Adenovirus serotype 35 helper vector

Abstract

The present disclosure provides, inter alia, Ad35 helper genomes and vectors useful for gene therapy, e.g., generating helper-dependent Ad35 donor vectors. The helper genomes of the present disclosure contain conditionally defective packaging sequences.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 129,346, filed December 22, 2020, and U.S. Provisional Patent Application No. 63 / 215,360, filed June 25, 2021, the contents of which are incorporated herein by reference in their entireties. [Background technology]

[0002] Many medical conditions are caused by genetic mutations and / or are treatable, at least in part, by gene therapy. Some conditions are particularly treatable by modification of target cells, such as hematopoietic stem cells (HSCs). Thus, there is a need for compositions and methods for gene therapy. Summary of the Invention

[0003] Gene therapy can treat many conditions with a genetic component, including, but not limited to, hemoglobinopathies, immunodeficiencies, and cancer. Hematopoietic stem cells (HSCs) are an important target in various gene therapies. However, current methods and compositions for gene therapy, particularly for modifying HSCs, are limited. For example, some vectors for gene therapy, such as lentiviral vectors, have relatively limited payload capacity. Other vectors, such as adenovirus serotype 5 (Ad5) vectors, are characterized by substantial payload capacity but are widespread enough that a large proportion of humans have antibodies directed against proteins from such vectors, some of which may be neutralizing. Ad35 is one of the rarest of the 57 known human adenovirus serotypes, with a seroprevalence of <7% and no cross-reactivity with Ad5. Ad35 is less immunogenic than Ad5, in part due to attenuation of T cell activation by the Ad35 fibrous knob. Furthermore, after intravenous (iv) injection, there is minimal transduction (e.g., detectable only by PCR) of certain tissues, such as the liver, in human CD46 transgenic (hCD46tg) mice and non-human primates. First-generation Ad35 vectors have been used clinically for vaccination purposes. The present disclosure provides Ad35 helper genomes and vectors useful for gene therapy, e.g., for the generation of helper-dependent Ad35 donor vectors.

[0004] Ad35 helper-dependent vectors are a type of vector that may be particularly useful for viral gene therapy; for example, the vector contains a donor genome encoding a therapeutic payload for delivery to a recipient. The donor genome of an Ad35 helper-dependent vector is modified to remove viral coding sequences necessary for and / or contributing to viral propagation, rendering the helper-dependent vector ineffective for propagation in the recipient (e.g., a human recipient undergoing gene therapy involving the helper-dependent vector). Because Ad35 helper-dependent donor genomes do not encode proteins used in viral production, they rely on other sources of viral proteins (e.g., expression from an Ad35 "helper" genome). For example, for packaging into a vector, a helper-dependent Ad35 genome can be delivered to a cell containing a nucleic acid sequence that provides Ad35 viral proteins in trans. The viral proteins can be provided by an Ad35 helper genome that has been modified to reduce or eliminate packaging of the helper genome into the helper-dependent donor vector. Packaging an Ad35 helper genome into an Ad35 donor vector poses the risk of propagation within the recipient.

[0005] Ad35 helper vectors must be conditionally competent for propagation (i.e., conditionally defective or conditionally defective). One means of achieving conditional proliferation deficiency is by engineering a conditionally defective packaging sequence within the helper genome (e.g., a packaging sequence capable of mediating packaging of the helper genome, or a packaging sequence capable of mediating packaging of the helper genome more efficiently in a first state or context compared to a second state or context). The present disclosure includes, among other things, an Ad35 helper genome comprising two recombinase sites positioned such that the two recombinase sites flank the packaging sequence, where the two recombinase sites are for the same recombinase. The location of the recombinase sites that will generate a conditionally defective packaging sequence in an Ad35 helper vector cannot be predicted from existing knowledge of other vectors. Conversely, the relevant sequence of Ad35 is very different from the corresponding sequence of Ad5, for example (e.g., comparing the 5'600-620 nucleotides of Ad35 and Ad5). Furthermore, packaging sequences are serotype-specific. Ad35 packaging sequences correspond to at least the Ad5 packaging signal sequences AI, AII, AIII, AIV, and AV, but contain sequences that are unique to Ad35. Thus, generating Ad35 helper vectors requires several unpredictable decisions, including (1) identifying Ad35 packaging sequences flanked by recombinase sites (e.g., loxP sites) by inserting or positioning recombinase sites within the genome of interest, where sequence similarity is limited but not straightforward; (2) identifying unpredictable recombinase site insertions or locations that do not negate helper vector propagation (under conditions where the flanking packaging sequences are not excised); and / or (3) identifying spacing between recombinase sites that allows efficient deletion of packaging sequences while reducing helper virus packaging during generation of HDAd35 donor vectors (e.g., in a cre recombinase-expressing cell line such as the 116 cell line).Thus, the present disclosure includes the placement of recombinase sites (e.g., loxP recombinase sites) flanking the Ad35 packaging sequence to generate a conditionally defective packaging sequence within the Ad35 helper genome. In various embodiments, the presence of the conditionally defective packaging sequence in the Ad35 helper genome renders the Ad35 helper genome conditionally defective for propagation, such that excision of the flanking Ad35 packaging sequence by recombination of the recombinase sites renders the Ad35 helper genome defective for packaging.

[0006] The present disclosure further recognizes that, in various embodiments, packaging sequence inversion can reduce the likelihood of mutations that bypass or disrupt propagation and / or packaging conditionality. One problem that characterizes various donor vector production systems is that when a helper genome is present in the same cell or system as a donor genome containing a wild-type or reference packaging sequence, all or part of the conditionally defective packaging sequence, or a genomic fragment containing it, can be exchanged for the corresponding fragment of the donor genome containing the wild-type or reference packaging sequence (sometimes referred to herein as packaging sequence recombination) by homologous recombination with the donor genome. When packaging sequence recombination causes a modification of the helper genome that removes at least one of the recombinase sites flanking the packaging sequence of the conditionally defective packaging sequence, this event can be referred to as recombinase site excision homologous recombination. When recombinase site excision homologous recombination occurs, the conditionality is lost. As a result, the helper genome can be packaged into the vector in the same way as the donor genome (even in the presence of recombinases that would otherwise cause the helper genome to be defective in packaging), and production of the donor vector can be contaminated by production of the vector containing the helper genome.

[0007] The packaging sequence inversions provided herein can reduce and / or eliminate recombinase site excision homologous recombination, at least in part, by reducing the overall homology between the helper genome and the donor genome in any single-stranded orientation (particularly in the packaging sequence and the genomic fragment containing the packaging sequence), thereby reducing the likelihood of packaging sequence recombination. While this disclosure specifically includes a discussion of Ad35 vectors, those skilled in the art will understand that packaging sequence inversions are beneficial for the helper genomes of various adenovirus serotypes and various types of viral vectors.

[0008] In at least one aspect, the disclosure provides a recombinant adenovirus helper genome comprising a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, and recombinase direct repeats flanked by an Ad35 packaging sequence, wherein the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 136 and 249 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of GenBank Accession No. AY128640. In certain embodiments, the first recombinase direct repeat is not at position 206, and / or the second recombinase direct repeat is not at position 481. In certain embodiments, the first recombinase direct repeat is not at position 154, and / or the second recombinase direct repeat is not at position 481. In various embodiments, the recombinant adenoviral helper genome can include a stuffer sequence.

[0009] In at least one aspect, the present disclosure provides a recombinant adenovirus helper genome comprising a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, and a recombinase direct repeat flanked by Ad35 packaging sequences, wherein the recombinase direct repeats are selected from the group consisting of sequences 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171 (e.g., 151-171, 152-171, 153-171, 154-171, 155-171, 156-171, 157-171, 158-171, 159-160, 161-162, 162-163, 163-164, 164-165, 165-166, 166-167, 167-168, 168-169, 169-200, 169-201, 170-202, 171-203, 172-204, 173-205, 174-206, 175-207, 176-208, 177-209, 178-209, 179-2010, 180-2011, 181-202, 182-203, 183-204, 184-205, 185-206, 186-207, 187-208, 188-209, 189-210, 189-211, 190-212, 191-21 and a second recombinase direct repeat between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of GenBank Accession No. AY128640. In certain embodiments, the first recombinase direct repeat is not at position 154 and / or the second recombinase direct repeat is not at position 481. In various embodiments, the recombinant adenoviral helper genome can include a stuffer sequence.

[0010] In at least one aspect, the disclosure provides a recombinant adenovirus helper genome comprising a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, and a recombinase direct repeat flanked by Ad35 packaging sequences, wherein the recombinase direct repeats comprise a first nucleotide direct repeat between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of GenBank Accession No. AY128640. In certain embodiments, the first recombinase direct repeat is not at position 154, and / or the second recombinase direct repeat is not at position 481. In various embodiments, the recombinant adenoviral helper genome can include a stuffer sequence.

[0011] In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412, or 469 and 489 of GenBank Accession No. AY128640.

[0012] In various embodiments, the recombinase direct repeats include a first recombinase direct repeat between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 161 and 181 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 185 and 205 of GenBank Accession No. AY128640 and a second recombinase direct repeat between nucleotide positions corresponding to 469 and 489 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 214 and 234 of GenBank Accession No. AY128640 and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412 of GenBank Accession No. AY128640.In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 161, 171, 195, or 224 of GenBank Accession No. AY128640, and a second recombinase direct repeat at a nucleotide position corresponding to 402, 479, or 3200 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 161 of GenBank Accession No. AY128640, and a second recombinase direct repeat at a nucleotide position corresponding to 3200 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 171 of GenBank Accession No. AY128640 and a second recombinase direct repeat at a nucleotide position corresponding to 402 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 195 of GenBank Accession No. AY128640 and a second recombinase direct repeat at a nucleotide position corresponding to 479 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 224 of GenBank Accession No. AY128640 and a second recombinase direct repeat at a nucleotide position corresponding to 402 of GenBank Accession No. AY128640.

[0013] In various embodiments, the recombinase direct repeats flanking the Ad35 packaging sequence are FRT, loxP, rox, vox, AttB, or AttP sites. In various embodiments, the recombinase direct repeats flanking the Ad35 packaging sequence are loxP sites.

[0014] The present disclosure further provides a recombinant adenovirus helper vector comprising the Ad35 helper genome of the present disclosure. The present disclosure further provides a recombinant adenovirus vector production system comprising (i) the Ad35 helper genome or helper vector of the present disclosure, and (ii) an HDAd35 donor genome, wherein the HDAd35 donor genome comprises a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, an Ad35 packaging sequence, and a nucleic acid sequence encoding at least one heterologous expression product. The present disclosure further provides a method for producing a recombinant helper-dependent adenovirus donor vector, the method comprising isolating a recombinant helper-dependent Ad35 donor vector from a culture of cells, wherein the cells comprise the recombinant Ad35 helper genome or recombinant adenovirus helper vector of the present disclosure, and the recombinant helper-dependent Ad35 donor genome comprises a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, an Ad35 packaging sequence, and a nucleic acid sequence encoding at least one heterologous expression product.

[0015] In various embodiments, the helper genome comprises a nucleic acid sequence encoding an Ad35 fiber knob. In various embodiments, the Ad35 fiber knob comprises a mutation that increases affinity for CD46. In various embodiments, the Ad35 fiber knob comprises one or more mutations selected from Ile192Val, Asp207Gly (or Glu207Gly), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His, or including each of the mutations Ile192Val, Asp207Gly (or Glu207Gly), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His.

[0016] In various embodiments, the helper genome is present in a cell comprising a nucleic acid encoding a recombinase for direct repeat recombination. In various embodiments, the recombinase is Flp, Cre, Dre, Vika, or PhiC31 recombinase. In various embodiments, the cell is a HEK293 cell, optionally the cell is a HEK293 cell that encodes or expresses Cre recombinase, and optionally the HEK293 cell that encodes or expresses Cre recombinase is a 116 cell.

[0017] In various embodiments, the Ad35 helper genome comprises an inverted packaging sequence.

[0018] In at least one aspect, the present disclosure provides a recombinant adenovirus helper genome comprising a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, and a recombinase direct repeat flanked by Ad35 packaging sequences, wherein the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 136 and 249 of GenBank Accession No. AY128640 and a second recombinase direct repeat between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of GenBank Accession No. AY128640, wherein the Ad35 helper genome comprises an inverted packaging sequence. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151 and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412 or 469 and 489 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151 and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640. In various embodiments, the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151 and 171 of GenBank Accession No. AY128640 and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640. In various embodiments, the recombinant adenoviral helper genome can comprise a stuffer sequence.

[0019] In various embodiments, the recombinase direct repeats flanking the Ad35 packaging sequence are FRT, loxP, rox, vox, AttB, or AttP sites. In various embodiments, the recombinase direct repeats flanking the Ad35 packaging sequence are loxP sites. The present disclosure further provides a recombinant adenoviral helper vector comprising an Ad35 helper genome of the present disclosure. The present disclosure further provides a recombinant adenoviral vector production system comprising (i) an Ad35 helper genome or helper vector of the present disclosure, and (ii) an HDAd35 donor genome, wherein the HDAd35 donor genome comprises a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, an Ad35 packaging sequence, and a nucleic acid sequence encoding at least one heterologous expression product. The present disclosure further provides a method for producing a recombinant helper-dependent adenoviral donor vector, the method comprising isolating a recombinant helper-dependent Ad35 donor vector from a culture of cells, the cells comprising a recombinant Ad35 helper genome or a recombinant adenoviral helper vector of the present disclosure, the recombinant helper-dependent Ad35 donor genome comprising a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, an Ad35 packaging sequence, and a nucleic acid sequence encoding at least one heterologous expression product. In various embodiments, the helper genome comprises a nucleic acid sequence encoding an Ad35 fiber knob. In various embodiments, the Ad35 fiber knob comprises a mutation that increases affinity for CD46.

[0020] In various embodiments, the Ad35 fiber knob comprises one or more mutations selected from Ile192Val, Asp207Gly (or Glu207Gly), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His, or comprising each of the mutations Ile192Val, Asp207Gly (or Glu207Gly), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His.

[0021] In various embodiments, the helper genome is present in a cell comprising a nucleic acid encoding a recombinase for direct repeat recombination. In various embodiments, the recombinase is Flp, Cre, Dre, Vika, or PhiC31 recombinase. In various embodiments, the cell is a HEK293 cell, optionally the cell is a HEK293 cell that encodes or expresses Cre recombinase, and optionally the HEK293 cell that encodes or expresses Cre recombinase is a 116 cell.

[0022] In various embodiments, the inverted packaging sequence comprises an Ad35 packaging sequence and one or both of a first recombinase direct repeat and a second recombinase direct repeat. In various embodiments, the inverted packaging sequence comprises, or has a first endpoint at, a nucleotide position between nucleotide positions 119 and 169 of AY128640, or 134 and 154 of AY128640. In various embodiments, the inverted packaging sequence comprises, or has a first endpoint at, a nucleotide position corresponding to position 144 of AY128640. In various embodiments, the inverted packaging sequence comprises, or has a second endpoint at, a nucleotide position between nucleotide positions 3175 and 3225 of AY128640, or 3190 and 3210 of AY128640. In various embodiments, the inverted packaging sequence comprises, or has a second endpoint at, a nucleotide position corresponding to position 3200 of AY128640. In various embodiments, the inverted packaging sequence comprises, or has a second endpoint at, a nucleotide position between nucleotide positions corresponding to 455 and 505 of AY128640, or 470 and 490 of AY128640. In various embodiments, the inverted packaging sequence comprises, or has a second endpoint at, a nucleotide position corresponding to position 480 of AY128640.

[0023] In at least one aspect, the disclosure provides an adenovirus serotype 35 (Ad35) packaging sequence flanked by recombinase sites, wherein the recombinase direct repeats flank the Ad35 packaging sequence, and the Ad35 packaging sequence corresponds to a fragment of GenBank Accession No. AY128640 having a first endpoint between nucleotide positions corresponding to 136 and 249 of GenBank Accession No. AY128640, and a second endpoint between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and the second endpoint is between nucleotide positions corresponding to 392 and 412 or 469 and 489 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640, and the second endpoint is between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is between nucleotide positions corresponding to 151-155 (e.g., 151, 152, 153, 154, and / or 155) and 171 of GenBank Accession No. AY128640, and the second endpoint is between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is between nucleotide positions corresponding to 161 and 181 of GenBank Accession No. AY128640, and the second endpoint is between nucleotide positions corresponding to 392 and 412 of GenBank Accession No. AY128640.In various embodiments, the first endpoint is between nucleotide positions corresponding to 185 and 205 of GenBank Accession No. AY128640, and the second endpoint is between nucleotide positions corresponding to 469 and 489 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is between nucleotide positions corresponding to 214 and 234 of GenBank Accession No. AY128640, and the second endpoint is between nucleotide positions corresponding to 392 and 412 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is at nucleotide positions corresponding to 161, 162, 171, 172, 195, 196, 224, or 225 of GenBank Accession No. AY128640, and the second endpoint is at nucleotide positions corresponding to 402, 479, or 3200 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is at nucleotide position 161 or 162 of GenBank Accession No. AY128640, and the second endpoint is at nucleotide position 3200 of GenBank Accession No. AY128640. The recombinant packaging sequence of claim 44, wherein the first endpoint is at nucleotide position 171 or 172 of GenBank Accession No. AY128640, and the second endpoint is at nucleotide position 402 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is at nucleotide position 195 or 196 of GenBank Accession No. AY128640, and the second endpoint is at nucleotide position 479 of GenBank Accession No. AY128640. In various embodiments, the first endpoint is at nucleotide position corresponding to 224 or 225 of GenBank Accession No. AY128640, and the second endpoint is at nucleotide position corresponding to 402 of GenBank Accession No. AY128640. In various embodiments, the packaging sequence is present in the adenoviral genome and is inverted, optionally, the packaging sequence is inverted relative to the 5' ITR of the adenoviral genome.

