Transcription factors

Abstract

The present disclosure relates to transcription cassettes and vectors comprising nucleotide sequences encoding transcription factors, plants, plant cells, plant cell cultures and seeds genetically engineered to contain recombinant copies of nucleic acids encoding the transcription factors, and processes for the extraction of benzylisoquinoline alkaloids from the genetically engineered plants.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present disclosure relates to transcription cassettes and vectors comprising nucleotide sequences encoding transcription factors, where the transcription factors control the expression of genes encoding polypeptides involved in the production of plant benzylisoquinoline (BIA) alkaloids, such as, for example, morphine, codeine, oripavine and thebaine, and the disclosure further relates to plants, plant cells / cultures and seeds engineered to contain recombinant copies of nucleic acids encoding said transcription factors to increase expression of said transcription factors and thereby alter the BIA production process, for cultivation of engineered plants or cultivation of plant cell cultures, and for regulation of processes for the extraction of BIAs and BIAs from engineered plants or plant cell cultures. [Background technology]

[0002] 2. Background of the Invention The opium poppy (Papaver somniferum) is an important source of various BIAs. Due to their anesthetic and analgesic properties, some BIAs and their derivatives are desirable for use in therapy. P. somniferum is a source of clinically useful alkaloids such as morphine, codeine, thebaine, noscapine, and papaverine. BIAs are extracted from the latex harvested from the green seed pods of the opium poppy or from the dried mature plant, the poppy husk. The pathways that produce alkaloids and the various genes involved in the pathways are known and are disclosed in U.S. Patent Application Nos. 15 / 182,761 and 15 / 304,455, the contents of which are incorporated herein by reference in their entirety. Morphinan alkaloids such as codeine and morphine are known to be derived from the intermediate (R)-reticuline. (R)-Reticuline is believed to be formed by its enantiomer (S)-Reticuline in a two-step isomerization process. (R)-Reticuline is then further converted to thebaine. Thebaine is converted to oripavine, morphinone and morphine, or via an alternative pathway to codeinone and codeine and then to morphine.

[0003] Various attempts to increase the alkaloid content in plants have been made by natural breeding methods or reverse genetics to shift the alkaloid pathway to increase intermediates and end products, for example to obtain plants with increased thebaine or codeine content. See WO2016 / 207643, WO2017 / 112011, EP3398430. Plants containing knockout mutations are disclosed in U.S. Patent Application No. 14 / 375,120, the contents of which are incorporated herein by reference. An alternative method for regulating plant metabolism is described in WO2021 / 026119 by overexpressing transcription factors that positively regulate nicotine biosynthesis. Modified Nicotiana tabacum plants contained increased nicotine levels in tobacco leaves.

[0004] Fast neutron mutagenesis (FNM) was performed on seeds of morphine- and noscapine-producing P. sominferum cultivars. Mutagenized M1 seeds were sown and the M1 generation was self-pollinated to generate M2 seeds. The M2 generation was then screened for any abnormal metabolite profiles compared to the non-mutagenized parent cultivar. Screening identified two independent mutants that no longer accumulated any BIA and no longer expressed most of the BIA biosynthetic genes. Molecular characterization of the mutants at the DNA level revealed that each mutant carried a unique deletion spanning a shared region encoding a transcription factor. Due to the loss of BIA synthesis gene expression and lack of BIA accumulation in the mutants, the transcription factor was named regulator of benzylisoquinoline alkaloids (RBA) and the mutants were retrospectively labeled rba-1 and rba-2 mutants.

[0005] The present disclosure features transcription factors that control the expression of genes involved in the production of BIAs, such as morphinan alkaloids. Summary of the Invention

[0006] STATEMENT OF THE INVENT According to one aspect of the present invention, i) a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:1; ii) a nucleic acid molecule, the complementary strand of which hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO:1, wherein the nucleic acid molecule encodes a transcription factor; iii) a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2; a nucleic acid molecule selected from the group consisting of: a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, the amino acid sequence being modified by addition, deletion or substitution of at least one amino acid residue as represented in ii) above, the polypeptide being a transcription factor, the transcription factor controlling the transcription of one or more genes involved in the synthesis of benzylisoquinoline alkaloids.

[0007] Hybridization of nucleic acid molecules occurs when two complementary nucleic acid molecules undergo some degree of hydrogen bonding with each other. The isolated nucleic acid molecules referred to herein include genomic DNA, cDNA molecules, and RNA molecules. The stringency of hybridization can vary depending on the environmental conditions surrounding the nucleic acid, the nature of the hybridization method, and the composition and length of the nucleic acid molecule used. Calculations regarding hybridization conditions required to achieve a certain degree of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001), and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). Tm is the temperature at which 50% of a given strand of a nucleic acid molecule hybridizes with its complementary strand. The following is an exemplary set of hybridization conditions, which are not limiting.

[0008] Very high stringency (allows sequences sharing at least 90% identity to hybridize) Hybridization: 5× SSC, 65℃, 16 hours 2 washes: 2× SSC, room temperature (RT), 15 min each 2 washes: 0.5× SSC, 65℃, 20 min each

[0009] High stringency (allows sequences sharing at least 80% identity to hybridize) Hybridization: 5×~6× SSC, 65℃~70℃, 16~20 hours 2 washes: 2× SSC, room temperature, 5–20 min each Wash twice: 1× SSC, 55℃~70℃, 30 min each

[0010] Low stringency (allows sequences sharing at least 50% identity to hybridize) Hybridization: 6× SSC, room temperature to 55℃, 16 to 20 hours Wash at least twice: 2×–3× SSC, room temperature–55°C, 20–30 min each.

[0011] In a preferred embodiment of the invention, the transcription factor is a helix-loop-helix transcription factor.

[0012] In a preferred embodiment of the invention, the isolated nucleic acid molecule has at least 50% identity to the nucleotide sequence set forth in SEQ ID NO:1.

[0013] Preferably, the isolated nucleic acid molecule is at least 55%, 60%, 65%, 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO:1 over the full-length nucleotide sequence.

[0014] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the sequence of SEQ ID NO: 1, or a polymorphic sequence variant thereof.

[0015] In a preferred embodiment, the nucleic acid encodes a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polymorphic sequence variant thereof.

[0016] The modified polypeptides disclosed herein may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations, which may be present in any combination, including polymorphic sequence variants that one skilled in the art would expect to exist in nature. Preferred variants include those that differ from the reference polypeptide by conservative amino acid substitutions. Such substitutions are those that replace a given amino acid with another amino acid of similar characteristics. The following non-limiting list of amino acids are considered conservative substitutions (analogs): a) alanine, serine, and threonine, b) glutamic acid and aspartic acid, c) asparagine and glutamine, d) arginine and lysine, e) isoleucine, leucine, methionine, and valine, and f) phenylalanine, tyrosine, and tryptophan. Most preferred are variants that retain or enhance the same biological function and activity as the reference polypeptide, where the variant is altered from the reference polypeptide.

[0017] In a preferred embodiment of the invention, the modified polypeptide is a variant and is at least 50%, 55%, 59%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% similar to the amino acid sequence set forth in SEQ ID NO:2 across the entire amino acid sequence.

[0018] In a preferred embodiment of the invention, the modified polypeptide is a variant and is at least 50%, 55%, 59%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence set forth in SEQ ID NO:2 across the entire amino acid sequence.

