Polypeptides that interact with peptide tags at their loops or termini and uses thereof

Abstract

The present invention relates to a polypeptide that forms one part of a bipartite linker, where the polypeptide spontaneously forms an isopeptide bond with a peptide tag, which is the second part of the bipartite linker. Nucleic acid molecules encoding the polypeptide, vectors containing the nucleic acid molecules, and host cells containing the vectors and the nucleic acid molecules are also provided. Additionally, kits containing the bipartite linker (i.e., peptide tag and polypeptide binding partner) and / or nucleic acid molecules / vectors are also provided. Methods for producing the polypeptides, as well as uses of the polypeptides of the invention are also provided.

Description

[Technical field]

[0001] In one aspect, the present invention relates to a polypeptide that forms one part of a two-part linker, in which the polypeptide (protein) spontaneously forms an isopeptide bond with a peptide tag, which is the second part of the two-part linker. In particular, a two-part linker can be considered as a cognate pair of a peptide tag and a polypeptide binding partner that can be covalently conjugated when contacted under conditions that allow the spontaneous formation of an isopeptide bond between the polypeptide of the invention and the peptide tag. In a second aspect, the present invention also provides an affinity purification system comprising modified polypeptides (proteins) that selectively (e.g., specifically) and reversibly bind to their cognate peptide tags (ligands), i.e., modified polypeptides (proteins) that do not spontaneously form isopeptide bonds with peptide tags. Nucleic acid molecules encoding these polypeptides, vectors comprising said nucleic acid molecules, and host cells comprising said vectors and said nucleic acid molecules are also provided. Kits comprising said polypeptides (e.g., peptide tags and polypeptide binding partners) and / or nucleic acid molecules / vectors are also provided. Furthermore, products comprising said polypeptides, as well as uses of the polypeptides of the present invention are also provided. [Background technology]

[0002] Cellular function depends on a vast number of reversible non-covalent protein-protein interactions, and the precise arrangement of proteins in complexes influences and determines cellular function. Thus, the ability to engineer covalent protein-protein interactions can provide a wide range of new opportunities in basic research, synthetic biology, and biotechnology. In particular, the conjugation of two or more proteins to form so-called "fusion proteins" can result in molecules with useful characteristics. For example, clustering of one type of protein often results in a greatly enhanced biological signal, e.g., repeated antigen structures in vaccines. Clustering of proteins with different activities can also result in complexes with improved activity, e.g., substrate channeling by enzymes.

[0003] Covalent protein interactions are typically mediated by disulfide bonds, which are reversible, inapplicable to reduced cellular compartments, and can interfere with protein folding. Peptide tags are convenient tools for protein analysis and modification because their small size minimizes disruption of protein function. Peptide tags are easy to genetically encode, and their small size limits disruption due to (i) interference with other interactions, (ii) biosynthetic costs, and (iii) introduction of immunogenicity. However, interactions between peptide tags and their peptide or polypeptide binding partners are rarely high affinity, limiting their usefulness in forming stable complexes.

[0004] Proteins capable of spontaneously forming isopeptide bonds (so-called "isopeptide proteins") have been advantageously used to develop peptide tag / polypeptide binding partner pairs (i.e., two-part linkers) that are covalently linked to each other resulting in an irreversible interaction (see, e.g., U.S. Patent Nos. 5,399,423, 5,443, 5,511,621, 5,625,712, and 5,733,762, all of which are incorporated herein by reference). In this regard, proteins capable of spontaneously forming isopeptide bonds may be expressed as separate fragments, a peptide tag and a polypeptide binding partner for the peptide tag, where the two fragments can be covalently reconstituted by isopeptide bond formation, thereby linking a molecule or component fused to the peptide tag with its polypeptide binding partner.

[0005] An isopeptide bond is an amide bond formed between a carboxyl / carboxamide group and an amino group, where at least one of the carboxyl or amino groups is on the outside of the protein backbone. Such bonds are chemically irreversible under typical biological conditions and are resistant to most proteases. Because isopeptide bonds are essentially covalent bonds, some of the strongest protein interactions measured are mediated by isopeptide bonds. Isopeptide bonds formed between a peptide tag and its polypeptide binding partner are stable under conditions where non-covalent interactions would dissociate quickly, for example, over long periods of time (e.g., weeks), at high temperatures (up to at least 95°C), under high forces, or under conditions involving harsh chemical treatments (e.g., pH 2-11, organic solvents, detergents, or denaturants).

[0006] Briefly, a two-part linker, i.e., a peptide tag and its polypeptide binding partner (so-called peptide tag / binding partner pair), may be derived from a protein (isopeptide protein) capable of spontaneously forming an isopeptide bond, where domains of the protein are expressed separately to produce a peptide tag that contains one residue involved in the isopeptide bond (e.g., aspartate or asparagine) and a peptide or polypeptide binding partner (i.e., a "catcher") that contains the other residue involved in the isopeptide bond (e.g., lysine) and at least one other residue required for the formation of the isopeptide bond (e.g., glutamate). When the peptide tag and the binding partner are mixed, an isopeptide bond is formed spontaneously between the tag and the binding partner. Thus, the peptide tag and the binding partner are separately fused to different molecules or components, e.g., proteins, allowing the molecules or components to be covalently linked via the isopeptide bond formed between the peptide tag and the binding partner, i.e., forming a linker between the molecules or components fused to the peptide tag and the binding partner.

[0007] There are many efficient methods to link proteins at their termini, ranging from classical gene fusion to sophisticated enzymatic ligation and bipartite peptide tag / polypeptide binding partner pairs (i.e., bipartite linkers) as disclosed herein above. Extensive research has been conducted to establish post-translational linkages of protein units, including native chemical ligation, split inteins, sortases, and butelases. However, some of these linking methods are not suitable for ligating proteins at internal sites. For example, split inteins must be at the termini of the protein. Similarly, sortase enzymes are mostly used at the termini of proteins, requiring very high concentrations of oligoglycine reactants. Protein-protein ligation at internal sites, which are more sterically hindered and have fewer accessible chemicals compared to the termini, has received little attention so far. The N- and C-termini of natural proteins are often flexible and exposed, making them easy to react, whereas internal loops can adopt diverse structures, and there are numerous examples where insertion of peptide tags into loops disrupts protein folding and function. Therefore, it is much more difficult to tether proteins at internal sites such as protein loops due to the lower flexibility and more variable environment.

[0008] However, for some applications, it may be necessary or desirable to link proteins at internal sites. There are many proteins that are not amenable to terminal fusion, including proteins with termini that are key to the protein's function (e.g., the proteasome), proteins with termini that are located on the intracellular side of the cell membrane (e.g., the tetraspanins and many ion channels), or proteins that are buried at protein-protein interfaces (e.g., Qβ virus-like particles). Even if termini are available fusion sites, internal fusions, such as loop fusions, may still be preferred to control protein orientation, such as on the surface of diagnostic agents, in multienzyme complexes, or in vaccine conjugates.

[0009] The present inventors have previously developed another bipartite peptide tag / polypeptide binding partner system, known as SpyTag / SpyCatcher, based on the CnaB2 domain of the Streptococcus pyogenes FbaB protein (Zakeri et al., 2012, Proc Natl Acad Sci USA 109, E690-E697). The latest iteration of this system, SpyTag003 / SpyCatcher003, is the pair that has been demonstrated to have the fastest reactivity in terminal protein-protein reactions to date (see US Pat. No. 5,399,363, incorporated herein by reference). However, as shown in the Examples, although SpyTag003 can be inserted into a specific loop region of certain proteins and can react with its cognate partner, SpyCatcher003, the reaction rate was significantly reduced compared to when SpyTag003 was fused to the terminus of the same protein. Moreover, in one particular case, insertion of SpyTag003 into a loop region of a given protein prevented the protein from being expressed at all.

[0010] An alternative system for binding proteins at internal sites can be provided by expressing the domains of an isopeptide protein that constitute the residues involved in isopeptide bond formation separately, i.e., as three separate fragments: two peptides and one polypeptide (see, e.g., Fierer et al. 2014, PNAS E1176-E1181). One such system has been developed by the present inventors based on RrgA (see, e.g., US Pat. No. 5,399,633, incorporated herein by reference). The RrgA protein was split into three separate components: a first peptide tag (called SnoopTagJr) that contains one of the residues involved in isopeptide bond formation (e.g., lysine), a second peptide tag (called DogTag) that contains the other residue involved in isopeptide bond formation (e.g., asparagine), and a polypeptide (called SnoopLigase) that contains the residues involved in mediating isopeptide bond formation (e.g., glutamate). By mixing all three fragments, i.e. both peptides and polypeptide, isopeptide bonds are formed between the two peptides that contain residues that react to form isopeptide bonds, i.e. between SnoopTagJr and DogTag. However, the reaction rate of SnoopLigase is relatively slow (about 48 hours to complete), which limits its application, especially in cellular systems. In addition, the SnoopLigase system is incompatible with certain buffers and requires relatively high concentrations of components, which is not always possible in practical applications, especially in, for example, mammalian expression systems.

[0011] Therefore, there is a need for improved linker systems that can attach proteins at internal sites.

[0012] The peptide tag / binding partner pair (bipartite linker) termed RrgATag / RrgACatcher is derived from the adhesin protein RrgA of Streptococcus pneumoniae, a Gram-positive bacterium that can cause sepsis, pneumonia, and meningitis in humans. A spontaneous isopeptide bond forms between residues Lys742 and Asn854 in the D4 immunoglobulin-like domain of RrgA. This D4 domain has previously been split into a linker pair termed RrgATag (SEQ ID NO: 4) and RrgACatcher (SEQ ID NO: 6) (see US Pat. No. 5,399,234, incorporated herein by reference). RrgATag is derived from residues 838-856 of the RrgA protein and thus contains the Asn854 residue, whereas RrgACatcher (also known as R2Catcher) corresponds to residues 734-837 of the RrgA protein and thus contains the Lys742 residue. Thus, RrgATag (SEQ ID NO: 4) and RrgACatcher (SEQ ID NO: 6) can spontaneously form an isopeptide bond.

[0013] Purified RrgATag and RrgACatcher could be successfully reconstituted and reacted when mixed, but the rate of isopeptide bond formation was relatively slow, especially when the linker was present at a concentration equivalent to the cellular expression level. An engineered version of RrgATag (DogTag, SEQ ID NO: 3) has been shown to reconstitute faster, i.e., form isopeptide bonds with RrgACatcher at a faster rate. RrgATag contains a Thr residue instead of a Gly residue at the position corresponding to position 842 of RrgA. This sequence was further modified by extending the peptide to include residues corresponding to residues 857-860 of RrgA, and replacing the Asp residue corresponding to position 848 in RrgATag with Gly. RrgATag with these two modifications (C-terminal extension and D848G) was designated RrgATag2 (SEQ ID NO: 5). In addition, the Asn residue corresponding to position 847 of RrgA in RrgATag and RrgATag2 was replaced with Asp. RrgATag with all three of these modifications (C-terminal extension, N847D, and D848G) was designated DogTag (SEQ ID NO: 3).

[0014] As shown in the Examples, DogTag showed improved reaction kinetics with RrgACatcher compared to RrgATag and other versions of the tag, such as R2Tag (SEQ ID NO: 17), but still showed slow reaction kinetics at low concentrations. Furthermore, the RrgACatcher polypeptide was observed to have limited solubility under certain conditions. [Prior art documents] [Patent documents]

[0015] [Patent Document 1] International Publication No. 2011 / 098772 [Patent Document 2] International Publication No. 2016 / 193746 [Patent Document 3] International Publication No. 2018 / 197854 [Patent Document 4] International Publication No. 2020 / 183198 [Patent Document 5] International Publication No. 2018 / 189517 Summary of the Invention

[0016] The present inventors have surprisingly found that by modifying (i.e., mutating) the amino acid sequence of an RrgACatcher polypeptide, the reaction rate of the RrgACatcher polypeptide can be increased by at least one order of magnitude, and furthermore, the solubility of the polypeptide in common buffers and conditions can be significantly improved. Remarkably and unexpectedly, these modifications that increase the reaction rate and solubility do not adversely affect other desirable properties of the polypeptide. Thus, the modified RrgACatcher polypeptide of the present invention (referred to as DogCatcher, SEQ ID NO: 1) reacts with DogTag more than one order of magnitude faster than the original RrgACatcher polypeptide, and furthermore, due to its improved solubility, it can be used in a variety of applications under a wide range of conditions.

[0017] Without wishing to be bound by theory, it is hypothesized that of the 10 modifications to the RrgACatcher polypeptide resulting in the DogCatcher polypeptide, 7 (referred to as "solubility modifications") may function independently to increase the solubility of the polypeptide. The sequence of RrgACatcher containing all 7 solubility modifications is referred to as RrgACatcherB or R2CatcherB (SEQ ID NO: 8). It is believed that the remaining 3 modifications (referred to as "reactivity modifications") that distinguish DogCatcher from RrgACatcher may function independently to increase the rate of reaction with DogTag peptide. The sequence of RrgACatcher containing all 3 reactivity modifications is shown in SEQ ID NO: 9. Thus, it is contemplated that each of the solubility and reactivity modifications of the polypeptide of the present invention (DogCatcher (SEQ ID NO: 1) or DogCatcher variant (e.g., SEQ ID NO: 8 or 9)) to the amino acid sequence of RrgACatcher may individually improve the solubility and reactivity of the polypeptide.

[0018] Furthermore, it is contemplated that the polypeptide exemplified herein (i.e., DogCatcher, SEQ ID NO:1) may be truncated at the N-terminus and / or C-terminus without significantly reducing the activity of the polypeptide. In particular, SEQ ID NO:1 may be truncated by up to four amino acids (e.g., 1, 2, 3, or 4 amino acids) at the N-terminus and / or by up to five amino acids (e.g., 1, 2, 3, 4, or 5 amino acids) at the C-terminus.

[0019] Thus, advantageously, the polypeptides (mutated "catchers" or peptide tag binding partners) of the present invention (DogCatcher, SEQ ID NO: 1) may be used with their cognate peptide tags, e.g., DogTag (SEQ ID NO: 3) (i.e., as a two-part linker) in practical applications, e.g., in vivo, where only low concentrations of peptide tags and polypeptide binding partners are available. The polypeptides (peptide tag binding partners) of the present invention may also be particularly useful in analytical assays requiring high sensitivity and / or speed, e.g., Western blots using peptide tags (e.g., DogTag, SEQ ID NO: 3) as epitope tags. The improved rate constants of the mutant catchers (polypeptides) of the present invention are also advantageous in reactions where the tag and / or catcher may slow down the reaction, e.g., reactions where the tag and / or catcher are fused to a large protein, as well as reactions where the molecule or component fused to the tag and / or catcher creates steric hindrance, e.g., virus-like particle formation for vaccine construction.

[0020] In this regard, the inventors noted that the sequence of domain 4 of RrgA (residues 838-860), from which DogTag is derived, forms a β-hairpin including the reactive Asn854 residue, and hypothesized that this may form the basis of a loop-friendly Tag / Catcher pair (i.e. a Tag / Catcher pair capable of binding proteins at internal sites such as protein loops). Surprisingly and advantageously, it was found that DogTag can be inserted into various loop sites in different proteins without disrupting the expression or function of said proteins, and that the reaction rate between the polypeptide of the invention (DogCatcher, SEQ ID NO: 1) and its binding partner (DogTag, SEQ ID NO: 3) is comparable regardless of whether DogTag is inserted into a terminal or internal (e.g. loop) site of the protein. The DogTag / DogCatcher bipartite linker, which includes the polypeptide of the present invention, showed a reaction rate approximately 10 times faster than that of SpyTag003 / SpyCatcher003 when the peptide tag was inserted into a specific protein loop site. As described in more detail in the Examples below, the DogTag / DogCatcher bipartite linker was demonstrated to function when the DogTag was inserted into the interior of a protein that is primarily α-helical, primarily β-sheet, or α+β fold. Furthermore, as a result of the above mutations, the DogCatcher polypeptide is soluble in different buffers, and thus the DogTag / DogCatcher bipartite linker can be used at lower concentrations under various conditions.

[0021] Thus, the polypeptide of the present invention (DogCatcher, SEQ ID NO: 1) forms one part of a two-part linker system that can spontaneously form isopeptide bonds with high kinetics when the peptide tag is inserted internally into a molecule or component of interest, for example, into an internal protein site, such as a loop site. This two-part linker thus provides an improved method of introducing covalent protein ligation between certain proteins, especially when the termini of at least one of these proteins are not optimal sites for fusion.

[0022] In another aspect, the polypeptide of the present invention (DogCatcher, SEQ ID NO:1) in combination with its cognate peptide tag (DogTag, SEQ ID NO:3) provides a two-part linker system that is particularly useful for linking proteins at internal sites such as protein loops.

[0023] Thus, in one aspect, the present invention comprises: i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 and if the amino acid sequence contains a proline at position 75, the amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), where these specified amino acid residues are at positions corresponding to those in SEQ ID NO: 1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 and if the amino acid sequence includes a proline at position 71, the amino acid sequence also includes one or more amino acid residues selected from 1) to 5) and 7) to 9), where these specified amino acid residues are at positions corresponding to those in SEQ ID NO: 2; A polypeptide (peptide tag binding partner) comprising: The present invention provides a polypeptide (peptide tag binding partner) capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0024] In an alternative embodiment, the polypeptide of the invention comprises: i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising: a lysine at position 9, a glutamic acid at position 70, 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) Proline at position 75, and 7) Aspartic acid at position 92 and one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) Proline at position 71, and 6) Aspartic acid at position 88 and one or more of the following: 1) Isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; It may include, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0025] According to another aspect, the present invention comprises: i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 wherein: (A) if the amino acid sequence contains a proline at position 75, the amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10); or (B) the amino acid sequence contains at least one amino acid residue selected from 1) to 5), 7), and 10) and one amino acid residue selected from 6), 8), and 9), where the specified amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 (A) if the amino acid sequence contains a proline at position 71, then the amino acid sequence also contains one or more amino acid residues selected from 1) to 5) and 7) to 9); or (B) the amino acid sequence contains at least one amino acid residue selected from 1) to 4), 6), and 9) and one amino acid residue selected from 5), 7), and 8), where the specified amino acid residues are at positions corresponding to those in SEQ ID NO:2. A polypeptide (peptide tag binding partner) comprising: The present invention provides a polypeptide (peptide tag binding partner) capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0026] In another aspect, the present invention provides a recombinant or synthetic polypeptide comprising a peptide or polypeptide linked to a polypeptide of the present invention.

[0027] In another aspect, the present invention relates to the use of a polypeptide of the present invention for conjugating two molecules or components via an isopeptide bond, comprising: The present invention provides a use, wherein the molecule or component conjugated via an isopeptide bond comprises the following a) and b): a) a first molecule or component comprising a polypeptide of the invention; and b) a second molecule or moiety comprising a peptide selected from (i) and (ii) below: (i) a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17; and (ii) a peptide comprising an amino acid sequence having at least 80% sequence identity to a sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17 (e.g., at least 85%, 90%, or 95% identical to a sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17), the amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11; wherein the peptide is capable of spontaneously forming an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, and the isopeptide bond is formed between the asparagine residue at position 17 of SEQ ID NO:3, 4, 5, or 17 and the lysine residue at position 9 of SEQ ID NO:1.

[0028] In another aspect, the present invention provides a method for conjugating two molecules or moieties via an isopeptide bond, comprising the steps of: a) providing a first molecule or moiety comprising a polypeptide of the invention; b) providing a second molecule or moiety comprising a peptide selected from: (i) a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17; and (ii) a peptide comprising an amino acid sequence having at least 80% sequence identity to a sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17 (e.g., at least 85%, 90%, or 95% identical to a sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17), the amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11; wherein the peptide is capable of spontaneously forming an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3, 4, 5, or 17 and a lysine residue at position 9 of SEQ ID NO:1; and c) contacting said first molecule or component with said second molecule or component under conditions that allow for the spontaneous formation of an isopeptide bond between said polypeptide and said peptide, thereby conjugating said first molecule or component to said second molecule or component via an isopeptide bond to form a complex; The present invention provides a method comprising:

[0029] In yet another aspect, the present invention provides a kit, preferably a kit for use in the use or method of the present invention, comprising: (a) a polypeptide of the invention, optionally conjugated or fused to a molecule or moiety; and (b) a peptide selected from (i) and (ii) below, optionally conjugated or fused to a molecule or moiety: (i) a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17; and (ii) a peptide comprising an amino acid sequence having at least 80% sequence identity to a sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17 (e.g., at least 85%, 90%, or 95% identical to a sequence set forth in any one of SEQ ID NOs: 3 to 5), the amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11;

[0030] wherein the peptide is capable of spontaneously forming an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, the isopeptide bond being formed between the asparagine residue at position 17 of SEQ ID NO:3, 4, 5, or 17 and the lysine residue at position 9 of SEQ ID NO:1; and / or (c) a nucleic acid molecule, particularly a vector, encoding a polypeptide according to (a); and / or (d) a nucleic acid molecule, in particular a vector, encoding a peptide according to (b), A kit is provided, comprising:

[0031] The inventors have previously demonstrated that "catcher" polypeptides can be modified to establish an affinity purification system for their cognate peptide tag (see, for example, WO 2020 / 115252, which is incorporated herein by reference). The system can thus be considered as a two-part system comprising a polypeptide (affinity purification polypeptide) and its cognate peptide tag (affinity tag), which can form a stable and reversible non-covalent complex (i.e., polypeptide:ligand complex) that can be dissociated under appropriate conditions, thereby facilitating the isolation and / or purification of a molecule or component conjugated or fused to the peptide tag (fusion partner).

[0032] Having clarified that the properties of the RrgACatcher polypeptide can be improved by introducing the mutations found in DogCatcher, the present inventors have found the possibility of establishing a DogTag affinity purification system by modifying the above-defined polypeptide. Without wishing to be bound by theory, it is believed that the mutation (803E) of the DogCatcher polypeptide at the position of the activating glutamic acid residue in the D4 domain of RrgA sufficiently abrogates the formation of an isopeptide bond between DogCatcher and DogTag while maintaining a selective, stable, and reversible non-covalent interaction with DogTag.

[0033] Thus, in a further aspect, the present invention comprises i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid (i.e., X at position 70 is any amino acid other than glutamic acid and aspartic acid), and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 and if the amino acid sequence contains a proline at position 75, the amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), where these specified amino acid residues are at positions corresponding to those in SEQ ID NO: 18; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 and if the amino acid sequence includes a proline at position 71, the amino acid sequence also includes one or more amino acid residues selected from 1) to 5) and 7) to 9), where these specified amino acid residues are at positions corresponding to those in SEQ ID NO: 19; A polypeptide (affinity purified polypeptide) comprising: The present invention provides a polypeptide (an affinity purified polypeptide) that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:3.

[0034] In an alternative aspect, the present invention provides a method for producing a composition comprising: i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) Proline at position 75, and 7) Aspartic acid at position 92 and one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) Proline at position 71, and 6) Aspartic acid at position 88 and one or more of the following: 1) Isoleucine at position 65, 2) serine at position 83; 3) Arginine at position 85 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO: 19; A polypeptide (affinity purified polypeptide) comprising: The present invention provides a polypeptide (an affinity purified polypeptide) that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:3.

[0035] According to another aspect, the present invention comprises: i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid (i.e., X at position 70 is any amino acid other than glutamic acid and aspartic acid), and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 wherein (A) if the amino acid sequence contains a proline at position 75, the amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), or (B) the amino acid sequence contains at least one amino acid residue selected from 1) to 5), 7), and 10), and one amino acid residue selected from 6), 8), and 9), an amino acid sequence in which these designated amino acid residues are at positions corresponding to those in SEQ ID NO:18; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 wherein (A) if the amino acid sequence contains a proline at position 71, the amino acid sequence also contains one or more amino acid residues selected from 1) to 5) and 7) to 9), or (B) the amino acid sequence contains at least one amino acid residue selected from 1) to 4), 6), and 9), and one amino acid residue selected from 5), 7), and 8), These designated amino acid residues are at positions corresponding to those in SEQ ID NO: 19, (iii) A part of A polypeptide (affinity purified polypeptide) comprising: The present invention provides a polypeptide (an affinity purified polypeptide) that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:3.

