RNA vaccines
Patent Information
- Application Number
- JP2024505286
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-07-30
- Filing Date
- 2022-07-29
- Publication Date
- 2025-08-05
AI Technical Summary
There is a need for rapid and effective prevention and treatment of infectious diseases, particularly those caused by viruses and bacteria, as well as cancer, due to the increasing resistance to antibiotics and the burden of infectious diseases on global health, exemplified by the COVID-19 pandemic.
The use of self-replicating RNA molecules and messenger RNA (mRNA) molecules to elicit immune responses, modified to reduce miRNA binding and encode viral replication proteins and antigenic proteins, delivered with lipid nanoparticles for efficient vaccine development.
These RNA molecules induce robust immune responses against infectious agents and cancer antigens, providing a rapid and effective vaccine platform capable of continuous protein expression and immune stimulation.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 227,972, filed July 30, 2021, which is incorporated by reference herein in its entirety for all purposes.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. Said ASCII copy, created on July 22, 2022, is named "049386-544001WO_SL_ST26.xml" and is 485,649 bytes in size.
[0003] The present disclosure relates generally to eliciting an immune response against infectious agents, and more specifically to RNA molecules and liponanoparticles as vaccines. [Background technology]
[0004] Infectious diseases pose a significant burden on health worldwide. According to the World Health Organization (WHO), lower respiratory tract infections were the world's deadliest infectious diseases in 2016, which caused approximately 3 million deaths. The impact of infectious diseases is illustrated by the coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). SARS-CoV-2 is a novel coronavirus that was first identified in Wuhan, China in December 2019, and as of July 2021, has caused over 184 million confirmed infections and nearly 4 million deaths worldwide. Control measures to curb the rapid global spread of SARS-CoV-2, such as national lockdowns, workplace and school closures, and reduced international travel, have taken a toll on the global economy and social welfare.
[0005] Self-replicating ribonucleic acid (RNA), such as RNA from viral replicons, and messenger RNA (mRNA) are useful for expressing proteins, e.g., heterologous proteins, for a variety of purposes, such as the expression of therapeutic proteins and the expression of antigens for vaccines. A desirable property of a replicon is the ability for sustained expression of a protein.
[0006] There are few treatments for infectious diseases caused by viruses and eukaryotes, and resistance to antibiotics for the treatment of bacterial infections is increasing. In addition, rapid responses, including rapid vaccine development, are required to effectively control emerging infectious diseases and pandemics. Thus, there is a need for prevention and / or treatment of infectious diseases and cancer. Summary of the Invention
[0007] The present disclosure provides RNA molecules useful for eliciting an immune response. Both self-replicating RNA molecules and messenger RNA (mRNA) molecules are provided.
[0008] In some embodiments, provided herein is an RNA molecule comprising: (a) a first polynucleotide encoding one or more viral replication proteins, wherein one or more miRNA binding sites in the first polynucleotide are modified compared to a reference polynucleotide; and (b) a second polynucleotide comprising a first transgene encoding a first antigenic protein or a fragment thereof.
[0009] Also provided herein, in some embodiments, is an RNA molecule comprising: (i) a first polynucleotide comprising a sequence having at least 80% identity to the sequence of SEQ ID NO:6; and (ii) a second polynucleotide comprising a first transgene encoding a first antigenic protein or a fragment thereof.
[0010] In some embodiments, the modification of one or more miRNA binding sites reduces or eliminates miRNA binding.In some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 miRNA binding sites in the first polynucleotide are modified.In some embodiments, the one or more miRNA binding sites are selected from the miRNA binding regions having the sequence of SEQ ID NO: 58, 59, 72, 80, 81, 83, 101, 102, 103, 112, 113, 114, 128, 131, 142, 156, 157, 171, 175, and any combination thereof.
[0011] In some embodiments, one or more of the viral replication proteins of the RNA molecules provided herein is an alphavirus protein or a rubivirus protein. In some embodiments, the alphavirus protein is selected from the group consisting of Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), Salmonid alphavirus (SAV), Buggy Creek virus (BCRV), or any combination thereof.
[0012] In some embodiments, a first polynucleotide of an RNA molecule provided herein encodes a polyprotein comprising an alphavirus nsP1 protein, an alphavirus nsP2 protein, an alphavirus nsP3 protein, an alphavirus nsP4 protein, or any combination thereof. In some embodiments, the first polynucleotide encodes a polyprotein comprising an alphavirus nsP1 protein, an alphavirus nsP2 protein, an alphavirus nsP3 protein, or any combination thereof, and an alphavirus nsP4 protein. In some embodiments, the first polynucleotide comprises a sequence having at least 80% identity to the sequence of SEQ ID NO:6. In some embodiments, the first polynucleotide comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:6. In some embodiments, the first polynucleotide encodes a polyprotein comprising a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:187.
[0013] In some embodiments, the RNA molecules provided herein comprise a 5' untranslated region (UTR). In some embodiments, the 5'UTR comprises a viral 5'UTR, a non-viral 5'UTR, or a combination of viral and non-viral 5'UTR sequences. In some embodiments, the 5'UTR comprises an alphavirus 5'UTR. In some embodiments, the alphavirus 5'UTR is selected from the group consisting of Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland In some embodiments, the 5'UTR comprises a sequence of HJV, Fort Morgan virus (FMV), Ndumu virus (NDUV), Salmonid alphavirus (SAV), or Buggy Creek virus (BCRV). In some embodiments, the 5'UTR comprises the sequence of SEQ ID NO:5.
[0014] In some embodiments, the RNA molecules provided herein comprise a 3' untranslated region (UTR). In some embodiments, the 3'UTR comprises a viral 3'UTR, a non-viral 3'UTR, or a combination of viral and non-viral 3'UTR sequences. In some embodiments, the 3'UTR comprises an alphavirus 3'UTR. In some embodiments, the alphavirus 3'UTR is selected from the group consisting of Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland In some embodiments, the 3'UTR comprises a J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), Salmonid alphavirus (SAV), or Buggy Creek virus (BCRV) 3'UTR sequence. In some embodiments, the 3'UTR comprises the sequence of SEQ ID NO: 9. In some embodiments, the 3'UTR further comprises a polyA sequence.
[0015] In some embodiments, the first antigen protein of the RNA molecule provided herein is a virus protein, a bacterial protein, a fungal protein, a protozoan protein, or a parasite protein.In some embodiments, the virus protein is a coronavirus protein, an orthomyxovirus protein, a paramyxovirus protein, a picornavirus protein, a flavivirus protein, a filovirus protein, a rhabdovirus protein, a togavirus protein, an arterivirus protein, a bunyavirus protein, a arenavirus protein, a reovirus protein, a bornavirus protein, a retrovirus protein, an adenovirus protein, a herpesvirus protein, a polyomavirus protein, a papillomavirus protein, a poxvirus protein, or a hepadnavirus protein. In some embodiments, the first antigenic protein is a SARS-CoV-2 protein, an influenza virus protein, a respiratory syncytial virus (RSV) protein, a human immunodeficiency virus (HIV) protein, a hepatitis C virus (HCV) protein, a cytomegalovirus (CMV) protein, a Lassa fever virus (LFV) protein, an Ebola virus (EBOV) protein, a Mycobacterium protein, a Bacillus protein, a Yersinia protein, a Streptococcus protein, a Pseudomonas protein, a Shigella protein, a Campylobacter protein, a Salmonella protein, a Plasmodium protein, or a Toxoplasma protein. In some embodiments, the first antigenic protein is a SARS-CoV-2 spike glycoprotein.In some embodiments, the SARS-CoV-2 spike glycoprotein comprises an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17. In some embodiments, the second polynucleotide of the RNA molecules provided herein comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In some embodiments, the first transgene of the RNA molecules provided herein is expressed from a first subgenomic promoter.
[0016] In some embodiments, the second polynucleotide of the RNA molecule provided herein comprises at least two transgenes. In some embodiments, the second transgene of the second polynucleotide encodes a second antigenic protein or a fragment thereof or an immunomodulatory protein. In some embodiments, the second polynucleotide further comprises a sequence encoding a 2A peptide, an internal ribosome entry site (IRES), a second subgenomic promoter, or a combination thereof, located between the transgenes. In some embodiments, the immunomodulatory protein is a cytokine, a chemokine, or an interleukin. In some embodiments, the first and second transgenes of the second polynucleotide encode a viral protein, a bacterial protein, a fungal protein, a protozoan protein, a parasitic protein, an immunomodulatory protein, or any combination thereof.
[0017] In some embodiments, the first polynucleotide is located 5' of the second polynucleotide. In some embodiments, the RNA molecule provided herein further comprises an intergenic region located between the first polynucleotide and the second polynucleotide. In some embodiments, the intergenic region comprises a sequence having at least 85% identity to the sequence of SEQ ID NO:7.
[0018] In some embodiments, the RNA molecule provided herein is a self-replicating RNA molecule.In some embodiments, the RNA molecule provided herein comprises the sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.In some embodiments, the RNA molecule provided herein is a self-replicating RNA molecule. In some embodiments, the RNA molecules provided herein comprise a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:40, or SEQ ID NO:48.
[0019] In some embodiments, the RNA molecules provided herein further comprise a 5' cap. In some embodiments, the 5' cap is a Cap1 structure, Cap1( m6 A) structure, Cap2 structure, or Cap0 structure.
[0020] In some embodiments, the present invention provides a DNA molecule that encodes any of the RNA molecules provided herein. In some aspects, the DNA molecule provided herein comprises a promoter. In some aspects, the promoter is located 5' of the 5'UTR. In some aspects, the promoter is a T7 promoter, a T3 promoter, or an SP6 promoter.
[0021] In some embodiments, provided herein is a composition comprising any of the RNA molecules provided herein and a lipid. In some aspects, the lipid comprises an ionizable cationic lipid. In some aspects, the ionizable cationic lipid comprises the following structure: [ka] or a pharma- ceutically acceptable salt thereof.
[0022] In some embodiments, provided herein is a composition comprising any of the RNA molecules provided herein and a lipid formulation.
[0023] In some embodiments, the lipid formulation comprises an ionizable cationic lipid. In some embodiments, the ionizable cationic lipid comprises the following structure: [ka] or a pharma- ceutically acceptable salt thereof.
[0024] In some embodiments, the lipid formulation is selected from lipoplexes, liposomes, lipid nanoparticles, polymer-based carriers, exosomes, lamellar bodies, micelles, and emulsions. In some embodiments, the lipid formulation is a liposome selected from cationic liposomes, nanoliposomes, proteoliposomes, unilamellar liposomes, multilamellar liposomes, ceramide-containing nanoliposomes, and multivesicular liposomes. In some embodiments, the lipid formulation is a lipid nanoparticle. In some embodiments, the lipid nanoparticles have a size of less than about 200 nm. In some embodiments, the lipid nanoparticles have a size of less than about 150 nm. In some embodiments, the lipid nanoparticles have a size of less than about 100 nm. In some embodiments, the lipid nanoparticles have a size of about 55 nm to about 90 nm. In some embodiments, the lipid formulation comprises one or more cationic lipids.In some embodiments, the one or more cationic lipids are 5-carboxyspermylglycine dioctadecylamide (DOGS), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium (DOSPA), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleoyloxy- N,N-Dimethyl-3-aminopropane (DODMA), 1,2-Dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), 1,2-Dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLenDMA), N-Dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-Distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-Dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 3-Dimethyl Amino-2-(cholest-5-ene-3-beta-oxybutane-4-oxy)-1-(cis,cis-9,12-oc-tadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-1-(cis,cis-9',1-2'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarb DAP), 2,3-dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), and 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or (DLin-K-XTC2-DMA).In some embodiments, the lipid formulation comprises an ionizable cationic lipid. In some embodiments, the ionizable cationic lipid has Formula I: [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein R 5 and R 6 each independently represents a straight-chain or branched C 1 -C 31 Alkyl, C 2 -C 31 Alkenyl, or C 2 -C 31 L is selected from the group consisting of alkynyl and cholesteryl; 5 and L 6 are each independently a linear C 1 -C 20 Alkyl and C 2 -C 20 alkenyl; X 5 is -C(O)O-, which results in -C(O)OR 6 is formed, or -OC(O)-, whereby -OC(O)-R 6 is formed, and X 6 is -C(O)O-, which results in -C(O)OR 5 is formed, or -OC(O)-, whereby -OC(O)-R 5 is formed, and X 7 is S or O, and L 7 is absent or lower alkyl, R 4 is a linear or branched C 1 -C 6 is alkyl, R 7 and R 8 are each independently hydrogen and a straight-chain or branched C 1 -C 6 In some embodiments, the ionizable cationic lipid is selected from the group consisting of: alkyl, aryl, arylsulfates, arylalkyl, arylsulfates ... [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]
[0025] In some embodiments, the ionizable cationic lipid is ATX-126: [ka]
[0026] In some aspects, the lipid formulation of the compositions provided herein encapsulates the nucleic acid molecule. In some aspects, the lipid formulation is complexed with the nucleic acid molecule.
[0027] In some embodiments, the lipid formulation further comprises a helper lipid. In some embodiments, the helper lipid is a phospholipid. In some embodiments, the helper lipid is selected from dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylcholine (DPPC), and phosphatidylcholine (PC). In some embodiments, the helper lipid is distearoylphosphatidylcholine (DSPC).
[0028] In some embodiments, the lipid formulation of the compositions provided herein further comprises cholesterol. In some embodiments, the lipid formulation further comprises polyethylene glycol (PEG)-lipid conjugate. In some embodiments, the PEG-lipid conjugate is PEG-DMG. In some embodiments, the PEG-DMG is PEG2000-DMG.
[0029] In some embodiments, the lipid portion of the lipid formulation comprises about 40 mol% to about 60 mol% of ionizable cationic lipid, about 4 mol% to about 16 mol% of DSPC, about 30 mol% to about 47 mol% of cholesterol, and about 0.5 mol% to about 3 mol% of PEG2000-DMG. In some embodiments, the lipid portion of the lipid formulation comprises about 42 mol% to about 58 mol% of ionizable cationic lipid, about 6 mol% to about 14 mol% of DSPC, about 32 mol% to about 44 mol% of cholesterol, and about 1 mol% to about 2 mol% of PEG2000-DMG. In some embodiments, the lipid portion of the lipid formulation comprises about 45 mol% to about 55 mol% of ionizable cationic lipid, about 8 mol% to about 12 mol% of DSPC, about 35 mol% to about 42 mol% of cholesterol, and about 1.25 mol% to about 1.75 mol% of PEG2000-DMG.
[0030] In some embodiments, the composition has a total lipid:nucleic acid molecular weight ratio of about 50:1 to about 10:1. In some embodiments, the composition has a total lipid:nucleic acid molecular weight ratio of about 44:1 to about 24:1. In some embodiments, the composition has a total lipid:nucleic acid molecular weight ratio of about 40:1 to about 28:1. In some embodiments, the composition has a total lipid:nucleic acid molecular weight ratio of about 38:1 to about 30:1. In some embodiments, the composition has a total lipid:nucleic acid molecular weight ratio of about 37:1 to about 33:1.
[0031] In some embodiments, the composition comprises a HEPES or TRIS buffer at a pH of about 7.0 to about 8.5, hi some embodiments, the HEPES or TRIS buffer is at a concentration of about 7 mg / mL to about 15 mg / mL.
[0032] In some embodiments, the composition further comprises about 2.0 mg / mL to about 4.0 mg / mL NaCl. In some embodiments, the composition further comprises one or more cryoprotectants. In some embodiments, the one or more cryoprotectants are selected from sucrose, glycerol, or a combination of sucrose and glycerol. In some embodiments, the composition comprises a combination of sucrose at a concentration of about 70 mg / mL to about 110 mg / mL and glycerol at a concentration of about 50 mg / mL to about 70 mg / mL.
[0033] In some embodiments, the composition is a lyophilized composition. In some embodiments, the lyophilized composition comprises one or more lyoprotectants. In some embodiments, the lyophilized composition comprises poloxamer, potassium sorbate, sucrose, or any combination thereof. In some embodiments, the poloxamer is poloxamer 188.
[0034] In some embodiments, the lyophilized composition comprises about 0.01 to about 1.0% w / w of RNA molecules. In some embodiments, the lyophilized composition comprises about 1.0 to about 5.0% w / w of lipid. In some embodiments, the lyophilized composition comprises about 0.5 to about 2.5% w / w of TRIS buffer. In some embodiments, the lyophilized composition comprises about 0.75 to about 2.75% w / w of NaCl. In some embodiments, the lyophilized composition comprises about 85 to about 95% w / w of sugar. In some embodiments, the sugar is sucrose. In some embodiments, the lyophilized composition comprises about 0.01 to about 1.0% w / w of poloxamer. In some embodiments, the poloxamer is poloxamer 188. In some embodiments, the lyophilized composition comprises about 1.0 to about 5.0% w / w of potassium sorbate.
[0035] In some embodiments, the compositions provided herein comprise an RNA molecule comprising (A) the sequence of SEQ ID NO:1, (B) the sequence of SEQ ID NO:2, (C) the sequence of SEQ ID NO:3, or (D) the sequence of SEQ ID NO:4. In some embodiments, the compositions provided herein comprise an RNA molecule comprising the sequence of SEQ ID NO:29. In some embodiments, the compositions provided herein comprise an RNA molecule comprising the sequence of SEQ ID NO:32. In some embodiments, the compositions provided herein comprise an RNA molecule comprising the sequence of SEQ ID NO:48. In some embodiments, the compositions provided herein comprise an RNA molecule comprising the sequence of SEQ ID NO:40.
[0036] In some embodiments, the present invention relates to a lipid composition comprising about 45 mol % to about 55 mol % of an ionizable cationic lipid having the structure of aiATX-126: [ka] A lipid nanoparticle composition is provided comprising a lipid formulation comprising ii. about 8 mol% to about 12 mol% DSPC, iii. about 35 mol% to about 42 mol% cholesterol, and iv. about 1.25 mol% to about 1.75 mol% PEG2000-DMG, and b. an RNA molecule having at least 80% identity to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, wherein the lipid formulation encapsulates the RNA molecule and the lipid nanoparticle has a size of about 60 to about 90 nm. In some embodiments, the RNA molecule included in the lipid nanoparticle composition provided herein has at least 80% identity to the sequence of SEQ ID NO:29. In some embodiments, the RNA molecule included in the lipid nanoparticle composition provided herein has at least 80% identity to the sequence of SEQ ID NO:32. In some embodiments, the RNA molecule included in the lipid nanoparticle composition provided herein has at least 80% identity to the sequence of SEQ ID NO:40. In some embodiments, the RNA molecule contained in the lipid nanoparticle compositions provided herein has at least 80% identity to the sequence of SEQ ID NO: 48. In some embodiments, the RNA molecule contained in the lipid nanoparticle compositions provided herein has at least 80% identity to the sequence of SEQ ID NO: 29. In some embodiments, the RNA molecule contained in the lipid nanoparticle compositions provided herein has at least 80% identity to the sequence of SEQ ID NO: 32.
[0037] In some embodiments, the present disclosure provides a method for administering the compositions provided herein to a subject in need thereof.In some aspects, the compositions provided herein are administered intramuscularly, subcutaneously, intradermally, transdermally, intranasally, orally, sublingually, intravenously, intraperitoneally, topically, by aerosol, or by pulmonary route.In some aspects, the compositions provided herein are administered intramuscularly.
[0038] Provided herein, in some embodiments, are methods of administering a composition provided herein to a subject in need thereof, where the composition is lyophilized and reconstituted prior to administration.
[0039] Provided herein, in some embodiments, is a method for preventing or ameliorating COVID-19, comprising administering to a subject in need thereof a composition provided herein. In some embodiments, the composition is administered once. In some embodiments, the composition is administered twice.
[0040] Provided herein, in some embodiments, are methods of administering a booster dose to a vaccinated subject, comprising administering a composition provided herein to a subject who has previously been vaccinated against a coronavirus.
[0041] In some embodiments, the compositions provided herein are administered in the methods provided herein at a nucleic acid dose of about 0.01 μg to about 1,000 μg. In some embodiments, the compositions provided herein are administered in a nucleic acid dose of about 1, 2, 5, 7.5, or 10 μg.
[0042] In some embodiments, the present invention provides a method for inducing an immune response in a subject, comprising administering to the subject an effective amount of an RNA molecule provided herein. In some embodiments, the RNA molecule is administered intramuscularly, subcutaneously, intradermally, transdermally, intranasally, orally, sublingually, intravenously, intraperitoneally, topically, by aerosol, or by pulmonary route.
[0043] Provided herein, in some embodiments, is a method of eliciting an immune response in a subject, comprising administering to the subject an effective amount of a composition provided herein. In some aspects, the composition is administered intramuscularly, subcutaneously, intradermally, transdermally, intranasally, orally, sublingually, intravenously, intraperitoneally, topically, by aerosol, or by pulmonary route.
[0044] Provided herein, in some embodiments, are RNA molecules for use in eliciting an immune response against a first antigenic protein or fragment thereof.
[0045] Also provided herein, in some embodiments, is the use of an RNA molecule provided herein in the manufacture of a medicament for eliciting an immune response against a first antigenic protein or a fragment thereof.
[0046] In another embodiment, the disclosure provides an RNA molecule for antigen expression comprising an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 33 or SEQ ID NO: 30, with T substituted with U.
[0047] In some embodiments, the RNA molecule further comprises a 5'UTR having a sequence selected from SEQ ID NO: 35, SEQ ID NOs: 189-218, or SEQ ID NOs: 233-279.
[0048] In some embodiments, the RNA molecule further comprises a 3'UTR having a sequence selected from SEQ ID NO: 37, SEQ ID NOs: 219-225, or SEQ ID NOs: 280-317.
[0049] In some embodiments, the RNA molecule further comprises a 5' cap. In some embodiments, the 5' cap has a Cap1 structure, a Cap1(m6A) structure, a Cap2 structure, or a Cap0 structure.
[0050] In some embodiments, the RNA molecule further comprises a polyA tail.
[0051] In another embodiment, the disclosure provides an RNA molecule for expressing an antigen comprising an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 33, a 5'UTR comprising the sequence of SEQ ID NO: 35, and a 3'UTR comprising the sequence of SEQ ID NO: 37, or an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 30, a 5'UTR comprising the sequence of SEQ ID NO: 35, and a 3'UTR comprising the sequence of SEQ ID NO: 37, wherein T is replaced by U.