[0019] In a preferred embodiment, the one or more genes involved in the synthesis of benzylisoquinoline alkaloids are thebaine synthase, salutaridine reductase, salutaridinol 7-O-acetyltransferase, salutaridine synthase, codeine O-demethylase, codeinone reductase, thebaine 6-O-demethylase, (S)-to-(R)-reticuline P450-oxidoreductase, O-methyltransferase 1, canadin synthase, O-methyltransferase 3, cytochrome P450 CYP82Y1, O-methyltransferase 2, acetyltransferase 1, cytochrome P450 CYP82X2, cytochrome P450 CYP82X1, carboxylesterase 1, short-chain dehydrogenase / reductase, (S)-tetrahydroprotoberberine-cis-N-methyltransferase, berberine bridge enzyme, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 2, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 1, (S)-N-methylcoclaurine 3'-hydroxylase, coclaurine N-methyltransferase, norcoclaurine 6-O-methyltransferase, S-norcoclaurine synthase 1, protopine 6-hydroxylase , norreticuline-7-O-methyltransferase, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 2, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 1, (S)-N-methylcoclaurine 3'-hydroxylase, coclaurine N-methyltransferase, norcoclaurine 6-O-methyltransferase, S-norcoclaurine synthase 1, (S)-tetrahydroprotoberberine-cis-N-methyltransferase, norreticuline-7-O-methyltransferase, and scourerine O-demethylase.

[0020] In a preferred embodiment, the one or more genes involved in the synthesis of benzylisoquinoline alkaloids are selected from the genes listed in Table 2.

[0021] In a preferred embodiment of the invention, the nucleic acid molecule is operably linked to a transcription promoter.

[0022] In an alternative preferred embodiment of the invention, the transcription promoter is a heterologous promoter.

[0023] In an alternative preferred embodiment, the transcription promoter is an endogenous promoter that naturally controls transcription of the transcription factor.

[0024] In a preferred embodiment of the invention, the transcription promoter is an inducible promoter.

[0025] In an alternative preferred embodiment of the invention, the transcription promoter is a constitutive promoter.

[0026] In an alternative preferred embodiment of the invention, the promoter is a tissue specific promoter.

[0027] In a further preferred method of the invention said promoter is selected from the group consisting of the CaMV 35S promoter and the Glycine Max ubiquitin 3 promoter.

[0028] "Transcription promoter" refers to a nucleotide sequence upstream from the transcription initiation site, and contains all the control regions necessary for transcription. Such promoters include viral, fungal, bacterial, animal, and plant-derived promoters that can function in plant cells. Constitutive promoters include, for example, CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812), rice actin (McElroy et al. (1990) Plant Cell 2: 163-171), ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689), pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588), MAS (Velten et al. (1984) EMBO J. 3. 2723-2730), the ALS promoter (U.S. Patent Application Serial No. 08 / 409,297), etc. Other constitutive promoters include those of U.S. Patent Nos. 5,608,149, 5,608,144, 5,604,121, 5,569,597, 5,466,785, 5,399,680, 5,268,463, and 5,608,142, each of which is incorporated by reference.

[0029] Chemically controlled promoters can be used to regulate the expression of genes in plants through the application of exogenous chemical regulators. Depending on the purpose, the promoter can be a chemically inducible promoter, where application of a chemical induces gene expression, or a chemically repressible promoter, where application of a chemical represses gene expression. Chemically inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds used as pre-emergence herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemically regulated promoters of interest include steroid-responsive promoters (see, e.g., glucocorticoid-inducible promoters of Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257), as well as tetracycline-inducible and tetracycline-repressible promoters (see, e.g., Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156), which are incorporated herein by reference.

[0030] If enhanced expression in a particular tissue is desired, tissue-specific promoters can be utilized. Tissue-specific promoters include Yamamoto et al. (1997) Plant J. 12(2): 255-265, Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803, Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343, Russell et al. (1997) Transgenic Res. 6(2): 157-168, Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341, Van Camp et al. (1996) Plant Physiol. 112(2): 525-535, Canevascni et al. (1996) Plant Physiol. 112(2): 513-524, Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778, Lam (1994) Results Probl. Cell Differ. 20: 181-196, Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138, Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90 (20): 9586-9590, and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.

[0031] "Operably linked" means functionally associated as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA that is operably linked to a promoter is "under the transcription initiation control" of the promoter.

[0032] According to one aspect of the invention there is provided a vector comprising an expression cassette according to the invention.

[0033] In a preferred embodiment of the invention, the expression vector is a transposon.

[0034] In an alternative embodiment of the invention, the vector is a viral vector.

[0035] Of interest in the present context are nucleic acid constructs that act as plant vectors. Specific procedures and vectors that have been used previously with widespread success in plants are described in Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant virus-derived vectors (see, for example, EP194809). If desired, selectable genetic markers may be included in the construct, such as those that confer a selectable phenotype, such as resistance to herbicides (e.g., kanamycin, hygromycin, phosphinothricin, chlorsulfuron, methotrexate, gentamicin, spectinomycin, imidazolinones, and glyphosate).

[0036] According to a further aspect of the present invention there is provided a plant, said plant transformed or transfected with a transcription cassette or expression vector according to the present invention.

[0037] Preferably, the plant is of the Papaveraceae species.

[0038] Genes involved in the pathway producing benzylisoquinoline alkaloids are known in the art and encode polypeptides with cytochrome p450 and methyltransferase activity. Deletion of one or more genes in this pathway can alter the levels of one or more benzylisoquinoline alkaloids. For example, deletion of codeine 3-O-demethylase results in Papaver somniferum plants with increased content of codeine, while deletion of thebaine 6-O-demethylase results in increased content of thebaine and oripavine. Plants with altered benzylisoquinoline alkaloid pathways are known in the art and are disclosed, for example, in PCT / GB2017 / 050068 and EP3398430.

[0039] In a preferred embodiment of the invention, the plant is selected from Papaver somniferum, P. setigerum, P. bracteatum, P. orientale, P. pseudo-orientale, P. lasiothrix, P. cylindricum, P. fugax, P. triniifolium.

[0040] In a preferred embodiment of the invention, the plant is a Papaver somniferum plant.

[0041] Benzylisoquinoline alkaloids include oripavine, codeine, thebaine, morphine, noscapine, morphinone, codeinone, reticuline, scoureline, papaverine, cryptopine, laudanosine, protopine, and O-methylsomniferine.

[0042] In a preferred embodiment of the invention, expression of the transcription factor from the transcription cassette or expression vector encoding is increased compared to a non-transformed plant of the same species.

[0043] In the context of the present invention, the expression "increased expression level" refers to an increase in transcription, which then results in a higher nucleic acid transcription level in the transformed plant compared to a non-transformed plant. The increased transcription level can be measured, for example, by quantitative PCR. The increased expression can be achieved by increasing the transcription rate and / or by increasing the copy number of the gene encoding the basic helix-loop-helix transcription factor according to the present invention.

[0044] In preferred embodiments of the invention, the expression level is increased by at least 2-fold, 3-fold, 4-fold, 5-fold, or 10-fold.

[0045] In a preferred embodiment of the invention, the transformed plant or plant material thereof comprises at least two copies of the nucleic acid molecule.

[0046] In a further preferred embodiment of the invention, the transformed plant or plant material thereof comprises three or more copies of the nucleic acid molecule encoding a basic helix-loop-helix transcription factor according to the invention.

[0047] In a preferred embodiment of the invention, the transformed plant or plant cell comprises an increased content of one or more BIAs compared to a non-transformed Papaverum plant or plant cell.