[0024] In at least one aspect, the present disclosure provides a recombinant adenovirus helper genome comprising an inverted sequence comprising a 5' Ad35 inverted terminal repeat (ITR), a 3' Ad35 ITR, and an Ad35 packaging sequence, wherein the inverted sequence comprises or has a first endpoint between nucleotide positions corresponding to 119 and 169 of AY128640, or 134 and 154 of AY128640, and optionally, the inverted sequence comprises or has a first endpoint at a nucleotide position corresponding to position 144 of AY128640, and (i) the inverted sequence comprises or has a first endpoint between nucleotide positions corresponding to 3175 and 3225 of AY128640, or 3190 and 3210 of AY128640. or (ii) the inverted sequence comprises a nucleotide position or comprises a second endpoint between nucleotide positions 455 and 505 of AY128640, or 470 and 490 of AY128640, and optionally the inverted sequence comprises a nucleotide position or comprises a second endpoint at a nucleotide position corresponding to position 480 of AY128640. In various embodiments, the recombinase direct repeats flank the Ad35 packaging sequence. In various embodiments, the recombinant adenoviral helper genome can comprise a stuffer sequence.

[0025] In various embodiments, the recombinant adenoviral vector production system can include a stuffer sequence. In any of the various embodiments provided herein, the helper vector can include a deletion of nucleotides corresponding to nucleotide positions 480-3199, 481-3199, or 482-3199 of AY128640, and optionally, the deletion can be or be referred to as an E1 deletion.

[0026] definition A, An, The: As used herein, "a", "an", and "the" refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" discloses embodiments of exactly one element as well as embodiments containing two or more elements.

[0027] About: As used herein, the term "about," when used in reference to a value, refers to a similar value in the context of the referenced value. Generally, a person skilled in the art familiar with the context will understand the reasonable degree of variation encompassed by "about" in that context. For example, in some embodiments, the term "about" can encompass values ​​within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the referenced value.

[0028] Administration: As used herein, the term "administration" typically refers to administering a composition to a subject or system to achieve delivery of the composition or a substance contained in the composition.

[0029] Affinity: As used herein, "affinity" refers to the strength of the sum of non-covalent interactions between a particular binding agent (e.g., a viral vector) and / or its binding site and a binding target (e.g., a cell). Unless otherwise indicated, as used herein, "binding affinity" refers to a 1:1 interaction between a binding agent and its binding target (e.g., a viral vector with its target cell). Those skilled in the art will understand that a change in affinity can be described by comparison to a reference (e.g., increased or decreased compared to a reference) or can be described numerically. Affinity is determined by the equilibrium dissociation constant (K D ) and / or the equilibrium association constant (K A ) can be measured and / or expressed in a number of ways known in the art, including, but not limited to, K D is k off / k on is the quotient of K A is kon / k off is the quotient of k on refers to the association rate constant of the viral vector with the target cell, and k off k refers to, for example, the dissociation of a viral vector from a target cell. on and k off can be determined by techniques known to those skilled in the art.

[0030] Substance: As used herein, the term "substance" may refer to any chemical substance, including, but not limited to, any one or more of: atoms, molecules, compounds, amino acids, polypeptides, nucleotides, nucleic acids, proteins, protein complexes, liquids, solutions, sugars, polysaccharides, lipids, or combinations or complexes thereof.

[0031] Between or From: As used herein, the term "between" refers to the content between a stated upper and lower limit, or a first and second limit, inclusive of the limits. Thus, for the avoidance of doubt, the term "between" includes values ​​that are exactly the upper or lower limit, or first or second limit, provided, as well as all values ​​within the range provided. Similarly, when used in the context of a series of values, the term "from" indicates that the range includes the content between the stated upper and lower limit, or first and second limit, inclusive of the limits.

[0032] Binding: As used herein, the term "binding" refers to a non-covalent association between two or more substances. "Direct" binding involves physical contact between the substances, while indirect binding involves physical interaction through physical contact with one or more intermediate substances. Binding between two or more substances can occur and / or be assessed in any of a variety of contexts (e.g., while covalently or otherwise associated with a carrier agent and / or within a biological system or cell), including when the interacting substances are studied alone or in the context of a more complex system.

[0033] Cancer: As used herein, the term "cancer" refers to a condition, disorder, or disease in which cells exhibit relatively aberrant, uncontrolled, and / or autonomous growth, resulting in an abnormally elevated growth rate and / or an abnormal growth phenotype characterized by a significant loss of control over cell proliferation. In some embodiments, cancer can comprise one or more tumors. In some embodiments, cancer can be or can comprise cells that are pre-cancerous (e.g., benign), malignant, pre-metastatic, metastatic, and / or non-metastatic. In some embodiments, cancer is or can comprise a solid tumor. In some embodiments, cancer is or can comprise a hematological tumor.

[0034] Control of expression or activity: As used herein, a first element (e.g., a protein such as a transcription factor, or a nucleic acid sequence such as a promoter) "controls" or "drives" the expression or activity of a second element (e.g., a protein or a nucleic acid encoding a substance such as a protein) when the expression or activity of the second element is completely or partially dependent on the state (e.g., presence, absence, conformation, chemical modification, interaction, or other activity) of the first element under at least one set of conditions. Control of expression or activity can be substantial, for example, in that a change in the state of the first element can result in a change in the expression or activity of the second element of at least 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold) compared to a reference control under at least one set of conditions.

[0035] Corresponding: As used herein, the term "corresponding to" may be used to designate the location and / or identity of a structural element in a compound or composition through comparison to an appropriate reference compound or composition. For example, in some embodiments, a monomer residue in a polymer (e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide) may be identified as "corresponding" to a residue in an appropriate reference polymer. For example, those skilled in the art will understand that residues in a provided polypeptide or polynucleotide sequence are often designated (e.g., numbered or labeled) according to the scheme of the associated reference sequence (e.g., even if such designation does not reflect the literal numbering of the provided sequence). By way of illustration, if a reference sequence contains a particular amino acid motif at positions 100-110 and a second, related sequence contains the same motif at positions 110-120, the motif position in the second, related sequence can be said to "correspond" to positions 100-110 of the reference sequence. Thus, the provided amino acid or nucleic acid sequences can have added, removed, inserted, or deleted positions or units that differ from a reference sequence, for example, but without limiting the designation of other positions or units relative to the reference. In a nucleic acid sequence, for example, exemplary additions or insertions can include restriction enzyme site nucleotides or recombinase site nucleotides. Those skilled in the art will appreciate that corresponding positions can be readily identified, for example, by alignment of sequences, and that such alignment is typically accomplished by any of a variety of known tools, strategies, and / or algorithms, including, but not limited to, software programs such as BLAST, CS-BLAST, CUDASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, Parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE.Two sequences can be identified as corresponding if they are identical or if they share substantial identity, e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In various embodiments, a nucleic acid sequence can correspond to a sequence that is identical or substantially identical (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to the complement of the nucleic acid sequence.

[0036] Downstream and upstream: As used herein, the term "downstream" means that a first DNA region is closer to the C-terminus of a nucleic acid comprising the first and second DNA regions than a second DNA region. As used herein, the term "upstream" means that a first DNA region is closer to the N-terminus of a nucleic acid comprising the first and second DNA regions than a second DNA region.

[0037] Effective amount: An "effective amount" is the amount of a formulation needed to produce a desired physiological change in a subject. Effective amounts are often administered for research purposes.

[0038] Modified: As used herein, the terms "modified" and "recombinant" are used interchangeably herein to refer to a composition that has been engineered by the hand of man. For example, a polynucleotide is considered "modified" if the hand of man has engineered two or more sequences that are not originally linked together in that order, so that they are directly linked to each other within the modified polynucleotide. Those skilled in the art will understand that a "modified" nucleic acid or amino acid sequence can be a recombinant nucleic acid or amino acid sequence and can be referred to as "genetically modified." In some embodiments, a modified polynucleotide contains coding and / or regulatory sequences that are found in nature operably linked to a first sequence, but not naturally operably linked to a second sequence, in a modified polynucleotide that has been operably linked to the second sequence by the hand of man. In some embodiments, a cell or organism is considered to be "modified" or "genetically modified" if it has been manipulated to change its genetic information (e.g., new genetic material not previously present has been introduced, e.g., by transformation, mating, somatic hybridization, transfection, transduction, or other mechanisms, or previously present genetic material has been altered or removed, e.g., by substitution, deletion, or mating). As is common practice and understood by those of skill in the art, complete or incomplete progeny or copies of an altered polynucleotide or cell are typically still referred to as "modified," regardless of the direct manipulation of the previous entity.

[0039] Expression: As used herein, "expression" refers individually and / or cumulatively to one or more biological processes that result in the production of an encoded substance, such as a protein, from a nucleic acid sequence. Expression specifically includes either or both of transcription and translation.

[0040] Contiguous: As used herein, a first element (e.g., a nucleic acid sequence or an amino acid sequence) present in a contiguous sequence with a second element and a third element is "flanked" by the second and third elements when positioned in the contiguous sequence between the second and third elements. Thus, in such a configuration, the second and third elements can be referred to as "adjacent" to the first element. Flanking elements can be directly adjacent to the flanked element or separated from the flanked element by one or more related units. In various examples where the contiguous sequence is a nucleic acid or amino acid sequence and the related units are bases or amino acid residues, respectively, the number of units in the contiguous sequence between the flanked element and, independently, the first and / or second flanking elements can be, for example, 50 units or less, e.g., 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 4, 3, 2, 1 unit or less, or 0 units.

[0041] Fragment: As used herein, a "fragment" refers to a structure that comprises and / or consists of a discrete portion of a reference material (sometimes referred to as a "parent" material). In some embodiments, a fragment lacks one or more portions found in the reference material. In some embodiments, a fragment comprises or consists of one or more portions found in the reference material. In some embodiments, the reference material is a polymer such as a polynucleotide or a polypeptide. In some embodiments, a fragment of a polymer comprises or consists of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more monomer units (e.g., residues) of a reference polymer. In some embodiments, the fragments are 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, or more monomers. and an upper limit selected from 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units.In some embodiments, a fragment of a polymer comprises or consists of at least 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomer units (e.g., residues) found in the reference polymer. A fragment of a reference polymer is not necessarily identical to the corresponding portion of the reference polymer. For example, a fragment of a reference polymer may be a polymer having a sequence of residues that is at least 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to the reference polymer. Fragments may or may not be generated by physical fragmentation of the reference material. In some cases, fragments are generated by physical fragmentation of the reference material. In some cases, fragments are not generated by physical fragmentation of the reference material, but instead may be generated, for example, by de novo synthesis or other means.

[0042] Gene, transgene: As used herein, the term "gene" refers to a DNA sequence that is or includes a coding sequence (i.e., a DNA sequence that encodes an expression product such as an RNA product and / or a polypeptide product), optionally together with some or all of the regulatory sequences that control expression of the coding sequence. In some embodiments, a gene includes non-coding sequences, such as, but not limited to, introns. In some embodiments, a gene can include both coding (e.g., exon) and non-coding (e.g., intron) sequences. In some embodiments, a gene includes a regulatory sequence that is a promoter. In some embodiments, a gene includes one or both of (i) DNA nucleotides extending a predetermined number of nucleotides upstream of the coding sequence in a reference context, such as a source genome, and (ii) DNA nucleotides extending a predetermined number of nucleotides downstream of the coding sequence in a reference context, such as a source genome. In various embodiments, the predetermined number of nucleotides can be 500 bp, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 75 kb, or 100 kb. As used herein, "transgene" refers to a gene that is not endogenous or native to the reference context in which it is present or into which it can be placed by modification.

[0043] Gene product or expression product: As used herein, the term "gene product" or "expression product" generally refers to the RNA transcribed from a gene (pre- and / or post-processing) or the polypeptide (pre- and / or post-modification) encoded by the RNA transcribed from a gene.

[0044] Host cell, target cell: As used herein, "host cell" refers to a cell into which exogenous DNA, such as a transgene, has been introduced (recombinantly or otherwise). One of skill in the art will understand that a "host cell" can be the cell into which the exogenous DNA was originally introduced and / or its perfect or imperfect progeny or copies. In some embodiments, a host cell contains one or more viral genes or transgenes. In some embodiments, an intended or potential host cell may be referred to as a target cell.

[0045] In various embodiments, host or target cells are identified by the presence, absence, or expression level of various surface markers.

[0046] A statement that a cell or population of cells is "positive" for or expresses a particular marker refers to the detectable presence of the particular marker on or within the cell. When referring to a surface marker, the term can refer to the presence of surface expression as detected by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting said antibody, where the staining is detectable by flow cytometry at a level substantially higher than that detected by performing the same procedure under otherwise identical conditions using an isotype-matched control, and / or at a level substantially similar to that of cells known to be positive for the marker, and / or at a level substantially higher than that of cells known to be negative for the marker.

[0047] A statement that a cell or population of cells is "negative" for a particular marker or lacks expression of the marker refers to the substantial absence of detectable presence of the particular marker on or within the cells. When referring to a surface marker, the term can refer to the absence of surface expression as detected by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting said antibody, where the staining is not detected by flow cytometry at a level substantially higher than that detected by performing the same procedure under otherwise identical conditions using an isotype-matched control, and / or at a level substantially lower than that of cells known to be positive for the marker, and / or at a level substantially similar compared to that of cells known to be negative for the marker.

[0048] Identity: As used herein, the term "identity" refers to the overall relatedness between polymers, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Methods for calculating the percent identity between two provided sequences are known in the art. The term "% sequence identity" refers to the relationship between two or more sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between protein and nucleic acid sequences, as determined by the match between strings of such sequences. "Identity" (often called "similarity") can be readily calculated by known methods, including those described below. Computational Molecular Biology (Lesk, A.M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.) Academic Press, NY (1994); Computer Analysis of Sequence Data, Part I (Griffin, A.M., and Griffin, H.G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (Von Heijne, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Oxford University Press, NY (1992). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs.For example, calculating the percent identity of two nucleic acid or polypeptide sequences can be performed, for example, by aligning the two sequences (or the complements of one or both sequences) for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second sequences for optimal alignment, and non-identical sequences can be ignored for comparison purposes). The nucleotides or amino acids at corresponding positions are then compared. If a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, optionally taking into account the number of gaps and the length of each gap that may need to be introduced for optimal alignment of the two sequences. Comparison of sequences and determination of percent identity between two sequences can be accomplished using computational algorithms such as BLAST (Basic Local Alignment Search Tool). Sequence alignment and percent identity calculations may be performed using the Megalign program in the LASERGENE bioinformatics computing suite (DNASTAR, Inc., Madison, Wisconsin). Multiple sequence alignment may also be performed using the Clustal method of alignment (Higgins and Sharp CABIOS, 5, 151-153 (1989)), with default parameters (gap penalty = 10, gap length penalty = 10).Relevant programs include the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin), BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403-410 (1990)), DNASTAR (DNASTAR, Inc., Madison, Wisconsin), and the FASTA program incorporating the Smith-Waterman algorithm (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, pp. 111-20. Editor(s): Suhai, Sandor. Publisher: Plenum, New York, NY). In the context of this disclosure, when sequence analysis software is used for the analysis, it will be understood that the results of the analysis will be based on the "default values" of the referenced program. "Default values" refers to any set of values ​​or parameters that originally loaded with the software when first initialized.

[0049] "Improve," "Increase," "Inhibit," or "Reduce": As used herein, the terms "improve," "increase," "inhibit," and "reduce," and their grammatical equivalents, indicate a qualitative or quantitative difference from a reference.