[0052] In some embodiments, the RNA molecule further comprises a 5' cap. In some embodiments, the 5' cap has a Cap1 structure, a Cap1(m6A) structure, a Cap2 structure, or a Cap0 structure.
[0053] In some embodiments, the RNA molecule further comprises a polyA tail.
[0054] In another embodiment, the disclosure provides a DNA molecule encoding any one of the RNA molecules described herein.
[0055] In some embodiments, the DNA molecule comprises a promoter. In some embodiments, the promoter is a T7 promoter, a T3 promoter, or an SP6 promoter.
[0056] In another embodiment, the disclosure provides a composition comprising any of the RNA molecules described herein and a lipid formulation.
[0057] In some aspects, the lipid formulation is selected from lipoplexes, liposomes, lipid nanoparticles, polymer-based carriers, exosomes, lamellar bodies, micelles, and emulsions.
[0058] In some aspects, the lipid formulation is a liposome selected from cationic liposomes, nanoliposomes, proteoliposomes, unilamellar liposomes, multilamellar liposomes, ceramide-containing nanoliposomes, and multivesicular liposomes.
[0059] In some aspects, the lipid formulation is a lipid nanoparticle.
[0060] In some embodiments, the lipid formulation comprises one or more cationic lipids.In some embodiments, the one or more cationic lipids are 5-carboxyspermylglycine dioctadecylamide (DOGS), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium (DOSPA), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleoyloxy- N,N-Dimethyl-3-aminopropane (DODMA), 1,2-Dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), 1,2-Dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLenDMA), N-Dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-Distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-Dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 3-Dimethyl Amino-2-(cholest-5-ene-3-beta-oxybutane-4-oxy)-1-(cis,cis-9,12-oc-tadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-1-(cis,cis-9',1-2'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarb DAP), 2,3-dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), and 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or (DLin-K-XTC2-DMA).
[0061] In some embodiments, the lipid formulation comprises an ionizable cationic lipid. In some embodiments, the ionizable cationic lipid is represented by Formula I: [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein R5 and R6 are each independently selected from the group consisting of linear or branched C1-C31 alkyl, C2-C31 alkenyl, or C2-C31 alkynyl and cholesteryl; L5 and L6 are each independently selected from the group consisting of linear C1-C20 alkyl and C2-C20 alkenyl; and X5 is -C(O)O-, thereby forming -C(O)O-R6; or X is -C(O)-, thereby forming -OC(O)-R; X is -C(O)O-, thereby forming -C(O)O-R; or -OC(O)-, thereby forming -OC(O)-R; X is S or O; L is absent or a lower alkyl; R is a straight or branched C-C alkyl; and R and R are each independently selected from the group consisting of hydrogen and straight or branched C-C alkyl.
[0062] In some aspects, the ionizable cationic lipid is selected from the following: [ka] or a pharma- ceutically acceptable salt thereof.
[0063] In some aspects, the lipid formulation comprises a helper lipid. In some aspects, the helper lipid is a phospholipid.
[0064] In some embodiments, the helper lipid is selected from dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylcholine (DPPC), and phosphatidylcholine (PC).
[0065] In some embodiments, the lipid formulation comprises cholesterol.
[0066] In some embodiments, the lipid formulation comprises a polyethylene glycol (PEG)-lipid conjugate.
[0067] In another embodiment, the disclosure provides a method of inducing an immune response in a subject, the method comprising administering to the subject an effective amount of any of the RNA molecules or compositions described herein.
[0068] In some embodiments, the methods include administering the RNA molecule or composition by intramuscular, subcutaneous, intradermal, transdermal, intranasal, oral, sublingual, intravenous, intraperitoneal, topical, or pulmonary routes.
[0069] In another embodiment, the disclosure provides a method of administering a booster dose to a vaccinated subject comprising administering any of the RNA molecules or compositions described herein to a subject who has previously been vaccinated against a coronavirus.
[0070] In some embodiments, the methods include administering the RNA molecule or composition by intramuscular, subcutaneous, intradermal, transdermal, intranasal, oral, sublingual, intravenous, intraperitoneal, topical, or pulmonary routes.
[0071] In some embodiments, the RNA molecules or compositions described herein are used to induce an immune response to an antigen.
[0072] In some embodiments, the RNA molecules or compositions described herein are used in the manufacture of a medicament for eliciting an immune response to an antigen. [Brief description of the drawings]
[0073] [Figure 1A] FIG. 1 shows a schematic diagram of an exemplary self-replicating RNA, including nsP1-nsP4 replicases and the coronavirus spike transgene region. [Figure 1B] Exemplary miRNA binding sites based on miRanda predictions are shown (Enright, AJ, John, B., Gaul, U. et al. MicroRNA targets in Drosophila. Genome Biol 5, R1 (2003). doi.org / 10.1186 / gb-2003-5-1-r1). The Venezuelan Equine Encephalitis Virus (VEEV) nonstructural protein coding region is shown with 15 predicted binding sites indicated by grey rectangles. [Figure 2A] Western blots of SARS-CoV-2 spike proteins expressed from the indicated constructs are shown, with the full-length spike protein and the S1 and S2 domains indicated by arrows. [Figure 2B] Quantitation of SARS-CoV-2 spike protein expressed from the indicated constructs is shown. [Figure 3A] Western blots of SARS-CoV-2 South African variant spike protein expressed from the indicated constructs. The arrow indicates the full-length spike protein. [Figure 3B] Western blots of SARS-CoV-2 D614G variant spike proteins expressed from the indicated constructs are shown. The arrow indicates the full-length spike protein. [Figure 3C] Western blots of SARS-CoV-2 D614G variant spike proteins expressed from the indicated constructs are shown. The arrow indicates the full-length spike protein. [Figure 3D] Quantitation of SARS-CoV-2 spike protein expression from the indicated constructs is shown. [Figure 4A] Quantitation of SARS-CoV-2 South African variant spike protein expression from the indicated constructs compared to a reference is shown. [Figure 4B] Quantitation of SARS-CoV-2 D614G variant spike protein expression from the indicated constructs compared to the reference is shown. [Figure 4C] Quantitation of SARS-CoV-2 D614G variant spike protein expression from the indicated constructs compared to the reference is shown. [Figure 5A] Shown is total immunoglobulin G (IgG) against the indicated SARS-CoV-2 spike proteins after immunization of mice with self-replicating RNA encoding the SARS-CoV-2 wild-type spike protein (Wuhan). [Figure 5B] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of mice with self-replicating RNA encoding the SARS-CoV-2 wild-type spike protein (Wuhan). [Figure 5C] Shown is total IgG against the indicated SARS-CoV-2 spike protein variants following immunization of mice with self-replicating RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 5D] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of mice with self-replicating RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 5E] Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of mice with self-replicating RNA encoding the SARS-CoV-2 South African spike protein variant. [Figure 5F] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of mice with self-replicating RNA encoding the SARS-CoV-2 South African spike protein variant. [Figure 6A]Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of mice with 2 μg of mRNA RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 6B] Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of mice with 15 μg of mRNA RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 6C] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of mice with 2 μg of mRNA RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 6D] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of mice with 15 μg of mRNA RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 7A] Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with self-replicating RNA encoding the SARS-CoV-2 wild-type spike protein (Wuhan). [Figure 7B] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with self-replicating RNA encoding the SARS-CoV-2 wild-type spike protein (Wuhan). [Figure 7C] Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with self-replicating RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 7D] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with self-replicating RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 7E]Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with self-replicating RNA encoding the SARS-CoV-2 South African spike protein variant. [Figure 7F] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with self-replicating RNA encoding the SARS-CoV-2 South African spike protein variant. [Figure 7G] Shown is total IgG against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with mRNA RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 7H] Neutralizing antibodies against the indicated SARS-CoV-2 spike proteins following immunization of non-human primates (NHPs) with mRNA RNA encoding the SARS-CoV-2 D614G spike protein variant. [Figure 8] 1 shows the HAI titers obtained with self-replicating RNA and mRNA constructs encoding the hemagglutinin of influenza virus A / California / 07 / 2009 (H1N1). [Figure 9A] Figure 1 shows the results of Luminex assay for anti-SARS-Cov-2 spike glycoprotein IgG in two preclinical studies. BALB / c mice were vaccinated with increasing RNA doses of self-replicating RNA (SEQ ID NO: 18) formulated as lyophilized lipid nanoparticles (LYO-LNP) and liquid (frozen) lipid nanoparticles (Liquid-LNP). First study 0.2μg. Blood was collected at various time points after vaccination and processed to serum and evaluated for anti-SARS-CoV-2 spike glycoprotein IgG. LYO-LNP was compared to Liquid-LNP by two-way ANOVA with Tukey's multiple comparison post-hoc test. *p<0.0332, **p<0.0021, ***p<0.0002, ****p<0.0001. [Figure 9B]Figure 1 shows the results of Luminex assay for anti-SARS-Cov-2 spike glycoprotein IgG in two preclinical studies. BALB / c mice were vaccinated with increasing RNA doses of self-replicating RNA (SEQ ID NO: 18) formulated as lyophilized lipid nanoparticles (LYO-LNP) and liquid (frozen) lipid nanoparticles (Liquid-LNP). First study 2μg. Blood was collected at various time points after vaccination and processed to serum and evaluated for anti-SARS-CoV-2 spike glycoprotein IgG. LYO-LNP was compared to Liquid-LNP by two-way ANOVA with Tukey's multiple comparison post-hoc test. *p<0.0332, **p<0.0021, ***p<0.0002, ****p<0.0001. [Figure 9C] Figure 1 shows the results of Luminex assay for anti-SARS-Cov-2 spike glycoprotein IgG in two preclinical studies. BALB / c mice were vaccinated with increasing RNA doses of self-replicating RNA (SEQ ID NO: 18) formulated as lyophilized lipid nanoparticles (LYO-LNP) and liquid (frozen) lipid nanoparticles (Liquid-LNP). Second study 0.2μg. Blood was collected at various time points after vaccination and processed to serum and evaluated for anti-SARS-CoV-2 spike glycoprotein IgG. LYO-LNP was compared to Liquid-LNP by two-way ANOVA with Tukey's multiple comparison post-hoc test. *p<0.0332, **p<0.0021, ***p<0.0002, ****p<0.0001. [Figure 9D]Figure 1 shows the results of Luminex assay for anti-SARS-Cov-2 spike glycoprotein IgG in two preclinical studies. BALB / c mice were vaccinated with increasing RNA doses of self-replicating RNA (SEQ ID NO: 18) formulated as lyophilized lipid nanoparticles (LYO-LNP) and liquid (frozen) lipid nanoparticles (Liquid-LNP). Second study 2μg. Blood was collected at various time points after vaccination and processed to serum and evaluated for anti-SARS-CoV-2 spike glycoprotein IgG. LYO-LNP was compared to Liquid-LNP by two-way ANOVA with Tukey's multiple comparison post-hoc test. *p<0.0332, **p<0.0021, ***p<0.0002, ****p<0.0001. [Figure 10] Figure 1 shows area under the curve (AUC) analysis of anti-SARS-Cov-2 spike glycoprotein IgG (combined data from first and second studies). Results of the IgG assays from two studies were combined to evaluate (A) 0.2 μg and (B) 2 μg of self-replicating RNA (SEQ ID NO: 18) formulated as lyophilized lipid nanoparticles (LYO-LNP) and liquid (frozen) lipid nanoparticles (Liquid-LNP). N=10 / group. Results from days 19 and 31 from the first study were combined with results from days 20 and 30 from the second study, respectively, to perform area under the curve (AUC) analysis. LYO-LNP was compared to Liquid-LNP by one-way ANOVA and Sidak's multiple comparison post-hoc test, with no statistical differences. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0074] The present disclosure relates to RNA, e.g., self-replicating RNA and messenger RNA (mRNA), for expressing a transgene, e.g., an antigenic protein, and the nucleic acids encoding them. Also provided herein are methods of administering RNA (e.g., to a host, e.g., a mammalian subject), whereby the RNA is translated in vivo and a heterologous protein coding sequence is expressed, e.g., eliciting an immune response in the recipient against the heterologous protein coding sequence, or, if the heterologous protein coding sequence is a therapeutic or antigenic protein, providing a therapeutic effect including eliciting an immune response. The RNA provided herein, e.g., self-replicating RNA and messenger RNA (mRNA), are useful as vaccines that can be rapidly generated and effective at low and / or single doses. The present disclosure further relates to methods of eliciting an immune response using the RNA provided herein.
[0075] In some embodiments, the immune response can be elicited against a coronavirus. Immunogens include, but are not limited to, those derived from SARS coronavirus, infectious bronchitis virus (IBV), mouse hepatitis virus (MHV), and transmissible gastroenteritis virus (TGEV). The coronavirus immunogen can be a spike polypeptide.
[0076] Self-replicating RNA is described, for example, in US2018 / 0036398, the contents of which are incorporated by reference in their entirety.
[0077] definition As used herein, the term "fragment", for example when referring to a protein or nucleic acid, refers to any sequence that is shorter than the full-length protein or nucleic acid. Thus, any sequence of a nucleic acid or protein other than the full-length nucleic acid or protein sequence can be a fragment. In some aspects, a protein fragment comprises an epitope. In other aspects, a protein fragment is an epitope.
[0078] As used herein, the term "nucleic acid" refers to any deoxyribonucleic acid (DNA) molecule, ribonucleic acid (RNA) molecule, or nucleic acid analog. The DNA or RNA molecule can be double-stranded or single-stranded and can be of any size. Exemplary nucleic acids include, but are not limited to, chromosomal DNA, plasmid DNA, cDNA, cell-free DNA (cfDNA), mitochondrial DNA, chloroplast DNA, viral DNA, mRNA, tRNA, rRNA, long non-coding RNA, siRNA, microRNA (miRNA or miR), hnRNA, and viral RNA. Exemplary nucleic acid analogs include peptide nucleic acid, morpholino and locked nucleic acid, glycol nucleic acid, and threose nucleic acid. As used herein, the term "nucleic acid molecule" is meant to include, for example, fragments of nucleic acid molecules, as well as any full-length or unfragmented nucleic acid molecule. As used herein, the terms "nucleic acid" and "nucleic acid molecule" can be used interchangeably unless the context indicates otherwise.
[0079] As used herein, the term "polynucleotide" refers to a nucleic acid sequence that contains at least two nucleotide monomers. The term "polynucleotide" can refer to DNA, RNA, or a nucleic acid analog. A "polynucleotide" can be double-stranded or single-stranded and can be of any size. A polynucleotide can be a separate nucleic acid molecule or a portion of a nucleic acid molecule. Thus, the term "polynucleotide" can refer to a nucleic acid molecule or a region of a nucleic acid molecule.
[0080] As used herein, the term "protein" refers to any polymeric chain of amino acids. The terms "peptide" and "polypeptide" can be used interchangeably with the term protein and can also refer to polymeric chains of amino acids, unless the context clearly indicates otherwise. The term "protein" encompasses natural or artificial proteins, fragments of proteins, and polypeptide analogs of protein sequences. Proteins can be monomeric or polymeric. The term "protein" encompasses fragments and variants thereof (including fragments of variants), unless the context clearly indicates otherwise.
[0081] Generally, "sequence identity" or "sequence homology", which may be used interchangeably, refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence, respectively, of two polynucleotide or polypeptide sequences. Typically, a procedure for determining sequence identity involves determining the nucleotide sequence of a polynucleotide and / or the amino acid sequence of the polypeptide encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. As used herein, the term "percentage of sequence identity" or "percentage of identity" (also including "percentage of homology") refers to the percentage of amino acid residues or nucleotides in a sequence that are identical to the amino acid residues or nucleotides in a reference sequence, after aligning the sequences and, if necessary, introducing gaps to achieve the maximum percentage of sequence identity (not considering conservative substitutions as part of sequence identity). Thus, two or more sequences (polynucleotide or amino acid) can be compared by determining their "percentage of identity" (also called "percentage of homology"). The percentage of identity to a reference sequence (e.g., a nucleic acid or amino acid sequence), which may be a sequence within a longer molecule (e.g., a polynucleotide or polypeptide), may be calculated as the number of exact matches between two optimally aligned sequences divided by the length of the reference sequence and multiplied by 100. The percentage of identity may also be determined by comparing sequence information using, for example, the latest version of the BLAST computer program, including version 2.2.9 available from the National Institutes of Health. The BLAST program is based on the method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990), as well as the alignment methods described in Altschul et al., J. Mol. Biol. 215:403-410 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993); and Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997).In summary, the BLAST program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. Using this program, the percentage of identity over the entire length of the sequences being compared can be determined. For example, default parameters are provided to optimize searches with a short query sequence using the blastp program. This program can also use a SEG filter to mask off segments of the query sequence, as determined by the SEG program of Wootton and Federhen, Computers and Chemistry 17:149-163 (1993). Desirable degrees of sequence identity range from about 80% to 100% and integer values therebetween. The percentage of identity between the reference sequence and the requested sequence can be at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%. In general, an exact match indicates 100% identity over the length of the reference sequence. Additional programs and methods for comparing sequences and / or assessing sequence identity include the Needleman-Wunsch algorithm (see, for example, the EMBOSS Needle aligner available at ebi.ac.uk / Tools / psa / emboss needle / , optionally using default settings), the Smith-Waterman algorithm (see, for example, the EMBOSS Water aligner available at ebi.ac.uk / Tools / psa / emboss water / , optionally using default settings), the similarity search method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85, 2444, or computer programs using these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group. 575 Science Drive, Madison, Wis.).In some embodiments, references to percentage of sequence identity refer to sequence identity measured using BLAST (Basic Local Alignment Search Tool). In other embodiments, ClustalW is used for multiple sequence alignment. Any suitable parameters of the selected algorithm, including default parameters, may be used to assess optimal alignment.
[0082] As used herein, "homologous sequences" refer to sequences that share sequence similarity and / or structural similarity (Pearson, 2013, An Introduction to Sequence similarity ("Homology") Searching, Current Protoc Bioinformatics, 42:3.1.1-3.1.8). Thus, homologous sequences share a common evolutionary ancestor or are derived from a common sequence. Homologous sequences may also share structural or sequence similarity to intermediate sequences. Homologous sequences may have similar functions (i.e., have functional similarity). Homology can be inferred based on nucleic acid and / or amino acid sequences, with protein similarity searches generally having higher sensitivity than nucleic acid sequence searches. Homology can also be inferred for amino acid sequences that contain similar amino acids, i.e., amino acids with similar physiochemical properties, rather than identical amino acids, at least over the sequence region. The terms "homologous sequence", "homolog", and "homologous nucleic acid" and / or "homologous protein" may be used interchangeably unless otherwise specified.
[0083] As used herein, the term "drug" or "pharmaceutical product" refers to a pharmaceutical formulation or composition described herein.
[0084] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "a method" includes one or more methods, and / or steps of the type described herein that would be apparent to a person of ordinary skill in the art upon reading this disclosure, and so forth.
[0085] As used herein, when referring to a measurable value, such as an amount, duration, and the like, "about" is meant to encompass a variation of +20%, or ±10%, or ±5%, or ±1% from the particular value, as such variations are appropriate for the disclosed methods or for practicing the disclosed methods.
[0086] The term "expression" refers to the process by which a nucleic acid sequence or polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and / or the process by which the transcribed mRNA or other RNA is subsequently translated into a peptide, polypeptide, or protein. The transcripts and the encoded polypeptides are sometimes collectively referred to as "gene products."
[0087] As used herein, the terms "self-replicating RNA", "self-transcriptional and self-replicating RNA", "self-amplifying RNA (saRNA)", and "replicon" may be used interchangeably unless the context indicates otherwise. In general, the term "replicon" or "viral replicon" refers to a self-replicating subgenomic RNA derived from a viral genome that contains viral genes encoding nonstructural proteins important for viral replication and lacks viral genes encoding structural proteins. Self-replicating RNA may further code for subgenomic RNA that is incapable of self-replicating. Self-replicating RNA may also be referred to as "STARR™" RNA.
[0088] As used herein, "operably linked," "operably linked," "operably linked," or grammatical equivalents thereof, refer to the juxtaposition of genetic elements, e.g., promoters, enhancers, polyadenylation sequences, etc., where the elements are in a relationship that allows them to operate in an expected manner. For example, a regulatory element, which may include a promoter and / or enhancer sequence, is operably linked to a coding region if the regulatory element serves to initiate transcription of the coding sequence. Intervening residues between the regulatory element and the coding region may be present so long as this functional relationship is maintained.
[0089] RNA molecule In some embodiments, provided herein is an RNA molecule comprising: (a) a first polynucleotide encoding one or more viral replication proteins, wherein one or more miRNA binding sites in the first polynucleotide are modified compared to a reference polynucleotide; and (b) a second polynucleotide comprising a first transgene encoding an antigenic protein or fragment thereof.
[0090] Also provided herein, in some embodiments, is an RNA molecule comprising: (i) a first polynucleotide comprising a sequence having at least 80% identity to the sequence of SEQ ID NO:6; and (ii) a second polynucleotide comprising a first transgene encoding a first antigenic protein or a fragment thereof.
[0091] Also provided herein, in some embodiments, is an RNA molecule for antigen expression comprising an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 33 or SEQ ID NO: 30, with T substituted with U.
[0092] Also provided herein is an RNA molecule for expressing an antigen, comprising an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 33, a 5'UTR comprising the sequence of SEQ ID NO: 35, and a 3'UTR comprising the sequence of SEQ ID NO: 37, or an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 30, a 5'UTR comprising the sequence of SEQ ID NO: 35, and a 3'UTR comprising the sequence of SEQ ID NO: 37, wherein T is replaced by U.
[0093] The RNA molecule may code for a single polypeptide immunogen or multiple polypeptides. Multiple immunogens can be presented as a single polypeptide immunogen (fusion polypeptide) or as separate polypeptides. If the immunogens are expressed as separate polypeptides from the replicon, one or more of them may be provided with an upstream IRES or additional viral promoter elements. Alternatively, multiple immunogens may be expressed from a polyprotein encoding each immunogen fused to a short autocatalytic protease (e.g., foot and mouth disease virus 2A protein) or as an intein.
