boric acid, 182.5 mM NaOH, 1% (v / v) octoxynol (TRITON® X-100), pH 8.5 or pH 9.2, to hydrolyze the AE label on unhybridized detection probe oligomers. Detection Reagents teeth, Detection Reagent I : 1 mM nitric acid and 32 mM H2O2, and Detection Reagent II : Contains 1.5M NaOH to induce chemiluminescence from the AE label (see U.S. Patent Nos. 5,283,174, 5,656,744, and 5,658,737).

[0044] The captured target nucleic acid may be detected by any process known to those skilled in the art of molecular biology that detects nucleic acid. For example, the captured nucleic acid may be detected by using a dye that specifically binds to nucleic acid in general or selectively binds to a specific form of nucleic acid. The specific nucleic acid may be detected by binding a detection probe that specifically hybridizes to the target sequence in the captured nucleic acid, or the target sequence in the captured nucleic acid may be treated by in vitro nucleic acid amplification to amplify a portion of the captured nucleic acid and then detected. In the model system described in the examples, the target nucleic acid in the sample is generally labeled by hybridizing it to a specific detection probe before target capture. The specific detection probes are labeled with acridinium ester (AE) compounds that induce a chemiluminescent signal (expressed in relative brightness units, or "RLU") in homogeneous systems using well-known methods detailed in other documents (see U.S. Pat. No. 5,658,737, column 25, lines 27-46, and Nelson et al., 1996, Biochem. 35:8429-8438, 8432). EXAMPLES

[0045] Example 1 Non-specific target capture of RNA This example demonstrates the efficiency of various non-specific target capture probes in capturing RNA. Tests were performed with known amounts of Chlamydia trachomatis rRNA (a mixture of 16S and 23S rRNA). Prior to capture, the target rRNA was labeled by hybridizing to a labeled detection probe complementary to a sequence in the rRNA. Typically, to prepare a test sample, 200 fmoles of rRNA were hybridized to 1 pmole of AE label dissolved in hybridization reagent (60 minutes at 60°C in 0.04 ml), then cooled to room temperature (RT) and diluted with 0.3 ml of hybridization reagent. An aliquot (10Fl) of the probe-labeled target nucleic acid mixture was mixed with 0.5 ml of a substantially aqueous solution (0.2 ml of sample transport reagent, 0.2 ml of water, and 0.1 ml of TCR containing 50 Fg magnetic particles with polydT immobilized probe) and 20 pmoles of non-specific capture probe. The mixture was incubated to allow attachment of the non-specific capture probe to the target nucleic acid and hybridization of the 3' tail of the non-specific capture probe to the complementary immobilized probe. The magnetic particles were separated from the solution phase by applying a magnetic field to the outside of the reaction vessel (pellet portion), and the supernatant was removed and saved. The magnetic particles with attached complexes in the pellet portion were washed as necessary (1 ml of washing solution at RT) and separated from the washing solution and pelleted as before. The magnetic particles with attached complexes in the pellet portion were suspended in 0.1 ml of aqueous buffer solution, and 0.1 ml of the saved supernatant portion was mixed with another 50 Fg of magnetic particles to provide a comparative supernatant aliquot for signal detection. Selection reagent (0.2 ml) was added to both the pellet and supernatant samples, which were incubated at 60° C. for 10 min to hydrolyze the AE label on the detection probe that was not bound to the target nucleic acid.Detection reagents were then added to induce chemiluminescence from the AE labels remaining on the probes bound to the target nucleic acids, and the relative brightness units (RLU) signal was measured in a photometer (LEADER®, Gen-Probe Incorporated) essentially as previously described (U.S. Pat. Nos. 5,283,174 and 5,656,744, Arnold et al., and U.S. Pat. No. 5,658,737, Nelson et al., column 25, lines 27-46; Nelson et al., 1996, Biochem. 35:8429-8438, p. 8432).

