Chimeric antigen receptor and modified cells containing the same

Abstract

The present invention relates to a chimeric antigen receptor (CAR), comprising an extracellular domain that binds one or more inflammation-associated factors, a transmembrane / hinge domain, and an intracellular domain. In a particular embodiment, T regulatory (Treg) cells express a chimeric construct encoding said CAR, further comprising Fox3p and a CAR activation-dependent NF-AT promoter that drives expression of interleukin-10 and TGF-β. The present invention also relates to a method of producing a CAR, a Treg cell expressing said CAR, and the use of said CAR to treat autoimmune diseases such as transplant rejection, graft-versus-host disease (GVHD), and cytokine release syndrome.

Description

[Technical field]

[0001] Related Applications This application is a subsidiary of Singapore Provisional Patent Application No. 10202104940X, filed on May 11, 2021, the entire disclosure of which is incorporated herein by reference.

[0002] The present invention relates to the field of biotechnology and bioengineering. In particular, the present invention relates to chimeric antigen receptors and modified cells, such as modified T cells, that contain same. [Background technology]

[0003] Inflammatory diseases or conditions are a major problem worldwide and may be caused by or associated with inflammatory cytokines.

[0004] Solid organ transplantation is currently the treatment of choice for end-stage organ failure. Early graft survival has improved due to better matching of donors and recipients and refinements in immunosuppressant therapy. However, long-term use of immunosuppressants has been shown to be associated with adverse side effects.

[0005] Similar to transplantation, administration of immunosuppressants to patients with autoimmune disease aims to target the immune and autoimmune response, leaving the patient immunocompromised. Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there is a need for new or improved therapeutic approaches for modulating immune activity and responses associated with inflammatory diseases or conditions, allogeneic transplantation, and / or autoimmune diseases or conditions. [Means for solving the problem]

[0007] In one aspect, the present disclosure relates to a chimeric antigen receptor (CAR) comprising an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain binds to one or more inflammation-associated factors.

[0008] In particular embodiments, the inflammation-associated factor is a proinflammatory cytokine or an inflammation-associated chemokine. In particular embodiments, the one or more inflammation-associated factors are selected from the group consisting of interleukin 1 (IL-1), tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), interleukin 12 (IL-12), interleukin 18 (IL-18), granulocyte macrophage colony-stimulating factor (GMCSF), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 17A (IL-17), CXCL1, CXCL2, CXCL9, CXCL10, CXCL11, CXCL16, and CCL2-20.

[0009] In a specific example, the disclosure relates to a chimeric antigen receptor (CAR) comprising an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain binds one or more proinflammatory cytokines. In a further example, the one or more proinflammatory cytokines are selected from the group consisting of interleukin 1 (IL-1), tumor necrosis factor (TNF-), interferon (IFN-), interleukin 12 (IL-12), interleukin 18 (IL-18), granulocyte macrophage colony stimulating factor (GMCSF), interleukin 6 (IL-6), interleukin 8 (IL-8), and interleukin 17A (IL-17). In one example, the proinflammatory cytokine is tumor necrosis factor alpha (TNF-α). In one example, the proinflammatory cytokine is interferon gamma (IFN-γ). In one example, the proinflammatory cytokine is interleukin 8 (IL-8).

[0010] In one example, the extracellular domain of the chimeric antigen receptor disclosed herein comprises one or more antigen binding domains, wherein each antigen binding domain is independently selected from the group consisting of an antibody, an antibody fragment, a single chain variable fragment (scFv), a chemokine receptor, or a functional variation thereof. In one embodiment, the chemokine receptor is further selected from the group consisting of CCR5, CXCR3, CCR1, and CCR2. In another embodiment, each antigen binding domain is a single chain variable fragment (scFv). In a specific embodiment, the extracellular domain comprises one or more of an scFv that binds TNF-α, an scFv that binds IFN-γ, and an scFv that binds IL-17a.

[0011] In certain embodiments, the antigen-binding domain competes with an antibody defined in Table 1 below for binding to an inflammation-associated factor.

[0012] In one embodiment, the antigen binding domain competes for binding to TNF-α with an antibody comprising SEQ ID NO:1; 19 and 20; 64; 65 and 66; 80 and 81; 85 and 86; 162 and 163; or 165.

[0013] In one embodiment, the antigen binding domain competes for binding to IFN-γ with an antibody comprising SEQ ID NO: 3; 5; 34 and 35; 49 and 50; 100 and 101; or 112 and 113.

[0014] In one embodiment, the antigen binding domain competes for binding to IL-17a with an antibody comprising SEQ ID NOs: 127 and 128; or 141 and 142.

[0015] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 20, 35, 50, 66, 81, 86, 101, 113, 128, 142, or 163, or any VL set forth in Table 1; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 19, 34, 49, 65, 80, 85, 100, 112, 127, 141 or 162, or any VH shown in Table 1 Includes.

[0016] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising the three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 20 or SEQ ID NO: 163; and (b) a heavy chain variable domain (VH) comprising the three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 19 or SEQ ID NO: 162 Includes.

[0017] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 35; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 34 Includes.

[0018] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 50; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 49 Includes.

[0019] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 66; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 65 Includes.

[0020] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 81; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 80 Includes.

[0021] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 86; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 85 Includes.

[0022] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 101; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 100 Includes.

[0023] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 113; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 112 Includes.

[0024] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 128; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 127 Includes.

[0025] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 142; and (b) a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 141 Includes.

[0026] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 29, 30, 44, 45, 59, 60, 75, 76, 95, 96, 107, 108, 122, 123, 137, 138, 151, or 152; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 31, 32, 46, 47, 61, 62, 77, 78, 97, 98, 109, 110, 124, 125, 139, or 153; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33, 48, 63, 79, 84, 99, 111, 126, 140, or 154; and (b) a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 21, 22, 23, 36, 37, 38, 51, 52, 53, 67, 68, 69, 87, 88, 89, 114, 115, 116, 129, 130, 131, 143, 144 or 145; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 27, 28, 42, 43, 57, 58, 73, 74, 82, 83, 93, 94, 105, 106, 120, 121, 135, 136, 149 or 150; Includes.

[0027] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:29; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:33; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:33; and (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:21; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:27; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:29; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:33; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:33; and (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:22; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:27; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 30; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:33; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:33; and (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:23; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:28; Includes.

[0028] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 44; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:48; (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 36; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:42; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:44; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:48; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 37; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:42; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:45; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:48; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 38; at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94% identical to the sequence of SEQ ID NO: 41; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:43; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:43. Includes.

[0029] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:59; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:63; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:63; and (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:51; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:57; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:59; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:63; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:52; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:57; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:60; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:63; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 53; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:58; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:58. Includes.

[0030] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 75; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:79; (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 67; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:73; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 75; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:79; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:68; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:73; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:76; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:79; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 69; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:74; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:74. Includes.

[0031] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 75; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:84; (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 67; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:82; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 75; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:84; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:68; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:82; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:76; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:84; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 69; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:83; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:83. Includes.

[0032] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:95; a CDR2 comprising or consisting of an amino acid sequence that is at least about 3%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:99; a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:99; and (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 87; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:93; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:95; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:99; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 88; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:93; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:96; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:99; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 89; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:94; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:94. Includes.

[0033] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 107; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:111; (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 21; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 105; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 107; a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:111; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:111; and (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 22; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 105; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 108; a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:111; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:111; and (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 23; at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94% identical to the sequence of SEQ ID NO: 104; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 106; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 106. Includes.

[0034] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 122; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 126; and (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 114; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 120; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 122; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:126; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 115; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 120; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 123; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO:126; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 116; at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94% identical to the sequence of SEQ ID NO: 119; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 121; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 121. Includes.

[0035] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 137; a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 140; a light chain variable domain (VL) comprising a CDR comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 140; and (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 129; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 135; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 137; a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 140; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 140; and (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 130; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 135; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 138; a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 140; a light chain variable domain (VL) comprising a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 140; and (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 131; at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94% identical to the sequence of SEQ ID NO: 134; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 136; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 136. Includes.

[0036] In one embodiment, the antigen recognition domain is (a) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 151; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 154; and (b) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 143; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 149; (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 151; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 154; (d) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 144; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 149; (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 that comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 152; a light chain variable domain (VL) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 154; (f) a complementarity determining region (CDR) 1 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 145; at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94% identical to the sequence of SEQ ID NO: 148; a heavy chain variable domain (VH) comprising a CDR2 comprising or consisting of an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 150; and a CDR3 comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the sequence of SEQ ID NO: 150. Includes.

[0037] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 29; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 31; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 21; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 24; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 27; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 29; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 31; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 22; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 25; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 27; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 30; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 32; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 23; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 26; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 28. Includes.

[0038] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 44; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 46; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 48; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 36; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 39; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 42; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 44; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 46; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 48; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 37; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 40; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 42; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 45; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 47; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 48; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 38; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 41; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 43. Includes.

[0039] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 59; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 61; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 63; and (b) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 51; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 54; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 57; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 59; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 61; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 63; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 52; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 55; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 57; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 60; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 62; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 63; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 53; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 56; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 58. Includes.

[0040] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 79; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 67; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 70; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 73; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 79; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 68; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 71; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 73; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 76; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 78; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 79; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 69; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 72; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 74. Includes.

[0041] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 84; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 67; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 70; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 82; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 84; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 68; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 71; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 82; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 76; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 78; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 84; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 69; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 72; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 83. Includes.

[0042] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 95; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 97; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 99; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 87; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 90; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 93; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 95; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 97; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 99; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 88; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 91; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 93; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 96; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 98; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 99; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 89; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 92; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 94. Includes.

[0043] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 107; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 109; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 111; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 21; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 102; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 105; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 107; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 109; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 111; and (d) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 22; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 103; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 105; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 108; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 110; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 111; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 23; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 104; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 106. Includes.

[0044] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 122; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 124; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 126; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 114; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 117; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 120; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 122; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 124; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 126; and (d) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 115; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 118; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 120; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 123; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 125; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 126; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 116; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 119; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 121. Includes.

[0045] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 137; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 139; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 140; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 129; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 132; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 135; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 137; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 139; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 140; and (d) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 130; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 133; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 135; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 138; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 125; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 140; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 131; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 134; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 136. Includes.

[0046] In one embodiment, the antigen recognition domain is (a) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 151; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 153; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 154; and (b) a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 143; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 146; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 149; or (c) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 151; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 153; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 154; and (d) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR)1 comprising or consisting of the amino acid sequence of SEQ ID NO: 144; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 147; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 149; or (e) a light chain variable domain (VL) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 152; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 47; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 154; and (f) a heavy chain variable domain (VH) comprising: a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 145; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 148; and a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 150. Includes.

[0047] In certain embodiments, the antigen-binding domain comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween, identity to the amino acid sequence set forth in SEQ ID NO:1.

[0048] In a specific embodiment, the antigen-binding domain comprises or consists of the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:66, having 0 to 10 amino acid insertions, deletions, substitutions, additions, or combinations thereof at one or more positions other than the CDR regions.

[0049] In certain embodiments, the antigen-binding domain comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween, identity to the amino acid sequence set forth in SEQ ID NO:3.

[0050] In a specific embodiment, the antigen-binding domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 3, having 0 to 10 amino acid insertions, deletions, substitutions, additions, or combinations thereof at one or more positions other than the CDR regions.

[0051] In certain embodiments, the antigen-binding domain comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween, identity to the amino acid sequence set forth in SEQ ID NO:5.

[0052] In a specific embodiment, the antigen-binding domain comprises or consists of the amino acid sequence set forth in SEQ ID NO:5, having 0 to 10 amino acid insertions, deletions, substitutions, additions, or combinations thereof at one or more positions other than the CDR regions.

[0053] In more specific examples, the antigen-binding domain comprises or consists of the amino acid sequence set forth in SEQ ID NO:1; comprises or consists of the amino acid sequence set forth in SEQ ID NO:3; or comprises or consists of the amino acid sequence set forth in SEQ ID NO:5.

[0054] In a more specific example, the scFv in i) has the amino acid sequence set forth in SEQ ID NO:1; the scFv in ii) has the amino acid sequence set forth in SEQ ID NO:3; and the scFv in iii) has the amino acid sequence set forth in SEQ ID NO:5.

[0055] In another aspect, the present disclosure relates to a nucleic acid comprising a nucleotide sequence encoding a chimeric antigen receptor disclosed herein. A nucleic acid encoding a chimeric antigen receptor disclosed herein may also be referred to as a first nucleic acid (in the context of the present disclosure relating to a second and / or third nucleic acid).

[0056] In another aspect, the disclosure relates to a first polynucleotide encoding a chimeric antigen receptor disclosed herein.

[0057] In another aspect, the present disclosure also relates to a nucleic acid construct or vector comprising the first nucleic acid or first polynucleotide disclosed herein. In some embodiments, the expression of the nucleic acid molecule is under the control of a transcription control sequence. In some embodiments, the transcription control sequence may be a constitutive promoter or an inducible promoter. In some embodiments, the vector is a viral vector that can be used to transform immune cells, such as T cells, to induce the expression of the CAR.

[0058] In another aspect of the disclosure, a genetically modified cell comprising a CAR disclosed herein is provided.

[0059] In another aspect of the disclosure, there is provided a genetically modified cell comprising a nucleic acid molecule as described herein, or a nucleic acid construct or vector as described herein, or a genomically integrated form of the construct or vector. The genetically modified cell may be a T cell, e.g., a Treg, an iPSC-derived T cell, e.g., an iPSC-derived Treg cell, or a CD34+ iPSC.

[0060] In another aspect of the disclosure, there is provided an engineered T cell comprising a chimeric antigen receptor as disclosed herein, a first polynucleotide or a first nucleic acid as disclosed herein, and / or a nucleic acid construct or vector as disclosed herein. The engineered T cell may be, for example, a Treg cell, such as an iPSC-derived T cell.

[0061] In one embodiment, the genetically modified cells, preferably T cells, are further modified to express one or more immunosuppressive molecules. Expression can be constitutive or inducible. Preferably, the one or more immunosuppressive molecules are expressed by the modified T cells, specifically via their signaling domains, when the modified T cells are activated, e.g., when the T cells are activated by the chimeric antigen receptors disclosed herein.

[0062] In one embodiment, inducible expression is enabled by a NFAT inducible system. Preferably, the modified T cells comprise a promoter comprising one or more binding sites for NFAT (nuclear factor of activated T cells) and a second nucleic acid or polynucleotide encoding one or more immunosuppressive molecules, wherein binding of NFAT to said promoter induces expression of the one or more immunosuppressive molecules.

[0063] In one example, the first and second nucleic acids or polynucleotides are both expressed from a single nucleic acid expression sequence as disclosed herein.

[0064] Exemplary immunosuppressive agents or molecules include, but are not limited to, IL-10, TGF-β, FOXP3, and combinations thereof. In one example, the one or more immunosuppressive molecules can suppress the activity of effector T cells or induce anergy in effector T cells. In a specific example, the one or more immunosuppressive molecules are selected from the group consisting of IL-10, TGF-β, CTLA-4, LAG3, PD-L1, and PD-1. In a specific example, the one or more immunosuppressive molecules are IL-10 and / or TGF-β. In a specific example, the second polynucleotide comprises the sequence set forth in SEQ ID NO:10.

[0065] In another aspect of the disclosure, there is provided a pharmaceutical composition comprising a genetically modified cell as disclosed herein and a pharma- ceutically acceptable carrier, diluent or excipient.

[0066] In another aspect of the present disclosure, a method of generating chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs) is provided, comprising transducing Tregs with a vector disclosed herein such that the transduced Tregs express a CAR of the present disclosure, thereby generating the chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs).

[0067] In another aspect of the present disclosure, a method is provided for generating chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs), comprising: a) isolating regulatory T cells (Tregs) from peripheral blood mononuclear cells (PBMCs) of a subject; b) expanding the isolated Tregs ex vivo; and c) transducing the expanded Tregs with a vector disclosed herein, such that the transduced Tregs express a CAR of the present disclosure.