[0036] In a further aspect, the present invention provides a method for purifying or isolating a molecule or component comprising a peptide having an amino acid sequence having at least 80% sequence identity to a sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11, said method comprising: a) providing a solid substrate on which a polypeptide as defined above (affinity purified polypeptide) is immobilized; b) providing a sample containing said molecule or component; c) contacting said solid substrate in a) with said sample in b) under conditions that allow said peptide to selectively bind to said polypeptide, thereby forming a non-covalent complex between said polypeptide immobilized on said solid substrate and a molecule or component that comprises said peptide; d) washing the solid substrate with a buffer; e) separating said molecule or component comprising said peptide from said polypeptide immobilized on said solid substrate; The present invention provides a method comprising:

[0037] In yet another embodiment, the present invention provides the use of a polypeptide (affinity purification polypeptide) as defined above for purifying or isolating a molecule or component comprising a peptide having an amino acid sequence having at least 80% sequence identity to any one of the sequences set forth in SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11.

[0038] In another aspect, the present invention provides a device for use in a method or use as defined above, comprising a solid substrate to which a polypeptide as defined above (affinity purification polypeptide) is immobilized.

[0039] In a further aspect, the present invention relates to a kit for use in the preparation of a solid substrate on which a polypeptide as defined above (affinity purification polypeptide) is immobilized, comprising: a) a polypeptide as defined above (affinity purified polypeptide); and b) means for immobilizing the polypeptide according to a) on a solid substrate; A kit is provided, comprising:

[0040] In a further aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide of the invention or a recombinant or synthetic polypeptide of the invention as defined above.

[0041] In yet another aspect, the present invention provides a vector comprising a nucleic acid molecule of the present invention.

[0042] In another aspect, the present invention provides a cell comprising the nucleic acid molecule or vector of the present invention.

[0043] The present invention also provides a method for producing or expressing a polypeptide or recombinant polypeptide of the present invention, comprising the steps of: a) transforming or transfecting a host cell with a vector of the invention; b) culturing said host cell under conditions allowing expression of said polypeptide, and, optionally, c) isolating said polypeptide; The present invention provides a method comprising:

[0044] Detailed Description As mentioned above, it is contemplated that each of the solubility and reactivity mutations in DogCatcher relative to RrgACatcher may separately and independently improve the solubility and reactivity of the polypeptide. Thus, in some embodiments, the polypeptide comprises: i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 and these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; Including, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0045] In some embodiments, wherein the polypeptide comprises two or more residues selected from 1)-10) above, the polypeptide comprises at least one solubility modification (i.e., at least one of 1)-5), 7) or 10)) and at least one reactivity modification (i.e., at least one of 6), 8) or 9)). Based on the data in Table 1, and without wishing to be bound by theory, it is hypothesized that the presence of a proline residue at position corresponding to position 75 of SEQ ID NO:1 (position corresponding to position 71 of SEQ ID NO:2) has a particularly beneficial effect on the solubility of the polypeptides of the invention. In some embodiments, the polypeptide comprises a proline residue at position corresponding to position 75 of SEQ ID NO:1 (position corresponding to position 71 of SEQ ID NO:2). Thus, the two or more amino acids may be a proline at position 75 of SEQ ID NO:1 and one or more of 1) to 6) and 8) to 10), or a proline at position 71 of SEQ ID NO:2 and one or more of 2) to 6) and 8) to 10) (or 1) to 5) and 7) to 9) using the numbering in part (iv) above). However, any combination of two or more amino acids selected from those listed above is contemplated herein. In some embodiments, the two or more amino acids may be the proline at position 75 of SEQ ID NO:1 and any one or more of 1), 4) and 10), or the proline at position 71 of SEQ ID NO:2 and one or both of 4) and 10) (or 3) or 9) using the numbering in part (iv) above).

[0046] In a further embodiment of the invention, the polypeptide comprises: i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 or an amino acid sequence comprising three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more of the following: iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 wherein the designated amino acid residues are at positions corresponding to positions in SEQ ID NO:2; Including, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0047] In some embodiments, the four or more residues include residues 1), 4), 7), and 10), and optionally one, two, or three of 6), 8), and 9) (using the numbering in part (iii) above).

[0048] As described above, of the 10 modifications made to the RrgACatcher polypeptide (SEQ ID NO: 6) resulting in the DogCatcher polypeptide (SEQ ID NO: 1), seven (referred to as "solubility modifications") are suggested to function to increase the solubility of the polypeptide, and three (referred to as "reactivity modifications") are suggested to function to increase the rate of reaction with the DogTag peptide.

[0049] The seven solubility modifications are, at residues in the original RrgA protein, D737E, N774D, N746T, N780D, K792T, A808P, and N825D. At residues in SEQ ID NO:1, these solubility modifications correspond to the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) Proline at position 75, and 7) Aspartic acid at position 92.

[0050] As mentioned above, the sequence of RrgACatcher comprising all seven solubility modifications is referred to as RrgACatcherB or R2CatcherB (SEQ ID NO: 8). In some embodiments, the polypeptides of the invention may comprise all said solubility modifications, i.e., comprise the amino acid sequence set forth in SEQ ID NO: 8 or a variant amino acid sequence thereof resulting in a functional polypeptide as defined herein, e.g., a variant amino acid sequence capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO: 3. In other words, the polypeptides of the invention may comprise i) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), said amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) Proline at position 75, and 7) Aspartic acid at position 92 all of which are at positions corresponding to those in SEQ ID NO:1; or ii) a portion of (i) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) Proline at position 71, and 6) Aspartic acid at position 88 all of which are at positions corresponding to those in SEQ ID NO:2, It may include, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0051] The three reactive modifications are F802I, A820S, and Q822R at residues in the original RrgA protein. At residues in SEQ ID NO:1, these solubility modifications correspond to the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89.

[0052] As mentioned above, the sequence of RrgACatcher containing all three reactive modifications is shown in SEQ ID NO: 9. In some embodiments, the polypeptides of the invention may contain all said reactive modifications, i.e. may comprise the amino acid sequence set forth in SEQ ID NO: 9 or a variant amino acid sequence thereof that results in a functional polypeptide as defined herein, e.g. a variant amino acid sequence that is capable of spontaneously forming an isopeptide bond under suitable conditions with a peptide comprising the amino acid sequence set forth in SEQ ID NO: 3. In other words, the polypeptides of the invention may comprise i) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), said amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 all of which are at positions corresponding to those in SEQ ID NO:1; or ii) a portion of (i) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 all of which are at positions corresponding to those in SEQ ID NO:2, It may include, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0053] In some embodiments, the polypeptides of the invention comprise a proline residue at a position corresponding to position 75 of SEQ ID NO:1 (position corresponding to position 71 of SEQ ID NO:2). Thus, the polypeptides of the invention may comprise a proline residue at said position and one or more of the reactive modifications described above. In this regard, the polypeptides of the invention may comprise i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, a proline at position 75, and the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) a portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), comprising a lysine at position 5, a glutamic acid at position 66, a proline at position 71, and the following: 1) Isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; It may include, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0054] In a further embodiment, the polypeptide of the invention comprises a proline residue at a position corresponding to position 75 of SEQ ID NO:1, one or more additional solubility modifications, and one or more reactivity modifications. i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising: a lysine at position 9, a glutamic acid at position 70, a proline at position 75, 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, and 6) Aspartic acid at position 92 and one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) a portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), comprising a lysine at position 5, a glutamic acid at position 66, a proline at position 71, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55; and 5) aspartic acid at position 88; and one or more of the following: 1) Isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; It may include, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0055] In a further embodiment, the polypeptide of the invention comprises i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) Proline at position 75, and 7) Aspartic acid at position 92 Two or more, three or more, four or more, five or more, or six or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) Proline at position 71, and 6) Aspartic acid at position 88 Two or more, three or more, four or more, or five or more of the following: 1) Isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 (iii), which comprises one or more (e.g., two or three) of the designated amino acid residues at positions corresponding to those in SEQ ID NO:2; Including, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0056] In some embodiments, the two or more amino acids selected from those listed as solubility modifications may be proline at position 75 of SEQ ID NO:1 and any one or more of 1)-5) and 7) (using the numbering in part (iii) above), or proline at position 71 of SEQ ID NO:2 and any one of 1)-4) and 6) (using the numbering in part (iii) above). However, any combination of two or more amino acids from the above is contemplated herein. In some embodiments, the polypeptide comprises at least a glutamic acid at position 4; an aspartic acid at position 47; a proline at position 75; and an aspartic acid at position 92. In some embodiments, the truncated polypeptide (polypeptide portion) comprises at least an aspartic acid at position 43; a proline at position 71; and an aspartic acid at position 88.

[0057] In some embodiments, the polypeptides of the invention comprise all of the solubility modifications and one or more, e.g., all, of the reactivity modifications. Thus, the polypeptides of the invention comprise: i) the amino acid sequence set forth in SEQ ID NO:1; or ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:1), the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 all of which are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2 (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO:2), the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 and wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; It may include, The polypeptide is capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, the isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:2.

[0058] In a particularly preferred embodiment, all ten amino acids described above with respect to SEQ ID NO:1 (nine with respect to SEQ ID NO:2) that distinguish DogCatcher from RrgACatcher are present in the variant polypeptides of the invention. In embodiments where the polypeptide variants of the invention (i.e. sequence identity related polypeptides and portions thereof) do not contain all of the specified residues, it is typically preferred that the variants contain, at the specified positions, amino acid residues or conservative substitutions thereof at the corresponding positions of the RrgACatcher polypeptide (SEQ ID NO:6). The corresponding positions can be readily determined by comparing the amino acid sequence of the polypeptide variant with SEQ ID NO:6, for example using the BLASTP algorithm.

[0059] Thus, by way of example, in an embodiment in which the polypeptide of the invention comprises an amino acid sequence having at least 80% sequence identity to a sequence defined herein (e.g. as set forth in SEQ ID NO: 1 or 18), if the residue at position 4 (or corresponding position) is not glutamic acid, it is preferably an aspartic acid. Similarly, if the residue at position 11 (or corresponding position) is not aspartic acid, it is preferably an asparagine. If the residue at position 13 (or corresponding position) is not threonine, it is preferably an asparagine. If the residue at position 47 (or corresponding position) is not aspartic acid, it is preferably an asparagine. If the residue at position 59 (or corresponding position) is not threonine, it is preferably a lysine. If the residue at position 69 (or corresponding position) is not isoleucine, it is preferably a phenylalanine. If the residue at position 75 (or corresponding position) is not proline, it is preferably an alanine. If the residue at position 87 (or corresponding position) is not serine, it is preferably an alanine. If the residue at position 89 (or corresponding position) is not arginine, it is preferably a glutamine. If the residue at position 92 (or corresponding position) is not aspartic acid, it is preferably an asparagine. Similarly for the other residues specified below.

[0060] However, in some embodiments, if the residue at position 87 (or a corresponding position) is not a serine, it is preferred that the residue is a glutamic acid. As shown in Figure 9 below, a glutamic acid residue at this position may further improve the solubility of the polypeptide. Thus, in some embodiments, the polypeptide contains only two "reactive" modifications, an isoleucine at position 69 (or a corresponding position) and an arginine at position 89 (or a corresponding position), and a glutamic acid at position 87 (or a corresponding position).

[0061] In some embodiments, the polypeptide variant of the present invention may differ from SEQ ID NO: 1 or 18, and the difference may be, for example, a substitution, insertion, and / or deletion of 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, for example, 1, 2, or 3 amino acids, and preferably a substitution of 1 to 21, 1 to 20, 1 to 15, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, for example, 1, 2 to 3 amino acids and / or a deletion of 1 to 15, 1 to 10, 1 to 9, 1 to 8, 1 to 6, 1 to 5, 1 to 4, for example, 1, 2, or 3 amino acids. As described below, in some embodiments, deletions are preferably at the N-terminus and / or C-terminus, i.e., truncations, thereby generating portions of the polypeptide of SEQ ID NO:1 as defined above, e.g., SEQ ID NO:2 or 19.

[0062] In some embodiments, any mutation present in the polypeptide of the invention relative to the exemplary polypeptide (e.g., SEQ ID NO: 1 or 18) may be a conservative amino acid substitution. A conservative amino acid substitution refers to the replacement of an amino acid with another amino acid that preserves the physicochemical properties of the polypeptide (e.g., D may be replaced with E or vice versa, N may be replaced with Q or L or I with V or vice versa). Thus, in general, the substituting amino acid has similar properties as the amino acid being substituted, such as similar hydrophobicity, hydrophilicity, electronegativity, bulky side chain, etc. Isomers of native L-amino acids may be incorporated, such as D-amino acids.

[0063] Thus, in some embodiments where a polypeptide variant of the invention does not contain all of the specified residues and those further specified below (i.e. all of the mutations in SEQ ID NO: 1 or 18 compared to SEQ ID NO: 6), said variant may comprise a conservative substitution of the amino acid residue at the corresponding position of the RrgACatcher peptide (SEQ ID NO: 6) at the positions specified herein, and in particular at the positions specified below. Thus, for example, if the residue at position 69 (or a corresponding position) is not an isoleucine or phenylalanine, then that residue is preferably a conservative substitution for the residue at the corresponding position in SEQ ID NO: 1, 6 or 18, e.g. a leucine.

[0064] The term "linker" as used herein refers to a molecule that functions to link, i.e., conjugate or bind, two molecules or components, preferably by a covalent bond, for example, an isopeptide bond. Thus, the polypeptide (peptide tag binding partner) of the present invention and its peptide tag may be considered as a two-part linker, where the formation of an isopeptide bond between the first part, i.e., the polypeptide, and the second part, i.e., the peptide tag, reconstitutes the linker, thereby connecting the molecules or components fused or conjugated to the first part and the second part of the linker. In other words, the polypeptide (peptide tag binding partner) of the present invention and its peptide tag may be considered as a cognate pair that functions as a linker, i.e., a cognate pair of a peptide tag and a polypeptide, or a cognate pair of a peptide tag and a binding partner. These terms are used interchangeably throughout the description.

[0065] The term "cognate" refers to components that function together or interact specifically. Thus, in the context of the present invention, a cognate pair can refer to a peptide tag and a polypeptide of the present invention (peptide tag binding partner) that react with each other spontaneously to form an isopeptide bond. Thus, a two-part linker that includes a peptide tag and a polypeptide that react with each other efficiently to form an isopeptide bond under conditions that allow the spontaneous formation of an isopeptide bond can also be referred to as a "complementary pair", i.e., a complementary pair of a peptide tag and a polypeptide.

[0066] In some embodiments, a cognate pair refers to a peptide tag (i.e., a DogTag or a variant thereof) and a polypeptide of the present invention (an affinity purification polypeptide) that are non-covalently bound to form a complex (i.e., a polypeptide:peptide tag complex).

[0067] Thus, in some embodiments, a cognate peptide tag refers to a DogTag peptide or a variant thereof, such as RrgATag or RrgATag2 (e.g., a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3-5 and 17), with which a polypeptide of the invention spontaneously reacts to form an isopeptide bond. In some embodiments, the cognate peptide tag may be a peptide that comprises an amino acid sequence having at least 80% (e.g., at least 85%, 90%, or 95%) sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 3-5 and 17, and that can spontaneously form an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, for example, between an asparagine in the cognate peptide tag (i.e., an asparagine at a position corresponding to position 17 in any one of SEQ ID NOs: 3-5 and 17) and the lysine residue at position 9 of SEQ ID NO:1.

[0068] In some embodiments, a cognate peptide tag refers to a peptide tag as defined herein (e.g., a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17) to which a polypeptide of the invention (an affinity purification polypeptide) can selectively (e.g., specifically) and reversibly bind.

[0069] Thus, in some preferred embodiments, the peptide tag comprises or consists of an amino acid sequence set forth in SEQ ID NO: 3, 4, 5, or 17, or an amino acid sequence having at least 80% sequence identity to the sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17 (e.g., at least 85%, 90%, or 95% identical to the sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17), comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11. Thus, in some embodiments, the peptide tag comprises or consists of an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO: 3 (e.g., at least 85%, 90%, or 95% identical to the sequence set forth in SEQ ID NO: 3), comprising a threonine residue at position 5, an aspartic acid residue at position 10, a glycine residue at position 11, and an asparagine residue at position 17.

[0070] Thus, the present invention further provides a two-part linker comprising a peptide (peptide tag) and a polypeptide (peptide tag binding partner), a) said polypeptide (peptide tag binding partner) comprises an amino acid sequence as defined above (i.e. SEQ ID NO: 1 or a variant thereof), b) said peptide (peptide tag) comprises an amino acid sequence as defined above (e.g., the amino acid sequence set forth in SEQ ID NO: 3, 4, or 5 or a variant thereof); A two-part linker is provided that allows the peptide (peptide tag) and the polypeptide (peptide tag binding partner) to spontaneously form an isopeptide bond between an asparagine residue in the peptide tag (e.g., position 17 of SEQ ID NO: 3, 4, or 5) and a lysine residue at position 9 of SEQ ID NO: 1.

[0071] The lysine residue at position 9 of the polypeptide (peptide tag binding partner) of the present invention (e.g., SEQ ID NO: 1) spontaneously forms an isopeptide bond with the asparagine residue at position 17 of SEQ ID NO: 3, 4, 5, or 17 under various conditions, including the conditions described below that are suitable for the formation of an isopeptide bond between the peptide tag and the polypeptide (peptide tag binding partner). The examples described below clearly show that the polypeptide (peptide tag binding partner) of the present invention is active under various conditions and can react with various peptide tags (specifically, SEQ ID NOs: 3 to 5).

[0072] For example, the polypeptide (peptide tag binding partner) is active (i.e., can spontaneously form an isopeptide bond with the peptide tag, as described herein) in a variety of buffers, including phosphate buffered saline (PBS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), HEPES buffered saline (HBS), Tris (tris(hydroxymethyl)aminomethane), and Tris buffered saline (TBS), with or without EDTA. The polypeptide (peptide tag binding partner) exhibits activity at a pH of about 5.5-11.0, such as a pH of 5.5-10.0, 6.0-9.5, 6.0-8.5 or 6.5-9.0, and at a wide range of temperatures, such as 0°C to 40°C, such as 1°C, 2°C, 3°C, 4°C, 5°C, 10°C, 12°C, 15°C, 18°C, 20°C, 22°C, 25°C, 28°C, 30°C, 35°C, or 37°C, preferably at about 25°C to 35°C, such as about 25°C. The polypeptide (peptide tag binding partner) of the present invention also exhibits activity in the presence of commonly used detergents, such as Tween 20 and Triton X-100, at concentrations up to about 1% (v / v), and in the presence of a reducing agent, such as dithiothreitol (DTT). Other suitable conditions can be readily determined by one skilled in the art.

[0073] Thus, in some embodiments, conditions suitable for the formation of an isopeptide bond between a polypeptide of the invention (peptide tag binding partner) and a cognate peptide tag (e.g., a peptide comprising or consisting of an amino acid sequence as set forth in SEQ ID NOs: 3 to 5) include any conditions under which contacting the peptide tag with a polypeptide of the invention (peptide tag binding partner) results in the spontaneous formation of an isopeptide bond between the peptide tag and the polypeptide (peptide tag binding partner), in particular between the asparagine residue at position 17 of SEQ ID NOs: 3, 4, or 5 and the lysine residue at position 9 (or a corresponding position) of SEQ ID NO: 1. For example, the peptide tag and the polypeptide (peptide tag binding partner) can be contacted under buffer conditions, e.g., in a buffer or on a solid phase (e.g., a column) that has been equilibrated with a buffer, such as PBS. The contact step may be carried out at any suitable pH, and suitable pH values ​​include about pH 5.5 to 11.0, for example, pH 5.5 to 10.0, such as about pH 5.6, 5.8, 6.0, 6.2, 6.4, 6.6, 6.8, 7.0, 7.2, 7.4, 7.6, 7.8, 8.0, 8.2, 8.4, 8.6, 8.8, 9.0, 9.2, 9.4, or 9.6. Additionally or alternatively, the contact step may be carried out at any suitable temperature, and a suitable temperature is about 0°C to 40°C, for example, about 1°C to 39°C, 2°C to 38°C, 3°C to 37°C, 4°C to 36°C, 5°C to 35°C, 6°C to 34°C, 7°C to 33°C, 8°C to 32°C, 9°C to 31°C, or 10°C to 30°C, for example, about 10°C, 12°C, 15°C, 18°C, 20°C, 22°C, 25°C, 28°C, 30°C, 33°C, 35°C, or 37°C, preferably about 25°C to 35°C, for example, about 25°C.

[0074] As mentioned above, the formation of an isopeptide bond between a peptide tag described herein and a polypeptide of the invention (peptide tag binding partner) is spontaneous. In this regard, the polypeptide (peptide tag binding partner) comprises a glutamic acid at position 70 (or a corresponding position, based on the numbering of SEQ ID NO: 1) that facilitates, e.g., induces, promotes, or catalyzes the formation of an isopeptide bond between an asparagine residue and a lysine residue contained in the peptide tag and the polypeptide (peptide tag binding partner), respectively.

[0075] The term "spontaneous" as used herein refers to an isopeptide bond that can form in a protein or between peptides or proteins (e.g., between two peptides or between a peptide and a protein, i.e., between the peptide tag and a polypeptide of the invention (peptide tag binding partner)) without the presence of other agents (e.g., enzyme catalysts) and / or without chemical modification of the protein or peptide, e.g., native chemical ligation or chemical coupling using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). Thus, no native chemical ligation is performed to modify peptides or proteins bearing C-terminal thioesters.

[0076] Thus, spontaneous isopeptide bonds can form between a peptide tag as defined herein and a polypeptide of the invention (peptide tag binding partner) in the separate presence and absence of chemical modification of the peptide tag and / or the polypeptide of the invention. Thus, spontaneous isopeptide bonds can form spontaneously in the absence of enzymes or other exogenous substances and in the absence of chemical modification of the peptide tag and / or the polypeptide of the invention. Spontaneous isopeptide bonds can form almost immediately after contact of the peptide tag with a polypeptide of the invention (peptide tag binding partner), e.g., within 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, or 30 minutes, or within 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours.

[0077] The rate of isopeptide formation will depend on the concentrations of the peptide tag reactants and the polypeptide reactants and the reaction conditions, e.g., temperature, etc. In some embodiments, for example, when each reactant is present at a concentration of about 5 μM at a reaction temperature of about 25° C., spontaneous isopeptide bond formation can be completed within about 20 minutes for about 80% or more of the reactants.

[0078] From another perspective, in some embodiments, spontaneous isopeptide bond formation can be completed within about 20 minutes for about 80% or more of the reactants, for example, when each reactant is present at a concentration of about μM at a reaction temperature of about 25° C.

[0079] Other reaction conditions, e.g., buffer, pH, etc., used to determine the rate of the above-defined reaction may be any of those defined herein. In some embodiments, the reaction conditions are those used in the Examples. For example, in some embodiments, spontaneous isopeptide bond formation is complete in PBS buffer at a pH of about 7.5 in the amounts specified above.

[0080] The polypeptides of the invention encompass mutant forms (i.e., referred to herein as homologs, variants, or derivatives) of polypeptides (i.e., peptide tag binding partners or affinity purification polypeptides) that are structurally similar to the exemplary polypeptides set forth in SEQ ID NOs: 1 and 18. The polypeptide (peptide tag binding partner) variants of the invention are capable of functioning as peptide tag binding partners (catchers), i.e., spontaneously forming an isopeptide bond between an asparagine at position 17 (or a corresponding position) of a peptide tag as defined herein and a lysine at position 9 (or a corresponding position) of the polypeptide (peptide tag binding partner) variant under suitable conditions as defined above. The affinity purification polypeptide variants of the invention are capable of selectively and reversibly binding to their cognate peptide tags under suitable conditions as defined herein.

[0081] Where a polypeptide variant contains a mutation, e.g., a deletion or insertion, relative to SEQ ID NO: 1 or 18, the above-specified residues are present at the corresponding amino acid positions in the variant polypeptide sequence. In some embodiments, deletions in polypeptide variants of the invention are not N-terminal and / or C-terminal truncations.