[0094] Codon Optimization In some embodiments, the first polynucleotide of the RNA molecule provided herein that encodes one or more viral replication proteins comprises a codon-optimized sequence. As used herein, the term "codon-optimized" means that a polynucleotide, nucleic acid sequence, or coding sequence is redesigned compared to a wild-type or reference polynucleotide, nucleic acid sequence, or coding sequence by selecting different codons without changing the amino acid sequence of the encoded protein. Thus, codon optimization generally refers to replacing codons with synonymous codons to optimize protein expression while keeping the amino acid sequence of the translated protein the same. Codon optimization of a sequence can, for example, increase the protein expression level of the encoded protein (Gustafsson et al., Codon bias and heterologous protein expression. 2004, Trends Biotechnol 22:346-53) and provide other benefits. Variables such as codon usage preference, as measured by codon adaptation index (CAI), such as the presence or frequency of U and other nucleotides, mRNA secondary structure, cis-regulatory sequences, GC content, and other variables, can be correlated with protein expression levels (Villalobos et al., Gene Designer: a synthetic biology tool for constructing artificial DNA segments. 2006, BMC Bioinformatics 7:285). Prior to modifying the miRNA binding site, the first polynucleotide can be codon-optimized. The miRNA binding site can be modified to replace one or more codons with synonymous codons.
[0095] Any method of codon optimization can be used to codon-optimize the polynucleotides and nucleic acid molecules provided herein, and any variable can be changed by codon optimization. Thus, any combination of codon optimization methods can be used. Exemplary methods include the high codon adaptation index (CAI) method, the Low U method, and the like. The CAI method selects the most frequently used synonymous codon for the entire protein-coding sequence. As an example, the most frequently used codon for each amino acid can be estimated from the 74,218 protein-coding genes of the human genome. The Low U method generally targets U-containing codons that can be replaced with synonymous codons with fewer U moieties without changing other codons. If there are multiple replacement options, the more frequently used codon can be selected. Any polynucleotide, nucleic acid sequence, or codon sequence provided herein can be codon-optimized.
[0096] In some embodiments, the nucleotide sequence of any region of the RNA or DNA template described herein may be codon-optimized. Preferably, the primary cDNA template may include a reduced occurrence or frequency of a particular nucleotide in the template strand. For example, the occurrence of a nucleotide in the template may be reduced to a level of less than 25% of said nucleotide in the template. In a further example, the occurrence of a nucleotide in the template may be reduced to a level of less than 20% of said nucleotide in the template. In some examples, the occurrence of a nucleotide in the template may be reduced to a level of less than 16% of said nucleotide in the template. Preferably, the occurrence of a nucleotide in the template may be reduced to a level of less than 15% of said nucleotide in the template, preferably less than 12%.
[0097] In some embodiments, the reduced nucleotide is uridine. For example, the present disclosure provides nucleic acids with altered uracil content, where at least one codon in the wild-type sequence is replaced with an alternative codon to generate a uracil modified sequence. The altered uracil sequence may have at least one of the following properties: (i) an increased or decreased overall uracil content (i.e., the ratio of uracil to the total nucleotide content in a section of a nucleic acid, e.g., an open reading frame of a nucleic acid); (ii) increased or decreased local uracil content (i.e., the change in uracil content is restricted to a specific subsequence); (iii) A change in uracil distribution without a change in overall uracil content. (iv) changes in uracil clustering (e.g., number of clusters, location of clusters, or distance between clusters); or (v) Combinations thereof.
[0098] In some embodiments, the percentage of uracil nucleobases in nucleic acid sequence is reduced relative to the percentage of uracil nucleobases in wild-type nucleic acid sequence.For example, in wild-type sequence, 30% of nucleobases may be uracil, but the nucleobases that are uracil are preferably less than 15%, preferably less than 12%, preferably less than 10% of the nucleobases in the nucleic acid sequence of the present disclosure.The percentage of uracil content can be determined by dividing the number of uracils in sequence by the total number of nucleotides and multiplying by 100.
[0099] In some embodiments, the percentage of uracil nucleobases in a subsequence of a nucleic acid sequence is reduced relative to the percentage of uracil nucleobases in the corresponding subsequence of a wild-type sequence.For example, a wild-type sequence may have a 5'-end region (e.g., 30 codons) with a local uracil content of 30%, and in the nucleic acid sequence of the present disclosure, the uracil content of that same region may be reduced to preferably 15% or less, preferably 12% or less, preferably 10% or less.These subsequences may also be part of the wild-type sequence of the heterologous 5' and 3' UTR sequences of the present disclosure.
[0100] In some embodiments, the codons in the nucleic acid sequences of the present disclosure are reduced or modified in number, size, location, or distribution of uracil clusters, which may, for example, adversely affect protein translation. In certain aspects, a lower uracil content is desirable, but the uracil content, particularly localized uracil content, of some subsequences of the wild-type sequence may be greater than the wild-type sequence and still maintain beneficial characteristics (e.g., increased expression).
[0101] In some embodiments, uracil modified sequences elicit a lower Toll-like receptor (TLR) response compared to wild-type sequences. Several TLRs recognize and respond to nucleic acids. Double-stranded (ds) RNA, a common viral component, has been shown to activate TLR3. Single-stranded (ss) RNA activates TLR7. RNA oligonucleotides, e.g., RNA with phosphorothioate internucleotide linkages, are ligands for human TLR8. DNA containing unmethylated CpG motifs, characteristic of bacterial and viral DNA, activates TLR9.
[0102] As used herein, the term "TLR response" is defined as the recognition of single-stranded RNA by the TLR7 receptor, and preferably includes the physiological response triggered by RNA degradation and / or the recognition of single-stranded RNA by the receptor. Methods for determining and quantifying the binding of RNA to TLR7 are known in the art. Similarly, methods for determining whether an RNA triggers a TLR7-mediated physiological response (e.g., cytokine secretion) are well known in the art. In some embodiments, the TLR response may be mediated by TLR3, TLR8, or TLR9 instead of TLR7. Inhibition of TLR7-mediated responses can be achieved by nucleoside modifications. RNA undergoes over 100 different nucleoside modifications in nature. For example, human rRNA has 10 times more pseudouracil ('P) and 25 times more 2'-O-methylated nucleosides than bacterial rRNA. Bacterial RNA does not contain any nucleoside modifications, but mammalian RNA has modified nucleosides such as 5-methylcytidine (m5C), N6-methyladenosine (m6A), inosine, and many 2'-O-methylated nucleosides in addition to N7-methylguanosine (m7G).
[0103] In some embodiments, the uracil content of the polynucleotides disclosed herein is less than about 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the total nucleic acid bases of the sequence in the reference sequence. In some embodiments, the uracil content of the polynucleotides disclosed herein is about 5% to about 25%. In some embodiments, the uracil content of the polynucleotides disclosed herein is about 15% to about 25%.
[0104] In some embodiments, the increased or decreased nucleotide is a nucleotide other than or in addition to uracil. A sequence with altered nucleotide content may have (i) a local increase or decrease in C content (i.e., the change in cytosine content is limited to a particular subsequence), (ii) a local increase or decrease in G content (i.e., the change in guanosine content is limited to a particular subsequence), or (iii) a combination thereof.
[0105] In some embodiments, the first polynucleotide of the nucleic acid molecule provided herein comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, identity to the sequence of SEQ ID NO: 6. In some embodiments, the first polynucleotide of the nucleic acid molecule provided herein comprises the sequence of SEQ ID NO: 6.
[0106] Intergenic Regions In some aspects, the first polynucleotide and the second polynucleotide of the nucleic acid molecules provided herein are contained in the same (i.e., a single) or separate nucleic acid molecules. Generally, the first polynucleotide and the second polynucleotide of the nucleic acid molecules provided herein are contained in a single nucleic acid molecule. In one aspect, the first polynucleotide is located 5' of the second polynucleotide. In one aspect, the first polynucleotide and the second polynucleotide of the nucleic acid molecules provided herein are contained in separate nucleic acid molecules. In yet another aspect, the first polynucleotide and the second polynucleotide are contained in two separate nucleic acid molecules.
[0107] In some embodiments, the first polynucleotide and the second polynucleotide are contained in the same (i.e., a single) nucleic acid molecule. The first polynucleotide and the second polynucleotide of the nucleic acid molecule provided herein can be contiguous, i.e., adjacent to each other with no intervening nucleotides. In one embodiment, an intergenic region is located between the first polynucleotide and the second polynucleotide. As used herein, the terms "intergenic region" and "intergenic sequence" can be used interchangeably unless the context clearly dictates otherwise.
[0108] The intergenic region, which is located between the first and second polynucleotides, can be of any length and have any nucleotide sequence.As an example, the intergenic region between the first polynucleotide and the second polynucleotide may be about 1 nucleotide, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides, about 11 nucleotides, about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, about 40 nucleotides, about 41 nucleotides, about 42 nucleotides, about 43 nucleotides, about 44 nucleotides, about 45 nucleotides, about 46 nucleotides, about 47 nucleotides, about 48 nucleotides, about 49 nucleotides, about 50 nucleotides, about 51 nucleotides, about 52 nucleotides, about 53 nucleotides, about 54 nucleotides, about 55 nucleotides, about 56 nucleotides, about 57 nucleotides, about 58 nucleotides, about 59 nucleotides, about 60 nucleotides, about 61 nucleotides, about 62 nucleotides, about 63 nucleotides, about 45 nucleotides, about 46 nucleotides, about 47 nucleotides, about 48 nucleotides, about 49 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 125 nucleotides, about 150 nucleotides, about 175 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 600 nucleotides The length of the nucleic acid sequence may be about 700 nucleotides, about 800 nucleotides, about 900, about 1,000 nucleotides, about 1,500 nucleotides, about 2,000 nucleotides, about 2,500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about 4,500 nucleotides, about 5,000 nucleotides, about 6,000 nucleotides, about 7,000 nucleotides, about 8,000 nucleotides, about 9,000 nucleotides, about 10,000 nucleotides, and any number or range therebetween.In one embodiment, the intergenic region between the first polynucleotide and the second polynucleotide comprises about 10-100 nucleotides, about 10-200 nucleotides, about 10-300 nucleotides, about 10-400 nucleotides, or about 10-500 nucleotides. In another embodiment, the intergenic region between the first polynucleotide and the second polynucleotide comprises about 1-10 nucleotides, about 1-20 nucleotides, about 1-30 nucleotides, about 1-40 nucleotides, or about 1-50 nucleotides. In yet another embodiment, the region comprises about 44 nucleotides.
[0109] In one aspect, the intergenic region between the first polynucleotide and the second polynucleotide comprises a viral sequence. The intergenic region between the first polynucleotide and the second polynucleotide may comprise a sequence from any virus, such as, for example, alphavirus and rubivirus. In one aspect, the intergenic region between the first polynucleotide and the second polynucleotide comprises a sequence from an alphavirus, such as, for example, Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross virus (RSV), or the like. In another embodiment, the intergenic region between the first polynucleotide and the second polynucleotide comprises a sequence from Venezuelan equine encephalitis virus (VEEV), or any combination thereof.In yet another embodiment, the intergenic region between the first polynucleotide and the second polynucleotide comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, identity to the sequence of SEQ ID NO: 7. In a further embodiment, the intergenic region between the first polynucleotide and the second polynucleotide comprises the sequence of SEQ ID NO: 7. In yet a further embodiment, the intergenic region between the first polynucleotide and the second polynucleotide is a second intergenic region comprising a sequence having at least 85% identity to the sequence of SEQ ID NO: 7.
[0110] Natural and Modified Nucleotides The self-replicating RNA of the present disclosure may include one or more chemically modified nucleotides. Examples of nucleic acid monomers include non-natural, modified, and chemically modified nucleotides, including any such nucleotides known in the art. Nucleotides may be artificially modified at either the base or sugar moiety. In nature, most polynucleotides include nucleotides that are "unmodified" or "natural" nucleotides, including the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). These bases are usually fixed to ribose or deoxyribose at the 1' position. The use of RNA polynucleotides that include chemically modified nucleotides has been shown to improve RNA expression, expression rate, half-life, and / or expressed protein concentration. RNA polynucleotides that include chemically modified nucleotides have also been useful in optimizing protein localization, thereby avoiding adverse biological reactions, such as immune responses and / or degradation pathways.
[0111] Examples of modified or chemically modified nucleotides include 5-hydroxycytidine, 5-alkylcytidine, 5-hydroxyalkylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-alkoxycytidine, 5-alkynylcytidine, 5-halocytidine, 2-thiocytidine, N4-alkylcytidine, N4-aminocytidine, N4-acetylcytidine, and N4,N4-dialkylcytidine.
[0112] Examples of modified or chemically modified nucleotides include 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, 5-propynylcytidine, 5-bromocytidine, 5-iodocytidine, 2-thiocytidine; N4-methylcytidine, N4-aminocytidine, N4-acetylcytidine, and N4,N4-dimethylcytidine.
[0113] Examples of modified or chemically modified nucleotides include 5-hydroxyuridine, 5-alkyluridine, 5-hydroxyalkyluridine, 5-carboxyuridine, 5-carboxyalkylester uridine, 5-formyluridine, 5-alkoxyuridine, 5-alkynyluridine, 5-halouridine, 2-thiouridine, and 6-alkyluridine.
[0114] Examples of modified or chemically modified nucleotides include 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine (also referred to herein as "5MeOU"), 5-propynyluridine, 5-bromouridine, 5-fluorouridine, 5-iodouridine, 2-thiouridine, and 6-methyluridine.
[0115] Examples of modified or chemically modified nucleotides include 5-methoxycarbonylmethyl-2-thiouridine, 5-methylaminomethyl-2-thiouridine, 5-carbamoylmethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethyluridine, 5-methyldihydrouridine, 5-taurinomethyluridine, 5-taurinomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 2'-O-methylpseudouridine, 2-thio-2'O-methyluridine, and 3,2'-O-dimethyluridine.
[0116] Examples of modified or chemically modified nucleotides include N6-methyladenosine, 2-aminoadenosine, 3-methyladenosine, 8-azaadenosine, 7-deazaadenosine, 8-oxoadenosine, 8-bromoadenosine, 2-methylthio-N6-methyladenosine, N6-isopentenyl adenosine, 2-methylthio-N6-isopentenyl adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl adenosine, N6-hydroxynorvalylcarbamoyl adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, alpha-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1-thio-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine.
[0117] Examples of modified or chemically modified nucleotides include N1-alkylguanosine, N2-alkylguanosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 8-bromoguanosine, O6-alkylguanosine, xanthosine, inosine, and N1-alkylinosine.
[0118] Examples of modified or chemically modified nucleotides include N1-methylguanosine, N2-methylguanosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 8-bromoguanosine, O6-methylguanosine, xanthosine, inosine, and N1-methylinosine.
[0119] Examples of modified or chemically modified nucleotides include pseudouridine.Examples of pseudouridine include N1-alkylpseudouridine, N1-cycloalkylpseudouridine, N1-hydroxypseudouridine, N1-hydroxyalkylpseudouridine, N1-phenylpseudouridine, N1-phenylalkylpseudouridine, N1-aminoalkylpseudouridine, N3-alkylpseudouridine, N6-alkylpseudouridine, N6-alkoxypseudouridine, N6-hydroxypseudouridine, N6-hydroxyalkylpseudouridine, N6-morpholinopseudouridine, N6-phenylpseudouridine and N6-halopseudouridine. Examples of pseudouridines include N1-alkyl-N6-alkylpseudouridine, N1-alkyl-N6-alkoxypseudouridine, N1-alkyl-N6-hydroxypseudouridine, N1-alkyl-N6-hydroxyalkylpseudouridine, N1-alkyl-N6-morpholinopseudouridine, N1-alkyl-N6-phenylpseudouridine, and N1-alkyl-N6-halopseudouridine. In these examples, the alkyl, cycloalkyl, and phenyl substituents may be unsubstituted or further substituted with alkyl, halo, haloalkyl, amino, or nitro substituents.
[0120] Examples of pseudouridines include N1-methylpseudouridine (also referred to herein as "N1MPU"), N1-ethylpseudouridine, N1-propylpseudouridine, N1-cyclopropylpseudouridine, N1-phenylpseudouridine, N1-aminomethylpseudouridine, N3-methylpseudouridine, N1-hydroxypseudouridine, and N1-hydroxymethylpseudouridine.
[0121] Examples of nucleic acid monomers include modified and chemically modified nucleotides, including any such nucleotides known in the art.
[0122] Examples of modified and chemically modified nucleotide monomers include any such nucleotide known in the art, such as 2'-O-methyl ribonucleotides, 2'-O-methyl purine nucleotides, 2'-deoxy-2'-fluoro ribonucleotides, 2'-deoxy-2'-fluoro pyrimidine nucleotides, 2'-deoxyribonucleotides, 2'-deoxy purine nucleotides, universal base nucleotides, 5-C-methyl-nucleotides, and inverted deoxy basic monomer residues.
[0123] Examples of modified and chemically modified nucleotide monomers include 3'-terminal stabilized nucleotides, 3'-glyceryl nucleotides, 3'-inverted abasic nucleotides, and 3'-inverted thymidines.
[0124] Examples of modified and chemically modified nucleotide monomers include locked nucleic acid nucleotides (LNA), 2'-O,4'-C-methylene-(D-ribofuranosyl) nucleotides, 2'-methoxyethoxy (MOE) nucleotides, 2'-methyl-thio-ethyl, 2'-deoxy-2'-fluoro nucleotides, and 2'-O-methyl nucleotides. In an exemplary embodiment, the modified monomer is a locked nucleic acid nucleotide (LNA).
[0125] Examples of modified and chemically modified nucleotide monomers include 2',4'-constrained 2'-O-methoxyethyl (cMOE) and 2'-O-ethyl (cEt) modified DNA.
[0126] Examples of modified and chemically modified nucleotide monomers include 2'-amino nucleotides, 2'-O-amino nucleotides, 2'-C-allyl nucleotides, and 2'-O-allyl nucleotides.
[0127] Examples of modified and chemically modified nucleotide monomers include N6-methyl adenosine nucleotides.
[0128] Examples of modified and chemically modified nucleotide monomers include nucleotide monomers having the modified bases 5-(3-amino)propyluridine, 5-(2-mercapto)ethyluridine, 5-bromouridine; 8-bromoguanosine, or 7-deazaadenosine.
[0129] Examples of modified and chemically modified nucleotide monomers include 2'-O-aminopropyl substituted nucleotides.
[0130] Examples of modified and chemically modified nucleotide monomers include those in which the 2'-OH group of the nucleotide is replaced with 2'-R, 2'-OR, 2'-halogen, 2'-SR, or 2'-amino, where R can be H, alkyl, alkenyl, or alkynyl.
[0131] The above exemplary base modifications can be combined with additional modifications of the nucleoside or nucleotide structure, including sugar modifications and linkage modifications.Certain modified or chemically modified nucleotide monomers can be found in nature.
[0132] Preferred nucleotide modifications include N1-methylpseudouridine and 5-methoxyuridine.
[0133] Viral Replication Proteins and Polynucleotides Encoding Them In some embodiments, the present invention provides an RNA molecule comprising a first polynucleotide encoding one or more viral replication proteins. As used herein, the term "replication protein" or "viral replication protein" refers to any protein or any protein subunit of a protein complex that functions in the replication of a viral genome. Generally, a viral replication protein is a non-structural protein. The viral replication protein encoded by the nucleic acid molecule provided herein can function in the replication of any viral genome. The viral genome can be a single-stranded positive-stranded RNA genome, a single-stranded negative-stranded RNA genome, a double-stranded RNA genome, a single-stranded positive-stranded DNA genome, a single-stranded negative-stranded DNA genome, or a double-stranded DNA genome. The viral genome can comprise a single nucleic acid molecule or multiple nucleic acid molecules. The nucleic acid molecule provided herein can encode one or more viral replication proteins from any virus or virus family, including, for example, animal viruses and plant viruses. The viral replication protein encoded by the first polynucleotide included in the nucleic acid molecule provided herein can be expressed from a self-replicating RNA.
[0134] In some embodiments, the first polynucleotide of the RNA molecule provided herein comprises one or more microRNA (miRNA; miR) binding site modifications or mutations. In other embodiments, the miRNA binding site modifications or mutations reduce or eliminate miRNA binding. In some embodiments, miRNA binding is reduced by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween. In some embodiments, miRNA binding is reduced by 100% (i.e., no miRNA binding). In still other embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 miRNA binding sites are modified or mutated.
[0135] miRNAs are small single-stranded non-coding RNA molecules that function in RNA silencing and post-transcriptional regulation of gene expression. For example, binding of miRNA to miRNA binding sites in transcripts or messenger RNA (mRNA) can inhibit translation. miRNAs are present in many eukaryotic cells, including mammals and plants. Some viruses also produce miRNAs. Generally, miRNAs are generated from a larger pri-miRNA molecule that forms a hairpin loop structure with a double-stranded region. The pri-miRNA is processed into Pre-miRNA in the nucleus and transported to the cytoplasm. The Pre-miRNA hairpin is cleaved in the cytoplasm by the RNase III enzyme Dicer, and one miRNA strand is incorporated into the RNA-induced silencing complex (RISC) to interact with the mRNA target. In animal cells, miRNAs can recognize target mRNAs via a seed region at the 5' end of the miRNA, which may contain as little as 6-8 nucleotides of the miRNA. When miRNA binds to a target mRNA, the mRNA can be cleaved in the case of perfect or near-perfect pairing, or the mRNA can be uncleaved and translation can be inhibited. Putative miRNA binding sites can be identified using algorithms such as miRanda (Enright, AJ, John, B., Gaul, U. et al. MicroRNA targets in Drosophila. Genome Biol 5, R1 (2003). doi.org / 10.1186 / gb-2003-5-1-r1).
[0136] Any modification or mutation can be made in the identified or predicted miRNA binding site, including point mutation or substitution, insertion, and deletion. In some embodiments, the modification or mutation of the miRNA binding site comprises a point mutation. In the identified or predicted miRNA binding site, multiple nucleotides can be changed, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides. In one embodiment, the point mutation comprises a synonymous nucleotide change, i.e., a change that does not change the encoded amino acid. The binding site of any miRNA provided herein can be modified or mutated. In some embodiments, the miRNA binding site that is modified or mutated in the first polynucleotide of the RNA molecule provided herein is selected from the region that binds to the miRNA having the sequence of SEQ ID NO: 58, 59, 72, 80, 81, 83, 101, 102, 103, 112, 113, 114, 128, 131, 142, 156, 157, 171, 175, and any combination thereof.