[0068] In another aspect of the present disclosure, a method of generating modified hypoimmunogenic T cells is provided, comprising: a) modifying CD34+ iPSCs to (i) reduce or eliminate expression or activity levels of B2 microglobulin and class II MHC transactivator, and (ii) overexpress CD47 or a functional variant thereof; b) transducing the modified CD34+ iPSCs with a vector of the present disclosure, such that the transduced CD34+ iPSCs express a CAR of the present disclosure; and c) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells. Preferably, the iPSC-derived T cells are iPSC-derived T regulatory (Treg) cells.

[0069] In another aspect of the present disclosure, a method for generating modified hypoimmunogenic T cells is provided, comprising: a) providing CD34+ iPSCs; b) reducing or eliminating the expression levels of B2 microglobulin and class II MHC transactivator activity in the CD34+ iPSCs; c) overexpressing CD47 or a functional variant thereof in the CD34+ iPSCs of b); d) transducing the CD34+ iPSCs of c) with a vector of the present disclosure, such that the transduced CD34+ iPSCs express a CAR of the present disclosure; and e) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells. Preferably, the iPSC-derived T cells are iPSC-derived T regulatory (Treg) cells.

[0070] In another aspect of the present disclosure, a method for generating modified hypoimmunogenic T cells is provided, comprising: a) editing the genome of CD34+ iPSCs to reduce or eliminate expression of functional gene products of B2M (B2 microglobulin) and CIITA (class II MHC transactivator) genes; c) overexpressing CD47 or a functional variant thereof in the CD34+ iPSCs; d) transducing the CD34+ iPSCs of c) with a vector of the present disclosure, such that the transduced cells express a CAR of the present disclosure; and e) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells. Preferably, the iPSC-derived T cells are iPSC-derived regulatory T cells (Treg) cells.

[0071] In another aspect of the disclosure, a method is provided for generating engineered hypoimmunogenic T cells, comprising: a) CD34+ induced pluripotent stem cells; b) editing the genome of CD34+ iPSCs to knock out both the B2M (B2 microglobulin) and CIITA (class II MHC transactivator) genes; c) genetically incorporating CD47 or a functional variant thereof, such that the transduced iPSCs overexpress CD47; d) transducing T cells with; e) transducing the T cells with a vector of the disclosure, such that the T cells express a CAR of the disclosure; and f) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells.

[0072] In another aspect, the invention relates to a method of generating chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs), comprising isolating regulatory T cells (Tregs) from peripheral blood mononuclear cells (PBMCs) of a subject; expanding the isolated Tregs ex vivo; and transducing the expanded Tregs with a vector disclosed herein, such that the transduced Tregs express a CAR disclosed herein.

[0073] In yet another aspect, the present disclosure relates to the genetically modified cell or modified T cell of the present disclosure for use in therapy.Preferably, the modified T cell is a modified Treg cell expressing the CAR of the present disclosure.In one embodiment, the Treg cell can be an iPSC-derived Treg cell.

[0074] In yet another aspect, the present disclosure relates to a genetically modified cell or modified T cell of the present disclosure for use in treating autoimmune disease; transplant rejection, graft-versus-host disease (GVHD), cytokine release syndrome, or any disease / condition involving or resulting from an uncontrolled inflammatory response mediated by one or more inflammation-related factors.Preferably, the modified T cell is a modified Treg cell expressing a CAR of the present disclosure.In one embodiment, the Treg cell may be an iPSC-derived Treg cell.

[0075] In yet another aspect, the present disclosure relates to a method of treating an autoimmune disease, transplant rejection, graft-versus-host disease (GVHD), cytokine release syndrome, or any disease / condition involving or resulting from an uncontrolled inflammatory response mediated by one or more inflammation-associated factors, wherein the method comprises administering a therapeutically effective number of genetically modified cells or modified T cells of the present disclosure, thereby treating the autoimmune disease, transplant rejection, or graft-versus-host disease (GVHD).

[0076] In yet another aspect, the disclosure relates to a method of inducing immune tolerance in a subject in need thereof, wherein the method comprises administering a therapeutically effective number of the modified T cells disclosed herein, thereby inducing immune tolerance in a subject in need thereof.

[0077] In yet another aspect, the disclosure relates to a method of downregulating inflammation locally or systemically in a subject in need thereof, wherein the method comprises administering a therapeutically effective number of the engineered T cells disclosed herein, thereby downregulating inflammation locally or systemically in a subject in need thereof.

[0078] In yet another aspect, the present disclosure relates to a method of locally or systematically suppressing effector T cell activity in a subject, wherein the method comprises locally or systemically administering to the subject a modified T cell as disclosed herein, or a therapeutically effective number of modified T cells as disclosed herein, thereby locally or systemically suppressing effector T cell activity in the subject.

[0079] In yet another aspect, the disclosure provides for the use of a nucleic acid, nucleic acid construct, or modified cell described herein in the manufacture of a medicament for: Treatment of autoimmune diseases, transplant rejection, graft-versus-host disease (GVHD), cytokine release syndrome, or any disease / condition involving or resulting from an uncontrolled inflammatory response mediated by one or more inflammation-related factors; Induction of immune tolerance in a subject in need thereof; downregulation of local or systemic inflammation in a subject in need thereof; or Suppressing effector T cell activity locally or systemically in a subject.

[0080] In another aspect of the disclosure, a vector is provided that comprises a sequence provided in this disclosure.

[0081] The invention will be better understood by reference to the detailed description, taken in conjunction with the non-limiting examples and the accompanying drawings, in which: [Brief description of the drawings]

[0082] [Figure 1] Schematic diagram of an exemplary design of an inducible expression cassette encoding a chimeric antigen receptor that binds a proinflammatory cytokine and an immunosuppressive molecule. In this example, TNF-α and / or IFN-γ are the proinflammatory cytokines targeted by the antigen-binding domain of the chimeric antigen receptor. Also in this example, the immunosuppressive molecules are IL-10 and TGF-β. [Diagram 2] For example, a schematic map of a polynucleotide construct is shown that encodes an exemplary chimeric antigen receptor (CAR) that targets tumor necrosis factor alpha (TNFα; TNFα) and further encodes a nuclear factor of activated T cells (NFAT)-inducible expression cassette. (A) In this example, the chimeric antigen receptor construct PMC882 comprises a single chain variable fragment (scFv) that binds the proinflammatory cytokine TNF-α and includes a CD28 costimulatory domain as well as a CD3-ζ signaling domain. In this example, the chimeric antigen receptor coding sequence is preceded by a CD8 leader sequence, which is preceded by the MNDU3 promoter. In this specific example, in FIG. 2A, the construct also encodes a NFAT-inducible expression cassette found downstream of the CAR cassette. The NFAT-inducible expression cassette encodes a 6 (NFAT) minimal IL-2 promoter, followed by coding sequences for TGF-β and IL-10, two immunosuppressive molecules exemplified in this example. A self-cleavable T2A peptide is also encoded between the two immunosuppressants. (B) In another example, FOXP3, another example of an immunosuppressant molecule, is expressed with a CAR cassette and separated from the CD3ζ signaling domain by a self-cleavable T2A peptide. [Diagram 3]Exemplary sorting of healthy donor peripheral blood mononuclear cells (PBMCs) using fluorescence-activated cell sorting (FACS) and purity of the sorted population are shown. (A) Peripheral blood mononuclear cells (PBMCs) were labeled with anti-CD14, CD4, CD25, CD127 surface markers and sorted as indicated. (B) This sorting strategy resulted in highly pure CD4+, CD25+, CD127- Tregs based on FOXP3 expression (upper panel) compared to CD4+, CD25-, CD127+ T effector cells (lower panel). Tregs isolated using fluorescence-activated cell sorting (FACS) were subsequently transduced and expanded to generate CAR Tregs. [Figure 4] Results of expression and proliferation of transduced CAR Tregs are shown. (A) Graph showing fold expansion of healthy Tregs over 14 days of CAR Treg production. Results show strong proliferation over 150-fold. (B) GFP+CAR Tregs show 75% transduction in expanded Tregs compared to non-transduced expanded Tregs. [Diagram 5] Figure 1 shows the results of Jurkat cells transduced with CAR PMC882. The graph shows increased surface expression of the activation marker CD69 compared to non-transduced Jurkats as determined by flow cytometry of CD69+ cells. This increased expression demonstrates activation by the presence of TNFα. Error bars indicate standard deviation; *p<0.05. [Figure 6]Flow cytometry analysis results based on intracellular staining of TGFβ and IL10 in transduced (A) Jurkat cells, (B) healthy Tregs, and (C) active disease Tregs, both in the presence or absence of TNFα. This was done to simulate and demonstrate inducible expression by the NFAT promoter. (A) Jurkat cells transduced with CAR PMC882 demonstrated increased expression of immunosuppressive TGFβ and IL10 in the presence of TNFα compared to without TNFα stimulation. (B) CAR PMC882 Tregs from healthy donors and (C) donors with active disease (juvenile idiopathic arthritis, JIA) showed increased expression of TGFβ and IL10 in the presence of TNFα compared to without TNFα stimulation. These results illustrate the inducible expression of TGFβ and IL10 using the NFAT promoter in PMC882. Error bars indicate standard deviation; *p<0.05. [Figure 7] Data are shown suggesting that 24 hour co-culture with CAR Treg PMC882 from (A) a healthy donor and (B) an actively diseased donor (JIA) reduces inflammatory T cells in the presence of CD3 / 28 activators compared to non-transduced Tregs. Error bars indicate standard deviation; *p<0.05. [Figure 8] Figure 1 shows the suppression of proliferating effector T cells activated by CD3 / 28 activators by PMC882-transduced CAR Tregs over 7 days. (A) Healthy donor Tregs as well as (B) active JIA disease Tregs were transduced with CAR PMC882. Results show the suppression of proliferating T cells. Error bars indicate standard deviation; *p<0.05; **p<0.005. [Figure 9]Figure 1 shows the effect of PMC882 CAR Treg treatment in the NSG GvHD mouse model. (A) Clinical GvHD scores of PMC882 CAR Treg treated mice compared to untreated mice. Error bars indicate standard deviation; area under the curve****p<0.0001; n=6 per group. (B) Survival curves of PMC882 CAR Treg treated mice compared to untreated mice. Log-rank test*p<0.05. (C) Percent engraftment of human CD45 in peripheral blood is suppressed in PMC882 CAR Treg treated mice compared to untreated mice at day 14. Error bars indicate standard deviation; Student's t-test**p<0.005; n=6. (D) Percent engraftment of human CD45 at the end of the experiment on day 35 showed a significant suppression of human CD45 engraftment in PMC882 CAR Treg treated mice compared to untreated mice. Student's t-test**p<0.005; n=4. (E) Liver tissue analysis using VECTRA staining for CD4+ (yellow) and CD8+ (red) indicating T cell infiltration within the tissue. (F) High dimensional reduced tSNE analysis of CD3+ T cells in peripheral blood using CyToF (Uppergawa panel) shows well separated clusters from CAR Treg treated (middle panel) and untreated (lower panel) mice. (G) Heatmap of markers constituting clusters in CAR Treg treated (left) and untreated (right) mice. [Figure 10] Anti-IFNγ CAR Jurkat (A) and healthy donor Treg (B) are responsive to soluble human IFNγ and induce upregulation of TGFβ (left two columns in (A) and (B)) and IL10 (right two columns in (A) and (B)). Error bars indicate standard deviation; Student's t-test *p<0.05. Data from three independent experiments. [Figure 11] We demonstrate that both anti-TNFα CAR PMC882 and anti-IFNγ CAR Tregs are able to suppress effector T cell proliferation significantly better than non-transduced Tregs in healthy donors. Error bars indicate the mean standard error; Two-way ANOVA, Tukey's multiple comparison test; *p<0.05; **p<0.005. Data from three healthy donors and three independent experiments. [Figure 12] Engineered iPS cells demonstrate knockout of HLA A, B, C (A) and HLA DR, DP, DQ (B) and overexpression of CD47 (C) by surface staining by flow cytometry compared to wild-type iPS cells. (D) Engineered iPS cells do not induce T cell proliferation compared to wild-type iPS cells. Error bars indicate standard error of the mean; one-way ANOVA, Tukey's multiple comparison test; ***p<0.0005. Data from three healthy donors. [Figure 13] Details of iPS cell differentiation into CD34+ cells (A) and subsequent differentiation into T cells showing expression of CD3, CD4, and CD8 (B) up to day 12. Upon PMA stimulation under the inducible NFAT promoter, iPS-derived T cells transduced with anti-TNFα CAR carrying GFP show upregulation of GFP expression. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0083] Array Description

[0084] [Table 1-1]

[0085] [Table 1-2]

[0086] [Table 1-3]

[0087] [Table 1-4]

[0088] [Table 1-5]

[0089]

Table 1-6

[0090]

Table 1-7

[0091]

Table 1-8

[0092]

Table 1-9

[0093]

Table 1-10

[0094]

Table 1-11

[0095]

Table 1-12

[0096]

Table 1-13

[0097]

Table 1-14

[0098]

Table 1-15

[0099] [Table 1-16]

[0100] [Table 1-17]

[0101] definition As used herein, the term "polynucleotide" or "nucleic acid" is defined as a chain of nucleotides. As used herein, the terms "nucleic acid" and "polynucleotide" are synonymous (including the singular form). A polynucleotide or nucleic acid may be DNA, RNA, or a combination of DNA and RNA. One of skill in the art will readily appreciate that a nucleic acid is a polynucleotide, which can be hydrolyzed into monomeric "nucleotides."

[0102] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be an intact immunoglobulin (e.g., IgG, IgM, IgA, IgD, and IgE) from natural or recombinant sources, or an immunoreactive portion of an intact immunoglobulin. The term "antibody" is used in the broadest sense herein and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific, trispecific antibodies), multivalent antibodies (e.g., bivalent antibodies, trivalent antibodies), single chain antibodies, antibody fragments (i.e., Fv, Fab, F(ab)2, etc.), and humanized antibodies, so long as they exhibit the desired antigen-binding activity.

[0103] As used herein, the term "vector" refers to any molecule used to transfer coding information to a host cell. Numerous vectors are known in the art, including, but not limited to, nucleic acids, linear polynucleotides, polynucleotides bound to ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. The term also includes non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0104] As used herein, the term "complementarity determining region" (syn.CDR; i.e., CDR1, CDR2, and CDR3) refers to the amino acid residues of an antibody variable region whose presence significantly contributes to specific antigen binding. Each variable region domain (VH or VL) typically has three CDRs identified as CDR1, CDR2, and CDR3. The CDRs of VH are also referred to herein as CDRH1, CDRH2, and CDRH3, respectively, where CDRH1 corresponds to CDR1 of VH, CDRH2 corresponds to CDR2 of VH, and CDRH3 corresponds to CDR3 of VH. Similarly, the CDRs of VL are referred to herein as CDRL1, CDRL2, and CDRL3, respectively, where CDRL1 corresponds to CDR1 of VL, CDRL2 corresponds to CDR2 of VL, and CDRL3 corresponds to CDR3 of VL. In one example, the amino acid positions assigned to the CDRs are defined according to Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., 1987 and 1991 (also referred to herein as the "Kabat numbering system"). In another example, the amino acid positions assigned to the CDRs are defined according to the extended Chothia numbering scheme (http: / / www.bioinfo.org.uk / mdex.html; Abhinandan & Martin, Mol. Immunology. 45(14):3832-3839, 2008), also referred to herein as the "AbM numbering system". In another example, the amino acid positions assigned to the CDRs are defined according to the International ImMunoGeneTics Information System (IMGT) (Lefranc, Immunology Today. 18:509, 1997; Lefranc, The Immunologist. 7:132-136, 1999).The present invention is not limited to CDRs defined by the Kabat numbering system, but includes all numbering systems, including, but not limited to, the canonical numbering systems of Chothia and Lesk J. Mol. Biol. 196:901-917, 1987; Chothia et al., Nature 342:877-883, 1989; and / or Al-Lazikani et al., J. Mol. Biol. 273:927-948, 1997; or the numbering systems of Honnegher and Plukthun J. Mol. Biol. 309:657-670, 2001.