[0082] However, as discussed above, it is contemplated that the exemplary polypeptides herein (e.g., SEQ ID NO: 1 or 18) may be truncated at the N-terminus and / or C-terminus without significantly reducing the activity or function of the polypeptide. In particular, SEQ ID NO: 1 or 18 may be truncated at the N-terminus by up to four amino acids (e.g., 1, 2, 3, or 4 amino acids) and / or at the C-terminus by up to five amino acids (e.g., 1, 2, 3, 4, or 5 amino acids). Thus, the term variant as used herein includes truncation variants of the exemplary polypeptides. In another aspect, the present invention may be considered to provide a portion of the exemplary polypeptide, said portion comprising the amino acid sequence set forth in SEQ ID NO: 2 or 19 or a variant thereof, as discussed above.

[0083] A "portion" as referred to herein comprises, for example, at least the amino acid sequence as set forth in SEQ ID NO: 2 or 19, i.e. at least 95, 96, 97, 98, 99, 100, 101, 102 or 103 amino acids in SEQ ID NO: 1 or 18 (the sequence from which said portion is derived) which comprises the amino acid sequence as set forth in SEQ ID NO: 2. Said portion may thus be obtained from the central portion or from the N-terminal or C-terminal portion of said sequence. Said portion is preferably obtained from the central portion, i.e. said portion comprises an N-terminal truncation and / or a C-terminal truncation as defined above. Of note, a "portion" as referred to herein is a polypeptide of the invention and therefore fulfils the conditions of identity (for the region to be compared) and of functional equivalence as referred to herein.

[0084] In some embodiments, peptide tags for use with the polypeptides of the invention may be variants of the sequences described herein, said peptide tags may differ, for example, from SEQ ID NOs: 3 to 5 by substitutions, insertions and / or deletions, preferably substitutions, of 1-5, 1-4, e.g., 1, 2-3 amino acids, e.g., as defined above. In some embodiments, polypeptide variants of the invention may differ, for example, from SEQ ID NOs: 1 or 18, e.g., as defined above. However, said peptides and polypeptide variants must retain their functional activity, e.g., their ability to spontaneously form isopeptide bonds with their cognate binding partners and peptides, respectively, or their ability to form complexes (i.e., polypeptide:peptide tag complexes).

[0085] Sequence identity may be determined by any suitable means known in the art, for example, using the SWISS-PROT protein sequence databank using FASTA pep-cmp with variable pamfactor, gap creation penalty set to 12.0, gap extension penalty set to 4.0, and window of 2 amino acids. Other programs for determining amino acid sequence identity include the BestFit program in the version 10 software package of the University of Wisconsin Genetics Computer Group (GCG). This program uses the Smith-Waterman local homology algorithm with default values ​​of gap creation penalty=8, gap extension penalty=2, average match=2.912, average mismatch=-2.003.

[0086] The comparison is preferably performed over the entire length of the sequences, but may be performed over a smaller comparison window, for example, less than 100, less than 80, or less than 50 contiguous amino acids.

[0087] Said peptide tag and polypeptide (peptide tag binding partner) variants (e.g., sequence identity related variants) are preferably functionally equivalent to the peptide tag and polypeptide (peptide tag binding partner) having the sequences set forth in SEQ ID NOs: 3 to 5 or SEQ ID NO: 1 or 2, respectively. As referred to herein, "functional equivalence" refers to variants of the peptide tag as defined herein and the polypeptide (peptide tag binding partner) of the invention described above, which may show some reduction in the efficacy of spontaneous formation of isopeptide bonds with their respective partners (e.g., lower expression yield, lower reaction rate, or activity in a limited range of reaction conditions (e.g., a narrower temperature range, such as 10°C to 30°C)) compared to the parent molecule (i.e., the molecule to which said variant shows sequence homology), but preferably shows the same efficacy or higher efficacy.

[0088] A mutant or variant peptide tag having an activity "equivalent" to that of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5 may have an activity similar to (i.e., comparable to) that of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5, i.e., an activity that does not significantly affect the practical application of the peptide tag, e.g., within the range of experimental error. Thus, equivalent peptide tag activity means that a mutant or variant peptide tag can spontaneously form an isopeptide bond with a polypeptide (a peptide tag binding partner, e.g., comprising or consisting of an amino acid sequence set forth in SEQ ID NOs: 1 or 2) under the same conditions with a reaction rate (i.e., rate constant as described below) and / or yield similar to that of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5.

[0089] Similarly, a mutant or variant polypeptide of the invention having an activity "equivalent" to that of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19 (preferably SEQ ID NO: 1 or 18) may have functional properties (e.g., solubility and / or activity (e.g., reactivity or affinity)) similar to (i.e., comparable to) the activity of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19 (preferably SEQ ID NO: 1 or 18), i.e., an activity that does not significantly affect the practical application of the peptide tag, e.g., within experimental error.

[0090] Thus, in some embodiments, equivalent polypeptide (peptide tag binding partner) activity or function means that a mutant or variant polypeptide (peptide tag binding partner) of the invention can spontaneously form an isopeptide bond with a peptide tag (e.g., comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5) with a reaction rate (i.e., rate constant as described below) and / or yield similar to a polypeptide (peptide tag binding partner) comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 1 or 2 (preferably SEQ ID NO: 1) under identical conditions.

[0091] In some embodiments, equivalent polypeptide function means that a mutant or variant polypeptide (e.g., peptide tag binding partner) of the invention has similar solubility properties under the same conditions as a polypeptide (peptide tag binding partner) that comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19 (preferably, SEQ ID NO: 1 or 18). Of note, in some embodiments, an equivalent polypeptide having similar solubility properties to a polypeptide (peptide tag binding partner) that comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 or 2 (preferably, SEQ ID NO: 1) must also be capable of spontaneously forming an isopeptide bond with a peptide tag (e.g., that comprises or consists of the amino acid sequence set forth in one of SEQ ID NOs: 3 to 5) as defined herein. Preferably, an equivalent polypeptide has similar solubility, reaction rate, and / or yield under the same conditions as a polypeptide (peptide tag binding partner) that comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 or 2 (preferably, SEQ ID NO: 1).

[0092] In some embodiments, an equivalent polypeptide having similar solubility properties as a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 18 or 19 (preferably SEQ ID NO: 18) (affinity purified polypeptide) should also be capable of selectively and reversibly binding to its cognate peptide tag under suitable conditions as defined herein. Preferably, the equivalent polypeptide has a similar solubility, binding affinity, and / or yield under the same conditions as a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 18 or 19 (preferably SEQ ID NO: 18) (affinity purified polypeptide).

[0093] It is therefore understood that the mutant or variant polypeptides of the present invention may have a solubility similar to (i.e., comparable to) that of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19 (preferably SEQ ID NO: 1 or 18), i.e., an activity that does not significantly affect the practical application of the peptide tag, e.g., within experimental error.

[0094] The activities of different peptide tags and polypeptides (e.g., SEQ ID NO:3 versus mutants, and SEQ ID NO:1 versus mutants, respectively) measured under identical reaction conditions, e.g., temperature, substrate (i.e., peptide tag or polypeptide sequence) and their concentrations, buffers, salts, etc., as exemplified above, can be readily compared to determine whether the activity is higher, lower, or equal for each peptide tag and polypeptide.

[0095] In particular, the peptide tag variants and polypeptide variants of the invention defined herein may have a rate constant equal to the peptide tag and polypeptide having the sequence set forth in SEQ ID NOs: 3 to 5 or SEQ ID NO: 1 or 2, respectively. The rate constant refers to the proportionality coefficient relating the rate of reaction (formation of isopeptide bonds) at a given temperature to the product of the concentrations of the reactants (i.e. the product of the concentrations of the peptide tag and the polypeptide of the invention).

[0096] Thus, the activity, e.g., rate constant, of a variant (e.g., mutated) peptide tag disclosed herein may be at least 60%, e.g., at least 70%, 75%, 80%, 85%, or 90%, of the activity, e.g., rate constant, of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5, and may be at least 91%, 92%, 93%, 94%, or 95%, etc., of the activity of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5. In another aspect, the activity, e.g., the rate constant, of the mutant peptide tag may be 40% or less lower than the activity, e.g., the rate constant, of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5, e.g., 35%, 30%, 25%, or 20% or less lower than the activity, e.g., the rate constant, of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5, and may be 10%, 9%, 8%, 7%, 6%, or 5% or less lower than the activity, e.g., the rate constant, of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5.

[0097] Similarly, the activity, e.g., rate constant, of a variant polypeptide (peptide tag binding partner) of the invention may be at least 60% of the activity, e.g., rate constant, of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1 or 2, e.g., at least 70%, 75%, 80%, 85%, or 90%, and may be at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, etc. of the activity, e.g., rate constant, of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1 or 2. In another aspect, the activity of the variant polypeptide may be 40% or less lower than the activity, e.g., the rate constant, of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1 or 2, e.g., 35%, 30%, 25%, or 20% or less lower than the activity, e.g., the rate constant, of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1 or 2, or 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% or less lower than the activity, e.g., the rate constant, of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1 or 2.

[0098] Furthermore, the solubility of the variant polypeptides of the invention may be at least 60%, such as at least 70%, 75%, 80%, 85%, or 90%, of the solubility of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1, 2, 18, or 19, when measured under the same conditions, e.g., the same buffer, temperature, pH, etc., and may be at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, etc., of the solubility of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:1 or 2. In another aspect, the solubility of the variant polypeptide may be 40% or less lower than that of a polypeptide comprising or consisting of an amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19, when measured under the same conditions, e.g., the same buffer, temperature, pH, etc., e.g., 35%, 30%, 25%, or 20% or less lower than that of a polypeptide comprising or consisting of an amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19, e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% or less lower than that of a polypeptide comprising or consisting of an amino acid sequence set forth in SEQ ID NO: 1, 2, 18, or 19. The solubility of the polypeptide may be measured using any suitable means known in the art. For example, as shown in the Examples, the solubility may be measured by determining the yield of soluble protein obtained from expression in a suitable host cell, e.g., E. coli, under the specified conditions. In yet another representative example, the relative solubility of a protein may be measured using a spin concentrator, in which a protein solution is concentrated until protein aggregation occurs, and the relative solubility of the protein may be determined using the aggregation point.

[0099] It should be noted that the rate constant of the reaction between the peptide tag disclosed herein and the polypeptide of the present invention may be lower than that described in the Examples, because the peptide tag and / or polypeptide may diffuse more slowly than the isolated peptide tag and polypeptide when fused to a large molecule or component (e.g., a protein). Furthermore, the rate constant may be lowered if the molecule or component to which the peptide tag and / or polypeptide is fused causes steric hindrance to the reaction. Therefore, when measuring the rate constant of the reaction between the peptide tag variant disclosed herein and the polypeptide variant of the present invention, it is preferable to perform the measurement using isolated peptide tags and polypeptides, i.e., peptide tags and polypeptides that are not fused or conjugated to other molecules or components.

[0100] However, as shown in the Examples, it is often convenient to measure the kinetic constants of the reactions of the polypeptide variants of the invention using peptide tags fused to the polypeptides. Thus, when measuring and comparing the kinetic constants of different polypeptide variants using peptide tags fused to the polypeptides, it is preferred that the polypeptides fused to the peptide tags are the same size, and preferably have the same sequence, in all reactions.

[0101] It will be apparent that fusion to larger molecules or moieties and / or steric hindrance will also affect the kinetic constants of other peptide tags and polypeptides, e.g., RrgATag, RrgATag2, and RrgACatcher. Thus, improved kinetic constants of the polypeptides of the invention may be advantageous not only when the polypeptides of the invention and their cognate peptide tags are used at low concentrations, but also when used at high concentrations, such as at least about 10 μM (e.g., when fused to larger molecules or moieties).

[0102] Reaction rates and rate constants can be assessed by any suitable means known in the art, such as those described in the Examples and in WO 2018 / 197854 (herein incorporated by reference). For example, reaction rates can be monitored (i) by boiling in SDS or other strong denaturing treatments that would disrupt any non-covalent interactions, followed by assessing the mobility of reaction products on SDS-PAGE, or (ii) by mass spectrometry.

[0103] Thus, any modification or any combination of modifications may be made to SEQ ID NO:1 to produce a variant polypeptide (peptide tag binding partner) of the invention, provided that the variant polypeptide (peptide tag binding partner) comprises a lysine residue at the position corresponding to position 9 of SEQ ID NO:1, a glutamic acid residue at the position corresponding to position 70 of SEQ ID NO:1, and at least one (preferably two or more) other amino acid residues at positions corresponding to 4, 11, 13, 47, 59, 69, 75, 87, 89, and 92 of SEQ ID NO:1, as defined above (wherein said at least one amino acid is proline at position 75, said amino acid sequence comprises a lysine residue at the position corresponding to position 9 of SEQ ID NO:1, a glutamic acid residue at the position corresponding to position 70 of SEQ ID NO:1, and at least one (preferably two or more) other amino acid residues at positions corresponding to positions 4, 11, 13, 47, 59, 69, 75, 87, 89, and 92 of SEQ ID NO:1, as defined above). 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 47, 59, 69, 87, 89, and 92), and provided that it retains the functional properties defined above, i.e. a polypeptide (peptide tag binding partner) that is capable of spontaneously forming an isopeptide bond with a peptide tag comprising or consisting of an amino acid sequence as set forth in one of SEQ ID NOs: 3 to 5, and optionally has a comparable or better yield, reaction rate, e.g. rate constant, solubility, resistance to temperature changes, and / or buffer range, compared to a polypeptide (peptide tag binding partner) having an amino acid sequence as set forth in SEQ ID NO: 1.

[0104] In some further embodiments, the variant polypeptide of the invention comprises the residues specified above and retains the functional properties defined above, i.e., is capable of spontaneously forming an isopeptide bond with a peptide tag (peptide tag binding partner) comprising or consisting of an amino acid sequence set forth in one of SEQ ID NO: 3 to 5, and optionally has comparable or better yields, reaction rates, e.g., rate constants, solubility, resistance to temperature changes, and / or buffer ranges, compared to a polypeptide (peptide tag binding partner) having the amino acid sequence set forth in SEQ ID NO: 1.

[0105] In another aspect, any modification or any combination of modifications (preferably substitutions) may be made to SEQ ID NO:2 to produce a variant polypeptide (peptide tag binding partner) of the invention, which comprises a lysine residue at a position corresponding to position 5 of SEQ ID NO:2, a glutamic acid residue at a position corresponding to position 66 of SEQ ID NO:2, and at least one (preferably two or more) other amino acid residues at positions corresponding to positions 7, 9, 43, 55, 65, 71, 83, 85, and 88 of SEQ ID NO:2, as defined above (wherein said at least one amino acid is proline at position 71, said amino acid sequence also ... as defined above), a glutamic acid residue at a position corresponding to position 66 of SEQ ID NO:2, and at least one (preferably two or more) other amino acid residues at positions corresponding to positions 7, 9, 43, 55, 65, 71, 83, 85, and 88 of SEQ ID NO:2, as defined above). 3 to 5) and optionally with the proviso that it retains the functional properties defined above, i.e. a polypeptide (peptide tag binding partner) capable of spontaneously forming an isopeptide bond with a peptide tag comprising or consisting of an amino acid sequence as set forth in one of SEQ ID NOs: 3 to 5, and optionally with a comparable or better yield, reaction rate, e.g. rate constant, solubility, resistance to temperature changes, and / or buffer range, compared to a polypeptide (peptide tag binding partner) having an amino acid sequence as set forth in SEQ ID NO: 2.

[0106] In some further embodiments, the truncated variant polypeptides of the invention comprise the residues specified above and retain the functional properties defined above, i.e. are capable of spontaneously forming an isopeptide bond with a peptide tag comprising or consisting of an amino acid sequence as set forth in one of SEQ ID NOs: 3 to 5 (peptide tag binding partner), optionally with comparable or higher yields, reaction rates, e.g. rate constants, solubility, resistance to temperature changes and / or buffer ranges, compared to a polypeptide having the amino acid sequence as set forth in SEQ ID NO: 2 (peptide tag binding partner).

[0107] The corresponding positions in the peptide tags disclosed herein are preferably determined by reference to the amino acid sequence of SEQ ID NO: 3. The corresponding positions in the polypeptides (peptide tag binding partners) of the present invention are determined by reference to the amino acid sequence of SEQ ID NO: 1 or 2. Homologous or corresponding positions can be easily inferred by aligning the sequence of a homologous (mutant, variant, or derivative) peptide tag with the sequence of SEQ ID NO: 3, or the sequence of a homologous (mutant, variant, or derivative) polypeptide (peptide tag binding partner) with the sequence of SEQ ID NO: 1 or 2, based on homology or identity between the sequences, for example using the BLAST algorithm.

[0108] As used herein, the terms "tag" and "peptide tag" generally refer to a peptide or oligopeptide.

[0109] As used herein, the terms "peptide tag binding partner," "binding partner," or "catcher" generally refer to a polypeptide or protein.

[0110] In this regard, there is no standard definition of the size boundaries of peptides and polypeptides. Typically, a peptide may be considered to contain between 2 and 39 amino acids. Thus, a polypeptide may be considered to contain at least 40 amino acids, preferably at least 50, 60, 70, 80, 90, or 100 amino acids.

[0111] Thus, in a preferred embodiment, a peptide tag as defined herein may be considered to comprise at least 12 amino acids, e.g., 12-39 amino acids, e.g., 13-35, 14-34, 15-33, 16-31, 17-30 amino acids in length, etc., and for example, the peptide tag may comprise or consist of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 amino acids.

[0112] A polypeptide of the invention as defined herein (e.g., a peptide tag binding partner, binding partner or "catcher," or affinity purification polypeptide) may be considered to comprise at least 95 amino acids, e.g., from 95 to 150 amino acids, e.g., from 95 to 140, 95 to 130, 95 to 120 amino acids in length, etc., e.g., the polypeptide may comprise or consist of 95, 96, 97, 98, 99, 100, 101, 102, 103, or 104 amino acids.

[0113] As mentioned above, two-part linkers (e.g., tag and catcher systems or pairs, i.e., cognate pairs) have numerous utilities, and the polypeptides (peptide tag binding partners) of the present invention and their cognate peptide tags (e.g., SEQ ID NOs: 3 to 5) are particularly useful in conjugating (i.e., binding or linking) two molecules or components via an isopeptide bond. For example, the peptide tag and the polypeptide (peptide tag binding partner) can be separately conjugated or fused to a molecule or component of interest, and then contacted under conditions suitable to allow spontaneous formation of an isopeptide bond between the peptide tag and the polypeptide (peptide tag binding partner), thereby linking (i.e., linking or conjugating) the molecule or component of interest via an isopeptide bond.

[0114] Thus, in some embodiments the invention may be viewed as providing the use of a pair of a peptide (peptide tag) and a polypeptide (peptide tag binding partner) as defined herein for conjugating two molecules or components via an isopeptide bond, The molecule or moiety that is conjugated via an isopeptide bond is a) a first molecule or moiety comprising (e.g. conjugated or fused to) a polypeptide of the invention (peptide tag binding partner) as defined herein; and b) comprises a second molecule or moiety that comprises (eg, is conjugated or fused to) a peptide (peptide tag) as defined herein.

[0115] It will be apparent that the use of the above-mentioned peptide tag and polypeptide (peptide tag binding partner) pairs (i.e., two-part linkers) involves contacting said first molecule with a second molecule under conditions suitable to allow (e.g., promote or facilitate) the spontaneous formation of an isopeptide bond between said peptide tag and polypeptide (peptide tag binding partner), as described above.

[0116] As mentioned above, the above-mentioned peptide tag and polypeptide (peptide tag binding partner) pair (i.e., two-part linker) is particularly useful when the peptide tag is incorporated into a molecule or component at an internal site, i.e., not at one end, of the molecule or component. Thus, in some embodiments, the second molecule or component may comprise a peptide (peptide tag) as defined herein at an internal site, for example, within a loop. In other words, the peptide tag as defined herein may be present at an internal site of the second molecule or component.

[0117] The term "internal site" as used herein refers to a site within a molecule or component into which a peptide tag or polypeptide (peptide tag binding partner) of the invention is incorporated that is not at either end of the molecule or component, i.e., is internal to the molecule or component. When the molecule or component is a protein, the internal site may be at least one residue away from the end of the protein, e.g., at least 2, 3, 4, 5, 10, 15, 20, or 25 residues away from the end of the protein. The internal site may be anywhere within the molecule or component. When the molecule or component is a protein, the internal site is preferably within a loop region of the protein, i.e., within a region that connects two regions of a defined regular secondary structure within the protein.

[0118] Thus, in some embodiments, the second molecule or component may be a protein and may comprise a peptide (peptide tag) as defined herein at an internal site. In a preferred embodiment, the second molecule or component may be a protein and may comprise a peptide (peptide tag) as defined herein within a loop region or domain.

[0119] In another aspect, the present invention provides a method for conjugating two molecules or moieties via an isopeptide bond, comprising the steps of: a) providing a first molecule or moiety comprising (e.g. conjugated or fused to) a polypeptide of the invention (peptide tag binding partner) as defined herein; b) providing a second molecule or moiety comprising (e.g. conjugated or fused to) a peptide as defined herein (peptide tag); c) contacting said first molecule or component with said second molecule or component under conditions that allow (e.g. promote or facilitate) the spontaneous formation of an isopeptide bond between said peptide and said polypeptide, as described above, thereby conjugating said first molecule or component to said second molecule or component via an isopeptide bond to form a complex; The present invention provides a method comprising:

[0120] Again, in some embodiments, said second molecule or component may comprise a peptide (peptide tag) as defined herein at an internal site. In a preferred embodiment, said second molecule or component is a protein and the peptide tag as defined herein is present at an internal site of said protein, preferably in a loop region or domain.

[0121] In the context of the present invention relating to the joining of two or more molecules or components to form a complex, the term "conjugating" or "linking" refers to the binding or conjugation of said molecules or components, e.g., proteins, via a covalent bond, in particular via an isopeptide bond formed between a peptide tag and a polypeptide (peptide tag binding partner) that is incorporated or fused to said molecule or component, e.g., protein (e.g., the peptide tag and the polypeptide (peptide tag binding partner) may form a domain of the protein to be conjugated or linked).

[0122] As mentioned above, in some embodiments, the peptide tag disclosed herein and / or the polypeptide of the present invention is fused or conjugated to other molecules or other components or entities. Such molecules or components (i.e., entities) may be nucleic acid molecules, proteins (e.g., antibodies or antigen-binding fragments thereof), peptides, small organic compounds, fluorophores, metal-ligand complexes, polysaccharides, nanoparticles, two-dimensional monolayers (e.g., graphene), lipids, nanotubes, polymers, cells, viruses, virus-like particles, viral vectors, or any combination thereof. In some embodiments, the component or entity to which the peptide tag and / or polypeptide is fused or conjugated is a solid support, i.e., a solid substrate or solid phase, as defined below.

[0123] Thus, in another aspect, the invention provides a nucleic acid molecule, a protein (e.g., an antibody or antigen-binding fragment thereof), a peptide, a small organic compound, a fluorophore, a metal-ligand complex, a polysaccharide, a nanoparticle, a two-dimensional monolayer (e.g., graphene), a lipid, a nanotube, a polymer, a cell, a virus, a virus-like particle, a viral vector, or any combination thereof, or a solid support, fused or conjugated to a peptide tag and / or a polypeptide of the invention.

[0124] The cell may be a prokaryotic or eukaryotic cell. In some embodiments, the cell is a prokaryotic cell, e.g., a bacterial cell. In some embodiments, the cell is a eukaryotic cell, such as an animal cell, e.g., a human cell.

[0125] In some embodiments, the peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be conjugated or fused to a compound or molecule having a therapeutic or prophylactic effect, such as an antibiotic, an antiviral agent, a vaccine, an antitumor drug, such as a radioactive compound or isotope, a cytokine, a toxin, an oligonucleotide and a nucleic acid encoding a gene, or a nucleic acid vaccine.