[0137] In some embodiments, binding of any miRNA or any combination of miRNAs is reduced by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween. In some embodiments, miRNA binding is reduced by 100% (i.e., there is no miRNA binding), hi some embodiments, the reduction in miRNA binding increases protein expression.Protein expression is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, The increase may be at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500%, at least 550%, at least 600%, at least 650%, at least 700%, at least 750%, at least 800%, at least 850%, at least 900%, at least 950%, at least 1000% or more, and any number or range therebetween. In some embodiments, protein expression is about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, about 101%, about 102%, about 103%, about 104%, about 105%, about 106%, about 107%, about 108%, about 109%, about 110%, about 111%, about 112%, about 113%, about 114%, about 115%, about 116%, about 117%, about 118%, about 119%, about 120%, about 121%, about 122%, about 123%, about 124%, about 125%, about 126%, about 127%, about 128%, about 129%, about 130%, about 131%, about 132%, about 133%, about 134%, about 135%, about 136%, about 137%, about 138%, about 139%, about 140%, about 141%, about 142%, about 143%, about 144%, about 145%, about 146%, about 147%, about 148%, about 149%, about 150%, about 151%, about 152%, about 153%, about 154%, about 155%, about %, about 99.5%, about 99.6%, about 99.7%, about 99.8%, about 99.9%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, about 500%, about 550%, about 600%, about 650%, about 700%, about 750%, about 800%, about 850%, about 900%, about 950%, about 1000%, or more, and any number or range therebetween.Protein expression can also be increased by about 1 fold, about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 20 fold, about 30 fold, about 40 fold, about 50 fold, about 60 fold, about 70 fold, about 80 fold, about 90 fold, about 100 fold, about 150 fold, about 200 fold, about 250 fold, about 300 fold, about 350 fold, about 400 fold, about 450 fold, about 500 fold, about 600 fold, about 700 fold, about 800 fold, about 900 fold, about 1000 fold, or more, and any number or range therebetween. In some embodiments, protein expression is increased by at least about 1 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 40 fold, at least about 50 fold, at least about 60 fold, at least about 70 fold, at least about 80 fold, at least about 90 fold, at least about 100 fold, at least about 150 fold, at least about 200 fold, at least about 250 fold, at least about 300 fold, at least about 350 fold, at least about 400 fold, at least about 450 fold, at least about 500 fold, at least about 600 fold, at least about 700 fold, at least about 800 fold, at least about 900 fold, at least about 1000 fold, or more, and any number or range therebetween.
[0138] The first polynucleotide sequence of the RNA molecules provided herein may encode one or more togavirus replication proteins. In some aspects, the one or more viral replication proteins encoded by the first polynucleotide of the RNA molecules provided herein are alphavirus proteins. In some embodiments, the one or more viral replication proteins encoded by the first polynucleotide of the RNA molecules provided herein are rubivirus proteins. The first polynucleotide sequence of the RNA molecules provided herein may encode any alphavirus replication protein and any rubivirus replication protein. Exemplary replication proteins from alphaviruses include those from Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland Exemplary rubivirus replication proteins include proteins from rubella virus, J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), Salmonid alphavirus (SAV), Buggy Creek virus (BCRV), and any combination thereof. Exemplary rubivirus replication proteins include proteins from rubella virus.
[0139] The viral replication proteins encoded by the first polynucleotide of the RNA molecules provided herein can be expressed as one or more polyproteins, or as separate or single proteins. Generally, a polyprotein is a precursor protein that is cleaved to generate individual or separate proteins. Thus, proteins derived from a precursor polyprotein can be expressed from a single open reading frame (ORF). As used herein, the term "ORF" refers to a nucleotide sequence that begins with a start codon, generally ATG, and ends with a stop codon, such as, for example, TAA, TAG, or TGA. It will be understood that T is present in DNA, while U is present in RNA. Thus, the start codon ATG of DNA corresponds to AUG of RNA, and the stop codons TAA, TAG, and TGA of DNA correspond to UAA, UAG, and UGA of RNA. Furthermore, for any sequence provided in this disclosure, it will be understood that T is present in DNA, while U is present in RNA. Thus, for any sequence provided herein, T occurring in DNA is replaced with U in RNA molecules and U occurring in RNA is replaced with T in DNA molecules.
[0140] The protease that cleaves the polyprotein can be a viral protease or a cellular protease. In some embodiments, the first polynucleotide of the RNA molecules provided herein encodes a polyprotein comprising an alphavirus nsP1 protein, an alphavirus nsP2 protein, an alphavirus nsP3 protein, an alphavirus nsP4 protein, or any combination thereof. In other embodiments, the first polynucleotide of the RNA molecules provided herein encodes a polyprotein comprising an alphavirus nsP1 protein, an alphavirus nsP2 protein, an alphavirus nsP3 protein, or any combination thereof, and an alphavirus nsP4 protein. In some embodiments, the polyprotein is a VEEV polyprotein. In other embodiments, the alphavirus nsP1, nsP2, nsP3, and nsP4 proteins are VEEV proteins.
[0141] In one embodiment, the first polynucleotide of the RNA molecule provided herein lacks a stop codon between the sequence encoding the nsP3 protein and the sequence encoding the nsP4 protein. Thus, in some embodiments, the first polynucleotide of the RNA molecule provided herein encodes a P1234 polyprotein that includes nsP1, nsP2, nsP3, and nsP4. The first polynucleotide of the RNA molecule provided herein may also include a stop codon between the sequence encoding the nsP3 protein and the sequence encoding the nsP4 protein. Thus, in some embodiments, the first polynucleotide of the nucleic acid molecule provided herein encodes a P123 polyprotein that includes nsP1, nsP2, and nsP3, as well as a P1234 polyprotein that includes nsP1, nsP2, nsP3, and nsP4, for example, as a result of read-through of the stop codon. In other aspects, the first polynucleotide of the RNA molecule provided herein encodes a polyprotein having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, identity to the sequence of SEQ ID NO: 187. In some embodiments, the first polynucleotide of the nucleic acid molecule provided herein encodes a polyprotein having the sequence of SEQ ID NO: 187. In one aspect, the nsP2 and nsP3 proteins comprise mutations. Exemplary mutations include the G1309R and S1583G mutations of the VEEV protein. In another embodiment, the nsP1, nsP2, and nsP4 proteins are VEEV proteins and the nsP3 protein is a Chikungunya virus (CHIKV) nsP3 protein.
[0142] In some embodiments, the first polynucleotide comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity to the sequence of SEQ ID NO: 6. In some embodiments, the first polynucleotide comprises the sequence of SEQ ID NO: 6. In some embodiments, the first polynucleotide comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity to the sequence of SEQ ID NO: 42. In some embodiments, the first polynucleotide comprises the sequence of SEQ ID NO: 42.
[0143] 5' untranslated region (5'UTR) The nucleic acid molecules provided herein may further include untranslated regions (UTRs). For example, untranslated regions, including 5'UTRs and 3'UTRs, may affect, for example, RNA stability and / or RNA translation, such as the efficiency of translation of cellular and viral mRNAs. 5'UTRs and 3'UTRs may also affect the stability and translation of viral genomic RNAs and self-replicating RNAs, including virus-derived self-replicating RNAs or replicons. Exemplary viral genomic RNAs whose translation stability and / or efficiency may be affected by 5'UTRs and 3'UTRs include the genomic nucleic acids of positive-stranded RNA viruses. Both the genomic nucleic acids of positive-stranded RNA viruses and the self-replicating RNAs, including virus-derived self-replicating RNAs or replicons, can be translated upon infection or introduction into a cell.
[0144] In some aspects, the nucleic acid molecules provided herein further comprise a 5' untranslated region (5'UTR). Any 5'UTR sequence may be included in the nucleic acid molecules provided herein. In some embodiments, the nucleic acid molecules provided herein comprise a viral 5'UTR. In one aspect, the nucleic acid molecules provided herein comprise a non-viral 5'UTR. Any non-viral 5'UTR, such as a 5'UTR of a transcript expressed in any cell or organ (including muscle, skin, subcutaneous tissue, liver, spleen, lymph nodes, antigen-presenting cells, etc.), may be included in the nucleic acid molecules provided herein. In another aspect, the nucleic acid molecules provided herein comprise a 5'UTR that comprises viral and non-viral sequences. Thus, the 5'UTR included in the nucleic acid molecules provided herein may comprise a combination of viral and non-viral 5'UTR sequences. In some aspects, the 5'UTR included in the nucleic acid molecules provided herein is located upstream or 5' of a first polynucleotide that encodes one or more viral replication proteins. In other aspects, the 5'UTR is located 5' or upstream of a first polynucleotide of a nucleic acid molecule provided herein that encodes one or more viral replication proteins, and the first polynucleotide is located 5' or upstream of a second polynucleotide of a nucleic acid molecule provided herein.
[0145] In one embodiment, the 5'UTR of a nucleic acid molecule provided herein comprises an alphavirus 5'UTR. Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort The 5'UTR of any alphavirus may be included in the nucleic acid molecules provided herein, including 5'UTR sequences from Morgan virus (FMV), Ndumu virus (NDUV), Salmonid alphavirus (SAV), or Buggy Creek virus (BCRV). In another embodiment, the 5'UTR comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, to the sequence of SEQ ID NO:5 or the sequence of SEQ ID NO:41, for example. In yet another embodiment, the 5'UTR comprises the sequence of SEQ ID NO:5 or SEQ ID NO:41.
[0146] In some embodiments, the 5'UTR comprises a sequence selected from human IL-6, alanine aminotransferase 1, human apolipoprotein E, human fibrinogen alpha chain, human transthyretin, human haptoglobin, human alpha-1-antichymotrypsin, human antithrombin, human alpha-1-antitrypsin, human albumin, human beta globin, human complement C3, human complement C5, SynK (a thylakoid potassium channel protein from the cyanobacterium Synechocystis species), mouse beta globin, mouse albumin, and tobacco etch virus, or a fragment of any of the above. Preferably, the 5'UTR is derived from tobacco etch virus (TEV). In one embodiment, the 5'UTR comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, identity to the sequence of SEQ ID NO: 35 or SEQ ID NO: 49. In another embodiment, the 5'UTR comprises the sequence of SEQ ID NO: 35 or SEQ ID NO: 49.
[0147] The mRNA or any other RNA described herein may include any 5'UTR sequence provided herein. For example, the RNA described herein may include a 5'UTR sequence derived from a gene expressed by Arabidopsis thaliana. In some embodiments, the 5'UTR sequence of the gene expressed by Arabidopsis thaliana is AT1G58420. Examples of 5UTRs and 3'UTRs are described in PCT / US2018 / 035419, the contents of which are incorporated herein by reference. Exemplary 5'UTR sequences include those of SEQ ID NOs: 189-218 shown in Table 1. [Table 1-1] [Table 1-2]
[0148] Further exemplary 5'UTR sequences of SEQ ID NOs: 233-279 are shown in Table 2. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7]
[0149] 3' untranslated region (3'UTR) In some aspects, the nucleic acid molecules provided herein further comprise a 3' untranslated region (3'UTR). Any 3'UTR sequence may be included in the nucleic acid molecules provided herein. In one aspect, the nucleic acid molecules provided herein comprise a viral 3'UTR. In another aspect, the nucleic acid molecules provided herein comprise a non-viral 3'UTR. Any non-viral 3'UTR may be included in the nucleic acid molecules provided herein, for example, a 3'UTR of a transcript expressed in any cell or organ (including muscle, skin, subcutaneous tissue, liver, spleen, lymph nodes, antigen-presenting cells, etc.). In some aspects, the nucleic acid molecules provided herein comprise a 3'UTR that comprises viral and non-viral sequences. Thus, the 3'UTR included in the nucleic acid molecules provided herein may comprise a combination of viral and non-viral 3'UTR sequences. In one aspect, the 3'UTR is located 3' or downstream of a second polynucleotide of the nucleic acid molecules provided herein that comprises a first transgene encoding a first antigen protein or a fragment thereof. In another embodiment, the 3'UTR is located 3' or downstream of a second polynucleotide of a nucleic acid molecule provided herein that comprises a first transgene encoding a first antigenic protein or fragment thereof, and the second polynucleotide is located 3' or downstream of a first polynucleotide of a nucleic acid molecule provided herein.
[0150] In one embodiment, the 3'UTR of a nucleic acid molecule provided herein comprises an alphavirus 3'UTR. Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort The 3'UTR of any alphavirus may be included in the nucleic acid molecules provided herein, including 3'UTR sequences from Morgan virus (FMV), Ndumu virus (NDUV), Salmonid alphavirus (SAV), or Buggy Creek virus (BCRV). In another embodiment, the 3'UTR comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, to the sequence of SEQ ID NO:9 or the sequence of SEQ ID NO:45, for example. In yet another embodiment, the 3'UTR further comprises a polyA sequence. In further embodiments, the 3'UTR comprises the sequence of SEQ ID NO: 9 or SEQ ID NO: 45. In yet other embodiments, the 3'UTR comprises, for example, the sequence of SEQ ID NO: 8 or the sequence of SEQ ID NO: 44.
[0151] In some embodiments, the 3'UTR comprises a sequence selected from the 3'UTR of alanine aminotransferase 1, human apolipoprotein E, human fibrinogen alpha chain, human haptoglobin, human antithrombin, human alpha globin, human beta globin, human complement C3, human growth factor, human hepcidin, MALAT-1, mouse beta globin, mouse albumin, and Xenopus beta globin, or a fragment of any of the above. In some embodiments, the 3'UTR is derived from Xenopus beta globin. Any of the 3'UTRs provided herein may include a poly-A tail, as further detailed below. In some embodiments, the 3'UTR comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, identity to the sequence of SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:50, or SEQ ID NO:51. The 3'UTRs provided herein can be included in any RNA molecule provided herein, including self-replicating RNA and mRNA molecules. Exemplary 3'UTR sequences include SEQ ID NOs:219-225, as shown in Table 3. [Table 3]
[0152] Additional exemplary 3'UTR sequences of SEQ ID NOs: 280-317 are shown in Table 4. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11]
[0153] Triple stop codon In some embodiments, the RNA molecules provided herein, including self-replicating RNA and mRNA, may contain a sequence immediately downstream of the coding region (i.e., ORF) that creates a triple stop codon. A triple stop codon is a sequence of three consecutive stop codons. A triple stop codon may ensure complete isolation of the expression cassette and may be incorporated to increase translation efficiency. In some embodiments, the RNA molecules of the present disclosure may contain any triple combination of sequences UAG, UGA, or UAA immediately downstream of the ORF described herein. The triple combination may be three of the same codons, three different codons, or three stop codons in any other permutation.
[0154] Translational enhancers and Kozak sequences For translation initiation, proper interaction between ribosome and mRNA must be established to determine the exact location of the translation initiation region. However, ribosome must also dissociate from the translation initiation region to slide toward the downstream sequence during translation of the mRNA. Translation enhancers upstream from the start sequence of the mRNA increase the yield of protein biosynthesis. Several studies have investigated the effect of translation enhancers. In some embodiments, the RNA molecules described herein, such as the self-replicating RNA or mRNA, contain translation enhancer sequences. These translation enhancer sequences increase the translation efficiency of the self-replicating RNA or mRNA of the present disclosure, thereby enhancing the production of the protein encoded by the RNA. The translation enhancer region may be located in the 5' or 3' UTR of the self-replicating RNA or mRNA sequence. Examples of translation enhancer regions include the naturally occurring enhancer regions from the TEV 5' UTR and the 3' UTR of Xenopus beta globin. Exemplary 5'UTR enhancer sequences include, but are not limited to, those derived from mRNAs encoding human heat shock proteins (HSPs), including HSP70-P2, HSP70-M1, HSP72-M2, HSP17.9, and HSP70-P1. Exemplary translation enhancer sequences for use in accordance with embodiments of the present disclosure are represented by SEQ ID NOs: 226-230, as shown in Table 5. [Table 5]
[0155] In some embodiments, the self-replicating RNA or mRNA of the present disclosure comprises a Kozak sequence. As understood in the art, the Kozak sequence is a short consensus sequence centered on the translation initiation site of eukaryotic mRNA that allows efficient translation initiation of the self-replicating RNA or mRNA. See, for example, Kozak, Marilyn (1988) Mol. and Cell Biol, 8:2737-2744; Kozak, Marilyn (1991) J. Biol. Chem, 266:19867-19870; Kozak, Marilyn (1990) Proc Natl. Acad. Sci. USA, 87:8301-8305, and Kozak, Marilyn (1989) J. Cell Biol, 108:229-241. It ensures that proteins are correctly translated from genetic messages and mediates ribosome assembly and translation initiation. The ribosomal translation machinery recognizes the AUG start codon associated with the Kozak sequence. The Kozak sequence may be inserted upstream of the coding sequence of the protein of interest, downstream of the 5'UTR, or upstream of the coding sequence of the protein of interest and downstream of the 5'UTR. In some embodiments, the self-replicating RNA or mRNA described herein comprises a Kozak sequence having the sequence GCCACC (SEQ ID NO: 231). The self-replicating RNA or mRNA described herein may comprise a partial Kozak sequence "p" having the nucleotide sequence GCCA (SEQ ID NO: 232).
[0156] Transgene The transgene contained in the nucleic acid molecule provided herein may encode an antigen protein or a fragment thereof. In some embodiments, the second polynucleotide of the RNA molecule provided herein comprises a first transgene. The first transgene contained in the second polynucleotide of the nucleic acid molecule provided herein may encode a first antigen protein or a fragment thereof. The transgene contained in the second polynucleotide of the RNA molecule provided herein may comprise a sequence encoding the entire amino acid sequence of an antigen protein, or a sequence encoding any suitable portion or fragment of the entire amino acid sequence of an antigen protein. The transgene contained in the second polynucleotide of the RNA molecule provided herein may also comprise a homolog of any antigen protein provided herein. Any antigen protein can be encoded by the transgene contained in the nucleic acid molecule provided herein. In one aspect, the first antigen protein is a viral protein, a bacterial protein, a fungal protein, a protozoan protein, or a parasitic protein. The transgene contained in the RNA molecule provided herein may be expressed from a self-replicating RNA or a subgenomic RNA derived from an mRNA.
[0157] In some aspects, the antigenic protein, when administered to a mammalian subject, elicits an immune response against a pathogen, optionally the pathogen being a virus, bacteria, fungus, protozoan, or any other type of pathogen. In other aspects, the antigenic protein is expressed on the outer surface of the pathogen, while in further aspects, the antigen may be a non-surface antigen, useful, for example, as a T-cell epitope. The immune response may include an antibody response (usually including IgG) and / or a cell-mediated immune response. A polypeptide immunogen typically elicits an immune response that recognizes a corresponding pathogen polypeptide, although in some embodiments, the polypeptide may act as a mimotope to elicit an immune response that recognizes a saccharide. The immunogen may be a surface polypeptide, such as an adhesin, hemagglutinin, envelope glycoprotein, spike glycoprotein, and the like.
[0158] Any virus, bacteria, fungus, protozoan, parasite, or other protein can be encoded by the transgene contained in the RNA molecule provided herein. Any infectious agent-derived protein can be encoded by the transgene contained in the RNA molecule provided herein. As used herein, the term "infectious agent" refers to any agent capable of infecting organisms, including humans and animals, and causing disease or a worsening health condition. The terms "infectious agent" and "infectious pathogen" can be used interchangeably unless the context indicates otherwise.
[0159] In some embodiments, the viral protein encoded by the transgene contained in the RNA molecules provided herein is a coronavirus protein, an orthomyxovirus protein, a paramyxovirus protein, a picornavirus protein, a flavivirus protein, a filovirus protein, a rhabdovirus protein, a togavirus protein, an arterivirus protein, a bunyaviral protein, an arenavirus protein, a reovirus protein, a bornavirus protein, a retroviral protein, an adenovirus protein, a herpesvirus protein, a polyomavirus protein, a papillomavirus protein, a poxvirus protein, or a hepadnavirus protein. In other embodiments, the antigenic protein is a SARS-CoV-2 protein, an influenza virus protein, a respiratory syncytial virus (RSV) protein, a human immunodeficiency virus (HIV) protein, a Hepatitis C virus (HCV) protein, a cytomegalovirus (CMV) protein, a Lassa fever virus (LFV) protein, an Ebola virus (EBOV) protein, a Mycobacterium protein, a Bacillus protein, a Yersinia protein, a Streptococcus protein, a Pseudomonas protein, a Shigella protein, a Campylobacter protein, a Salmonella protein, a Plasmodium protein, or a Toxoplasma protein.
[0160] In one embodiment, the antigenic protein is from a prokaryotic organism, including gram positive, gram negative, or other bacteria, such as Bacillus (e.g., Bacillus anthracis), Mycobacterium (e.g., Mycobacterium tuberculosis, Mycobacterium leprae), Shigella (e.g., Shigella sonnei, Shigella dysenteriae, Shigella flexneri), Helicobacter (e.g., Helicobacter pylori), Salmonella (e.g., Salmonella enterica, Salmonella typhi, Salmonella typhimurium), Neisseria (e.g., Neisseria gonorrhoeae, Neisseria meningitidis), Moraxella (e.g., Moraxella catarrhalis), Haemophilus (e.g., Haemophilus influenzae), Klebsiella (e.g., Klebsiella pneumoniae), Legionella (e.g., Legionella pneumophila), Pseudomonas (e.g., Pseudomonas aeruginosa), Acinetobacter (e.g., Acinetobacter baumannii), Listeria (e.g., Listeria monocytogenes), Staphylococcus (e.g., Staphylococcus aureus), Streptococcus (e.g., Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae), Corynebacterium (e.g., Corynebacterium diphtheria), Clostridium (e.g., Clostridium botulinum, Clostridium tetani, Clostridium difficile), Chlamydia (e.g., Chlamydia pneumoniae, Chlamydiatrachomatis), Caphylobacter (e.g., Caphylobacter jejuni), Bordetella (e.g., Bordetella pertussis), Enterococcus (e.g., Enterococcus faecalis, Enterococcus faecium), Vibrio (e.g., Vibrio cholerae), Yersinia (e.g., Yersinia pestis), Burkholderia (e.g., Burkholderia cepacia complex), Coxiella (e.g., Coxiella burnetti), Francisella (e.g., Francisella tularensis), and Escherichia (e.g., enterotoxigenic, enterohemorrhagic, or Shiga toxin-producing E. coli, e.g., ETEC, EHEC, EPEC, EIEC, and EAEC). In another aspect, the antigenic protein is derived from a eukaryote, including a protist and a fungus, such as Plasmodium (e.g., Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium diarrhea), Candida (e.g., Candida albicans), Aspergillus (e.g., Aspergillus fumigatus), Cryptococcus (e.g., Cryptococcus neoformans), Histoplasma (e.g., Histoplasma capsulatum), Pneumocystis (e.g., Pneumocystis jirovecii), and Coccidiodes (e.g., Coccidiodes immitis).