[0105] As used herein, the term "inflammatory-associated factor" refers to any factor known to be associated with or related to inflammation. Inflammation-associated factors include, but are not limited to, proteins, nucleic acids, and lipids. Inflammation-associated factors may be inducers or promoters of the inflammatory process, or may be upregulated and / or secreted as a result of increased inflammation. In certain instances, inflammation-associated factors are proinflammatory cytokines or inflammation-associated chemokines. As used herein, the term "cytokine" refers to small proteins or peptides involved in cell signaling, and are generally secreted by immune cells, such as, for example, T cells and macrophages. Proinflammatory cytokines are cytokines involved in upregulating inflammatory responses, such as interleukin 1 (IL-1), tumor necrosis factor (TNF-), interferons (IFN-), interleukin 12 (IL-12), interleukin 18 (IL-18), granulocyte macrophage colony stimulating factor (GMCSF), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 17A (IL-17), and the like. As used herein, the term "chemokine" refers to a special class of cytokines known primarily for their function of mediating chemotaxis (i.e., acting as attractants for other cells, particularly immune cells). Inflammation-associated chemokines, also referred to as inflammatory chemokines, play an active role in inflammatory responses, such as attracting immune cells to sites of inflammation. Examples of inflammation-related chemokines include, but are not limited to, CXCL1, CXCL2, CXCL9, CXCL10, CXCL11, CXCL16, and CCL2-20.

[0106] As used herein, the term "codon redundant sequences" or "codon redundancy", also known as "codon degeneracy", refers to the multiplicity of combinations of three base pair codons that specify an amino acid. That is, one amino acid can be coded for by different triplet (codon) of nucleic acids. However, only one amino acid can be obtained from one triplet (codon) of nucleic acids.

[0107] The term "encoding" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA (including that of a transgene), or mRNA (or the entire polynucleotide) to serve as a template for the synthesis of other polymers and macromolecules in biological processes. Polymers and macromolecules have either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to the gene produces said protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence, and the non-coding strand, which is used as a template for transcription of the gene or cDNA, may be referred to as encoding the protein or other product of that gene or cDNA. A polynucleotide is said to "encode" a polypeptide if, in its native state or when manipulated by methods well known to those of skill in the art, it can be transcribed and / or translated to produce an mRNA for the polypeptide or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the coding sequence may be deduced therefrom.

[0108] As used herein, the term "CRISPR-Cas9" refers to a genome editing technology based on the ability of, for example, clustered regularly interspaced palindromic repeats (CRISPR) and CRISPR-associated protein-9 nuclease (Cas9) from Streptococcus pyogenes to induce double-stranded (ds) DNA breaks at specific locations complementary to synthetic guide RNA (sgRNA) sequences integrated into the CRISPR-Cas9 complex. This allows for the deletion, addition, and / or modification of genes and / or other genomic elements, such as transcription elements, promoters, promoter enhancers, transcription enhancers, restriction sites, mutations, selection markers, e.g., antibiotic selection cassettes. For example, antibiotic selection cassettes and any other optional selection markers may also be added to the genome prior to, simultaneously with, or following the insertion of genetic material using CRISPR technology. The function of CRISPR (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) genes is essential for adaptive immunity in selected bacteria and archaea, allowing the organism to respond to and eliminate invading genetic material. Various types of CRISPR mechanisms have been identified to date, of which type II is the best studied. Other combinations of CRISPR have also been developed, such as CRISPR-Cpf1. Also contemplated herein is the use of CRISPR technology, where the Cas protein or a functionally similar protein is not isolated from S. pyogenes. Examples of Cas9 proteins are, but are not limited to, Cas9 proteins or proteins with the same function isolated from S. pyogenes (pyogenees), Staphylococcus aureus, or any representative of the archaeal kingdom (Woese, Kandler & Wheelis, 1990). The Cas9 protein can be replaced by the so-called CasX and CasY proteins.In another example, Cpf1 protein, or examples of proteins with the same function, are isolated from, but not limited to, Acidaminococcus species and Lachnospiraceae. With respect to adaptive immunity, the mechanism of CRISPR-Cas9-mediated defense is as follows: Invading DNA from a virus or plasmid is cut into small fragments and integrated into the CRISPR locus in a series of short repeats (about 20 bps). The locus is transcribed, and the transcript is then processed to generate small RNAs (crRNA-CRISPR RNA; also called synthetic guide RNA (sgRNA) in an in vitro environment), which are used to guide effector endonucleases that target the invading DNA based on sequence complementarity. With respect to gene editing, CRISPR-Cas9 works according to the same principle, with the sgRNA directing the effector nuclease to the desired section of DNA where excision takes place.

[0109] As used herein, the term "activation" refers to the state of an immune cell, e.g., a T cell, that has been sufficiently stimulated to exhibit detectable cell proliferation or cytokine production. In one example disclosed herein, activation is the result of stimulation by binding of a chimeric antigen receptor (CAR) to one or more target antigens. In a specific example of the disclosure in which the engineered T cell comprises a chimeric antigen receptor capable of binding to one or more proinflammatory cytokines, binding of the one or more proinflammatory cytokines to the chimeric antigen receptor activates the engineered T cell through activity of the signaling domain of the chimeric antigen receptor.

[0110] As used herein, the term "immune tolerance" (also known as immunological tolerance, or immune tolerance) refers to a state of unresponsiveness or hyporesponsiveness of the immune system to substances that would otherwise evoke an immune response, either locally or systemically, in a human subject.

[0111] As used herein, the term "autologous" refers to any material derived from the same individual that is reintroduced at a later date. In contrast, the term "allogeneic" refers to a graft derived from a different individual.

[0112] As used herein, the term "Treg" refers to a subpopulation of T cells, also known as regulatory T cells, i.e., suppressor T cells, that have at least one of the following characteristics: expressing CD4; expressing FOXP3; expressing CD25; CD4+, FOXP3+, and CD25+ T cells; the ability to downregulate the induction and proliferation of effector T cells; CD4+FOXP3+CD25(high) T cells; or greater T cell receptor (TCR) diversity than effector T cells.

[0113] As used herein, the term "autoimmune disease" is defined as a disease or disorder that is the result of or results from a response by the host against itself. Thus, an autoimmune disease is the result of an inappropriate and excessive response to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addision's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes mellitus (type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, general rejection of transplanted organs, graft-versus-host disease, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, inflammation, systemic lupus erythematosus (lupus), multiple sclerosis, inflammatory bowel disease, myasthenia gravis, pemphigus vulgaris, psoriatic arthritis, psoriasis, rheumatism, rheumatic fever, rheumatoid arthritis, juvenile rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis.

[0114] As used herein, the term "operably linked" refers to a linkage between a first nucleic acid sequence and a second nucleic acid sequence that allows for functional expression of both nucleic acid sequences. In other words, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed into a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0115] As used herein, the term "subject" refers to any animal that may suffer from an autoimmune disease; transplant rejection, graft-versus-host disease (GVHD), cytokine release syndrome, or any disease / condition involving or resulting from an uncontrolled inflammatory response mediated by one or more inflammation-related factors. Particular subjects of interest are humans, as well as scientifically relevant species such as mice, rats, ferrets, guinea pigs, hamsters, non-human primates, dogs, pigs, and sheep, or economically relevant animals such as horses, dogs, cats, and cows. In a preferred embodiment, the subject is a human.

[0116] The reference to "providing to a subject" refers to administering genetically modified cells to a subject. Alternatively, the genetically modified cells may be generated in the subject's body. For example, the genetically modified cells may be generated in vivo, such that the subject has an endogenous population of genetically modified cells. Suitable means for such in vivo generation are known in the art, and include gene therapy of the subject.

[0117] Regulatory T cells (Tregs, a subset of T cells) play an important role in the induction and maintenance of peripheral immune tolerance and are key to preventing excessive immune responses and autoimmunity.

[0118] Advances in adoptive cell therapy have enabled researchers / clinicians to render a patient's own immune cells responsive to a selected antigen by introducing a gene encoding a synthetic chimeric antigen receptor (CAR).

[0119] For this reason, according to the present disclosure, the function of Treg is utilized to attenuate or suppress immune responses, thereby providing a treatment option for subjects suffering from inflammatory diseases and those undergoing transplantation. As shown herein, enhancing the suppressive properties of Treg or similar immunosuppressive cells by genetic modification provides a treatment for autoimmune diseases, transplant rejection, graft-versus-host disease (GVHD), cytokine release syndrome, and any disease / condition involving or resulting from uncontrolled inflammatory responses mediated by one or more inflammation-related factors.

[0120] Disclosed herein are strategies for adoptive cell transfer of T cells transduced to express a chimeric antigen receptor (CAR). Instead of binding to a tumor-specific antigen and promoting an immune response / activity, as in most anti-cancer CAR T cell therapies, the chimeric antigen receptor disclosed herein binds or can bind to proinflammatory cytokines. Modified T cells containing the chimeric antigen receptor disclosed herein have been shown to result in the killing and / or suppression of effector T cells upon activation, thereby suppressing immune responses and immune activity. Also disclosed herein are materials and methods for controlling inflammatory immune responses and inducing long-term drug-free immune tolerance in diseases where tolerance is desired, such as autoimmunity and transplant rejection.

[0121] The compositions and methods of the invention use engineered cells, preferably engineered regulatory T cells (Tregs) or induced pluripotent stem cell (iPSC)-derived T cells, to modulate immune responses associated with allogeneic translation and autoimmune diseases. Engineered cells, such as engineered Tregs or iPSC-derived T cells, bind to chimeric antigen receptors (CARs) equipped with single-chain variable fragments (scFvs) that bind inflammation-associated factors, resulting in the reduction and resolution of inflammation.

[0122] Chimeric Antigen Receptor Thus, in one aspect, the present disclosure relates to a chimeric antigen receptor (CAR) comprising an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain binds to one or more inflammation-associated factors. In a particular example, the inflammation-associated factor is a proinflammatory cytokine or an inflammation-associated chemokine. In a specific example, the one or more inflammation-associated factors are selected from the group consisting of interleukin 1 (IL-1), tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), interleukin 12 (IL-12), interleukin 18 (IL-18), granulocyte macrophage colony stimulating factor (GMCSF), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 17A (IL-17), CXCL1, CXCL2, CXCL9, CXCL10, CXCL11, CXCL16, and CCL2-20.

[0123] In a specific example, the disclosure relates to a chimeric antigen receptor (CAR) comprising an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain binds one or more proinflammatory cytokines. In a further example, the one or more proinflammatory cytokines are selected from the group consisting of interleukin 1 (IL-1), tumor necrosis factor (TNF-), interferon (IFN-), interleukin 12 (IL-12), interleukin 18 (IL-18), granulocyte macrophage colony stimulating factor (GMCSF), interleukin 6 (IL-6), interleukin 8 (IL-8), and interleukin 17A (IL-17). In one example, the proinflammatory cytokine is tumor necrosis factor alpha (TNF-α). In one example, the proinflammatory cytokine is interferon gamma (IFN-γ). In one example, the proinflammatory cytokine is interleukin 8 (IL-8).

[0124] In specific examples, the chimeric antigen receptor disclosed herein comprises an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain comprises an scFv that binds TNF-α, wherein the hinge region is CD8a or a CD28 hinge, the transmembrane domain is a CD28 transmembrane domain, the signaling domain is the intracellular signaling domain of CD3ζ, and the costimulatory domain is the intracellular signaling domain of CD28. In specific examples, the chimeric antigen receptor disclosed herein comprises an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain comprises an scFv that binds IFN-γ, wherein the hinge region is CD8a or a CD28 hinge, the transmembrane domain is a CD28 transmembrane domain, the signaling domain is the intracellular signaling domain of CD3ζ, and the costimulatory domain is the intracellular signaling domain of CD28. In another specific example, a chimeric antigen receptor disclosed herein comprises an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain comprises an scFv that binds IL-17a, wherein the hinge region is CD8a or a CD28 hinge, the transmembrane domain is a CD28 transmembrane domain, the signaling domain is the intracellular signaling domain of CD3zeta, and the costimulatory domain is the intracellular signaling domain of CD28.

[0125] Antigen-binding domain In one example, the extracellular domain of a chimeric antigen receptor disclosed herein comprises one or more antigen binding domains.

[0126] The antigen recognition domain can be any suitable domain capable of recognizing one or more inflammation-associated factors (e.g., proinflammatory cytokines or inflammation-associated chemokines). The term "antigen recognition domain" as used throughout the specification refers to a portion of a CAR that provides the specificity of the CAR for one or more inflammation-associated factors. The antigen recognition domain can be all of the extracellular region of the CAR, or just a portion thereof. Suitable antigen recognition domains include, but are not limited to, polypeptides having sequence homology to an antigen-binding site of an antibody or fragment thereof that binds to an inflammation-associated factor. Thus, in some embodiments of any aspect of the invention, the antigen recognition domain comprises an amino acid sequence having homology to an antibody or fragment thereof that binds to an inflammation-associated factor. In some embodiments, a portion of the antigen recognition domain comprises an amino acid sequence having homology to an antibody or fragment thereof that binds to an inflammation-associated factor. The source homologous antibody sequence can be any suitable sequence of an antibody that has affinity for an inflammation-associated factor. For example, the sequence may share sequence homology with antibodies from one or more of the following species: human, non-human primate, mouse, rat, rabbit, sheep, goat, ferret, dog, chicken, cat, guinea pig, hamster, horse, cow, or pig. The antigen recognition domain may share sequence homology with a sequence of a monoclonal antibody produced from a hybridoma cell line. If the species of origin of the homologous antibody sequence is not human, the antibody is preferably a humanized antibody. The homologous antibody sequence may be derived from a non-mammalian species, such as a cartilaginous fish (e.g., shark IgNAR antibodies - see WO 2012 / 073048). Alternatively, the antigen binding domain may comprise an engineered protein scaffold that provides similar functionality to a shark antibody, such as an i-body with a binding portion based on a shark IgNAR antibody (see WO 2005 / 118629). Furthermore, the antigen recognition domain can be derived from, or share sequence homology with, any other suitable binding molecule or peptide that can selectively interact with an inflammation-associated factor with sufficient affinity to activate the CAR signaling domain.For example, methods for identifying antigen-binding proteins are known in the art, such as panning phage display libraries, protein affinity chromatography, co-immunoprecipitation, and the yeast two-hybrid system, among others (see Srinivasa Rao, V. et al. Int J Proteomics, 2014; Literature ID 147648).

[0127] In some embodiments, the antigen recognition domain of the CAR comprises an amino acid sequence homologous to the amino acid sequence of the fragment antigen-binding (Fab) portion of an antibody that binds to an inflammation-associated factor. As understood in the art, the Fab portion of an antibody is composed of one constant region and one variable region of each of the antibody's heavy and light chains. The Fab is the antigen-determining region of an antibody and can be generated by enzymatic cleavage of the Fc region from an antibody.

[0128] In some embodiments of any aspect of the invention, the antigen recognition domain comprises amino acid sequence homology to the amino acid sequence of a single chain variable fragment (scFv) that binds to an inflammation-associated factor. As will be appreciated in the art, an scFv is a fusion protein that comprises two moieties that may share homology with or be identical to the variable heavy (VH) and variable light (VL) chains of an antibody, the two moieties being linked by a linker peptide. For example, an scFv may comprise the amino acid sequences of VH and VL derived from an antibody that recognizes an inflammation-associated factor. In this context, it will be understood that the term "derived from" does not refer to the source of the polypeptide itself, but rather to the derivation of the amino acid sequence that constitutes part of the antigen-binding region. Thus, the term "derived from" includes synthetic, artificial, or otherwise generated polypeptides that share sequence identity with an antibody that binds to an inflammation-associated factor.

[0129] In some embodiments, the antigen recognition domain comprises amino acid sequence homology to the amino acid sequence of a multivalent scFv that binds to an inflammation-associated factor, hi some embodiments, the multivalent scFv is a bivalent or trivalent scFv.