[0050] Isolated: As used herein, "isolated" refers to substances and / or entities that (1) have been separated from at least some of the components with which they are associated when originally produced (whether in nature and / or in an experimental setting) and / or (2) have been designed, produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99% of the other components with which they are originally associated. In some embodiments, isolated materials are greater than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. In some embodiments, as will be understood by those skilled in the art, a substance may be considered "isolated" or even "pure" even after being combined with certain other components, such as, for example, one or more carriers or excipients (e.g., buffers, solvents, water, etc.). In such embodiments, the percent isolation or purity of a substance is calculated without including such carriers or excipients. By way of example, in some embodiments, a biological polymer, such as a naturally occurring polypeptide or polynucleotide, is considered "isolated" if: a) it is not associated with some or all of the components that naturally accompany it in its native state due to its origin or source; b) it is substantially free from other polypeptides or nucleic acids of the same species from the species that naturally produces it; or c) it is expressed or otherwise associated with components from cells or other expression systems other than the species that naturally produces it. Thus, for example, in some embodiments, a polypeptide that is chemically synthesized or synthesized in a cellular system different from that which naturally produces it is considered to be an "isolated" polypeptide.Alternatively or additionally, in some embodiments, a polypeptide that has been subjected to one or more purification techniques may be considered to be an "isolated" polypeptide to the extent that it has been separated from other components a) with which it is naturally associated and / or other components b) with which it was associated when originally produced.

[0051] Reference: As used herein, "reference" refers to a standard or control against which a comparison is made. For example, in some embodiments, a substance, sample, sequence, subject, animal, or individual, or a population thereof, or a measure or characteristic representative thereof, is compared to a reference, substance, sample, sequence, subject, animal, or individual, or a population thereof, or a measure or characteristic representative thereof. In some embodiments, the reference is a measured value. In some embodiments, the reference is an established standard or expected value. In some embodiments, the reference is a longitudinal reference. The reference can be quantitative or qualitative. Typically, as understood by those of skill in the art, the reference and the value to which it is compared represent comparable conditions. Those of skill in the art will understand when sufficient similarity exists to justify reliance and / or comparison. In some embodiments, a suitable reference may be a substance, sample, sequence, subject, animal, or individual, or a population thereof, under conditions that a skilled artisan would recognize as comparable, for example, for purposes of assessing one or more particular variables (e.g., the presence or absence of a substance or condition), or a measure or characteristic representative thereof. Without wishing to be bound by any particular embodiment(s), in various embodiments, the reference sequence may be the sequence associated with a sequence assignment number provided herein, of which the sequence associated with a particular sequence assignment number is provided in Figure 17.

[0052] Subject: As used herein, the term "subject" refers to an organism, typically a mammal (e.g., a human, rat, or mouse). In some embodiments, the subject is suffering from a disease, disorder, or condition. In some embodiments, the subject is susceptible to a disease, disorder, or condition. In some embodiments, the subject exhibits one or more symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the subject is not suffering from a disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the subject exhibits one or more characteristics characteristic of susceptibility to, or risk for, a disease, disorder, or condition. In some embodiments, the subject is one being tested for and / or treated with therapy for a disease, disorder, or condition. In some instances, a subject to whom a substance is administered can be referred to interchangeably as a "recipient." In some instances, a human subject can be referred to interchangeably as a "patient" or an "individual."

[0053] Treatment: As used herein, the term "treatment" (also "treat" or "treating") refers to the administration of a therapy that results in the partial or complete alleviation, amelioration, relief, inhibition, delay in onset, less severity, and / or reduction in incidence of one or more symptoms, characteristics, and / or causes of a particular disease, disorder, or condition, or is administered with the intent to achieve any such result. In some embodiments, such treatment may be of subjects who do not exhibit symptoms of the associated disease, disorder, or condition and / or who exhibit only early symptoms of the disease, disorder, or condition. Alternatively, or additionally, such treatment may be of subjects who exhibit one or more established symptoms of the associated disease, disorder, and / or condition. In some embodiments, treatment may be of subjects who have been diagnosed with the associated disease, disorder, and / or condition. In some embodiments, treatment may be of subjects known to have one or more susceptibility factors that statistically correlate with an increased risk of developing the associated disease, disorder, or condition. "Prophylactic treatment" includes treatment administered to a subject who does not exhibit signs or symptoms of the condition to be treated, or who exhibits only early signs or symptoms of the condition to be treated, such that the treatment is administered with the intent to reduce, prevent, or decrease the risk of developing the condition. Prophylactic treatment thus serves as a prophylactic treatment for the condition. "Therapeutic treatment" includes treatment administered to a subject who exhibits symptoms or signs of a condition, with the intent of reducing the severity or progression of the condition. [Brief explanation of the drawings]

[0054] [Figure 1]FIG. 1 is a schematic diagram showing an alignment of the "left end" sequences of the wild-type sequences of Ad3 (GenBank accession number NC_011203) and Ad35 (GenBank accession number AY128640) (the "left end" is defined by the conventional representation of the adenovirus map, with the major late promoter transcribing the "top strand"). The alignment was used to identify putative packaging signals for Ad35 (boxed). Packaging signals A1, A2, A5, and A6 were identified according to the terminology described in Ostapchuk and Hearing, J Virol. 2001 75:45-51. The table shown in FIG. 1 provides four exemplary locations for placement of a 5' loxP site, four exemplary locations for placement of a 3' loxP site, and four exemplary pairings of locations for placement of a 5' loxP site and a 3' loxP site. A loxP site was inserted into the Ad35 genome to the left of packaging signal A1 at one of four positions indicated by a black arrowhead (i.e., after nucleotides 161, 171, 195, or 224), in combination with a loxP sequence inserted to the right of packaging signal A6, e.g., at a position indicated by an open arrowhead (indicated after nucleotides 402 or 479). Exemplary combinations are further described in Example 1. Example adenovirus sequences were deleted between base pairs 480, 481, or 482 and 3199 to derive E1-deleted replication-incompetent vectors; therefore, one loxP insertion was placed at position 3200, but not far from the other insertion sites, as the numbering suggests. [Figure 2A] Schematic diagram showing the "left end" sequence of the Ad35 helper genome (see also GenBank accession number AY128640) corresponding to that shown in FIG. 1, including (i) six nucleotides added to generate an FseI restriction site between Ad35 positions 143 and 144, (ii) loxP sites added after positions 224 and 402, and (iii) I-SceI and FseI sites added after position 480. Specific added sequences are indicated in boxes. [Figure 2B]Schematic diagram showing the "left end" sequence of the Ad35 helper genome (see also GenBank Accession No. AY128640) corresponding to that shown in FIG. 1, including (i) six nucleotides added to generate an FseI restriction site between Ad35 positions 143 and 144, (ii) loxP sites added after positions 171 and 402, and (iii) an I-SceI site and an FseI site added after position 480. Specific added sequences are indicated in boxes. [Figure 2C] Schematic diagram showing the "left end" sequence of the Ad35 helper genome (see also GenBank accession number AY128640) corresponding to that shown in FIG. 1, including (i) six nucleotides added to generate an FseI restriction site between Ad35 positions 143 and 144, (ii) loxP sites added after positions 195 and 479, and (iii) I-SceI and FseI sites added after position 480. Specific added sequences are indicated in boxes. [Figure 2D] FIG. 1 is a schematic diagram showing the "left end" sequence of the Ad35 helper genome corresponding to that shown in FIG. 1 (see also GenBank Accession No. AY128640), including (i) six nucleotides added to generate an FseI restriction site between Ad35 positions corresponding to 143 and 144, (ii) a loxP site added after positions corresponding to 161 and 3200, and (iii) an I-SceI and FseI site added after position corresponding to 480. The specific added sequence is indicated in a box. The location of the loxP site at position 3200 is numbered such that the depicted construct contains a deletion of nucleotide positions 481-3199 or 482-3199, corresponding to GenBank Accession No. AY128640 (thus, this loxP site can alternatively be described as having been added along with the I-SceI and FseI sites after position corresponding to 480). [Figure 2E]

[0023] Figure 1 is a schematic diagram showing the "left end" sequence of the Ad35 helper genome, corresponding to that shown in Figure 1 (see also GenBank Accession No. AY128640), including sequences added after positions corresponding to 206 and 484 to introduce a SwaI restriction site and a loxP site. The specific added sequences are indicated in boxes. pEN024 is a plasmid encoding a helper vector genome containing the construct of this figure. As noted elsewhere herein, and as applicable throughout, if an inserted sequence (such as a loxP site, to provide one non-limiting example) contains terminal nucleotide positions identical in sequence to reference nucleotides that may be interpreted as replaced by the insertion, the insertion site can be represented as occurring, for example, after either of such terminal nucleotide positions or after the last nucleotide that does not correspond to the inserted sequence of interest. Thus, for example, defining loxP insertion positions in pEN024 can be alternatively identified, for example, after positions corresponding to 206 and 481. [Figure 3] 1 is an image of a gel showing digestion of the Ad35 helper genome and a plasmid containing the Ad35 helper genome, accompanied by a table describing the gel. Gel lanes 1, 3, 6, and 8 show BsrGI digestion of helper virus genomes produced using pEN025, pEN026, pEN027, and pEN028, respectively, and gel lanes 2, 4, 7, and 9 show digestion of the respective starting plasmids with BsrGI and Swal. Lane 5 contains a 1 Kb Plus ladder. The accompanying table included in the figure shows that pEN025, pEN026, pEN027, and pEN028 each contain a conditional packaging sequence according to the present disclosure, specifically one of the four constructs described as Constructs 1-4 in Example 1 (i.e., pEN025 corresponds to Construct 1 and FIG. 2A; pEN026 corresponds to Construct 2 and FIG. 2B; pEN027 corresponds to Construct 3 and FIG. 2C; and pEN028 corresponds to Construct 4 and FIG. 2D). The expected band sizes were obtained in all lanes. [Figure 4]Figure 1 is an image of a gel showing digestion of the Ad35 helper genome, accompanied by a table describing the gel. The accompanying table included with the figure indicates the plasmid and cell type used to produce the sample shown in each lane, as well as the expected band sizes. ApaI digestion produces a 2014 bp fragment from the packaging-competent Ad35 genome (without excision of the flanking packaging sequence) and a smaller fragment from the Ad35 genome with excision of the flanking packaging sequence. Lane 1 contains a 1 Kb Plus ladder. All band sizes were consistent with expectations. [Figure 5] 1 is a plasmid map showing the structural organization of plasmid 5427, a plasmid encoding a helper-dependent genome containing terminal sequences from Ad35. The encoded helper-dependent genome contains a cassette for expression of Beta-galactosidase. Digestion of plasmid 5427 with the restriction enzyme PmeI releases the helper-dependent genome from the plasmid backbone. Because at least the 5' and 3' ends of plasmid 5427 contain sequences derived from Ad35, the encoded helper-dependent genome can be packaged into vector particles produced using the Ad35 helper genome of the present disclosure. [Figure 6A]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN025) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 5427) containing a helper-dependent genome with terminal sequences derived from Ad35. [Figure 6B]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN026) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 5427) containing a helper-dependent genome with terminal sequences derived from Ad35. [Figure 6C]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN027) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 5427) containing a helper-dependent genome with terminal sequences derived from Ad35. [Figure 6D]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN028) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 5427) containing a helper-dependent genome with terminal sequences derived from Ad35. [Figure 6E]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN024) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 5427) containing a helper-dependent genome with terminal sequences derived from Ad35. [Figure 7A]1 is an image of a gel accompanied by a table describing the gel. The gel shows digestion of adenoviral genomes obtained from 116 cells transfected with a plasmid containing an Ad35 helper genome (pEN025 or pEN026) and plasmid 5427 according to the present disclosure, followed by two consecutive rounds of cesium chloride gradient purification. As indicated in the accompanying table, purified adenoviral genomes were digested with SacII (lanes 4 and 6), while the parental plasmid was also digested for comparison (lanes 2, 3, and 5). In lane 2, plasmid 5427 was digested with PmeI (to release the helper-dependent genome from the plasmid 5427 backbone) and SacII. In lanes 3 and 5, helper plasmids pEN025 and pEN026 were digested with SwaI (to release the helper genome from the plasmid backbone of pEN025 and pEN026) and SacII. [Figure 7B] 1 is an image of a gel accompanied by a table describing the gel. The gel shows digestion of adenoviral genomes obtained from 116 cells transfected with a plasmid containing an Ad35 helper genome (pEN027 or pEN028) and plasmid 5427 according to the present disclosure, followed by two consecutive rounds of cesium chloride gradient purification. As indicated in the accompanying table, purified adenoviral genomes were digested with SacII (lanes 4 and 6), while the parental plasmid was also digested for comparison (lanes 2, 3, and 5). In lane 2, plasmid 5427 was digested with PmeI (to release the helper-dependent genome from the plasmid 5427 backbone) and SacII. In lanes 3 and 5, helper plasmids pEN027 and pEN028 were digested with SwaI (to release the helper genome from the plasmid backbone of pEN027 and pEN028) and SacII. [Figure 7C]1 is an image of a gel accompanied by a table describing the gel. The gel shows digestion of adenoviral genomes obtained from 116 cells transfected with a plasmid containing the Ad35 helper genome (pEN024) and plasmid 5427 according to the present disclosure, followed by two consecutive rounds of cesium chloride gradient purification. As indicated in the table included in the figure, the purified adenoviral genome was digested with SacII (lane 4), and the parental plasmid was also digested for comparison (lanes 2 and 3). In lane 3, plasmid 5427 was digested with PmeI (to release the helper-dependent genome from the plasmid 5427 backbone) and SacII. In lane 2, helper plasmid pEN024 was digested with PmeI (to release the helper genome from the pEN024 plasmid backbone) and SacII. [Figure 8A] FIG. 1 is a schematic diagram showing homologous recombination between an Ad35 helper genome (Helper Ad) and a helper-dependent Ad35 genome (HDAd), resulting in removal of one of the recombinase sites flanking the packaging sequence. [Figure 8B] Schematic diagram showing an Ad35 helper genome (helper Ad) containing a packaging sequence inversion that reduces and / or eliminates recombinase site excision homologous recombination, thereby preventing the production of a constitutively packageable helper genome. [Figure 9A] 9A is a schematic diagram showing the "left end" sequence of the Ad35 helper genome, including the packaging sequence inversion. The sequence shown in Figure 9A corresponds to the sequence in Figure 2A, including the inversion of the nucleotides located between the FseI sites in Figure 2A. [Figure 9B] 9A is a schematic diagram showing the "left end" sequence of the Ad35 helper genome containing the packaging sequence inversion. The sequence shown in Figure 9A corresponds to the sequence in Figure 2B, and includes an inversion of the nucleotides located between the FseI sites in Figure 2B. [Figure 9C] 9C is a schematic diagram showing the "left end" sequence of the Ad35 helper genome, including the packaging sequence inversion. The sequence shown in Figure 9C corresponds to the sequence in Figure 2C, including the inversion of the nucleotides located between the FseI sites in Figure 2C. [Figure 9D] 9D is a schematic diagram showing the "left end" sequence of the Ad35 helper genome, including the packaging sequence inversion. The sequence shown in Figure 9D corresponds to the sequence in Figure 2D, including an inversion of the nucleotides located between the FseI sites in Figure 2D. [Figure 10] Figure 1 is an image of a gel showing digestion of an Ad35 helper genome and a plasmid containing the Ad35 helper genome, accompanied by a table describing the gel. Gel lanes 2 and 4 show XmnI digestion of helper virus genomes produced using pEN0056 and pEN0057, respectively, and gel lanes 1 and 3 show digestion of the respective starting plasmids with XmnI and Swal. Lane 5 contains a 1 Kb Plus ladder. The accompanying table included in the figure indicates that pEN0056 and pEN0057 each contain a reverse-conditional packaging sequence according to the present disclosure, specifically one of the constructs described as constructs 7 and 8 in Example 5, respectively (i.e., pEN0056 corresponds to the plasmid containing construct 7, and pEN0057 corresponds to the plasmid containing construct 8). The expected band sizes were obtained in all lanes. [Figure 11] Figure 1 shows an image of a gel showing digestion of the Ad35 helper genome, accompanied by a table describing the gel. The accompanying table included with the figure indicates the plasmid and cell type used to produce the sample shown in each lane, as well as the expected band sizes. ApaI digestion produces a 2013 bp fragment from the packaging-competent Ad35 genome (without excising the inverted-flanked packaging sequence) and a smaller fragment from the Ad35 genome with the inverted-flanked packaging sequence excised. Lane 1 contains the 1 Kb Plus ladder. All band sizes were consistent with expectations. [Figure 12]1 is a plasmid map showing the structural organization of plasmid 5475, a plasmid encoding a helper-dependent genome containing terminal sequences from Ad35. The encoded helper-dependent genome contains a cassette for expression of Beta-galactosidase. Digestion of plasmid 5475 with the restriction enzyme PmeI releases the helper-dependent genome from the plasmid backbone. Because at least the 5' and 3' ends of plasmid 5475 contain sequences derived from Ad35, the encoded helper-dependent genome can be packaged into vector particles produced using the Ad35 helper genome of the present disclosure. [Figure 13A]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid containing an Ad35 helper genome according to the present disclosure (pEN0056) and a helper-dependent genome containing terminal sequences derived from Ad35 (plasmid 5475). [Figure 13B]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN0057) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 5475) containing a helper-dependent genome with terminal sequences derived from Ad35. [Figure 14]Figure 1 shows an image of a gel accompanied by a table describing the gel. The gel shows digestion of adenoviral genomes obtained from 116 cells transfected with a plasmid containing an Ad35 helper genome (pEN0056 or pEN0057) according to the present disclosure and plasmid 5475, followed by two consecutive rounds of cesium chloride gradient purification. As indicated in the accompanying table, purified adenoviral genomes were digested with SacII (lanes 4 and 5), while the parental plasmid was also digested for comparison (lanes 2 and 3). In lane 3, plasmid 5475 was digested with PmeI (to release the helper-dependent genome from the plasmid 5475 backbone) and SacII. In lane 2, helper plasmid pEN0057 was digested with PmeI (to release the helper genome from the pEN0057 plasmid backbone) and SacII. Digestion of helper plasmid pEN0056 is expected to show a similar restriction pattern to pEN0057. [Figure 15A]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid (pEN0057) containing an Ad35 helper genome according to the present disclosure and a plasmid (plasmid 1) containing an exemplary helper-dependent genome with terminal sequences derived from Ad35. [Figure 15B]