[0048] The total sum of the weights of benzylisoquinoline alkaloids is the sum of the weights of oripavine, codeine, thebaine, morphine, noscapine, morphinone, codeinone, reticuline, scoureline, papaverine, cryptopine, laudanosine, protopine, and O-methylsomniferin, or more preferably, the sum of the weights of codeine, morphine, thebaine, noscapine, and oripavine, or even more preferably, the sum of the weights of codeine, morphine, thebaine, and oripavine.

[0049] In preferred embodiments of the invention, the level is increased by 2-fold, 3-fold, 4-fold, 5-fold, or 10-fold.

[0050] According to a further aspect of the invention there is provided plant material obtained from a plant according to the invention.

[0051] Plant material in the context of the present invention refers to leaves, capsules or seeds.

[0052] According to a further aspect of the invention there is provided a plant cell transformed or transfected with a transcription cassette or expression vector according to the invention.

[0053] According to a further aspect of the invention there is provided a plant cell culture comprising a transformed plant cell according to the invention.

[0054] In a preferred embodiment of the invention, the plant cell is a plant cell of a Papaverum species.

[0055] In a preferred embodiment of the invention, the plant cell is selected from the group consisting of Papaver somniferum, P. setigerum, P. bracteatum, P. orientale, P. pseudo-orientale, P. lasiothrix, P. cylindricum, P. fugax, P. triniifolium.

[0056] In a preferred embodiment of the invention, the plant cell is a Papaver somniferum cell.

[0057] According to a further aspect of the invention there is provided a bioreactor comprising a plant cell culture according to the invention.

[0058] According to a further aspect of the present invention there is provided a method for producing one or more benzylisoquinoline alkaloids, the method comprising the steps of: i) forming a cell culture in a cell culture vessel comprising transformed or transfected cells according to the invention; ii) culturing the cell culture in the presence of one or more benzylisoquinoline alkaloids or benzylisoquinoline precursors; and, optionally, and iii) extracting one or more benzylisoquinoline alkaloids from the cell or cell culture.

[0059] According to one aspect of the present invention, there is provided a process for extraction from a plant of the genus Papaverum, the process comprising: i) harvesting a plant or plant material prepared from a plant according to the invention; ii) forming a reaction mixture of particulate plant material; iii) extraction of the reaction mixture to provide an alkaloid-enriched fraction; and, optionally, and iv) concentrating the alkaloid-enriched fraction to provide an alkaloid-enriched fraction.

[0060] In a preferred method of the invention, the plant material comprises poppy capsules, poppy straw and / or poppy latex.

[0061] According to a further aspect of the invention there is provided a method of generating a plant having altered expression of a polypeptide according to the invention, the method comprising the steps of: i) transforming a Papaveracea plant with a vector according to the invention; ii) obtaining seeds from the plant under i); iii) cultivating the seeds from ii) to generate first and successive generation plants; and iv) obtaining seeds from said first generation plants and any subsequent generation plants.

[0062] In a preferred embodiment of the invention, the plant is of the Papaveraceae species. In a preferred method of the invention, the Papaver plant is selected from Papaver somniferum, P. setigerum, P. bracteatum, P. orientale, P. pseudo-orientale, P. lasiothrix, P. cylindricum, P. fugax, P. triniifolium.

[0063] According to a further aspect of the present invention there is provided a plant obtained by the method according to the present invention.

[0064] According to a further aspect of the present invention there is provided a Papaverum plant or plant part thereof comprising a gene encoding a transcription factor comprising a nucleotide sequence as set forth in SEQ ID NO:1, or a polymorphic sequence variant of SEQ ID NO:1, wherein the nucleotide sequence has been modified such that the modified nucleotide sequence encodes a transcription factor having reduced or undetectable transcription factor activity.

[0065] In a preferred embodiment of the invention, the nucleotide sequence is modified by the addition, deletion or substitution of at least one nucleotide base.

[0066] In a preferred embodiment of the invention, the Papaverum plant is modified, the modification being a deletion of all or part of the nucleotide sequence set out in SEQ ID NO:1, or a polymorphic sequence variant of SEQ ID NO:1.

[0067] In a preferred embodiment of the invention, the plant part is a capsule of the Papaveraceae genus.

[0068] In an alternative preferred embodiment, the plant part is a Papaverum seed.

[0069] In a preferred embodiment of the invention, the Papaverum plant, capsule or seed is substantially devoid of benzylisoquinoline alkaloids or benzylisoquinoline precursors.

[0070] In a preferred embodiment of the invention, the Papaver plant or plant part thereof is selected from Papaver somniferum, P. setigerum, P. bracteatum, P. orientale, P. pseudo-orientale, P. lasiothrix, P. cylindricum, P. fugax, P. triniifolium.

[0071] In a preferred embodiment of the invention, the poppy plant is Papaver somniferum.

[0072] Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of these words, such as "comprising" and "comprises," mean "including but not limited to" and are not intended to (and do not) exclude other moieties, additives, components, integers, or steps. "Consisting essentially of" means having the requisite integer but including integers that do not materially affect the function of the requisite integer.

[0073] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. Where the indefinite article is used, the specification is to be understood as contemplating the singular as well as the plural, unless the context otherwise requires.

[0074] It is to be understood that any feature, integer, property, compound, chemical moiety, or group described in connection with a particular aspect, embodiment, or example of the invention is applicable to any other aspect, embodiment, or example described herein, unless inconsistent.

[0075] Embodiments of the invention will now be described, by way of example only, with reference to the following figures and tables. [Brief description of the drawings]

[0076] [Figure 1] FIG. 1 is a schematic diagram of the deletions in rba-1 and rba-2 mutants. [Figure 2A] Nucleotide and amino acid sequences of RBA. [Figure 2B] Nucleotide and amino acid sequences of RBA. [Figure 2C] Nucleotide and amino acid sequences of RBA. [Diagram 3]

[0046] Figure 1 is a map of pRI 201-AN_35S::RBA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0077] material and method

[0078] Growth of plant material All plant material was grown for 16 days in a glasshouse at the University of York Horticulture Facility. The growth substrate consisted of 4:1:2 John Innes No. 2, Perlite, and Vermiculite.

[0079] Cross-breeding and self-pollination The mother plants used in the crosses were emasculated at the hook stage of floral development. At anthesis, the emasculated flowers were pollinated with pollen from synchronously developing father plants. To prevent contaminating pollen from reaching the receptive stigma, the emasculated flowers were covered with a finely perforated transparent bakery bag until 4 days after pollination.

[0080] Self-pollination was ensured by covering the flowers just before the onset of anthesis with a finely perforated transparent bakery bag and manually pollinating the flowers during anthesis.

[0081] Rapid neutron deletion mutagenesis and glasshouse forward screening Fast neutron mutagenesis (FNM) was performed by the HAS Centre for Energy Research, Radiation Protection Department (H-1121 Budapest, Konkoly Thege ut 29-33, X. epulet, Hungary). Approximately 40 g of seeds of the Sun Pharmaceutical Industries (Australia) cultivar High Noscapine 4 (HN4) were exposed to 20 Gy (50 min beam time). The M1 generation was self-pollinated. One M2 plant per M2 seed family was screened. Lacquer was collected from 9-week-old M2 seedlings and analyzed. M2 plants showing altered alkaloid composition in the lacquer compared to HN4 controls were grown to maturity to confirm the phenotype in dried M2 capsule material. M3 seeds were collected from M2 plants with confirmed phenotype. Five M3 plants per plant were then grown that were M2 mutants to confirm the heritability of the phenotype in mature dried M3 capsule material. The rba-1 and rba-2 mutants were further propagated through self-pollination to the M5 generation, and each successive generation was phenotyped to confirm the "loss of all BIAs" phenotype. All generations were grown in a glasshouse.