[0130] In some embodiments of any aspect of the invention, the antigen recognition domain has the amino acid sequence of a single antibody domain (sdAb) that binds to an inflammation-associated factor.

[0131] In some examples, each antigen binding domain is independently selected from the group consisting of an antibody, an antibody fragment, a single chain variable fragment (scFv), a chemokine receptor, or a functional variation thereof. In one embodiment, the chemokine receptor is further selected from the group consisting of CCR5, CXCR3, CCR1, and CCR2. In another embodiment, each antigen binding domain is a single chain variable fragment (scFv).

[0132] In a specific example, the extracellular domain comprises one or more of an scFv that binds TNF-α, an scFv that binds IFN-γ, and an scFv that binds IL-17a. In a more specific example, the scFv in i) has the amino acid sequence set forth in SEQ ID NO:1; the scFv in ii) has the amino acid sequence set forth in SEQ ID NO:2; and the scFv in iii) has the amino acid sequence set forth in SEQ ID NO:3.

[0133] When comparing amino acid sequences, the sequences should be compared over the entire comparison window determined by the length of the polypeptide. The comparison window may include about 20% or less additions or deletions (i.e., gaps) compared to the reference sequence (not including additions or deletions) for optimal alignment of the two sequences. Optimal sequence alignment for aligning the comparison window may be performed by computerized implementation of algorithms such as the BLAST family of programs, for example, as disclosed by Altschul et al., 1997, Nucl.Acids Res.25:3389-3402. Global alignment programs may be used to align similar sequences of approximately the same size. Examples of global alignment programs include the NEEDLE program, which is part of the EMBOSS package (available at www.ebi.ac.uk / Tools / psa / emboss_needle / ) (Rice P et al., 2000, Trends Genet., 16:276-277), and the GGSEARCH program, which is part of the FASTA package (available at fasta.bioch.virginia.edu / fasta_www2 / fasta_www.cgi?rm=compare&pgm=gnw) (Pearson W and Lipman D, 1988, Proc. Natl. Acad. Sci. USA, 85:2444-2448). Both of these programs are based on the Needleman-Wunsch algorithm, which is used to find the optimal alignment (including gaps) along the entire length of two sequences. A detailed discussion of sequence analysis can also be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998).

[0134] As indicated above, functional variants may include substitutions, deletions, or insertions of individual amino acids into one of the amino acid sequences described herein, such as in Table 2. For example, one of skill in the art will recognize that any amino acid may be replaced with a chemically (functionally) similar amino acid and the function of the polypeptide is retained. Such conservative amino acid substitutions are well known in the art. Each of the following groups in Table 2 contains amino acids that are conservative substitutions for one another:

[0135] [Table 2]

[0136] Additionally, unnatural amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptides encompassed herein, as desired, including, but not limited to, D-isomers of common amino acids, such as 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, 2-aminobutyric acid, 6-aminohexanoic acid, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, and Nα-methyl amino acids, and common amino acids. Hinge

[0137] In one example, the chimeric antigen receptor disclosed herein further comprises a hinge region located between the extracellular domain and the transmembrane domain. In a specific example, the hinge region is selected from the group consisting of CD8a hinge, CD28 hinge, IgG hinge, IgD hinge, and functional variations thereof. For example, the hinge region is a CD8a hinge comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 164. In another example, the hinge region is an IgG hinge region, such as an IgG4 hinge region comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 156. In yet another example, the hinge region is an IgD hinge region comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 157. In a preferred example, the hinge region is a CD28 hinge region. In this particular example, the hinge region comprises or consists of the amino acid sequence set forth in SEQ ID NO: 7 or a codon-redundant sequence thereof. In certain embodiments, the hinge region comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween, identity to the amino acid sequence set forth in SEQ ID NO: 7, 156, 157 or 164.

[0138] Signaling domains In another example, the intracellular domain of a chimeric antigen receptor disclosed herein comprises a signaling domain and, optionally, one or more costimulatory domains.

[0139] In one example, the signaling domain includes a portion derived from an activating receptor.

[0140] As used throughout this specification, the term "portion" when used in reference to an activating or costimulatory receptor relates to any segment of the receptor that contains sequences that are responsible for or involved in the initiation / induction of an intracellular signaling cascade following interaction of the receptor with its cognate antigen or ligand. An example of initiation / induction of an intracellular signaling cascade of the T cell receptor (TCR) via CD3 is outlined below.

[0141] Without wishing to be bound by theory, the extracellular portion of the TCR primarily comprises heterodimers of either the clonotypic TCRα and TCRβ chains (TCRα / β receptors) or the TCRγ and TCRδ chains (TCRγδ receptors). These TCR heterodimers generally lack intrinsic signaling capabilities, so they non-covalently associate with multiple signaling subunits of CD3 (mainly CD3-ζ, -γ, -δ, and -ε). Each of the CD3 γ, δ, and ε chains has an intracellular (cytoplasmic) portion that contains a single immunoreceptor tyrosine-based activation motif (ITAM), while the CD3-ζ chain contains three tandem ITAMs. When the TCR binds its cognate antigen in the presence of MHC and the necessary co-receptors, such as CD4 or CD8, signaling is initiated and a tyrosine kinase (i.e., Lck) phosphorylates two tyrosine residues within the intracellular ITAMs of the CD3 chains. Subsequently, a second tyrosine kinase (ZAP-70 - itself activated by Lck phosphorylation) is recruited and diphosphorylates the ITAMs, resulting in the activation of several downstream target proteins, which ultimately result in intracellular conformational changes, calcium mobilisation and rearrangements of the actin cytoskeleton, which in combination ultimately lead to the activation of transcription factors and the induction of T cell immune responses.

[0142] The term "activating receptor" as used throughout this specification relates to a receptor or co-receptor that forms a component of or is involved in the formation of the T cell receptor (TCR) complex, or a receptor that is involved in the specific activation of an immune cell as a result of recognition of an antigenic or other immunogenic stimulus.

[0143] Non-limiting examples of such activating receptors include components of the T cell receptor-CD3 complex (CD3-ζ, -γ, -δ, and -ε), CD4 co-receptors, CD8 co-receptors, Fc receptors or natural killer (NK) cell associated activating receptors (such as LY-49 (KLRA1)), natural cytotoxicity receptors (NCRs, preferably NKp46, NKp44, NKp30 or NKG2 or CD94 / NKG2 heterodimers). Thus, in some embodiments, the signaling domain comprises a portion derived from any one or more of a member of the CD3 co-receptor complex (preferably the CD3-ζ chain or a portion thereof), a CD4 co-receptor, a CD8 co-receptor, an Fc receptor (FcR) (preferably FcεRI or FcγRI) or an NK associated receptor such as LY-49.

[0144] In some embodiments, the signaling domain comprises a portion derived from either CD3 (preferably the CD3-zeta chain or a portion thereof) or an Fc receptor (preferably FcεRI or FcγRI).

[0145] For example, CD3ζTM and CD3ζIC (Landmeier S.et al.Cancer Res.2007;67:8335-43;Guest RD.et al.,J Immunother.2005,28:203-11;Hombach AA.et al.J Immunol.2007;178:4650-7), CD4TM and CD3ζIC (James SE.et al.J Immunol.2008;180:7028-38), CD8TM and CD3ζIC (Patel SD.et al.Gene Ther.1999;6:412-9), and FcεRIγTM and FcεRIγIC (Haynes NM.et al.J Immunol.2001;166:182-7;Annenkov AE.et al.J Various combinations of portions of activating receptors, such as CAR-specific activators (e.g., CAR-specific activators, CAR-specific receptor ...

[0146] In one example, the signaling domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs). In a specific example, the signaling domain comprises the intracellular signaling domain of any one of the proteins selected from the group consisting of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b, CD66d, and functional variations / fragments thereof. In a further specific example, the signaling domain is the intracellular signaling domain of CD3ζ or a functional variant thereof.

[0147] In one specific example, the signaling domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 8. In certain embodiments, the signaling domain comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween identity to the amino acid sequence set forth in SEQ ID NO: 8, or a codon-redundant sequence thereof.

[0148] Costimulatory domain The term "costimulatory receptor" as used throughout the present specification refers to a receptor or co-receptor that assists in the activation of immune cells upon antigen-specific triggering of an activating receptor. As will be understood, a costimulatory receptor does not require the presence of an antigen, nor is it antigen-specific, but is typically one of two signals, the other being an activation signal, that are required for the induction of an immune cell response. In the context of an immune response, a costimulatory receptor is typically activated by the presence of a ligand expressed on the surface of an antigen-presenting cell (APC), such as a dendritic cell or macrophage. With respect to T cells in particular, costimulation is required to lead to cell activation, proliferation, differentiation, and survival (all of which are commonly referred to as T cell activation), while antigen presentation to T cells in the absence of costimulation can lead to anergy, clonal deletion, and / or the development of antigen-specific tolerance.

[0149] Non-limiting examples of T cell costimulatory receptors include CD27, CD28, CD30, CD40, DAP10, OX40, 4-1BB (CD137), and ICOS. Specifically, CD27, CD28, CD30, CD40, DAP10, OX40, 4-1BB (CD137), and ICOS are all "positive" costimulatory molecules that enhance activation of T cell responses. Thus, in some embodiments of any aspect of the invention, the signaling domain comprises a portion derived from any one or more of CD27, CD28, CD30, CD40, DAP10, OX40, 4-1BB (CD137), and ICOS.

[0150] In some embodiments of any aspect of the invention, the signaling domain comprises a portion from a CD28, OX40, or 4-1BB costimulatory receptor. In some embodiments, the signaling domain comprises a portion of a CD28 costimulatory receptor. In some embodiments, the signaling domain comprises a portion of an OX40 costimulatory receptor.

[0151] Various combinations of portions of costimulatory receptors can be used to form the transmembrane (TM) and intracellular (IC) portions of the CAR, such as CD8TM and DAP10 IC or CD8TM and 4-1BB IC (Marin V. et al. Exp Hematol. 2007;35:1388-97), CD28TM and CD28IC (Wilkie S. et al. J Immunol. 2008;180:4901-9; Maher J. et al. Nat Biotechnol. 2002;20:70-5), and CD8TM and CD28IC (Marin V. et al. Exp Hematol. 2007;35:1388-97).

[0152] In one example, each of the one or more costimulatory domains is selected from the group consisting of CD28, CD28T, OX40, 4-1BB / CD137, CD2, CD4, CD5, CD7, CD9, CD16, CD22, CD27, CD30, CD33, CD37, CD40, CD45, CD64, CD80, CD86, CD134, CD137, CD154, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1 / CD11a / CD18), CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14; TNFSF 14), NKG2C, Igα (CD79a), DAP-10, Fcγ receptor, MHC class I molecule, TNF, TNFr, integrin, signaling lymphocyte activation molecule, BTLA, Toll ligand receptor, ICAM-l, B7-H3, CDS, ICAM-l, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL-2Rβ, IL-2Rγ, IL-7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD1la, LFA-l, ITGAM, CD11b, ITGAX, CDl1c, IT GB1, CD29, ITGB2, CD18, LFA-l, ITGB7, NKG2D, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM , Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD83 ligand, FOXP3, functional variations / fragments, and combinations thereof. In another example, the intracellular domain comprises FOXP3.In specific examples, each of the one or more costimulatory domains comprises an intracellular signaling domain of any one of the proteins selected from the group consisting of CD28, 41BB, IL2Rb, TLR2, MyD88, and CD40. In a preferred example, the one or more costimulatory domains comprise the intracellular signaling domain of CD28.

[0153] In one specific example, the signaling domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the signaling domain comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween identity to the amino acid sequence set forth in SEQ ID NO: 9, or a codon-redundant sequence thereof.

[0154] Sequence information for the above activating and costimulatory receptors is readily accessible in a variety of databases. For example, examples of the human amino acid, gene, and mRNA sequences for these receptors are provided in Table 3.

[0155] [Table 3]

[0156] Although Table 3 describes human activating and costimulatory receptors, one of skill in the art will understand that homologous and orthologous versions of each receptor exist in most mammalian and vertebrate species. Thus, the above referenced sequences are provided only as non-limiting examples of receptor sequences that may be included in the CARs described herein, and homologous and orthologous sequences from any desired species may be used to generate a CAR suitable for a given species.

[0157] In one example, the intracellular domain and / or the extracellular domain comprises a self-cleaving peptide. In another example, the self-cleaving peptide is, but is not limited to, P2A, E2A, F2A, and T2A. In yet another example, the self-cleaving peptide is T2A.

[0158] Transmembrane domain In another example, the transmembrane domain of the chimeric antigen receptor disclosed herein is a transmembrane domain of a protein selected from the group consisting of CD28, CD28T, OX-40, 4-1BB / CD137, CD2, CD7, CD27, CD30, CD40, programmed death-1 (PD-1), inducible T cell costimulator (ICOS), lymphocyte function associated antigen-1 (LFA-1, CD11a / CD18), CD3γ, CD3δ, CD3ε, CD247, CD276 (B7-H3), LIGHT, (TNFSF14), NKG2C, Igα (CD79a), DAP-10, Fcγ receptor, MHC class 1 molecule, TNF receptor protein, immunoglobulin protein, cytokine receptor, integrin, and functional variations / fragments thereof. In a specific example, the transmembrane domain is a CD3ε transmembrane domain or a functional variant thereof.

[0159] In a specific example, the transmembrane domain is a CD28 transmembrane domain, and preferably the CD28 transmembrane domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 10. In certain embodiments, the CD28 transmembrane domain comprises or consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween, identity to the amino acid sequence set forth in SEQ ID NO: 10, or a codon-redundant sequence thereof.

[0160] In a specific example of a chimeric antigen receptor disclosed herein, the hinge region is an IgG4 hinge, the transmembrane domain is a CD28 transmembrane domain, the signaling domain is the intracellular signaling domain of CD3ζ, and the costimulatory domain is the intracellular signaling domain of CD28.

[0161] In a more specific example, the chimeric antigen receptor comprises or consists of the amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 160, SEQ ID NO: 161, or SEQ ID NO: 165, or any other CAR amino acid sequence set forth in Table 1. In another specific example, the chimeric antigen receptor comprises or consists of the amino acid sequence of SEQ ID NO: 12, SEQ ID NO: 160, SEQ ID NO: 161, or SEQ ID NO: 165, in which the "ASA" residues are deleted or substituted with any combination of alanine and serine; or substituted with any other combination of the three amino acids. In a more specific example, the chimeric antigen receptor comprises or consists of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 11.

[0162] nucleic acid The present disclosure provides a first polynucleotide, nucleic acid, or nucleic acid construct comprising a nucleotide sequence encoding a chimeric antigen receptor disclosed herein. For example, the nucleic acid may comprise or consist of the nucleotide sequence of SEQ ID NO:11.

[0163] The disclosure also provides a polynucleotide, nucleic acid or nucleic acid construct comprising or consisting of the nucleotide sequence of SEQ ID NO:13, SEQ ID NO:14 or SEQ ID NO:15.

[0164] The disclosure also provides a polynucleotide, nucleic acid, or nucleic acid construct comprising or consisting of a nucleotide sequence encoding any one or more of the amino acid sequences set forth in Table 1.

[0165] The disclosure also provides a polynucleotide, nucleic acid or nucleic acid construct comprising or consisting of the nucleotide sequence of a CD28 hinge set forth in SEQ ID NO: 11, or an IgG4 hinge set forth in SEQ ID NO: 14 or 15; a CD28 transmembrane domain set forth in SEQ ID NO: 11, 14, or 15; a CD28 costimulatory domain set forth in SEQ ID NO: 11, 14, or 15; and / or a CD3 zeta signaling domain set forth in SEQ ID NO: 11, 14, or 15.

[0166] The nucleic acid construct may further comprise one or more of the following: one or more host origins of replication; one or more selectable marker genes active in the host; and / or one or more transcription control sequences.

[0167] As used herein, the term "selectable marker gene" includes any gene that confers a phenotype to a cell in which it is expressed, facilitating the identification and / or selection of cells that have been transfected or transformed with the construct.