[0126] In some embodiments, the peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be conjugated or fused to a label, such as, for example, a radiolabel, a fluorescent label, a luminescent label, a chromophore label, and may be conjugated or fused to an enzyme that generates a substrate and a detectable signal, such as horseradish peroxidase, luciferase, or alkaline phosphatase. This detection may be applied to a large number of assays where antibodies are traditionally used, including Western blotting / immunoblotting, histochemistry, enzyme-linked immunosorbent assay (ELISA), or flow cytometry (FACS) formats. Labels for magnetic resonance imaging, positron emission tomography probes, and boron-10 for neutron capture therapy may also be conjugated to the peptide tag and / or the polypeptide (peptide tag binding partner) of the present invention. In particular, the peptide tag and / or polypeptide (e.g., a peptide tag binding partner) may be fused or produced with another peptide, e.g., a His tag, and / or may be fused or produced with another protein, for the purposes of enhancing expression of the recombinant protein, for example, by fusion to Maltose Binding Protein.

[0127] In some embodiments, a polypeptide of the present invention may include a peptide (e.g., a c-myc Tag) fused to its C-terminus, e.g., via a linker or spacer sequence such as SEQ ID NO: 16, which may further improve the solubility of the polypeptide compared to, for example, a polypeptide that does not include a C-terminal peptide.

[0128] In some embodiments, it may be useful to introduce a cysteine ​​residue into a polypeptide of the invention in order to couple the polypeptide to another molecule or moiety, such as a label, e.g., a fluorescent label, or a solid substrate. For example, the introduction of a cysteine ​​residue could allow the polypeptide to be coupled to another molecule or moiety, such as a label containing a maleimide functional group, e.g., a fluorescent label.

[0129] As mentioned above, the peptide tag binding partner polypeptide ("catcher") as defined above may be modified to suppress the spontaneous formation of an isopeptide bond between said polypeptide and its cognate peptide tag. Advantageously, said modified polypeptide may be immobilized on a solid substrate (phase) to provide an affinity purification system for the isolation and / or purification of molecules or components comprising a peptide tag as defined herein. Thus, any of the above defined polypeptides may be modified to substitute a glutamic acid at position 70 of SEQ ID NO:1 or position 66 of SEQ ID NO:2 (or a corresponding position) to render said modified polypeptide unable to spontaneously form an isopeptide bond with a peptide tag as defined herein, thereby providing a polypeptide useful in an affinity purification system. Thus, said modified polypeptide (i.e., affinity purification polypeptide) may comprise a non-conservative substitution of a glutamic acid at position 70 of SEQ ID NO:1 or position 66 of SEQ ID NO:2 (or an equivalent position). In another aspect, said modified polypeptide does not comprise a glutamic acid and an aspartic acid at position 70 of SEQ ID NO:1 or position 66 of SEQ ID NO:2 (or a corresponding position). In some embodiments, the glutamic acid at position 70 of SEQ ID NO:1 or position 66 of SEQ ID NO:2 (or a corresponding position) may be substituted with alanine, glycine, serine, asparagine, or threonine.

[0130] Thus, in one embodiment, the present invention comprises: i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid (i.e., any amino acid other than glutamic acid and aspartic acid), and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 and if the amino acid sequence contains a proline at position 75, the amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), where these specified amino acid residues are at positions corresponding to those in SEQ ID NO: 18; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 and if the amino acid sequence includes a proline at position 71, the amino acid sequence also includes one or more amino acid residues selected from 1) to 5) and 7) to 9), where these specified amino acid residues are at positions corresponding to those in SEQ ID NO: 19; A polypeptide (affinity purified polypeptide) comprising: The present invention provides a polypeptide (an affinity purified polypeptide) that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:3.

[0131] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid (i.e., any amino acid other than glutamic acid and aspartic acid), and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) Proline at position 75, and 7) Aspartic acid at position 92 and one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) Proline at position 71, and 6) Aspartic acid at position 88 and one or more of the following: 1) Isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO: 19; A polypeptide (affinity purified polypeptide) comprising: The present invention provides a polypeptide (an affinity purified polypeptide) that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:3.

[0132] In some embodiments, X at position 70 (or a corresponding position) of SEQ ID NO: 18 is a conventional (standard) amino acid other than an acidic amino acid, ie, X is not D or E.

[0133] In some embodiments, X at position 70 (or a corresponding position) of SEQ ID NO: 18 is not, or is not a basic amino acid (e.g., R, K, or H), an aromatic amino acid (e.g., F, Y, or W), cysteine ​​(C), proline (P), or any of the above.

[0134] Thus, in some embodiments, X at position 70 (or a corresponding position) of SEQ ID NO: 18 is selected from A, G, I, L, M, N, Q, S, T, and V. In some embodiments, X at position 70 (or a corresponding position) is selected from A, G, S, N, and T.

[0135] A "conventional or standard amino acid" is an amino acid that is used in vivo to produce a polypeptide or protein molecule, i.e., a proteinogenic amino acid, in other words, an amino acid that has a standard or conventional R group or a side chain that is coded for by the standard genetic code, i.e., an "encoded amino acid."

[0136] The combinations of "solubility modifications" and / or "activity modifications" specified above with respect to the peptide tag binding partner polypeptides of the invention (i.e., polypeptides capable of spontaneously forming isopeptide bonds with peptide tags as defined herein, e.g., DogCatcher and its functional variants) apply analogously to the modified (affinity purified) polypeptides defined above. For example, an affinity purified polypeptide may comprise all of the "solubility modifications" and / or all of the "activity modifications" defined above, or any selection or combination thereof.

[0137] The lysine residue at position 9 of SEQ ID NO: 1 may not be required in affinity purification polypeptides of the invention because the polypeptides do not spontaneously form an isopeptide bond with a peptide tag as defined herein, however, it may be advantageous to retain this residue in affinity purification polypeptides of the invention since it may non-covalently interact with the peptide tag to promote selective binding of the polypeptide to the peptide tag.

[0138] Thus, in some embodiments, the (affinity purified) polypeptide defined above comprises an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO: 18 or 19, wherein said amino acid sequence comprises a lysine at the position corresponding to position 9 of SEQ ID NO: 18 or position 5 of SEQ ID NO: 19.

[0139] As mentioned above, it may be useful to introduce a cysteine ​​residue into a polypeptide of the invention to couple the polypeptide to another molecule or component, in particular a solid substrate, for example for use in an affinity purification system or affinity purification device as defined herein. In some embodiments, the cysteine ​​residue may be incorporated into the polypeptide by adding an N- or C-terminal amino acid sequence (e.g., a tag) comprising a cysteine ​​residue, such as that shown in SEQ ID NO:20.

[0140] Thus, in some embodiments, the above defined polypeptides (eg affinity purification polypeptides) comprise an additional N- or C-terminal sequence which comprises a cysteine ​​residue.

[0141] In some embodiments, a cysteine ​​residue may be introduced into a polypeptide by substituting an amino acid with a cysteine ​​residue. In a preferred embodiment, a cysteine ​​residue is not introduced into any of the solubility-modifying or activity-modifying residue positions defined above. In some embodiments, an aspartic acid at a position corresponding to position 31 of SEQ ID NO: 18 or position corresponding to position 27 of SEQ ID NO: 19 is substituted with a cysteine ​​residue. In some embodiments, a glutamine at a position corresponding to position 41 of SEQ ID NO: 18 or position corresponding to position 37 of SEQ ID NO: 19 is substituted with a cysteine ​​residue.

[0142] Thus, in some embodiments, the (affinity purified) polypeptide comprises: i) the amino acid sequence set forth in SEQ ID NO: 21 or 22, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 23 or 24, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 21 or 22, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein said amino acid sequence comprises a cysteine ​​at position 31 or 41 and one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) Threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, ranked 87th; 9) arginine at position 89, and 10) Aspartic acid at position 92 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:21 or 22, and, optionally, (A) if the amino acid sequence contains a proline at position 75, the amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), or (B) the amino acid sequence contains at least one amino acid residue selected from 1) to 5), 7), and 10), and one amino acid residue selected from 6), 8), and 9); or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 23 or 24, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence comprises a cysteine ​​at position 27 or 37 and one of the following: 1) Aspartic acid at position 7, 2) Threonine at position 9, 3) aspartic acid at position 43, 4) Threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, ranked 83rd; 8) arginine at position 85, and 9) Aspartic acid at position 88 and these designated amino acid residues are at positions corresponding to those in SEQ ID NO:23 or 24, and, optionally, (A) if the amino acid sequence includes a proline at position 71, the amino acid sequence also includes one or more amino acid residues selected from 1) to 5) and 7) to 9), or (B) the amino acid sequence includes at least one amino acid residue selected from 1) to 4), 6), and 9), and one amino acid residue selected from 5), 7), and 8), The polypeptide comprises The polypeptide selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:3.

[0143] In some embodiments, the (affinity purified) polypeptide comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 21 to 24, and the amino acid sequence comprises a lysine at a position corresponding to position 9 of SEQ ID NO: 21 or 22 or position 5 of SEQ ID NO: 23 or 24.

[0144] The term "selectively binds" refers to the ability of said (affinity purified) polypeptide to bind non-covalently (e.g., by van der Waals forces and / or hydrogen bonds) to its cognate peptide tag with greater affinity and / or specificity than other components in the sample in which the peptide tag is present (e.g., the sample from which the peptide tag (and related molecules or related components to which the peptide tag is fused or conjugated, i.e., fusion partners) are isolated or purified). Thus, in another respect, the (affinity purified) polypeptide of the invention may be considered to specifically and reversibly bind to its cognate peptide tag (i.e., DogTag peptide or a variant thereof), such as a peptide comprising the amino acid sequence set forth in SEQ ID NO: 3, 4, 5, or 17, under suitable conditions.

[0145] Binding to said cognate peptide tag may be distinguished from binding to other molecules (e.g. peptides or polypeptides) present in the sample, i.e. non-cognate molecules. The (affinity purified) polypeptides of the invention do not bind to other molecules (e.g. peptides or polypeptides) present in the sample, or such non-specific binding, if it occurs at all, is negligible or undetectable and can be easily distinguished from binding to the cognate peptide tag.

[0146] In particular, when the (affinity purified) polypeptide of the invention binds to a molecule other than its cognate peptide tag, such binding should be temporary and the binding affinity should be lower than the binding affinity of the (affinity purified) polypeptide to its cognate peptide tag. Thus, the binding affinity of the (affinity purified) polypeptide to the peptide tag should be at least one order of magnitude greater than that of other molecules (i.e. non-cognate molecules) present in the sample. Preferably, the binding affinity of the (affinity purified) polypeptide to its cognate peptide tag should be at least two, three, four, five or six orders of magnitude greater than its binding affinity to a non-cognate molecule (e.g. peptide or polypeptide).

[0147] Thus, selective or specific binding means binding where the dissociation constant of the polypeptide for its cognate peptide tag is about 10 -3 This refers to the affinity of a (affinity purified) polypeptide of the invention for its cognate peptide tag when the affinity is less than M. In a preferred embodiment, the dissociation constant of a polypeptide for its cognate peptide tag is about 10 -4 M, 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, or 10 -9 Less than M.

[0148] The binding selectivity (e.g., specificity) of the (affinity purified) polypeptides of the invention may also be defined based on the yield and / or purity of the product obtained in the isolation or purification method defined below, i.e., the cognate peptide tag and the associated molecule or associated component to which the peptide tag is fused or conjugated (fusion partner, e.g., polypeptide). In some embodiments, the (affinity purified) polypeptides of the invention in the methods defined below yield products with a purity of at least about 75%, e.g., at least about 80%, 85%, or 90%. The purity of the products obtained using the methods and (affinity purified) polypeptides of the invention may be determined using any suitable means, such as the SDS-PAGE method described in WO2020 / 115252 (herein incorporated by reference).

[0149] In some embodiments, the (affinity purified) polypeptides of the invention in the methods defined below yield a product with a yield of at least about 50%, such as about 60%, 70%, 75%, 80%, 85%, or 90%, etc. The product yield obtained using the methods and (affinity purified) polypeptides of the invention may be determined using any suitable means.

[0150] Thus, the polypeptides of the invention (affinity purified polypeptides) must selectively and reversibly bind to at least one peptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 3 to 5 and 17. In a preferred embodiment, said (affinity purified) polypeptides must selectively and reversibly bind to a peptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 3. Thus, the (affinity purified) polypeptides of the invention bind to at least one peptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 3 to 5 or 17 with higher affinity and / or specificity than to other components (i.e. non-cognate molecules) in the sample in which the peptide tag is present. The sample may be any sample (such as, for example, a cell lysate as described below) from which the peptide tag (and the associated molecules or associated components to which the peptide tag is fused or conjugated, i.e. fusion partners) is isolated or purified. However, the polypeptides of the invention may also bind to other cognate peptide tags as defined herein.

[0151] A non-cognate molecule, in particular a non-cognate peptide or polypeptide, may be defined as a peptide or polypeptide that does not contain a peptide tag as defined herein, i.e. an amino acid sequence consisting of an amino acid sequence having at least 60% sequence identity to SEQ ID NO: 3, 4, 5, or 17. Preferably, said non-cognate molecule does not contain a peptide tag as defined herein, i.e. a contiguous sequence of 19 to 23 amino acids having more than about 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% sequence identity to SEQ ID NO: 3, 4, 5, or 17. Other non-cognate molecules include carbohydrates, sugars, lipids, ions, and small molecules.

[0152] Conditions suitable for selective or specific binding of a (affinity purification) polypeptide to its cognate peptide tag can be determined using routine experimentation. Suitable conditions can include, for example, those conditions described above for the peptide tag binding partner polypeptides of the invention, as well as conditions for isopeptide bond formation with peptide tags as defined herein.

[0153] The term "reversible" or "reversibly binds" refers to the ability of the interaction between an (affinity purification) polypeptide and its cognate peptide tag to be disrupted, resulting in separation (dissociation) of the complex under suitable conditions. In other words, the non-covalent interaction formed by the affinity purification polypeptide:cognate peptide tag complex is cleavable under suitable conditions that allow separation of the constituent parts. Suitable conditions for dissociating the complex may include any conditions that can disrupt or cleave the non-covalent bonds necessary for the formation of the complex, and may be determined using routine experimentation.

[0154] It will be clear that the conditions for dissociating the affinity purification polypeptide: cognate peptide tag complex are preferably those that do not cause irreversible loss of activity of the DogTag peptide and / or fusion partner. For example, conditions that prevent DogTag from spontaneously reacting with the peptide tag binding partner polypeptide of the present invention (e.g., DogCatcher) to form an isopeptide bond should be avoided. Similarly, conditions that alter or inhibit (e.g., denature) the molecule or component fused to the DogTag peptide (i.e., the fusion partner, e.g., a polypeptide) are not suitable for dissociating the affinity purification polypeptide: cognate peptide tag complex, since such conditions would limit the usefulness of the DogTag fusion in downstream applications. Such conditions will depend on the nature of the fusion partner, and a person skilled in the art can easily determine which conditions are appropriate (or inappropriate) based on methods known in the art. As an example, boiling the affinity purified polypeptide:cognate peptide tag complex and / or treatment with 1% sodium dodecyl sulfate (SDS) dissociates the affinity purified polypeptide:cognate peptide tag complex but may irreversibly alter (e.g., denature) the fusion partner.

[0155] As referred to herein, "functional equivalents" refer to variants of the peptide tags described herein and affinity purified polypeptides of the invention described above, which may exhibit some reduction in selectivity (e.g., specificity) or affinity in binding (forming non-covalent complexes) with their respective partners (e.g., lower purity or yield in the methods of the invention, or activity in a limited range of reaction conditions (e.g., a narrower temperature range, such as 10°C to 30°C)) compared to the parent molecule (i.e., the molecule to which the variant exhibits sequence homology), but preferably exhibit similar or greater efficacy.

[0156] A mutant or variant cognate peptide tag having an activity "equivalent" to that of a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5 or 17 may have an activity similar to (i.e., comparable to) the activity of a cognate peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5 or 17, i.e., an activity that does not significantly affect the practical application of the peptide tag, e.g., within experimental error.

[0157] Thus, in some embodiments, equivalent peptide tag activity means that the mutant or variant cognate peptide tag described is capable of selectively and reversibly binding to an affinity purification polypeptide of the invention. In some preferred embodiments, the mutant or variant cognate peptide tag is capable of spontaneously forming an isopeptide bond with a peptide tag-binding partner polypeptide as defined herein under identical conditions with a reaction rate (i.e., the rate constants described above) and / or yield similar to a peptide tag comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5 or 17.

[0158] Similarly, a mutant or variant affinity purified polypeptide of the invention having an activity "equivalent" to that of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 18 (preferably, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine), may have an activity similar to (i.e., comparable to) the activity of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 18 (preferably, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine), i.e., an activity that does not significantly affect the practical application of the peptide, e.g., within experimental error. Thus, equivalent polypeptide activity means that a mutated or variant affinity purified polypeptide of the invention can selectively and reversibly bind to a cognate peptide tag as described herein (e.g. comprising or consisting of an amino acid sequence set forth in one of SEQ ID NOs: 3-5 or 17) under the same conditions with similar affinity and / or yield as a polypeptide comprising or consisting of an amino acid sequence set forth in SEQ ID NO: 18 (preferably, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine), as described above.

[0159] A mutant or variant polypeptide of the invention having an activity "equivalent" to that of a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 18 (preferably, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine), may compete with a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 18 (preferably, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine) for binding to a cognate peptide tag as defined herein, e.g., one or all of SEQ ID NOs: 3 to 5, 17.

[0160] The activities of different polypeptides (e.g., SEQ ID NO:18 versus variants) measured under identical reaction conditions, e.g., conditions of temperature, ligand (i.e., cognate peptide tag sequence) and their concentrations, buffers, salts, etc., as exemplified above, can be readily compared to determine whether the affinity and / or yield is higher, lower, or equal for each polypeptide.

[0161] In particularly useful embodiments, the peptide tag and / or polypeptide (e.g., peptide tag binding partner) is fused or conjugated to another peptide or polypeptide. For example, the peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be produced as part of another peptide or polypeptide, i.e., as a recombinant or synthetic protein or polypeptide, using recombinant techniques as described below.

[0162] It will be clear that the peptide tags disclosed herein and / or the polypeptides of the invention (e.g., peptide tag binding partners) may be fused to any protein or polypeptide. The protein may be derived or obtained from any suitable source. For example, the protein may be translated in vitro or purified from biological and clinical samples, such as any cell or tissue sample of an organism (eukaryotic, prokaryotic) or any body fluid or preparation derived therefrom, as well as samples such as cell cultures, cell preparations, cell lysates, etc. The protein may be derived or obtained, e.g., purified, from environmental samples, such as soil and water samples or food samples. The sample may be freshly prepared or may be pretreated in any convenient way, e.g., for storage.

[0163] As mentioned above, in a preferred embodiment, the peptide or protein fused to the peptide tag and / or polypeptide of the present invention disclosed herein may be produced by genetic recombination, and thus the nucleic acid molecule encoding said recombinant protein may be derived or obtained from any suitable source, for example, any viral or cellular material, including any prokaryotic or eukaryotic cell, virus, bacteriophage, mycoplasma, protoplasts, and organelles. Thus, such biological material may include all kinds of mammalian and non-mammalian cells, plant cells, algae including cyanobacteria, fungi, bacteria, protists, viruses, etc. In some embodiments, the protein may be a synthetic protein. For example, the peptides and polypeptides (proteins) disclosed herein may be produced by chemical synthesis, such as solid phase peptide synthesis.

[0164] The peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be placed at any convenient location within a recombinant or synthetic protein. In some embodiments, the peptide tag and / or polypeptide (peptide tag binding partner) may be placed at the N-terminus or C-terminus of a recombinant or synthetic polypeptide. In some embodiments, the peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be placed internally within a recombinant or synthetic polypeptide. Thus, in some embodiments, the peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be considered an N-terminal domain, a C-terminal domain, or an internal domain of a recombinant or synthetic polypeptide.

[0165] As mentioned above, the peptide tag and peptide tag binding partner polypeptide of the present invention are particularly effective in situations where proteins need to be coupled via at least one loop region.Therefore, in some embodiments, the peptide tag is preferably located inside a recombinant or synthetic polypeptide.In a preferred embodiment, the peptide tag is located within a loop region or loop domain of a recombinant or synthetic polypeptide.Therefore, in some embodiments, the polypeptide tag can be considered as an internal domain of a recombinant or synthetic polypeptide.

[0166] In some embodiments, it may be useful to provide one or more spacers, e.g., peptide spacers, between the peptide or polypeptide to be bound or conjugated to the peptide tag and / or polypeptide (e.g., peptide tag binding partner). Thus, the peptide or polypeptide and the peptide tag and / or polypeptide (e.g., peptide tag binding partner) may be directly linked to each other or indirectly linked by one or more spacer sequences. Thus, the spacer sequence may space or separate two or more distinct portions of a recombinant or synthetic polypeptide. In some embodiments, the spacer may be N-terminal or C-terminal to the peptide tag and / or polypeptide (e.g., peptide tag binding partner), e.g., when the peptide tag and / or polypeptide (e.g., peptide tag binding partner) is to be placed at the N-terminus or C-terminus of the peptide or polypeptide to be bound or conjugated. As mentioned above, the peptide tags and polypeptides (e.g., peptide tag binding partners) of the present invention are particularly suitable for use when the peptide tag is located at an internal site of the peptide or polypeptide to be bound or conjugated (or isolated or purified). For example, the peptide tag may be inserted into a loop region. Thus, in some embodiments, a spacer may flank the peptide tag.

[0167] The exact nature of the spacer sequence may vary in length and / or sequence, for example the spacer sequence may have 1-40, more specifically 2-20, 1-15, 1-12, 1-10, 1-8, or 1-6 residues, such as 6, 7, 8, 9, 10, or more residues. As a representative example, the spacer sequence, if present, may have 1-15, 1-12, 1-10, 1-8, or 1-6, etc. residues. The nature of the residues is not critical, and these residues may be any amino acid, such as neutral or aliphatic amino acids, or may be hydrophobic, or polar or charged, or structure-forming amino acids, such as proline. In some preferred embodiments, the linker is a serine-rich and / or glycine-rich sequence. An exemplary linker / spacer sequence is set forth in SEQ ID NO: 16.

[0168] Thus, exemplary spacer sequences include any single amino acid residue, e.g., S, G, L, V, P, R, H, M, A, or E, or a dipeptide, tripeptide, tetrapeptide, pentapeptide, or hexapeptide composed of one or more of such residues.

[0169] Thus, in some embodiments, the present invention provides recombinant or synthetic polypeptides comprising a polypeptide of the invention (e.g., a peptide tag binding partner) as defined above, i.e., a peptide or polypeptide (e.g., a heterologous peptide or polypeptide, i.e., a peptide or polypeptide not normally associated with the polypeptide of the invention, e.g., from a different organism) fused to a polypeptide of the invention (peptide tag binding partner). The recombinant or synthetic polypeptide optionally comprises a spacer as defined above.

[0170] The recombinant or synthetic polypeptides of the invention may also include purification moieties or tags to facilitate purification (e.g., prior to use in the methods and uses of the invention described below). Any suitable purification moiety or tag may be incorporated into the polypeptide, and such moieties are well known in the art. For example, in some embodiments, the recombinant or synthetic polypeptide may include a peptide purification tag or moiety, such as a His-tag or C-tag sequence. Such a purification moiety or tag may be incorporated at any position within the polypeptide. In some preferred embodiments, the purification moiety is located at or toward the N- or C-terminus of the polypeptide (i.e., within 5, 10, 15, 20 amino acids from each end). In some embodiments, the tag may include a cysteine ​​residue to facilitate conjugation of the recombinant or synthetic polypeptide to another molecule or component, such as a solid substrate.

[0171] As mentioned above, the advantages of the present invention arise from the fact that the peptide tags and / or polypeptides of the present invention incorporated in a peptide or polypeptide (e.g., a recombinant or synthetic polypeptide of the present invention) can be entirely genetically encoded. Thus, in a further aspect, the present invention provides a nucleic acid molecule encoding a polypeptide (e.g., a peptide tag binding partner) or recombinant polypeptide as defined above.

