Dairy cow 10K low-density SNP chip based on targeted capture sequencing and application of dairy cow 10K low-density SNP chip

Abstract

The invention discloses a dairy cow 10K low-density SNP (Single Nucleotide Polymorphism) chip based on targeted capture sequencing and application thereof. The invention provides a 10K low-density chip for detecting genotypes of dairy cows. Comprising 11352 SNP loci and 6 INDEL loci (mainly comprising three types of loci related to dairy cow importance characters, paternity test and genetic defect loci and loci selected from an existing commercial dairy cow genome chip) on a dairy cow genome. Compared with an existing high-density chip, the 10K low-density genome chip provided by the invention is low in detection cost, and compared with the existing high-density chip, the 10K chip provided by the invention is consistent in detection performance in the aspects of SNP (Single Nucleotide Polymorphism) detection rate, polymorphism detection, individual genotype detection rate, genetic evaluation accuracy and the like. The chip disclosed by the invention can be applied to cow whole genome selection and genetic defect identification, and has important significance on early breeding of replacement cows, establishment of cow core groups, seed selection and matching, acceleration of genetic progress and improvement of feed management efficiency.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a dairy cow 10K low-density SNP chip based on targeted capture sequencing and an application thereof. Background Art

[0002] SNP is the abbreviation of Single Nucleotide Polymorphism, which has the characteristics of large number and easy typing. SNP analysis is currently an important analytical method for mining and identifying key genes of important complex traits and genome selection (GS).

[0003] The genomic selection process generally includes three steps: (1) establishing a reference population to ensure that the reference population has complete pedigree records and that each individual has known phenotypic records and genotypic data. Then, linkage detection is performed on all SNP sites related to QTLs in the entire genome to predict the effect value of each SNP or different chromosome fragments. (2) establishing a candidate population, genotyping the candidate population to obtain the genotypic data of the individuals, and estimating the breeding value (Genomic Estimated Breeding Value, GEBV) of each individual in the candidate population through the SNP effect value obtained from the reference population. (3) selecting the individuals in the candidate population based on the obtained GEBV ranking. After the selected individuals in the candidate population have completed the phenotypic performance measurement, they can be returned to the reference population to re-estimate the SNP effect value. This process is repeated to complete the update of the reference population and the candidate population.

[0004] The main principle of genomic selection is to evaluate and select individuals with excellent genes through high-density markers (mainly SNPs) throughout the genome. This technology can be used to accurately select young bulls and reserve cows at an early stage without relying on phenotypic information, shortening the dairy cow breeding cycle from 5-6 years to about 2 years, greatly shortening the generation interval, thereby significantly reducing breeding costs and accelerating population genetic progress.

[0005] Since 2009, Illumina has developed two cattle genome chips, Bovine SNP 50K chip (containing 54,000 SNPs) and Bovine HD (containing 777,962 SNPs); since 2014, Neogen has developed Neogen 80K, Neogen 150K, and Neogen 100K cattle genome SNP chips. The inventor team has also developed 30K, 40K, 126K and other low-density and high-density chips for Holstein cows. However, medium and high density SNP chips are mainly used for genome evaluation of young bulls and reference population construction (bulls do not produce milk, and frozen semen is promoted through artificial insemination technology for genetic improvement of cow populations. Therefore, the number of bulls is far less than that of cows. As of October 2024, there are 610 dairy bulls in my country), and the detection price is still relatively expensive. The current unit price of 40K, 126K, and 150K chip genotyping in China is about 180 yuan, 260 yuan, and 480 yuan, which affects the large-scale application of GS in cow populations. According to the current cost of domestic DNA probe synthesis and high-throughput sequencing, the unit price of 10K chip genotyping is only about 100 yuan, and the unit price is less than 100 yuan when the test sample is large, which is suitable for dairy farms (12.33 million dairy cows in the country). Therefore, the development of a low-density SNP chip for dairy cows is of great significance for the early selection and breeding of reserve dairy cows, the establishment of a core group of cows, the selection and matching of breeds, as well as accelerating genetic progress and improving feed management efficiency. Summary of the invention

[0006] The purpose of the present invention is to provide a dairy cow 10K low-density SNP chip based on targeted capture sequencing and application thereof.

[0007] In a first aspect, the present invention claims a chip for detecting the genotype of a dairy cow.