[0168] A "selectable marker gene" includes any nucleotide sequence that, when expressed by cells transformed with a construct, confers a phenotype on the cells that facilitates identification and / or selection of these transformed cells. A series of nucleotide sequences encoding suitable selectable markers are known in the art (e.g., Mortesen, RM. and Kingston RE. Curr Protoc Mol Biol, 2009; Unit 9.5). Exemplary nucleotide sequences encoding selectable markers include the adenosine deaminase (ADA) gene; the cytosine deaminase (CDA) gene; the dihydrofolate reductase (DHFR) gene; the histidinol dehydrogenase (hisD) gene; the puromycin-N-acetyltransferase (PAC) gene; the thymidine kinase (TK) gene; the xanthine-guanine phosphoribosyltransferase (XGPRT) gene; or antibiotic resistance genes, such as the ampicillin resistance gene, the puromycin resistance gene, the bleomycin resistance gene, the hygromycin resistance gene, the kanamycin resistance gene, and the ampicillin resistance gene; fluorescent reporter genes, such as genes encoding green, red, yellow, and blue fluorescent proteins; and luminescence-based reporter genes, such as the luciferase gene, among others, that allow for optical selection of cells using techniques such as fluorescence-activated cell sorting (FACS).

[0169] Furthermore, it should be noted that the selectable marker gene may be a separate open reading frame in the construct or may be expressed as a fusion protein with another polypeptide (e.g., CAR).

[0170] As indicated above, the nucleic acid construct may also include one or more transcription control sequences. The term "transcription control sequence" should be understood to include any nucleic acid sequence that affects the transcription of an operably connected nucleic acid. Transcription control sequences may include, for example, a leader, a polyadenylation sequence, a promoter, an enhancer or upstream activating sequence, and a transcription terminator. Typically, a transcription control sequence includes at least a promoter. As used herein, the term "promoter" refers to any nucleic acid that confers, activates, or enhances the expression of a nucleic acid in a cell.

[0171] In some embodiments of any aspect of the present invention, at least one transcription control sequence is operably connected to the nucleic acid molecule of the present invention. For the purposes of this specification, a transcription control sequence is considered to be "operably connected" to a given nucleic acid molecule if the transcription control sequence can promote, inhibit, or otherwise regulate the transcription of the nucleic acid molecule. Thus, in some embodiments, the nucleic acid molecule is under the control of a transcription control sequence, such as a constitutive promoter or an inducible promoter.

[0172] A "nucleic acid construct" may be in any suitable form, such as a plasmid, phage, transposon, cosmid, chromosome, vector, etc., that is capable of autonomous replication when associated with appropriate control elements and capable of transmitting the genetic sequences contained within the construct between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some embodiments, the nucleic acid construct is a vector. In some embodiments, the vector is a viral vector.

[0173] A promoter may constitutively or differentially control the expression of an operably linked nucleic acid molecule with respect to the cell, tissue, or organ in which expression occurs. Thus, a promoter may include, for example, a constitutive promoter or an inducible promoter. A "constitutive promoter" is a promoter that is active under most environmental and physiological conditions. An "inducible promoter" is a promoter that is active under specific environmental or physiological conditions. The present invention contemplates the use of any promoter that is active in the cell of interest. Thus, a wide range of promoters can be readily identified by one of ordinary skill in the art.

[0174] Constitutive mammalian promoters include, but are not limited to, Simian Virus 40 (SV40), Cytomegalovirus (CMV), P-actin, ubiquitin C (UBC), elongation factor-1 alpha (EF1A), phosphoglycerate kinase (PGK), and CMV early enhancer / chicken beta actin (CAGG).

[0175] Inducible promoters include, but are not limited to, chemically inducible promoters and physically inducible promoters. Chemically inducible promoters include promoters whose activity is controlled by compounds such as alcohol, antibiotics, steroids, metal ions, or other compounds. Examples of chemically inducible promoters include, among others, tetracycline-regulated promoters (see, e.g., U.S. Pat. Nos. 5,851,796 and 5,464,758); steroid-responsive promoters such as glucocorticoid receptor promoters (see, e.g., U.S. Pat. No. 5,512,483); ecdysone receptor promoters (see, e.g., U.S. Pat. No. 6,379,945); and metal-responsive promoters such as metallothionein promoters (see, e.g., U.S. Pat. Nos. 4,940,661, 4,579,821, and 4,601,978).

[0176] As mentioned above, the control sequence may also include a terminator. The term "terminator" refers to a DNA sequence at the end of a transcription unit that signals the end of transcription. A terminator is generally a 3' non-translated DNA sequence that contains a polyadenylation signal, facilitating the addition of a polyadenylation sequence to the 3' end of a primary transcript. Similar to a promoter sequence, a terminator may be any terminator sequence that is operable in the cell, tissue or organ in which it is intended to be used. Suitable terminators will be known to those skilled in the art.

[0177] As will be appreciated, the nucleic acid construct may further comprise additional sequences, such as sequences that allow for enhanced expression, cytoplasmic or membrane transport, and location signals. Specific non-limiting examples include internal ribosome entry sites (IRES).

[0178] The present invention extends to essentially all genetic constructs described herein, which may further comprise nucleotide sequences intended for the maintenance and / or autonomous replication of the genetic construct in eukaryotic organisms and / or for the integration of the genetic construct or parts thereof into the genome of a eukaryotic cell.

[0179] Methods for deliberately introducing (transfecting / transducing) exogenous genetic material, such as nucleic acids, into eukaryotic cells are known in the art. As will be appreciated, the most suitable method for introducing a nucleic acid construct into a desired host cell depends on many factors, such as the size of the nucleic acid construct, the type of host cell, the desired efficiency of transfection / transduction, and the final desired or required viability of the transfected / transduced cells. Non-limiting examples of such methods include chemical transfection transfection with chemicals such as cationic polymers, calcium phosphate, or structures such as liposomes and dendrimers; non-chemical methods such as electroporation, sonoporation, heat shock, or phototransfection; particle-based methods such as "gene gun" delivery, magnetofection, or impalefection, or viral transduction.

[0180] The nucleic acid construct is selected depending on the desired method of transfection / transduction. In some embodiments, the nucleic acid construct is a viral vector, and the method of introducing the nucleic acid construct into the host cell is viral transduction. Methods for inducing the expression of CAR in PBMCs using viral transduction are known in the art (Parker, LL. et al. Hum Gene Ther. 2000; 11: 2377-87), and more commonly utilize retroviral systems for transduction of mammalian cells (Cepko, C. and Pear, W. Curr Protoc Mol Biol. 2001, unit 9.9). In other embodiments, the nucleic acid construct is a plasmid, cosmid, artificial chromosome, etc., and can be transfected into cells by any suitable method known in the art.

[0181] In addition to the domains and regions disclosed herein, the nucleic acid sequence as shown herein may also include a promoter sequence specifically intended for the expression of the CAR construct, along with any other sequences that may be necessary or required for the functional expression of the CAR construct disclosed herein. In one example, the nucleic acid sequence for the expression of the CAR construct includes a promoter at its 5' or N-terminus. In another example, the expression sequence of the CAR construct includes a leader sequence (sometimes referred to as a signal peptide), whereby the leader sequence is operably linked to the promoter sequence. In one example, the promoter is MNDU3. In another example, the leader sequence is a CD8 leader sequence. In one example, the sequence for expression includes both the MNDU3 promoter and the CD8 leader sequence. Examples of expression sequences of CAR constructs can be found, for example, in Figures 2A and 2b. The promoter and leader sequences disclosed herein are thus inserted or present upstream of and operably linked to the sequence encoding the extracellular domain of the CAR construct disclosed herein.

[0182] In another aspect, the disclosure relates to a first polynucleotide encoding a chimeric antigen receptor disclosed herein.

[0183] In another aspect, the present disclosure also relates to a vector comprising the first polynucleotide disclosed herein. In a specific example, the vector is a viral vector, optionally a lentiviral vector.

[0184] Engineered Cells In another aspect of the disclosure, there is provided an engineered cell, preferably an engineered T cell, comprising a chimeric antigen receptor disclosed herein, a first polynucleotide, a nucleic acid or a nucleic acid construct disclosed herein, and / or a vector disclosed herein.

[0185] The genetically modified cells may be obtained from a suitable source. In some embodiments of any aspect of the invention, the genetically modified cells are autologous cells, autologous to the subject being treated. Advantageously, autologous cells will not be recognized as "non-self" by the subject's immune system and therefore will be tolerated by the subject. However, autologous cells are not always readily available. Thus, in some embodiments of the invention, the genetically modified cells are allogeneic or xenogeneic cells.

[0186] In one example, the modified T cells of the present disclosure are modified from regulatory T cells (Tregs). In this example, the Tregs are isolated from a subject or isolated from a subject and expanded ex vivo. In one example, the Tregs are isolated and optionally expanded ex vivo, and then modified by transfection with one or more vectors of the present disclosure. In another example, the modified T cells are derived from induced pluripotent stem cells (iPSCs). In a specific example, the iPSCs are modified by transfection with one or more vectors of the present disclosure to arrive at the modified T cells of the present disclosure. In a preferred example, the iPSCs are derived from donor T cells.

[0187] When genetically modified cells are generated according to the present disclosure, it may be desirable to expand the cell population in vitro to increase the total number of cells that can be used for therapy. This can be done using a step of exposing the cells to an antigen of the CAR. Thus, the present disclosure also provides a method of growing genetically modified cells described herein in vitro, the method comprising a step of exposing the cells to an antigen of the CAR. In some embodiments, the method comprises a further step of exposing the cells to a cytokine. For example, the present disclosure also includes a method of growing genetically modified cells in vitro, the method comprising a step of exposing the cells to a cytokine at the same time as exposing the cells to an antigen of the CAR.

[0188] In another aspect, the disclosure provides a method of expanding in vitro a genetically modified cell described herein, the method comprising exposing the cells to immobilized anti-CD3 and anti-CD28 antibodies. In some embodiments, the antibodies are immobilized on a beaded substrate (e.g., "Human Activator" Dynabeads™). In some embodiments, the antibodies are immobilized on an alternative surface, such as the surface of a tissue culture vessel, culture flask, plate, or bioreactor.

[0189] As will be understood by those skilled in the art, depending on the signaling domain of the CAR, the recognition of its cognate antigen by the CAR triggers intracellular signaling that can ultimately lead to cell proliferation. Thus, a small number of cells, or even individual cells, can be expanded (or clonally expanded in the case of a single cell) to form therapeutically significant numbers. This process is further promoted by the supply of cytokines.

[0190] The delivery or administration of the genetically modified cells may be the delivery or administration of the cells alone or the delivery or administration of the cells formulated in a suitable pharmaceutical composition. Thus, the present invention provides a pharmaceutical composition comprising the genetically modified cells and a pharma- ceutically acceptable carrier.

[0191] Methods for providing CAR-containing cells for immunotherapy are known in the art (see, e.g., Kershaw, MH. et al. ClinCancerRes. 2006;12(20):6106-15; Parker LL. et al. HumGeneTher 2000;11:2337-87). Additionally, protocols and methods for the preparation, growth, and evaluation of mammalian CAR-expressing cells are known in the art (see, e.g., Cheadle, EJ. et al. Antibody Engineering: Methods and Protocols, Second Edition, Methods in Molecular Biology, vol. 907:645-66) and are summarized in the Examples below.

[0192] The pharmaceutical composition may also include one or more pharma- ceutically acceptable additives, including pharma- ceutically acceptable salts, amino acids, polypeptides, polymers, solvents, buffers, excipients, and bulking agents, taking into account the specific physical and chemical properties of the cells to be administered. In some embodiments, the pharmaceutical composition comprises a suspension of the genetically modified cells in a suitable medium, such as isotonic saline. In some embodiments, the pharmaceutical composition may include a suitable adjuvant, such as one or more cytokines, as described above.

[0193] Administration of the pharmaceutical compositions may also be by parenteral means, including intravenous, intraventricular, intraperitoneal, intramuscular or intracranial injection, or localized injection at the site of a tumor or cancerous mass.

[0194] Immunosuppressive molecules and inducible systems In one example, the modified T cell expresses one or more immunosuppressive molecules. Expression can be constitutive or inducible. In a specific example, the modified T cell is activated and one or more immunosuppressive molecules are expressed. In a particular example, the T cell is activated by a chimeric antigen receptor disclosed herein and expressed by the modified T cell, particularly through its signaling domain.

[0195] In a specific example, the inducible expression is made possible by a NFAT inducible system. In a specific example, the modified T cell comprises a promoter comprising one or more binding sites for NFAT (nuclear factor of activated T cells) and a second polynucleotide encoding one or more immunosuppressive molecules, and binding of NFAT to said promoter induces expression of one or more immunosuppressive molecules. In one example, both the first and second polynucleotides are expressed from a single nucleic acid expression sequence, as disclosed herein. It is known in the art that NFAT is a major response to T cell activation (via CD3ζ and CD28 signaling) and thus is the molecule of choice to couple expression of an immunosuppressant to activation of the chimeric antigen receptor, as disclosed herein. Such immunosuppressants include, but are not limited to, IL-10, TGF-β, FOXP3, and combinations thereof. Nevertheless, factors such as NF-κB can potentially be induced in many other non-CD3ζ-dependent manners, and the chimeric antigen receptor can be modified accordingly. In a more specific example, the promoter comprises or is a promoter of interleukin-2 (IL-2) or a derivative thereof. The NFAT motif in the IL2 promoter is well characterized and is therefore a preferred example of the promoter. It is generally known in the art that the number of NFAT binding sites can determine the level of activation. In a specific example, the promoter is a 6(NFAT) minimal IL-2 promoter, which contains six NFAT binding sites. In one example where the second polynucleotide encodes two or more immunosuppressive molecules, the coding sequences of the immunosuppressive molecules can be separated by one or more linker sequences. In a particular example, the one or more linker sequences encode a glycine-serine (GS) linker, such as a GSG linker. In a further example, each of the one or more linker sequences further encodes a self-cleaving peptide, preferably a T2A peptide. In one example, the one or more immunosuppressive molecules can suppress the activity of effector T cells or induce anergy in effector T cells.In a specific example, the one or more immunosuppressive molecules are selected from the group consisting of IL-10, TGF-β, CTLA-4, LAG3, PD-L1, and PD-1. In a specific example, the one or more immunosuppressive molecules are IL-10 and / or TGF-β. In a specific example, the second polynucleotide comprises a sequence as set forth in SEQ ID NO: 10. It will be immediately apparent to one skilled in the art that the first, second, and / or third polynucleotides can be encoded on one, two, three or more vectors in any combination. For example, the first polynucleotide comprising a CAR construct can further comprise a second or third polynucleotide, or both. It is also conceivable that the second polynucleotide is broken down into several polynucleotide segments encoded on different vectors, with each polynucleotide segment responsible for expressing a different immunosuppressive agent.

[0196] With respect to the nucleic acid sequence encoding the inducible cassette, as described above, the sequences encoding each part of the CAR construct may be found on one or more (nucleic acid) expression sequences. In one example, the promoter, leader sequence, extracellular sequence, transmembrane domain, intracellular domain, and nucleic acid sequence for expressing the inducible cassette described herein are found on one expression sequence. In another example, the promoter, leader sequence, extracellular sequence, transmembrane domain, intracellular domain, and nucleic acid sequence for expressing the inducible cassette described herein are found on separate expression sequences, whereby the separate expression sequences are operably linked to each other in a manner that allows for the expression of a functional CAR construct.

[0197] Guided Suicide System In a further example, the modified T cell further comprises a third polynucleotide, said third polynucleotide encoding an inducible suicide system, wherein contact of an inducer molecule by the modified T cell induces cell death in said modified T cell. An example of an inducible suicide system is the caspase 9 (iCasp9) suicide gene system. In this system, the inducer is CID (also known as AP1903 / Rimiducid). Examples of iCasp9-based inducible suicide systems are known in the art and are described in the following non-exhaustive list of publications: An inducible caspase 9 safety switch can halt cell therapy-induced autoimmune disease (de Witte MA, Jorritsma A, Swart E, Straathof KC, de Punder K, Haanen JB, Rooney CM, Schumacher TN; J Immunol. 2008 May 1; 180(9):6365-73); Combining a CD20 chimeric antigen receptor and an inducible caspase 9 suicide switch to improve the efficacy and safety of T cell adoptive immunotherapy for lymphoma (Budde LE, Berger C, Lin Y, Wang J, Lin X, Frayo SE, Brouns SA, Spencer DM, Till BG, Jensen MC, Riddell SR, Press OW PLoS One.2013;8(12):e82742).