[0023] Figure 1 is a pair of images showing cesium chloride gradient purification of helper-dependent adenovirus produced using an Ad35 helper genome according to the present disclosure. The images represent two successive rounds of purification. HDAd preparations that underwent cesium chloride gradient purification were produced by transfecting 116 cells with a plasmid containing an Ad35 helper genome according to the present disclosure (pEN0057) and a plasmid containing an exemplary helper-dependent genome (plasmid 2) that includes terminal sequences derived from Ad35. [Figure 16]Figure 1 is an image of a gel accompanied by a table describing the gel. The gel shows digestion of adenoviral genomes obtained from 116 cells transfected with an Ad35 helper genome (pEN0057) according to the present disclosure and a plasmid containing plasmid 1 or plasmid 2, and then purified by two consecutive rounds of cesium chloride gradient purification. As indicated in the table included in the figure, the purified adenoviral genomes were digested with EcoRV (lanes 3, 5, and 6), and the parental plasmid was also digested for comparison (lanes 2, 4, and 7). In lanes 4 and 7, plasmid 1 or plasmid 2 was digested with PmeI (to release the helper-dependent genome from the plasmid 5475 backbone) and EcoRV. In lane 2, helper plasmid pEN0057 was digested with SwaI (to release the helper genome from the pEN0057 plasmid backbone) and EcoRV. [Figure 17] A list of nucleic acid and amino acid sequences corresponding to published sequence accession numbers, certain of which sequences and / or sequence accession numbers are included and / or utilized, in whole and / or in part, in the present disclosure and / or certain of which sequences and / or sequence accession numbers are incorporated herein by reference. DETAILED DESCRIPTION OF THE INVENTION

[0055] The present disclosure includes adenovirus serotype 35 (Ad35) vectors and Ad35 genomes useful for gene therapy. Adenoviruses are large, icosahedral, non-enveloped viruses. While some viral vectors are characterized by relatively high immunogenicity in human populations and / or relatively low payload capacity, Ad35 vectors are characterized by relatively low immunogenicity in human populations and relatively high payload capacity. However, modifying Ad35 vectors and genomes for use in gene therapy is not straightforward. The present disclosure includes, inter alia, the generation of therapeutic Ad35 donor vectors and / or modifications of Ad35 helper vectors useful in gene therapy methods.

[0056] Those skilled in the art will understand that throughout this disclosure, reference to a particular nucleotide position and / or its corresponding position discloses both the identified specific position and similar positions, e.g., positions within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of the indicated position. Furthermore, in various embodiments in which a heterologous sequence is inserted into or positioned within a sequence corresponding to a reference adenovirus genome, a particular insertion point may be equivalently referred to by multiple positions if the inserted sequence contains nucleotides adjacent to the reference sequence that are identical to those found in the reference sequence. In various such embodiments, an insertion can be identified as an insertion after any nucleotide position that is contiguous with the reference sequence nucleotide and identical in sequence to the corresponding nucleotide in the reference sequence.

[0057] Various sequences corresponding to the accession numbers disclosed herein are provided herein in Figure 17. One of skill in the art will understand that such sequences, including those disclosed in Figure 17, may be referenced in whole (e.g., by accession number) or in part (e.g., by reference to a nucleotide position and / or set or range of nucleotide positions of the sequence and / or accession number).

[0058] Adenovirus genomes, such as the Ad35 genome, contain DNA flanked on both sides by serotype-specific inverted terminal repeats (ITRs), which are understood to be cis-elements that contribute to or are necessary for viral genome replication. Depending on the serotype, the ITRs can be, for example, about 100-200 base pairs (e.g., about 160 base pairs) in length, with the highest conservation at the nucleotide position closest to the end of the adenovirus genome (e.g., about 50 base pairs). In various embodiments, the Ad35 ITRs comprise 137 bp (e.g., the 5'Ad35 ITR comprises nucleotides 1-137 or 4-140 of GenBank Accession No. AY128640, and the 3'ITR comprises nucleotides 34658-34794 of GenBank Accession No. AY128640). In various embodiments, the Ad35 5'ITR comprises at least 80 nucleotides (e.g., at least 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides, e.g., a number of nucleotides, e.g., 137 nucleotides, having a lower limit of 80, 90, 100, 110, 120, or 130 nucleotides and an upper limit of 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides) that share at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) with the corresponding fragment of nucleotides 1-200 of GenBank Accession No. AY128640, The 3' ITR comprises at least 80 nucleotides (e.g., at least 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides, e.g., a number of nucleotides, e.g., 137 nucleotides, having a lower limit of 80, 90, 100, 110, 120, or 130 nucleotides and an upper limit of 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides) that share at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) with the corresponding fragment from nucleotides 34595 to 34794 of GenBank Accession No. AY128640.In various embodiments, the ITRs are sufficient for one or both of Ad35 encapsidation and / or replication. In various embodiments, the Ad35 vector's Ad35 ITR sequence differs in that the first 8 bp are CTATCTAT (SEQ ID NO: 12) instead of CATCATCA (SEQ ID NO: 13) (Wunderlich, J. Gen Viro. 95:1574-1584, 2014).

[0059] The adenoviral genome also contains cis-acting packaging sequences (e.g., conditional or non-conditional packaging sequences, sometimes represented by the symbol ψ) that can facilitate packaging of the viral genome into a viral vector. In various embodiments, the packaging sequence can be located in the 5' portion of the Ad genome using the 5' ITR.

[0060] The native adenoviral genome encodes several proteins, including early transcription units E1, E2, E3, and E4, and a late transcription unit that encodes the structural protein components of the adenoviral vector. Early (E) and late (L) transcription are separated by the initiation of viral genome replication. Late transcription involves the expression of proteins that make up the viral capsid. The adenoviral capsid contains three types of proteins: fiber, penton, and hexon.

[0061] The Ad35 fiber is a fiber protein trimer, with each fiber protein comprising an N-terminal tail domain that interacts with the pentameric penton base, a C-terminal globular knob domain (fiber knob) that functions as an attachment site for host cell receptors, and a central shaft domain (shaft) that connects the tail and knob domains. In various embodiments, the Ad35 fiber knob has at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) to the reference fiber sequence, GenBank accession AP_000601. In various embodiments, the Ad35 fiber knob comprises amino acids 123 to 320 or 323 of the canonical wild-type Ad35 fiber protein. In various embodiments, the Ad35 fiber knob comprises at least 60 amino acids (e.g., at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 198 amino acids) that have at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) with the corresponding fragment of amino acids 123 to 320 or 323 of the canonical wild-type Ad35 fiber protein.

[0062] Exemplary genomes of native Ad35 adenoviruses are known and published (see, for example, Gao et al., 2003 Gene Ther. 10(23):1941-9; Reddy et al., 2003 Virology 311(2):384-393; GenBank accession number AY128640). Table 1 provides a summary of an example of an expression product encoded by the Ad35 genome (see Gao, Gene Ther. 10:1941-1949, 2003). [Table 1-1] [Table 1-2]

[0063] Other examples of Ad35 reference genomes include GenBank accession numbers AC_000019, AY271307, and AX049983.

[0064] Ad35 genomes and vectors can be modified for therapeutic use. One purpose of certain such modifications can include rendering the viral genome and vector defective for replication in recipient cells or systems, such as human subjects. The defective replication enhances the safety of administering the viral genome or vector to recipient cells or systems. Broadly, there are three recognized "generations" of adenoviral vectors and genomes modified to reduce and / or eliminate viral replication in recipients. First-generation adenoviral vectors are modified to remove the E1 and E3 genes. Without these genes, adenoviral vectors cannot replicate on their own but can be produced in E1-expressing mammalian cell lines (e.g., HEK293 cells). With first-generation modifications alone, the cloning capacity of the adenoviral vector is limited, and host immune responses to the vector can be problematic for effective payload expression. Second-generation adenoviral vectors are modified to remove the nonstructural genes E2 and E4 in addition to E1 / E3 removal, resulting in increased potency and reduced immunogenicity. Third-generation adenoviral vectors (also called enterovirus-free, high-capacity adenoviral vectors, or helper-dependent adenoviral vectors (HDAd)) are engineered to remove all viral coding sequences but retain the genomic ITRs and genomic packaging sequences. HDAd genomes are helper-dependent because they do not encode proteins necessary for viral production. Helper-dependent genomes can be packaged into vectors only when present in cells containing nucleic acid sequences that provide viral proteins in trans. These helper-dependent vectors are also characterized by greater capacity and reduced immunogenicity. By deleting viral coding sequences and leaving only the cis-acting elements necessary for genome replication (ITRs) and packaging, the cellular immune response to the Ad vector is reduced. Helper-dependent adenoviral vectors (HDAd) engineered to lack all viral coding sequences can efficiently transduce a wide variety of cell types and mediate long-term transgene expression with negligible chronic toxicity.HDAd vectors have a large cloning capacity, for example, up to 37 kb, allowing for the delivery of large payloads. In various embodiments, the retained portion of the reference genome may be identical in sequence to the corresponding sequence of the reference genome, or may share less than 100% identity with the reference genome, for example, at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, or 75% identity.

[0065] Because HDAd vectors do not encode viral proteins necessary for viral particle production, viral proteins must be provided in trans, e.g., expressed in and / or by the cell in which the HDAd genome resides. In some HDAd vector systems, one viral genome (the helper genome) encodes some or all of the proteins necessary for vector production (e.g., all of the structural viral proteins) but has a conditional defect in its packaging sequence, making the helper genome less likely to be packaged into a vector under certain vector production conditions (e.g., under those conditions and / or in the presence of a substance that impairs the function of the conditionally defective packaging sequence). Thus, in various embodiments, the HDAd donor viral genome comprises (e.g., comprises only) Ad ITRs, a payload (e.g., a therapeutic payload), and a functional packaging sequence (e.g., a wild-type packaging sequence or a functional fragment thereof), allowing the HDAd donor genome to be selectively packaged into HDAd vectors produced from structural components expressed from the conditionally packaging-defective helper genome. In other words, the Ad35 helper vector and genome can be used to generate an Ad35 donor vector.

[0066] In some HDAd vector systems, the helper genome utilizes a recombinase system (e.g., a Cre / loxP system) for conditional packaging. In certain such HDAd vector systems, the helper genome can contain a packaging sequence (e.g., a complete packaging sequence or a functional fragment thereof (e.g., a fragment of a packaging sequence sufficient for packaging, necessary for packaging, or necessary for efficient packaging of the Ad genome into capsids)) flanked by recombinase (e.g., loxP) sites, such that contact with a corresponding recombinase (e.g., Cre recombinase) excises the packaging sequence from the helper genome by recombinase-mediated (e.g., Cre-mediated) site-specific recombination between the recombinase sites (e.g., loxP sites). The present disclosure includes, inter alia, Ad35 helper vectors and genomes containing two recombinase sites flanking the packaging sequence, where the two recombinase sites correspond to (i.e., act on or by) the same recombinase. In various embodiments, the packaging sequence refers to the portion of the helper genome that is located between two recombinase sites described herein, e.g., between the location where the first recombinase site and the second recombinase site are inserted or positioned within the helper genome.

[0067] Similar HDAd production systems have been developed using FLP (e.g., FLPe) / frt site-specific recombination, in which FLP-mediated recombination between frt sites flanking the packaging sequence of the helper genome reduces or eliminates packaging of the helper genome in producer cells expressing FLP.

[0068] Thus, examples of recombinase systems include the Flp / Frt system and the Cre / loxP system, as well as others such as the Dre / rox system, the Vika / vox system, and the PhiC31 system. Cre is a site-specific DNA recombinase derived from the bacteriophage P1 sequence. The Cre / loxP system is described, for example, in EP02200009B1. The Cre / loxP system can include both canonical loxP sites and / or canonical Cre recombinase and / or mutants of one or both. The recognition site for the Cre protein is typically a 34-base pair nucleotide sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT) (SEQ ID NO: 1), referred to as a loxP site. Lox recognition site mutants that can be used include lox2272 (ATAACTTCGTATAAaGTATcCTATACGAAGTTAT) (SEQ ID NO: 2), lox511 (ATAACTTCGTATAATGTATaCTATACGAAGTTAT) (SEQ ID NO: 3), lox66 (ATAACTTCGTATANNNTANNNTATACGAACGGTA) (SEQ ID NO: 4), lox71 (TACCGTTCGTATANNNTANNNTATACGAAGTTAT) (SEQ ID NO: 5), loxM2 (ATAACTTCGTATA loxM3 (ATAACTTCGTATAtaaTACCATATACGAAGTTAT) (SEQ ID NO: 7), loxM7 (ATAACTTCGTATAAgaTAGAATATACGAAGTTAT) (SEQ ID NO: 8), loxM11 (ATAACTTCGTATAcgaTAccaTATACGAAGTTAT) (SEQ ID NO: 9), and lox5171 (ATAACTTCGTATAATGTgTaCTATACGAAGTTAT) (SEQ ID NO: 10).Mutants of Cre recombinase are known and are included herein, for example, as disclosed in Eroshenko and Church, "Mutants of Cre recombinase with improved accuracy," Nature Communications volume 4, Article number: 2509 (2013), which is incorporated herein by reference in its entirety, particularly with respect to mutants of Cre recombinase. The VCre / VloxP recombinase system was derived from the Vibrio plasmid p0908. The sCre / SloxP system is described, for example, in WO 2010 / 143606. The Flp / Frt DNA recombinase system was derived from Saccharomyces cerevisiae. The Flp / Frt system contains the recombinase Flp (flippase), which catalyzes DNA recombination at its Frt recognition site. In various embodiments, the Frt site contains the sequence GAAGTTCCTATTCtctagaaaGtATAGGAACTTC (SEQ ID NO: 11). Mutant Frt sites are also included herein. For example, Senecoff et al. (1987) showed that most mutations in the FRT sequence have minimal effect when present at only one of the two sites. Mutant Flp proteins include GenBank: ABD57356.1 and GenBank: ANW61888.1. The Dre / rox system is described, for example, in US Pat. No. 7,422,889 and US Pat. No. 7,915,037B2. It generally includes the Dre recombinase and rox recognition sites derived from Enterobacteria phage D6. The Vika / vox system is described, for example, in US Pat. No. 10,253,332. The PhiC31 recombinase recognizes the AttB / AttP binding site. In various embodiments, a recombinase site of the present disclosure is a sequence having at least 70% sequence identity (e.g., 70%, 75%, 80%, 95%, 90%, or 95% sequence identity to a sequence selected from SEQ ID NOs: 1-11).

[0069] The Ad35 packaging sequence can include up to 5, 6, or 7 predicted "A" repeats. For example, in various embodiments, the Ad35 packaging sequence can include one or more, or all, of AI, AII, AIII, AIV, AV, and / or AVI. In various embodiments, the present disclosure includes a recombinant Ad35 helper vector or genome comprising a packaging sequence flanked by recombinase sites. In various embodiments, the Ad35 packaging sequence refers to a nucleic acid sequence comprising nucleotides 138-504 of GenBank Accession No. AY128640, or a functional fragment thereof (e.g., a fragment of nucleotides 138-504 of GenBank Accession No. AY128640 that is sufficient for packaging, necessary for packaging, or required for efficient packaging of the Ad genome into capsids) (e.g., a fragment of the Ad35 packaging sequence flanked by recombinase sites). and excision by recombination of the recombinase sites, rendering the vector or genome defective for packaging, e.g., at least 10%, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, compared to a reference containing packaging sequences, optionally wherein the reference includes packaging sites flanked by recombination sites. In various embodiments, the Ad35 packaging sequence is at least 80 nucleotides (e.g., at least 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 960, 970, 980, or 990% sequence identity). 275, or 300 nucleotides, e.g., the number of nucleotides having a lower limit of 80, 90, 100, 110, 120, 130, 140, or 150 nucleotides and an upper limit of 150, 160, 170, 180, 190, 200, 225, 250, 275, or 300 nucleotides), along with the corresponding fragment from nucleotides 137 to 504 of GenBank Accession No. AY128640.