[0046] In the first set of tests, the nonspecific capture probes consisted of a 5' nonspecific target capture sequence, consisting of RNA bases and a 2'-methoxy linkage, and a dT3dA 30 and 3'-DNA tail sequences of the following structures: (n)6-U3-(n)6dT3dA 30 (SEQ ID NO: 1), (n)6-Ni3-(n)6dT3dA 30 (SEQ ID NO:2), in which "Ni" represents 5-nitroindole; (n)6-Ni5-(k)6-(n)6dT3dA 30 (SEQ ID NO:3), in which "Ni" represents 5-nitroindole; As shown by:

[0047] Target capture studies were performed as described above, using incubation at 60°C for 15 min followed by RT for 90 min. Negative controls were treated similarly but did not contain a target capture probe, and positive controls used a specific target capture probe containing a sequence that specifically hybridizes to the target sequence in the labeled rRNA probe as previously described. Table 1 shows the results obtained in these studies, with the RLUs detected in the supernatant and pellet portions shown in columns 2 and 3, respectively, and the calculated percentage of target nucleic acid captured in the pellet shown in column 4. These results showed that between two nonspecific capture probes containing a 5-nitroindole spacer between the randomized 6-mers, the probe containing a randomized k·6mer (G / U) captured RNA more efficiently than the nonspecific capture probe containing a randomized n·6mer (G, A, C, and U), and that the capture probe containing a randomized n·6mer linked by three U bases captured the target to the same extent as the probe containing a randomized k·6mer.

[0048] [Table 1] In the second set of experiments, the nonspecific capture probes consisted of a 5' nonspecific target capture sequence, consisting of RNA bases and a 2'-methoxy linkage, and a 3' dT3dA 30 They have the following structure: (l) 12 -dT3dA 30 (SEQ ID NO: 4), in which "l" represents inosine; (k)6-C9-C9-(k)6-dT3dA 30 (SEQ ID NO:5), in which "C9" represents a 9-carbon non-nucleotide spacer; (k)6-C9-(k)6-C9-(k)6-dT3dA 30 (SEQ ID NO: 6), in which "C9" represents a 9-carbon non-nucleotide spacer. As shown by:

[0049] Target capture studies were performed as previously described, except that incubation was at 60°C for 15 min, followed by RT for 60 min. Table 2 shows the results of these studies, displayed as above. The results showed that between the two nonspecific capture probes containing a C9 spacer, both the probe with two k·6 mers and the probe containing three k·6 mers efficiently captured rRNA, whereas the polyinosine probe was inefficient in capturing RNA targets.

[0050] [Table 2] In a third set of experiments, C9-containing non-specific capture probes of SEQ ID NOs: 5 and 6 were tested similarly, except that incubation was at 60° C. for 15 minutes, followed by 15 minutes at RT. In these experiments, the efficiency of RNA capture was 32% for the capture probe of SEQ ID NO: 5 and 50.7% for the capture probe of SEQ ID NO: 6, compared to 79% capture for the positive control and 0% capture for the negative control.

[0051] Example 2 Non-specific target capture of RNA This example demonstrates the efficiency of non-specific target capture to rRNA using a variety of different capture probes in an assay carried out substantially similarly to that described in Example 1, except that the target capture incubation was 10 to 30 minutes at room temperature. All non-specific capture probes used were synthesized with RNA bases and 2'-methoxy linkages, and 3' DNA tail sequences.

[0052] In a first set of studies, C9-containing nonspecific capture probes of SEQ ID NOs: 5 and 6 were tested using a 30 minute incubation at RT, and the efficiency of RNA capture was 71% for the capture probe of SEQ ID NO: 5 and 89.5% for the capture probe of SEQ ID NO: 6, compared to 53% capture for the positive control and 1.3% capture for the negative control. These results indicate that 60° C. incubation is not required for efficient, nonspecific target capture of RNA.

[0053] In a second set of target capture, also incubated at RT for 30 minutes, the non-specific capture probe of SEQ ID NO:5 was compared to three other non-specific capture probes, which were: (k) 12 -dT3dA 30 (SEQ ID NO: 7), (k)6-U3-(k)6-dT3dA 30 (SEQ ID NO: 8), and (k)6-U6-(k)6-dT3dA 30 (SEQ ID NO:9) It has the structure shown in:

[0054] Table 3 shows the results of these tests, displayed as described in Example 1. These results show the relative efficiency of different non-specific capture probe designs, all of which capture target RNA at RT.