[0198] Low immunogenicity engineered cells In one example, the modified T cells disclosed herein are hypoimmunogenic. In a specific example, the modified T cells are genetically edited to be hypoimmunogenic. In a specific example, one or more genes of major histocompatibility class (MHC) I and one or more genes of major histocompatibility class (MHC) II are deleted or mutated, where deletion of the gene mutation causes dysfunction of MHC I and MHC II complexes. In a more specific example, one or more genes of MHC I and II include at least B2M (B2 microglobulin) and CIITA (class II MHC transactivator). In a specific example, further edits may be introduced into the modified T cells to enhance their hypoimmunogenicity. In one example, the modified T cells are further modified to overexpress CD47 (cluster of differentiation 47) or a functional variant thereof. Overexpression of CD47 on the cell surface may further prevent recognition and elimination of the modified T cells by the non-self host immune system. It should be understood that the above-mentioned gene editing can be applied to either iPSC-derived or Treg-derived modified T cells. The low immunogenic modified T cells can act as "stealth" cells that are not targeted by the immune system when administered to an individual. The low immunogenic modified T cells are suitable for allogeneic administration, where the cells do not need to be derived from the individual receiving the administration, or be histocompatible.

[0199] Methods for generating genetically modified cells In another aspect of the present disclosure, a method of generating chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs) is provided, comprising transducing Tregs with a vector disclosed herein such that the transduced Tregs express a CAR of the present disclosure, thereby generating the chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs).

[0200] In another aspect of the present disclosure, a method is provided for generating chimeric antigen receptor (CAR) regulatory T cells (CAR-Tregs), comprising: a) isolating regulatory T cells (Tregs) from peripheral blood mononuclear cells (PBMCs) of a subject; b) expanding the isolated Tregs ex vivo; and c) transducing the expanded Tregs with a vector disclosed herein, such that the transduced Tregs express a CAR of the present disclosure.

[0201] In another aspect of the present disclosure, a method of generating modified hypoimmunogenic T cells is provided, comprising: a) modifying CD34+ iPSCs to (i) reduce or eliminate expression or activity levels of B2 microglobulin and class II MHC transactivator, and (ii) overexpress CD47 or a functional variant thereof; b) transducing the modified CD34+ iPSCs with a vector of the present disclosure, such that the transduced CD34+ iPSCs express a CAR of the present disclosure; and c) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells. Preferably, the iPSC-derived T cells are iPSC-derived T regulatory (Treg) cells.

[0202] In another aspect of the present disclosure, a method for generating modified hypoimmunogenic T cells is provided, comprising: a) providing CD34+ iPSCs; b) reducing or eliminating the expression levels of B2 microglobulin and class II MHC transactivator activity in the CD34+ iPSCs; c) overexpressing CD47 or a functional variant thereof in the CD34+ iPSCs of b); d) transducing the CD34+ iPSCs of c) with a vector of the present disclosure, such that the transduced CD34+ iPSCs express a CAR of the present disclosure; and e) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells. Preferably, the iPSC-derived T cells are iPSC-derived T regulatory (Treg) cells.

[0203] In another aspect of the present disclosure, a method for generating modified hypoimmunogenic T cells is provided, comprising: a) editing the genome of CD34+ iPSCs to reduce or eliminate expression of functional gene products of B2M (B2 microglobulin) and CIITA (class II MHC transactivator) genes; c) overexpressing CD47 or a functional variant thereof in the CD34+ iPSCs; d) transducing the CD34+ iPSCs of c) with a vector of the present disclosure, such that the transduced cells express a CAR of the present disclosure; and e) differentiating the CAR hypoimmunogenic iPSCs into iPSC-derived T cells. Preferably, the iPSC-derived T cells are iPSC-derived regulatory T cells (Treg) cells.

[0204] In another aspect of the present disclosure, a method is provided for generating engineered hypoimmunogenic T cells, comprising: a) CD34+ induced pluripotent stem cells (iPSCs); b) editing the genome of the iPSCs to knock out both the B2M (B2 microglobulin) and CIITA (class II MHC transactivator) genes; c) gene editing the iPSCs of b) with a template encoding CD47 or a functional variant thereof, such that the knock-in iPSCs overexpress CD47; d) transducing the gene-edited iPSCs with a vector of the present disclosure, such that the transduced iPSCs express a chimeric antigen receptor of the present disclosure; and e) differentiating the gene-edited CAR-iPSCs into iPSC-derived T cells.

[0205] In a specific example, steps b) and c) or any editing of the genome described herein is carried out using a CRISPR-Cas gene editing system. Methods utilizing CRISPR-Cas gene editing are well known in the art, and commercial kits are readily available and widely used.

[0206] Methods for differentiating iPSCs into iPSC-derived T cells are also well known in the art and commercially available kits are available. A detailed example of this method can be found in Kaneko S. (2016), In Vitro Generation of Antigen-Specific T Cells from Induced Pluripotent Stem Cells of Antigen-Specific T Cell Origin. In: Bondanza A., Casucci M. (eds) Tumor Immunology. Methods in Molecular Biology, vol 1393. Humana Press, New York, NY. DOI: 10.1007 / 978-1-4939-3338-9_6.

[0207] In a further example, the method further comprises any one or more of the following: g) testing the expression of a chimeric antigen receptor of the present disclosure; h) testing the functional potential of said chimeric antigen receptor-Treg or modified T cells to produce one or more immunosuppressive molecules in response to contact with said inflammation-associated factor; i) testing the functional potential of said chimeric antigen receptor-Treg or modified T cells to suppress the activation / proliferation of effector T cells.

[0208] In a specific example of the above method, the vector is a viral vector, preferably a lentiviral vector. The viral vector of the present disclosure may comprise sequences isolated or derived from retrovirus, lentivirus, adenovirus, adeno-associated virus, or any combination thereof. The viral vector may comprise sequences isolated or derived from adeno-associated virus (AAV). The viral vector may comprise recombinant AAV (rAAV). Exemplary adeno-associated and recombinant adeno-associated viruses of the present disclosure comprise two or more inverted terminal repeat (ITR) sequences located in cis next to the sequence encoding the CAR of the present disclosure. Exemplary adeno-associated and recombinant adeno-associated viruses of the present disclosure include, but are not limited to, all serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9). Exemplary adeno-associated viruses and recombinant adeno-associated viruses of the present disclosure include, but are not limited to, self-complementary AAV (scAAV) and AAV hybrids, which contain the genome of one serotype and the capsid of another serotype (e.g., AAV2 / 5, AAV-DJ, and AAV-DJ8).

[0209] treatment In yet another aspect, the present disclosure relates to a modified cell, preferably a modified T cell, of the present disclosure for use in therapy.

[0210] For example, any disease / condition involving or resulting from an uncontrolled inflammatory response mediated by one or more inflammation-related factors disclosed herein may be treated using the engineered cells (e.g., engineered T cells, or CAR Treg cells) or nucleic acids disclosed herein. Typically, the inflammation-related facts are TNFα and / or IFNγ. Diseases / conditions include, but are not limited to, inflammatory autoimmune diseases, transplants, cytokine release syndrome, and any other disease or condition described herein.

[0211] In any aspect or embodiment, the disclosure includes a method of treating a disease or condition in which TNFα or IFNγ plays a role in the pathogenesis of the disease or condition.

[0212] In yet another aspect, the present disclosure relates to a modified cell (e.g., modified T cell, or CAR Treg cell) or nucleic acid of the present disclosure for use in treating an autoimmune disease; transplant rejection, or graft-versus-host disease (GVHD).

[0213] In yet another aspect, the present disclosure relates to a method of treating an autoimmune disease, transplant rejection, or graft-versus-host disease (GVHD), wherein the method comprises administering a therapeutically effective number of modified cells, preferably modified T cells, or an amount of a nucleic acid disclosed herein.

[0214] In one example, the autoimmune disease being treated is selected from the group consisting of rheumatoid arthritis, psoriatic arthritis, psoriasis, lupus, juvenile rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease, and Crohn's disease, hi another example, the transplant rejection being treated is selected from the group consisting of organ transplant rejection, stem cell transplant rejection, and bone marrow transplant rejection.

[0215] In yet another aspect, the present disclosure relates to a method of inducing immune tolerance in a subject in need thereof, wherein the method comprises administering a therapeutically effective number of modified cells, preferably modified T cells, or an amount of a nucleic acid disclosed herein.

[0216] In yet another aspect, the present disclosure relates to a method of downregulating inflammation locally or systemically in a subject in need thereof, wherein the method comprises administering a therapeutically effective number of modified cells, preferably modified T cells, or an amount of a nucleic acid as disclosed herein.

[0217] In yet another aspect, the present disclosure relates to a method of suppressing effector T cell activity locally or systemically in a subject, the method comprising administering to the subject locally or systemically a modified cell, preferably a modified T cell, or a nucleic acid of the present disclosure.

[0218] In another aspect of the disclosure, a vector is provided that comprises a sequence provided in this disclosure.

[0219] Isolation of T cells from leukapheresis products Leukapheresis product or blood may be collected from a subject at a clinical site using a closed system and standard methods (e.g., the COBE Spectrum Apheresis System). Preferably, the product is collected in standard leukapheresis collection bags according to standard hospital or institutional leukapheresis procedures. For example, preferred embodiments of the disclosed methods do not include additional anticoagulants or blood additives (such as heparin) other than those typically used during leukapheresis.

[0220] Alternatively, white blood cells (WBCs) / peripheral blood mononuclear cells (PBMCs) (using Biosafe Sepax 2 (closed / automated)) or T cells (using CliniMACS® Prodigy (closed / automated)) may be isolated directly from whole blood. However, in certain subjects (e.g., subjects diagnosed with and / or treated for cancer), WBC / PBMC yields may be significantly lower when isolated from whole blood than when isolated by leukapheresis.

[0221] Either leukapheresis procedures and / or direct cell isolation procedures may be used for any of the subjects of this disclosure.

[0222] Leukapheresis products, blood, WBC / PBMC compositions and / or T cell compositions should be packaged in insulated containers and stored at controlled room temperature (+19°C to +25°C) according to standard hospital or institutional blood collection procedures approved for use in clinical protocols. Leukapheresis products, blood, WBC / PBMC compositions and / or T cell compositions should not be refrigerated.

[0223] The cell concentration of the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition should not exceed 0.2×109 cells per mL during transport. Vigorous mixing of the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition should be avoided.

[0224] If the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition needs to be stored, e.g., overnight, it should be stored at controlled room temperature (same as above). During storage, the concentration of the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition should not exceed 0.2 x 109 cells per mL.

[0225] Preferably, the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition should be stored in autologous plasma. In certain embodiments, if the cell concentration of the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition is greater than 0.2×10 9 cells per mL, the product should be diluted with autologous plasma.

[0226] Preferably, the leukapheresis product, blood, WBC / PBMC composition and / or T cell composition should not be more than 24 hours old when starting the labelling and separation procedure. The leukapheresis product, blood, WBC / PBMC composition and / or T cell composition may be processed and / or prepared for cell labelling using a closed and / or automated system (e.g. CliniMACS Prodigy).

[0227] The automated system may further optionally perform buffy coat isolation by ficolation and / or washing of the cell product (e.g., leukapheresis product, blood, WBC / PBMC composition and / or T cell composition).

[0228] A closed and / or automated system may be used to prepare and label cells for T cell isolation (e.g., from leukapheresis products, blood, WBC / PBMC compositions and / or T cell compositions).

[0229] While WBC / PBMCs may be directly transfected, which is easier and may eliminate additional steps, the methods of the disclosure may also include a step of first isolating T cells prior to transfection.

[0230] T cells may be directly isolated by enrichment of labeled cells or depletion of labeled cells in one-way labeling procedures, or indirectly isolated in two-step labeling procedures. According to a particular enrichment strategy of the present disclosure, T cells may be collected in a cell collection bag and non-labeled cells (non-target cells) in a negative fraction bag. In contrast to the enrichment strategy of the present disclosure, non-labeled cells (target cells) are collected in a cell collection bag and labeled cells (non-target cells) in a negative fraction bag or non-target cell bag, respectively. Selection reagents include, but are not limited to, antibody-coated beads. The antibody-coated beads may be removed before the modification and / or expansion steps or may be retained on the cells before the modification and / or expansion steps. T cells may be isolated using one or more of the following non-limiting examples of cell markers: CD3, CD4, CD8, CD25, anti-biotin, CD1c, CD3 / CD19, CD3 / CD56, CD14, CD19, CD34, CD45RA, CD56, CD62L, CD133, CD137, CD271, CD304, IFN-γ, TCR α / β, and / or any combination thereof. The method of isolating T cells may include one or more reagents that specifically bind and / or detectably label, and T cells may be isolated using one or more of the following non-limiting examples of cell markers: CD3, CD4, CD8, CD25, anti-biotin, CD1c, CD3 / CD19, CD3 / CD56, CD14, CD19, CD34, CD45RA, CD56, CD62L, CD133, CD137, CD271, CD304, IFN-γ, TCRα / β, and / or any combination thereof. These reagents may or may not be of "Good Manufacturing Practice" ("GMP") grade. Reagents include, but are not limited to, Thermo DynaBeads and Miltenyi CliniMACS products. The method of isolating T cells of the present disclosure may include multiple repetitions of the labeling and / or isolation steps. At any point in the methods of isolating T cells of the present disclosure, undesirable cells and / or undesirable cell types may be depleted from the T cell product compositions of the present disclosure by positively or negatively selecting for undesirable cells and / or undesirable cell types.The T cell product compositions of the disclosure may contain additional cell types that may express CD4, CD8, and / or another T cell marker.

[0231] The disclosed methods for nucleofection of T cells may eliminate the step of isolating T cells, for example, by a process for nucleofection of T cells in a population or composition of WBC / PBMCs that includes an isolation step or selective expansion step via TCR signaling following nucleofection.

[0232] Specific cell populations may be depleted by positive or negative selection before or after enrichment and / or sorting of T cells. Examples of cell compositions that may be depleted from a cell product composition include myeloid cells, CD8+ cytotoxic T cells, dendritic cells, macrophages, erythrocytes, mast cells, gamma-delta T cells, natural killer (NK) cells, natural killer (NK)-like cells (e.g., cytokine-induced killer (CIK) cells), induced natural killer (iNK) T cells, NKT cells, B cells, or any combination thereof.

[0233] A preferred method of T cell isolation may involve a negative selection strategy to obtain untouched pan T cells, meaning that the resulting T cell composition contains T cells that have not been manipulated and contain endogenously occurring T cell types / ratios.

[0234] Reagents that may be used for positive or negative selection include, but are not limited to, magnetic cell separation beads, which may or may not be removed or depleted from the selected population of CD4+ T cells, CD8+ T cells, or a mixed population of both CD4+ and CD8+ T cells prior to performing the next step in the T cell isolation method of the present disclosure.

[0235] The T cell and T cell product compositions may be prepared for cryopreservation, storage in standard T cell culture medium, and / or genetic modification.

[0236] The T cell composition, T cell product composition, unstimulated T cell composition, resting T cell composition, or any portion thereof, may be cryopreserved using standard cryopreservation methods optimized for preserving and recovering human cells with high recovery, viability, phenotype, and / or functional capacity. Commercially available cryopreservation media and / or protocols may be used. The cryopreservation methods of the present disclosure may include DMSO-free cryopreservation agents (e.g., CryoSOfree™ DMSO-free cryopreservation medium) that reduce freezing-associated toxicity.