[0070] Those skilled in the art will understand that the term packaging sequence does not necessarily include all of the packaging elements present in a given vector or genome. For example, a helper genome can include recombinase direct repeats flanking a packaging sequence, where the flanked packaging sequence does not include all of the packaging elements present in the helper genome. Thus, in certain embodiments, one or two recombinase direct repeats of a helper genome are positioned within a larger packaging sequence, such that, for example, introduction of one or two recombinase direct repeats causes the larger packaging sequence to become non-contiguous. In various embodiments, the recombinase direct repeats of a helper genome flank a fragment of the packaging sequence such that excision of the flanked packaging sequence by recombination of the recombinase direct repeats reduces or eliminates (more generally, destroys) packaging of the helper genome and / or the ability of the helper genome to be packaged.

[0071] In some embodiments, to prevent the generation of replication-competent Ad (RCA) as a result of homologous recombination between the helper genome present in the producer cell and the HDAd donor genome, a "stuffer" sequence can be positioned or inserted into the E3 region to render any recombinants too large to be packaged and / or packaged efficiently.

[0072] In some embodiments, production of an HDAd35 donor vector can involve transfection of a plasmid containing an HDAd donor genome and transduction of a helper vector containing a helper genome into the same cell, cell, or cell population. The helper genome rescues the propagation of the Ad35 donor vector, allowing the Ad35 donor vector to be produced and isolated. In various embodiments, the HDAd donor genome can be delivered to cells expressing a recombinase for excision of the conditional packaging sequence of the helper vector (e.g., 293 cells expressing Cre recombinase (HEK293)), and optionally, the HDAd donor genome is delivered to the cell in a non-viral vector form, such as a bacterial plasmid form (e.g., the HDAd donor genome is present in a bacterial plasmid (pHDAd) and / or released by restriction enzyme digestion). The same cell can be transduced with a helper genome containing a packaging sequence flanked by recombinase sites (e.g., loxP sites). Thus, producer cells can be transfected with an HDAd donor genome and transduced with a helper genome having a packaging sequence flanked by recombinase sites (e.g., loxP sites), and the cells express a recombinase (e.g., Cre) corresponding to the recombinase sites. Consequently, excision of the packaging sequence renders the helper viral genome defective for packaging (e.g., unable to be packaged) but capable of providing all of the trans-acting factors necessary for the production of an HDAd donor vector containing the HDAd donor genome. After excision of the packaging sequence, the helper genome is defective for packaging (e.g., unable to be packaged) but is still capable of trans-complementing the replication and packaging of the HDAd donor genome. An HDAd vector containing the donor genome (e.g., a donor genome containing a therapeutic payload) can be isolated from the producer cells. Generally, some contamination of the helper vector and / or helper genome in HDAd viral vectors and HDAd viral vector preparations can occur and can be tolerated.The HDAd donor vector can be further isolated and / or purified from any helper vector by physical means. Various protocols are known in the art, for example, Palmer et al., 2009 Gene Therapy Protocols. Methods in Molecular Biology, Volume 433. Humana Press, Totowa, NJ: 2009, pp. 33-53.

[0073] Because the sequence of each viral genome differs for at least each serotype, the placement of recombinase sites for producing helper virus genomes cannot be predicted from available information about other serotypes. The present disclosure includes locations for the insertion and / or placement of recombinase sites adjacent to packaging sequences for use in Ad35 helper genomes.

[0074] In various embodiments, the Ad35 helper vector can include recombinase sites positioned or inserted adjacent to the packaging sequence, with a first recombinase site (e.g., a loxP site) positioned or inserted between positions 136 and 249 (e.g., between 151 and 171, between 161 and 181, between 185 and 205, or between 214 and 234) and a second recombinase site (e.g., a loxP site) positioned or inserted between positions 377 and 504 (e.g., between 392 and 412, or between 469 and 489), or between positions 3175 or 3200 and 3225 (e.g., between positions 3190 and 3210, e.g., in a genome containing an E1 deletion, such as a deletion of nucleotides from positions 480 to 3199, 481 to 3199, or 482 to 3199).

[0075] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted between positions 151 and 171, and a second recombinase site (e.g., a loxP site) is positioned or inserted between positions 3190 or 3200 and 3210 (e.g., in a genome that includes an E1 deletion, such as a deletion of nucleotide positions 480-3199, 481-3199, or 482-3199).

[0076] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted between positions 161 and 181, and a second recombinase site (e.g., a loxP site) is positioned or inserted between positions 392 and 412.

[0077] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted between positions 185 and 205, and a second recombinase site (e.g., a loxP site) is positioned or inserted between positions 469 and 489.

[0078] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted between positions 214 and 234, and a second recombinase site (e.g., a loxP site) is positioned or inserted between positions 392 and 412.

[0079] In various embodiments, the Ad35 helper vector can include recombinase sites positioned or inserted adjacent to the packaging sequence, with a first recombinase site (e.g., a loxP site) positioned or inserted at (e.g., immediately adjacent, e.g., before or after) a position selected from 161, 171, 195, and 224, and a second recombinase site (e.g., a loxP site) at (e.g., immediately adjacent, e.g., before or after) a position selected from 402, 479, and 3200 (e.g., within a genome that includes an E1 deletion, such as a deletion from nucleotide positions 480 to 3199, 481 to 3199, or 482 to 3199).

[0080] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted at position 161 and a second recombinase site (e.g., a loxP site) is positioned or inserted at position 3200 (e.g., within a genome that includes an E1 deletion, such as a deletion of nucleotide positions 480-3199, 481-3199, or 482-3199).

[0081] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted at position 171 and a second recombinase site (e.g., a loxP site) is positioned or inserted at position 402.

[0082] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted at position 195 and a second recombinase site (e.g., a loxP site) is positioned or inserted at position 479.

[0083] In certain exemplary embodiments, a first recombinase site (e.g., a loxP site) is positioned or inserted at position 224 and a second recombinase site (e.g., a loxP site) is positioned or inserted at position 402.

[0084] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 178 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 437. Excision of the loxP flanking sequences removes the packaging sequences for AI through AVI. In certain such embodiments, deletion of nucleotides 345-3113 removes the E1 gene, which may include AVI, as well as a packaging signal sequence and may include an additional packaging signal sequence. Thus, the flanking packaging sequences correspond to positions 179-344. Vectors according to this description have been shown to propagate.

[0085] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 178, a recombinase site (e.g., a loxP element) is inserted after nucleotide 481, and nucleotides 179-365 are deleted (removing packaging sequences AI-AV such that the remaining sequence, which may include AVI and may include additional packaging signal sequences, is in the nucleic acid sequence flanked by the recombinase sites). In certain such embodiments, deletion of nucleotides 482-3113 removes the E1 gene. Thus, the flanking packaging sequences correspond to positions 366-481. Vectors according to this description have been shown to propagate.

[0086] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 154 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 481. Thus, the flanking packaging sequences correspond to positions 155-481. Vectors according to this description have been shown to propagate. In certain such embodiments, a deletion of nucleotides 482-3113 removes the E1 gene.

[0087] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 158 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 480. Thus, the flanking packaging sequences correspond to positions 159-480. Vectors according to this description have been shown to propagate. In certain such embodiments, nucleotides 27388-30402, which comprise the E3 region, are deleted. In certain embodiments, the vector is an Ad35 helper vector. ++ It is a vector.

[0088] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 158 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 446. Thus, the flanking packaging sequences correspond to positions 159-446. Vectors according to this description have been shown to propagate. In certain such embodiments, nucleotides 27388-30402, which comprise the E3 region, are deleted. In certain embodiments, the vector is an Ad35 helper vector. ++ It is a vector.

[0089] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 179 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 480. Thus, the flanking packaging sequences correspond to positions 180-480. Vectors according to this description have been shown to propagate. In certain such embodiments, nucleotides 27388-30402, which comprise the E3 region, are deleted. In certain embodiments, the vector is an Ad35 helper vector. ++ It is a vector.

[0090] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 206 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 480. Thus, the flanking packaging sequences correspond to positions 207-480. Vectors according to this description have been shown to propagate. In certain such embodiments, nucleotides 27,388-30,402, which comprise the E3 region, are deleted. In certain embodiments, nucleotides 27,607-30,409 or 27,609-30,402 are deleted. In certain embodiments, nucleotides 27,240-27,608 are not deleted.

[0091] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 139 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 446. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 140-446.

[0092] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 158 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 446. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 159-446.

[0093] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 179 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 446. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 180-446.

[0094] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 201 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 446. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 202-446.

[0095] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 158 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 481. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 159-481.

[0096] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 179 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 384. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 180-384.

[0097] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 179 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 481. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 180-481.

[0098] In at least one exemplary Ad35 helper vector, a recombinase site (e.g., a loxP element) is inserted after nucleotide 206 and a recombinase site (e.g., a loxP element) is inserted after nucleotide 481. In certain such embodiments, nucleotides 27609-30402 are deleted. Thus, the flanking packaging sequence corresponds to positions 207-481.

[0099] In various embodiments, excision of the packaging sequence from the Ad35 helper genome reduces vector amplification by, e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, and 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%. reducing vector amplification by a percentage with an upper limit of 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%), optionally where the percent growth is measured as the number of viral particles produced by growth of the excised vector (a vector from which the recombinase site flanking sequences have been excised) compared to an intact vector (a vector not removed from the recombinase site flanking sequences) or compared to a wild-type Ad35 vector under equivalent conditions.

[0100] As described above, homologous recombination between a helper genome containing a conditionally defective packaging sequence and a donor genome containing a wild-type or reference packaging sequence can remove one or more recombinase sites in the conditionally defective packaging sequence, potentially resulting in contamination of the resulting donor vector. This is at least in part because excision of the packaging sequence requires two recombinase sites flanking the packaging sequence. Excision of one or more of the recombinase sites by recombinase site excision homologous recombination produces a helper genome that is not defective in packaging when contacted with a recombinase corresponding to the recombinase site (referred to herein as a constitutively packageable helper genome). The present disclosure recognizes that packaging sequence inversion can reduce recombinase site excision homologous recombination.

[0101] In some embodiments, the helper genome can include a packaging sequence inversion, in that a sequence comprising a recombinase site-flanked packaging sequence of the helper genome is present in a different orientation than a wild-type or reference sequence, such as a reference adenoviral genome. As one skilled in the art will appreciate, nucleic acid sequences are ordered from the 5' to 3' end for a given strand and can exist within a nucleic acid context, such as a strand of genomic DNA having a particular 5' to 3' sequence. The "orientation" of a nucleic acid sequence fragment present in a nucleic acid context can refer to whether the order of nucleotides in the fragment is the same as that in the corresponding fragment of the wild-type or reference nucleic acid context (e.g., a genomic sequence comprising a sequence corresponding to the nucleic acid sequence), or whether it is inverted, with a complementary sequence running in the opposite direction (the reverse complement of the corresponding wild-type or reference sequence) instead present in the nucleic acid context. As used herein, in various embodiments, the "orientation" of a flanking packaging sequence of an adenoviral genome or other nucleic acid fragment can refer to the order of nucleotides relative to the ITR, e.g., the 5' ITR or the 3' ITR. Inversion of sequences containing recombinase-flanked packaging sequences can reduce and / or eliminate recombinase site excision homologous recombination, thereby preventing the production of constitutively packageable helper genomes. Sequence inversion is further illustrated by comparing Figures 2A-2D to 9A-9D.

[0102] Thus, the present disclosure includes, among other things, helper vectors and genomes comprising two recombinase sites flanking a packaging sequence, where the two recombinase sites correspond to the same recombinase (i.e., act for or by the recombinase), and the sequence comprising the flanking packaging sequences is inverted. In various embodiments, the inverted sequence is or comprises a packaging sequence, such as a recombinase site-flanked packaging sequence. In various embodiments, the inverted sequence comprises one or both of a recombinase site-flanked packaging sequence and a recombinase site flanking a packaging sequence.

[0103] In various embodiments, the inverted sequence comprises additional nucleic acid that is not present in the flanking packaging sequence and / or that is not present in the recombinase site adjacent to the packaging sequence, hi various embodiments, one or both of the 5' and 3' ends of the inverted sequence comprises at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1,000, or more nucleotides adjacent to the recombinase site. In various embodiments, the inverted sequence comprises a number of nucleotides 5' of the 5' recombinase site of the flanking packaging sequence, with a lower limit of 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 75, 100, 150, 200, or 250 nucleotides and an upper limit of 10, 20, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, or more nucleotides. In various embodiments, the inverted sequence comprises several nucleotides 3' of the 3' recombinase site of the flanking packaging sequence, with a lower limit of 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 75, 100, 150, 200, or 250 nucleotides and an upper limit of 10, 20, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1,000, or more nucleotides.

[0104] In various embodiments, the inverted sequence comprises a gene. In various embodiments, the inverted sequence comprises E1 or encompasses an E1 deletion. In various embodiments, the inverted sequence comprises a gene encoding protein IX. In various embodiments, the inverted sequence comprises a gene encoding protein IVa2.

[0105] In various embodiments, the inverted sequence does not include an ITR (e.g., a 5' ITR). In various embodiments, the inverted sequence does not include an exon and / or does not include a portion of an exon. In various embodiments, the inverted sequence is present in the viral genome at a position that does not correspond to its position in the reference or wild-type genome. In various embodiments, the inverted sequence does not include any portion of the E1 coding sequence, protein IX coding sequence, and / or protein IVa2 coding sequence.

[0106] In various embodiments, the inverted packaging sequence can include a recombinase-flanked packaging sequence according to any embodiment (e.g., including any recombinase site location provided herein). In various embodiments, as provided herein, the nucleic acid locations of the Ad35 vectors of the present disclosure can be numbered according to the references disclosed herein, e.g., GenBank Accession No. AY128640. In various embodiments, the inverted packaging sequence can include one or more or all of AI, AII, AIII, AIV, AV, and / or AVI, optionally, one or more or all of AI, AII, AIII, AIV, AV, and / or AVI are present within a sequence flanked by recombinase sites.

[0107] In some embodiments, the inverted sequence is or comprises a sequence corresponding to a portion of the reference sequence that includes a first endpoint between positions 119 and 169 and a second endpoint between positions 3175 and 3225 (e.g., in a genome that includes an E1 deletion, such as a deletion of nucleotide positions 480-3199, 481-3199, or 482-3199). In some embodiments, the inverted sequence is or comprises a sequence corresponding to a portion of the reference sequence that includes a first endpoint between positions 119 and 169 and a second endpoint between positions 455 and 505.

[0108] In some embodiments, the inverted sequence is or comprises a sequence corresponding to a portion of the reference sequence that includes a first endpoint between positions 134 and 154 and a second endpoint between positions 3190 and 3210 (e.g., in a genome that includes an E1 deletion, such as a deletion of nucleotide positions 480-3199, 481-3199, or 482-3199). In some embodiments, the inverted sequence is or comprises a sequence corresponding to a portion of the reference sequence that includes a first endpoint between positions 134 and 154 and a second endpoint between positions 470 and 490.

[0109] In some embodiments, the inverted sequence is or comprises a sequence corresponding to a portion of the reference sequence that includes a first endpoint at position 144 and a second endpoint at position 3200 (e.g., in a genome that includes an E1 deletion, such as a deletion of nucleotide positions 480-3199, 481-3199, or 482-3199). In some embodiments, the inverted sequence is or comprises a sequence corresponding to a portion of the reference sequence that includes a first endpoint at position 144 and a second endpoint at position 480.

[0110] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 136 and 249 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0111] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 151 and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 392 and 412 or 469 and 489 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0112] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 151 and 171, 161 and 181, 185 and 205, or 214 and 234 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0113] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 151 and 171 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 3190 and 3210 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0114] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 161 and 181 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 392 and 412 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0115] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 185 and 205 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 469 and 489 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0116] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 214 and 234 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) located between nucleotide positions corresponding to 392 and 412 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0117] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) at a nucleotide position corresponding to 161, 171, 195, or 224 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) at nucleotide position corresponding to 402, 479, or 3200 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0118] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) at nucleotide position corresponding to 161 of GenBank accession number AY128640; (ii) a second recombinase site (e.g., a loxP site) at nucleotide position corresponding to 3200 of GenBank accession number AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0119] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) at nucleotide position corresponding to 171 of GenBank accession number AY128640; (ii) a second recombinase site (e.g., a loxP site) at the nucleotide position corresponding to 402 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0120] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) at nucleotide position corresponding to 195 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) at nucleotide position corresponding to 479 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0121] In one particular exemplary embodiment, (i) a first recombinase site (e.g., a loxP site) at nucleotide position corresponding to 224 of GenBank Accession No. AY128640; (ii) a second recombinase site (e.g., a loxP site) that is a second direct repeat at nucleotide position 402 of GenBank Accession No. AY128640; and (iii) An inversion of the sequence, comprising a first endpoint between positions 119 and 169 (e.g., between positions 134 and 154, e.g., position 144) and a second endpoint between positions 3175 and 3225 (e.g., between positions 3190 and 3210, e.g., position 3200) or between positions 455 and 505 (e.g., between positions 470 and 490, e.g., position 480).