[0008] The chip for detecting the genotype of dairy cows claimed in the present invention is a dairy cow 10K low-density SNP chip based on targeted capture sequencing, comprising:

[0009] (A1) a single-stranded nucleotide probe for specifically detecting a SNP site; the SNP site is one of the 11352 SNP sites in Table 2;

[0010] (A2) a single-stranded nucleotide probe for specifically detecting an INDEL site; the INDEL site is one of the six INDEL sites in Table 3;

[0011] The position information of the 11352 SNP sites in Table 2 and the 6 INDEL sites in Table 3 were determined based on the comparison of the reference sequence of the dairy cow genome, and the reference sequence of the dairy cow genome was Bos_taurus UMD3.1 version (Bos_taurus-Ensembl genome browser 112).

[0012] The position information of each target point (including the target point 1 and the target point 2) mentioned below is also determined by comparison based on the reference sequence of the dairy cow genome (Bos_taurus UMD3.1 version).

[0013] Further, in (A1), there are a total of 11352 single-stranded nucleotide probes. For each SNP site, a target site (the target site is a sequence with a length of 110 bp) is selected from the 110 bp range upstream and downstream of the location of the SNP site on the dairy cow genome (Bos_taurus UMD3.1 version), the target site covers the SNP site, and a probe is designed for the target site, and the nucleotide sequence of the probe is reverse complementary to the nucleotide sequence of the target site.

[0014] Further, in (A2), there are 6 pairs of single-stranded nucleotide probes in total. For each INDEL site, a target 1 is selected from the upstream 110bp range of the location of the INDEL site on the dairy cow genome (Bos_taurus UMD3.1 version) (the target 1 is a sequence with a length of 110bp), the target 1 does not cover the INDEL site, an upstream probe is designed for the target 1, and the nucleotide sequence of the upstream probe is reversely complementary to the nucleotide sequence of the target 1; a target 2 is selected from the location of the INDEL on the dairy cow genome (Bos_taurus UMD3.1 version) and the downstream 110bp range (the target 2 is a sequence with a length of 110bp), the target 2 covers all or part of the nucleotides in the INDEL site, a downstream probe is designed for the target 2, and the nucleotide sequence of the downstream probe is reversely complementary to the nucleotide sequence of the target 2.

[0015] Furthermore, in (A1), the starting position and the ending position of the target corresponding to each of the 11352 single-stranded nucleotide probes are shown in Table 2. The 11352 single-stranded nucleotide probes include the probe shown in SEQ ID No. 1.

[0016] Furthermore, in (A2), in the 6 pairs of single-stranded nucleotide probes, the starting position and the ending position of the target 1 corresponding to the upstream probe in each pair of probes, and the starting position and the ending position of the target 2 corresponding to the downstream probe are as shown in Table 3. The 6 pairs of single-stranded nucleotide probes include a pair of probes consisting of an upstream probe shown in SEQ ID No. 2 and a downstream probe shown in SEQ ID No. 3.

[0017] It should be noted that, when the reference genome and its version number are determined, it is very easy for a person skilled in the art to obtain the specific sequence information of each probe after the specific location information of the target is given. Due to space limitations, the specific sequence information of each probe is not intuitively displayed one by one in the article.

[0018] Furthermore, in the chip, each of the single-stranded nucleotide probes is modified with biotin.

[0019] Accordingly, the chip further comprises magnetic beads modified with streptavidin.

[0020] In one embodiment of the present invention, the chip is a liquid phase probe hybridization chip.

[0021] In a second aspect, the present invention claims protection for the use of the chip described in the first aspect above in dairy cow breeding.

[0022] Furthermore, the breeding is molecular marker-assisted breeding, specifically, genomic selection breeding.

[0023] In a third aspect, the present invention claims protection for the use of the chip described in the first aspect above in genotyping detection of dairy cows.

[0024] In a fourth aspect, the present invention claims protection for the use of the chip described in the first aspect above in identifying the relationship of dairy cows.

[0025] In a fifth aspect, the present invention claims protection for the use of the chip described in the first aspect above in the preparation of a product for diagnosing genetic defects in dairy cows.

[0026] In each of the above related aspects, the dairy cows can be Holstein cows.

[0027] In the 10K low-density chip for dairy cows based on targeted capture sequencing provided by the present invention, the molecular markers mainly come from three types of sites: the first type, SNP sites significantly related to some important traits of dairy cows (including milk production, body shape and health traits) excavated and identified by the inventor's team in the early stage of research, a total of 153 SNP sites; the second type, 199 parentage identification sites (three of which are repeated with the first type of sites) and 34 genetic defect sites; the third type, based on the large-scale reference population constructed in my country, according to the detection rate, gene frequency, position uniqueness, genotype filling principle and distribution on the genome, 10975 SNP sites were selected from the existing commercial dairy cow genome chips. The above three categories contain a total of 11358 sites.