[0055] [Table 3] In a third set of experiments, target capture of rRNA was performed using the same nonspecific capture probes (SEQ ID NOs: 5, 7, 8, and 9), except that incubation was at RT of 10 min. The results of these experiments are shown in Table 4. These results, compared with those in Table 3, indicate that although longer incubation at RT results in slightly greater target capture, significant target capture occurs at RT of only 10 min. Comparison of the results in Table 4 for the capture efficiency of a probe containing U3 linking two k·6-mers and a probe containing U6 linking two k·6-mers indicates that the probe with the U3 spacer is more efficient. Based on these and other results, capture probes containing shorter spacers (e.g., 3 nt, or one C-9 spacer) are generally more efficient than probes with similar structure but longer spacers (e.g., 6 nt, or two adjacent C-9 spacers).

[0056] [Table 4] Example 3 Target capture of HIV-1 target RNA This example demonstrates the use of two different non-specific target capture probes to capture HIV sequences. These probes were synthetic RNA sequences corresponding to portions of the HIV-1 protease-encoding gene and the RT4 gene. Tests were performed separately for both target nucleic acids, using known amounts of in vitro RNA transcripts (681 nt protease transcript, and 471 nt RT4 transcript) prepared from cloned protease and RT4 sequences, which were specifically and individually hybridized to labeled detection probes complementary to sequences in the target rRNA before being captured. To prepare the test sample, 200 fmoles of target RNA were specifically hybridized to the AE-labeled detection probe dissolved in hybridization reagent (60 min at 60° C. in 0.04 ml), cooled to room temperature (RT), and diluted with 0.3 ml of hybridization reagent. An aliquot (10Fl) of this probe-labeled target RNA mixture was mixed with 0.5ml of a substantially aqueous solution (0.2ml sample transport reagent, 0.2ml water, and 0.1ml TCR containing 50Fg magnetic particles with polydT immobilized probe) and 20pmole of non-specific capture probe. This mixture was incubated at RT for 30 minutes to allow attachment of the non-specific capture probe to the target nucleic acid and hybridization of the 3' tail of the capture probe to the immobilized probe. The magnetic particles with attached complexes (pellet part) were separated from the solution phase by applying a magnetic field and the supernatant was saved. The pellet part was washed (0.5ml sample transport reagent at RT) and separated as before to produce a pellet part, which was mixed with 0.1ml of aqueous buffer solution for detection of RLU. A part (0.1ml) of the saved supernatant was mixed with 50Fg magnetic particles for detection of RLU. Selection reagent (0.2 ml) was added to each mixture for RLU detection, the mixture was incubated at 60° C. for 10 min, then mixed with detection reagent, and detection of chemiluminescence (RLU) was performed as described in Example 1.

[0057] The nonspecific capture probe used in these studies was (k) 12 -dT3dA 30 (SEQ ID NO: 7), and (k)6-C9-(k)6-C9-(k)6-dT3dA 30 (SEQ ID NO:6). The negative control was treated similarly to the test samples, but the mixture did not contain a capture probe. Table 5 shows the test results, which demonstrate that both nonspecific capture probes are effective in capturing HIV-1 target RNA from the mixture.

[0058] [Table 5] Example 4 Kinetics of target capture using non-specific capture probes This example shows that target capture using non-specific capture probes is efficient at RT, with significant capture occurring in as little as 2-5 minutes. These studies were performed essentially as described in Example 2, except that incubations were performed for various periods (1-60 minutes). After incubation, pellet portions were isolated and the signal (RLU) from the captured target RNA was measured to determine the relative efficiency of target capture over time.