[0122] The present disclosure further includes, in certain embodiments, the recombinase site is located at a nucleotide position as described herein. For example, in various non-limiting embodiments of the present disclosure, the first recombinase site is at one or more of positions 139, 140, 154, 155, 158, 159, 178, 179, 180, 201, 202, 206, 207, 343, 344, 364, 365, 366, 383, 384, 437, 445, 446, 479, 480, and / or 481. In various specific embodiments that do not limit the scope of the disclosure, the first recombinase site is at one or more of positions 139, 140, 154, 155, 158, 159, 178, 179, 180, 201, 202, 206, 207, 343, 344, 364, 365, and / or 366. In various specific embodiments that do not limit the scope of the disclosure, the second recombinase site is at one or more of positions 343, 344, 364, 365, 366, 383, 384, 437, 445, 446, 479, 480, and / or 481. In various specific embodiments, the first and second recombinase sites are not at positions selected from the following first and second positions: 139 and 446, 154 and 481, 158 and 446, 158 and 480, 158 and 481, 178 and 344, 178 and 437, 178 and 481, 179 and 384, 179 and 446, 179 and 480, 179 and 481, 201 and 446, 206 and 480, 206 and 481, and / or 365 and 481. In various specific embodiments that do not limit the scope of the disclosure, the first recombinase site is located between nucleotide 130 and nucleotide 400 (e.g., between nucleotides 138 and 180, 138 and 200, 138 and 220, 138 and 240, 138 and 260, 138 and 280, 138 and 300, 138 and 320, 138 and 340, 138 and 360, 138 and 366, 138 and 380, or 138 and 400).In various specific embodiments that do not limit the scope of the disclosure, the second recombinase site is at one or more positions between nucleotide 300 and nucleotide 550 (e.g., between nucleotides 344 and 360, 344 and 380, 344 and 400, 344 and 420, 344 and 440, 344 and 460, 344 and 480, 344 and 481, 344 and 500, 344 and 520, 344 and 540, or 344 and 550).

[0123] The present disclosure further includes, in certain embodiments, that the recombination sites are not located at nucleotide positions as described herein. For example, in various non-limiting embodiments of the present disclosure, the first recombinase site is not at one or more of positions 139, 140, 154, 155, 158, 159, 178, 179, 180, 201, 202, 206, 207, 343, 344, 364, 365, 366, 383, 384, 437, 445, 446, 479, 480, and / or 481. In various specific embodiments that do not limit the scope of the disclosure, the first recombinase site is not at one or more of positions 139, 140, 154, 155, 158, 159, 178, 179, 180, 201, 202, 206, 207, 343, 344, 364, 365, and / or 366. In various specific embodiments that do not limit the scope of the disclosure, the second recombinase site is not at one or more of positions 343, 344, 364, 365, 366, 383, 384, 437, 445, 446, 479, 480, and / or 481. In various specific embodiments, the first and second recombinase sites are not at positions selected from the following first and second positions: 139 and 446, 154 and 481, 158 and 446, 158 and 480, 158 and 481, 178 and 344, 178 and 437, 178 and 481, 179 and 384, 179 and 446, 179 and 480, 179 and 481, 201 and 446, 206 and 480, 206 and 481, and / or 365 and 481. In various specific embodiments that do not limit the scope of the disclosure, the first recombinase site is not located between nucleotide 130 and nucleotide 400 (e.g., between nucleotides 138 and 180, 138 and 200, 138 and 220, 138 and 240, 138 and 260, 138 and 280, 138 and 300, 138 and 320, 138 and 340, 138 and 360, 138 and 366, 138 and 380, or 138 and 400).In various specific embodiments that do not limit the scope of the disclosure, the second recombinase site is not at one or more of the positions between nucleotide 300 and nucleotide 550 (e.g., between nucleotides 344 and 360, 344 and 380, 344 and 400, 344 and 420, 344 and 440, 344 and 460, 344 and 480, 344 and 481, 344 and 500, 344 and 520, 344 and 540, or 344 and 550).

[0124] Those skilled in the art will understand that there are various ways to create inversions in relatively large sequences such as adenovirus genomes. Such inversions can be created using various available tools in molecular biology. For example, in certain embodiments, an inversion sequence can be synthesized or isolated and inserted into a target sequence by various means known in the art. In certain embodiments, the sequence for inversion can be located between two copies of a palindromic restriction site, so that an inversion can be created by contacting a sequence containing the sequence for inversion flanked by restriction sites according to various methods known in the art.

[0125] To provide one non-limiting example of a technique for generating an inversion of a sequence in an adenoviral genome, FseI sites can be inserted adjacent to a packaging sequence or a sequence that includes a packaging sequence, and optionally the packaging sequence is flanked by recombinase sites that are in turn located between the FseI sites. Such a sequence can be digested with FseI to excise the FseI site-flanking sequence, which can then be religated to the digested sequence in the opposite orientation.

[0126] The present disclosure includes, inter alia, the Ad35 helper genomes disclosed herein and Ad35 helper vectors comprising the same. The present disclosure further includes the use of Ad35 helper genomes and vectors in methods or compositions for producing HDAd35 donor vectors. The present disclosure further includes cells comprising an Ad35 helper vector and / or an Ad35 helper genome (and optionally further comprising an HDAd35 donor genome), e.g., for producing HDAd35 donor vectors. The present disclosure further includes the use of such cells in methods or compositions for producing HDAd35 donor vectors. In certain such cells, viral proteins encoded and expressed by the helper genome can be utilized in producing HDAd35 donor vectors in which the HDAd35 donor genome is packaged. Thus, the present disclosure includes methods for producing HDAd35 donor vectors by culturing cells comprising an HDAd35 donor genome and an Ad35 helper genome. In some embodiments, the cells encode and express a recombinase corresponding to the recombinase direct repeats flanking the packaging sequence of the Ad35 helper vector, hi some embodiments, the flanking packaging sequence of the Ad35 helper genome is excised.

[0127] In various embodiments, the Ad35 helper genome contains a conditional (e.g., flanked by frt or loxP sites) packaging sequence and encodes all of the proteins necessary to produce Ad35 virions capable of packaging a donor genome, hi some embodiments, the Ad35 helper genome encodes all of the Ad35 coding sequences.

[0128] An additional optional modification consideration may be modifying the helper genome to have a size that allows for separation of the helper vector from the HDAd35 donor vector by centrifugation, for example, by CsCl ultracentrifugation. One means of achieving this result is to increase the size of the helper genome compared to a typical Ad35 genome. In particular, the adenovirus genome can be modified to increase its length to at least 104% of its wild-type length. Certain helper vectors of the present disclosure can accommodate payload and / or stuffer sequences.

[0129] In various embodiments, the present disclosure provides that vectors or genomes of the present disclosure, such as the Ad35 helper genome, can include a selection of components each selected from a corresponding sequence of the Ad35 reference genome or having at least 75% sequence identity (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a corresponding sequence of the Ad35 reference genome.

[0130] In various embodiments, an Ad35 vector, such as a helper vector or donor vector, or an Ad35 helper genome, comprises or encodes a fiber knob mutation, compared to a reference or canonical Ad35 fiber knob, which mutation increases affinity of the vector, fiber, and / or fiber knob for CD46 (see, e.g., Table 2). In various embodiments, an Ad35++ fiber knob is comprised by or encoded by an Ad35 vector, such as a helper vector or donor vector, or an Ad35 helper genome. An Ad35++ fiber knob is a fiber knob that comprises a mutation, compared to a reference or canonical Ad35 fiber knob, which mutation increases affinity for CD46, e.g., optionally, the increase is at most or at least 1.1-fold, e.g., at most or at least 1, 2, 3, 4, 5, 10, 15, 20, or 25-fold. Increasing affinity for CD46 can increase the efficiency of target cell transduction and / or decrease the multiplicity of infection (MOI) required to achieve target levels of transduction (Li and Lieber, FEBS Letters, 593(24):3623-3648, 2019). In various embodiments, the Ad35++ fiber knob comprises at least one mutation selected from Ile192Val, Asp207Gly (or Glu207Gly in certain Ad35 sequences), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His. In various embodiments, the Ad35++ fiber knob comprises each of the following mutations: Ile192Val, Asp207Gly (or Glu207Gly in certain Ad35 sequences), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His. In various embodiments, the amino acid numbering of the Ad35 fiber is according to GenBank accession AP_000601 or a corresponding amino acid sequence, e.g., position 207 is Glu or Asp. In various embodiments, the Ad35 fiber has an amino acid sequence according to GenBank accession AP_000601.Further description of Ad35++ fiber knob mutations can be found in Wang 2008 J. Virol. 82(21):10567-10579, which is incorporated herein by reference in its entirety and with respect to the fiber knob. [Table 2] [Example]

[0131] The present disclosure includes the identification of locations within the Ad35 packaging sequence where recombinase sites can be advantageously positioned to produce Ad35 genomes (e.g., helper genomes) that are conditionally defective for packaging. Identification of these locations and genomes allows for the construction of safer and / or more efficient helper-dependent adenoviral vectors and vector systems. This example provides, among other things, the successful production and use of adenoviral genomes, including the adenoviral helper genomes provided herein, including adenoviral helper genomes that contain conditionally defective packaging sequences and / or inverted packaging sequences.

[0132] Example 1: Design of the Ad35 helper genome This example involves the identification of locations within the Ad35 genome, specifically within the Ad35 packaging sequence, where recombinase sites can be positioned for efficient switching between packaging competent and packaging deficient. Insertion or positioning of recombinase sites within the packaging sequence does not abrogate Ad35 genome packaging. However, excision of the recombinase flanking sequences reduces and / or eliminates genome packaging.

[0133] This example includes an alignment of adenovirus packaging sequences to identify putative packaging signals within the Ad35 genome, as shown in Figure 1. This example further includes the selection of specific locations for placement of 5' (left) and 3' (right) recombinase sites. The selected left recombinase sites include Ad35 genome positions 224, 171, 195, and 161. The selected right recombinase sites include Ad35 genome positions 402, 479, and 3200. This example further includes specific pairings of left and right recombinase site locations: positions 224 and 402, positions 171 and 402, positions 195 and 479, and positions 161 and 3200 (e.g., in genomes containing E1 deletions, such as deletions of nucleotide positions 480-3199, 481-3199, or 482-3199). These locations and pairings are shown in FIG. 1 and are further explained in the remainder of this example.

[0134] Exemplary Construct 1 Construct 1 contains recombinase sites positioned to generate a conditionally defective packaging sequence of the Ad35 helper genome. The inserted LoxP site is shown in the context of nucleotides 1-402 of the reference Ad35 sequence in GenBank accession number AY128640. The LoxP sites flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking sequences renders the genome defective in packaging. In the ITRs, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Additionally, CCGGCC (SEQ ID NO: 14) was inserted to allow for the insertion of the restriction enzyme FseI. [ka] Further sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1-402 modified to contain a conditionally defective packaging sequence (LoxP sequence is underlined). [ka]

[0135] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] LoxP sequences ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 18) LoxP flanking sequences (identified packaging signals A1, A2, A5, and A6 are underlined) [ka] FIG. 2A shows the region of the Ad35 helper genome (leftmost) that contains sequences from construct 1.

[0136] Exemplary Construct 2 Construct 2 contains recombinase sites positioned to generate a conditionally defective packaging sequence for the Ad35 helper genome. The inserted LoxP sites are shown in the context of nucleotides 1-402 of the reference Ad35 sequence in GenBank accession number AY128640. The LoxP sites flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking sequences renders the genome defective in packaging. In the ITRs, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Additionally, the CCGGCC sequence (SEQ ID NO: 14) was inserted to allow for the insertion of the FseI restriction enzyme. [ka] Further sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1-402 modified to contain a conditionally defective packaging sequence (LoxP sequence underlined). [ka]

[0137] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] LoxP sequences ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 18) LoxP flanking sequences (identified packaging signals A1, A2, A5, and A6 are underlined) [ka] FIG. 2B shows the region of the Ad35 helper genome (leftmost) that contains sequences from construct 2.

[0138] Exemplary Construct 3 Construct 3 contains recombinase sites positioned to generate a conditionally defective packaging sequence of the Ad35 helper genome. The inserted LoxP site is shown in the context of nucleotides 1-479 of the reference Ad35 sequence in GenBank accession number AY128640. The LoxP sites flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking sequences renders the genome defective in packaging. In the ITRs, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Additionally, the sequence CCGGCC (SEQ ID NO: 14) was inserted to allow for the insertion of the restriction enzyme FseI. [ka] Further sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1 to 479 modified to contain a conditionally defective packaging sequence (LoxP sequence underlined). [ka]

[0139] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] LoxP sequences ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 18) LoxP flanking sequences (identified packaging signals A1, A2, A5, and A6 are underlined) [ka] FIG. 2C shows the region of the Ad35 helper genome (leftmost) that contains sequences from construct 3.

[0140] Exemplary Construct 4 Construct 4 contains recombinase sites positioned to generate a conditionally defective packaging sequence of the Ad35 helper genome. The inserted LoxP sites are shown in the context of nucleotides 1-480 of the reference Ad35 sequence in GenBank accession number AY128640. The LoxP sites flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking sequences renders the genome defective in packaging. In the ITRs, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Additionally, the sequence CCGGCC (SEQ ID NO: 14) was inserted to allow for the insertion of the restriction enzyme FseI. [ka] Further sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1 to 480 modified to contain a conditionally defective packaging sequence (LoxP sequence underlined). [ka]

[0141] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] LoxP sequences ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 18) LoxP flanking sequences (identified packaging signals A1, A2, A5, and A6 are underlined; sequences inserted in place of the deletion of the early E1 gene extending from base pairs 481 to 3199 in bold and italics) [ka] FIG. 2D shows the region of the Ad35 helper genome (leftmost) that contains sequences from construct 4.

[0142] Example 2: Analysis of propagation and stability of Ad35 helper genomes This example demonstrates that Ad35 helper genomes containing recombinase-flanked packaging sequences according to the present disclosure are stable and can be propagated without detectable genome rearrangements.

[0143] The helper genome can be present in a plasmid or a viral vector. The plasmid form can be used to transfect target cells for the production of helper vectors (helper vectors containing the Ad35 helper genome) or donor vectors (donor vectors not containing the Ad35 helper genome). Four plasmids encoding the E1-deleted Ad35 helper genome (designated pEN025, pEN026, pEN027, and pEN028) were each transfected into HEK293 cells and grown to determine whether viable helper virus could be rescued. Each of pEN025, pEN026, pEN027, and pEN028 contained a construct according to constructs 1-4 in Example 1, respectively.

[0144] The rescued E1-deleted adenovirus was purified using standard methods (see, e.g., Su et al. doi:10.1101 / pdb.prot095547 Cold Spring Harb Protoc 2019), and the viral genome was isolated from the purified helper vector. The isolated Ad35 helper genome was digested with BsrGI alone, and for comparison, the starting plasmid was digested with BsrGI and SwaI (which excises the plasmid backbone sequence). The digestion products were analyzed by gel electrophoresis (Figure 3).

[0145] To determine whether the Ad35 helper genome is stable during propagation, the restriction patterns obtained by digesting the isolated adenoviral genomic DNA were compared with those obtained by digesting the starting plasmid with the restriction enzymes BsrG1 and SwaI. Analysis of the restriction patterns on a gel showed the expected banding patterns and band sizes (Figure 3), demonstrating that the Ad35 helper genome containing the recombinase-flanked packaging sequences disclosed herein is genetically stable and can be propagated in large-scale preparations without detectable genome rearrangements.

[0146] Example 3: Analysis of recombinase-mediated excision of recombinase-flanked packaging sequences in the Ad35 helper genome This example demonstrates recombinase-mediated deletion of recombinase-flanked packaging sequences in the Ad35 helper genome. Plasmids containing the Ad35 helper genomes (pEN025, pEN026, pEN027, and pEN028) were linearized by digestion with SwaI (which excised the plasmid backbone sequences) and transfected into two cell types: HEK293 cells, which do not express Cre recombinase, and 116 cells, which were modified from HEK293 cells to express Cre recombinase. Therefore, excision of the loxP-flanked sequences is expected in 116 cells but not in HEK293 cells. DNA was isolated from the transfected cells and digested with the restriction enzyme ApaI. Digestion of the Ad35 helper genome with the restriction enzyme ApaI is expected to produce a 2014-bp fragment. If the Ad35 helper genome had undergone recombination to mediate deletion of the recombinase-flanked packaging sequences, a smaller DNA fragment would be expected. The restriction results were analyzed by gel electrophoresis (Figure 4). The expected band sizes were observed for DNA isolated from HEK293 cells transfected with the Ad35 helper genome (Figure 4—lanes 2, 4, 6, and 8) and for DNA isolated from 116 cells transfected with the Ad35 helper genome (Figure 4—lanes 3, 5, 7, and 9). Thus, the data demonstrate successful Cre-mediated excision of the flanking packaging sequences from all helper genomes in the presence of the recombinase.