[0172] In some embodiments, the nucleic acid molecule is codon-optimized for expression in a host cell. Thus, in some embodiments, the nucleic acid molecule is codon-optimized for expression in a bacterial cell, such as E. coli, e.g., the nucleotide sequence set forth in SEQ ID NO: 7. In some embodiments, the nucleic acid molecule is codon-optimized for expression in a mammalian cell, such as a human cell, e.g., a HEK cell.

[0173] In some embodiments, the nucleic acid molecule encoding the polypeptide binding partner defined above comprises a nucleotide sequence set forth in SEQ ID NO:7, or a nucleotide sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:7. Preferably, the above-mentioned nucleic acid molecules are at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7.

[0174] Nucleic acid sequence identity may be determined, for example, using FASTA Search with the GCG package with default settings and variable pam factors, gap creation penalty set to 12.0, gap extension penalty set to 4.0, and a window of 6 nucleotides. The comparison is preferably made over the entire length of the sequence, but may also be made over smaller comparison windows, for example, less than 300, less than 200, less than 100, or less than 50 contiguous nucleotides.

[0175] The nucleic acid molecules of the invention may be composed of ribonucleotides and / or deoxyribonucleotides, as well as synthetic residues capable of participating in Watson-Crick or analogous base pair interactions, e.g., synthetic nucleotides. Preferably, the nucleic acid molecule is DNA or RNA.

[0176] The above-mentioned nucleic acid molecules may be operably linked to an expression control sequence or a recombinant DNA cloning vehicle or vector containing such a recombinant DNA molecule. This allows the peptides and polypeptides of the invention to be expressed intracellularly as gene products, the expression being directed by a gene introduced into the cells of the subject. Gene expression is driven from a promoter active in the cells of the subject and may be inserted into any form of linear or circular nucleic acid (e.g., DNA) vector for integration into the genome or for independent replication or transient transfection / expression. Suitable transformation or transfection techniques are described in detail in the literature. Alternatively, naked nucleic acid (e.g., DNA or RNA, which may contain one or more synthetic residues, e.g., base analogs and / or sugar analogs) molecules may be directly introduced into the cells to produce the polypeptides of the invention. Alternatively, the nucleic acid may be converted into mRNA by in vitro transcription and the relevant protein produced by in vitro translation.

[0177] Suitable expression vectors include suitable control sequences, such as translational control elements (e.g., initiation and termination codons, ribosome binding sites) and transcriptional control elements (e.g., promoter-operator regions, termination stop sequences) linked in frame with the nucleic acid molecule of the present invention. Suitable vectors may include plasmids and viruses, including both bacteriophage and eukaryotic viruses. Suitable viral vectors include baculoviruses, as well as adenoviruses, adeno-associated viruses, lentiviruses, herpes, and vaccinia / pox viruses. Many other viral vectors are described in the art. Examples of suitable vectors include bacterial and mammalian expression vectors, such as pGEX-KG, pEF-neo, and pEF-HA.

[0178] As mentioned above, the recombinant or synthetic polypeptides of the invention may contain additional sequences (e.g., peptide / polypeptide tags which facilitate purification of the polypeptide) and thus the nucleic acid molecules may be conveniently fused to DNA encoding additional peptides or polypeptides, e.g., His tags, maltose binding protein, etc., such that upon expression a fusion protein is generated.

[0179] Thus, in a further aspect, the present invention provides a vector, preferably an expression vector, comprising a nucleic acid molecule as defined above.

[0180] Another aspect of the invention is a method for preparing a recombinant nucleic acid molecule of the invention, comprising inserting a nucleic acid molecule of the invention encoding a polypeptide (peptide tag binding partner) of the invention into a vector nucleic acid.

[0181] The nucleic acid molecule of the invention, preferably contained in a vector, may be introduced into a cell by any suitable means. Suitable transformation or transfection techniques are described in detail in the literature. Numerous techniques are known and may be used to introduce such vectors into prokaryotic or eukaryotic cells for expression. Preferred host cells for this purpose include insect cell lines, yeast, mammalian cell lines or E. coli, such as the BL21(DE3) strain. The invention further extends to transformed or transfected prokaryotic or eukaryotic host cells containing a nucleic acid molecule, in particular a vector as defined above.

[0182] Thus, in a further aspect, there is provided a recombinant host cell containing the nucleic acid molecule and / or vector as described above.

[0183] "Recombinant" means that a nucleic acid molecule and / or vector has been introduced into a host cell. The host cell may or may not naturally contain an endogenous copy of the nucleic acid molecule, but the host cell is recombinant in that an exogenous or additional endogenous copy of the nucleic acid molecule and / or vector has been introduced.

[0184] A further aspect of the present invention provides a method for preparing a polypeptide of the invention or a recombinant polypeptide as defined herein above, comprising culturing a host cell containing a nucleic acid molecule as defined above under conditions in which said nucleic acid molecule encoding said polypeptide is expressed and recovering said molecule (polypeptide) thus produced. The expressed polypeptide gives rise to a further aspect of the present invention.

[0185] In some embodiments, the peptide tags disclosed herein and / or the polypeptides of the invention, or for use in the methods and uses of the invention, may be produced synthetically, for example by ligation of amino acids or smaller synthetic peptides, or more conveniently, by recombinant expression of a nucleic acid molecule encoding the polypeptide as described herein above.

[0186] The nucleic acid molecules of the invention may be produced synthetically using any suitable means known in the art.

[0187] Thus, the peptide tags disclosed herein and / or polypeptides of the invention may be isolated, purified, recombinant, or synthetic peptide tags or polypeptides.

[0188] The term "polypeptide" is used interchangeably with the term "protein" herein. As mentioned above, the term polypeptide or protein typically includes any amino acid sequence containing at least 40 consecutive amino acid residues, for example, any amino acid sequence containing at least 50, 60, 70, 80, 90, 100, 150 amino acids, 40-1000, 50-900, 60-800, 70-700, 80-600, 90-500, 100-400 amino acids, etc.

[0189] Similarly, a nucleic acid molecule of the present invention can be an isolated, purified, recombinant, or synthetic nucleic acid molecule.

[0190] Thus, in another aspect, the polypeptide and nucleic acid molecules of the invention are preferably non-naturally occurring, ie, non-naturally occurring molecules.

[0191] Standard amino acid nomenclature is used herein. Thus, the full names of amino acid residues may be used interchangeably with the one-letter code or three-letter abbreviations. For example, lysine may be replaced with K or Lys, isoleucine may be replaced with I or Ile, and so on. Furthermore, the terms aspartate and aspartic acid, and glutamate and glutamic acid are used interchangeably herein and may be replaced with Asp or D, or Glu or E, respectively.

[0192] It is envisaged that the peptide tags disclosed herein, as well as the polypeptides of the invention and the polypeptides for use in the invention, may be produced recombinantly, which is a preferred embodiment of the invention, and it will be clear that the peptide tags disclosed herein and the polypeptides of the invention may be conjugated to proteins or other entities, such as molecules or components as defined above, by other means. In other words, the peptide tags or polypeptides and other molecules, components or entities, such as proteins or solid substrates, may be produced separately by any suitable means, such as recombinantly, and then conjugated (linked) to form a conjugate of the peptide tag and other components or a conjugate of the polypeptide and other components that can be used in the methods and uses of the invention. For example, the peptide tags disclosed herein and / or the polypeptides of the invention may be produced synthetically or recombinantly as described above, and conjugated to another component, such as a protein, via a non-peptide linker or non-peptide linker spacer, such as a chemical linker or chemical spacer.

[0193] As with the other embodiments described above, the peptide tag may be conjugated to the other component at an internal site, i.e., at a site that is not at one of the termini of said other component. If said other component is a protein, the peptide tag may preferably be conjugated to a loop region within said protein.

[0194] As noted above, the affinity purification polypeptides of the invention form one part of a two-part affinity purification system and are particularly useful in purifying (i.e. isolating or separating) molecules or components (fusion partners) that comprise (e.g. have attached or conjugated to) a cognate peptide tag as defined herein.

[0195] Thus, in a further aspect, the present invention may be regarded as providing the use of an affinity purification polypeptide of the invention as defined above (e.g. SEQ ID NO: 18) for purifying or isolating a molecule or component comprising a cognate peptide tag as defined herein, for example a peptide tag having an amino acid sequence having at least 80% sequence identity to the sequence set forth in one of SEQ ID NOs: 3 to 5 or 17, said amino acid sequence comprising an asparagine residue at position 17 and, optionally, a threonine residue at position 5, an aspartic acid residue at position 10 and a glycine residue at position 11.

[0196] Affinity purification systems typically utilize capture molecules (e.g., receptors) immobilized on a solid substrate to facilitate capture, washing, and elution of target ligands. Thus, the affinity purification polypeptides of the present invention may be immobilized (e.g., fused, conjugated, or linked) to a solid substrate (i.e., solid phase or solid support). It will be apparent that this may be achieved by any convenient method. In another aspect, the present invention provides a solid support to which the polypeptides of the present invention are immobilized.

[0197] The immobilization technique or means and solid support may be selected from any of a number of immobilization means and solid supports, as widely known in the art and described in the literature. Thus, the polypeptide of the present invention may be directly bound to the support, for example, via a domain or portion of the polypeptide (e.g., chemically crosslinked). In some embodiments, the polypeptide may be indirectly bound by a linker group or by an intermediate linking group (e.g., by biotin-streptavidin interaction). Thus, the polypeptide may be linked to the solid support by covalent or non-covalent bonds. In some embodiments, the polypeptide is immobilized to the solid substrate via a covalent bond.

[0198] The bond may be a reversible (e.g., cleavable) bond or an irreversible bond, and thus in some embodiments the bond may be cleaved enzymatically, chemically, or with light, e.g., the bond may be a photolabile bond.

[0199] Thus, in some embodiments, the peptide tag and / or polypeptide and other components, such as proteins or solid substrates, may be directly linked via a bond or indirectly linked via a linking group. When a linking group is used, such a group may be selected such that it provides a covalent bond between the peptide tag or polypeptide and other entities, such as proteins or solid substrates. The subject linking group may vary depending on the nature of the other entities, such as proteins. When a linking group is present, the linking group is in many embodiments biologically inert.

[0200] Many linking groups are known to those skilled in the art and can be used in the present invention. In representative embodiments, the linking group is generally at least about 50 daltons, usually at least about 100 daltons, and can be as high as 1000 daltons or more, for example, up to 1 million daltons if the linking group includes a spacer, but generally does not exceed about 500 daltons, usually does not exceed about 300 daltons. Generally, such linkers will have a spacer group terminated at either end with a reactive functional group that can covalently bond the peptide tag or polypeptide to another molecule or component, such as a protein or solid substrate.

[0201] Spacer groups of interest include aliphatic and unsaturated hydrocarbon chains, spacers containing heteroatoms such as oxygen (ethers such as polyethylene glycol) or nitrogen (polyamines), peptides, carbohydrates, and cyclic or acyclic systems that may contain heteroatoms. Spacer groups may also be composed of multiple ligands that bind to metals and coordinate two or more ligands to form a complex upon the presence of a metal ion. Specific spacer elements include 1,4-diaminohexane, xylylenediamine, terephthalic acid, 3,6-dioxaoctane diacid, ethylenediamine-N,N-diacetic acid, 1,1'-ethylenebis(5-oxo-3-pyrrolidine carboxylic acid), 4,4'-ethylenedipiperidine, oligoethylene glycol, and polyethylene glycol. Potentially reactive functional groups include nucleophilic functional groups (amines, alcohols, thiols, hydrazides), electrophilic functional groups (aldehydes, esters, vinyl ketones, epoxides, isocyanates, maleimides), and functional groups capable of cycloaddition reactions, disulfide bond formation, or binding to metals. Specific examples include primary and secondary amines, hydroxamic acids, N-hydroxysuccinimidyl esters, N-hydroxysuccinimidyl carbonates, oxycarbonylimidazoles, nitrophenyl esters, trifluoroethyl esters, glycidyl ethers, vinyl sulfones, and maleimides.Specific linker groups that may be used in peptide tag / polypeptide binding partner conjugates include azidobenzoyl hydrazide, N-[4-(p-azidosalicylamino)butyl]-3'-[2'-pyridyldithio]propionamide), bis-sulfosuccinimidyl suberate, dimethyl adipimidate, disuccinimidyl tartrate, N-maleimidobutyryloxysuccinimide ester, N-hydroxysulfosuccinimidyl-4-azidobenzoate, N-succinimidyl [4-azidophenyl]phenyl Examples of suitable heterofunctional compounds include succinimidyl-4-[N-maleimidomethyl]cyclohexane-1-carboxylate, 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester (SPDP), 4-(N-maleimidomethyl)-cyclohexane-1-carboxylic acid N-hydroxysuccinimide ester (SMCC), etc. For example, a spacer may be formed using an azide reacting with an alkyne or a tetrazine reacting with trans-cyclooctene or norbornene.

[0202] In some embodiments, it may be useful to modify one or more residues of the peptide tag and / or polypeptide to facilitate conjugation of these molecules and / or to improve the stability of the peptide tag and / or polypeptide.Thus, in some embodiments, the peptide tags disclosed herein or polypeptides of the invention or for use in the invention may include unnatural or non-standard amino acids.

[0203] In some embodiments, a peptide tag disclosed herein or a polypeptide of the invention or for use in the invention may comprise one or more, e.g., 1, 2, 3, 4, 5 or more, non-conventional amino acids, i.e., amino acids having a side chain not encoded by the standard genetic code, herein referred to as "non-encoded amino acids". Such amino acids are well known in the art and may be selected from amino acids formed via metabolic processes, such as ornithine or taurine, and / or artificially modified amino acids, such as 9H-fluoren-9-ylmethoxycarbonyl (Fmoc), (tert)-butyloxycarbonyl ((B)utyl (o)xy (c)arbonyl (Boc)), 2,2,5,7,8-pentamethylchroman-6-sulfonyl (Pmc) protected amino acids, or amino acids bearing a benzyloxy-carbonyl (Z) group.

[0204] Examples of non-standard or structural analogue amino acids that may be used in the peptide tags or polypeptides of the invention and polypeptides for use in the invention include D-amino acids, amide isosteres (such as N-methylamides, retroinverse amides, thioamides, thioesters, phosphonates, ketomethylene, hydroxymethylene, fluorovinyl, (E)-vinyl, methyleneamino, methylenethio, or alkanes), LN-methyl amino acids, D-alpha methyl amino acids, DN-methyl amino acids. Further non-standard amino acids that may be used in the peptide tags and / or polypeptides of the invention and polypeptides for use in the invention disclosed herein are disclosed in Willis and Chin, Nat Chem. 2018; 10(8):831-837, Table 1 of WO 2018 / 189517, and WO 2018 / 197854, all of which are incorporated herein by reference.

[0205] Thus, in some embodiments, the peptide tag or polypeptide of the present invention may be provided with a means for immobilization (e.g., its binding partner, i.e., a binding partner of affinity capable of binding to a cognate binding partner, e.g., streptavidin or an antibody, e.g., biotin or a hapten) provided on a support. In some embodiments, the interaction of the peptide tag or polypeptide with the solid support must be sufficiently robust to tolerate a washing step, i.e., the interaction of the peptide tag or polypeptide with the solid support is not disrupted (significantly disrupted) by the washing step. For example, it is preferred that for each washing step, less than 5%, preferably less than 4%, 3%, 2%, 1%, 0.5%, or 0.1% of the peptide tag or polypeptide is removed or eluted from the solid phase.

[0206] Solid supports (phases or substrates) may be any of the well-known supports or matrices currently in widespread use or proposed for immobilization, separation, etc. They may take the form of particles (e.g., beads, which may be magnetic, paramagnetic, or non-magnetic), sheets, gels, filters, membranes, fibers, capillaries, slides, arrays or microtiter strips, tubes, plates, or wells, etc.

[0207] The support may be made of glass, silica, latex, or polymeric materials, such as polysaccharide polymeric materials, such as agarose (e.g., sepharose). Materials with a large surface area are preferred for binding the polypeptides of the present invention. Such supports may have an irregular surface, e.g., porous or particulate, such as particles, fibers, fabrics, sinters, or sieves. Particulate materials, such as beads, are useful due to their higher binding capacity, and polymeric beads are particularly useful.

[0208] Conveniently, the particulate solid support used according to the present invention includes spherical beads.The size of beads is not critical, but may have a diameter of at least about 1 μm, preferably at least about 2 μm, 5 μm, 10 μm, or 20 μm, and may have a maximum diameter of preferably about 500 μm or less, for example about 100 μm or less.

[0209] Monodisperse particles, i.e., particles that are substantially uniform in size (e.g., with a standard deviation of diameter of less than 5%), have the advantage that reaction reproducibility is highly uniform. Exemplary monodisperse polymeric particles can be produced by the techniques described in U.S. Pat. No. 4,336,173.

[0210] However, to aid in manipulation and separation, magnetic beads are advantageous. As used herein, the term "magnetic" means that the support can have a magnetic moment imparted to it when placed in a magnetic field, and thus the support can be displaced under the action of the magnetic field. In other words, the support containing the magnetic particles can be easily removed by magnetic aggregation, providing a fast, simple and efficient method of separating the particles following the isopeptide bond formation step.

[0211] In some embodiments, the solid support is a resin, e.g., an amylose resin. In some embodiments, the solid support is a thiol-reactive resin. Thus, in some embodiments, the solid substrate can include iodoacetyl groups, e.g., the solid substrate can be an iodoacetyl-activated substrate.

[0212] In a further embodiment, the present invention relates to a kit, in particular a kit for use in the methods and uses of the present invention, i.e. a kit for conjugating two molecules or components via an isopeptide bond, wherein two of the molecules or components in the complex are conjugated via an isopeptide bond, the kit comprising: (a) a peptide tag binding partner polypeptide as defined above, such as a peptide tag binding partner polypeptide as defined above, optionally conjugated or fused to a molecule or component, e.g. a recombinant or synthetic polypeptide comprising a peptide tag binding partner polypeptide as defined above; and (b) a peptide (peptide tag) as defined above, optionally conjugated or fused to a molecule or component, e.g. a protein; and / or (c) a nucleic acid molecule, particularly a vector, encoding a peptide tag binding partner polypeptide according to (a); and / or (d) a nucleic acid molecule, particularly a vector, encoding the peptide tag according to (b); A kit is provided, comprising:

[0213] It will be apparent that the peptide tags disclosed herein and the peptide tag binding partner polypeptides of the invention have broad utility. From another perspective, the peptide tags disclosed herein and the peptide tag binding partner polypeptides of the invention can be employed in a variety of industries.

[0214] For example, in some embodiments, the peptide tags disclosed herein and the polypeptides of the present invention (peptide tag binding partners) may find utility in targeting fluorescent or other biophysical probes or labels to specific proteins. In this regard, the protein of interest may be modified to incorporate a peptide tag (e.g., one of SEQ ID NOs: 3 to 5) as described above, and a fluorescent or other biophysical probe or label may be fused or conjugated to a polypeptide (peptide tag binding partner, e.g., SEQ ID NO: 1 or 2). The modified protein and the probe or label may be contacted under suitable conditions that allow for the spontaneous formation of an isopeptide bond between the peptide tag and the polypeptide (peptide tag binding partner), thereby labeling the protein with the label or probe via an isopeptide bond. For example, the labeled polypeptides of the present invention may find utility in antibody-free Western blots, i.e., Western blots in which the labeled polypeptides are used to detect polypeptides containing DogTag or RrgATag / RrgATag2 peptides (e.g., peptides having an amino acid sequence set forth in one of SEQ ID NOs: 3 to 5) without the need for a separate labeled antibody.

[0215] In some embodiments, the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention may find utility in protein immobilization for proteomics. In this regard, a protein of interest may be modified to incorporate a peptide tag (e.g., one of SEQ ID NOs: 3 to 5), and a solid substrate may be fused or conjugated to a polypeptide (peptide tag binding partner, e.g., SEQ ID NO: 1 or 2). The modified protein and the solid substrate may be contacted under suitable conditions that allow spontaneous formation of an isopeptide bond between the peptide tag and the polypeptide (peptide tag binding partner), thereby immobilizing the protein to the solid substrate via an isopeptide bond. It will be apparent that the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention may be used to simultaneously immobilize multiple proteins to a solid phase / substrate, i.e., in a multiplex reaction.

[0216] In yet another embodiment, the peptide tags disclosed herein and the polypeptides of the invention (peptide tag binding partners) may find utility in conjugating antigens to virus-like particles, viruses, viral vectors, bacteria, or multimerisation scaffolds for vaccination. For example, the production of virus-like particles, viruses, viral vectors, or bacteria that display the polypeptides of the invention (peptide tag binding partners) (e.g., SEQ ID NO: 1 or 2) on their surface will facilitate the conjugation of antigens comprising peptide tags (e.g., one of SEQ ID NOs: 3 to 5) to their surface via isopeptide bonds. In this regard, multimerisation of antigens significantly enhances the immune response. Thus, in some embodiments, the molecule or component fused to the polypeptide of the invention is a viral capsid protein and / or the molecule or component fused to the peptide tag is an antigen, e.g., an antigen associated with a particular disease, such as an infection, an autoimmune disease, an allergy, or cancer.

[0217] In other embodiments, the peptide tags disclosed herein and the polypeptides of the invention (peptide tag binding partners) may be used to cyclize a protein, e.g., an enzyme, for example, by fusing the peptide tag and binding partner to each end of the protein, e.g., an enzyme, and then allowing the spontaneous formation of an isopeptide bond between the peptide tag and the polypeptide (peptide tag binding partner). In this regard, cyclization of enzymes has been shown to increase enzyme resilience.

[0218] In particular, cyclization of enzymes or enzyme polymers (fusion proteins) can improve the thermal stability of proteins or protein units in enzyme polymers. In this regard, enzymes are valuable tools in many processes, but are unstable and difficult to recover. Enzyme polymers have higher stability to temperature, pH, and organic solvents, and there is an increasing demand for the use of enzyme polymers in industrial processes. However, glutaraldehyde non-specific reactions are commonly used to generate enzyme polymers, which damage or denature (i.e., reduce activity) many potentially useful enzymes. Site-specific conjugation of proteins to chains (polymers) via isopeptide bonds using the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention is expected to increase enzyme resilience, such as in enzymes added to diagnostics or animal feed. In a particularly preferred embodiment, enzymes may be stabilized by cyclization, as described above.

[0219] Using the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention, multiple enzymes could be linked to pathways that promote metabolic efficiency, as described in WO 2016 / 193746. In this regard, multiple enzymes often work together in intracellular pathways, and it has traditionally been difficult to link multiple enzymes together outside the cell (in vitro). Thus, the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention can be used to couple or conjugate enzymes to produce fusion proteins, thus enhancing the activity of multi-step enzyme pathways, which can be useful for various industrial transformations or diagnostics.

[0220] The peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention may also find utility in the production of antibody polymers. In this regard, antibodies are one of the most important classes of pharmaceuticals and are often used by attaching them to a surface. However, antigens are mixed into the sample, and therefore capturing antigens in the sample is inefficient near the surface. It is expected that extending the antibody chains will improve the capture efficiency. This will be particularly beneficial in the isolation of circulating tumor cells, which is currently one of the most promising methods for enabling early cancer diagnosis.

[0221] In yet another embodiment, the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention may find utility in the manufacture of drugs that activate cell signaling. In this regard, many of the most effective ways to activate cell functions are via protein ligands. However, protein ligands, by their nature, usually do not act alone, but in specific combinations with other signaling molecules. Thus, the peptide tags disclosed herein and the polypeptides (peptide tag binding partners) of the present invention allow the generation of tailored fusion proteins (i.e., groups of proteins) that can optimally activate cell signaling. These fusion proteins (groups of proteins) may be applied to control cell survival, division, or differentiation.

[0222] In yet another embodiment, the peptide tags disclosed herein and the polypeptides of the invention (peptide tag binding partners) may find utility in generating hydrogels for the growth of eukaryotic cells, e.g., neurons, stem cells, preparing biomaterials, functionalizing antibodies with dyes or enzymes, and stabilizing enzymes by cyclization.