[0059] In the first set of experiments, the following nonspecific capture probes (20 pmoles per reaction) were used to capture the detector probe-labeled rRNA targets. All capture probes were synthesized with RNA bases and 2'-methoxy linkages in the nonspecific portion, and 3' DNA tails: (k) 12 -dT3dA 30 (SEQ ID NO: 7), (k) 18 -dT3dA 30 (SEQ ID NO: 11), and (k) 24 -dT3dA 30(SEQ ID NO: 12). The target capture mixture was incubated at RT for 1, 2, 5, 10, and 20 min, then the pellet portion was isolated and the signal was measured. In a related experiment, the same nonspecific capture probe was synthesized with a 5' nonspecific portion, 2'-methoxy-linked RNA bases, and a 3' tail containing polyA residues as a mixture of DNA and LNA conformations (k). 18 Capture probe (SEQ ID NO: 13, diagrammatically (k) 18 -dT3dA3LA1dA3LA1dA1LA1dA1LA1dA3LA1dA3LA1dA1LA1dA1LA2dA3LA1dA1, which is (k) in Table 6. 18 -dT3 / L(A 30 ) were tested under the same conditions, except that the incubation was 18 min. In all of these tests, negative controls were treated identically to the test samples, except that no capture probe was included in the target capture mixture. The negative controls yielded RLU signals equivalent to 1.4 to 1.9% of the target. The results of these tests are shown in Table 6. The results revealed that maximum capture was observed after 18-20 min of incubation, but significant capture was observed after only 1-2 min of incubation at room temperature, and that the presence of the LNA conformation in the 3' tail did not improve the efficiency of non-specific target capture.

[0060] [Table 6] The second set of tests contained the same nonspecific capture probe as the first set of tests, and (G / T) 18 -dT3dA 30The same rRNA target was captured using another non-specific capture probe, which contained an 18-nt segment of random G and T bases, synthesized with a 2'-methoxy linkage and a 3' DNA tail, as shown in (SEQ ID NO: 14). This target capture mixture was incubated at RT for 5 and 60 min, and then the pellet portion was isolated and the signal was measured. A negative control treated similarly but without the capture probe gave 1078 RLU after 5 min incubation and 2160 RLU after 60 min incubation in the pellet portion. The results of the test of the reaction carried out with the non-specific capture probe are shown in Table 7. The results showed that the maximum capture was observed after 60 min incubation, but significant capture was also observed after 5 min incubation at RT.

[0061] [Table 7] In a third set of experiments, the same rRNA target was captured using a nonspecific capture probe with an 18-nt 5' portion, synthesized with a 2'-methoxy linkage, and a 3' DNA tail, either as a random G / U or random G / T sequence. The target capture mixture was incubated at RT for 0 to 50 min, and then the pellet portion was isolated and the signal was measured. The results of these experiments are shown in Table 8. The results showed that maximum capture was observed after 50 min of incubation, but significant capture was also observed after 1-2 min of incubation at RT, and that at all time points, the capture probe containing the random G / T sequence captured slightly more efficiently than the capture probe containing the random G / U sequence.

[0062] [Table 8] Example 5 Target capture by non-specific capture probes of various designs This example demonstrates that many different embodiments of non-specific capture probes are effective in capturing rRNA target nucleic acids, and that testing of various capture probes can be used to optimize assay performance. The testing described in this example was carried out in a manner similar to that described in Example 2, using detection probe-labeled rRNA as the target and RT incubation of the target capture mixture.