[0028] The 10K low-density genome chip provided by the present invention has lower detection cost than the existing high-density chip, so it will inevitably be more widely used in practical applications. Experiments have shown that compared with the existing 40K, 126K and 150K chips, the 10K chip of the present invention has consistent detection performance in terms of SNP detection rate, polymorphism detection, individual genotype detection rate, and genetic assessment accuracy. The chip of the present invention can be applied to the whole genome selection and genetic defect identification of dairy cows, which is of great significance for the early breeding of reserve dairy cows, the establishment of a core group of cows, the selection of breeds, and the acceleration of genetic progress and the improvement of feed management efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The chip of the present invention is a flow chart for design and preparation.

[0030] Figure 2 The figure shows the distribution of 11352 SNP sites on dairy cow chromosomes.

[0031] Figure 3 The results are a comparison of the accuracy of genome genetic evaluation between the chip of the present invention and other existing chips. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] Example 1. Design and preparation of a 10K low-density SNP chip for dairy cows based on targeted capture sequencing

[0035] Figure 1 The chip of the present invention is a flow chart for design and preparation.

[0036] 1. Acquisition of the first type of sites

[0037] Studies have shown that adding SNP sites significantly associated with target traits to the SNP chip can improve the accuracy of genome selection. Therefore, it is necessary to add sites of the genetic background of the Chinese Holstein dairy cow population to the chip. The inventors added 153 SNP sites significantly associated with important traits of Chinese Holstein dairy cows (including milk production, body shape and health traits) to the 10K chip using multi-omics technologies such as whole genome association analysis, resequencing, transcriptome and metabolome.

[0038] The first type of loci are SNP200 to SNP349, and SNP52, 56 and 173 (these three loci are repeated with the second type of loci later) in Table 2. The detailed process of obtaining the SNP loci related to each trait is as follows:

[0039] 1. Milk production traits

[0040] Milk production traits are the most important economic traits of dairy cows, including milk yield, milk fat content, milk protein content, milk fat rate, milk protein rate and milk fatty acid content.

[0041] (1) Analysis of genetic effects of candidate genes

[0042] The main genes affecting the milk production of dairy cows found in the current research are DGAT1, GHR, ABCG2 and EEF1D. At the same time, the inventor's team has previously identified other key functional genes, including AKT3, PKLR, SEC13, ACAT1, ACOX2, ADIPOQ, ALDH18A1, AMDHD2, APOA2, APOB, APOC4, CLINT1, CYP2C18, CYP3A5, CYP7A1, DH1, EHHADH, ETFA, FBP2, GLUL, HADH, HADHB, HSD17B2, IDH2, LDHA, MAT2A, NPL, PCK1, PM20D1, PP4C, PRKACA, SUCLA2, APOP4, APOP5, GYS2, LDHB, NGFR, NR0B2, PC, PPP2R2B and SLC22A7.

[0043] A total of 947 Chinese Holstein cows from 22 farms and 45 bull families of Beijing Shounong Animal Husbandry were used as the experimental population for genetic effect analysis. A total of 135 SNP loci were identified through frozen sperm DNA pool sequencing, and individual genotyping was performed using targeted sequencing genotyping technology (Genotyping By Target Sequencing, GBTS). The SAS software MIXED process and animal model (model as follows) were used to perform single marker and haplotype association analysis on SNP loci and five milk production traits (milk yield, milk fat content, milk fat rate, milk protein content and milk protein rate).

[0044] y=μ+hys+b×M+G+a+e

[0045] Among them, y is the phenotypic value of milk production traits (individual 305-day milk production, milk fat content, milk protein content, milk fat rate and milk protein rate), μ is the overall mean, hys is the production year and season utility, b is the regression coefficient of the covariate M, M is the calving age effect, G is the genotype / haplotype combination effect, a is the individual random additive genetic effect and e is the random residual effect.

[0046] According to the results of single marker and haplotype association analysis, the above 135 SNP sites were significantly associated with one or more milk production traits (P<0.05, P<0.01), allele substitution effect or additive genetic effect (P<0.05, P<0.01). Among the above significant sites, 126 SNP sites were included in the 10K chip.