[0082] Leaf latex and dried capsule analysis of glasshouse-grown material. Latex was collected from cut petioles of 9-week-old plants and one drop was dispersed in 500 μL of 10% acetic acid. This was diluted 10-fold with 1% acetic acid to obtain a 2% solution of alkaloids in acetic acid for further analysis. Capsules were taken from the same plants used for latex analysis and single capsules were ground to a fine powder in a ball mill (model MM04, Letsch, Hahn, Germany). A sample of ground poppy straw was then accurately weighed to 10 ± 0.1 mg and extracted in 0.5 ml of 10% acetic acid solution with gentle shaking for 1 h at room temperature. The sample was then clarified by centrifugation and a sub-sample of 50 μl was diluted 10-fold with 1% acetic acid to obtain a 2% solution of alkaloids in acetic acid for further analysis.

[0083] All solutions were analyzed using a Waters Acquity UPLC system (Waters Ltd., Elstree, UK) equipped with a Waters Acquity BEH C18 column, 2.1 mm x 100 mm, 1.7 micron packing. The mobile phase used a gradient profile with eluent A consisting of 10 mM ammonium bicarbonate at pH 10.2 and eluent B methanol. The mobile phase gradient conditions used are shown in the table below with a linear gradient. The flow rate was 0.5 ml per minute. The column temperature was maintained at 60°C. The injection volume was 2 μl. The eluted peaks were ionized in positive APCI mode and detected with a mass accuracy within 5 ppm using a Thermo LTQ-Orbitrap. The run was controlled by Thermo Xcalibur software (Thermo Fisher Scientific Inc., Hemel Hempstead, UK). TIFF2024520212000001.tif51153

[0084] All data analysis was performed using the R programming language and custom scripts. Standards for morphine, oripavine, codeine, thebaine, and noscapine were used to identify and quantify these alkaloids using the accurate mass, retention time, and peak area of ​​the pseudomolecular ion. Other putative alkaloid peaks were quantified by their pseudomolecular ion areas relative to the thebaine standard. For putative alkaloids, pseudomolecular formulas were generated from accurate masses within element constraints C=1-100, H=1-200, O=0-200, N=0-3, and mass accuracy <5 ppm using the Bioconductor rcdk package (Guha, (2007) J. Stat. Software 6(18)). Hits with minimum ppm error within these constraints were used to assign putative formulas.

[0085] Plant material for genome sequencing Three-week-old rba-1 (M5 generation) and rba-2 (seM4 generation) mutant seedlings were used for DNA extraction. Seedling material was grown in complete darkness for 24 h before harvesting. Seedlings were detached from the primary root, flash frozen in liquid nitrogen, and stored at -80 °C until shipped on dry ice to Amplicon Express, Inc. (Pullman, WA, USA) for DNA extraction.

[0086] Genome sequencing High-quality genomic DNA was prepared from seedling material by Amplicon Express using their in-house NGS-grade genomic DNA preparation protocol optimized for long reads on various Next Generation Sequencing (NGS) platforms such as Chromium. DNA preparations were shipped directly to HudsonAlphas (HudsonAlpha Institute for Biotechnology, 601 Genome Way, Huntsville, AL 35806), where Chromium libraries were constructed for each sample on the 10X Genomics Platform and sequenced with Illumina NovaSeq technology after quality control of the DNA samples. In the resulting dataset, consisting of 2 × 600 million bases (2 × 603,588,548 and 2 × 603,721,151, respectively) of paired-end 150-base long sequence reads, a total of 180 billion bases (2 × 91,141,870,748 and 2 × 91,161,893,801, respectively) were generated for each of the rba-1 and rba-2 mutant samples (designated TC06 and TC07, respectively). Based on the 2.7 Gb size of the HN1 reference genome (ASM357369v1), this represents an approximately 60-fold sequencing depth for each base position of the two mutants.

[0087] Genome assembly The draft genomes TC06 and TC07 for the rba-1 and rba-2 mutants, respectively, were assembled on the Viking high-performance computing cluster at the University of York using Supernova (version 2.1.1), 10x Genomics Linked-Read Diploid De Novo Assembler (https: / / support.10xgenomics.com / de-novo-assembly / software / overview / latest / performance). The TC06 (rba-1) mutant assembly has a total size of 2.6 Gb (2,581,235,059) with 67,648 scaffolds and a scaffold N50 of 836 kb (836,342), and the TC07 (rba-2) mutant assembly has a total size of 2.5 Gb (2,459,139,609) with 87,225 scaffolds and a scaffold N50 of 210 kb (209,519).

[0088] Identification of candidate scaffolds containing overlapping deletion regions in genome assemblies of rba-1 and rba-2 mutants A BLASTN search was performed against both the TC06 (rba-1) and TC07 (rba-2) mutant assemblies using the entire 51,213 annotated protein-coding gene transcripts of the HN1 reference genome. The top scaffold hits for each gene were ordered based on the location of each gene in the reference genome. Because the mutant genome is nearly identical to the reference genome, each scaffold is expected to appear as a top match for a stretch of contiguous reference genes. If a scaffold matches two such stretches but is interrupted by one or more genes with lower matching top hit scores in between, it was identified as a potential candidate for carrying the deleted region in the mutant genome. Two such scaffolds, TC06_scaffold_251445 in the TC06 (rba-1) assembly and TC07_scaffold_186274 in the TC07 (rba-2) assembly, were identified as potentially carrying overlapping deletions corresponding to the same region on chromosome 9 of the reference genome.

[0089] In silico characterization of deletions in candidate scaffolds First, dot plot analysis was used to confirm and locate the putative deletions for the two scaffolds. Dot plot analysis is a graphical representation of the comparison of two sequences that identifies the regions of close similarity after sequence alignment. A dot plot is a two-dimensional similarity matrix with two sequences compared along a vertical axis and a horizontal axis. For a simple visual representation of the similarity between two sequences, individual dots in the matrix are colored black if the length of a defined base is identical, so that matching sequence segments appear as diagonal runs across the matrix. As a result, if the two DNA sequences are completely identical, a solid diagonal line with a downward slope appears. If the two DNA sequences are reverse-complementary to each other, a solid diagonal line with an upward slope appears. If the two sequences are random, no continuous line pattern appears. Thus, the dot plot result identifies potential deletions as well as inversions between the two sequences. The regions corresponding to both scaffolds (TC06_scaffold_251445 and TC07_scaffold_186274) were obtained from the HN1 reference genome and compared to each scaffold using the Gepard dot plot tool, resulting in the detection of the respective deletions in the scaffolds as well as an inversion in TC06_scaffold_251445.

[0090] Cloning and Sanger sequencing of RBA genes from HN4 genomic DNA and cDNA Genomic DNA was extracted from the first true leaves of HN4 seedlings using the BioSprint 96 Plant kit on a BioSprint 96 Workstation (Qiagen) according to the manufacturer's protocol. Extracted DNA was quantified on a NanoDrop™ 8000 spectrophotometer (Fisher Scientific) and normalized to 10 ng / μL.

[0091] Total RNA was extracted from HN4 stems harvested at the anthesis stage and flash frozen in liquid nitrogen using a Direct-Zol RNA Miniprep Kit (Zymo) according to the manufacturer's instructions. RNA concentration and purity were tested by NanoDrop (Thermo Fisher Scientific) and agarose gel electrophoresis. cDNA was synthesized using the SuperScript IV First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific) using Oligo d(T)20 primer according to the manufacturer's instructions.