[0147] Example 4: Analysis of helper-dependent adenovirus (HDAd) production using Ad35 helper vectors with genomes containing recombinase-flanked packaging sequences This example demonstrates the production of helper-dependent adenovirus (HDAd) using an Ad35 helper vector with a genome containing recombinase-flanked packaging sequences. The Ad35 helper vector was purified from HEK293 cells transfected with a plasmid containing an Ad35 helper genome with recombinase-flanked packaging sequences (pEN025, pEN026, pEN027, pEN028, and pEN024). Helper-dependent adenovirus vectors were then produced in 116 cells using the purified Ad35 helper vector and transfection plasmid 5427 (a plasmid encoding a helper-dependent genome containing Ad35-derived terminal sequences and a cassette for expression of Beta-galactosidase) according to standard procedures (see Palmer and Ng, Methods Mol Biol. 2008;433:33-53) (Figure 5). HDAd viral particles produced using Ad35 helper vectors from pEN026 and pEN028 were isolated and subsequently used to achieve production of secondary HDAd preparations by coinfecting 116 cells with HDAd viral particles from plasmid 5427 and Ad35 helper viral particles from pEN026 or pEN028 (respectively).

[0148] Helper-dependent adenovirus (HDAd) preparations were purified using two sequential cesium chloride gradients (Figure 6A-E). The purified HDAd preparations were characterized using several approaches. The physical titer or yield of the purified virus preparation was determined spectrophotometrically and can be expressed as the total number of purified virus particles (vp) or the number of virus particles per volume (vp / ml). The infectivity of the purified HDAd preparations was determined by infecting cultured HEK293 cells with the purified helper-dependent virus and staining the cells to determine the expression of beta-galactosidase (as described in Parks et al., PNAS. 1996:93(24):13565-13570). Infected cells were expected to express beta-galactosidase. Infectivity was expressed as blue-forming units (BFU), which is the number of cells showing blue staining, indicating positive expression of beta-galactosidase encoded by the cassette in the HDAd genome. Infectivity can further be expressed as BFU per volume of purified virus (BFU / ml) and / or the ratio between the total number of virus particles and BFU (vp:BFU).

[0149] Further characterization of the purified HDAd preparations was performed using DNA isolated from the purified HDAd preparations. The isolated DNA was digested using a restriction enzyme (SacII), and the restriction pattern was compared to the restriction pattern obtained by digestion of the starting HDAd plasmid with the restriction enzymes (SacII and PmeI) and the restriction pattern obtained by digestion of the starting Ad35 helper plasmid with the restriction enzymes (SacII and SwaI for pEN025, pEN026, pEN027, and pEN028; or SacII and PmeI for pEN024). Analysis of the restriction pattern on a gel showed the expected banding pattern and expected band sizes (Figures 7A-C), indicating successful HDAd production. In Figures 7A and 7B, the restriction patterns of the HDAd preparations indicate low levels of helper virus contamination, whereas in Figure 7C, the banding pattern in lane 4 indicates relatively large helper virus contamination. The HDAd preparation examined in Figure 7C was prepared using an Ad35 helper vector generated using a plasmid (pEN024) encoding the Ad35 helper vector genome containing the construct of Figure 2E. Nevertheless, the vector, genome, and conditional packaging sequences analyzed in Figures 7A-C are advantageous and useful for the various methods and compositions provided herein. Additionally, quantitative PCR of DNA isolated from purified HDAd preparations was used to determine the Ad35 helper contamination fraction in the purified preparations.

[0150] Table 3 shows the results of experiments to characterize purified HDAd preparations. Table 4 shows the results from secondary preparations, including estimated helper fractions (%). [Table 3] [Table 4]

[0151] Example 5: Design of an Ad35 helper genome containing an inverted packaging sequence This example demonstrates the design of an Ad35 helper genome containing an inverted packaging sequence. This example is based, at least in part, on the recognition that the use of an inverted packaging sequence in an Ad35 helper vector can reduce and / or eliminate recombinase site excision homologous recombination (compare Figures 8A and 8B). Inversion of a sequence containing a conditionally defective packaging sequence thereby produces an inverted recombinase-flanked packaging sequence, which reduces and / or eliminates recombinase site excision homologous recombination, as shown in Figure 8B. Sequence elements contained within an inverted sequence are referred to herein as inverted sequence elements (e.g., a recombinase-flanked packaging sequence contained within an inverted sequence is referred to as an inverted recombinase-flanked packaging sequence). Those skilled in the art will understand from the present disclosure that the orientation of the packaging sequence is not critical to its function (see, e.g., Palmer and Ng, Mol Ther. 2003;8:8460852), and will further understand from the present disclosure that the inverted conditionally defective packaging sequences disclosed herein are packaging-competent. The inverted recombinase site-flanking packaging sequences can be further excised by recombination upon contact with the corresponding recombinase, preventing packaging of the helper genome.

[0152] This example specifically includes an Ad35 helper genome containing an inverted packaging sequence, as described below.

[0153] Exemplary Construct 5 Construct 5 (Figure 9A) corresponds to Construct 1 (Figure 2A) but contains an inverted packaging sequence. The inverted recombinase-flanked packaging sequence is shown in the context of nucleotides 1 to 480 of the reference Ad35 sequence in GenBank accession number AY128640. The locations of the inserted sequence elements are identified based on their correspondence with the locations of the reference Ad35 genome sequence, including when present in Construct 5 in the reverse orientation. Two inserted LoxP sites (one at position 224 and the other at position 402) flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking packaging sequence renders the genome defective in packaging. The sequence AGGGATAACAGGGTAAT (SEQ ID NO: 29) was inserted in place of the deleted early E1 gene extending from base pairs 481 to 3199 to create a recognition site for the restriction enzyme I-SceI. Additionally, the sequence CCGGCC (SEQ ID NO: 14) was inserted at position 143 to create a first recognition site for the restriction enzyme FseI, and the sequence GGCCGGCC (SEQ ID NO: 34) was inserted at position 3200 to create a second recognition site for the restriction enzyme FseI. An inverted recombinase-flanked packaging sequence was produced by inversion of the sequence containing the recombinase-flanked packaging sequence. The inverted sequence of Construct 5 contains a sequence flanked by two FseI sites at positions 143 and 3200, which contains two LoxP sites, a recombinase-flanked packaging sequence, and an I-SceI recognition site. Because the inverted LoxP sites are adjacent to the inverted recombinase-flanked packaging sequence of the Ad35 genome, Cre recombinase-mediated deletion of the flanking sequences renders the genome defective for packaging. In the ITR, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Figure 9A shows the region of the Ad35 helper genome containing construct 5. Sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1-480, modified to contain inverted recombinase-flanked packaging sequences (inverted sequence is underlined; FseI recognition site is bolded and italicized) [ka]

[0154] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] Inverted LoxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 1) Inverted sequence (inverted LoxP sequence is underlined; inverted recombinase flanking packaging sequences are bolded and italicized) [ka] Inverted recombinase flanking packaging sequences (identified inverted packaging signals A1, A2, A5, and A6 are underlined) [ka]

[0155] Exemplary Construct 6 Construct 6 (Figure 9B) corresponds to Construct 1 (Figure 2B) but contains an inverted packaging sequence. The inverted recombinase-flanked packaging sequence is shown in the context of nucleotides 1 to 480 of the reference Ad35 sequence in GenBank accession number AY128640. The location of the inserted sequence elements is identified based on their correspondence with their location in the reference Ad35 genome sequence, including when present in Construct 6 in the reverse orientation. Two inserted LoxP sites (one at position 171 and the other at position 402) flank the packaging sequence in the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking packaging sequence renders the genome defective in packaging. The sequence AGGGATAACAGGGTAAT (SEQ ID NO: 29) was inserted in place of the deleted early E1 gene extending from base pairs 481 to 3199 to create a recognition site for the restriction enzyme I-SceI. Additionally, the sequence CCGGCC (SEQ ID NO: 14) was inserted at position 143 to create a first recognition site for the restriction enzyme FseI, and the sequence GGCCGGCC (SEQ ID NO: 34) was inserted at position 3200 to create a second recognition site for the restriction enzyme FseI. An inverted recombinase-flanked packaging sequence was produced by inversion of the sequence containing the recombinase-flanked packaging sequence. The inverted sequence of Construct 6 contains a sequence flanked by two FseI sites at positions 143 and 3200, which contains two LoxP sites, a recombinase-flanked packaging sequence, and an I-SceI recognition site. Because the inverted LoxP sites flank the inverted recombinase-flanked packaging sequence of the Ad35 genome, Cre recombinase-mediated deletion of the flanking sequences renders the genome defective for packaging. In the ITR, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Figure 9B shows the region of the Ad35 helper genome containing construct 6. Sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1-480, modified to include inverted recombinase flanking packing sequences (inverted sequence is underlined; FseI recognition site is bolded and italicized) [ka]

[0156] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] Inverted LoxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 1) Inverted sequence (inverted LoxP sequence is underlined; inverted recombinase flanking packaging sequences are bolded and italicized) [ka] Inverted recombinase flanking packaging sequences (identified inverted packaging signals A1, A2, A5, and A6 are underlined) [ka]

[0157] Exemplary Construct 7 Construct 7 (Figure 9C) corresponds to Construct 1 (Figure 2C) but contains an inverted packaging sequence. The inverted recombinase-flanked packaging sequence is shown in the context of nucleotides 1 to 480 of the reference Ad35 sequence in GenBank accession number AY128640. The locations of the inserted sequence elements are identified based on their correspondence with the locations of the reference Ad35 genome sequence, including when present in Construct 7 in the reverse orientation. Two inserted LoxP sites (one at position 195 and the other at position 479) flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking packaging sequence renders the genome defective in packaging. The sequence AGGGATAACAGGGTAAT (SEQ ID NO: 29) was inserted in place of the deleted early E1 gene extending from base pairs 481 to 3199 to create a recognition site for the restriction enzyme I-SceI. Additionally, the sequence CCGGCC (SEQ ID NO: 14) was inserted at position 143 to create a first recognition site for the restriction enzyme FseI, and the sequence GGCCGGCC (SEQ ID NO: 34) was inserted at position 3200 to create a second recognition site for the restriction enzyme FseI. An inverted recombinase-flanked packaging sequence was produced by inversion of the sequence containing the recombinase-flanked packaging sequence. The inverted sequence of Construct 7 contains a sequence flanked by two FseI sites at positions 143 and 3200, which contains two LoxP sites, a recombinase-flanked packaging sequence, and an I-SceI recognition site. Because the inverted LoxP sites flank the inverted recombinase-flanked packaging sequence of the Ad35 genome, Cre recombinase-mediated deletion of the flanking sequences renders the genome defective for packaging. In the ITR, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Figure 9C shows the region of the Ad35 helper genome containing construct 7. Sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1-480, modified to include inverted recombinase flanking packing sequences (inverted sequence is underlined; FseI recognition site is bolded and italicized) [ka]

[0158] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] Inverted LoxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 1) Inverted sequence (inverted LoxP sequence is underlined; inverted recombinase flanking packaging sequences are bolded and italicized) [ka] Inverted recombinase flanking packaging sequences (identified inverted packaging signals A1, A2, A5, and A6 are underlined) [ka]

[0159] Exemplary Construct 8 Construct 8 (Figure 9D) corresponds to Construct 1 (Figure 2D) but contains an inverted packaging sequence. The inverted recombinase-flanked packaging sequence is shown in the context of nucleotides 1 to 480 of the reference Ad35 sequence in GenBank accession number AY128640. The locations of the inserted sequence elements are identified based on their correspondence with the locations of the reference Ad35 genome sequence, including when present in Construct 8 in the reverse orientation. Two inserted LoxP sites (one at position 161 and the other at position 3200) flank the packaging sequence of the Ad35 genome, such that Cre recombinase-mediated deletion of the flanking packaging sequence renders the genome defective in packaging. The sequence AGGGATAACAGGGTAAT (SEQ ID NO: 29) was inserted in place of the deleted early E1 gene extending from base pairs 481 to 3199 to create a recognition site for the restriction enzyme I-SceI. Additionally, the sequence CCGGCC (SEQ ID NO: 14) was inserted at position 143 to create a first recognition site for the restriction enzyme FseI, and the sequence GGCCGGCC (SEQ ID NO: 34) was inserted immediately downstream of the LoxP site inserted at position 3200 to create a second recognition site for the restriction enzyme FseI. An inverted recombinase-flanked packaging sequence was produced by inversion of the sequence containing the recombinase-flanked packaging sequence. The inverted sequence of construct 8 contains a sequence flanked by two FseI sites at positions 143 and 3200, which contains two LoxP sites, a recombinase-flanked packaging sequence, and an I-SceI recognition site. Because the inverted LoxP sites are adjacent to the inverted recombinase-flanked packaging sequence of the Ad35 genome, Cre recombinase-mediated deletion of the flanking sequences renders the genome defective for packaging. In the ITR, CTATCTAT (SEQ ID NO: 12) was used in place of the canonical CATCATCA (SEQ ID NO: 13) in the reference sequence, based on publication in Wunderlich et al., J Gen Virol. 2014;95:1574-1584. Figure 9D shows the region of the Ad35 helper genome containing construct 8. Sequence information is provided below. Sequence corresponding to AY128640 nucleotides 1-480, modified to include inverted recombinase flanking packing sequences (inverted sequence is underlined; FseI recognition site is bolded and italicized) [ka]

[0160] The components of the above sequences are further described below. ITR (CTATCTAT (SEQ ID NO: 12) sequence used in place of the canonical CATCATCA (SEQ ID NO: 13) is underlined) [ka] Inverted LoxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 1) Inverted sequence (inverted LoxP sequence is underlined; inverted recombinase flanking packaging sequences are bolded and italicized) [ka] Inverted recombinase flanking packaging sequences (identified inverted packaging signals A1, A2, A5, and A6 are underlined) [ka]

[0161] Example 6: Analysis of propagation and stability of Ad35 helper genomes This example demonstrates the successful use of Ad35 helper genomes disclosed herein that contain inverted packaging sequences. This example further demonstrates that Ad35 helper genomes containing inverted recombinase-flanked packaging sequences according to the present disclosure are stable and can be propagated without detectable genome rearrangements.

[0162] Generally, the helper genome can be present in a plasmid or a viral vector. The plasmid form can be used to transfect target cells for the production of helper vectors (where the helper vector contains the Ad35 helper genome) or donor vectors (where the donor vector does not contain the Ad35 helper genome). In this example, two plasmids encoding the E1-deleted Ad35 helper genome (designated pEN0056 and pEN0057) were each transfected into HEK293 cells and grown to determine whether viable helper virus could be rescued. pEN0056 and pEN0057 each contained constructs according to constructs 7 and 8 in Example 5, respectively.

[0163] The rescued E1-deleted adenovirus was purified using standard methods (see, e.g., Su et al. doi:10.1101 / pdb.prot095547 Cold Spring Harb Protoc 2019), and the viral genome was isolated from the purified helper vector. The isolated Ad35 helper genome was digested with XmnI alone, and for comparison, the starting plasmid was digested with XmnI and SwaI (which excises the plasmid backbone sequence). The digestion products were analyzed by gel electrophoresis (Figure 10).

[0164] To determine whether the Ad35 helper genome is stable during propagation, the restriction pattern obtained by digesting the isolated adenoviral genomic DNA was compared to the restriction pattern obtained by digesting the starting plasmid with the restriction enzymes XmnI and SwaI. Analysis of the restriction pattern on a gel showed the expected banding pattern and expected band sizes (Figure 10), demonstrating that the Ad35 helper genome containing the inverted recombinase-flanked packaging sequences disclosed herein is genetically stable and can be propagated in large-scale preparations without detectable genome rearrangement.

[0165] Example 7: Analysis of recombinase-mediated excision of inverted recombinase-flanked packaging sequences in Ad35 helper genomes This example demonstrates recombinase-mediated deletion of the inverted recombinase-flanked packaging sequence in the Ad35 helper genome. Plasmids containing the Ad35 helper genomes (pEN0056 and pEN0057) were linearized by digestion with SwaI (which excised the plasmid backbone sequences) and transfected into two cell types: HEK293 cells, which do not express Cre recombinase, and 116 cells, which were modified from HEK293 cells to express Cre recombinase. Therefore, excision of the loxP-flanked sequences is expected in 116 cells but not in HEK293 cells. DNA was isolated from the transfected cells and digested with the restriction enzyme ApaI. Digestion of the Ad35 helper genome with the restriction enzyme ApaI is expected to produce a 2013-bp fragment. If the Ad35 helper genome had undergone recombination to mediate deletion of the inverted recombinase-flanked packaging sequence, a smaller DNA fragment would be expected. The restriction results were analyzed by gel electrophoresis (Figure 11). The expected band sizes were observed for DNA isolated from HEK293 cells transfected with the Ad35 helper genome (Figure 11—lanes 2 and 4) and for DNA isolated from 116 cells transfected with the Ad35 helper genome (Figure 11—lanes 3 and 5). Thus, the data demonstrate successful Cre-mediated excision of the flanking packaging sequences from all helper genomes in the presence of the recombinase.