[0047] 2. Body shape traits

[0048] The Bovine SNP50 bovine whole-genome SNP chip was used to detect the individual genotypes of 1,314 Chinese Holstein cattle from Beijing Shounong Livestock. The LASSO model (the model is as follows) was used for genome-wide association analysis of 29 somatotype traits (including size, body height, front segment, chest width, body depth, loin strength, rump width, rump angle, bone texture, hoof angle, hind limb side view, udder depth, udder texture, central suspensory ligament, anterior chamber attachment, anterior teat position, teat length, posterior attachment height, posterior attachment width, posterior teat position and angularity, as well as 8 functional scoring traits including total score, capacity, milking characteristics, rump, limbs and hooves, front udder, hind udder and lactation system).

[0049] The 10K chip included 16 significant SNP loci that were significantly associated with body shape traits.

[0050] 3. Health traits

[0051] (1) Immunoglobulin

[0052] A group of 588 Chinese Holstein cattle from Beijing Shounong Animal Husbandry was selected as the research subjects. Colostrum, serum and hair samples were collected within 24 hours after calving. The concentrations of immunoglobulins and albumin in colostrum and serum were detected by ELISA kits, and genotyping was performed using Neogen 150K chip. Based on GCTA software, the estimated heritability of colostrum and serum IgG, IgA IgM and albumin concentrations was 0.08-0.48. Except for serum IgG1 and IgG2 concentrations, most immunoglobulin concentrations had medium-to-high heritability (0.12-0.48). Using GCTA software, a genome-wide association analysis was performed based on a mixed linear model. Six SNP loci included in this chip were significantly associated with colostrum and serum IgG, IgG2 and IgM concentrations (P<3.08E-6).

[0053] (2) Susceptibility / resistance to paratuberculosis

[0054] A total of 945 dairy cows from Beijing Shounong Animal Husbandry were selected as the research population, and a case-control strategy was used to conduct a genome-wide association analysis of paratuberculosis susceptibility / resistance. Bovine 50K chip and Neogen 150K chip were used for individual genotyping, and the serum paratuberculosis antibody OD value was used as the phenotype (185 positive and 760 negative). GRAMMAR-GC and ROADTRIPS software were used to perform genome-wide association analysis on two data sets (50K and 150K chip intersection data vs. data set after filling low density to high density). The two methods detected 14 and 18 genome-wide significant SNP loci, respectively, which were significantly associated with paratuberculosis susceptibility / resistance in Holstein cows (P<5×10 -5 ). Five SNP sites significantly associated with paratuberculosis susceptibility / resistance were added to the 10K chip.

[0055] 2. Acquisition of the Second Type of Sites

[0056] 1. Paternity test

[0057] In dairy cattle breeding, correct pedigree records are an important basis for accurately estimating individual breeding values ​​and accelerating population genetic progress. Pedigree errors are common in dairy farms, and parentage identification and pedigree correction through genetic markers are of great significance. The International Society of Animal Genetics (ISAG) has studied and recommended 199 SNP loci (numbered SNP1 to SNP199 in Table 2) for cattle paternity identification (to facilitate research and communication between laboratories in various countries), so they are added to this chip.

[0058] 2. Genetic defects

[0059] Genetic defects in dairy cows mainly include spinal deformity syndrome CVM, leukocyte adhesion deficiency BLAD, uridylate synthase deficiency and citrullinemia, which can lead to early abortion of cows, death of calves, and reduced survival rate, causing huge economic losses to the dairy farming industry. By adding genetic defect gene sites in the SNP chip, it is possible to simply, quickly and accurately identify and screen whether individual dairy cows carry recessive harmful genes with genetic defects, thereby reducing the frequency of harmful genes in the group through early elimination or scientific selection and matching, and improving the quality of my country's dairy cow population. Therefore, 26 common cattle genetic defect-causing mutation sites, a total of 34 sites, are added to this chip, including 28 SNP sites and 6 INDEL sites (Note: INDEL sites in the present invention generally refer to sequence changes of more than 2bp, including insertions, deletions and substitutions). The site information comes from the main cattle genetic defect sites included in the OMIA database.