[0223] The primary utility of the affinity purification polypeptides of the invention is in the isolation and / or purification of molecules or components comprising a peptide tag as defined herein. Thus, in a further aspect, the invention provides a method for purifying or isolating a molecule or component comprising a peptide (i.e., a cognate peptide tag) having an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11, said method comprising: a) providing a solid substrate having an affinity purification polypeptide of the invention (e.g., SEQ ID NO:18) immobilized thereon; b) providing a sample containing said molecule or component; c) contacting said solid substrate in a) with said sample in b) under conditions that allow said peptide to selectively bind to said polypeptide, thereby forming a non-covalent complex between said polypeptide immobilized on said solid substrate and a molecule or component that comprises said peptide; d) washing the solid substrate with a buffer; e) separating said molecule or component comprising said peptide from said polypeptide immobilized on said solid substrate; The present invention provides a method comprising:

[0224] The cognate peptide tags of the affinity purification systems described herein may be fused or conjugated to other molecules or other components or entities (i.e., fusion partners) to facilitate their purification prior to other downstream applications, such as, for example, reacting the cognate peptide tag with a peptide tag-binding partner polypeptide (e.g., DogCatcher, i.e., a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1). Such molecules or components (i.e., entities) may be nucleic acid molecules, proteins (e.g., antibodies), peptides, lipids, small organic compounds, fluorophores, metal-ligand complexes, polysaccharides, nanoparticles, nanotubes, polymers, cells, organelles, vesicles, viruses, virus-like particles, viral vectors, or any combination thereof.

[0225] Thus, the method or use of the invention may be used to purify or isolate nucleic acid molecules, proteins (e.g. antibodies), peptides, lipids, small organic compounds, fluorophores, metal-ligand complexes, polysaccharides, nanoparticles, nanotubes, polymers, cells, organelles, vesicles, viruses, virus-like particles, viral vectors or combinations thereof to which the cognate peptide tag is fused or conjugated. Further examples of molecules or components to which the peptide tag may be fused or conjugated are given above.

[0226] In the context of the present invention relating to linking a cognate peptide tag to a molecule or component for purification or isolation in a method or use of the present invention, the term "conjugating" or "linking" refers to binding the peptide tag to the molecule or component, e.g., a protein, via a covalent bond, in particular via a peptide bond between the peptide tag and the polypeptide. In relation to linking an affinity purification polypeptide of the present invention to a solid substrate, "conjugating" or "linking" refers to binding the polypeptide to the solid substrate, e.g., a bead, via a covalent bond, in particular via a thioether bond between the polypeptide (e.g., a cysteine ​​residue in the polypeptide) and the solid substrate.

[0227] The samples used in the methods of the invention (i.e., samples containing molecules or components, e.g., recombinant proteins, that contain the cognate peptide tag) may be obtained from any biological and clinical samples, for example from any cell or tissue sample of an organism (eukaryotic, prokaryotic) or any body fluid or preparation derived therefrom, as well as samples of cell cultures, cell preparations, cell lysates, etc. The samples may be freshly prepared or may be pre-treated in any convenient way, e.g., for storage.

[0228] In some embodiments, the step of separating a peptide-containing molecule or component from a polypeptide immobilized on a solid substrate may comprise subjecting said solid substrate to conditions suitable for disrupting the (affinity purification) polypeptide:cognate peptide tag complex, i.e., conditions suitable for disrupting the non-covalent interaction between the polypeptide and the cognate peptide tag. Suitable conditions may depend on the molecule or component linked or conjugated to the polypeptide and may be determined using routine experimentation.

[0229] In representative embodiments, conditions suitable for disrupting a polypeptide:cognate peptide tag complex may include contacting the complex with a solution containing imidazole (e.g., at least 1.0 M, e.g., 1.0-4.0 M, 1.0-3.0 M, or 2.0-3.0 M, preferably about 2.5 M imidazole). Other conditions suitable for disrupting the complex include contacting the solid substrate with a low pH solution or buffer (e.g., 0.1 M glycine, pH 2.0, 4° C.), exposing the complex to elevated temperatures, e.g., temperatures of at least 30° C., 35° C., 40° C., or 45° C., 30° C.-65° C., 35° C.-60° C., 40° C.-55° C., etc., and / or incubating the complex with a solution containing a competitor (e.g., a cognate peptide tag as defined above, e.g., SEQ ID NO: 3).

[0230] In some embodiments, the solid substrate may be subjected to these conditions repeatedly, for example, two, three, four, five or more times, to maximize the yield of the molecule or component to be purified. In some embodiments, it may be advantageous to use a combination of conditions, for example, a first step using a solution containing imidazole in combination with a second step using a low pH solution or buffer, to maximize the yield of the molecule or component to be purified. Any suitable combination of conditions may be used, and such combinations are within the understanding of those skilled in the art. In embodiments in which peptide competitive elution is used, i.e., in which the complex is incubated with a competitor such as a cognate peptide tag, the elution step may be repeated multiple times, for example, two, three, four, five or more times. A "low pH solution or buffer" may be considered as any solution or buffer suitable for disrupting the non-covalent interaction between the (affinity purified) polypeptide of the invention and its cognate peptide tag partner. In some embodiments, said low pH solution or buffer is an antibody elution buffer. In this regard, it is clear that the pH of the solution required to disrupt the interaction between the (affinity purified) polypeptide of the invention and its cognate peptide tag partner may depend on the components in said solution. By way of example, the antibody elution buffer may comprise or consist of 50 mM glycine at pH 2.2-2.8 or 100 mM citrate buffer at pH 3.5-4.0. Thus, in some embodiments, the low pH solution or buffer has a pH of 4.0 or less, e.g., 3.9, 3.8, 3.7, 3.6, 3.5, 3.4, 3.3, 3.2, 3.1, 3.0 or less, e.g., about 1.5-3.5, 1.6-3.4, 1.7-3.3, 1.8-3.2, 1.9-3.1, or 2.0-3.0, such as about 2.2-2.8 or 2.5-2.7.

[0231] The conditions used to disrupt the (affinity purified) polypeptide:cognate peptide tag complex are preferably such that the cognate peptide tag remains usable in downstream applications, i.e., the conditions do not result in irreversible loss of activity of the cognate peptide tag.

[0232] Although the use of peptide tags as defined herein in affinity purification is particularly advantageous as they confer downstream functionality to the purified molecule or component (i.e., the ability to conjugate to other molecules via a peptide tag binding partner polypeptide of the invention), the methods of the invention may find utility in purifying or isolating the target molecule or component alone, i.e., without the peptide tag. This may be achieved by separating the target molecule or component from the polypeptide immobilized on a solid substrate by a cleavage reaction that cleaves the peptide tag from the target molecule or component.

[0233] Thus, in some embodiments, the step of separating the peptide-containing molecule or component from the polypeptide immobilized on the solid substrate may include subjecting said solid substrate to conditions suitable for cleaving the peptide tag from the peptide tag-containing molecule or component, e.g., on-resin tag cleavage. This may be achieved by incorporating (e.g., genetically encoding) a cleavage site between the peptide tag and the target molecule or component that is recognizable by one or more proteases specific for that site. Cleavage of the target molecule:peptide tag fusion by a specific protease at the cleavage site releases the target molecule or component from the polypeptide:cognate peptide tag complex, while the peptide tag remains bound to the polypeptide. Suitable proteases and their respective recognition sites are well known in the art, and any suitable configuration may be utilized in the method.

[0234] Thus, in some embodiments, the molecule or component comprising the peptide tag comprises a cleavage site between the peptide tag and the molecule or component, e.g., a cleavage site linking the peptide tag and the molecule or component. In another aspect, the peptide tag is indirectly fused or conjugated to the molecule or component via a cleavable linker. In some embodiments, the cleavage site or cleavable linker is a protease cleavage site, such as a TEV recognition site. Thus, in some embodiments, the step of separating the peptide-containing molecule or component from the polypeptide immobilized on the solid substrate may include contacting the solid substrate with an entity (e.g., a protease, e.g., SuperTEV) under conditions suitable for cleaving the cleavage site or cleavable linker, thereby releasing the molecule or component from the peptide tag and the polypeptide immobilized on the solid substrate.

[0235] Prior to the separation of the complex from the solid substrate, the step of washing the solid substrate with a buffer solution may utilize any suitable buffer solution, for example, TBS. The buffer solution may be selected based on the molecule or component that is conjugated or linked to the peptide tag. Furthermore, the step of washing the solid substrate may be repeated multiple times, for example, two, three, four, five or more times. In another aspect, in some embodiments, the method may include multiple washing steps, and the same or different washing conditions may be used in each step.

[0236] If the solid substrate comprises beads (e.g., agarose-based beads), the volume of buffer used in the wash step may be at least about 2 times the volume of the beads, for example, at least about 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times the volume of the beads.

[0237] In some embodiments, the solid substrate is subjected to stringent washing conditions. The nature of the stringent washing conditions depends on the molecule or component that is conjugated or linked to the peptide tag and / or the composition of the solid substrate. Those skilled in the art can select such conditions as a matter of routine.

[0238] The temperature of the washing and separation (elution) steps can be readily determined by one of skill in the art based on routine experimentation and can depend on the nature of the molecule or component to be isolated or purified. In some embodiments, the washing and / or separation steps are performed at 10° C. or lower, e.g., 9° C., 8° C., 7° C., 6° C., 5° C., or 4° C. or lower.

[0239] It may be useful, but it will be clear that this is not essential, to immobilize the affinity purified polypeptide of the invention on a solid support before contacting it with a sample containing a molecule or component that contains a cognate peptide tag. For example, the binding of the polypeptide of the invention to the component that contains the cognate peptide tag may be carried out in solution, and the solution is applied to a solid support or solid phase, e.g., a column, for subsequent washing and separation (e.g., elution) steps. In some embodiments, the polypeptide:cognate peptide tag complex is applied to the solid phase under conditions suitable for immobilizing the complex to the solid phase via the polypeptide (e.g., an immobilization domain on the polypeptide), washed under suitable conditions, and then subjected to one or more of the above conditions, such as contacting with a solution containing imidazole, to disrupt the complex, thereby separating the component that contains the cognate peptide tag from the polypeptide.

[0240] In a further aspect, the present invention provides a device for use in a method or use as defined herein above, comprising a solid substrate to which is immobilized a (affinity purification) polypeptide of the invention.

[0241] In some embodiments, the device may comprise a chromatography column comprising a solid substrate to which an (affinity purification) polypeptide of the invention is immobilized. The device may further comprise means for contacting the solid substrate with the sample, a wash buffer, and an elution buffer, and / or means for removing (e.g., aspirating) or recovering liquid (e.g., wash-through fraction, elution fraction) from the solid substrate.

[0242] In a further aspect, the present invention relates to a kit, in particular a kit for use in the preparation of a solid substrate to which an inventive (affinity purification) polypeptide is immobilized, comprising a) an (affinity purified) polypeptide of the invention; and b) means for immobilizing the polypeptide according to a) on a solid substrate; A kit is provided, comprising:

[0243] In a further embodiment, the kit further comprises a solid substrate as defined above.

[0244] Means for immobilizing a polypeptide of the invention on a solid substrate may include a solid substrate (e.g., a resin) and / or a reagent for activating the polypeptide (e.g., tris(2-carboxyethyl)phosphine), a reagent for coupling the polypeptide to the solid substrate (e.g., a coupling buffer such as 50 mM Tris-HCl, 5 mM EDTA, pH 8.5), and / or a reagent for blocking the solid substrate (e.g., L-cysteine-HCl in a coupling buffer).

[0245] The invention will now be described in more detail in the following non-limiting examples and with reference to the figures set out below. [Brief description of the drawings]

[0246] [Figure 1] Figure 1: Amide bond formation rates of R2Tag / R2Catcher and the increase with DogTag (DogTag / R2Catcher curve) and DogCatcher (DogTag / DogCatcher curve) were measured at 25°C in PBS, pH 7.5, using 5 μM of each protein. Mean ± 1 standard deviation, n=3, based on SDS-PAGE densitometry. Some error bars are too small to be visible. [Diagram 2]Figure 2: Determination of second-order rate constants for DogTag / DogCatcher and R2Tag / R2Catcher. (A) Time course of DogTag / DogCatcher or R2Tag / R2Catcher reactions. 5 μM AviTag-DogTag-MBP and 5 μM DogCatcher, or 5 μM AviTag-R2Tag-MBP and 5 μM R2Catcher were incubated in PBS, pH 7.5 at 25°C and quantified by SDS-PAGE / Coomassie and densitometry (mean ± 1 standard deviation, n = 3). Some error bars are too small to be visible. The resulting second-order rate constants are marked (mean ± 1 standard deviation, n = 3). (B) The y-axis of (A) has been expanded to make the data for R2Tag / R2Catcher more visible. [Diagram 3] Figure 3: Sequence alignment of R2Catcher (SEQ ID NO: 6) with DogCatcher (SEQ ID NO: 1). The mutations making DogCatcher are underlined and in bold. [Figure 4] Figure 4: Condition dependence of DogTag / DogCatcher reactivity. (A) pH dependence. 2 μM AviTag-DogTag-MBP and 2 μM DogCatcher were reacted for 30 min at 25°C in SPG buffer with the pH indicated in the figure. (B) Temperature dependence. 2 μM AviTag-DogTag-MBP and 2 μM DogCatcher were reacted for 30 min at 25°C in SPG with pH 7.0 at the temperature indicated in the figure. (C) Buffer dependence. 5 μM AviTag-DogTag-MBP and 5 μM DogCatcher were reacted for 5 min at 25°C in the buffer indicated in the figure (HBS is HEPES-buffered saline, TBS is Tris-buffered saline) at pH 7.5. Data are mean ± 1 standard deviation, n = 3, some error bars are too small to be visible. [Diagram 5]Figure 5: DogTag / DogCatcher reaction to completion with DogTag internal. (A) The DogCatcher reaction kinetics with HaloTag7SS with DogTag internal was similar to that with the unconstrained DogTag in AviTag-DogTag-MBP. Data are means ± 1 standard deviation, n=3, some error bars are too small to see. (B) DogTag / DogCatcher reaction was run to completion. DogCatcher was incubated with HaloTag7SS-DogTag in PBS pH 7.5 for 200 min, followed by SDS-PAGE with Coomassie staining. +=10 μM, ++=20 μM. M=molecular weight marker. Densitometry showed loss of 98% of HaloTag7SS-DogTag in the presence of excess DogCatcher. In the presence of excess HaloTag7SS-DogTag, 98% loss of DogCatcher was observed. [Figure 6] Figure 6: DogTag worked well within the β-barrel domain of sfGFP and had faster kinetics than SpyTag003. Quadratic kinetics plot comparing the kinetics of DogCatcher for DogTag in sfGFP loop A to the kinetics of SpyCatcher003 for SpyTag003. Mean ± 1 standard deviation, n = 3. Some error bars are too small to be visible. [Figure 7] Figure 7: Tag reactivity and enzyme activity after insertion of the tag into the loop of isovaleraldehyde reductase. Second-order reaction plot. DogTag / DogCatcher had a faster reaction rate than SpyTag003 / SpyCatcher003 in loop B of Gre2p. [Figure 8]Figure 8: DogTag / DogCatcher orthogonality. (A) DogTag reacted with DogCatcher but not with SnoopCatcher or SpyCatcher003. 15 μM DogCatcher, Affi-SnoopCatcher, or SpyCatcher003 were incubated with 10 μM HaloTag7SS-DogTag in PBS, pH 7.5 at 25°C for 24 hours, followed by SDS-PAGE with Coomassie staining. (B) DogCatcher reacted with DogTag and SnoopCatcher. 15 μM DogCatcher was incubated with 10 μM HaloTag7SS-DogTag, SpyTag003-MBP, SnoopTagJr-Affi, Affi-SnoopCatcher, or SpyCatcher003 in PBS pH 7.5 at 25° C. for 24 hours, followed by SDS-PAGE with Coomassie staining. M=molecular weight marker. [Figure 9] FIG. 9: Bar graph showing the effect of various modifications to R2Catcher on its solubility based on the yield of soluble protein obtained from 1 L of E. coli culture after Ni-NTA purification. [Figure 10]Figure 10 shows the results of specific targeting of ion channels on the mammalian cell surface with DogTag / DogCatcher. (A) Insertion of DogTag had little effect on ion channel opening. Representative intracellular calcium measurements (Ca2+ i) (mean ± 1 SD, n = 4) from one 96-well plate show that 30 nM (-)-Englerin A (present during the period indicated by the horizontal line) activated TRPC5-SYFP2 (gray trace) or TRPC5-DogTag-SYFP2 (middle trace) in HEK293 cells. In cells transfected with empty vector, (-)-Englerin A did not induce a calcium response (lower trace). (B) Rapid labeling of cell surface with DogCatcher. COS-7 cells expressing TRPC5-DogTag-SYFP2 or TRPC5-SYFP2 control were incubated with 5 μM biotin-DogCatcher-MBP at 25°C for the times indicated. Cell lysates were immunoprecipitated with GFP-Trap and then blotted for either biotin (upper panel) or fluorescent protein (lower panel). (C) The DogCatcher reaction had little effect on ion channel opening. Representative intracellular calcium measurements (Ca2+ i) from one 96-well plate (mean ± 1 standard deviation, n = 6) show activation of TRPC5-DogTag-SYFP2 in HEK293 cells by 10 nM (-)-Englerin A (present for the period indicated by the horizontal line) with (gray trace) or without (black trace) 30 min pretreatment with 5 μM biotin-DogCatcher-MBP. EXAMPLES

[0247] Example 1: Improvement of the tag-catcher pair derived from RrgA domain 4 RrgA is an adhesin from Streptococcus pneumoniae that consists of four domains. Domain 4 (residues 734-861) forms a spontaneous intramolecular isopeptide bond by transamidation of Lys742 and Asn854 by Glu803. By dividing and engineering this domain, the protein coupling reagents R2Catcher (also known as RrgACatcher (SEQ ID NO: 6), which corresponds to residues 734-838 of RrgA and contains a reactive Lys and a catalytic Glu) and R2Tag (SEQ ID NO: 17, which corresponds to residues 838-860 of RrgA) have been created.

[0248] Although mixing of R2Tag and R2Catcher successfully reconstituted and reacted, the reaction rate was slow (Fig. 1). The second-order rate constant was determined to be 3 ± 0.1 M in PBS at pH 7.4 at 25 °C. -1 s -1 (mean ± 1 standard deviation, n = 3) (Figure 2). R2Tag was engineered for faster reconstitution. The flexible Gly at position 842 in the β-strand was replaced with Thr, which maintains hydrophilicity and is more favored in β-sheets. Asp848 was replaced with Gly to favor tight turn formation. Asn847 was replaced with Asp to improve electrostatic interaction with Lys849. R2Tag with mutations G842T, N847D, and D848G (referred to as DogTag, SEQ ID NO: 3) improved the reaction with R2Catcher by 10-fold. The second-order rate constant of DogTag with R2Catcher was 30 ± 2 M. -1 s -1 (mean ± 1 standard deviation, n = 3).

[0249] The main problem with R2Catcher is its limited solubility in PBS at pH 7.4 (approximately 140 μM), which is lower than that of SpyCatcher (>1 mM). SnoopLigase, a polypeptide derived from the D4 domain of RrgA, has previously been computationally optimized using PROSS and Rosetta, resulting in the mutations D737S, D838G, and I839V. However, mutations in acidic residues in R2Catcher variants resulted in proteins that were highly insoluble at neutral pH. The inventors observed that the predicted pI of R2Catcher was close to neutral (6.6), and hypothesized that the solubility of the protein could be improved by introducing mutations that increase the surface negative change of R2Catcher. The inventors identified a number of mutations that could increase the surface negative change of the polypeptide. Selected mutations were evaluated with Rosetta to determine whether they significantly reduced the predicted stability of the polypeptide (see Table 1).

[0250] [Table 1]

[0251] The combination of mutations D737E, N744D, N746T, N780D, K792T, and N825D, in addition to A808P, which was introduced to reduce the structural flexibility of the R2Catcher β-turn, increased the solubility to 316 μM in PBS at pH 7.4. The resulting mutant was named R2CatcherB (SEQ ID NO: 8).

[0252] Example 2: Improving R2Catcher responsiveness Phage display of novel protein scaffolds often faces obstacles including misfolding, degradation in the periplasm, loss of phage infectivity, and accumulation of frameshifted or truncated variants. For this reason, it was necessary to rationally optimize R2Catcher before attempting directed evolution. Having obtained highly soluble R2CatcherB, we applied directed evolution to improve the reaction rate. A mutant library of R2CatcherB was generated by error-prone PCR. In conventional phage display panning, non-covalently bound phages are eluted from the bait protein under conditions such as glycine at pH 2.5. In the approach adopted here, this same washing method was used to remove non-covalently bound phages and select only variants that allow isopeptide bond formation. The phages were then specifically eluted using TEV protease. After multiple rounds of phage display and evaluation of different phage libraries, the best performing variant, called DogCatcher (SEQ ID NO: 1), reacted with AviTag-DogTag-MBP 25-fold faster than R2Catcher (760 ± 20 M -1 s -1 , mean ± 1 standard deviation, n=3) (Figures 1 and 2). DogCatcher contained three additional mutations compared to R2CatcherB (F802I, A820S, and Q822R) (Figure 3). The effect of these mutations on domain stability was assessed individually using Rosetta and predicted to result in negligible changes (Table 1 above). Overall, DogTag / DogCatcher shows a 250-fold improvement in reaction rate compared to the initial split pair (R2Tag and R2Catcher) (Figures 1 and 2).

[0253] Example 3: Characterization of DogTag / DogCatcher The DogTag / DogCatcher pair was characterized to determine its dependence on reaction conditions (Figure 4). DogTag / DogCatcher showed poor reactivity at pH 4 and pH 5, but showed a rapid increase in reactivity up to pH 7 and maintained high reactivity at pH 8 and pH 9 (Figure 4A). DogTag / DogCatcher was shown to have substantial activity at 4°C, with high reactivity at 25°C to 37°C (Figure 4B). DogTag / DogCatcher showed high reactivity in various buffers (HEPES, PBS, Tris) and was resistant to chelating agents (EDTA) or detergents (Figure 4C).

[0254] Example 4: DogTag inserted into the loop maintained good DogCatcher reactivity The Tag / Catcher approach has been employed on hundreds of proteins, with the majority of the time the Tag is inserted at the flexible end of the protein of interest. Given that DogTag is expected to form a β-hairpin to reorganize the structure of domain 4, we hypothesized that constraining DogTag to a structured internal site of the protein would allow efficient isopeptide bond formation. We therefore performed assays on DogTag inserted between residues 139 and 140 of the α-helix of the 42 kDa HaloTag7 protein (a version we termed HaloTag7SS). Comparison with the response of the unconstrained DogTag (fused N-terminally to the MBP domain) revealed that DogTag exhibited similar reactivity in these different environments (Figure 5A). We also tested the ability of the DogTag / DogCatcher reaction to completion: when a 2-fold excess of DogCatcher was used, 98% of the HaloTag7SS-DogTag reacted (Figure 5B). Conversely, when a 2-fold excess of HaloTag7SS-DogTag was used, 98% of the DogCatcher reacted (Figure 5B).

[0255] Example 5: DogTag had better Catcher reactivity in superfolder GFP than SpyTag003 Ideally, a tag such as SpyTag003 or DogTag should be inserted into a loop in a protein, with high reactivity with the catcher protein and with the ability to retain the function of the host protein. In the first case, DogTag or SpyTag003 flanked by G5S linkers was cloned into a loop in superfolder GFP (sfGFP), a β-barrel protein that has previously been shown to tolerate loop insertions. All variants of sfGFP were soluble expressed (containing DogTag or SpyTag003 and loop A, loop B, or loop C). A large difference in reactivity was observed between the Catchers. In the reaction between DogTag and DogCatcher in loop A (Figure 6), the second-order rate constant was 1.0 ± 0.08 × 10 3 M -1 s -1 (mean ± 1 standard deviation, n = 3), which is comparable to the kinetics for terminal DogTag fusions (Fig. 2). In contrast, the second-order rate constant for the SpyCatcher003 reaction with SpyTag003 in the same loop of sfGFP was 87 ± 8 M -1 s -1 (mean ± 1 standard deviation, n = 3), and the rate of terminal fusion in SpyTag003 (5.5 ± 0.6 × 10 5 M -1 s -1 ) was 6,000 times slower than All loop insertion variants of sfGFP showed absorption intensities and spectra comparable to those of the unfused wild-type sfGFP. Similarly, there was only a small change in the intensity or spectrum of the fluorescence emission for any of the variants. Thus, the insertion of DogTag or SpyTag003 was well tolerated to retain the function of the fluorescent protein.