[0237] The T cell composition, T cell product composition, unstimulated T cell composition, resting T cell composition or any portion thereof may be preserved in the culture medium. The T cell culture medium of the present disclosure may be optimized for cell preservation, cell genetic modification, cell phenotype and / or cell proliferation. The T cell culture medium of the present disclosure may include one or more antibiotics. Since the incorporation of antibiotics into the cell culture medium may reduce the transfection efficiency and / or cell yield following genetic modification via nucleic acid transfer, the specific antibiotics (or combinations thereof) and their respective concentrations may be altered for optimal transfection efficiency and / or cell yield following genetic modification via nucleic acid transfer.

[0238] The T cell culture medium of the present disclosure may include serum, and furthermore, serum composition and concentration may be altered for optimal cell results. Human AB serum is preferred over FBS / FCS for culturing T cells, as FBS / FCS may introduce xenogeneic proteins, although its use in the T cell culture medium of the present disclosure is contemplated. Serum may be isolated from the blood of the subject to whom the T cell composition in culture is intended to be administered, and thus the T cell culture medium of the present disclosure may include autologous serum. Serum-free media or serum replacements may also be used in the T cell culture medium of the present disclosure. In certain embodiments of the T cell culture medium and methods of the present disclosure, serum-free media or serum replacements may provide advantages over supplementing the medium with xenogeneic serum, including, but not limited to, healthier cells that have higher survival rates, transduce nucleic acids more efficiently, exhibit higher survival rates after transduction, exhibit more desirable cell phenotypes, and / or exhibit larger / faster growth upon addition of expansion techniques.

[0239] The T cell culture medium may comprise a commercially available cell growth medium. Exemplary commercially available cell growth media include, but are not limited to, PBS, HBSS, OptiMEM, DMEM, RPMI1640, AIM-V, X-VIVO15, CellGro DC Medium, CTS OpTimizer T Cell Expansion SFM, TexMACS Medium, PRIME-XV T Cell Growth Medium, ImmunoCult-XF T Cell Expansion Medium, or any combination thereof.

[0240] The T cell composition, the T cell product composition, the unstimulated T cell composition, the resting T cell composition, or any portion thereof may be prepared for genetic modification. Preparation of the T cell composition, the T cell product composition, the unstimulated T cell composition, the resting T cell composition, or any portion thereof for genetic modification may include cell washing and / or resuspension in a desired nucleic acid transfection buffer. The cryopreserved T cell composition may be thawed and prepared for genetic modification by nucleic acid transfection. The cryopreserved cells may be thawed according to standard or known protocols. Thawing and preparation of the cryopreserved cells may be optimized to obtain cells that have higher viability, undergo nucleofection with higher efficiency, exhibit higher viability after nucleofection, exhibit more desirable cell phenotypes, and / or exhibit larger / faster proliferation when proliferation techniques are added. For example, Grifols Albutein (25% human albumin) may be used in the thawing and / or preparation process.

[0241] Injection of engineered cells as adoptive cell therapy The present disclosure provides modified cells expressing one or more CARs of the present disclosure, selected and / or expanded for administration to a subject in need thereof. The modified cells of the present disclosure may be formulated for storage at any temperature, including room temperature and body temperature. The modified cells of the present disclosure may be formulated for cryopreservation and subsequent thawing. The modified cells of the present disclosure may be formulated in a pharma- ceutically acceptable carrier for direct administration to a subject from a sterile package. The modified cells of the present disclosure may be formulated in a pharma- ceutically acceptable carrier with indicators of cell viability and / or CAR expression levels to ensure cell function and a minimum level of CAR expression. The modified cells of the present disclosure may be formulated in a pharma- ceutically acceptable carrier at a predefined density with one or more reagents to inhibit further proliferation and / or prevent cell death.

[0242] The present invention illustratively described herein may be suitably implemented in the absence of any element or group of elements, limitations or groups of limitations not specifically disclosed herein. Thus, for example, terms such as "include", "includes", "contains" and the like are to be interpreted expansively without limitation. In addition, the terms and expressions used herein are used as terms of description and not of limitation, and the use of such terms and expressions is not intended to exclude equivalents of the functions shown and described or portions thereof, and it is recognized that various modifications are possible within the scope of the claims of the present invention. Thus, although the present invention has been specifically disclosed by preferred embodiments and optional features, it should be understood that modifications and changes of the invention embodied therein disclosed herein may be utilized by those skilled in the art, and such modifications and changes are considered to be within the scope of the present invention.

[0243] As used in this application, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "genetic marker" includes a plurality of genetic markers, including mixtures and combinations thereof.

[0244] As used herein, the term "about" in the context of concentrations of components of a formulation typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0245] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the disclosed ranges. Thus, the description of a range should be considered to have specifically disclosed all possible subranges as well as individual numerical values ​​within that range. For example, description of a range such as 1-6 should be considered to have specifically disclosed subranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, etc., as well as individual numerical values ​​within that range, e.g., 1, 2, 3, 4, 5, and 6. This is true regardless of the breadth of the range.

[0246] Certain embodiments may be described broadly and generically herein. Each of the narrower species and subgroups falling within the scope of the generic disclosure also form part of the disclosure. This includes the general description of the embodiments, regardless of whether the carved out subject matter is specifically described herein, and includes any provisos or negative limitations that remove any subject matter from the genus.

[0247] The invention has been described broadly and generically herein. Each of the narrower species and subgroups falling within the scope of the generic disclosure also form part of the invention. This includes the generic description of the invention, regardless of whether the carved out subject matter is specifically set forth herein, and includes any provisos or negative limitations that remove any subject matter from the genus.

[0248] Other embodiments are within the scope of the following claims and non-limiting examples. Furthermore, when features or aspects of the invention are described in terms of Markush groups, those of skill in the art will recognize that the invention is also described in terms of any individual members or subgroups of members of the Markush group. EXAMPLES

[0249] Example 1 - Synthesis of Constructs The synthesis of constructs and the cloning of constructs into lentiviral vectors are common and known techniques in the field of the present invention. In the examples disclosed herein, the synthesis and virus packaging utilizes a third generation lentiviral packaging plasmid consisting of four plasmids. The constructs are designed and cloned into transfer plasmids containing the disclosed sequences.

[0250] Example 2 - Generation of CAR Treg cells Autologous chimeric antigen receptor (CAR) Treg cells can be generated by isolation and expansion of regulatory T cells (Treg) from a patient, which can then be used for therapeutic purposes. Regulatory T cells express the CD25 + and CD127 - CD4 + Using a commercially available immunomagnetic regulatory T cell isolation kit for T (Stemcell Technologies) or CD4 + , CD25 + , CD127 - CD14 - Tregs are isolated from peripheral blood mononuclear cells of healthy donors using fluorescence activated cell sorting (FACS) for markers of T cells. The purity of isolated cells is confirmed using flow cytometry by staining for CD3, CD4, CD25, FOXP3, CD127 (markers used to identify regulatory T cells). Isolated Tregs are expanded for 14 days using CD3 / 28 magnetic beads.

[0251] Example 3 - Lentivirus-based Treg transduction and validation Isolated Tregs are transduced with lentiviral vectors containing the disclosed chimeric antigen receptor (CAR) sequences one day after activation with CD3 / 28 beads in the presence of polybrene (8 μg / ml; Sigma-Aldrich) or GMP-grade transduction activator (LentiBOOST; Sirion Biotech). At the end of 14 days of expansion, CAR Tregs are verified by ELISA and flow cytometry for cytokine production by transduced cells in response to recombinant TNFα and IFNγ (Figure 6). Furthermore, the suppressive capacity of CAR Treg cells is assessed using an activated T cell suppression assay.

[0252] Example 4 - Generation of iPSC-derived T cells To overcome the limitations of autologous therapy and provide the consistency of off-the-shelf therapy, induced pluripotent stem cells (iPSCs) can be differentiated into iPSC-derived T cells. In the first preferred method, human CD34 T cells from curated iPS cell banks such as the RIKEN BioResource Research Center or ATCC are differentiated into iPSC-derived T cells. + iPS cells. These CD34 + iPSCs can be differentiated into iPSC-derived T cells using commercially available kits such as the STEMdiff™ T cell kit (Stemcell Technologies). Any disease / condition involving or resulting from an uncontrolled inflammatory response mediated through TNFα and / or IFNγ can potentially be treated using the CAR Treg cells disclosed herein. These include, but are not limited to, inflammatory autoimmune diseases, transplantation, and the like. Furthermore, the pre-made iPSC-derived CAR Treg cells provided herein obviate the need for autologous T cells for CAR-T generation.

[0253] Example 5 – Gene editing of iPS cells First, CD34 +To make iPSCs less immunogenic, two rounds of genetic modification are performed. The first round is a CRISPR-Cas based knockout of the B2M and CIITA genes. A commercial kit such as the IDT Alt-R CRISPR system is used according to the manufacturer's protocol. Briefly, gRNAs are synthesized (B2M guide RNA: GAGTAGCGCGAGCAGCTA; CIITA guide RNA: TCCAGGTAGCCACCTTCTAG) and optimized recombinant cas9 protein is added to form ribonucleoproteins (RNPs), which are transfected into cells via electroporation or liposomes. After transfection, single cell clones are isolated and expanded into colonies. Colonies are screened for successful CRISPR editing by sequencing to ensure gene disruption as well as the absence of off-target effects. Furthermore, cells are tested for pluripotency and normal karyotype. The second round of genetic editing involves CRISPR-cas9 induced homology-directed repair for site-specific integration of the overexpressed CD47 template.

[0254] Successfully CRISPR-edited hypoimmunogenic iPSCs are then lentivirally transduced with the CAR sequence disclosed herein. iPSCs that successfully integrate and express the CAR construct are subsequently single-cell cloned and banked.

[0255] Example 6 - Differentiation of low immunogenic CAR-iPSCs into CAR-iPSC-derived T cells Hypoimmunogenic CAR-iPSCs are cultured with feeder cells in EB medium (embryoid body formation medium) containing rhVEGF (recombinant human vascular endothelial growth factor) for 7 days, followed by the addition of rhCSF (recombinant human colony stimulating factor-1) and rhFlt-3L (recombinant human Fms-related tyrosine kinase 3 ligand). On day 14, hematopoietic progenitor cells are collected and transferred into OP9-DL1 cells in the presence of rhIL7 (recombinant human interleukin-7) and rhFlt-3L. T cells are harvested and stimulated in the presence of rhIL7 and dexamethasone. Other methods include the use of feeder-free conditions, such as the STEMdiff™ T cell kit (Stemcell Technologies), as well as the method developed by Iriguchi, S., Yasui, Y., Kawai, Y., Arima, S., Kunitomo, M., Sato, T., & Kaneko, S. (2021). Feeder-free differentiation and expansion for T cells from induced pluripotent stem cells.

[0256] Example 7 - Low immunogenic iPSC-derived CAR-T cells A limitation in CAR-T cell-based therapy is the availability of autologous cells for engineering. The development of "off-the-shelf" allogeneic cells for cell therapy is one of the major goals of the CAR-T field. Disclosed herein is a method to engineer allogeneic T cells into hypoimmunogenic CAR-T cells. Briefly, T cells from healthy donors are reprogrammed into induced pluripotent stem cells or selected CD34+ iPSCs are used to facilitate expansion and as a ready supply of cells. These iPSCs are rendered hypoimmunogenic by inactivation of MHC class I and II and overexpression of CD47. These cells are then differentiated to generate iPS-derived T cells, which can be further engineered to become antigen-specific. This antigen specificity is the result of the introduction of a chimeric antigen receptor (CAR) along with expression of FOXP3, the master transcription factor of regulatory T cells, to inherit regulatory functions.

[0257] Example 8 - Construction of inflammatory soluble factor-specific CARs The inducible cassette CAR design, named PMC882, contains two parts (Figure 2A). The first part is a CAR cassette containing antigen recognition domains (scFv) specific for inflammatory soluble factors. Upon binding to these factors, the CAR costimulatory domains CD28 and CD3ζ are phosphorylated, activating the cells (Figure 1). The second part is an immunosuppressive cassette, containing the immunosuppressive cytokines TGFβ (tumor growth factor β) and IL10 (interleukin 10). The inducible promoter NFAT (nuclear factor of activated T cells) triggers the expression of these cytokines only when the cells are activated.

[0258] In another design, the regulatory T cell transcription factor FOXP3 (forkhead box P3) was added to the CAR cassette and separated by a translational self-cleaving peptide sequence, T2A (Figure 2B).

[0259] Example 9 - Expression and antigen specificity of CAR design The CAR design disclosed herein is activated by inflammatory soluble factors, not surface-bound antigens as in current and known CAR T cell therapies. In autoimmune diseases, these inflammatory soluble factors are pathogenic and play a role in disease progression. The design disclosed herein allows CAR Tregs to be activated at the site of inflammation, followed by the release of immunosuppressive factors, including but not limited to TGFβ and IL10. Primary regulatory T cells (Tregs) from healthy or autoimmune diseases (such as but not limited to rheumatoid arthritis) were isolated using fluorescence-activated cell sorting (FACS) of peripheral blood mononuclear cells (PBMCs). PBMCs stained with CD4, CD14, CD25, and CD127 (Figure 3A) were sorted for high purity for Tregs, as indicated by the Treg marker FOXP3 (Figure 3B). Use of CD3 / 28 Dynabeads and lentiviral transduction of primary Tregs with the construct anti-TNFα scFv PMC882 resulted in Treg expansion (Figure 4A) and a high percentage of CAR-positive Tregs (GFP+). PMC882 CAR Jurkat cells (Figure 6A), PMC882 CAR Tregs from healthy donors (Figure 6B), and PMC882 CAR Tregs from juvenile idiopathic arthritis (JIA) active disease donors (Figure 6C) showed an increase in TGFβ and IL10 positive cells in the presence of TNFα.

[0260] Example 10 - CAR Tregs outperform non-transduced Tregs in suppression assays PMC882 CAR Tregs from both healthy donors (Figure 7A) and donors with active disease (Figure 7B) were able to reduce autologous proinflammatory T cells based on CD3 and CD28 activation. In autologous effector T cell suppression assays, PMC882 CAR Tregs increased suppression (suppression refers to suppressing the proliferation of activated effector T cells) compared to non-transduced Tregs from healthy donors (Figure 8A) and donors with active disease (Figure 8B). This demonstrates the function of CAR Tregs equipped with immunosuppressive cassettes of TGFβ and IL10 in suppressing activated effector T cells.

[0261] Example 11 - CAR Tregs extend survival in NSG GvHD mouse model NSG mice were injected with 5 million human PBMCs on day 0 to induce acute GvHD, followed by PMC882 CAR Treg treatment on day 1. PMC882 CAR Treg treatment in the NSG GvHD mouse model shows significantly better clinical scores (Figure 9A) and survival rates (Figure 9B) compared to untreated mice (in Figure 9B, results show that all untreated mice did not survive). Percent human CD45 engraftment in mouse peripheral blood, an indicator of disease progression, shows that PMC882 CAR Treg-treated mice are able to significantly suppress human CD45 engraftment compared to untreated mice at day 14 (Figure 9C) and at the end of the experiment on day 35 (Figure 9D). Liver tissue analysis of CAR Treg-treated (top) and untreated (bottom) mice showed differences in human T cell infiltration into the liver organelles, where untreated mice express large numbers of mainly cytotoxic CD8 + T cells (red), whereas CAR Treg-treated mice showed more CD4 + T cells (yellow) are shown, demonstrating the changes in the tissue environment brought about by CAR Treg treatment (Figure 9E). High-dimensional reduced analysis tSNE plots (top) of mass CyToF analysis of human CD3 positive cells from mouse peripheral blood show a clear separation of CAR Treg treated (middle) and untreated (bottom) mice (Figure 9F). Heatmaps of markers found in clusters 1, 5, and 9 show that naive T cell markers CD45RA and CD62L are enriched in CAR Treg treated mice, suggesting T cells that are not pre-activated or actively proliferating. Clusters 4, 12, 13, and 15, which are enriched in untreated mice, have high expression of memory T cell marker CD45RO, activation markers CD69 and granzyme B, proliferation marker Ki67, and exhaustion marker LAG3, suggesting activated and stimulated as well as actively proliferating T cells in untreated mice (Figure 9G).