[0060] Table 1. Common mutation sites causing genetic defects in cattle

[0061] Starting position of the site (corresponding number) Genetic defects in cattle Starting position of the site (corresponding number) Genetic defects in cattle Chr1:1277227(SNP354) HH4 Chr14:9487845(SNP6631) Familial goiter Chr1:69756880(SNP640) Uridine monophosphate synthase deficiency Chr15:77667136(SNP7285) Donkey hoof disease Chr1:145114963(SNP960) Bovine leukocyte adhesion defect Chr15:77675440(SNP7286) Donkey hoof disease Chr3:9479761(SNP1605) Dominant Red Chr15:77682052(SNP7287) Donkey hoof disease Chr3:43412427(SNP1740) Spinal Deformity Syndrome Chr15:77686731(SNP7288) Donkey hoof disease Chr3:43418851(SNP1741) Spinal Deformity Syndrome Chr16:39523051(SNP7472) Trimethylaminourea Chr5:27545478(SNP2703) Epidermolysis bullosa Chr19:44695843(SNP8420) Spherocytosis Chr5:63150400(SNP2841) HH1 Chr24:57298883(SNP9824) Protoporphyria Chr6:23540228(SNP3178) Mannan poisoning Chr29:43611783(SNP10805) Glycogen storage disease type V Chr6:89196592(SNP3445) Lung hypoplasia Chr1:1768587(SNP11342) No horns Chr7:13956640(SNP3627) Alpha-mannosidosis Chr16:29773628(SNP11343) HH6 Chr7:13957949(SNP3628) Alpha-mannosidosis Chr15:77675516-77675517(INDEL4) Mule foot disease / syndactyly Chr7:65080197(SNP3844) Myoclonus Chr23:13833871-13833872(INDEL5) Cow spider leg syndrome Chr8:95410507(SNP4457) HH3 Chr5:57641332(INDEL6) Cow spider leg syndrome Chr10:62054844(SNP5236) Marfan syndrome Chr11:77959000(INDEL1) Cholesterol deficiency Chr10:62141462(SNP5237) Marfan syndrome Chr21:21184870-21188198(INDEL2) Short spine syndrome Chr11:100802781(SNP5833) Citrullinemia Chr9:93222102-93311988(INDEL3) HH5

[0062] Note: "Corresponding number" refers to the SNP site number in Table 2 or the INDEL number in Table 3.

[0063] 3. Acquisition of the third type of SNP loci

[0064] Large-scale, high-quality reference populations are an important foundation and necessary link for genomic selection. Since 2008, the inventor team has built the only reference population for dairy cow genomic selection in my country, which currently has a size of 23,000 cows. The SNP chips used for genotyping of the reference group individuals are all from abroad, including 50K 5811, 80K 1535, 100K 5000, and 150K 10591. Therefore, this chip needs to have a high genotype filling accuracy with the chip data of the reference group, so as to accurately evaluate the genome of the cow population.

[0065] The premise of genomic selection is that the markers are closely linked to the QTLs, so the markers are evenly distributed in the genome, which can capture the QTLs that affect the traits to the maximum extent, thereby improving the accuracy of genotype inference of genomic fragments and genomic evaluation. The genotype filling method is based on the inferred haplotype (referring to the combination of alleles that are linked between adjacent markers on the same chromosome) to fill in the missing genotype. The basic process is: first, use individuals with high-density markers, family information, and linkage disequilibrium information between populations to construct haplotypes; then, the markers in the chip to be filled are matched with the markers in the haplotype.

[0066] Factors that affect the accuracy of chip genotype filling include: minimum allele frequency, marker density, reference population size and filling method, etc. Therefore, a 170Kb sliding window was set on the chromosome to screen the 50K, 126K and 150K commercial cattle genome chip site sets, and finally 10,975 third-category SNP sites (i.e., the remaining SNP sites in Table 2 except the first and second category SNP sites) were determined.

[0067] After the above screening, the present invention obtained a total of 11358 loci of the above three types, including 11352 SNP loci (Table 2) and 6 INDEL loci (Table 3). The distribution of the 11352 SNP loci on the chromosomes of dairy cows is as follows: Figure 2 shown.

[0068] For each SNP site, a target site was selected within 110 bp upstream and downstream of the location of the SNP site on the dairy cow genome reference sequence (Bos_taurus UMD3.1 version), and the target site covered the SNP site. A probe was designed for the target site, and the nucleotide sequence of the probe was reverse complementary to the nucleotide sequence of the target site. The information of the 11352 targets targeting the 11352 SNP sites is shown in Table 2.

[0069] For each INDEL site, a target 1 (upstream target) is selected from the upstream 110bp range of the location of the INDEL site on the dairy cow genome reference sequence (Bos_taurus UMD3.1 version), and the target 1 (upstream target) does not cover the INDEL site. An upstream probe is designed for the target 1, and the nucleotide sequence of the upstream probe is reversely complementary to the nucleotide sequence of the target 1 (upstream target); a target 2 (downstream target) is selected from the location of the INDEL site on the dairy cow genome reference sequence and the downstream 110bp range, and the target 2 (downstream target) covers all or part of the nucleotides in the INDEL site. A downstream probe is designed for the target 2, and the nucleotide sequence of the downstream probe is reversely complementary to the nucleotide sequence of the target 2 (downstream target). The information of the 6 pairs of targets targeting the 6 INDEL sites is shown in Table 3.