[0092] Full-length RBA gene sequences and coding sequences were amplified from HN4 genomic DNA and cDNA, respectively, using Q5 high fidelity DNA polymerase (New England Biolabs). PCR reactions containing 1× Q5 high fidelity buffer, 2 mM dNTPs, 0.5 μM forward primer GAAGGGGTAGTGGAGTGGTAGTTG, 0.5 μM reverse primer GTGTTATACGATCATCGTTTTGC, and 0.5 U Q5 DNA polymerase in a total volume of 25 μl were performed on a Tetrad thermocycler (Bio-Rad) under the following conditions: 98° C. for 30 s, followed by 10 cycles of 98° C. for 10 s, 65° C. reduced to 55° C. at 1° C. per cycle (20 s), 72° C. for 1 min, followed by 25 cycles of 98° C. for 10 s, 55° C. for 20 s, 72° C. for 1 min, followed by 72° C. for 2 min, followed by a hold at 7° C. PCR products were checked on 1% agarose gels, extracted with Wizard SV PCR extraction kit (Promega) according to the manufacturer's instructions, and concentrations were determined using Qubit™ dsDNA BR Assay Kit (Thermo Fisher Scientific).

[0093] Purified RBA PCR products were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer's protocol and transformed into Subcloning Efficiency™ DH5α Competent Cells (Invitrogen) according to the manufacturer's protocol.

[0094] Two to twelve positive single colonies for each insertion were selected by colony PCR. Plasmids were extracted using the QIAprep Spin Miniprep kit (Qiagen) and used for Sanger sequencing.

[0095] RNA isolation for RNA sequencing Upper stem samples (defined as the 2 cm stem section just below the flower head) were collected at anthesis from plants that were rba-1 and rba-2 mutants of the M4 generation, as well as from HN4 wild type. Samples were flash frozen in liquid nitrogen and stored at −80°C until extraction. Grinding was performed in a bottle cooled in liquid nitrogen on a Qiagen TissueLyser as follows: 15 s at 20 Hz, followed by recooling in liquid nitrogen, then another 15 s at 20 Hz. 100 mg of ground material was used per RNA extraction. RNA was isolated from the powder using a CTAB-based extraction method (Chang et al. (1993) Plant Mol. Biol. Rep.11: 113-116) with minor modifications: (i) three successive extractions with chloroform:isoamyl alcohol (24:1) were performed; (ii) RNA was precipitated with lithium chloride overnight at −20°C. After extraction, samples were treated with DNAse I using the DNA-free kit from Ambion according to the manufacturer's protocol. After spectrophotometric quantification, equal amounts of RNA were pooled from three plants per mutant and HN4 wild type.

[0096] Library preparation and RNA sequencing RNA sequencing library preparation was performed by the Genomics Laboratory at the Bioscience Technology Facility, Department of Biology, University of York. RNA quality was assessed by running 1ul from each RNA pool on an Agilent Bioanalyzer RNA Nano chip. 900ng of good quality total RNA per pool was then used for mRNA sequencing library preparation using the NEB RNA Ultra Library Prep Kit for Illumina in conjunction with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs Inc.) and NEB Next single 6bp indexing primers according to the manufacturer's instructions. First, mRNA was purified from total RNA using two rounds of sample binding to oligo d(T)-conjugated paramagnetic beads and washing. Purified mRNA was eluted from the beads into first strand synthesis reaction buffer + random primer mix and incubated at 94°C for 12 minutes to fragment the RNA. After adding RNase inhibitor and ProtoScript II reverse transcriptase, first strand cDNA synthesis was performed by incubating at 25°C for 10 min, 42°C for 50 min, then 70°C for 15 min. Second strand synthesis and sample cleanup were performed according to the manufacturer's guidelines, as were the subsequent final preparation and adapter ligation steps. Libraries were amplified and complementary indicators were added in a 12-cycle PCR reaction. Following the final cleanup step, the yield and size distribution of each amplified cDNA library was assessed using an Agilent High Sensitivity DNA kit with an Agilent 2100 Bioanalyzer and quantified using a Qubit with HS dsDNA kit (Thermo Fisher Scientific). Libraries were then sent for 2 × 150 base pair end sequencing on a HiSeq 3000 at the University of Leeds Next Generation Sequencing Facility.

[0097] RNA sequencing analysis: Three samples were sequenced and the read counts obtained were as follows: rba-1, 2 × 28,154,370; rba-2, 2 × 21,681,680; and HN4 wild type, 2 × 29,529,431. The FASTQC method was used for QC analysis and ribosomal RNA was filtered using mapping to rRNA_115_tax_silva_v1.0 downloaded from the SILVA database (https: / / www.arb-silva.de / ) using BOWTIE2 mapping software. The remaining RNA-seq reads were mapped to a reference transcript dataset of 51,213 annotated protein encoding genes of the HN1 reference genome (ASM357369v1) using BWA mapping software with default parameters. Mapped reads were counted and obtained using the SAMTOOLS software package, and expression matrices were normalized to RPKM (reads per kilobase of transcript per million mapped reads) values ​​for subsequent comparative analysis.

[0098] Generation of stable opium poppy transformants constitutively expressing RBA under the control of the CaMV 35S promoter from cauliflower mosaic virus

[0099] The RBA open reading frame was cloned into the binary vector pRI 201-AN (Takara Bio Inc.), which contains the 5'-UTR untranslated region (5'UTR enhancer region) from Arabidopsis alcohol dehydrogenase downstream of the CaMV 35S promoter to drive constitutive expression of the candidate gene in plants.

[0100] Preparation of pRI 201-AN for homology-based cloning Plasmid pRI 201-AN was linearized by double digestion with SalI and NdeI (NEB) in rCutSmart™ Buffer (NEB) for 1 hour at 37° C. according to the manufacturer's instructions. The digest was purified using NucleoSpin™ Gel and PCR Cleanup Kit (Macherey-Nagel™) according to the manufacturer's instructions to remove small fragments from between the restriction sites.

[0101] Preparation of RBA ORFs for homology-based cloning The RBA open reading frame (ORF) was synthesized by GeneArt Gene Synthesis (Invitrogen / Thermo Fisher Scientific UK) and further amplified using the PCRBIO HiFi polymerase kit (PCRbiosystems) according to the manufacturer's instructions with primers 470 and 471 (Table 4). This included a 5' extension to facilitate homology-based cloning into pRI 201-AN linearized with SalI and NdeI. PCR reactions were performed in 5 x 20 μL reactions on a Thermocycler as follows: initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 15 s, 65°C for 15 s, and 72°C for 30 s, followed by a final extension at 72°C for 1 min. PCR reactions were pooled and resolved on a 0.6% agarose gel. PCR products of the expected size were excised from the gel and purified using NucleoSpin™ Gel and PCR Clean-up Kit (Macherey-Nagel™) according to the manufacturer's instructions. This purified RBA ORF PCR product was used for homology-based cloning into pRI 201-AN.

[0102] Table 4: Primers used to amplify the ORF of RBA for homology-based cloning into pRI 201-AN. TIFF2024520212000002.tif42163

[0103] Homology-based cloning of RBA into pRI 201-AN linearized with SalI and NdeI The pRI 201-AN_35S::RBA expression construct (Figure 3) was assembled from the purified RBA PCR product and the linearized pRI 201-AN vector using the Gibson Assembly® Cloning Kit (NEB) according to the manufacturer's instructions. Correct integration of the RBA ORF and assembly of the pRI 201-AN_35S::RBA construct were sequence verified by Sanger sequencing.