[0161] In some aspects, the viral protein encoded by the transgene contained in the RNA molecules provided herein is a coronavirus protein. In some embodiments, the antigenic protein is a SARS-CoV-2 protein.
[0162] In one embodiment, the antigenic protein is a SARS-CoV-2 spike glycoprotein or a fragment thereof. In another embodiment, the SARS-CoV-2 spike glycoprotein is a wild-type SARS-CoV-2 spike glycoprotein. In some embodiments, the SARS-CoV-2 spike glycoprotein is pre-fusion stabilized. The pre-fusion stabilized SARS-CoV-2 glycoprotein may include K986P, V987P, or both K986P and V987P mutations. In some embodiments, the SARS-Cov-2 spike glycoprotein is a variant spike glycoprotein. As used herein, the term "variant SARS-CoV-2 spike glycoprotein" refers to any spike glycoprotein other than that of the SARS-CoV-2 Wuhan isolate(s) that emerged in Wuhan, China in 2019 (Wu, F., Zhao, S., Yu, B. et al. A new coronavirus associated with human respiratory disease in China. Nature 579, 265-269 (2020). doi.org / 10.1038 / s41586-020-2008-3). Thus, as used herein, the terms "wild-type SARS-CoV-2 spike glycoprotein" and "SARS-CoV-2 spike glycoprotein Wuhan strain" may be used interchangeably, for example, unless the context clearly indicates otherwise.
[0163] Exemplary variant SARS-CoV-2 spike glycoproteins include, but are not limited to, alpha (B.1.1.7; UK), beta (B.1.351; South Africa), gamma (P.1; Brazil), delta (B.1.617.2; India), and lambda (C.37; Peru) variants. Additional variants, including further variants of concern, can be found, for example, in COVID-19 Weekly Epidemiological Update, Edition 44, 15 June 2021 (who.int / publications / m / item / weekly-epidemiological-update-on-covid-19---15-june-2021). Any SARS-CoV-2 spike glycoprotein variant or fragment thereof, and any SARS-CoV-2 spike glycoprotein mutant protein or fragment thereof, can be encoded by the second polynucleotide of the RNA molecules provided herein. For example, the second polynucleotide of the RNA molecule provided herein may encode a SARS-CoV-2 spike protein that includes one or more mutations compared to the wild-type SARS-CoV-2 spike glycoprotein sequence. The mutations may include substitutions, deletions, insertions, etc. The mutations may be present at any position or combination of positions in the SARS-CoV-2 spike glycoprotein. Any number of substitutions, insertions, deletions, or combinations thereof may be present at any one or more positions in the SARS-CoV-2 spike glycoprotein. By way of example, the substitutions may include a change from a wild-type amino acid at any position or combination of positions to any other amino acid or combination of any other amino acids. Exemplary mutations include mutations at positions 614, 936, 320, 477, 986, 987, 988, or any combination thereof.In one embodiment, the SARS-CoV-2 spike glycoprotein or fragment thereof encoded by the transgene of the second polynucleotide comprised in the nucleic acid molecule provided herein comprises a D614G mutation, a D936Y mutation, a D936H mutation, a V320G mutation, a S477N mutation, a S477I mutation, a S477T mutation, a K986P mutation, a V987P mutation, or any combination thereof. Additional mutations and variants can be found in the National Bioinformatics Center 2019 Novel Coronavirus Information Database (2019nCoVR), the National Genomics Data Center, the China National Center for Bioinformation / Beijing Institute of Genomics, the Chinese Academy of Science (bigd.big.ac.cn / ncov / variation / annotation).
[0164] The variant spike glycoprotein may also include a protein called "VFLIP" spike glycoprotein (also referred to as "5P_FL2_DS3") (Olmedillas et al., Structure-based design of a highly stable, covalently-linked SARS-CoV-2 spike trimer with improved structural properties and immunogenicity, bioRxiv 2021.05.06.441046; doi.org / 10.1101 / 2021.05.06.441046). Thus, any antigen protein encoded by the RNA molecules provided herein may be a VFLIP variant spike glycoprotein. Thus, the variant spike glycoprotein may include five proline substitutions. Exemplary proline substitutions include V986P and V987P, as well as proline substitutions at positions 817, 892, 899, and 942 (Hsieh et al., 2020, Structure-Based Design of Prefusion Stabilized SARS-CoV-2 Spikes. Science 369(6510):1501-5). Any combination of proline substitutions can be included in the variant spike glycoproteins provided herein. In one aspect, the variant spike glycoprotein includes proline substitutions at positions 987, 817, 892, 899, and 942. The variant spike glycoprotein can also include an S1 / S2 linker. Exemplary linkers include GP, GGGS (SEQ ID NO: 318), GPGP (SEQ ID NO: 319), and GGGSGGGS (SEQ ID NO: 320). In one aspect, the linker is GGGSGGGS (SEQ ID NO: 320).In another aspect, the variant spike glycoprotein comprises proline substitutions at positions 987, 817, 892, 899, and 942, and further comprises a GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320) and / or a disulfide bond Y707C-T883C (Olmedillas et al., Structure-based design of a highly stable, covalently-linked SARS-CoV-2 spike trimer with improved structural properties and immunogenicity, bioRxiv 2021.05.06.441046; doi.org / 10.1101 / 2021.05.06.441046). The variant spike glycoprotein may also comprise a D614G substitution. Any combination of proline substitutions, linker sequence(s), disulfide bonds, and substitutions such as D614G can be included in the variant spike glycoproteins provided herein. In one aspect, the variant spike glycoprotein comprises proline substitutions at positions 987, 817, 892, 899, and 942, a GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320), and a disulfide bond Y707C-T883C. In another aspect, the variant spike glycoprotein comprises proline substitutions at positions 987, 817, 892, 899, and 942, a GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320), a disulfide bond Y707C-T883C, and a D614G substitution. A transgene encoding any of the variant spike glycoproteins described herein can be included in an RNA molecule provided herein, such as a self-replicating RNA and mRNA molecule. In one aspect, one or more transgenes encoding a variant spike glycoprotein comprising proline substitutions at positions 987, 817, 892, 899, and 942, the GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320), and the disulfide bond Y707C-T883C are included in the self-replicating RNA molecules provided herein.In another aspect, one or more transgenes encoding a variant spike glycoprotein comprising proline substitutions at positions 987, 817, 892, 899, and 942, a GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320), and a disulfide bond Y707C-T883C are included in the mRNA molecules provided herein. In yet another aspect, one or more transgenes encoding a variant spike glycoprotein comprising proline substitutions at positions 987, 817, 892, 899, and 942, a GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320), a disulfide bond Y707C-T883C, and a D614G substitution are included in the self-replicating RNA molecules provided herein. In still further aspects, one or more transgenes encoding a variant spike glycoprotein comprising proline substitutions at positions 987, 817, 892, 899, and 942, the GGGSGGGS S1 / S2 linker sequence (SEQ ID NO: 320), disulfide bond Y707C-T883C, and a D614G substitution are included in the mRNA molecules provided herein.
[0165] In some embodiments, the variant SARS-CoV-2 spike glycoprotein encoded by the second polynucleotide of the RNA molecules provided herein has an amino acid sequence of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 31, or SEQ ID NO: 34. In yet other embodiments, the second polynucleotide of the RNA molecules provided herein encodes a SARS-CoV-2 spike glycoprotein sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, identity to the sequence of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 31, or SEQ ID NO: 34. In another embodiment, the second polynucleotide of the RNA molecules provided herein comprises the sequence of SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:30, or SEQ ID NO:33. Thus, in a further embodiment, the first transgene comprised in the second polynucleotide of the RNA molecules provided herein comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, or 100% identity to the sequence of SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:30, or SEQ ID NO:33.
[0166] In one aspect, the antigenic protein encoded by the first transgene of the second polynucleotide contained in the nucleic acid molecule provided herein is an influenza virus protein or a fragment thereof. In another aspect, the second polynucleotide comprises one or more transgenes encoding one or more influenza virus proteins or fragments thereof. Exemplary influenza virus proteins that can be encoded by the transgene of the second polynucleotide contained in the nucleic acid molecule provided herein include proteins from any human or animal virus, including influenza A virus, influenza B virus, influenza C virus, influenza D virus, or any combination thereof. Exemplary influenza proteins include hemagglutinin (HA), neuraminidase (NA), M2, M1, NP, NS1, NS2, PA, PB1, PB2, and PB1-F2. Hemagglutinin proteins from any influenza virus subtype, such as H1-H18 and any emerging hemagglutinin, and neuraminidase proteins from any influenza virus subtype, such as N1-N11 and any emerging neuraminidase, can be antigenic proteins encoded by the transgenes contained in the second polynucleotide of the nucleic acid molecules provided herein. For example, any suitable fragment of an influenza virus protein, including one or more helper T lymphocyte (HTL) epitopes, one or more cytotoxic T lymphocyte (CTL) epitopes, or any combination thereof, can be encoded by the transgenes contained in the second polynucleotide of the nucleic acid molecules provided herein. In some embodiments, the first transgene of the second polynucleotide contained in the RNA molecules provided herein comprises the sequence of SEQ ID NO: 46 or SEQ ID NO: 52.In other aspects, the first transgene comprised in the second polynucleotide of the RNA molecules provided herein comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, or 100% identity to the sequence of SEQ ID NO:46 or SEQ ID NO:52. In further aspects, the first transgene of the second polynucleotide comprised in the RNA molecules provided herein encodes a protein having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, or 100% identity to the sequence of SEQ ID NO:47 or SEQ ID NO:53.
[0167] In some embodiments, the transgene contained in the second polynucleotide of the nucleic acid molecule provided herein encodes a reporter or marker, including a selection marker. Reporters and markers can include, for example, fluorescent proteins, such as green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), luciferase enzymes, such as firefly and Renilla luciferase, and antibiotic selection markers.
[0168] In some embodiments, the second polynucleotide of the nucleic acid molecule provided herein comprises at least two transgenes. Any number of transgenes, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more transgenes, can be included in the second polynucleotide of the nucleic acid molecule provided herein. In one embodiment, the second polynucleotide of the nucleic acid molecule provided herein comprises a second transgene encoding a second antigenic protein or fragment thereof or an immunomodulatory protein. In one embodiment, the second polynucleotide further comprises an internal ribosome entry site (IRES), a sequence encoding a 2A peptide, or a combination thereof, located between the transgenes. As used herein, the term "2A peptide" refers to a small (generally 18-22 amino acids) sequence that allows for efficient stoichiometric production of separate protein products in a single reading frame via a ribosome skipping event within the 2A peptide sequence. As used herein, the term "internal ribosome entry site" or "IRES" refers to a nucleotide sequence that allows initiation of protein translation of a messenger RNA (mRNA) sequence in the absence of an AUG start codon or without the use of the AUG start codon. An IRES can be found anywhere in an mRNA sequence, for example, at or near the beginning, in or near the middle, or at or near the end of the mRNA sequence. In another embodiment, the second polynucleotide further comprises a subgenomic promoter located between the transgenes. The subgenomic promoter located between the transgenes can be an additional subgenomic promoter, for example, a second, third, fourth, etc. subgenomic promoter located between the second and third, third and fourth, fourth and fifth, etc. transgenes.
[0169] Any number of transgenes contained in the second polynucleotide of the nucleic acid molecule provided herein can be expressed via any combination of 2A peptide and IRES sequences. For example, a second transgene located 3' of a first transgene can be expressed via a 2A peptide sequence or an IRES sequence. As another example, a second transgene located 3' of a first transgene and a third transgene located 3' of a second transgene can be expressed via a 2A peptide sequence located between the first transgene and the second transgene and between the second transgene and the third transgene, via an IRES sequence located between the first transgene and the second transgene and between the second transgene and the third transgene, via a 2A peptide sequence located between the first transgene and the second transgene and an IRES located between the second transgene and the third transgene, or via an IRES sequence located between the first transgene and the second transgene and a 2A peptide sequence located between the second transgene and the third transgene. Similar configurations and combinations of 2A peptide and IRES sequences located between transgenes are contemplated for any number of transgenes contained in the second polynucleotide of the nucleic acid molecule provided herein. In addition to expression via 2A peptides and IRES sequences, two or more transgenes contained in the nucleic acid molecules provided herein can also be expressed from separate subgenomic RNAs.
[0170] The second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, etc. transgene contained in the second polynucleotide of the nucleic acid molecules provided herein can encode an immunomodulatory protein or a functional fragment or variant thereof. Any immunomodulatory protein or a functional fragment or variant thereof can be encoded by a transgene contained in the second polynucleotide.
[0171] As used herein, the term "functional variant" or "functional fragment" refers to a molecule, including, for example, a nucleic acid or a protein, that contains a nucleotide and / or amino acid sequence that is altered at one or more nucleotides and / or amino acids compared to the nucleotide and / or amino acid sequence of a parent or reference molecule. In the case of a protein, the functional variant is still capable of functioning in a manner similar to the parent molecule. In other words, the modification in the amino acid and / or nucleotide sequence of the parent molecule does not significantly affect or change the functional characteristics of the molecule encoded by the nucleotide sequence or containing the amino acid sequence. Functional variants may have conservative sequence modifications, including nucleotide and amino acid substitutions, additions, and deletions. These modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and random PCR-mediated mutagenesis. Functional variants can also include, but are not limited to, derivatives that are substantially similar in primary structural sequence but contain, for example, chemical and / or biochemical in vitro or in vivo modifications not found in the parent molecule. Such modifications include, inter alia, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, PEGylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins, e.g., arginylation, ubiquitination, and the like.
[0172] In one aspect, the second transgene included in the second polynucleotide of the nucleic acid molecule provided herein encodes a cytokine, chemokine, or interleukin. Exemplary cytokines include interferon, TNF-α, TGF-β, G-CSF, and GM-CSF. Exemplary chemokines include CCL3, CCL26, and CXCL7. Exemplary interleukins include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, IL-15, IL-18, IL-21, and IL-23. Any transgene or combination of transgenes encoding any cytokine, chemokine, interleukin, or combination thereof may be included in the second polynucleotide of the nucleic acid molecule provided herein.
[0173] In one aspect, the first and second transgenes comprised in the second polynucleotide of the nucleic acid molecule provided herein encode a viral protein, a bacterial protein, a fungal protein, a protozoan protein, a parasitic protein, an immunomodulatory protein, or any combination thereof. In yet another aspect, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more transgenes comprised in the second polynucleotide of the nucleic acid molecule provided herein encode a viral protein, a bacterial protein, a fungal protein, a protozoan protein, a parasitic protein, an immunomodulatory protein, or any combination thereof.
[0174] In some embodiments, the second transgene encodes a second coronavirus protein. In other embodiments, the second transgene encodes a second influenza virus protein. In still other embodiments, the first and second transgenes encode a coronavirus protein and an influenza virus protein, respectively. In further embodiments, the first and second transgenes encode an influenza virus protein and a coronavirus protein, respectively.
[0175] RNA and DNA molecules RNA Molecules - Exemplary Features The nucleic acid molecule provided herein can be a DNA molecule or an RNA molecule. It will be understood that T present in DNA is replaced by U in RNA, and vice versa. In one embodiment, the nucleic acid molecule provided herein is an RNA molecule, and the first polynucleotide is located 5' of the second polynucleotide. In another embodiment, the RNA molecule provided herein further comprises an intergenic region. The intergenic region can have at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, or 100% identity to the sequence of SEQ ID NO: 7 or the sequence of SEQ ID NO: 43.
[0176] The RNA molecule provided herein can be a self-replicating RNA molecule.In one embodiment, the RNA molecule provided herein comprises a sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, and any number or range therebetween, or 100% identity to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:40.The RNA molecule provided herein can also be mRNA. In some embodiments, the RNA molecules provided herein comprise a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO: 29, SEQ ID NO: 32, or SEQ ID NO: 48. It is understood that T in the sequences provided herein is replaced with U in the RNA molecule.
[0177] The RNA molecules provided herein can be generated by in vitro transcription (IVT) of the DNA molecules provided herein. In one embodiment, the RNA molecules provided herein are self-replicating RNA molecules. In another embodiment, the RNA molecules provided herein are mRNA molecules. In yet another embodiment, the RNA molecules provided herein further comprise a 5' cap. Any 5' cap can be included in the RNA molecules provided herein, including a 5' cap having a Cap1 structure, a Cap1(m6A) structure, a Cap2 structure, or a Cap0 structure. A population or plurality of RNA molecules provided herein can have the same 5' cap or different 5' caps. For example, a population or plurality of RNA molecules can have a 5' cap having a Cap1 structure, a Cap1(m6A) structure, a Cap2 structure, a Cap0 structure, or any combination thereof.
[0178] In one embodiment, the RNA molecules provided herein comprise a 5' cap having a Cap1 structure. In yet another embodiment, the RNA molecules provided herein are self-replicating RNA molecules comprising a 5' cap having a Cap1 structure. In a further embodiment, the RNA molecules provided herein comprise a cap having a Cap1 structure in which m7G is linked via a 5'-5' triphosphate to the 5' end of the 5' UTR. In a further embodiment, the RNA molecules provided herein comprise a cap having a Cap1 structure in which m7G is linked via a 5'-5' triphosphate to the 5' end of the 5' UTR comprising the sequence of SEQ ID NO:5 or SEQ ID NO:41. For example, by including a capping reagent as part of the in vitro transcription (IVT) reaction, any capping method can be used, including but not limited to the use of Vaccinia capping enzyme (New England Biolabs, Ipswich, Mass.), and co-transcriptional capping or capping at or shortly after the start of in vitro transcription (IVT). (Nuc. Acids Symp. (2009) 53:129).
[0179] Only RNA molecules having a Cap structure, such as mRNA and self-replicating RNAs that can function as mRNAs, are active in Cap-dependent translation, and "decapitation" of mRNA results in almost complete loss of template activity for protein synthesis (Nature, 255:33-37, (1975); J. Biol. Chem., vol. 253:5228-5231, (1978); and Proc. Natl. Acad. Sci. USA, 72:1189-1193, (1975)).
[0180] Another element of eukaryotic mRNA is the presence of 2'-O-methylnucleoside residues at transcription position 1 (Cap1) and in some cases at transcription positions 1 and 2 (Cap2). 2'-O-methylation of mRNA increases the efficiency of mRNA translation in vivo (Proc. Natl. Acad. Sci. USA, 77:3952-3956 (1980)) and also improves the nuclease stability of 5'-capped mRNAs. mRNAs with Cap1 (and Cap2) are distinctive marks that allow cells to recognize the 5' end of authentic mRNAs and, in some cases, distinguish transcripts arising from infectious genetic elements (Nucleic Acid Research 43:482-492 (2015)).
[0181] Some examples of 5' cap structures and methods for preparing mRNAs containing same are shown in WO2015 / 051169A2, WO / 2015 / 061491, US2018 / 0273576, and U.S. Patent Nos. 8,093,367, 8,304,529, and US10,487,105. In some embodiments, the 5' cap is m7GpppAmpG, as known in the art. In some embodiments, the 5' cap is m7GpppG or m7GpppGm, as known in the art. Structural formulas of embodiments of 5' cap structures are shown below.
[0182] In some embodiments, a self-replicating RNA or mRNA of the disclosure includes a 5' cap having the structure of formula (Cap I): [ka] (In the formula, B 1 is a natural or modified nucleobase, R 1 and R 2 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, n is 0 or 1, and the mRNA represents an mRNA of the present disclosure linked at the 5' end. 1 , G, m 7 In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, B 1 is A or m 6 A and R 1 is OCH 3 where G is guanine and m 7 G is 7-methylguanine, A is adenine, m 6 A is N 6 -methyladenine.
[0183] In some embodiments, a self-replicating RNA or mRNA of the disclosure includes a 5' cap having the structure of formula (Cap II): [ka] (In the formula, B 1 and B. 2 are each independently a natural or modified nucleobase; R 1 , R 2 , and R 3 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, B 1 , G, m 7In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, B 1 is A or m 6 A and R 1 is OCH 3 where G is guanine and m 7 G is 7-methylguanine, A is adenine, m 6 A is N 6 -methyladenine.
[0184] In some embodiments, a self-replicating RNA or mRNA of the disclosure includes a 5' cap having the structure of formula (Cap III): [ka]
[0185] (wherein B1, B2, and B3 are each independently a natural or modified nucleobase, R1, R2, R3, and R4 are each independently selected from halogen, OH, and OCH3, each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1). In some embodiments, at least one of R1, R2, R3, and R4 is OH. In some embodiments, B1 is G, m7G, or A. In some embodiments, B1 is A or m6A, R1 is OCH3, G is guanine, m7G is 7-methylguanine, A is adenine, and m6A is N6-methyladenine. In some embodiments, n is 1.
[0186] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises an m7GpppG 5' cap analog having the structure of formula (Cap IV): [ka] (In the formula, R1 , R 2 , and R 3 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , and R 3 In some embodiments, the 5' cap is 7 GpppG and R 1 , R 2 , and R 3 are each OH, n is 1, and each L is phosphate. In some embodiments, n is 1. In some embodiments, the 5' cap is m7GpppGm and R 1 and R 2 are OH and R 3 is OCH 3 wherein each L is a phosphate and n is 1.
[0187] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises a m7Gpppm7G 5' cap analog having the structure of formula (Cap V): [ka] (In the formula, R 1 , R 2 , and R 3 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , and R 3In some embodiments, n is 1.