[0063] In the first set of tests, all nonspecific capture probes were dT3dA 30 The 3' DNA tails were synthesized with a variety of different structures in the 5' non-specific portion. The structures are as follows: (k) 18 -dT3dA 30 (SEQ ID NO:11), the 5' portion is synthesized with RNA bases and 2'-methoxy bases; d(k)6-dT3-d(k)6-dT3dA 30 (SEQ ID NO:10), the 5' portion is synthesized by DNA only; L(k)6-dT3-L(k)6-dT3dA 30 (SEQ ID NO: 15), the 5' portion being synthesized as LNA and DNA; and L(k)4-d(k)2-dT3-L(k)4-d(k)2-dT3dA 30 (SEQ ID NO: 16), the 5' portion is synthesized as LNA and DNA, The capture probe of SEQ ID NO:11 was synthesized with various ratios of G and U bases (50:50, 70:30, and 30:70) to determine which particular random mixture was preferred for efficient RNA target capture. The target capture mixtures separately contained 20 pmoles of non-specific capture probe, were incubated at RT for 20 minutes, and then processed as described in Example 2 to quantify the signal associated with the pellet portion after target capture. The negative control was similarly processed except that the mixture did not contain capture probe, but gave 38267 RLU in the supernatant portion and 1379 RLU in the pellet portion. The results of these tests are shown in Table 9. The results demonstrate that the performance of various conformations of the non-specific capture probe exhibits different relative efficiencies. Random combinations of G and U bases synthesized such that G:U=50:50 or 30:70 were more effective than those synthesized such that G:U=70:30 (compare columns 2-4 in Table 9). Capture probes with similar structures but made with LNA residues were more effective than the corresponding capture probes made with DNA residues (compare columns 5 and 6 in Table 9).

[0064] [Table 9] A second set of experiments, performed using the same target nucleic acids and target capture conditions as the first set of experiments in this example, compared a variety of nonspecific capture probes, all of which contained an 18-nt nonspecific region synthesized with a 2'-methoxy linkage and all of which had a 3' DNA tail. 18 (k) the moieties are synthesized using mixtures of 50:50, 70:30, and 30:70 ratios; 18 -dT3dA 30 The capture probe of (SEQ ID NO: 11) was 18 -dT3dA 30(SEQ ID NO: 17). The results of these tests showed the relative efficiency of these capture probes in target rRNA capture. The poly U-containing capture probe was the least efficient (3.5% capture), the poly k-containing capture probe made with G:U=70:30 was efficient (41% capture), and the poly k-containing capture probes made with G:U=50:50 and 30:70 were the most efficient (73% and 65% capture, respectively). Thus, the comparative tests can be used to optimize probe design for non-specific target capture.

[0065] Example 6 Target capture with different amounts of non-specific capture probes This example shows that it is possible to optimize target capture reactions by determining the optimal amount of non-specific capture probe included in the reaction. These studies were performed using reaction mixtures and conditions similar to those described in Example 2, except that various amounts (e.g., 1-60 pmoles) of non-specific capture probe were used per reaction. Target capture reactions were incubated at RT for 10-25 minutes, then the pellet portion was separated and capture efficiency was measured by detecting the RLU of the pellet portion.

[0066] In the first set of experiments, nonspecific capture probes containing an 18-nt nonspecific region with various conformations were synthesized and compared. The first conformation was synthesized with RNA bases and a 2'-methoxy linkage in the 5' portion and DNA in the 3' tail (k). 18 -dT3dA 30 (SEQ ID NO: 11), and the second conformation is L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA, synthesized with LNA and DNA bases in the DNA conformation in the 5' portion and DNA in the 3' tail. 30(SEQ ID NO: 18). These two capture probes were tested with the same rRNA target, but separately, using 1, 2, 5, 10, 15, 20, 30, and 60 pmoles of capture probe per reaction, incubated at RT for 10 minutes. The results of these tests, shown in Table 10, indicate that capture is most efficient when approximately 15-30 pmoles of capture probe per reaction is used, and that capture probes with 2'-methoxy linkages in the backbone are slightly more efficient than conformations with DNA and LNA residues.

[0067] [Table 10] In the second set of tests, conformations (k) synthesized with RNA bases and 2'-methoxy bonds in the 5' portion were 18 -dT3dA 30 A non-specific capture probe having (SEQ ID NO: 11) was prepared by adding DNA and LNA in the 5' portion, except that L(k)3-d(k)3-L(k)3-d(k)3-L(k)3-d(k)3-dT3dA 30 (SEQ ID NO: 19). Both probes contained a 3' DNA tail. Reactions were performed similarly to that described in the first set of experiments in this example, except that the capture probes were used at 1, 2, 5, 10, 15, 20, 40, and 60 pmoles per reaction and incubated at RT for 15 minutes. The results of these experiments are shown in Table 11. The results indicate that both conformations efficiently capture the RNA target, but that the LNA-containing capture probes are slightly more efficient at the low end of the concentration range tested.