[0104] Preparation of competent cells of Agrobacterium tumefaciens strain GV3101 Agrobacterium tumefaciens strain GV3101 cells were streaked onto YEB plates containing gentamicin (50 μg / ml) and rifampicin (10 μg / ml) for antibiotic selection and grown at 28°C with shaking for 2-3 days. A single colony was selected to inoculate a 5 ml starter culture of YEB liquid medium with gentamicin and rifampicin selection. This was grown overnight at 28°C with shaking. The starter culture was used to inoculate a larger 100 ml culture with gentamicin and rifampicin selection and this was grown at 28°C with shaking for an additional 3 hours to an OD600 of 0.5-1.0. The culture was then chilled on ice for 10 minutes before cells were harvested by centrifugation. Pelleted cells were resuspended in 2 ml of 20 mM CaCl2 + 10% glycerol and aliquoted, immediately frozen in liquid nitrogen, and stored at -80°C.

[0105] Transformation of A. tumefaciens strain GV3101 with pRI 201-AN_35S::RBA One 50 μl aliquot of competent A. tumefaciens strain GV3101 cells was thawed on ice and approximately 200 ng of pRI 201-AN_35S::RBA expression vector was added and swirled to mix. The cells were flash frozen in liquid nitrogen and then heat shocked by thawing in a water bath at 37°C for 5 min, followed by incubation on ice for 30 min. 250 μL of liquid LB medium was then added and the tube was placed in a shaking incubator at 28°C for 3 h. The transformed cells were plated on selective agar plates using kanamycin (50 μg / ml) and gentamicin (50 μg / ml) selection and incubated at 28°C for 2 days to obtain single colonies.

[0106] A single colony was used to inoculate 5 ml of LB + kanamycin and gentamicin at 28°C until a dense culture was obtained to make a glycerol stock containing 15% glycerol. Aliquots of the glycerol stock were kept at -80°C.

[0107] Transformation of opium poppy with pRI 201-An_35S::RBA Wild-type strain HN4 and homozygous rba-1 deletion mutant material were used for stable transformation and expression of RBA using the pRI 201-An_35S::RBA expression construct.

[0108] Seed sterilization Prior to sowing, poppy seeds were sterilized using a chlorine vapor method. Glass Petri dishes containing seeds were placed without their lids in a sealable box in a fume hood. The Petri dish lids were also placed in the box along with a beaker containing a 3% hydrochloric acid solution. To release chlorine vapor, 2.5 g of Presept® disinfectant tablets (Johnson & Johnson) were added to the 3% hydrochloric acid solution, the box was sealed with parafilm and placed in a fume hood. After 90 minutes, the seal was broken and the lid was removed to allow the Petri dishes containing sterilized seeds to be carefully covered by the glass lid and removed from the sealable box to a laminar flow hood.

[0109] Seed sowing Sterilized seeds were sown on B50 agar medium in sterile tissue culture pots. The B50 medium composition is B5 micro- and macroelements (Duchefa Biochemie), B5 vitamins (Duchefa Biochemie), 20% sucrose, 2-(N-morpholino)ethanesulfonic acid (MES) buffer, and 0.8% plant cell culture agar. The sown seeds were stratified for 48 h at 4 °C and then transferred to a growth cabinet to germinate and grow at 24 °C for 7-9 days.

[0110] Transformation of hypocotyl explants A. tumefaciens preculture was set up using a glycerol stock prepared from A. tumefaciens GV3101 cells containing the pRI 201-AN_35S::RBA construct. A single 50 μl aliquot was added to 5 ml of LB containing kanamycin (50 μg / ml) and gentamicin (50 μg / ml). The culture was grown overnight at 28 °C in a shaking incubator. Approximately 100 μl of the preculture was used to inoculate a 50 ml main culture of LB medium containing kanamycin (50 μg / ml) and gentamicin (50 μg / ml), grown overnight in a shaking incubator at 28 °C. When the OD600 reached 0.3-0.8, the cells were harvested by centrifugation at 4000 rpm for 20 min at 4 °C. Inoculation cultures were prepared by resuspending the cell pellet in inoculation medium to an OD600 of 0.2–0.3 and incubated for 1–3 h at 28 °C on a shaker. Inoculation medium consisted of liquid B50 medium without MES but containing acetosyringone (100 μM). Hypocotyl explants were carefully excised from the roots and cotyledons of 7- to 9-day-old poppy seedlings and immediately transferred to Petri dishes containing the Agrobacterium inoculation cultures. After gentle shaking on an orbital shaker for 15 min at room temperature, the explants were blotted on sterile filter paper to remove excess medium and transferred to solid co-medium at 24 °C for 2 to 3 days. The co-medium consisted of B50 medium + agar supplemented with 2,4-dichlorophenoxyacetic acid (1 μg / ml) and acetosyringone (100 μM).

[0111] Inhibition of Agrobacterium and selection of transgenic plants After the co-cultivation period, the explants were immersed in a Timentin®-containing solution (150 μg / mL) in a 50 mL Falcon tube, agitated for 60 seconds, and washed three times in sterile water. After blotting on sterile filter paper, the explants were transferred to callus induction (CM) plates. CM medium consisted of B50 medium + agar containing Timentin® (150 μg / mL) and paromomycin (30 μg / mL) in addition to 2,4-dichlorophenoxyacetic acid (1 μg / ml). CM plates were incubated at 24°C in a growth cabinet. Explants were transferred to fresh CM plates of the same composition at 3-week intervals.

[0112] Production of embryogenic callus cultures Two types of callus formed on the explants (Chitty et al., 2003): type I and type II. Type I is a colorless, loose callus that turns brown over time. Type II forms as small areas of white, compact, embryogenic callus that appears on transformed explants after approximately 12 weeks.

[0113] Type II callus was removed from the explants and transferred to B50 medium containing Timentin® (150 μg / mL) and paromomycin (30 μg / mL) and incubated in a growth cabinet at 18-20° C. Type II callus was transferred to fresh B50 plates of the same composition at 3-week intervals until somatic embryos began to form (typically after 2-3 culture periods).

[0114] Development of somatic embryos into plantlets Once plantlets began to develop from the somatic embryos, they were transferred to B50 medium containing Timentin® (150 μg / mL) and paromomycin (30 μg / mL) selection in small bottles to allow them to grow taller and develop roots. Any basal callus as well as brown or dead leaves or shoots were removed prior to transfer.

[0115] Transfer of plantlets into soil Plantlets with fully established root systems were transferred to soil and initially maintained in a humid environment, slowly strengthened by decreasing humidity over time. Once acclimated to normal humidity levels, the plants were transferred to plant growth cabinets or glasshouses.

[0116] Empty vector control transformants Exactly the same procedure was followed to transform HN4 wild-type and homozygous rba-1 deletion mutant material with pRI 201-AN empty vector, which is identical to the vector pRI 201-AN_35S::RBA shown in Figure 3 but lacks the RBA gene. Empty vector transformants served as control material.

[0117] Example 1 Detection of rba-1 and rba-2 mutant alleles and alkaloid profiling in the M2 generation and derived material

[0118] Forward screening was performed on the M2 generation of fast neutron mutagenized material of the HN4 variety. Two rounds of screening were performed whereby in the first round, latex of 12-week-old plants from the entire M2 mutant population was analyzed by high-throughput screening using Direct Injection MS without prior separation on UPLC to monitor the relative proportions of non-isobaric alkaloid groups. Any material showing a substantially different latex phenotype from the HN4 control material was selected for a second round of screening by UPLC-MS against a reference standard to obtain a complete benzylisoquinoline alkaloid profile of the mature dry capsule.