[0070] Table 2. The starting and ending positions of the 11352 SNP loci and the targets for the 11352 SNPs in the UMD3.1 version of the dairy cow reference genome

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236] Note: The position information of 11352 SNP sites and their targets in the table are determined based on the comparison of the reference sequence of the dairy cow genome (Bos_taurus UMD3.1 version). The nucleotide information in the "SNP wild-type nucleotide" column in the table is consistent with the corresponding nucleotides of the Bos_taurusUMD3.1 version.

[0237] In Table 2, from left to right, there are multiple groups of data consisting of SNP number, SNP position, SNP wild-type nucleotide, SNP mutant nucleotide, target starting position and target ending position, indicating the chromosome where the corresponding SNP site and its corresponding target are located and their specific positions. Among them, the characters before the ":" in the "SNP position" indicate the chromosome number, and the characters after the ":" are the specific positions of the SNP site on the chromosome. For example, "Chr1" represents chromosome 1, and "135098" represents the specific position of chromosome 1 in the UMD3.1 version of the dairy cow reference genome. "SNP wild-type nucleotide" is the type of nucleotide at the SNP site in the UMD3.1 version of the dairy cow reference genome, and "SNP mutant nucleotide" is the type of nucleotide after the mutation of the "SNP wild-type nucleotide" at the SNP site. For example, if SNP350 corresponds to the 135098th position of chromosome 1 of the cow reference genome UMD3.1 version, and its nucleotide type is A or G, the starting position and the ending position of the target of SNP350 are the 135016th position and the 135125th position of chromosome 1 of the cow reference genome UMD3.1 version, respectively, and the nucleotide sequence of the target of SNP350 is (3'-5'): AATCTTCCCGTATTAAGAATACGGTTGTTTACAACCT CTTGGTG ACCAGATCCCTTAGAAATTTGGGATTAATATGTACTGGTTACTGGGAATAAAGTACAAGTCAGTGGA (the reverse complementary sequence of SEQ ID No. 1), and the nucleotide sequence of the single-stranded DNA probe for SNP350 is (5'-3'): TTA GAAGGCATAATTCTTATGCCAACAAATGTTGGAGAACCACTGGTCTAGGGAATCTTTAAACCCTAATTATACATGACCAATGACCTTATTTCATGTTCAGTCACCT (SEQ ID No. 1).

[0238] Table 3. The starting and ending positions of the six INDEL sites and the targets of the six INDELs in the UMD3.1 version of the dairy cow reference genome

[0239]

[0240] Note: The location information of the 6 INDEL sites and their targets in the table are determined based on the comparison of the reference sequence of the dairy cow genome (Bos_taurus UMD3.1 version). The sequence information in the "INDEL wild type" column in the table is consistent with the corresponding nucleotides of the Bos_taurus UMD3.1 version.

[0241] In Table 3, from left to right, there are multiple groups of data, including INDEL number, INDEL position, INDEL wild type, INDEL mutant type, target start position and target end position (each INDEL has a pair of target start position and target end position), indicating the chromosome where the corresponding INDEL site and its corresponding pair of targets (upstream target and downstream target) are located and their specific positions. Among them, the characters before the ":" in "INDEL position" indicate the chromosome number, and the characters after the ":" are the specific positions of the SNP site on the chromosome. For example, "Chr1" represents chromosome 11, and "77959000" represents the specific position of chromosome 11 in the UMD3.1 version of the dairy cow reference genome. "INDEL wild type" is the nucleotide information of the INDEL site in the UMD3.1 version of the dairy cow reference genome, and "INDEL mutant type" is the nucleotide information of the "INDEL wild type" of the INDEL site after mutation. For example, if INDEL1 corresponds to position 77959000 of chromosome 11 of the cow reference genome UMD3.1, the wild type is G at this site, and the mutant type is a 1.3kb insertion at this site. The starting and ending positions of the upstream target of INDEL1 are positions 77958835 and 77958944 of chromosome 11 of the cow reference genome UMD3.1, respectively. The starting and ending positions of the downstream target of INDEL1 are positions 77958946 and 77959055 of chromosome 11 of the cow reference genome UMD3.1, respectively. The nucleotide sequence of the upstream target of INDEL1 is (3'-5'): TTTTATATACATATACACGACTATAAATAGTT TTTGTTACATTTTTCTTTTATCATTTTTCCTCCGACGTTTCGGTGGATCGGATACCGAGTGCCATCTCTTCCCTGGGA (reverse complementary sequence of SEQ ID No. 2), and the nucleotide sequence of the single-stranded DNA probe targeting the upstream target of INDEL1 is (5'-3'): AAAATATATGTATATGTGCTGATATTTATCAAAAACAATGTAAAAAGAAAATAGTAAAAAGGAGGCT GCAAAGCCACCTAGCCTATGGCTCACGGTAGAGAAGGGACCCT (SEQ ID No. 2).The nucleotide sequence of the downstream target of INDEL1 is (3'-5'): CCACTGGTAGGAGAGAGACGTGGTCCATGCTGGAGTTCGACCGACAAGGACTTCCGT TCGTTCAAGATGAAATGGGTCTCTTTCTTCTCGGATTTGTGTAGGAGTTGTAG (reverse complementary sequence of SEQ ID No. 3), and the nucleotide sequence of the single-stranded DNA probe targeting the downstream target of INDEL1 is (5'-3'): GGTGACCATCCTC TCTCTGCACCAGGTACGACCTCAAGCTGGCTGTTCCTGAAGGCAAGCAAGTTCTACTTTACCCAGAGAAAGAAGAGCCTA AACACATCCTCAACATC (SEQ ID No. 3).