[0068] [Table 11] Another set of experiments was carried out using two different concentrations of K 18 The same procedure was carried out using a capture probe. One conformation was L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA30 (SEQ ID NO: 18), and the other is L(k)3-d(k)3-L(k)3-d(k)3-L(k)3-d(k)3-dT3dA 30 (SEQ ID NO:19) and were tested as above using 0, 1, 2, 5, 10, 15, 20, 40, and 60 pmoles of capture probe per reaction, incubated at RT for 10 min. Target capture by the two conformations performed similarly in the 1-60 pmole range (15-50% capture with SEQ ID NO:18 probe, 21-65% capture with SEQ ID NO:19 probe), but capture was most efficient in the 15-40 pmole range of probe per reaction (45-50% with the first probe, 58-65% with the second probe). In separate studies, the same target rRNA and the same range of amounts of capture probe were used, but incubated at RT for 25 min. In these studies, in the 1-60 pmole range, the SEQ ID NO:18 probe captured 16-87% of the target, while the SEQ ID NO:19 probe captured 27-100% of the target, with the most efficient capture for both probes occurring in the 10-60 pmole range.

[0069] non-specific k 18 A similar set of experiments was performed using two different conformations of the capture probe (SEQ ID NO:11), both consisting of a nonspecific 5' region with a 2'-methoxy linkage and a 3' DNA tail. One was synthesized with RNA bases (equimolar G and U, SEQ ID NO:20) and one with DNA bases (equimolar G and T, SEQ ID NO:14). 0, 1, 2, 5, 10, 15, 20, 30, and 60 pmoles of capture probe per reaction were used and incubated at RT for 10 min and tested as described above. Capture with the two capture probes performed similarly in the 1-60 pmole range (15-85% capture for the G / U probe and 21-90% capture for the G / T probe), but capture was most efficient in the 15-30 pmole range of probe per reaction (78-85% for the G / U probe and 86-90% for the G / T probe).

[0070] (GU)9-dT3dA30 (SEQ ID NO: 21) and (G / U) 18 -dT3dA 30 A similar study was performed to compare a nonspecific probe synthesized with (SEQ ID NO:20), both of which have RNA bases and a 5' region with a 2'-methoxy linkage. The two capture probes were tested separately on the same target rRNA by incubating for 25 min at RT using 0, 1, 2, 5, 10, 15, 20, 40, and 60 pmoles of capture probe per reaction. Target capture with the two capture probes performed similarly in the 1-60 pmole range (17-96% capture with SEQ ID NO:20 probe and 7-91% capture with SEQ ID NO:21 probe), but capture was most efficient in the 10-40 pmole range of probe per reaction (87-96% with SEQ ID NO:20 probe and 75-91% with SEQ ID NO:21 probe).

[0071] Example 7 Targeted capture of DNA targets with non-specific capture probes This example shows that the non-specific target capture probe efficiently captures target DNA from a sample. The target DNA is either a synthetic single-stranded ssDNA consisting of SEQ ID NO: 22: CCTCCATTCCGTTACCAACAGAACTGGAGGCGGTACAATGGGTCTTGTCATCCGGTAAAGGCCAAATATACGAGCATCAACATATGTACTTATGTATGTATCTACTATATACATACATATGTACATATATGAATACCATCAGTCTGTGCAGT, or a substantially dsDNA made by hybridizing the ssDNA of SEQ ID NO: 22 with a complementary strand (SEQ ID NO: 23) that retains a portion of the ssDNA strand available for hybridization with a complementary detection probe. The ssDNA or dsDNA was labeled by hybridizing to a labeled probe (200 fmol of target DNA in a 0.04 ml solution was hybridized to 1 pmole of AE-labeled probe at 60° C. for 1 hour, then diluted with 0.4 ml of aqueous buffer). The target capture reaction contained an aliquot (0.01 ml) of probe-labeled target DNA mixed with 0.2 ml of sample transport buffer, 0.2 ml of water, and 0.1 ml of TCR containing polydT immobilized on magnetic particles and 0.5 ml containing 20 pmoles of capture probe to be tested. The target capture reaction was incubated at RT for 1 hour, then processed to pellet the capture complexes, washed the capture complexes once (0.5 ml wash), and detected for RLU substantially as described in Example 1.