[0119] Two independent M2 mutant plants belonging to different M2 seed families were identified in the latex screen as lacking any BIA. The complete absence of measurable amounts of BIA in these plants was confirmed by analysis of mature dry M2 capsule material (Table 1). After characterizing the molecular basis for the loss of BIA in the mutant plants (Examples 3 and 4), the mutant alleles were named "regulator of benzylisoquinoline alkaloid-1" and "regulator of benzylisoquinoline alkaloid-2" (rba-1 and rba-2), respectively.

[0120] The rba-1 and rba-2 M2 mutant plants were self-pollinated and their respective progeny were further propagated by self-pollination for several generations to provide larger amounts of material to test the heritability and stability of the "loss of all BIAs" phenotype.

[0121] As with the M2 capsules, dried capsule material from the M3, M4, and M5 generations lacked the major alkaloids, morphine and noscapine, found in substantial amounts in the HN4 parent line. They also did not contain any other alkaloids in measurable amounts (Table 1). Thus, the analysis confirmed the "loss of all BIA" phenotype and demonstrated that it was stably inherited.

[0122] The rba-1 mutant was crossed with two different morphine varieties (HM1 and HM8). The capsules of the F1 progeny, in which the rba-1 mutant allele is in the heterozygous state, contained morphine and other morphinan alkaloids in similar amounts as the parental morphine varieties, demonstrating that the rba-1 mutant allele is recessive (Table 1). Considering that the rba-1 and rba-2 mutants carry different mutant alleles at the same locus (Examples 3 and 4), the rba-2 allele can also be considered recessive.

[0123] Crosses were performed between rba-1 and rba-2 mutants to test whether they complemented each other with respect to BIA production. Since the HN4 wild-type phenotype was not rescued in the resulting capsules of the F1 generation (Table 1), the rba-1 and rba-2 mutant alleles must belong to the same complementation group with their respective mutations affecting the same locus. This was later confirmed by characterization of the molecular basis of the rba-1 and rba-2 mutants (Example 3).

[0124] Table 1: Alkaloid content in dried capsules of rba-1 and rba-2 mutant material and HN4 control. Mature dry capsules were analyzed using UPLC-MS. Concentrations below the background noise level, defined as the mean + 3 x standard deviation (SD) of measurements from machine idle runs distributed throughout each UPLC-MS analysis batch, are indicated as ND (not detectable). For extremely low near-zero concentrations where the SD was greater than the mean measurement, the concentration was considered not significantly greater than zero and therefore indicated as ND. [Table 1]

[0125] Example 2 Transcriptome analysis of rba-1 and rba-2 mutant material To further characterize the mutants with respect to gene expression levels of BIA biosynthetic genes, RNA sequencing was performed on stem material of the M3 generation of rba-1 and rba-2 as well as the parent cultivar HN4. RPKM normalized expression analysis revealed that compared to non-mutagenized HN4 wild-type material, the majority of BIA biosynthetic genes were strongly downregulated in rba-1 and rba-2 mutant material compared to the HN4 control (Table 2). One example is norcoclaurine synthase (NCS), which catalyzes the first committed step in the biosynthesis of all BIAs in opium poppy (Samanani et al. (2004) Plant J. 40: 302-313). There are two NCS genes annotated in the opium poppy reference genome: PSUN64910.1 on scaffold ups_21 and PSUN03620.1 on scaffold ups_10. The RPKM values ​​for the rba-1 and rba-2 mutants are only 2 compared to 300 for the HN4 parent cultivar. Similarly, the respective RPKM values ​​for PSUN03620.1 are 8 and 2 in the rba-1 and -2 mutants compared to 130 in HN4.

[0126] Table 2: RNA sequencing gene expression analysis of alkaloid biosynthetic genes in the stems of rba-1 and rba-2 mutants compared to the HN4 wild type. Upper stem tissue at the flowering stage was used for RNA isolation followed by RNAseq. RPKM normalized expression levels are shown (RPKM=reads per kilobase per million mapped reads). The column "Gene ID" shows opium poppy gene identifiers from the annotation of the HN1 genome assembly (Guo et al. (2018) Science. 362(6412): 343-347). Also shown are the public gene accession numbers, as well as the scaffold in the HN1 reference assembly in which each gene resides. TIFF2024520212000004.tif240170TIFF2024520212000005.tif255169TIFF20245202120 00006.tif255169TIFF2024520212000007.tif250170TIFF2024520212000008.tif158170

[0127] Example 3 Determining the molecular basis of the "loss of all BIA" phenotype in rba-1 and rba-2 mutants To determine the molecular basis of the "loss of all BIAs" phenotype, the genomes of rba-1 and rba-2 mutants were resequenced using the 10X Genomics platform and assembled in-house using Supernova software. The respective deletions in each mutant causing the "loss of all BIAs" phenotype were identified using a bioinformatic approach as described in Materials and Methods.

[0128] Relative to the HN1 genome reference assembly, 989 kb of genomic sequence on chromosome 9 containing 12 genes is deleted in the rba-1 mutant (Figure 1, Table 3). Additionally, 70 kb of genomic sequence immediately upstream of the 5' boundary of the deletion was found to be inverted.

[0129] In the rba-2 mutant, a 780 kb genomic sequence on chromosome 9 containing 11 genes was found to be deleted (Fig. 1, Table 3).

[0130] The fact that the rba-1 and rba-2 deletion alleles identified in each mutant are unique in terms of their overall size and precise boundaries is consistent with them having arisen by independent mutational events in different M1 plants.

[0131] Consistent with gene complementation analysis (Example 1), the rba-1 and rba-2 deletion alleles overlap by 506 kb of genomic sequence (Figure 1). This overlapping region, deleted in both mutants, contains six genes, one of which encodes a basic helix-loop-helix (bHLH) transcription factor (Example 4).

[0132] Example 4 Support for rba-1 and rba-2 deletion mutations The deletions identified in the rba-1 and rba-2 mutants by genome resequencing and assembly were further supported by gene expression analysis using the RNA sequencing dataset from the upper stem described above. The RPKM values ​​of those genes present in the respective deleted regions on chromosome 9 were compared between the rba-1 and rba-2 mutants and the HN4 wild type (Table 3).

[0133] The RPKM values ​​of the deleted genes are expected to be lower in the respective mutants compared to HN4 wild type, provided that they are expressed to reasonable levels at the first position in HN4 wild type stem tissue. (The RPKM values ​​of the deleted genes may not be absolutely zero in the respective mutants: low RPKM values ​​may reflect background noise inherent to the methodology, such as non-specific mapping of short reads from other genes that have some sequence similarity, rather than purely low expression.)

[0134] The RPKM values ​​of genes present in the overlapping region deleted in both mutants are generally zero or lower in both mutants compared to HN4 wild type. In contrast, the RPKM values ​​of genes outside the overlapping region (and expressed to reasonable levels in HN4) show lower expression only in the respective mutant in which they are deleted, but not in the other.

[0135] Thus, RNA sequencing gene expression analysis confirms each of the deletions identified in the rba-1 and rba-2 genome assemblies as true deletions.

[0136] Example 5 Detection and sequence validation of regulatory elements of benzylisoquinoline alkaloid (RBA) genes. Of the six genes present in the overlapping region deleted in both mutants, only one shows homology to a gene known to be involved in transcriptional regulation: PS0917990.1, which encodes a bHLH transcription factor.