[0256] Example 6: DogTag can be inserted into a loop in an enzyme while maintaining catalytic activity The Tag / Catcher reaction has been used to scaffold multienzyme complexes and to create catalytic hydrogels. The isovaleraldehyde reductase Gre2p has been used for this application with SpyTag / SpyCatcher and has a mixed β-α-β Rossmann fold. This protein was chosen to test whether DogTag / DogCatcher can be used for enzymes that must remain flexible to function efficiently. Three loops in Gre2p, distant from the active site, were selected to insert DogTag or SpyTag003 flanked on either side by G5S linkers. All SpyTag003 or DogTag insertions allowed for expression of soluble enzyme. The reduction of isovaleraldehyde to isoamyl alcohol by Gre2p is NADPH dependent. NADPH is converted to NADP + The reactions of wild-type (WT) and loop-inserted Gre2p variants were monitored using the absorbance change upon oxidation to . In the presence of SpyTag003 or DogTag on each loop, isovaleraldehyde reductase activity was successfully maintained within a two-fold range of that of wild-type Gre2p (Table 2). [Table 2] In loop B of Gre2p, the second-order rate constant for the reaction of DogTag with DogCatcher is 527 ± 80 M -1 s -1 However, SpyTag003 reacted much slower with SpyCatcher003 (93±13M -1 s -1 ;mean ± 1 standard deviation, n = 3, Figure 7).

[0257] Example 7: DogTag / DogCatcher orthogonality test SnoopTagJr / SnoopCatcher is derived from the D4 domain of RrgA and is orthogonal to the SpyTag / SpyCatcher family of Tag / Catchers. We tested the cross-reactivity of DogTag / DogCatcher with SnoopTagJr / SnoopCatcher or SpyTag003 / SpyCatcher003. DogTag reacted only with DogCatcher, even after 24 hours at high protein concentrations (Figure 8A). DogCatcher reacted only with Tag / Catcher constructs containing DogTag (Figure 8B). As a result, DogCatcher did not react with SpyTag003, SpyCatcher003, or SnoopTagJr. In contrast, DogCatcher reacted to completion with HaloTag7SS-DogTag or SnoopCatcher (Figure 8B). DogCatcher reacts with SnoopCatcher because SnoopCatcher contains a DogTag-like sequence at its C-terminus (DogCatcher similarly contains a SnoopTag-like sequence at its N-terminus).

[0258] Example 8: DogCatcher specifically reacts with ion channels on the surface of mammalian cells A variety of cell surface proteins lack membrane-accessible N- or C-termini and therefore may facilitate covalent labeling with exogenous probes by loop-mediated ligation. Transient receptor potential canonical 5 (TRPC5) is a Na + and Ca 2+ TRPC5 is a permeable ion channel that has been implicated in a variety of pathologies, including anxiety, renal disease, cardiovascular disease, and metabolic disease. Both termini of TRPC5 are located on the cytoplasmic side of the membrane. The DogTag was genetically inserted between residues 460 and 461 in the second extracellular loop of TRPC5, distal to the pore. The bright, rapidly maturing yellow fluorescent protein SYFP2 was fused to the C-terminus, allowing imaging of the distribution of total TRPC5 but not highlighting the active surface pool. The functionality of the DogTag insertion was tested by intracellular calcium measurements in transiently transfected HEK293 cells and by stimulating TRPC5 opening with the sesquiterpinoid activator, (-)-Englerin A. The DogTag fusion formed functional channels with efficient agonist responses (Fig. S10A). The efficacy of DogCatcher recognition at the cell surface was tested by adding biotin-DogCatcher-MBP to COS-7 cells expressing TRPC5-DogTag-SYFP2. After GFP-Trap pulldown of the SYFP2 fusion, whole-cell lysates were blotted with streptavidin-HRP. The reaction of DogCatcher with TRPC5-DogTag-SYFP2 was rapid and detectable after only 1 min of incubation, with negligible signal on negative control cells lacking the DogTag fusion (Figure 10B). We also tested the functionality of TRPC5 in HEK293 cells after labeling with biotin-DogCatcher-MBP. Labeling with DogCatcher did not affect TRPC5-mediated calcium influx in these cells stimulated by (-)-Englerin A (Fig. S4C). To visualize the surface-exposed TRPC5 pool, a unique cysteine ​​was introduced at the N-terminus of DogCatcher and coupled with maleimide-Alexa Fluor 647 to yield DogCatcher-647. DogCatcher-647 enabled selective staining of TRPC5-DogTag-SYFP2 in COS-7 cells compared with controls lacking DogTag, and the receptor was visualized by confocal fluorescence microscopy. DogCatcher staining was observed as little as 1 min after addition, with optimal staining achieved at 10 min. Overall, DogTag / DogCatcher enabled rapid and selective covalent labeling of ion channels on the surface of different mammalian cell types.

[0259] conclusion The DogTag / DogCatcher pair is efficient for covalent protein-protein reactions in diverse protein loops. DogTag / DogCatcher shows many features that facilitate the application of the system: both partners can be genetically encoded from the 20 common amino acids, and the reaction is tolerant to a variety of conditions (4°C to 37°C, pH 6-8, detergents, and different buffers). The reaction proceeds with about 98% conversion without detectable by-products, leaving an amide bond that is expected to be highly stable. Neither DogTag nor DogCatcher contain cysteine ​​residues, allowing coupling to proteins that require reducing or oxidizing conditions. DogTag reacts efficiently with DogCatcher at the end of a protein or inserted internally in a protein, mainly in α-helical, mainly in β-sheet, or α+β fold. Good retention of fluorescence properties upon insertion into different loops of sfGFP was observed, as well as good catalytic activity in different loops of Gre2p. Insertion of DogTag into a loop of a membrane protein (TRCP5) also allowed labeling of mammalian cells. In the case of HaloTag, DogTag was inserted into a secondary structure element. Obtaining Tag / Catcher pairs with rapid and high-yield reactions is a considerable challenge. The majority of Tag / Catcher pairs in the literature require high micromolar concentrations and days for substantial coupling. In some cases, split proteins are completely unreactive. Thus, a significant protein engineering effort was required to achieve the efficient spontaneous intermolecular isopeptide bond formation shown here. The rate of DogTag / DogCatcher reaction is comparable at terminal and loop sites, and therefore DogTag / DogCatcher is a preferred pairing for reactions with a variety of loops.

[0260] material and method Cloning of plasmids and constructs PCR-based cloning and site-directed mutagenesis were performed using standard methods with Q5 High-Fidelity Polymerase (NEB) or KOD polymerase (EMD Millipore) and Gibson assembly. pDEST14-R2Catcher was obtained by cloning residues 734-838 (numbering based on PDB ID 2WW8) of the RrgA adhesin from Streptococcus pneumoniae TIGR4 (GenBank AAK74622) into a backbone derived from pDEST14-SpyCatcher (GenBank JQ478411, Addgene plasmid ID 35044). Mutations D737E, N744D, N746T, N780D, K792T, A808P, and N825D were overlaid onto R2Catcher and assembled by Gibson to form pDEST14-R2CatcherB. The phagemid vector pFab5cHis-R2CatcherB was derived from pFab5cHis-SpyCatcher-gIII. pDEST14-DogCatcher (Figure 3) was derived from pDEST14-R2CatcherB by incorporating the mutations F802I, A820S, and Q822R by Gibson assembly. pDEST14-SpyCatcher003 has been described previously (GenBank accession number MN433887, Addgene plasmid ID 133447). pET28-AviTag-R2Tag-MBP was derived from pET28a-SpyTag003-MBP (GenBank accession number MN433888, Addgene plasmid ID 133450). pET28-AviTag-DogTag-MBP was derived from pET28a-SpyTag003-MBP (GenBank accession no. MN433888, Addgene plasmid ID 133450). pET28-AviTag-DogTagNA-MBP was derived from pET28-AviTag-DogTag-MBP by Gibson assembly.pET28a-HaloTag7SS-DogTag encodes DogTag inserted between residues D139 and E140 of HaloTag7 and additionally the C61S and C261S mutations in HaloTag7 to block disulfide bond formation. pET28-Gre2p was derived from pET28-SpyTag003-sfGFP (Addgene plasmid ID 133454) by inserting the Gre2p isovaleraldehyde reductase from Saccharomyces cerevisiae (a synthetic gene block with codons optimized for expression in E. coli B strains) in place of sfGFP by Gibson assembly. The pET28-Gre2p-SpyTag003 loop inserts were obtained from pET28-Gre2p by inserting the spacer-SpyTag003-spacer (sequence GGGGSRGVPHIVMVDAYKRYKGGGGS, SEQ ID NO: 10) by Gibson assembly between residues Lys140 and Ser141 (pET28-Gre2p-SpyTag003 Loop A), between residues Glu229 and Asp230 (pET28-Gre2p-SpyTag003 Loop B), or between residues Ser297 and Thr303 (pET28-Gre2p-SpyTag003 Loop C). The pET28-Gre2p-DogTag loop insert was obtained from pET28-Gre2p by inserting spacer-DogTag-spacer (sequence GGGGSDIPATYEFTDGKHYITNEPIPPKGGGGS, SEQ ID NO: 11) between residues Lys140 and Ser141 (pET28-Gre2p-DogTag Loop A), between residues Glu229 and Asp230 (pET28-Gre2p-DogTag Loop B), or between residues Ser297 and Thr303 (pET28-Gre2p-DogTag Loop C) by Gibson assembly. pET28-sfGFP was obtained from pET28-SpyTag003-sfGFP (Addgene plasmid ID 133454) by deleting the N-terminal SpyTag003 by Gibson assembly.pET28-sfGFP-SpyTag003 loop inserts were obtained from pET28-sfGFP by inserting spacer-SpyTag003-spacer (SEQ ID NO: 10) by Gibson assembly between residues Val22 and Asn23 (pET28-sfGFP-SpyTag003 Loop A), between residues Asp102 and Asp103 (pET28-sfGFP-SpyTag003 Loop B), or between residues Asp173 and Gly174 (pET28-sfGFP-SpyTag003 Loop C). pET28-sfGFP-DogTag Loop inserts were derived from pET28-sfGFP by inserting spacer-DogTag-spacer (SEQ ID NO: 11) by Gibson assembly between residues Val22 and Asn23 (pET28-sfGFP-DogTag Loop A), between residues Asp102 and Asp103 (pET28-sfGFP-DogTag Loop B), or between residues Asp173 and Gly174 (pET28-sfGFP-DogTag Loop C). pGEX-2T-GST-BirA was a kind gift from Chris O'Callaghan, University of Oxford. pET28-MBP-sTEV is a modified TEV protease construct with the domain arrangement MBP-His6-TEV protease-Arg6 but does not contain an internal TEV cleavage site between MBP and TEV protease. The TEV protease domain contains the following solubility / stability mutations (numbers indicate standard TEV protease numbering scheme): C19V, L56V, C110V, C130S, S135G, and S219D. pET28 Affi-SnoopCatcher was generated by cloning an anti-HER2 affibody into the N-terminus of pET28 SnoopCatcher (GenBank accession number KU500646, Addgene plasmid ID 72322). pDEST14-Cys-DogCatcher was derived from pDEST14-DogCatcher by inserting a cysteine ​​between the TEV cleavage site and the DogCatcher moiety by Gibson assembly.

[0261] Protein expression and purification R2Catcher, DogCatcher variants, AviTag-R2Tag-MBP, DogTag-MBP fusion, SpyTag003-MBP, SpyCatcher003-sfGFP, and His6-MBP were expressed in E. coli BL21 DE3 RIPL (Agilent). SpyCatcher003 was expressed in E. coli C41 DE3 (a kind gift from Anthony Watts, University of Oxford). Multiple single colonies were inoculated into 10 mL of LB containing either 100 μg / mL ampicillin (SpyCatcher003, SpyCatcher003-sfGFP, R2Catcher, or DogCatcher variants) or 50 μg / mL kanamycin (His6-MBP, SpyTag003-MBP, AviTag-R2Tag-MBP, and DogTag fusions) and grown for 16 h at 37°C with shaking at 200 rpm. For secondary cultures, a 1 / 100 dilution of the saturated overnight culture was inoculated into 1 L of autoinduction LB broth with 0.8% (v / v) glucose supplemented with the appropriate antibiotic in an ultra-yield baffled flask (Thomson Instrument Company) and grown at OD at 37°C with shaking at 200 rpm. 600After growth to an affinity of 0.5, overexpression was induced with 0.42 mM IPTG at 30°C with shaking at 200 rpm for 4 h. Cells were harvested and lysed by sonication on ice in 50 mM Tris-HCl, pH 8.0, containing 300 mM NaCl, 10 mM imidazole with mixed protease inhibitors (cOmplete mini EDTA-free protease inhibitor cocktail, Roche) and 1 mM phenylmethylsulfonyl fluoride (PMSF), and purified by Ni-NTA (Qiagen). Proteins were dialyzed into PBS, pH 7.5 (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4) using 3.5 kDa molecular weight cut-off dialysis tubing (Spectrum Labs). MBP-sTEV was expressed and purified as described above, except that no protease inhibitor cocktail tablets were used. Protein concentration was determined by OD using the extinction coefficient of ExPASy ProtParam. 280 was obtained from. GST-BirA was expressed in E. coli BL21 DE3 RIPL (Agilent). Multiple single colonies were inoculated into 10 mL of LB containing 100 μg / mL ampicillin and grown for 16 h at 37 °C with shaking at 200 rpm. For the secondary culture, a 1 / 100 dilution of the saturated overnight culture was inoculated into 1 L of autoinduction LB broth with 0.8% (v / v) glucose supplemented with the appropriate antibiotic in an ultra-yield baffled flask (Thomson Instrument Company) and grown at OD 37 °C with shaking at 200 rpm. 600 The cells were grown until the NA was 0.5. Cells were induced with 0.42 mM IPTG at 30°C with shaking at 200 rpm for 4 h. Proteins were purified using glutathione-Sepharose purification as described (Fairhead and Howarth, 2015). AviTag was biotinylated with GST-BirA and confirmed by SDS-PAGE as described in (Fairhead and Howarth, 2015). Briefly, a master mix was made with 100 μM bait protein, 5 μL 1M MgCl2, 20 μL 100 mM ATP, 20 μL 50 μM GST-BirA, and 1.5 mM biotin in 952 μL PBS. This was incubated at 30°C for 1 h with shaking at 800 rpm. An additional 20 μL of 50 μM GST-BirA was added, followed by another incubation for 1 h. Finally, the bait was dialyzed into PBS buffer at pH 7.5 at 4°C. The extent of protein biotinylation was tested by streptavidin gel shift assay. Superfolder GFP (sfGFP) variants were expressed in E. coli BL21 DE3 RIPL. Multiple single colonies were inoculated into LB supplemented with 50 μg / mL kanamycin and grown for 16 h at 37 °C with shaking at 200 rpm. For the secondary culture, a 1 / 100 dilution of a saturated overnight culture was inoculated into LB supplemented with 50 μg / mL kanamycin and grown at 37 °C with shaking at 200 rpm until OD 600 The culture was grown to a pH of 0.5, to which 0.42 mM IPTG was added and the culture was grown for 18 hours at 22°C. Cells were harvested, lysed by sonication on ice in 50 mM Tris-HCl, pH 8.0, containing 300 mM NaCl, 10 mM imidazole containing cOmplete mini EDTA-free protease inhibitor cocktail and 1 mM PMSF, and purified with Ni-NTA (Qiagen) using standard techniques. Proteins were dialyzed into PBS, pH 7.5, using 3.5 kDa molecular weight cut-off dialysis tubing (Spectrum Labs). Protein quantification was performed using the Pierce bicinchoninic acid (BCA) Protein assay kit (Thermo Fisher) according to the manufacturer's instructions, with the modification that the protein was incubated in the assay solution at 60°C for 1 hour before reading the absorbance. The Gre2p variant was expressed in Escherichia coli BL21 DE3 RIPL. Multiple single colonies were inoculated into LB supplemented with 50 μg / mL kanamycin and grown at 37 °C for 16 h with shaking at 200 rpm. For the secondary culture, a 1 / 100 dilution of the saturated overnight culture was inoculated into LB supplemented with 50 μg / mL kanamycin and grown at 37 °C with shaking at 200 rpm until the OD 600 reached 0.5. Then, 0.42 mM IPTG was added, and the culture was grown at 25 °C for 18 h. The cells were harvested and lysed by sonication on ice in 50 mM Tris, pH 8.0, containing 300 mM NaCl, a cocktail of mixed protease inhibitors (cOmplete mini EDTA-free protease inhibitor cocktail, Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF), and purified by Ni-NTA (Qiagen) using standard procedures. The protein was dialyzed against 100 mM potassium phosphate, pH 7.4 [prepared by mixing 100 mM solutions of monobasic (KH2PO4) and dibasic (K2HPO4) potassium phosphate solutions], using a dialysis tube with a molecular weight cut-off of 3.5 kDa (Spectrum Labs). Protein quantification was performed using the Pierce BCA Protein assay kit (Thermo Fisher) according to the manufacturer's instructions.

[0262] Modeling of the R2Catcher mutation Rosetta3 was used to model the effect of the mutation on R2Catcher (Leaver-Fay et al., 2011). The crystal structure of residues 734 - 838 of RrgA (PDB code 2WW8) with the A808P mutation was relaxed, and the Rosetta Energy Units of each mutant were calculated using the pmut_scan protocol.

[0263] <Production of wild-type phage R2CatcherB> Because R2CatcherB was initially poorly displayed on the phage surface, two different cell lines were selected to identify better conditions for R2CatcherB phage production. The R2CatcherB phagemid was transformed into E. coli XL1-Blue (Agilent) or E. coli K12 ER2738 (Lucigen) and grown for 16 h at 18°C, 25°C, or 30°C to produce phages. The transformed cells were incubated at 37°C at 200 rpm until OD was reached in 50 mL of 2YT supplemented with 100 μg / mL ampicillin, 10 μg / mL tetracycline, and 0.2% (v / v) glycerol. 600 The cells were grown until the β-amyloid ratio reached 0.5 (approximately 2-3 hours). 12 Cells were infected with R408 helper phage (Agilent) in log phase and incubated at 37°C and 80 rpm for 30 min. Expression of R2CatcherB-pIII was induced with 0.1 mM IPTG, and cells were incubated at 18°C, 25°C, or 30°C and 200 rpm for 18–20 h. Phages were harvested using 1 volume of precipitation buffer [sterile, 20% (w / v) PEG8000, 2.5 M NaCl] per 4 volumes of supernatant (Keeble et al., 2017). Briefly, supernatants were mixed with precipitation buffer and incubated at 4°C for 3–4 h. Phages were pelleted by centrifugation at 15,000g for 30 min at 4°C, and the supernatant was removed. The phage pellet was resuspended in PBS (2 mL per 100 mL culture) and centrifuged at 15,000 g for 10 min at 4°C to remove residual cells, and the supernatant was transferred to a new tube. The mixture was precipitated again as before, but this time resuspended in 0.25 mL PBS per 100 mL culture. The sample was centrifuged at 15,000 g for 10 min at 4°C for a third precipitation of phage and resuspended in 0.25 mL PBS per 100 mL culture. Samples were stored short-term at 4°C (1-2 weeks) or long-term at -80°C with 20% glycerol (v / v) as cryoprotectant. Phage quantification was performed by plating serial dilutions after reinfection.

[0264] Phage library generation To generate the randomized mutagenesis library, the pFab5cHis R2CatcherB phagemid construct was used as a template for PCR reactions. The vector was amplified with oligonucleotide primers (forward primer: 5'-GGATCCAGTGGTAGCGAAAACCTCTAC (SEQ ID NO: 12); reverse primer: 5'-CATGGCGCCCTGATCTCGAGG (SEQ ID NO: 13)) using KOD polymerase (EMD Millipore). The insert was amplified with forward primer 5'- GACCTCGAGATCAGGGCGCCATG (SEQ ID NO: 14) and reverse primer 5'-GAAGTAGAGGTTTTCGCTACCACTGGATC (SEQ ID NO: 15) using the GeneMorpHII Random Mutagenesis kit (Agilent) according to the manufacturer's protocol. DpnI was added after thermal cycling, incubated at 37°C for 1 hour, and heat inactivated at 80°C for 20 minutes. Amplified fragments were separated by agarose gel electrophoresis, and vector and insert DNA bands were purified by gel extraction (Thermo Scientific). Ligations were performed with approximately 500 ng of DNA in a total volume of 20 μL at an optimized vector:insert molar ratio of 1:3. An equal volume of 2× master mix Gibson (New England Biotech) was added to the insert-vector mixture and incubated at 50°C for 16 h. DNA was concentrated on a spin filter (Wizard PCR clean up kit; Promega), and 3 μL (approximately 700 ng) of DNA was transformed into 50 μL of electrocompetent ER2738 amber stop codon suppressor cells (Lucigen) by electroporation in a Bio-Rad 2 mm electroporation cuvette in a GenePulserXcell (Bio-Rad) with voltage settings of 2.5 kV. Transformants were recovered by the addition of 950 μL of SOC medium for 1 h at 37°C and then further grown in 50 mL of 2YT medium containing 100 μg / mL ampicillin and 10 μg / mL tetracycline at 37°C for 16 h.Transformation efficiency was measured by plating serial dilutions of 1 mL of rescue culture onto agar plates supplemented with 100 μg / mL ampicillin and 10 μg / mL tetracycline. Aliquots were flash frozen and stored at -80°C. To harvest the library, 1 mL of the overnight culture was added to 250 mL of 2YT medium containing 100 μg / mL ampicillin, 10 μg / mL tetracycline, and 0.2% (v / v) glycerol and incubated at OD 37°C at 200 rpm. 600 The cells were grown until the β-amyloid ratio reached 0.5 (approximately 2-3 hours). 12 Cells were infected with R408 helper phage (Agilent) and incubated at 37 °C and 80 rpm for 30 min. Expression of the R2CatcherB-pIII library was induced with 0.1 mM IPTG and incubated at 18 °C and 200 rpm for 18-20 h. Cells were removed by centrifugation at 15,000 g for 10 min at 4 °C, and phages were purified as described above.

[0265] Phage selection Biotinylated AviTag-DogTag-MBP was used as bait to react with the R2CatcherB phage library. A non-reactive bait variant (biotinylated AviTag-DogTag NA-MBP) was included in parallel selections to assess the efficiency of panning. Reactions were performed at 25°C in PBS, pH 7.5, containing 3% (w / v) bovine serum albumin (BSA; Sigma A9418) and supplemented with 25 μM His6-MBP (to counterselect DogCatcher variants that bind MBP). In the first selection round, 10 12 The phages were mixed with 0.5 μM bait and incubated for 18 h. Three subsequent selection rounds were performed with increasing stringency (2nd round with 0.2 μM bait for 60 min; 3rd round with 0.1 μM bait for 15 min; 4th round with 0.05 μM bait for 10 min). The reaction was stopped by adding a 100-fold excess of bait without AviTag (DogTag-MBP). Phages were purified from unreacted biotinylated bait by PEG-NaCl precipitation. The pellet containing the phage-biotinylated bait adduct was resuspended in PBS pH 7.5 with 0.1% (v / v) Tween-20. 200 μL of phage was mixed with 20 μL of Biotin-Binder Dynabeads (Thermo Fisher Scientific) in a 96-well low-binding Nunc plate preblocked with 3% (w / v) BSA in PBS pH 7.5 with 0.1% (v / v) Tween-20 for 2 h at 25° C. The beads were prewashed 4 times with 200 μL / well of PBS pH 7.5 with 0.1% (v / v) Tween-20. The phage-biotinylated bait adduct was incubated with the beads in the microtiter plate for 1 h at 25° C. with shaking at 800 rpm in an Eppendorf Thermomixer. To remove weakly binding phages, the beads were washed once at 25°C with 150 μL of glycine-HCl, pH 2.2, and then four times at 25°C with 150 μL of TBS (50 mM Tris-HCl + 150 mM NaCl, pH 7.5) containing 0.5% (v / v) Tween-20. Phages were eluted from the beads by TEV protease digestion in 50 mM Tris-HCl, pH 8.0, containing 0.5 mM EDTA, for 2 h at 34°C. Eluted phages were cultured on mid-log phase ER2738 cells (OD 600 Cells were grown at 37°C and 80 rpm for 30 min, then transferred to 200 mL of 2YT supplemented with ampicillin (100 μg / mL), tetracycline (10 μg / mL), and 0.2% (v / v) glycerol and grown at 37°C and 200 rpm for approximately 2 h (OD 600 The culture was grown for 10 12The cells were infected with 100 R408 helper phages and incubated at 37 °C and 80 rpm for 30 min. Expression of R2CatcherB-pIII was induced with 0.1 mM IPTG, and the cells were incubated at 18 °C and 200 rpm for 18–20 h. The number of eluted phages was quantified by plating serial dilutions of 10 mL of rescue culture.