[0166] Example 8: Analysis of helper-dependent adenovirus (HDAd) production using Ad35 helper vectors with genomes containing inverted recombinase-flanked packaging sequences This example demonstrates the production of helper-dependent adenovirus (HDAd) using an Ad35 helper vector with a genome containing inverted recombinase-flanked packaging sequences. The Ad35 helper vector was purified from HEK293 cells transfected with a plasmid containing an Ad35 helper genome with inverted recombinase-flanked packaging sequences (pEN0056 and pEN0057). Helper-dependent adenovirus vectors were produced in 116 cells using the purified Ad35 helper vector and transfection plasmid 5475 (a plasmid encoding a helper-dependent genome containing Ad35-derived terminal sequences and a cassette for Beta-galactosidase expression) according to standard procedures (see Palmer and Ng, Methods Mol Biol. 2008;433:33-53) (Figure 12). HDAd viral particles produced using Ad35 helper vectors from pEN0056 and pEN0057 were isolated and subsequently used to achieve production of secondary HDAd preparations by coinfecting 116 cells with HDAd viral particles from plasmid 5475 and Ad35 helper viral particles from pEN0056 and pEN0057 (respectively).

[0167] Helper-dependent adenovirus (HDAd) preparations were purified using two sequential cesium chloride gradients (Figure 13A-B). The purified HDAd preparations were characterized using several approaches. The physical titer or yield of the purified virus preparation was determined spectrophotometrically and can be expressed as the total number of purified virus particles (vp) or the number of virus particles per volume (vp / ml). The infectivity of the purified HDAd preparations was determined by infecting cultured HEK293 cells with the purified helper-dependent virus and staining the cells to determine the expression of beta-galactosidase (as described in Parks et al., PNAS. 1996:93(24):13565-13570). Infected cells were expected to express beta-galactosidase. Infectivity was expressed as blue-forming units (BFU), which is the number of cells showing blue staining, indicating positive expression of beta-galactosidase encoded by the cassette in the HDAd genome. Infectivity can further be expressed as BFU per volume of purified virus (BFU / ml) and / or the ratio between the total number of virus particles and BFU (vp:BFU).

[0168] Further characterization of the purified HDAd preparations was performed using DNA isolated from the purified HDAd preparations. The isolated DNA was digested using a restriction enzyme (SacII), and the restriction pattern was compared to the restriction pattern obtained by digestion of the starting HDAd plasmid with the restriction enzymes (SacII and PmeI) and the restriction pattern obtained by digestion of the starting Ad35 helper plasmid with the restriction enzymes (SacII and SwaI). Analysis of the restriction pattern on a gel showed the expected banding pattern and expected band sizes (Figure 14), indicating successful HDAd production. The vector, genome, and conditional packaging sequences analyzed in Figure 14 are advantageous and useful for the various methods and compositions provided herein. Furthermore, quantitative PCR of DNA isolated from the purified HDAd preparations was used to determine the Ad35 helper contamination fraction in the purified preparations.

[0169] Table 5 shows the results of experiments to characterize purified HDAd preparations. Table 6 shows the results from secondary preparations, including estimated helper fractions (%). [Table 5] [Table 6]

[0170] To further demonstrate the production of helper-dependent adenovirus (HDAd) using an Ad35 helper vector with a genome containing inverted recombinase-flanked packaging sequences, HDAd vectors were produced in 116 cells by transfecting one of two exemplary plasmids (plasmid 1 and plasmid 2) with a purified Ad35 helper vector (derived from pEN0057). Plasmids 1 and 2 encode exemplary helper-dependent genomes, each containing Ad35-derived terminal sequences and an exemplary transgene payload, with each of plasmids 1 and 2 containing a different exemplary transgene payload. HDAd preparations were purified using two consecutive cesium chloride gradients (Figure 15A-B). The purified HDAd preparations were characterized as described above. DNA isolated from purified HDAd preparations was digested with restriction enzymes (EcoRV), and the restriction patterns were compared to those obtained by digestion of the starting HDAd plasmid with restriction enzymes (EcoRV and PmeI) and the starting Ad35 helper plasmid with restriction enzymes (EcoRV and SwaI). Analysis of the restriction patterns on a gel showed the expected banding pattern and expected band sizes (Figure 16), indicating successful HDAd production.

[0171] Table 7 shows the results of experiments to characterize purified HDAd preparations. [Table 7]

[0172] Other embodiments While several embodiments have been described herein, it is clear that the disclosure and examples herein also provide other embodiments that utilize or are encompassed by the compositions and methods described herein. Accordingly, it will be understood that the scope of the disclosure is defined not by the specific embodiments represented by way of example, but by what can be understood from the present disclosure. Limitations described with respect to one aspect of the present disclosure may, in certain embodiments, be implemented with respect to other aspects of the present disclosure. For example, any claim limitations that depend directly or indirectly on a particular independent claim presented herein serve to support those limitations presented in additional dependent claims of one or more other independent claims.

[0173] All documents cited herein are hereby incorporated by reference.

Claims

1. A recombinant adenovirus helper genome, comprising: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, and recombinase direct repeats flanking the Ad35 packaging sequence, wherein the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 155 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of SEQ ID NO:

50. (a) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 155 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412, or 469 and 489 of SEQ ID NO:50; (b) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 155 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of SEQ ID NO:50; (c) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 155 and 171 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of SEQ ID NO:50; (d) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 161 and 181 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412 of SEQ ID NO:50; (e) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 185 and 205 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 469 and 489 of SEQ ID NO:50; (f) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 214 and 234 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412 of SEQ ID NO:50; (g) the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 161, 171, 195, or 224 of SEQ ID NO:50, and a second recombinase direct repeat at a nucleotide position corresponding to 402, 479, or 3200 of SEQ ID NO:50; (h) the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 161 of SEQ ID NO:50 and a second recombinase direct repeat at a nucleotide position corresponding to 3200 of SEQ ID NO:50; (i) the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 171 of SEQ ID NO:50 and a second recombinase direct repeat at a nucleotide position corresponding to 402 of SEQ ID NO:50; (j) the recombinase direct repeats comprise a first recombinase direct repeat at a nucleotide position corresponding to 195 of SEQ ID NO:50 and a second recombinase direct repeat at a nucleotide position corresponding to 479 of SEQ ID NO:50; or (k) the recombinase direct repeat comprises a first recombinase direct repeat at a nucleotide position corresponding to 224 of SEQ ID NO:50 and a second recombinase direct repeat at a nucleotide position corresponding to 402 of SEQ ID NO:50; The helper genome of claim 1.

3. 3. The helper genome of claim 1 or 2, wherein the recombinase direct repeats flanking the Ad35 packaging sequence are FRT, loxP, rox, vox, AttB, or AttP sites.

4. The helper genome of any one of claims 1 to 3, wherein the recombinase direct repeats flanking the Ad35 packaging sequence are loxP sites.

5. A recombinant adenovirus helper vector comprising an Ad35 helper genome described in any one of claims 1 to 4.

6. A recombinant adenoviral vector production system, comprising: (i) an Ad35 helper genome according to any one of claims 1 to 4, or a helper vector according to claim 5; (ii) a HDAd35 donor genome, wherein the HDAd35 donor genome comprises: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, Ad35 packaging sequence; and a nucleic acid sequence encoding at least one heterologous expression product.

7. 1. A method for producing a recombinant helper-dependent adenoviral donor vector, comprising isolating the recombinant helper-dependent Ad35 donor vector from a culture of cells, the cells comprising: A recombinant Ad35 helper genome according to any one of claims 1 to 4, or a recombinant adenovirus helper vector according to claim 5, a recombinant helper-dependent Ad35 donor genome, said recombinant helper-dependent Ad35 donor genome comprising: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, Ad35 packaging sequence; and a nucleic acid sequence encoding at least one heterologous expression product.

8. A recombinant adenovirus helper genome, comprising: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, recombinase direct repeats flanking the Ad35 packaging sequence, said recombinase direct repeats comprising a first recombinase direct repeat between nucleotide positions corresponding to 136 and 249 of SEQ ID NO:50 and a second recombinase direct repeat between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of SEQ ID NO:50; The recombinant adenovirus helper genome, wherein the Ad35 helper genome comprises an inverted packaging sequence. (a) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 392 and 412, or 469 and 489 of SEQ ID NO:50; (b) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3210 of SEQ ID NO:50; or (c) the recombinase direct repeats comprise a first recombinase direct repeat between nucleotide positions corresponding to 151 and 171 of SEQ ID NO:50, and a second recombinase direct repeat between nucleotide positions corresponding to 3190 and 3120 of SEQ ID NO:50; The helper genome described in claim 8.

10. 10. The helper genome of claim 8 or 9, wherein the recombinase direct repeats flanking the Ad35 packaging sequence are FRT, loxP, rox, vox, AttB, or AttP sites.

11. The helper genome of any one of claims 8 to 10, wherein the recombinase direct repeats flanking the Ad35 packaging sequence are loxP sites.

12. A recombinant adenovirus helper vector comprising an Ad35 helper genome described in any one of claims 8 to 11.

13. A recombinant adenoviral vector production system, comprising: (i) an Ad35 helper genome according to any one of claims 8 to 11, or a helper vector according to claim 12; (ii) a HDAd35 donor genome, wherein the HDAd35 donor genome comprises: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, Ad35 packaging sequence; and a nucleic acid sequence encoding at least one heterologous expression product.

14. 1. A method for producing a recombinant helper-dependent adenoviral donor vector, comprising isolating the recombinant helper-dependent Ad35 donor vector from a culture of cells, the cells comprising: A recombinant Ad35 helper genome according to any one of claims 8 to 11, or a recombinant adenovirus helper vector according to claim 12, a recombinant helper-dependent Ad35 donor genome, said recombinant helper-dependent Ad35 donor genome comprising: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, Ad35 packaging sequence; and a nucleic acid sequence encoding at least one heterologous expression product.

15. A helper genome, helper vector, system, or method described in any one of claims 8 to 14, wherein the inverted packaging sequence comprises the Ad35 packaging sequence and one or both of the first recombinase direct repeat and the second recombinase direct repeat.

16. (a) the inverted packaging sequence comprises a nucleotide position between nucleotide positions corresponding to 119 and 169 of SEQ ID NO:50 or 134 and 154 of SEQ ID NO:50, or comprises a first endpoint therein; (b) the inverted packaging sequence comprises a nucleotide position corresponding to position 144 of SEQ ID NO:50, or comprises a first endpoint thereat; (c) the inverted packaging sequence comprises a nucleotide position between nucleotide positions corresponding to 3175 and 3225 of SEQ ID NO:50 or 3190 and 3210 of SEQ ID NO:50, or comprises a second endpoint therein; (d) the inverted packaging sequence comprises a nucleotide position corresponding to position 3200 of SEQ ID NO:50, or comprises a second endpoint thereat; (e) the inverted packaging sequence comprises a nucleotide position between nucleotide positions corresponding to 455 and 505 of SEQ ID NO:50 or 470 and 490 of SEQ ID NO:50, or comprises a second endpoint therein; and / or (f) the inverted packaging sequence comprises a nucleotide position corresponding to position 480 of SEQ ID NO:50 or comprises a second endpoint thereat; A helper genome, a helper vector, a system, or a method according to any one of claims 8 to 15.

17. The helper genome, helper vector, system or method of any one of claims 1 to 16, wherein the helper genome comprises a nucleic acid sequence encoding the Ad35 fiber knob.

18. The helper genome, helper vector, system, or method of claim 17, wherein the Ad35 fiber knob comprises a mutation that increases affinity for CD46.

19. The Ad35 fiber knob is selected from Ile192Val, Asp207Gly (or Glu207Gly), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His; or each of the mutations Ile192Val, Asp207Gly (or Glu207Gly), Asn217Asp, Thr226Ala, Thr245Ala, Thr254Pro, Ile256Leu, Ile256Val, Arg259Cys, and Arg279His; 19. The helper genome, helper vector, system or method of claim 17 or claim 18, comprising one or more mutations.

20. The helper genome, helper vector, system or method of any one of claims 1 to 19, wherein the helper genome is present in a cell that contains a nucleic acid encoding a recombinase for recombination of the direct repeats.

21. 21. The helper genome, helper vector, system, or method of claim 20, wherein the recombinase is a Flp, Cre, Dre, Vika, or PhiC31 recombinase.

22. (a) the cell is a HEK293 cell; (b) the cell is a HEK293 cell that encodes or expresses Cre recombinase; or (c) the cell is a HEK293 cell encoding or expressing Cre recombinase, and the HEK293 cell encoding or expressing Cre recombinase is a 116 cell; 22. A helper genome, helper vector, system or method according to claim 20 or claim 21.

23. A recombinant recombinase site-flanked adenovirus serotype 35 (Ad35) packaging sequence corresponding to a fragment of SEQ ID NO:50, wherein recombinase direct repeats flank the Ad35 packaging sequence, and the Ad35 packaging sequence has a first endpoint between nucleotide positions corresponding to 136 and 249 of SEQ ID NO:50, and a second endpoint between nucleotide positions corresponding to 377 and 504, or 3175 and 3225 of SEQ ID NO:

50.

24. (a) the first endpoint is between nucleotide positions corresponding to 155 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and the second endpoint is between nucleotide positions corresponding to 392 and 412, or 469 and 489 of SEQ ID NO:50; (b) the first endpoint is between nucleotide positions corresponding to 155 and 171, 161 and 181, 185 and 205, or 214 and 234 of SEQ ID NO:50, and the second endpoint is between nucleotide positions corresponding to 3190 and 3210 of SEQ ID NO:50; (c) the first endpoint is between nucleotide positions corresponding to 155 and 171 of SEQ ID NO:50, and the second endpoint is between nucleotide positions corresponding to 3190 and 3210 of SEQ ID NO:50; (d) the first endpoint is between nucleotide positions corresponding to 161 and 181 of SEQ ID NO:50, and the second endpoint is between nucleotide positions corresponding to 392 and 412 of SEQ ID NO:50; (e) the first endpoint is between nucleotide positions corresponding to 185 and 205 of SEQ ID NO:50, and the second endpoint is between nucleotide positions corresponding to 469 and 489 of SEQ ID NO:50; (f) the first endpoint is between nucleotide positions corresponding to 214 and 234 of SEQ ID NO:50, and the second endpoint is between nucleotide positions corresponding to 392 and 412 of SEQ ID NO:50; (g) the first endpoint is at a nucleotide position corresponding to 161, 162, 171, 172, 195, 196, 224, or 225 of SEQ ID NO:50, and the second endpoint is at a nucleotide position corresponding to 402, 479, or 3200 of SEQ ID NO:50; (h) the first endpoint is at a nucleotide position corresponding to 161 or 162 of SEQ ID NO:50, and the second endpoint is at a nucleotide position corresponding to 3200 of SEQ ID NO:50; (i) the first endpoint is at a nucleotide position corresponding to 171 or 172 of SEQ ID NO:50, and the second endpoint is at a nucleotide position corresponding to 402 of SEQ ID NO:50; (j) the first endpoint is at a nucleotide position corresponding to 195 or 196 of SEQ ID NO:50, and the second endpoint is at a nucleotide position corresponding to 479 of SEQ ID NO:50; or (k) the first endpoint is at a nucleotide position corresponding to 224 or 225 of SEQ ID NO:50, and the second endpoint is at a nucleotide position corresponding to 402 of SEQ ID NO:50; 24. The recombinant packaging sequence of claim 23.

25. 25. The recombinant packaging sequence of claim 23 or 24, wherein the packaging sequence is present in the adenovirus genome and is inverted.

26. The recombinant packaging sequence of claim 25, wherein the packaging sequence is inverted compared to the 5' ITR of the adenoviral genome.

27. A recombinant adenovirus helper genome, comprising: 5'Ad35 inverted repeat (ITR); 3'Ad35 ITR, an inverted sequence containing an Ad35 packaging sequence, the inverted sequence comprises a nucleotide position between nucleotide positions corresponding to 119 and 169 of SEQ ID NO:50, or 134 and 154 of SEQ ID NO:50, or comprises a first endpoint therein; and (i) the inverted sequence comprises a nucleotide position between nucleotide positions corresponding to 3175 and 3225 of SEQ ID NO:50, or 3190 and 3210 of SEQ ID NO:50, or a second endpoint therein; or (ii) the inverted sequence comprises a nucleotide position between nucleotide positions corresponding to 455 and 505 of SEQ ID NO:50, or 470 and 490 of SEQ ID NO:50, or a second endpoint therein.

28. (a) the inverted sequence comprises a nucleotide position corresponding to position 144 of SEQ ID NO:50, or comprises a first endpoint thereat; (b) the inverted sequence comprises a nucleotide position corresponding to position 3200 of SEQ ID NO:50 or comprises a second endpoint thereat; and / or (c) the inverted sequence comprises a nucleotide position corresponding to position 480 of SEQ ID NO:50 or a second endpoint thereat; The recombinant adenoviral vector genome of claim 27.

29. 29. The recombinant adenovirus helper genome of claim 27 or 28, wherein recombinase direct repeats flank the Ad35 packaging sequence.

Images