[0262] Example 12 - Anti-IFNγ CAR is reactive to soluble human interferon gamma Anti-IFNγ CAR constructs transduced into CAR Jurkat cells (Figure 10A), anti-IFNγ CAR Tregs from healthy donors (Figure 10B) showed an increase in TGFβ and IL10 positive cells in the presence of 50 ng / ml human IFNγ.

[0263] Example 13 - CAR Tregs are superior to expanded Tregs in suppressing effector T cell proliferation Anti-TNFα CAR PMC882 and anti-IFNγ CAR transduced into healthy regulatory T cells demonstrate superior suppression of activated effector T cells compared to non-transduced Tregs (Figure 11). Significant suppression was seen with anti-TNFα CAR PMC882 Tregs over non-transduced Tregs at 2 Tregs to 1 Teff. Significant suppression was seen with anti-IFNγ CAR Tregs over non-transduced Tregs at all tested Treg to Teff ratios: 2:1, 1:1, and 1:2.

[0264] Example 14 - Engineered iPS cells demonstrate knockout of MHC I and MHC II, expression of CD47, and are hypoimmunogenic Induced pluripotent stem cells (iPSCs) had the major histocompatibility class I (MHCI) gene B2M and class II (MHCII) gene CIITA ablated using CRISPR. Anti-HLAA, B, C (Figure 12A) and anti-HLA-DR, DP, DQ (Figure 12B) show protein knockdown of the respective genes. CD47 was knocked into the AAVS1 locus under an overexpression promoter, resulting in high expression of CD47 compared to wild-type iPS (Figure 12C). Gene-edited iPS cells do not induce T cell proliferation during co-culture, indicating that they are less immunogenic to CD3+ T cells compared to wild-type iPS cells (Figure 12D).

[0265] Example 15 - iPS-derived T cells have T cell markers and are inducible by T cell stimulation The induced pluripotent cells differentiate into CD34+ cells (Figure 13A) and then subsequently differentiate into T cells, expressing CD3, CD4, and CD8 on differentiation day 24 (Figure 13B). These iPS-derived T cells can also be transduced with a lentivirus containing an anti-TNFα CAR with GFP under an NFAT inducible promoter and upon activation show an increase in the GFP signal demonstrating the inducibility of the NFAT promoter in these T cells (Figure 13C).

Claims

1. A chimeric antigen receptor (CAR) comprising an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain binds to one or more inflammation-associated factors.

2. the one or more inflammation-associated factors are selected from the group consisting of tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), interleukin 1 (IL-1), interleukin 12 (IL-12), interleukin 18 (IL-18), granulocyte macrophage colony-stimulating factor (GMCSF), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 17A (IL-17), CXCL1, CXCL2, CXCL9, CXCL10, CXCL11, CXCL16, and CCL2-20; and / or the extracellular domain comprises one or more antigen-binding domains, the / each antigen-binding domain being independently selected from the group consisting of an antibody, an antibody fragment, a single chain variable fragment (scFv), a chemokine receptor, or a functional variation thereof, wherein the chemokine receptor may optionally be selected from CCR5, CXCR3, CCR1, and CCR2, and preferably the / each antigen-binding domain is a single chain variable fragment (scFv); The chimeric antigen receptor of claim 1.

3. the extracellular domain being i) an scFv that binds to TNF-α; ii) an scFv that binds IFN-γ; and iii) scFv that binds to IL-17 2. The chimeric antigen receptor of claim 1, comprising one or more of:

4. The antigen-binding domain comprises: i) compete for binding to TNF-α with antibodies including SEQ ID NOs: 65 and 66; 64; 1; 19 and 20; 80 and 81; 85 and 86; and 162 and 163; ii) competes for binding to IFN-γ with antibodies including SEQ ID NOs: 3; 5; 34 and 35; 49 and 50; 100 and 101; 112 and 113; or iii) competes with antibodies comprising SEQ ID NOs: 127 and 128; 141 and 142 for binding to IL-17a; The chimeric antigen receptor of claim 1.

5. The antigen recognition domain is (a) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 66, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 65; (b) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 20 or SEQ ID NO: 163, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 19 or SEQ ID NO:

162. (c) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 35, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

34. (d) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 50, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

49. (e) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 81, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

80. (f) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 86, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

85. (g) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 101, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

100. (h) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 113, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

112. (i) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 128, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 127; or (j) a light chain variable domain (VL) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO: 142, and a heavy chain variable domain (VH) comprising three complementarity determining regions (CDRs) of the amino acid sequence set forth in SEQ ID NO:

141. The chimeric antigen receptor of claim 1 .

6. The antigen recognition domain is (a) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 79; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 67; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 70; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 73; or (b) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 79; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 68; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 71; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 73; or (c) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 76; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 78; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 79; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 69; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 72; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 74; or (d) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 29; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 31; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 21; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 24; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 27; or (e) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 29; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 31; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 22; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 25; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 27; or (f) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 30; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 32; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 33; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 23; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 26; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 28; or (g) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 44; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 46; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 48; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 36; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 39; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 42; or (h) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 44; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 46; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 48; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 37; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 40; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 42; or (i) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 45; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 47; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 48; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 38; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 41; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 43; or (j) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 59; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 61; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 63; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 51; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 54; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 57; or (k) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 59; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 61; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 63; and a heavy chain variable domain (VH) comprising or consisting of the amino acid sequence of SEQ ID NO: 52; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 55; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 57; or (l) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 60; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 62; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 63; and a heavy chain variable domain (VH) comprising or consisting of the amino acid sequence of SEQ ID NO: 53; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 56; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 58; or (m) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 84; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 67; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 70; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 82; or (n) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 75; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 77; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 84; and a heavy chain variable domain (VH) comprising or consisting of the amino acid sequence of SEQ ID NO: 68; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 71; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 82; or (o) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 76; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 78; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 84; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 69; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 72; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 83; or (p) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 95; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 97; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 99; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 87; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 90; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 93; or (q) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 95; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 97; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 99; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 88; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 91; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 93; or (r) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 96; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 98; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 99; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 89; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 92; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 94; or (s) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 107; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 109; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 111; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 21; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 102; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 105; or (t) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 107; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 109; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 111; and a heavy chain variable domain (VH) comprising or consisting of the amino acid sequence of SEQ ID NO: 22; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 103; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 105; or (u) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 108; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 110; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 111; and a heavy chain variable domain (VH) comprising or consisting of the amino acid sequence of SEQ ID NO: 23; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 104; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 106; or (v) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 122; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 124; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 126; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 114; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 117; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 120; or (w) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 122; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 124; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 126; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 115; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 118; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 120; or (x) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 123; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 125; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 126; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 116; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 119; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 121; or (y) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 137; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 139; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 140; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 129; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 132; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 135; or (z) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 137; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 139; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 140; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 130; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 133; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 135; or (aa) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 138; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 125; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 140; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 131; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 134; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 136; or (ab) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 151; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 153; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 154; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 143; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 146; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 149; or (ac) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 151; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 153; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 154; and a heavy chain variable domain (VH) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 144; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 147; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 149; or (ad) a light chain variable domain (VL) comprising a complementarity determining region (CDR) 1 comprising or consisting of the amino acid sequence of SEQ ID NO: 152; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 47; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO: 154; and a heavy chain variable domain (VH) comprising or consisting of the amino acid sequence of SEQ ID NO: 145; a CDR2 comprising or consisting of the amino acid sequence of SEQ ID NO: 148; a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO:

150. The chimeric antigen receptor of claim 1 .

7. The antigen-binding domain comprises: (i) comprises or consists of an amino acid sequence having at least 75% identity to the amino acid sequence set forth in SEQ ID NO:1; or (ii) comprises or consists of an amino acid sequence having at least 75% identity to the amino acid sequence set forth in SEQ ID NO:3; or (iii) comprising or consisting of an amino acid sequence having at least 75% identity to the amino acid sequence set forth in SEQ ID NO:5; The chimeric antigen receptor of claim 5.

8. the intracellular domain being (i) a signaling domain; wherein preferably said signaling domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs) and / or comprises an intracellular signaling domain of any one of the proteins selected from the group consisting of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b, CD66d, and functional variations / fragments thereof, more preferably said signaling domain is the intracellular signaling domain of CD3ζ or a functional variant thereof, even more preferably said signaling domain is encoded by the nucleotide sequence set forth in SEQ ID NO:5 or a codon-redundant sequence thereof; (ii) one or more costimulatory domains; wherein preferably each of said one or more costimulatory domains is selected from the group consisting of CD28, CD28T, OX40, 4-1BB / CD137, CD2, CD4, CD5, CD7, CD9, CD16, CD22, CD27, CD30, CD33, CD37, CD40, CD45, CD64, CD80, CD86, CD134, CD137, CD154, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1 (CD1la / CD18), CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14;TNFSF14), NKG2C, Igα (CD79a), DAP-10, Fcγ receptor, MHC class I molecule, TNF, TNFr, integrin, signaling lymphocyte activation molecule, BTLA, Toll ligand receptor, ICAM-1, B7-H3, CDS, ICAM-1, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL-2Rβ, IL-2Rγ, IL-7Rα, IT GA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1ld, I TGAE, CD103, ITGAL, CD1la, LFA-1, ITGAM, CD1lb, ITGAX, CD1lc, ITGB1, CD2 9, ITGB2, CD18, LFA-l, ITGB7, NKG2D, TNFR2, TRANCE / RANKL, DNAM1 (CD226) , SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229) , CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD83 ligand, and functional variations / fragments thereof, and more preferably, or wherein each of said one or more costimulatory domains comprises an intracellular signaling domain of any one of the proteins selected from the group consisting of CD28, 41BB, IL2Rb, TLR2, MyD88, and CD40, and even more preferably wherein said one or more costimulatory domains comprise the intracellular signaling domain of CD28, and / or optionally wherein said intracellular domain comprises a costimulatory domain, said costimulatory domain being or comprising the CD28 intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:9; and (iii) Forkhead box P3 (FOXP3) transcription factor and / or The transmembrane domain is a member of the following families: CD28, CD28T, OX-40, 4-1BB / CD137, CD2, CD7, CD27, CD30, CD40, programmed death-1 (PD-1), inducible T cell costimulatory factor (ICOS), lymphocyte function-associated antigen-1 (LFA-1, CD11a / CD18), CD3gamma, CD3delta, CD3epsilon, CD247, CD276 (B7-H3), LIGHT, (TNFSF14), NKG2C, Igalpha (CD79a), DAP-10, Fcgamma receptor a transmembrane domain of a protein selected from the group consisting of a CD3ε transmembrane domain, an MHC class 1 molecule, a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, and functional variations / fragments thereof, preferably wherein said transmembrane domain is a CD3ε transmembrane domain or a functional variant thereof, or wherein said transmembrane domain is a CD28 transmembrane domain comprising or consisting of the amino acid sequence of SEQ ID NO: 10, and / or The chimeric antigen receptor further comprises a hinge region located between the extracellular domain and the transmembrane domain, preferably said hinge region is selected from the group consisting of a CD8a hinge, a CD28 hinge, and an IgG hinge, more preferably said hinge region is or comprises a CD8a hinge region or an IgG4 hinge, even more preferably said hinge region comprises the amino acid sequence of SEQ ID NO: 7, and optionally The extracellular domain and / or the intracellular domain comprises a self-cleaving peptide, preferably the self-cleaving peptide is selected from the group consisting of P2A, E2A, F2A, and T2A; The chimeric antigen receptor of claim 1.

9. The chimeric antigen receptor of claim 1, wherein the chimeric antigen receptor comprises the sequence of SEQ ID NO:

12.

10. 10. A vector comprising a first polynucleotide encoding a chimeric antigen receptor according to any one of claims 1 to 9, or comprising the sequence set forth in SEQ ID NO: 14 or 15.

11. The vector according to claim 10, wherein the vector is a viral vector, preferably a lentiviral vector.

12. 10. A modified cell comprising the chimeric antigen receptor of any one of claims 1 to 9.

13. The modified cell of claim 12, wherein the modified cell is a modified T cell.

14. The modified cell of claim 12 , wherein the modified cell expresses one or more immunosuppressive molecules.

15. For expression of the one or more immunosuppressive molecules, the modified cells a. a promoter comprising one or more binding sites for NFAT (nuclear factor of activated T cells); and b. One or more immunosuppressive molecules a second polynucleotide encoding wherein the binding of NFAT to the promoter induces expression of the one or more immunosuppressive molecules. The modified cell of claim 14.

16. the one or more immunosuppressive molecules are selected from the group consisting of IL-10, TGF-β, CTLA-4, LAG3, PD-L1, FOXP3, and PD-1, or the second polynucleotide comprises a sequence as set forth in SEQ ID NO: 13, and optionally the modified cells, upon activation, express one or more immunosuppressive molecules; The modified cell of claim 14.

17. The modified cell of claim 15, wherein the modified cell further comprises a third polynucleotide, the third polynucleotide encoding an inducible suicide system, and contact of an inducer molecule by the modified cell induces cell death of the modified cell, preferably, the inducible suicide system is a caspase-9 (iCasp9) suicide gene system and / or the inducer is CID (also known as AP1903 / Rimiducid).

18. a. Obtaining regulatory T cells (Tregs) isolated from peripheral blood mononuclear cells (PBMCs) of a subject; b. Expanding the isolated Tregs in vitro; c. transducing the expanded Tregs with the vector of claim 10 such that the transduced Tregs express a CAR; and, if necessary, d. testing for expression of the chimeric antigen receptor of any one of claims 1 to 9; e. testing the functional potential of said chimeric antigen receptor-Treg or CAR-iPSC-derived T cells to produce one or more immunosuppressive molecules in response to contact with said inflammation-associated factor; and f. Testing the functional potential of said CAR-Treg or CAR-iPSC-derived T cells to suppress effector T cell activation / proliferation; Further comprising any one or more of: A method for generating chimeric antigen receptor (CAR) regulatory T cells (CAR-Treg).

19. a. Editing the genome of the iPSC to knock out both the B2M (beta 2 microglobulin) and CIITA (class II MHC transactivator) genes; b. Genetically editing and knocking in CD47 or a functional variant thereof, such that the knocked-in iPSCs overexpress CD47; c. Transducing the hypoimmunogenic iPSCs with the vector of claim 10 such that the transduced cells express a chimeric antigen receptor; d. Differentiating the hypoimmunogenic CAR-iPSCs to generate iPSC-derived cells expressing one or more T cell markers. and, if necessary, e. testing for expression of the chimeric antigen receptor of any one of claims 1 to 9; f. testing the functional potential of said chimeric antigen receptor-Treg or CAR-iPSC-derived cells expressing one or more T cell markers to produce one or more immunosuppressive molecules in response to contact with said inflammation-associated factor; g. Testing the functional potential of said CAR-Treg or CAR-iPSC-derived cells expressing one or more T cell markers to suppress effector T cell activation / proliferation; Further comprising any one or more of: A method for generating modified, hypoimmunogenic iPSC-derived cells that express one or more T cell markers.

20. The iPSC of step a. ＋ - The method of claim 19, which is an iPSC.

21. The method according to claim 19, wherein in step d., the hypoimmunogenic CAR-iPSCs are differentiated to generate iPSC-derived T cells.

22. i) A method for treating an autoimmune disease, preferably wherein the autoimmune disease is selected from the group consisting of rheumatoid arthritis, psoriatic arthritis, psoriasis, lupus, juvenile rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease, and Crohn's disease. ii) A method for treating transplant rejection, preferably wherein said transplant rejection is selected from the group consisting of organ transplant rejection, stem cell transplant rejection, and bone marrow transplant rejection; iii) methods of treating graft-versus-host disease (GVHD); iv) methods of treating cytokine release syndrome; v) Methods for inducing immune tolerance vi) Methods for downregulating inflammation locally or systemically vii) Methods for locally or systemically suppressing effector T cell activity A pharmaceutical composition comprising the modified cell of claim 12 for use in

Images