[0188] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises a 5' cap analog, m7Gpppm7GpN, where N is a natural or modified nucleotide, and the 5' cap analog has the structure of formula (Cap VI). [ka] (In the formula, B 3 is a natural or modified nucleobase, R 1 , R 2 , R 3 , and R 4 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 3. In some embodiments, R 1 , R 2 , R 3 , and R 4 At least one of B is OH. 1 , G, m 7 G, or A. In some embodiments, B 1 is A or m 6 A and R 1 is OCH 3 where G is guanine and m 7 G is 7-methylguanine, A is adenine, m 6 A is N 6 -methyladenine. In some embodiments, n is 1.
[0189] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises a m7Gpppm7GpG 5' cap analog having the structure of formula (Cap VII): [ka] (In the formula, R 1 , R 2 , R 3 , and R 4 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , R 3 , and R 4 In some embodiments, n is 1.
[0190] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises a m7Gpppm7Gpm7G 5' cap analog having the structure of formula (Cap VIII): [ka] (In the formula, R 1 , R 2 , R 3 , and R 4 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , R 3 , and R 4 In some embodiments, n is 1.
[0191] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises an m7GpppA 5' cap analog having the structure of formula (Cap IX): [ka] (In the formula, R 1 , R 2 , and R 3 are each independently a halogen, OH, or OCH 3 each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, and each L is linked by a diester bond; mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , and R 3 In some embodiments, n is 1.
[0192] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises a m7GpppApN 5' cap analog, where N is a natural or modified nucleotide, and the 5' cap has the structure of the formula (Cap X). [ka] (In the formula, B 3 is a natural or modified nucleobase, R 1 , R 2 , R 3 , and R 4 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , R 3 , and R 4 At least one of B is OH. 3 is G, m 7 G, A, or m 6 A is guanine, and m is 7 G is 7-methylguanine, A is adenine, m6 A is N 6 -methyladenine. In some embodiments, n is 1.
[0193] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises an m7GpppAmpG 5' cap analog having the structure of formula (Cap XI): [ka] (In the formula, R 1 , R 2 , and R 4 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , and R 4 At least one of is OH. In some embodiments, the compound of formula Cap XI is 7 GpppAmpG and R 1 , R 2 , and R 4 are each OH, n is 1, and each L is a phosphate linkage. In some embodiments, n is 1.
[0194] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises a m7GpppApm7G 5' cap analog having the structure of formula (Cap XII): [ka] (In the formula, R 1 , R 2 , R 3 , and R 4 are each independently a halogen, OH, or OCH 3wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , R 3 , and R 4 In some embodiments, n is 1.
[0195] In some embodiments, a self-replicating RNA or mRNA of the disclosure comprises an m7GpppApm7G 5' cap analog having the structure of formula (Cap XIII): [ka] (In the formula, R 1 , R 2 , and R 4 are each independently a halogen, OH, or OCH 3 wherein each L is independently selected from the group consisting of phosphate, phosphorothioate, and boranophosphate, each L is linked by a diester bond, the mRNA represents an mRNA of the present disclosure linked at the 5' end, and n is 0 or 1. In some embodiments, R 1 , R 2 , and R 4 In some embodiments, n is 1.
[0196] Polyadenine (polyA) tail Polyadenylation is the addition of a poly(A) tail, a chain of adenine nucleotides, usually about 100-120 monomers in length, to an mRNA or an RNA that can function as an mRNA. In eukaryotes, polyadenylation is part of the process that produces mature mRNA for translation and begins as transcription at the end of a gene. The 3'-most segment of the newly made pre-mRNA is first cleaved by a series of proteins, which then synthesize a poly(A) tail at the 3' end. The poly(A) tail is important for the nuclear import, translation, and stability of the mRNA. The tail shortens over time, and when it becomes short enough, the mRNA is degraded by enzymes. However, in some cell types, mRNAs with short poly(A) tails are stored for later activation by re-polyadenylation in the cytosol.
[0197] Preferably, the RNA molecule of the present disclosure comprises a 3' tail region that may help protect the RNA from exonuclease degradation. The tail region may be a 3' poly(A) and / or a 3' poly(C) region. Preferably, the tail region is a 3' poly(A) tail. Any self-replicating RNA and any mRNA provided herein, as well as any 3' UTR of any self-replicating RNA or mRNA, may comprise a poly(A) tail. As used herein, a "3' poly(A) tail" is a polymer of contiguous adenine nucleotides that can range in size, for example, from 10-250 contiguous adenine nucleotides, from 60-125 contiguous adenine nucleotides, from 90-125 contiguous adenine nucleotides, from 95-125 contiguous adenine nucleotides, from 95-121 contiguous adenine nucleotides, from 100-121 contiguous adenine nucleotides, from 110-121 contiguous adenine nucleotides, from 112-121 contiguous adenine nucleotides, from 114-121 contiguous adenine nucleotides, or from 115-121 contiguous adenine nucleotides. In some aspects, the 3' poly(a) tails described herein comprise about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, 240, 250, 260, 270, 280, 290, 300, and any number or range in between of consecutive adenine nucleotides. Preferably, the 3' poly(A) tails described herein comprise 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, or 125 consecutive adenine nucleotides. The 3' poly(A) tail can be added using a variety of methods known in the art, for example, using poly(A) polymerase to tail synthetic or in vitro transcribed RNA.Other methods include the use of transcription vectors to encode poly(A) tails, or the use of ligases (e.g., by splint ligation using T4 RNA ligase and / or T4 DNA ligase), where poly(A) may be ligated to the 3' end of the sense RNA. In some embodiments, a combination of any of the above methods is utilized.
[0198] dna molecule In one aspect, the present specification provides a DNA molecule encoding an RNA molecule disclosed herein. In another aspect, the DNA molecule provided herein further comprises a promoter. As used herein, the term "promoter" refers to a regulatory sequence that initiates transcription. The promoter can be operably linked to the first and second polynucleotides of the DNA molecule provided herein, and the first and second polynucleotides of the DNA molecule correspond to the encoded first and second polynucleotides of the RNA molecule provided herein. Generally, the promoter included in the DNA molecule provided herein comprises a promoter for in vitro transcription (IVT). Any promoter suitable for in vitro transcription, such as a T7 promoter, a T3 promoter, an SP6 promoter, etc., can be included in the DNA molecule provided herein. In one aspect, the DNA molecule provided herein comprises a T7 promoter. In another aspect, the promoter is located 5' of the 5'UTR included in the DNA molecule provided herein. In yet another aspect, the promoter is a T7 promoter located 5' of the 5'UTR included in the DNA molecule provided herein. In yet another aspect, the promoter overlaps with the 5'UTR.The promoter and 5'UTR may be about 1 nucleotide, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides, about 11 nucleotides, about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, about 40 nucleotides, about 41 nucleotides, about 42 nucleotides, about 43 nucleotides, about 44 nucleotides, about 45 nucleotides, about 46 nucleotides, about 47 nucleotides, about 48 nucleotides, about 49 nucleotides, about 50 nucleotides, about 51 nucleotides, about 52 nucleotides, about 53 nucleotides, about 54 nucleotides, about 55 nucleotides, about 56 nucleotides, about 57 nucleotides, about 58 nucleotides, about 59 nucleotides, about 60 nucleotides, about 61 nucleotides, about 62 nucleotides, about 63 nucleotides, about 64 nucleotides The sequences may overlap by about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, about 40 nucleotides, about 41 nucleotides, about 42 nucleotides, about 43 nucleotides, about 44 nucleotides, about 45 nucleotides, about 46 nucleotides, about 47 nucleotides, about 48 nucleotides, about 49 nucleotides, about 50 nucleotides, or more nucleotides.
[0199] In some aspects, the DNA molecules provided herein include a promoter for in vivo transcription. Generally, the promoter for in vivo transcription is an RNA polymerase II (RNA pol II) promoter. Any RNA pol II promoter, including constitutive promoters, inducible promoters, and tissue-specific promoters, can be included in the DNA molecules provided herein. Exemplary constitutive promoters include cytomegalovirus (CMV) promoter, EF1α promoter, SV40 promoter, PGK1 promoter, Ubc promoter, human beta actin promoter, CAG promoter, and the like. Any tissue-specific promoter can be included in the DNA molecules provided herein. In one aspect, the RNA pol II promoter is a muscle-specific promoter, a skin-specific promoter, a subcutaneous tissue-specific promoter, a liver-specific promoter, a spleen-specific promoter, a lymph node-specific promoter, or any other tissue-specific promoter. The DNA molecules provided herein can also include an enhancer. Any enhancer that increases transcription can be included in the DNA molecules provided herein.
[0200] Design and synthesis of RNA and DNA molecules The RNA molecules provided herein may include any combination of RNA sequences provided herein, including, for example, any 5'UTR sequence, any sequence encoding a polyprotein including nsP1, nsP2, nsP3, and nsP4, any sequence encoding a transgene, and any 3'UTR sequence provided herein. In some embodiments, the RNA molecules provided herein are self-replicating RNA molecules. The self-replicating RNA molecules may include, for example, a sequence encoding a polyprotein including nsP1, nsP2, nsP3, and nsP4. In some embodiments, the RNA molecules provided herein are mRNA molecules. In general, mRNA molecules do not include a sequence encoding a polyprotein for RNA replication.
[0201] In some aspects, the RNA molecules provided herein include modified nucleotides. For example, 0%-100%, 1%-100%, 25%-100%, 50%-100%, and 75%-100% of the uracil nucleotides of the RNA molecule can be modified. In some aspects, 1%-100% of the uracil nucleotides are N1-methylpseudouridine or 5-methoxyuridine. In some embodiments, 100% of the uracil nucleotides are N1-methylpseudouridine. In some embodiments, 100% of the uracil nucleotides are 5-methoxyuridine.
[0202] The RNA molecule of the present disclosure, for example, self-replicating RNA or mRNA, may be obtained by any suitable means.The method of producing RNA molecule is known in the art and will be easily clear to those skilled in the art.The RNA molecule of the present disclosure may be prepared according to any available technique, including but not limited to chemical synthesis, in vitro transcription (IVT), or enzymatic or chemical cleavage of longer precursor.
[0203] In some embodiments, the RNA molecules of the present disclosure, e.g., self-replicating RNA or mRNA, are produced from a primary complementary DNA (cDNA) construct. The action of a reverse transcriptase (e.g., an RNA-dependent DNA polymerase) can produce a cDNA construct on an RNA template. The process of designing and synthesizing a primary cDNA construct described herein generally includes the steps of gene construction, RNA production (either modified or unmodified) and purification. In the IVT method, a target polynucleotide sequence encoding an RNA molecule of the present disclosure is first selected for incorporation into a vector and amplified to produce a cDNA template. Optionally, the target polynucleotide sequence and / or any adjacent sequences may be codon-optimized. The cDNA template is then used to produce an RNA molecule of the present disclosure by in vitro transcription (IVT). After production, the RNA molecule of the present disclosure may be subjected to a purification and clean-up process. This step is shown in more detail below.
[0204] The steps of gene construction may include, but are not limited to, gene synthesis, vector amplification, plasmid purification, plasmid linearization and cleanup, and cDNA template synthesis and cleanup. Once a protein of interest is selected for production, a primary construct is designed. Within the primary construct, a first region of linked nucleosides encoding a polypeptide of interest may be constructed using an open reading frame (ORF) of a selected nucleic acid (DNA or RNA) transcript. The ORF may include a wild-type ORF, an isoform, variant, or fragment thereof. As used herein, "open reading frame" or "ORF" is meant to refer to a nucleic acid sequence (DNA or RNA) capable of encoding a polypeptide of interest. The ORF often begins with a start codon, ATG, and ends with a nonsense or stop codon or signal.
[0205] To produce the RNA molecules of the present disclosure, the cDNA template may be transcribed using an in vitro transcription (IVT) system. The system typically includes a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase. The NTPs may be selected from, but are not limited to, those described herein, including natural and non-natural (modified) NTPs. The polymerase may be selected from, but is not limited to, T7 RNA polymerase, T3 RNA polymerase, and mutant polymerases, including but not limited to, polymerases capable of incorporating modified nucleic acids.
[0206] The primary cDNA template or transcribed RNA sequence may also undergo a capping and / or tailing reaction. The capping reaction may be performed by methods known in the art to add a 5' cap to the 5' end of the primary construct. Methods of capping include, but are not limited to, the use of Vaccinia Capping Enzyme (New England Biolabs, Ipswich, Mass.) or capping at the start of in vitro transcription, for example, by including a capping agent as part of the IVT reaction. (Nuc. Acids Symp. (2009) 53:129). The poly(A) tailing reaction may be performed by methods known in the art, for example, but not limited to, with 2'O-methyltransferase, and by methods described herein. If the primary construct generated from cDNA does not contain polyT, it may be beneficial to perform a poly(A) tailing reaction before washing the primary construct.
[0207] Codon-optimized cDNA constructs encoding nonstructural proteins and transgenes of self-replicating RNA are particularly suitable for generating the self-replicating RNA sequences described herein. For example, such cDNA constructs may be used as a basis for in vitro transcription of polyribonucleotides encoding the protein of interest as part of the self-replicating RNA. Codon-optimized cDNA constructs may also be used to generate the mRNAs provided herein.
[0208] The disclosure also provides expression vectors, preferably comprising a nucleotide sequence encoding a self-replicating RNA or mRNA operably linked to at least one regulatory sequence, which are art-recognized and selected to direct expression of the encoded polypeptide.
[0209] Thus, the term regulatory sequence includes promoters, enhancers and other expression control elements. The design of the expression vector may depend on such factors as the choice of the host cell to be transformed and / or the type of protein desired to be expressed.
[0210] The present disclosure also provides a polynucleotide (e.g., DNA, RNA, cDNA, mRNA, etc.) for the self-replicating RNA or mRNA of the present disclosure, which can be operably linked to one or more regulatory nucleotide sequences in an expression construct, such as a vector or plasmid. In certain embodiments, such a construct is a DNA construct. The regulatory nucleotide sequence will generally be suitable for the host cell used for expression. Numerous types of suitable expression vectors and suitable regulatory sequences for various host cells are known in the art.
[0211] Typically, the one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosome binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. Constitutive or inducible promoters known in the art are contemplated in the embodiments of the present disclosure. The promoter may be either a naturally occurring promoter or a hybrid promoter that combines elements of multiple promoters.
[0212] The expression construct may be present in the cell on an episome, such as a plasmid, or the expression construct may be inserted into a chromosome. In some embodiments, the expression vector contains a selectable marker gene that allows for the selection of transformed host cells. Selectable marker genes are well known in the art and will vary depending on the host cell used.
[0213] The present disclosure also provides a host cell transfected with the self-replicating RNA, mRNA, or DNA described herein. The self-replicating RNA, mRNA, or DNA may encode any protein of interest, such as an antigen, including the spike glycoprotein of the SARS-CoV-2 virus, or any other viral glycoprotein, such as influenza virus hemagglutinin and neuraminidase. The host cell may be any prokaryotic or eukaryotic cell. For example, the polypeptide encoded by the self-replicating RNA or mRNA may be expressed in bacterial cells, such as E. coli, insect cells (e.g., using a baculovirus expression system), yeast, or mammalian cells. Other suitable host cells are known to those skilled in the art.
[0214] Host cells transfected with an expression vector containing the self-replicating RNA or mRNA of the present disclosure can be cultured under appropriate conditions to result in expression of the self-replicating RNA or mRNA and translation of the polypeptide. Upon expression, the self-replicating RNA generally undergoes self-amplification and translation. The polypeptide may be secreted and isolated from a mixture of cells and medium containing the polypeptide. Alternatively, the polypeptide may be retained in the cytoplasm or membrane fraction, and the cells may be harvested and lysed to isolate the protein. A cell culture includes host cells, medium, and other by-products. Suitable media for cell culture are well known in the art.
[0215] The expressed proteins described herein can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification using antibodies specific for a particular epitope of the polypeptide.
[0216] Compositions and pharmaceutical compositions In some embodiments, the present invention provides a composition comprising any of the RNA molecules or DNA molecules provided herein. The present invention provides a composition comprising any of the RNA molecules or DNA molecules provided herein. The present invention provides a composition comprising any of the lipids. Any lipid can be included in the present invention. In one aspect, the lipid is an ionizable cationic lipid. Any ionizable cationic lipid can be included in the present invention.
[0217] The compositions and polynucleotides of the present disclosure may be used to immunize or vaccinate a subject against a viral infection. In some embodiments, the compositions and polynucleotides of the present disclosure may be used to vaccinate or immunize a subject against SARS-CoV-2, the virus that causes COVID-19.
[0218] Also provided herein in some embodiments is a pharmaceutical composition comprising any of the RNA and DNA molecules provided herein and a lipid formulation. Any lipid can be included in the lipid formulation of the pharmaceutical composition provided herein. In one aspect, the lipid formulation of the pharmaceutical composition provided herein comprises an ionizable cationic lipid. Exemplary ionizable cationic lipids of the compositions and pharmaceutical compositions provided herein include the following:
[0219] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]
[0220] In one aspect, the ionizable cationic lipid of the compositions provided herein has the following structure: [ka] or a pharma- ceutically acceptable salt thereof.
[0221] In another aspect, the ionizable cationic lipid of the compositions provided herein has the following structure: [ka] or a pharma- ceutically acceptable salt thereof.
[0222] In one aspect, the ionizable cationic lipid included in the lipid formulation of the pharmaceutical compositions provided herein has the following structure: [ka] or a pharma- ceutically acceptable salt thereof.
[0223] In another aspect, the ionizable cationic lipid included in the lipid formulation of the pharmaceutical compositions provided herein has the following structure: [ka] or a pharma- ceutically acceptable salt thereof.
[0224] Lipid formulations / LNP Therapeutics based on intracellular delivery of nucleic acids to target cells face both extracellular and intracellular barriers. In fact, naked nucleic acid materials cannot be easily administered systemically due to toxicity, poor stability in serum, rapid renal clearance, reduced uptake by target cells, uptake by phagocytes, and ability in activating immune responses, all characteristics that hinder clinical development. Upon entering the human biological system, foreign nucleic acid materials (e.g., mRNA) are recognized as foreign pathogens by the reticuloendothelial system (RES) and are cleared from the blood circulation before they have a chance to encounter target cells inside or outside the vascular system. It has been reported that the half-life of naked nucleic acids in the bloodstream is about several minutes (Kawabata K, Takakura Y, Hashida MPharm Res. 1995 Jun; 12 (6): 825-30). Chemical modifications and appropriate delivery methods can reduce uptake by the RES and protect the nucleic acid from degradation by ubiquitous nucleases, thereby improving the stability and efficacy of nucleic acid-based therapies. Furthermore, RNA or DNA are anionic hydrophilic polymers that are not favorable for cellular uptake, and they are also anionic on the surface. Therefore, the success of nucleic acid-based therapeutics depends heavily on the development of vehicles or vectors that can efficiently and effectively deliver genetic material to target cells and achieve sufficient levels of expression in vivo with minimal toxicity.
[0225] Furthermore, upon internalization into target cells, nucleic acid delivery vectors face challenges of intracellular barriers including endosomal entrapment, lysosomal degradation, unpacking of the nucleic acid from the vector, translocation across the nuclear membrane (for DNA), release in the cytoplasm (for RNA), etc. Thus, the success of nucleic acid-based therapeutics depends on the ability of the vector to deliver the nucleic acid to a target site within the cell to obtain sufficient levels of the desired activity, such as gene expression.
[0226] Although some gene therapies have been successfully implemented using viral delivery vectors (e.g., AAV), lipid-based formulations are increasingly recognized as one of the most promising delivery systems for RNA and other nucleic acid compounds due to their biocompatibility and ease of large-scale production. One of the most significant advances in lipid-based nucleic acid therapy occurred in August 2018, when Patisiran (ALN-TTR02) was the first siRNA therapeutic approved by the Food and Drug Administration (FDA) and the European Commission (EC). ALN-TTR02 is an siRNA formulation based on the so-called stable nucleic acid lipid particle (SNALP) transfection technology. Despite the success of Patisiran, lipid formulations for delivery of nucleic acid therapeutics, including mRNA, are still under development.
[0227] Some art-recognized lipid-formulated delivery vehicles for nucleic acid therapeutics include, according to various embodiments, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, multivesicular liposomes, proteoliposomes, exosomes of both natural and synthetic origin, natural, synthetic, and semi-synthetic lamellar bodies, nanoparticles, micelles, and emulsions. These lipid formulations can vary in structure and composition, and as can be expected in a rapidly developing field, several different terms are used in the art to describe a single type of delivery vehicle. At the same time, the terms of lipid formulations vary in intended meaning throughout the scientific literature, and this inconsistent use has created confusion about the exact meaning of some terms of lipid formulations. Among several potential lipid formulations, liposomes, cationic liposomes, and lipid nanoparticles are specifically detailed and defined herein for the purposes of this disclosure.
[0228] Liposomes Conventional liposomes are vesicles composed of at least one bilayer and an internal aqueous compartment. The bilayer membrane of liposomes is usually formed of amphiphilic molecules, e.g., lipids of synthetic or natural origin that contain spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of liposomes can also be formed of amphiphilic polymers and surfactants (e.g., polymersomes, niosomes, etc.). They generally exist as spherical vesicles and can range in size from 20 nm to several microns. Liposome formulations can be prepared as colloidal dispersions or lyophilized to reduce stability risks and improve the shelf life of liposome-based drugs. Methods for preparing liposome compositions are known in the art and would be within the skill of the art.
[0229] Liposomes with only one bilayer are called unilamellar, and those with multiple bilayers are called multilamellar. The most common types of liposomes are small unilamellar vesicles (SUVs), large unilamellar vesicles (LUVs), and multilamellar vesicles (MLVs). In contrast to liposomes, lysosomes, micelles, and reverse micelles are composed of a single layer of lipids. Generally, liposomes are considered to have a single internal compartment, but some formulations may be multivesicular liposomes (MVLs), which are composed of multiple discontinuous internal aqueous compartments separated by several non-concentric lipid bilayers.
[0230] Given that liposomes are essentially analogs of biological membranes and can be prepared from both natural and synthetic phospholipids, liposomes have long been recognized as drug delivery vehicles due to their excellent biocompatibility (Int J Nanomedicine. 2014; 9: 1833-1843). In their use as drug delivery vehicles, liposomes have an aqueous core surrounded by a hydrophobic membrane, so that hydrophilic solutes dissolved within the core cannot easily pass through the bilayer and hydrophobic compounds associate with the bilayer. Thus, liposomes can be loaded with hydrophobic and / or hydrophilic molecules. When liposomes are used to carry nucleic acids such as RNA, the nucleic acid will be contained within the aqueous phase liposomal compartment.