[0137] Its deletion results in loss of expression of most of the genes known to be involved in BIA biosynthesis, resulting in a "loss of all BIA" phenotype. PS0917990.1 is the master regulator of BIA synthesis and is therefore referred to as regulator of benzylisoquinoline alkaloids (RBA).

[0138] Cloning and Sanger sequencing from genomic and cDNA confirmed that the RBA sequences from HN4 were identical to those from the HN1 reference genome assembly.

[0139] Table 3: RNA sequencing gene expression analysis of genes present in the genomic region of chromosome 9 deleted in the rba-1 and rba-2 mutant lines Upper stem tissue at the flowering stage was used for RNA isolation followed by RNA sequencing. RPKM normalized expression levels are shown (RPKM=reads per kilobase per million mapped reads). RPKM values ​​obtained for rba-1 and rba-2 mutants are compared to HN4 wild type.

[0140] The column "Gene ID" shows the opium poppy gene identifier from the annotation of the HN1 genome assembly. The column "Deleted in" shows the mutants in which genome resequencing and assembly found that the respective gene is deleted. Genes PS0917890.1-PS0917930.1 are deleted in rba-2 but not in the rba-1 mutant, genes PS0917940.1-PS0917990.1 reside in an overlapping region that is deleted in both mutants, and genes PS0918000.1-PS0918050.1 are deleted in rba-1 but not in the rba-2 mutant. PS0917990.1 encodes the bHLH transcription factor RBA. [Table 2]

Claims

1. An expression cassette adapted for plant expression, comprising: i) a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1; ii) a nucleic acid molecule, wherein the complementary strand of the nucleic acid molecule hybridizes with the sequence of SEQ ID NO: 1 under stringent hybridization conditions, and the nucleic acid molecule encodes a helix-loop-helix transcription factor; iii) a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; iv) a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue represented by i), ii) or iii) above, the polypeptide is a transcription factor, and the transcription factor controls the transcription of one or more genes involved in the synthesis of benzylisoquinoline alkaloids; An expression cassette comprising a nucleic acid molecule selected from the above.

2. The expression cassette according to claim 1, wherein the modified polypeptide is a variant and is at least 50%, 55%, 59%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% similar to the amino acid sequence set forth in SEQ ID NO: 2 over the entire amino acid sequence.

3. The one or more genes involved in the synthesis of benzyl alkaloids are tabersonine synthase, salutaridine reductase, salutaridinol 7-O-acetyltransferase, salutaridine synthase, codeine O-demethylase, codeinone reductase, tabersonine 6-O-demethylase, (S)-to-(R)-reticuline P450-oxidoreductase, O-methyltransferase 1, canadine synthase, O-methyltransferase 3, cytochrome P450 CYP82Y1, O-methyltransferase 2, acetyltransferase 1, cytochrome P450 CYP82X2, cytochrome P450 CYP82X1, carboxylesterase 1, short-chain dehydrogenase / reductase, (S)-tetrahydroprotoberberine-cis-N-methyltransferase, berberine bridge enzyme, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 2, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 1, (S)-N-methylcoclaurine 3'-hydroxylase, coclaurine N-methyltransferase, norcoclaurine 6-O-methyltransferase, S-norcoclaurine synthase 1, protopine 6-hydroxylase, norreticuline-7-O-methyltransferase, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 2, 3'-hydroxy-N-methylcoclaurine 4'-O-methyltransferase 1, (S)-N-methylcoclaurine 3'-hydroxylase, coclaurine N-methyltransferase, norcoclaurine 6-O-methyltransferase, S-norcoclaurine synthase 1, (S)-tetrahydroprotoberberine-cis-N-methyltransferase, norreticuline-7-O-methyltransferase, scoulerine O-demethylase, the expression cassette according to claim 1 or 2, selected from.

4. The expression cassette according to claim 1 or 2, wherein the nucleic acid molecule is operably linked to a transcriptional promoter.

5. The expression cassette according to claim 4, wherein the transcriptional promoter is a heterologous promoter, an endogenous promoter, an inducible promoter, a tissue-specific promoter, or a constitutive promoter.

6. A vector comprising the expression cassette according to claim 1.

7. The vector according to claim 6, wherein the expression vector is a transposon.

8. The vector according to claim 6, wherein the expression vector is a viral vector.

9. A plant transformed or transfected with the transcription cassette according to claim 1 or 2 or the expression vector according to claim 6.

10. The plant according to claim 9, which is of the genus Papaver.

11. Plant material obtained from the plant according to claim 9.

12. A plant cell transformed or transfected with the transcription cassette according to claim 1 or 2 or the expression vector according to claim 6.

13. The plant cell according to claim 12, wherein the transcription cassette or expression vector is stably integrated into the plant cell genome or transiently expressed in the plant cell.

14. A plant cell culture comprising the transformed plant cell according to claim 12.

15. A plant cell of the genus Papaver transformed or transfected with the transcription cassette according to claim 1 or 2 or the expression vector according to claim 6, or a plant cell culture comprising the transformed plant cell.

16. A plant comprising a plurality of the transformed plant cells according to claim 12.

17. A plant seed comprising a plurality of the transformed plant cells according to claim 12.

18. A pollen grain comprising the transformed plant cell according to claim 12.

19. A plant or plant seed comprising a plant cell transformed or transfected with the transcription cassette according to claim 1 or 2 or the expression vector according to claim 6, wherein the plant or seed is homozygous for the integrated transcription cassette or integrated expression vector.

20. A bioreactor comprising the plant cell culture according to claim 14.

21. A process for producing one or more benzylisoquinoline alkaloids, comprising: i) forming a cell culture comprising the transformed cells according to claim 12 in a cell culture vessel; ii) culturing the cell culture in the presence of one or more benzylisoquinoline alkaloids or benzylisoquinoline precursors or intermediates; and optionally, iii) extracting one or more benzylisoquinoline alkaloids from the transformed or transfected cells or cell culture.

22. A process for extracting benzylisoquinoline alkaloids from plants of the genus Papaver, comprising: i) harvesting a plant or plant material prepared from the plant according to claim 9; ii) forming a reaction mixture of particulate plant material; iii) extracting the reaction mixture to provide a benzylisoquinoline alkaloid enriched fraction, and optionally iv) concentrating the alkaloid enriched fraction to provide a benzylisoquinoline alkaloid enriched fraction.

23. A method for generating a plant with increased expression of a transcription factor, comprising: i) transforming a plant with the vector according to claim 6; ii) obtaining seeds from the plant under i); iii) cultivating the seeds under ii) to generate first and subsequent generations of plants; iv) obtaining seeds from the first and subsequent generations of plants.

24. A method for generating a plant cell with increased expression of a transcription factor, comprising: i) transforming a plant cell with the vector according to claim 6; ii) culturing the transformed plant cell to provide a plant cell culture comprising plant cells overexpressing the transcription factor.

25. A plant of the genus Papaver or a plant part thereof, comprising a gene encoding a transcription factor comprising the nucleotide sequence set forth in SEQ ID NO: 1 or a polymorphic sequence variant of SEQ ID NO: 1, wherein the nucleotide sequence is modified and the modified nucleotide sequence encodes a transcription factor having reduced or undetectable transcription factor activity.

26. The plant of the genus Papaver or a plant part thereof according to claim 25, wherein the plant part is a capsule.

27. The plant of the genus Papaver or a plant part thereof according to claim 25, wherein the plant part is a seed.

28. The plant of the genus Papaver, capsule, or seed according to any one of claims 25 to 27, substantially lacking benzylisoquinoline alkaloids or benzylisoquinoline precursors.

Images