[0072] In the first set of tests, the non-specific capture probes used were: (k) 18 -dT3dA 30 (SEQ ID NO:11), the 5' portion is synthesized with RNA bases and 2'-methoxy bases; d(k)6-dT3-d(k)6-dT3dA 30 (SEQ ID NO:10), the 5' portion is synthesized by DNA only; L(k)6-dT3-L(k)6-dT3dA 30(SEQ ID NO: 24), the 5' portion being synthesized as LNA and DNA; and L(k)4-d(k)2-dT3-L(k)4-d(k)2-dT3dA 30 (SEQ ID NO: 25), the 5' portion is synthesized as LNA and DNA, Negative controls were samples treated similarly, but the target capture reaction mixture did not contain any capture probe. The results of these tests are shown in Table 12. These results indicate that ssDNA can be captured by non-specific target probes, and that the structure of the probe affects capture efficiency.

[0073] [Table 12] In another set of studies, different conformations and various amounts (1-40 pmoles) of k 18 Using the capture probe, target capture of ssDNA was carried out as described above. One conformation has a 5' non-specific portion synthesized with a 2'-methoxy RNA group, and a 3' DNA tail, (k). 18 -dT3dA 30 (SEQ ID NO: 11), and the other conformation is L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA, which has a 5' non-specific portion composed of LNA and DNA residues, and a 3' DNA tail. 30 (SEQ ID NO: 18). Negative controls were treated similarly but did not contain the capture probe. The target capture reaction was incubated at RT for 10 minutes and the remaining assay steps were as described above. The results, shown in Table 13, indicate that the LNA / DNA capture probe, which has an RNA residue and a 2'-methoxy linkage in the oligomer backbone, is superior in non-specific capture of ssDNA. 18 For both capture probes, capture was efficient in the range of 15-40 pmoles of capture probe per reaction.

[0074] [Table 13] In the next set of tests, two k 18 The capture probe was tested using various amounts (1-60 pmoles) of the capture probe. The two conformations tested were L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA. 30 (SEQ ID NO: 18), and L(k)3-d(k)3-L(k)3-d(k)3-L(k)3-d(k)3-dT3dA 30 (SEQ ID NO: 19). The target was ssDNA and was captured in a target capture reaction mixture incubated at RT for 20 min using methods essentially as described above. The results of these studies are shown in Table 14. The results indicate that capture efficiency is influenced by the LNA / DNA structure of the capture probe.

[0075] [Table 14] Using the same conditions as in the immediately preceding study, the k 18 Non-specific capture probes were tested for ssDNA target capture using 1-60 pmoles of capture probe per reaction. L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA 30 (SEQ ID NO: 18) captured 4 to 66% of ssDNA in the 1-60 pmole range, but efficient capture (54-66%) was seen in the 15-60 pmole range. 30 The capture probe of (SEQ ID NO:26) captured 2 to 62% of ssDNA in the 1-60 pmole range, although efficient capture (49-62%) was seen in the 15-60 pmole range. The most efficient capture for both probes was seen when 40 pmole was included in the reaction.

[0076] In another set of tests, different conformations of (k) 12 , (k)18 or (k) 25 A non-specific capture probe with a non-specific sequence was used to capture the ssDNA target. Each probe was tested individually as above, using 20 pmoles per reaction, but incubated at RT for 30 minutes. (k) below 12 The capture probes were tested: d(k)6-dT3-L(k)6-dT3dA 30 (SEQ ID NO:27), L(k)6-dT3-L(k)6-dT3dA 30 (SEQ ID NO: 15), and L(k)4-d(k)2-dT3-L(k)4-d(k)2-dT3dA 30 (Sequence number 25).