[0231] Cationic Liposomes Liposomes can be composed of cationic, anionic, and / or neutral lipids. As an important subclass of liposomes, cationic liposomes are liposomes made in whole or in part from positively charged lipids, or more specifically, lipids that contain both cationic groups and lipophilic moieties. In addition to the general properties of liposomes outlined above, the positively charged portion of the cationic lipids used in cationic liposomes offers some advantages and some unique structural features. For example, the lipophilic portion of cationic lipids is hydrophobic and therefore moves itself away from the aqueous interior of the liposome and will associate with other non-polar and hydrophobic species. Conversely, the cationic portion can associate with and complex with aqueous media, and more importantly, polar molecules and species, in the aqueous interior of cationic liposomes. For these reasons, cationic liposomes are increasingly being explored for use in gene therapy, as they favor negatively charged nucleic acids through electrostatic interactions, resulting in complexes that offer biocompatibility, low toxicity, and the potential for large-scale production required for in vivo clinical applications. Cationic lipids suitable for use in cationic liposomes are described herein below.
[0232] Lipid Nanoparticles In contrast to liposomes and cationic liposomes, lipid nanoparticles (LNPs) have a structure that includes a single monolayer or bilayer of lipids that encapsulates compounds in a solid phase. Thus, unlike liposomes, lipid nanoparticles do not have an aqueous or other liquid phase inside, but rather, the lipids of the bilayer or monolayer shell directly complex with the internal compound, thereby encapsulating it in the solid core. Lipid nanoparticles are usually spherical vesicles with a relatively uniform distribution of shape and size. Sources vary according to the size at which lipid particles are considered to be nanoparticles, but there is some overlap that agrees that lipid nanoparticles can have diameters ranging from 10 nm to 1000 nm. However, more commonly, they are considered to be smaller than 120 nm or even 100 nm.
[0233] In the case of lipid nanoparticle nucleic acid delivery systems, the lipid shell is formulated to include ionizable cationic lipids that can complex and associate with the negatively charged backbone of the nucleic acid core. Ionizable cationic lipids with an apparent pKa value of less than about 7 have the advantage of providing a cationic lipid for complexing with the negatively charged backbone of the nucleic acid and for loading into the lipid nanoparticles at pH values that are less than the pKa of the ionizable lipid when positively charged. Then, at physiological pH values, the lipid nanoparticles can adopt a relatively neutral conformation that can significantly increase the circulation half-life of the particles after iv administration. In the context of nucleic acid delivery, lipid nanoparticles offer many advantages over other lipid-based nucleic acid delivery systems, including high nucleic acid encapsulation efficiency, potent transfection, improved penetration into tissues that deliver therapeutic agents, and low levels of cytotoxicity and immunogenicity.
[0234] Prior to the development of lipid nanoparticle delivery systems for nucleic acids, cationic lipids were widely studied as synthetic materials for the delivery of nucleic acid drugs. In these early efforts, cationic lipids condensed nucleic acids after mixing at physiological pH to form lipid-nucleic acid complexes known as lipoplexes. However, lipoplexes proved to be unstable and characterized by a wide size distribution, ranging from the submicron scale to several microns. Lipoplexes, such as Lipofectamine® reagent, have found considerable utility for in vitro transfection. However, these first generation lipoplexes have not proven to be useful in vivo. The large particle size and positive charge (imparted by the cationic lipids) result in rapid plasma clearance, hemolysis and other toxicities, and immune system activation. In some aspects, the nucleic acid molecules provided herein and the lipids or lipid formulations provided herein form nanoparticles (LNPs).
[0235] In other aspects, the nucleic acid molecules provided herein are incorporated into lipid formulations (ie, lipid-based delivery vehicles).
[0236] In the context of the present disclosure, lipid-based delivery vehicles are generally useful for transporting desired RNA to target cells or tissues. The lipid-based delivery vehicle can be any suitable lipid-based delivery vehicle known in the art. In some aspects, the lipid-based delivery vehicle is a liposome, cationic liposome, or lipid nanoparticle containing the self-replicating RNA or mRNA of the present disclosure. In some aspects, the lipid-based delivery vehicle comprises a nanoparticle or bilayer of lipid molecules and the self-replicating RNA or mRNA of the present disclosure. In some aspects, the lipid bilayer further comprises a neutral lipid or polymer. In some aspects, the lipid formulation comprises a liquid medium. In some aspects, the formulation further encapsulates a nucleic acid. In some aspects, the lipid formulation further comprises a nucleic acid and a neutral lipid or polymer. In some aspects, the lipid formulation encapsulates a nucleic acid.
[0237] The present disclosure provides lipid formulations comprising one or more RNA molecules encapsulated in lipid formulations.In some embodiments, the lipid formulation comprises liposomes.In some embodiments, the lipid formulation comprises cationic liposomes.In some embodiments, the lipid formulation comprises lipid nanoparticles.
[0238] In some embodiments, the self-replicating RNA or mRNA is fully encapsulated within the lipid portion of the lipid formulation, such that the RNA in the lipid formulation is resistant to nuclease degradation in aqueous solution.In other embodiments, the lipid formulations described herein are substantially non-toxic to animals, such as humans and other mammals.
[0239] The lipid formulations of the present disclosure also typically have a total lipid:RNA ratio (mass / mass ratio) of about 1:1 to about 100:1, about 1:1 to about 50:1, about 2:1 to about 45:1, about 3:1 to about 40:1, about 5:1 to about 45:1, or about 10:1 to about 40:1, or about 15:1 to about 40:1, or about 20:1 to about 40:1; or about 25:1 to about 45:1; or about 30:1 to about 45:1; or about 32:1 to about 42:1; or about 34:1 to about 42:1. In some embodiments, the total lipid:RNA ratio (mass / mass ratio) is about 30:1 to about 45:1. The ratio may be any value or subvalue within the recited range, including the endpoints.
[0240] The lipid formulations of the present disclosure typically have a diameter of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or about 30 nm, about 35 nm, about 40 The lipid nanoparticles have an average diameter of about 100 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, about 100 nm, about 105 nm, about 110 nm, about 115 nm, about 120 nm, about 125 nm, about 130 nm, about 135 nm, about 140 nm, about 145 nm, or about 150 nm, and are substantially non-toxic. The diameter can be any value or subvalue within the recited range, including the end points. Furthermore, nucleic acids, when present in the lipid nanoparticles of the present disclosure, are generally resistant to degradation by nucleases in aqueous solution.
[0241] In some embodiments, the lipid nanoparticles have a size of less than about 500 nm, less than about 400 nm, less than about 300 nm, less than about 200 nm, less than about 100 nm, or less than about 50 nm. In certain embodiments, the lipid nanoparticles have a size of about 55 nm to about 90 nm.
[0242] In some embodiments, the lipid formulation comprises a self-replicating RNA or mRNA, a cationic lipid (e.g., one or more cationic lipids or salts thereof described herein), a phospholipid, and a conjugated lipid (e.g., one or more PEG-lipid conjugates) that inhibits particle aggregation. The lipid formulation may also comprise cholesterol. In one embodiment, the cationic lipid is an ionizable cationic lipid.
[0243] In nucleic acid-lipid formulations, RNA may be completely encapsulated within the lipid portion of the formulation, thereby protecting the nucleic acid from nuclease degradation.In some embodiments, the lipid formulation containing RNA is completely encapsulated within the lipid portion of the lipid formulation, thereby protecting the nucleic acid from nuclease degradation.In certain embodiments, the RNA in the lipid formulation is not substantially degraded after the particles are exposed to nuclease at 37°C for at least 20, 30, 45, or 60 minutes.In certain other embodiments, the RNA in the lipid formulation is not substantially degraded after the formulation is incubated in serum at 37°C for at least 30, 45, or 60 minutes, or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours.In some embodiments, the RNA is complexed with the lipid portion of the formulation. One of the advantages of the formulations of the present disclosure is that the nucleic acid-lipid compositions are substantially non-toxic to animals, such as humans and other mammals.
[0244] For nucleic acids, complete encapsulation may be determined by performing a membrane-impermeable fluorescent dye exclusion assay using a dye that enhances its fluorescence when associated with nucleic acid. Encapsulation is determined by adding the dye to the lipid formulation, measuring the resulting fluorescence, and comparing it to the fluorescence observed upon addition of a small amount of non-ionic detergent. Detergent-mediated disruption of the lipid layer releases the encapsulated nucleic acid so that it can interact with the membrane-impermeable dye. Nucleic acid encapsulation may be calculated as E=(I0-I) / I0, where / and I0 refer to the fluorescence intensity before and after the addition of detergent.
[0245] In some embodiments, the present disclosure provides a nucleic acid-lipid composition comprising a plurality of nucleic acid-liposomes, nucleic acid-cationic liposomes, or nucleic acid-lipid nanoparticles. In some embodiments, the nucleic acid-lipid composition comprises a plurality of RNA-liposomes. In some embodiments, the nucleic acid-lipid composition comprises a plurality of RNA-cationic liposomes. In some embodiments, the nucleic acid-lipid composition comprises a plurality of RNA-lipid nanoparticles.
[0246] In some embodiments, the lipid formulation comprises about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 30% to about 95%, about 40% to about 95%, about 50% to about 95%, about 60% to about 95%, about 70% to about 95%, about 80% to about 95%, about 85% to about 95%, about 90% to about 95%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90 ... % to about 90%, about 70% to about 90%, about 80% to about 90%, or at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% (or any fraction or range thereof) of the RNA is fully encapsulated within the lipid portion of the formulation such that the RNA is encapsulated therein. The amount may be any value or subvalue within the recited range, including the endpoints. The RNA contained in any of the RNA-lipid compositions or RNA-lipid formulations provided herein may be a self-replicating RNA or an mRNA.
[0247] Depending on the intended use of the lipid formulation, the proportions of the components can be varied, and the delivery efficiency of a particular formulation can be measured using assays known in the art.
[0248] In some embodiments, the nucleic acid molecules provided herein are lipid-formulated. The lipid formulation is preferably selected from, but not limited to, liposomes, cationic liposomes, and lipid nanoparticles. In one embodiment, the lipid formulation is a cationic liposome or lipid nanoparticle (LNP) comprising: (a) an RNA of the present disclosure; (b) cationic lipids, (c) an aggregation reducing agent (e.g., a polyethylene glycol (PEG) lipid or a PEG-modified lipid); (d) optionally, a non-cationic lipid (e.g., a neutral lipid), and (e) optionally, a sterol.
[0249] In another aspect, the cationic lipid is an ionizable cationic lipid. Any ionizable cationic lipid, including the exemplary cationic lipids provided herein, can be included in the lipid formulation.
[0250] In some embodiments, compositions comprising lipids and / or lipid formulations provided herein comprise an RNA molecule comprising (A) the sequence of SEQ ID NO:1, (B) the sequence of SEQ ID NO:2, (C) the sequence of SEQ ID NO:3, or (D) the sequence of SEQ ID NO:4. In some embodiments, compositions provided herein comprise an RNA molecule comprising the sequence of SEQ ID NO:40. In some embodiments, compositions provided herein comprise an RNA molecule comprising the sequence of SEQ ID NO:29, SEQ ID NO:32, or SEQ ID NO:48. In some embodiments, compositions provided herein comprise lipid nanoparticles (LNPs). In some embodiments, compositions provided herein comprise lyophilized LNPs.
[0251] In some embodiments, the present invention relates to a lipid composition comprising about 45 mol % to about 55 mol % of an ionizable cationic lipid having the structure of aiATX-126: [ka]
[0252] A lipid nanoparticle composition is provided comprising a lipid formulation comprising ii. about 8 mol% to about 12 mol% DSPC, iii. about 35 mol% to about 42 mol% cholesterol, and iv. about 1.25 mol% to about 1.75 mol% PEG2000-DMG, and b. an RNA molecule having at least 80% identity to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, wherein the lipid formulation encapsulates the RNA molecule and the lipid nanoparticle has a size of about 60 to about 90 nm. In some embodiments, the RNA molecule contained in the lipid nanoparticle composition provided herein has at least 80% identity to the sequence of SEQ ID NO:40. In some embodiments, the RNA molecule contained in the lipid nanoparticle composition provided herein has at least 80% identity to the sequence of SEQ ID NO:29, SEQ ID NO:32, or SEQ ID NO:48. In some embodiments, the lipid nanoparticle composition provided herein is lyophilized. In some embodiments, the RNA molecule contained in the lipid nanoparticle composition provided herein has at least 80% identity to the sequence of SEQ ID NO:29. In some embodiments, the RNA molecule contained in the lipid nanoparticle compositions provided herein has at least 80% identity to the sequence of SEQ ID NO:32.
[0253] Cationic lipids In one embodiment, the lipid nanoparticle formulation comprises (i) at least one cationic lipid, (ii) a helper lipid, (iii) a sterol (e.g., cholesterol), and (iv) a PEG-lipid. In another embodiment, the cationic lipid is an ionizable cationic lipid. In yet another embodiment, the lipid nanoparticle formulation comprises (i) at least one cationic lipid, (ii) a helper lipid, (iii) a sterol (e.g., cholesterol), and (iv) a PEG lipid in a molar ratio of about 40-70% ionizable cationic lipid: about 2-15% helper lipid: about 20-45% sterol: about 0.5-5% PEG lipid. In a further embodiment, the cationic lipid is an ionizable cationic lipid.
[0254] In one embodiment, the lipid nanoparticle formulation comprises (i) at least one cationic lipid, (ii) a helper lipid, (iii) a sterol (e.g., cholesterol), and (iv) a PEG-lipid. In another embodiment, the cationic lipid is an ionizable cationic lipid. In yet another embodiment, the lipid nanoparticle formulation comprises (i) at least one cationic lipid, (ii) a helper lipid, (iii) a sterol (e.g., cholesterol), and (iv) a PEG lipid in a molar ratio of about 40-70% ionizable cationic lipid: about 2-15% helper lipid: about 20-45% sterol: about 0.5-5% PEG lipid. In a further embodiment, the cationic lipid is an ionizable cationic lipid.
[0255] In the presently disclosed lipid formulations, the cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), 1,2-dioleoyltrimethylammonium propane chloride (DOTAP) (also known as N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride and 1,2-dioleyloxy-3-trimethylaminopropane chloride salt), N-(l-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride and 1,2-dioleyloxy-3-trimethylaminopropane chloride salt), N-(l-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride and 1,2-dioleo ... pyryl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-di-y-linolenyloxy-N,N-dimethylaminopropane (γ-DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-di Linoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleyloxy-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1, 2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanediol (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or its analogs, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine, (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxyphenyl) ... (2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (C12-200), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28 31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-M-C3-DMA), 3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethylpropan-1-amine (MC3 ether), 4-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethylbutan-1-amine (MC4 ether), or any combination thereof. Other cationic lipids include N,N-distearyl-N,N-dimethylammonium bromide (DDAB), 3P-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Choi), N-(l-(2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoroacetate (DOSPA), dioctadecylamidoglycylcarboxyspermine (DOGS), 1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), N-(1,2-dimyristyloxyprop-3-yl)-N,Cationic lipids include, but are not limited to, N-dimethyl-N-hydroxyethylammonium bromide (DMRIE) and 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC). Additionally, commercially available preparations of cationic lipids can be used, such as, for example, LIPOFECTIN (containing DOTMA and DOPE, available from GIBCO / BRL) and Lipofectamine (containing DOSPA and DOPE, available from GIBCO / BRL).
[0256] Other suitable cationic lipids are disclosed in International Publication Nos. WO09 / 086558, WO09 / 127060, WO10 / 048536, WO10 / 054406, WO10 / 088537, WO10 / 129709, and WO2011 / 153493; U.S. Patent Publication Nos. 2011 / 0256175, 2012 / 0128760, and 2012 / 0027803; U.S. Patent No. 8,158,601; and Love et al., PNAS, 107(5), 1864-69, 2010, the contents of which are incorporated herein by reference.
[0257] The RNA-lipid formulations of the present disclosure may include helper lipids, which may be referred to as neutral helper lipids, non-cationic lipids, non-cationic helper lipids, anionic lipids, anionic helper lipids, or neutral lipids.Lipid formulations, particularly cationic liposomes and lipid nanoparticles, have been shown to have increased cellular uptake when helper lipids are present in the formulation.(Curr.Drug Metab.2014;15(9):882-92). For example, several studies have shown that neutral and zwitterionic lipids, such as 1,2-dioleoyl sn-glycero-3-phosphatidylcholine (DOPC), di-oleoyl-phosphatidyl-ethanolamine (DOPE), and 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), are more fusogenic (i.e., promote fusion) than cationic lipids and may affect the polymorphism of lipid-nucleic acid complexes, which promotes the transition from lamellar to hexagonal phases, thereby inducing fusion and disruption of cell membranes. (Nanomedicine (Lond). 2014 Jan; 9 (1): 105-20). In addition, the use of helper lipids may help reduce any potential adverse effects, such as toxicity and immunogenicity, of using many common cationic lipids.
[0258] Non-limiting examples of non-cationic lipids suitable for the lipid formulations of the present disclosure include phospholipids, such as lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylcholine (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylcholine (DPPG), palmitoyloleoylphosphatidylethanolamine (DPPG ... phosphatidylethanolamine (POPE), palmitoyloleoyl-phosphatidylglycerol (POPG), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyloleoyl-phosphatidylethanolamine (SOPE), lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof. Other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having carbon chains of from C10 to C24, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl.
[0259] Additional examples of non-cationic lipids include sterols such as cholesterol and its derivatives. As a helper lipid, cholesterol increases the charge spacing of the lipid layer that interacts with nucleic acid, so that the charge distribution matches that of the nucleic acid more closely. (JRSoc.Interface.2012 Mar 7;9(68):548-561). Non-limiting examples of cholesterol derivatives include polar analogs such as 5α-cholestanol, 5α-coprostanol, cholesteryl-(2'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5α-cholestane, cholestenone, 5α-cholestanone, 5α-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog such as cholesteryl-(4'-hydroxy)-butyl ether.
[0260] In some embodiments, the helper lipid present in lipid formulation comprises or consists of a mixture of one or more phospholipids and cholesterol or its derivatives.In other embodiments, the neutral lipid present in lipid formulation comprises or consists of one or more phospholipids, for example, cholesterol-free lipid formulations.In yet other embodiments, the neutral lipid present in lipid formulation comprises or consists of cholesterol or its derivatives, for example, phospholipid-free lipid formulations.
[0261] Other examples of helper lipids include non-phosphorus-containing lipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramides, and sphingomyelin.
[0262] Other suitable cationic lipids include those with alternative fatty acid groups and other dialkylamino groups, including those with different alkyl substituents (e.g., N-ethyl-N-methylamino- and N-propyl-N-ethylamino-). These lipids are part of a subcategory of cationic lipids called amino lipids. In some embodiments of the lipid formulations described herein, the cationic lipid is an amino lipid. In general, amino lipids with less saturated acyl chains are more easily sized, especially when the complex must be sized to less than about 0.3 microns for sterile filtration purposes. Amino lipids containing unsaturated fatty acids with carbon chain lengths in the range of C14 to C22 may be used. Other scaffolds can also be used to separate the amino group and the fatty acid or fatty alkyl portion of the amino lipid.
[0263] In some embodiments, the lipid formulation comprises a cationic lipid of formula I according to patent application PCT / EP2017 / 064066, the disclosure of which is also incorporated herein by reference in this regard.
[0264] In some embodiments, the amino lipids or cationic lipids of the present disclosure are ionizable and have at least one protonatable or deprotonatable group such that the lipid is positively charged at a pH below physiological pH (e.g., pH 7.4) and neutral at a second pH, preferably above physiological pH. Of course, it will be understood that the addition or removal of protons as a function of pH is an equilibrium process, and reference to a charged or neutral lipid refers to the nature of the predominant species and does not require that all of the lipids be present in a charged or neutral form. Lipids with multiple protonatable or deprotonatable groups, or lipids that are zwitterionic, are not excluded from use in the present disclosure. In certain embodiments, the protonatable lipid has a pKa of the protonatable group ranging from about 4 to about 11. In some embodiments, the ionizable cationic lipid has a pKa of about 5 to about 7. In some embodiments, the pKa of the ionizable cationic lipid is about 6 to about 7.
[0265] In some embodiments, the lipid formulation comprises an ionizable cationic lipid of formula I: [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein R5 and R6 are each independently selected from the group consisting of linear or branched C1-C31 alkyl, C2-C31 alkenyl, or C2-C31 alkynyl, and cholesteryl; L5 and L6 are each independently selected from the group consisting of linear C1-C20 alkyl and C2-C20 alkenyl; and X5 is -C(O)O- (thereby forming -C(O)O-R6) or -OC( X is -C(O)O- (thereby forming -OC(O)-R), X is -C(O)O- (thereby forming -C(O)O-R) or -OC(O)- (thereby forming -OC(O)-R), X is S or O, L is absent or lower alkyl, R is linear or branched C-C alkyl, and R and R are each independently selected from the group consisting of hydrogen and linear or branched C-C alkyl.
[0266] In some embodiments, X7 is S.
[0267] In some embodiments, X5 is -C(O)O-, thereby forming -C(O)O-R6, and X6 is -C(O)O-, thereby forming -C(O)O-R5.
[0268] In some embodiments, R7 and R8 are each independently selected from the group consisting of methyl, ethyl, and isopropyl.
[0269] In some embodiments, L5 and L6 are each independently a C1-C10 alkyl. In some embodiments, L5 is a C1-C3 alkyl and L6 is a C1-C5 alkyl. In some embodiments, L6 is a C1-C2 alkyl. In some embodiments, L5 and L6 are each a linear C7 alkyl. In some embodiments, L5 and L6 are each a linear C9 alkyl.