[0242] It should be noted that, when the reference genome and its version number are determined, it is very easy for a person skilled in the art to obtain the specific sequence information of each probe after the specific location information of the target is given. Due to space limitations, the specific sequence information of each probe is not intuitively displayed one by one in the article.

[0243] 4. Preparation and use of chips

[0244] The principle of liquid phase chip is to design probes near the target mutation site and hybridize with the target genomic fragment region. After elution, amplification and library construction, all captured gene fragments are subjected to second-generation sequencing to obtain the genotype of the target mutation site.

[0245] The specific steps are as follows: (1) First, a gDNA library is constructed for the material to be tested. According to the principle of DNA complementarity, a probe covering the target variation site (including the 11,352 SNP sites in Table 2 of the present invention and the 6 INDEL sites in Table 3) is designed at each site to be tested, and the target probe (i.e., the probe for a total of 11,358 sites in Table 2 and Table 3 of the present invention) is modified by biotin labeling; (2) The biotin-modified probe is hybridized with the target region of the genome in a PCR solution to form a double strand; (3) The biotin-modified probe is molecularly adsorbed on magnetic beads coated with streptavidin to capture the target site hybridized with the probe; (4) The captured target site sequence is eluted, the target site is amplified, and high-depth sequencing is performed to obtain the genotype of the target variation site.

[0246] Liquid phase chips capture labeled probes in a suspended solution, overcoming the technical shortcomings of solid phase chips such as poor repeatability, slow reaction rate and poor flexibility. They have the advantages of high throughput, low cost, simple and fast operation and flexible use.

[0247] Example 2: Application of the 10K low-density SNP chip for dairy cows based on targeted capture sequencing of the present invention

[0248] In order to verify the practical effect of the 10K low-density SNP chip for dairy cows based on targeted capture sequencing prepared in Example 1 of the present invention, the present invention selected 203 Holstein dairy cows to simultaneously detect 10K (the present invention, operation see step 4 of Example 1), 40K, 126K and 150K chips, and analyzed the 10K chip SNP detection rate, polymorphism detection, individual genotype detection rate and comparative verification analysis. Among them, the 40K developed by the inventor team, the 126K and Neogen 150K chips developed by China Agricultural University in conjunction with Beijing Dairy Center and Huazhi Biotechnology Co., Ltd. are existing commercial chips.

[0249] First, the chip genotype data of 203 dairy cows were analyzed for quality using PLINK software. The results showed that the average SNP detection rate of the 10K chip was 97.70%, and the average site polymorphism information content was 0.345. The average SNP detection rates of 40K, 126K and 150K chips were 97.2%, 99.3% and 98.3%, respectively. The common sites of the 10K chip of the present invention and the existing commercialized 40K, 126K and 150K chips were 10090, 11331 and 11125, respectively, and the genotyping consistency was 98.92%, 96.23% and 97.18%, respectively. The results show that the performance of the 10K chip of the present invention meets the requirements of genome genetic evaluation, and the site polymorphism performance is good, which is in line with the genetic background of my country's dairy cow population.