[0266] Isopeptide bond formation assay Reactions were typically carried out at 25°C in PBS pH 7.5. Reactions were analyzed by SDS-PAGE on 16% (w / v) polyacrylamide gels using the XCell SureLock system (Thermo Fisher) at 180V. Reactions were quenched after addition of 6x SDS loading buffer [0.23 M Tris-HCl, pH 6.8, 24% (v / v) glycerol, 120 μM bromophenol blue, 0.23 M SDS] for 5 min at 95°C in a Bio-Rad C1000 thermal cycler. Proteins were stained with InstantBlue (Expedeon) Coomassie. Band intensity was quantified using a Gel Doc XR imager and Image Lab 5.0 software (Bio-Rad). The percentage of isopeptide bond formation was calculated by dividing the intensity of the covalent complex band by the intensity of all bands in the lane and multiplying by 100. The second-order rate constant of covalent complex formation upon reaction of 5 μM AviTag-DogTag-MBP and 5 μM Catcher protein was determined by monitoring the decrease in relative intensity of the R2Catcher or DogCatcher bands and varying the concentration of unreacted Catcher variant. Time points in the linear portion of the reaction curve were analyzed. 1 / [Catcher variant] was plotted against time and analysis, including calculation of standard deviation for best fit, was performed by linear regression using Excel (Microsoft) and Origin 2015 (OriginLab Corporation). Data represent the mean ± 1 standard deviation of triplicate measurements. The temperature dependence of DogTag:DogCatcher isopeptide bond formation was assessed in triplicate at 15 min in succinate-phosphate-glycine (SPG) buffer (12.5 mM succinic acid, 43.75 mM NaH2PO4, 43.75 mM glycine; pH adjusted to 7.0 with NaOH) containing 2 μM AviTag-DogTag-MBP and DogCatcher at 4°C, 25°C, or 37°C. The pH dependence of DogTag:DogCatcher isopeptide bond formation was assessed in triplicate at pH 4, 5, 6, 7, 8, or 9 in SPG buffer containing 2 μM each of AviTag-DogTag-MBP and DogCatcher at 30 min. The buffer dependence of DogTag:DogCatcher isopeptide bond formation was assessed at 5 min in various buffers at pH 7.5 containing 5 μM AviTag-DogTag-MBP and 5 μM DogCatcher: PBS, PBS + 1 mM DTT, PBS + 1 mM EDTA, PBS + 1% (v / v) Triton X-100, PBS + 1% (v / v) Tween-20, HBS (50 mM HEPES + 150 mM NaCl), TBS (50 mM Tris-HCl + 150 mM NaCl), or Tris (50 mM Tris-HCl). The condition dependence of SpyTag003 / SpyCatcher003 was determined as follows: In the temperature dependence assay, 100 nM SpyCatcher003-sfGFP and SpyTag003-MBP were reacted in PBS, pH 7.4, supplemented with 0.2% (w / v) BSA at 4°C, 25°C, 30°C, or 37°C for 2 min. For the buffer-dependent assay, 100 nM SpyCatcher003-sfGFP and SpyTag003-MBP were reacted for 2 min at 25°C in various buffers: PBS pH 7.4, PBS pH 7.4 + 1 mM EDTA (ethylenediaminetetraacetic acid), PBS pH 7.4 + 1% (v / v) Triton X-100, PBS pH 7.4 + 1% (v / v) Tween-20, HBS (20 mM HEPES pH 7.4 + 150 mM NaCl), or TBS (20 mM Tris-HCl pH 7.4 + 150 mM NaCl). Each buffer contained 0.2% (w / v) BSA. For the pH-dependent assay, 1 μM SpyCatcher003 and SpyTag003-MBP were reacted in SPG buffer at 25°C. The completion of the reaction between DogCatcher and DogTag was tested by reacting 10 μM or 20 μM DogCatcher with 10 μM or 20 μM HaloTag7SS-DogTag in PBS at pH 7.5 for 200 minutes. 5 μM DogCatcher was reacted with either 5 μM HaloTag7SS-DogTag or AviTag-DogTag-MBP in PBS at pH 7.5 to compare the reaction of DogTag constrained in the loop (HaloTag7SS-DogTag) or DogTag without this constraint (AviTag-DogTag-MBP). Reaction of sfGFP or Gre2p loop variants was carried out by reacting 5 μM loop variant with 5 μM DogCatcher or SpyCatcher003 in PBS, pH 7.5, at 25°C. Cross-reactivity tests between DogCatcher (15 μM) and HaloTag7SS-DogTag (10 μM) were performed using Affi-SnoopCatcher, SnoopTagJr-AffiHer2, SpyCatcher003, and SpyTag003-MBP (all at 10 μM for DogCatcher reactivity tests, and Affi-SnoopCatcher and SpyCatcher003 at 15 μM for reaction with HaloTag7SS-DogTag) in PBS, pH 7.5, at 25°C for 24 hours.

[0267] Spectroscopic measurements Spectra of 0.5 μM sfGFP variants were collected at 25°C in PBS pH 7.5 using a Horiba-Yvon Fluoromax 4 with an excitation wavelength of 488 nm and a monochromator collecting fluorescence emission between 500 nm and 660 nm while collecting data with the polarizer set at the magic angle (54.7°). Absorbance spectra of 10 μM sfGFP variants were collected at 25°C in PBS pH 7.5 using a Jasco V-550 UV / VIS spectrophotometer. Data were collected every 1 nm from 250 nm to 600 nm with a scan speed of 200 nm / min, fast response, and a bandwidth of 2.0 nm. Data are the average of three biological triplicates.

[0268] Gre2p activity assay 50 nM Gre2p variants were incubated with 1.5 mM isovaleraldehyde (Merck) and 0.25 mM reduced nicotinamide dinucleotide phosphate (NADPH) (ChemCruz) in 100 mM potassium phosphate, pH 7.4 [prepared by mixing 100 mM solutions of monobasic (KH2PO4) and dibasic (K2HPO4) potassium phosphate solutions] supplemented with 0.1% (w / v) BSA and 1 mM dithiothreitol (DTT) at 25°C. The reaction was initiated by pipetting 100 μL of a 15 mM stock of isovaleraldehyde in 100 mM potassium phosphate, pH 7.4 into the reaction mixture and its progress was monitored using a Jasco V-550 UV / VIS spectrophotometer with a medium response and a band width of 5.0 nm as measured by A. 340 The decrease in saturation was measured by the decrease in saturation. Data was collected every second for 200 seconds.

[0269] DogCatcher Dye Label Dye labeling was performed with tubes wrapped in foil to minimize light exposure. Alexa Fluor 647-maleimide (Thermo Fisher) was dissolved in DMSO to 10 mg / mL. Cys-DogCatcher was dialyzed into TBS, pH 7.4 and reduced with 1 mM TCEP [tris(2-carboxyethyl)phosphine] for 30 min at 25°C. 100 μM Cys-DogCatcher was incubated with a 3-fold molar excess of dye:protein and allowed to react for 4 h at 25°C with end-over-end rotation. Unreacted maleimide was quenched with 1 mM DTT for 30 min at 25°C, after which the samples were centrifuged at 16,000 g for 5 min at 4°C to remove aggregates. Free dye was removed by dialysis against Sephadex G-25 resin (Merck) three times for at least 3 h each time at 4°C into PBS, pH 7.4.

[0270] Intracellular calcium measurement HEK293 cells were plated at 0.8 x 10 in a 6-well plate prior to transfection. 6Cells were plated at 60,000 cells / well for 24 h. Cells were transfected with 2 μg of DNA for either pcDNA4 / TO (empty vector), TRPC5-SYFP2, or TRPC5-DogTag-SYFP2 using jetPRIME transfection reagent (VWR). 24 h after transfection, cells were plated at 60,000 cells / well in black 96-well plates with clear bottoms (Greiner) and left to adhere for 16–18 h. For intracellular calcium recordings, medium was removed and replaced with SBS containing 2 μM Fura-2 AM (Thermo Fisher) and 0.01% (v / v) pluronic acid. SBS contained (values ​​in mM) NaCl 130, KCl 5, glucose 8, HEPES 10, MgCl2 1.2, and CaCl2 1.5, and was titrated to pH 7.4 with NaOH. The cells were then incubated for 1 h at 37°C. After incubation, Fura-2 AM was removed and replaced with fresh SBS. The cells were incubated for 30 min at 25°C. The SBS was then replaced with recording buffer (SBS with 0.01% (v / v) pluronic acid and 0.1% (v / v) DMSO to match compound buffer). For experiments to determine the effect of DogCatcher labeling on TRPC5 function, the cells were washed twice with SBS after Fura-2 AM incubation. SBS with or without 5 μM biotin-DogCatcher-MBP was added and the cells were incubated for 30 min at 25°C. The buffer was then replaced with recording buffer. Intracellular calcium measurements were performed using a FlexStation3 (Molecular Devices) at excitation wavelengths of 340 and 380 nm and emission wavelength of 510 nm. Recordings were performed for 5 min at 5 s intervals. At 60 s, the agonist (-)-englerin A (PhytoLab) was added from a compound plate containing compound buffer [SBS with 0.01% (v / v) pluronic acid and (-)-englerin A] to a final concentration of 30 nM (Fig. S4A) or 10 nM (Fig. S4C).

Claims

1. i) the amino acid sequence set forth in SEQ ID NO:1; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, said amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, 87th place; 9) arginine at position 89, and 10) Aspartic acid at position 92 and if said amino acid sequence contains a proline at position 75, then said amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), where these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2, said amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, and the following: 1) aspartic acid at position 7, 2) threonine at position 9; 3) aspartic acid at position 43, 4) threonine at position 55, 5) isoleucine at position 65, 6) proline at position 71, 7) Serine, 83rd place; 8) arginine at position 85, and 9) Aspartic acid at position 88 and if the amino acid sequence includes a proline at position 71, then the amino acid sequence also includes one or more amino acid residues selected from 1)-5) and 7)-9), where these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; A polypeptide comprising: A polypeptide capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, wherein the isopeptide bond is formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:

2.

2. 2. The polypeptide of claim 1, wherein the polypeptide comprises an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, 87th place; 9) arginine at position 89, and 10) Aspartic acid at position 92 wherein the designated amino acid residues are at positions corresponding to those in SEQ ID NO:

1.

3. 2. The polypeptide of claim 1, wherein the polypeptide comprises an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, a proline at position 75, and the following amino acids: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:

1.

4. 4. The polypeptide of claim 3, comprising: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, and 6) Aspartic acid at position 92 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:

1.

5. i) the amino acid sequence set forth in SEQ ID NO:1; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO:2; iii) an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, said amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) proline at position 75, and 7) Aspartic acid at position 92 as well as one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) A portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:2, the amino acid sequence comprising a lysine at position 5, a glutamic acid at position 66, 1) aspartic acid at position 7, 2) threonine at position 9; 3) aspartic acid at position 43, 4) threonine at position 55, 5) proline at position 71, and 6) Aspartic acid at position 88 as well as one or more of the following: 1) isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 and wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:2; A polypeptide comprising: A polypeptide capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, wherein the isopeptide bond is formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:

2.

6. 6. The polypeptide of claim 5, wherein the polypeptide comprises an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following amino acids: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) proline at position 75, and 7) Aspartic acid at position 92 Two or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:

1.

7. 7. The polypeptide of claim 1, comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, a proline at position 75, and the following amino acids: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, and 6) Aspartic acid at position 92 as well as one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1, A polypeptide capable of spontaneously forming an isopeptide bond with a peptide comprising the amino acid sequence set forth in SEQ ID NO:3, wherein the isopeptide bond is formed between an asparagine residue at position 17 of SEQ ID NO:3 and a lysine residue at position 9 of SEQ ID NO:1 or position 5 of SEQ ID NO:

2.

8. 7. The polypeptide of claim 1, comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1, the amino acid sequence comprising a lysine at position 9, a glutamic acid at position 70, and the following amino acid residues: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) Proline at position 75, 8) Serine, 87th place; 9) arginine at position 89, and 10) Aspartic acid at position 92 and wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:

1.

9. 7. The polypeptide of any one of claims 1 to 6, conjugated or fused to a nucleic acid molecule, a protein, a peptide, a small organic compound, a fluorophore, a metal-ligand complex, a polysaccharide, a nanoparticle, a two-dimensional monolayer (e.g., graphene), a lipid, a nanotube, a polymer, a cell, a virus, a virus-like particle, a viral vector, or a combination thereof.

10. i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) isoleucine at position 69, 7) proline at position 75, 8) Serine, 87th place 9) arginine at position 89, and 10) Aspartic acid at position 92 and if said amino acid sequence contains a proline at position 75, then said amino acid sequence also contains one or more amino acid residues selected from 1) to 6) and 8) to 10), where these designated amino acid residues are at positions corresponding to those in SEQ ID NO: 18; or iv) a portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) aspartic acid at position 7, 2) threonine at position 9; 3) aspartic acid at position 43, 4) threonine at position 55, 5) isoleucine at position 65, 6) Proline at position 71, 7) Serine, 83rd place; 8) arginine at position 85, and 9) Aspartic acid at position 88 and if the amino acid sequence includes a proline at position 71, then the amino acid sequence also includes one or more amino acid residues selected from 1)-5) and 7)-9), where these designated amino acid residues are at positions corresponding to those in SEQ ID NO:19; A polypeptide comprising: A polypeptide that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:

3.

11. i) the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine; ii) a portion of (i) comprising the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally, X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine; iii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18, wherein X at position 70 is not glutamic acid or aspartic acid, and optionally, X at position 70 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) glutamic acid at position 4, 2) aspartic acid at position 11; 3) threonine at position 13, 4) aspartic acid at position 47, 5) Threonine at position 59, 6) proline at position 75, and 7) Aspartic acid at position 92 as well as one or more of the following: 1) isoleucine at position 69, 2) serine at position 87, and 3) Arginine at position 89 wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO:1; or iv) a portion of (iii) comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19, wherein X at position 66 is not glutamic acid or aspartic acid, and optionally X at position 66 is selected from alanine, glycine, serine, asparagine, or threonine, and wherein the amino acid sequence is one of the following: 1) aspartic acid at position 7, 2) threonine at position 9; 3) aspartic acid at position 43, 4) threonine at position 55, 5) proline at position 71, and 6) Aspartic acid at position 88 as well as one or more of the following: 1) isoleucine at position 65, 2) serine at position 83, and 3) Arginine at position 85 and wherein these designated amino acid residues are at positions corresponding to those in SEQ ID NO: 19; A polypeptide comprising: A polypeptide that selectively and reversibly binds to a peptide comprising the amino acid sequence set forth in SEQ ID NO:

3.

12. 12. The polypeptide of claim 10 or 11, comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO: 18 or 19, said amino acid sequence comprising a lysine at a position corresponding to position 9 of SEQ ID NO: 18 or position 5 of SEQ ID NO:

19.

13. 12. The polypeptide of claim 10 or 11, wherein the polypeptide comprises an additional N-terminal or C-terminal sequence comprising a cysteine ​​residue.

14. 12. The polypeptide of claim 10 or 11, wherein the polypeptide comprises an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO: 18 or 19, and the polypeptide comprises a cysteine ​​residue.

15. 15. The polypeptide of claim 14, wherein the cysteine ​​residue is at a position corresponding to position 31 or 41 of SEQ ID NO:18, or at a position corresponding to position 27 or 37 of SEQ ID NO:

19.

16. 12. The polypeptide of any one of claims 1 to 6, 10 and 11, wherein the polypeptide is immobilized on a solid substrate.

17. 12. The polypeptide of any one of claims 1 to 6, 10 and 11, wherein the polypeptide is immobilized on a solid substrate via a covalent bond.

18. 12. The polypeptide of claim 10 or 11, wherein the polypeptide is immobilized on a solid substrate via a covalent bond between a cysteine ​​residue and the solid substrate.

19. 12. A recombinant or synthetic polypeptide comprising a peptide or polypeptide linked to a polypeptide according to claims 1 to 6, 10 or 11.

20. A nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide according to any one of claims 1 to 6, 10 or 11, or a nucleotide sequence encoding a recombinant polypeptide comprising a peptide or polypeptide linked to a polypeptide according to any one of claims 1 to 6, 10 and 11.

21. A vector comprising the nucleic acid molecule of claim 20.

22. 21. A cell comprising the nucleic acid molecule of claim 20 or a vector comprising said nucleic acid molecule.

23. 12. A method for producing or expressing a recombinant polypeptide comprising a polypeptide according to any one of claims 1 to 6, 10 and 11, or a peptide or polypeptide linked to a polypeptide according to any one of claims 1 to 6, 10 and 11, comprising: a) transforming or transfecting a host cell with the vector of claim 21; b) culturing said host cell under conditions allowing expression of said polypeptide; and, optionally, c) isolating said polypeptide; A method comprising:

24. 7. Use of a polypeptide according to any one of claims 1 to 6 for conjugating two molecules or components via an isopeptide bond, comprising The use, wherein the molecule or component to be conjugated via an isopeptide bond comprises the following a) and b): a) a first molecule or component comprising a polypeptide according to any one of claims 1 to 6; and b) a second molecule or component comprising a peptide selected from (i) and (ii): (i) a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17; and (ii) a peptide comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11; wherein the peptide is capable of spontaneously forming an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, and the isopeptide bond is formed between the asparagine residue at position 17 of SEQ ID NO:3, 4, 5, or 17 and the lysine residue at position 9 of SEQ ID NO:

1.

25. 25. The use according to claim 24, wherein the second molecule or moiety comprises the peptide at an internal site.

26. 25. The use according to claim 24, wherein the second molecule or moiety is a protein, and the protein comprises the peptide in a loop.

27. 10. A method for conjugating two molecules or components via an isopeptide bond, comprising: a) providing a first molecule or component comprising a polypeptide according to any one of claims 1 to 6; b) providing a second molecule or moiety comprising a peptide selected from: (i) a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17; and (ii) a peptide comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11; wherein the peptide is capable of spontaneously forming an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, the isopeptide bond being formed between the asparagine residue at position 17 of SEQ ID NO:3, 4, 5, or 17 and the lysine residue at position 9 of SEQ ID NO:1; and c) contacting said first molecule or component with said second molecule or component under conditions that allow for the spontaneous formation of an isopeptide bond between said polypeptide and said peptide, thereby conjugating said first molecule or component to said second molecule or component via an isopeptide bond to form a complex; A method comprising:

28. 28. The method of claim 27, wherein the second molecule or moiety comprises the peptide at an internal site.

29. 28. The method of claim 27, wherein the second molecule or moiety is a protein, and the protein comprises the peptide in a loop.

30. A kit comprising: (a) a polypeptide according to any one of claims 1 to 6, optionally conjugated or fused to a molecule or moiety; and (b) a peptide selected from (i) and (ii) below, optionally conjugated or fused to a molecule or moiety: (i) a peptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 5 and 17; and (ii) a peptide comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11; wherein said peptide is capable of spontaneously forming an isopeptide bond with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, said isopeptide bond being formed between an asparagine residue at position 17 of SEQ ID NO:3, 4, 5, or 17 and a lysine residue at position 9 of SEQ ID NO:1, optionally conjugated or fused to a molecule or moiety; and / or (c) a nucleic acid molecule, particularly a vector, encoding a polypeptide according to (a); and / or (d) a nucleic acid molecule, in particular a vector, encoding a peptide according to (b); Including the kit.

31. 25. The use according to claim 24, wherein the peptide is selected from (i) and (ii): (i) a peptide comprising the amino acid sequence set forth in SEQ ID NO:3; and (ii) A peptide comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:3, said amino acid sequence comprising a threonine residue at position 5, an aspartic acid residue at position 10, a glycine residue at position 11, and an asparagine residue at position 17, wherein these designated amino acid residues are at positions corresponding to their positions in SEQ ID NO:

3.

32. The method of claim 27, wherein the peptide is selected from the following (i) and (ii): (i) a peptide comprising the amino acid sequence set forth in SEQ ID NO:3; and (ii) A peptide comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:3, said amino acid sequence comprising a threonine residue at position 5, an aspartic acid residue at position 10, a glycine residue at position 11, and an asparagine residue at position 17, wherein these designated amino acid residues are at positions corresponding to their positions in SEQ ID NO:

3.

33. The kit of claim 30, wherein the peptide is selected from the following (i) and (ii): (i) a peptide comprising the amino acid sequence set forth in SEQ ID NO:3; and (ii) A peptide comprising an amino acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:3, said amino acid sequence comprising a threonine residue at position 5, an aspartic acid residue at position 10, a glycine residue at position 11, and an asparagine residue at position 17, wherein these designated amino acid residues are at positions corresponding to their positions in SEQ ID NO:

3.

34. 1. A method for purifying or isolating a molecule or component comprising a peptide having an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11, said method comprising: a) providing a solid substrate on which the polypeptide according to claim 10 or 11 is immobilized; b) providing a sample containing said molecule or component; c) contacting said solid substrate in a) with said sample in b) under conditions that allow said peptide to selectively bind to said polypeptide, thereby forming a non-covalent complex between said polypeptide immobilized on said solid substrate and a molecule or component that comprises said peptide; d) washing the solid substrate with a buffer; e) separating said molecule or component comprising said peptide from said polypeptide immobilized on said solid substrate; A method comprising:

35. 12. Use of a polypeptide according to claim 10 or 11 for purifying or isolating a molecule or component comprising a peptide having an amino acid sequence having at least 80% sequence identity to any one of the sequences set forth in SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11.

36. 12. An apparatus for use in (i) or (ii) below, comprising a solid substrate to which a polypeptide according to claim 10 or 11 is immobilised. (i) a method for purifying or isolating a molecule or component comprising a peptide having an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11; (ii) Use of the polypeptide of claim 10 or 11 for purifying or isolating a molecule or component comprising a peptide having an amino acid sequence having at least 80% sequence identity to any one of the sequences set forth in SEQ ID NOs: 3 to 5 and 17, said amino acid sequence comprising an asparagine residue at position 17, and optionally comprising a threonine residue at position 5, an aspartic acid residue at position 10, and a glycine residue at position 11.

37. A kit for use in preparing a solid substrate on which the polypeptide according to claim 10 or 11 is immobilized, comprising: a) a polypeptide according to claim 10 or 11; and b) a means for immobilizing the polypeptide according to a) on a solid substrate; Including the kit.

38. 36. The use according to claim 35, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO:

3.

39. The method of claim 34, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO:

3.

40. A polypeptide described in any one of claims 1 to 6, wherein the polypeptide is conjugated or fused to a compound or molecule having a therapeutic or prophylactic effect.

41. The polypeptide described in claim 40, wherein the compound or molecule having a therapeutic or prophylactic effect is an antibiotic, an antiviral agent, a vaccine, or an antitumor drug.

42. The polypeptide described in claim 40, wherein the compound or molecule having a therapeutic or prophylactic effect is a radioactive compound or isotope, a cytokine, a toxin, an oligonucleotide, a nucleic acid encoding a gene, or a nucleic acid vaccine.

43. The polypeptide of any one of claims 1 to 6, wherein the polypeptide is conjugated or fused to an antibody, a virus-like particle, a virus, or a multimerized scaffold for vaccination.

Images