[0077] These three (k) 12 The probe is 18 and (k) 25 Compared to capture probes: L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA 30 (SEQ ID NO: 18), and L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA 30 (SEQ ID NO:28, (k) 25 probe).

[0078] Of these five capture probes, (k) 18 and (k) 25 The capture probes were the most efficient at capturing ssDNA (74% and 77%, respectively). 12 The first of the probes (SEQ ID NO:27), which did not contain any LNA, was the least effective (0.5%) in capturing DNA targets, whereas the two probes containing LNA were more effective in capturing ssDNA (15% for SEQ ID NO:15 probe and 42% for SEQ ID NO:25 probe). Based on the results of these and other tests performed using the same method for ssDNA capture, the k of the various LNA / DNA conformations was 18The relative efficiency of the nonspecific capture probes was determined as shown in the following list, with the most effective capture probe listed first: (1) L(k)3-d(k)3-L(k)3-d(k)3-L(k)3-d(k)3-dT3dA 30 , (2)L(k)4-d(k)3-L(k)4-d(k)3-L(k)4-dT3dA 30 , (3)L(k)2-d(k)4-L(k)2-d(k)4-L(k)2-d(k)4-dT3dA 30 , (4)L(k)5-d(k)2-L(k)5-d(k)2-L(k)4-dT3dA 30 , and (5)L(k)1-d(k)5-L(k)1-d(k)5-L(k)1-d(k)5-dT3dA 30 In general, nonspecific capture probes containing a mixture of LNA and DNA conformations were more efficient in capturing ssDNA targets than capture probes of the same length with DNA conformations or capture probes synthesized with RNA bases with 2'-methoxy linkages in the nonspecific portion.

[0079] Example 8 Non-specific target capture by using non-nucleic acid specific binding partners This example demonstrates non-specific target capture by a non-specific capture probe that contains a first specific binding partner (SBP) that specifically binds to a second specific binding partner (SBP'), which is not a nucleic acid but is an immobilized probe attached to a support. This demonstration was carried out using a model system in which the SBP is biotin attached to an oligonucleotide that contains a non-specific binding region for the target nucleic acid, and the SBP' is streptavidin attached to a magnetic particle (Streptavidin-conjugated DYNABEAD®, Invitrogen Corp., Carlsbad, CA). This model system uses an rRNA target prepared as described in Examples 1 and 2. The non-specific capture probe is (k) 18-dT6-biotin (SEQ ID NO: 29), synthesized with RNA bases and 2'-methoxy linkage at the 5' end and biotin attached to the 3' end. The target capture reaction contained an aliquot (0.01 ml) of probe-labeled rRNA (described in Example 1) mixed with 0.2 ml sample transport buffer, 0.2 ml water, and 0.1 ml TCR, and containing a biotin-derivative capture probe that specifically binds to streptavidin-bound magnetic beads via the specific binding pair of biotin and streptavidin. The labeled capture reaction was incubated at RT for 20 minutes and then processed to pellet the capture complex as described in Example 1, the pellet portion was washed once with 0.5 ml wash solution, and the pellet portion was separated as described above. The chemiluminescence signal from the AE-labeled probe attached to the labeled rRNA was then detected as described in Example 1. The signal in the supernatant portion was also detected, which was 246310 RLU. The results of this experiment are shown in Table 15. This table shows that target capture mediated by nonspecific capture probes attached to a support via a specific binding pair captures RNA targets, with the most efficient capture being seen with streptavidin-coupled particles of approximately 60-120 Fg.

[0080] [Table 15] In the second test, using the same materials as above, the target capture mixture was incubated at RT for 2 to 60 minutes, then the complex on the support was separated from the solution phase and the remaining steps as above were carried out to detect the time course of capture. All these reactions were carried out using 100 Fg streptavidin-coupled magnetic particles attached to a biotin-derivatized capture probe. The time course of target capture is shown by the results shown in Table 16. The results showed that there was efficient capture in as little as 6 minutes, with maximum capture occurring at 60 minutes.

[0081] [Table 16]

Claims

[Claim 1] A kit or method as described in the specification.

Images