[0250] Secondly, for the verification group of 203 dairy cows, based on the genome selection reference group (23,000 heads) described in Example 1, the 10K (the present invention), 40K, 126K and 150K genotype data were filled to the 50K level by Beagle5.4, and the filling accuracy of different types of chips was calculated. The results show that the filling accuracy of the 10K chip of the present invention is 95.90%, which is slightly lower than the medium and high density chips (99.05% to 99.23%), and higher than the international general dairy cow low-density chip - Illumina 3K (filling accuracy of 89.60%) and 7K (filling accuracy of 94.20%), which meets the needs of early breeding of reserve dairy cows, construction of cow core groups, selection and matching, accelerating genetic progress, and improving feed management efficiency.

[0251] Finally, the validation group of 203 Holstein cows was selected based on the 23,000 genome reference group. The nine traits of milk production, milk fat rate, milk protein rate, milk fat content, milk protein content, total body score, lactation system score, limb system score and somatic cell score were evaluated by the GBLUP model, and the evaluation accuracy of different types of chips was calculated. The results showed that the accuracy of the 10K chip genome genetic evaluation was 0.6190-0.7352, which was basically consistent with the accuracy of other commercial chips (Table 4 and Figure 3 ).

[0252] Table 4. Comparison of accuracy of genomic genetic assessment

[0253] Characteristics 10K 40K 126K 150K MY 0.6676 0.6916 0.6723 0.6830 FP 0.7071 0.7311 0.7131 0.7233 PP 0.7352 0.7587 0.7428 0.7514 FY 0.6503 0.6741 0.6545 0.6652 PY 0.6469 0.6709 0.6508 0.6618 CONF 0.6268 0.6507 0.6297 0.6420 MS 0.6217 0.6458 0.6244 0.6369 FL 0.7015 0.7261 0.7077 0.7191 SCS 0.6190 0.6420 0.6208 0.6334

[0254] Note: MY: milk yield; FP: milk fat percentage; PP: milk protein percentage; FY: milk fat content; PY: milk protein content; CONF: total body score; MS: lactation system score; FL: limb system score; SCS: somatic cell score.

[0255] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Chips for detecting cow genotypes, including: (A1) Single-stranded nucleotide probe for specific detection of SNP sites; The SNP sites are the 11352 SNP sites in Table 2; (A2) a single-stranded nucleotide probe for specifically detecting an INDEL site; the INDEL site is one of the six INDEL sites in Table 3; The position information of the 11352 SNP sites in Table 2 and the 6 INDEL sites in Table 3 were determined based on the comparison of the reference sequence of the dairy cow genome, which is the Bos_taurus UMD3.1 version.

2. The chip according to claim 1, characterized in that: In (A1), there are 11352 single-stranded nucleotide probes in total; for each SNP site, a target site is selected within 110 bp upstream and downstream of the location of the SNP site on the cow genome reference sequence, the target site covers the SNP site, and a probe is designed for the target site, the nucleotide sequence of the probe is reverse complementary to the nucleotide sequence of the target site; and / or In (A2), there are 6 pairs of single-stranded nucleotide probes in total; for each INDEL site, a target site 1 is selected within 110 bp upstream of the location of the INDEL site on the cow genome reference sequence, and the target site 1 does not cover the INDEL site. An upstream probe is designed for the target site 1, and the nucleotide sequence of the upstream probe is reverse complementary to the nucleotide sequence of the target site 1; A target 2 is selected from the position of the INDEL site on the cow genome reference sequence and within 110bp downstream thereof, wherein the target 2 covers all or part of the nucleotides in the INDEL site, and a downstream probe is designed for the target 2, wherein the nucleotide sequence of the downstream probe is reverse complementary to the nucleotide sequence of the target 2.

3. The chip according to claim 2, characterized in that: In (A1), the starting position and the ending position of the target corresponding to each of the 11352 single-stranded nucleotide probes are shown in Table 2; and / or In (A2), among the 6 pairs of single-stranded nucleotide probes, the starting position and the ending position of the target 1 corresponding to the upstream probe in each pair of probes, and the starting position and the ending position of the target 2 corresponding to the downstream probe are as shown in Table 3.

4. The chip according to any one of claims 1 to 3, characterized in that: The single-stranded nucleotide probe is modified with biotin.

5. The chip according to any one of claims 1 to 4, characterized in that: The chip also includes magnetic beads modified with streptavidin.

6. The chip according to any one of claims 1 to 5, characterized in that: The chip is a liquid phase probe hybridization chip.

7. Use of the chip according to any one of claims 1 to 6 in dairy cow breeding.

8. Use of the chip according to any one of claims 1 to 6 in genotyping detection of dairy cows.

9. Use of the chip according to any one of claims 1 to 6 in identifying the relationship of dairy cows.

10. Use of the chip according to any one of claims 1 to 6 in the preparation of a product for diagnosing genetic defects in dairy cows.

Images