[0270] In some embodiments, R5 and R6 are each independently alkenyl. In some embodiments, R6 is alkenyl. In some embodiments, R6 is C2-C9 alkenyl. In some embodiments, the alkenyl contains a single double bond. In some embodiments, R5 and R6 are each alkyl. In some embodiments, R5 is a branched alkyl. In some embodiments, R5 and R6 are each independently selected from the group consisting of C9 alkyl, C9 alkenyl, and C9 alkynyl. In some embodiments, R5 and R6 are each independently selected from the group consisting of C11 alkyl, C11 alkenyl, and C11 alkynyl. In some embodiments, R5 and R6 are each independently selected from the group consisting of C7 alkyl, C7 alkenyl, and C7 alkynyl. In some embodiments, R5 is -CH((CH2)pCH3)2 or -CH((CH2)pCH3)((CH2)p-1CH3) and p is 4 to 8. In some embodiments, p is 5 and L5 is a C1-C3 alkyl. In some embodiments, p is 6 and L5 is a C3 alkyl. In some embodiments, p is 7. In some embodiments, p is 8 and L5 is a C1-C3 alkyl. In some embodiments, R5 consists of -CH((CH2)pCH3)((CH2)p-1CH3) where p is 7 or 8.
[0271] In some embodiments, R4 is ethylene or propylene. In some embodiments, R4 is n-propylene or isobutylene.
[0272] In some embodiments, L7 is absent, R4 is ethylene, X7 is S, and R7 and R8 are each methyl. In some embodiments, L7 is absent, R4 is n-propylene, X7 is S, and R7 and R8 are each methyl. In some embodiments, L7 is absent, R4 is ethylene, X7 is S, and R7 and R8 are each ethyl.
[0273] In some embodiments, X7 is S, X5 is -C(O)O- (thereby forming -C(O)O-R6), X6 is -C(O)O- (thereby forming -C(O)O-R5), L5 and L6 are each independently a linear C3-C7 alkyl, L7 is absent, R5 is -CH((CH2)pCH3)2, and R6 is a C7-C12 alkenyl. In some further embodiments, p is 6 and R6 is a C9 alkenyl.
[0274] In embodiments, any one or more of the lipids listed herein may be explicitly excluded.
[0275] In some embodiments, the helper lipid comprises about 2 mol% to about 20 mol%, about 3 mol% to about 18 mol%, about 4 mol% to about 16 mol%, about 5 mol% to about 14 mol%, about 6 mol% to about 12 mol%, about 5 mol% to about 10 mol%, about 5 mol% to about 9 mol%, or about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, or about 12 mol% (or any fraction or range thereof) of the total lipid present in the lipid formulation.
[0276] The lipid portion of the lipid formulation, or the cholesterol or cholesterol derivative, may comprise up to about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, or about 60 mol% of the total lipid present in the lipid formulation. In some embodiments, the cholesterol or cholesterol derivative comprises about 15 mol% to about 45 mol%, about 20 mol% to about 40 mol%, about 25 mol% to about 35 mol%, or about 28 mol% to about 35 mol%; or about 25 mol%, about 26 mol%, about 27 mol%, about 28 mol%, about 29 mol%, about 30 mol%, about 31 mol%, about 32 mol%, about 33 mol%, about 34 mol%, about 35 mol%, about 36 mol%, or about 37 mol% of the total lipid present in the lipid formulation.
[0277] In certain embodiments, the lipid portion of the lipid formulation is about 35 mol % to about 42 mol % cholesterol.
[0278] In some embodiments, the phospholipid component in the mixture may comprise about 2 mol% to about 20 mol%, about 3 mol% to about 18 mol%, about 4 mol% to about 16 mol%, about 5 mol% to about 14 mol%, about 6 mol% to about 12 mol%, about 5 mol% to about 10 mol%, about 5 mol% to about 9 mol%, or about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, or about 12 mol% (or any fraction or range thereof) of the total lipid present in the lipid formulation.
[0279] In certain embodiments, the lipid portion of the lipid formulation comprises, but is not necessarily limited to, about 40 mol% to about 60 mol% ionizable cationic lipid, about 4 mol% to about 16 mol% DSPC, about 30 mol% to about 47 mol% cholesterol, and about 0.5 mol% to about 3 mol% PEG2000-DMG.
[0280] In certain embodiments, the lipid portion of the lipid formulation may comprise, but is not necessarily limited to, about 42 mol% to about 58 mol% ionizable cationic lipid, about 6 mol% to about 14 mol% DSPC, about 32 mol% to about 44 mol% cholesterol, and about 1 mol% to about 2 mol% PEG2000-DMG.
[0281] In certain embodiments, the lipid portion of the lipid formulation may comprise, but is not necessarily limited to, about 45 mol% to about 55 mol% ionizable cationic lipid, about 8 mol% to about 12 mol% DSPC, about 35 mol% to about 42 mol% cholesterol, and about 1.25 mol% to about 1.75 mol% PEG2000-DMG.
[0282] The percentage of helper lipid present in the lipid formulation is a target amount and the actual amount of helper lipid present in the formulation may vary, for example, by ±5 mol %.
[0283] A lipid formulation comprising a cationic lipid compound or an ionizable cationic lipid compound may be about 30-70% cationic lipid compound, about 25-40% cholesterol, about 2-15% helper lipid, and about 0.5-5% polyethylene glycol (PEG) lipid on a molar basis, the percentages being of the total lipid present in the formulation. In some embodiments, the composition is about 40-65% cationic lipid compound, about 25-35% cholesterol, about 3-9% helper lipid, and about 0.5-3% PEG-lipid, the percentages being of the total lipid present in the formulation.
[0284] The formulation may be, for example, a lipid particle formulation containing 8-30% nucleic acid compound, 5-30% helper lipid, and 0-20% cholesterol; 4-25% cationic lipid, 4-25% helper lipid, 2-25% cholesterol, 10-35% cholesterol-PEG, and 5% cholesterol-amine; or 2-30% cationic lipid, 2-30% helper lipid, 1-15% cholesterol, 2-35% cholesterol-PEG, and 1-20% cholesterol-amine; or up to 90% cationic lipid and 2-10% helper lipid, or 100% cationic lipid.
[0285] lipid complex The lipid formulations described herein may further comprise lipid complexes. Complexed lipids are useful in that they prevent particle aggregation. Suitable complexed lipids include, but are not limited to, PEG-lipid complexes, cationic polymer-lipid complexes, and mixtures thereof. Furthermore, lipid delivery vehicles can be used for specific targeting by binding ligands (e.g., antibodies, peptides, and carbohydrates) to the surface or end of the PEG chains that are attached (Front Pharmacol.2015 Dec 1;6:286).
[0286] In some embodiments, the lipid complex is a PEG-lipid. The inclusion of polyethylene glycol (PEG) in lipid formulations as a coating or surface ligand, a technique called PEGylation, helps to protect nanoparticles from the immune system and avoid RES uptake (Nanomedicine (Lond). 2011 Jun; 6(4): 715-28). PEGylation has been used to stabilize lipid formulations and their payloads through physical, chemical, and biological mechanisms. Surfactant-like PEG lipids (e.g., PEG-DSPE) can be placed in lipid formulations to form a hydration layer and steric barrier on the surface. Based on the degree of PEGylation, the surface layer can generally be divided into two types: brush-like and mushroom-like layers. In the case of formulations stabilized with PEG-DSPE, PEG adopts a mushroom structure at low degrees of PEGylation (usually less than 5 mol%) and shifts to a brush structure as the content of PEG-DSPE increases beyond a certain level (Journal of Nanomaterials. 2011; 2011: 12). PEGylation significantly increases the circulating half-life of lipid formulations (Annu. Rev. Biomed. Eng. 2011 Aug 15;13():507-30; J. Control Release. 2010 Aug 3;145(3):178-81).
[0287] Examples of PEG-lipids include, but are not limited to, PEG conjugated to dialkyloxypropyl (PEG-DAA), PEG conjugated to diacylglycerol (PEG-DAG), methoxypolyethylene glycol (PEG-DMG or PEG2000-DMG), PEG conjugated to phospholipids such as phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramide, PEG conjugated to cholesterol or its derivatives, and mixtures thereof.
[0288] PEG is a linear water-soluble polymer of ethylene PEG repeating units with two terminal hydroxyl groups. PEG is classified by molecular weight and includes: monomethoxypolyethyleneglycol (MePEG-OH), monomethoxypolyethylene-glycol-succinate (MePEG-S), monomethoxypolyethylene-glycol-succinimidyl succinate (MePEG-S-NHS), monomethoxypolyethyleneglycol-amine (MePEG-NH2), monomethoxypolyethyleneglycol-tresylate (MePEG-TRES), monomethoxypolyethyleneglycol-imidazolyl-carbonyl (MePEG-IM), and such compounds containing terminal hydroxyl groups instead of terminal methoxy groups (e.g., HO-PEG-S, HO-PEG-S-NHS, HO-PEG-NH2).
[0289] The PEG moiety of the PEG-lipid conjugates described herein may comprise an average molecular weight ranging from about 550 daltons to about 10,000 daltons. In certain embodiments, the PEG moiety has an average molecular weight of about 750 daltons to about 5,000 daltons (e.g., about 1,000 daltons to about 5,000 daltons, about 1,500 daltons to about 3,000 daltons, about 750 daltons to about 3,000 daltons, about 750 daltons to about 2,000 daltons). In some embodiments, the PEG moiety has an average molecular weight of about 2,000 daltons or about 750 daltons. The average molecular weight may be any value or partial value within the recited range, including the endpoints.
[0290] In certain embodiments, PEG can be optionally substituted with alkyl, alkoxy, acyl, or aryl groups.PEG can be directly conjugated to lipid, or can be linked to lipid via a linker moiety.Any linker moiety suitable for coupling PEG to lipid can be used, including, for example, non-ester-containing linker moieties and ester-containing linker moieties.In one embodiment, the linker moiety is a non-ester-containing linker moiety. Exemplary non-ester containing linker moieties include, but are not limited to, amide (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), carbamate (-NHC(O)O-), urea (-NHC(O)NH-), disulfide (-SS-), ether (-O-), succinyl (-(O)CCH2CH2C(O)-), succinamidyl (-NHC(O)CH2CH2C(O)NH-), ether, and combinations thereof (e.g., linkers containing both carbamate and amide linker moieties). In one aspect, a carbamate linker is used to couple the PEG to the lipid.
[0291] In some embodiments, PEG is coupled to lipids using an ester-containing linker moiety. Exemplary ester-containing linker moieties include, for example, carbonate (-OC(O)O-), succinoyl, phosphate ester (-O-(O)POH-O-), sulfonate ester, and combinations thereof.
[0292] Phosphatidylethanolamines having various acyl chain groups of various chain lengths and degrees of saturation can be conjugated to PEG to form lipid conjugates. Such phosphatidylethanolamines are commercially available or can be isolated or synthesized using conventional techniques known to those of skill in the art. 10 ~C 20Phosphatidylethanolamines containing saturated or unsaturated fatty acids with carbon chain lengths in the range of 0 to 100 are preferred. Phosphatidylethanolamines containing mono- or di-unsaturated fatty acids, as well as mixtures of saturated and unsaturated fatty acids, can also be used. Suitable phosphatidylethanolamines include, but are not limited to, dimyristoyl-phosphatidylethanolamine (DMPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dioleoyl-phosphatidylethanolamine (DOPE), and distearoyl-phosphatidylethanolamine (DSPE).
[0293] In some embodiments, the PEG-DAA conjugate is a PEG-didecyloxypropyl (C10) conjugate, a PEG-dilauryloxypropyl (C12) conjugate, a PEG-dimyristyloxypropyl (C14) conjugate, a PEG-dipalmityloxypropyl (C16) conjugate, or a PEG-distearyloxypropyl (C18) conjugate. In some embodiments, the PEG has an average molecular weight of about 750 or about 2,000 daltons. In some embodiments, the terminal hydroxyl group of the PEG is replaced with a methyl group.
[0294] In addition to the above, other hydrophilic polymers can be used instead of PEG. Examples of suitable polymers that can be used instead of PEG include, but are not limited to, polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyl, methacrylamide, polymethacrylamide, and polydimethylacrylamide, polylactic acid, polyglycolic acid, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
[0295] In some embodiments, the lipid conjugates (e.g., PEG lipids) comprise about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 0.9 mol% to about 1.6 mol%, about 0.9 mol% to about 1.8 mol%, about 1 mol% to about 1.8 mol%, about 1 mol% to about 1.7 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, or about 1.4 mol% to about 1.6 mol% (or any fraction or range thereof) of the total lipid present in the lipid formulation. In other embodiments, the lipid conjugates (e.g., PEG-lipids) comprise about 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, or 5% (or any fraction or range thereof) of the total lipid present in the lipid formulation. The amount can be any value or subvalue within the recited range, including the endpoints.
[0296] The percentage of lipid conjugates (e.g., PEG-lipids) present in the lipid formulations of the present disclosure is a target amount, and the actual amount of lipid conjugates present in the formulation may vary, for example, by ±0.5 mol%. Those skilled in the art will understand that the concentration of lipid conjugates may vary depending on the lipid conjugates used and the rate at which the lipid formulation becomes fusogenic.
[0297] In some embodiments, the lipid formulation for any of the compositions described herein comprises a lipoplex, liposome, lipid nanoparticle, polymer-based particle, exosome, lamellar body, micelle, or emulsion.
[0298] Mechanism of action of cellular uptake of lipid formulations In some aspects, lipid formulations for intracellular delivery of nucleic acids, particularly liposomes, cationic liposomes, and lipid nanoparticles, are designed for cellular uptake by penetrating the target cell through the utilization of the endocytosis mechanism of the target cell, and the contents of the lipid delivery vehicle are delivered to the cytosol of the target cell. (Nucleic Acid Therapeutics, 28(3):146-157, 2018). Prior to endocytosis, functionalized ligands such as PEG lipids on the surface of the lipid delivery vehicle are shed from the surface, which causes internalization into the target cell. During endocytosis, some portion of the cell's plasma membrane surrounds the vector and engulfs it into a vesicle, which then pinches off from the cell membrane, enters the cytosol, and finally enters and translocates into the endolysosomal pathway. In the case of ionizable cationic lipid-containing delivery vehicles, the increased acidity associated with endosomal aging results in vehicles with a strong positive charge on the surface. The interaction between the delivery vehicle and the endosomal membrane then leads to a membrane fusion event that leads to the cytosolic delivery of the payload. In the case of an RNA payload, the cell's own internal translation process then translates the RNA into the encoded protein. The encoded protein can further undergo post-translational processing, including transport to a target organelle or location within the cell or excretion from the cell.
[0299] By controlling the composition and concentration of lipid complexes, the rate at which lipid complexes are exchanged from the lipid formulation and, in turn, the rate at which the lipid formulation becomes fusogenic can be controlled.In addition, other variables, including, for example, pH, temperature, or ionic strength, can be used to vary and / or control the rate at which the lipid formulation becomes fusogenic.Other methods that can be used to control the rate at which the lipid formulation becomes fusogenic will be apparent to those skilled in the art upon reading this disclosure.In addition, by controlling the composition and concentration of lipid complexes, the particle size of the liposomes or lipids can be controlled.
[0300] Manufacture of lipid formulations There are many different methods for the preparation of lipid formulations containing nucleic acids. (Curr. Drug Metabol. 2014, 15, 882-892; Chem. Phys. Lipids 2014, 177, 8-18; Int. J. Pharm. Stud. Res. 2012, 3, 14-20). The following techniques are briefly described here: thin film hydration, double emulsion, reverse phase evaporation, microfluidic preparation, double asymmetric centrifugation, ethanol injection, detergent dialysis, spontaneous vesicle formation by ethanol dilution, and encapsulation in preformed liposomes.
[0301] Thin Film Hydration In the thin film hydration method (TFH) or Bangham method, lipids are dissolved in an organic solvent and then evaporated using a rotary evaporator to form a thin lipid layer. After hydration of the layer with an aqueous buffer containing the compound to be loaded, multilamellar vesicles (MLVs) are formed, which can be reduced in size to produce small or large unilamellar vesicles (LUVs and SUVs) by extrusion through the membrane or sonication of the starting MLVs.
[0302] Double Emulsion Lipid formulations can also be prepared by a double emulsion technique involving dissolving lipids in a water / organic solvent mixture. An organic solution containing aqueous droplets is mixed with an excess of aqueous medium to form a water-in-oil-in-water (W / O / W) double emulsion. After vigorous mechanical shaking, some of the aqueous droplets collapse, forming large unilamellar vesicles (LUVs).
[0303] Reverse Phase Evaporation Nucleic acid-loaded LUVs can also be obtained by the reverse phase evaporation (REV) method. In this technique, a two-phase system is formed by dissolving phospholipids in an organic solvent and an aqueous buffer. The resulting suspension is then sonicated for a short period of time until the mixture becomes a clear, one-phase dispersion. After evaporating the organic solvent under reduced pressure, the lipid formulation is obtained. This method has been used to encapsulate a variety of small and large hydrophilic molecules, including nucleic acids.
[0304] 2. Preparation of Microfluidics Microfluidic methods offer the possibility to control the lipid hydration process, unlike other bulk techniques. Methods can be classified into continuous-flow microfluidics and droplet-based microfluidics, depending on the way the flow is manipulated. In the microfluidic hydrodynamic focusing (MHF) method, which operates in continuous-flow mode, lipids are dissolved in isopropyl alcohol, which is hydrodynamically focused at a microchannel cross junction between two aqueous buffer streams. The vesicle size can be controlled by adjusting the flow rate, thereby controlling the lipid solution / buffer dilution process. The method can be used to generate oligonucleotide (ON) lipid formulations by using a microfluidic device composed of three inlet and one outlet port.
[0305] Double asymmetric centrifugation Double asymmetric centrifugation (DAC) differs from more common centrifugation because it uses an additional rotation around its own vertical axis. The two overlapping motions generated achieve efficient homogenization. The sample is pushed outward as in a normal centrifuge, and then pushed toward the center of the vial by the additional rotation. By mixing lipid and NaCl solutions, a viscous vesicular phospholipid gel (VPC) is obtained, which is then diluted to obtain a lipid formulation dispersion. The size of the lipid formulation can be adjusted by optimizing the DAC speed, lipid concentration, and homogenization time.
[0306] Ethanol injection The ethanol injection (EI) method can be used to encapsulate nucleic acids. This method involves using a needle to rapidly inject an ethanol solution in which lipids are dissolved into an aqueous medium containing the nucleic acid to be encapsulated. Vesicles form spontaneously as the phospholipids disperse throughout the medium.
[0307] Detergent dialysis Nucleic acid can be encapsulated using detergent dialysis. In summary, lipids and plasmids are solubilized in a detergent solution of appropriate ionic strength, and after removing the detergent by dialysis, a stabilized lipid formulation is formed. Unencapsulated nucleic acid is then removed by ion exchange chromatography, and empty vesicles are removed by sucrose density gradient centrifugation. The technique is highly sensitive to cationic lipid content and salt concentration of the dialysis buffer, and the method is also difficult to scale.
[0308] Spontaneous vesicle formation upon ethanol dilution Stable lipid formulations can also be generated by spontaneous vesicle formation via an ethanol dilution method, in which stepwise or dropwise dilution of ethanol is performed with the controlled addition of lipids dissolved in ethanol to rapidly mix with an aqueous buffer containing the nucleic acid, resulting in the immediate formation of vesicles loaded with nucleic acid.
[0309] Encapsulation into preformed liposomes Entrapment of nucleic acids can also be obtained from preformed liposomes in two different ways: (1) simple mixing of cationic liposomes with nucleic acids resulting in electrostatic complexes called "lipoplexes" (which can be preferably used to transfect cell cultures but are characterized by low encapsulation efficiency and poor in vivo performance) and (2) destabilization of liposomes (gradual addition of absolute ethanol to a suspension of cationic vesicles to a concentration of 40% v / v, followed by dropwise addition of nucleic acid to obtain loaded vesicles). However, the two main steps characterizing the encapsulation process are too sensitive and the particles have to be miniaturized.
[0310] Excipients The pharmaceutical compositions disclosed herein can be formulated with one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) allow sustained or delayed release (e.g., from a depot formulation of a polynucleotide, primary construct, or RNA); (4) modify biodistribution (e.g., targeting a polynucleotide, primary construct, or RNA to a particular tissue or cell type); (5) increase translation of the encoded protein in vivo; and / or (6) modify the release characteristics of the encoded protein in vivo.
[0311] The pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. Generally, such preparation methods include the step of bringing into association an active ingredient (i.e., a nucleic acid) with an excipient and / or one or more other accessory ingredients. Pharmaceutical compositions according to the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses.
[0312] Pharmaceutical compositions may further comprise pharma- ceutically acceptable excipients, which as used herein include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as appropriate for the particular dosage form desired.
[0313] In addition to conventional excipients, such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, excipients of the present disclosure may include, but are not limited to, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with primary DNA constructs or RNA (e.g., for implantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.
[0314] Thus, the pharmaceutical compositions described herein may include one or more excipients, each in an amount that together increase the stability of the nucleic acid in the lipid formulation, increase cell transfection with the nucleic acid, increase expression of the encoded protein, and / or modify the release characteristics of the encoded protein. Additionally, the RNA of the present disclosure may be formulated using self-assembling nucleic acid nanoparticles.
[0315] Various excipients for formulating pharmaceutical compositions and techniques for preparing compositions are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, AR Gennaro, Lippincott, Williams & Wilkins, Baltimore, Md., 2006, incorporated herein by reference in its entirety). The use of any conventional excipient medium may be contemplated within the scope of the embodiments of the present disclosure, except insofar as the conventional excipient medium is incompatible with the substance or its derivatives, for example, by causing any undesirable biological effects or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
[0316] The pharmaceutical compositions of the present disclosure may further contain pharma- ceutically acceptable carrier substances required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, and wetting agents, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, and mixtures thereof. For solid compositions, conventional non-toxic pharma-ceutically acceptable carriers can be used, including, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0317] In certain embodiments of the present disclosure, RNA-lipid formulations may be administered in sustained release formulations, for example in compositions that contain sustained release polymers.Active agent can be prepared with carriers that prevent immediate release, for example, controlled release vehicles, for example, polymers, microencapsulated delivery systems, or bioadhesive gels.Long-term delivery of RNA in various compositions of the present disclosure can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate hydrogel and gelatin.
[0318] Methods for Inducing an Immune Response In some embodiments, methods of eliciting an immune response in a subject are provided herein. The methods provided herein can be used to elicit any type of immune response, including adaptive and innate immune responses. In one aspect, the immune response elicited using the methods provided herein includes an antibody response, a cellular immune response, or both an antibody response and a cellular immune response.
[0319] The method of eliciting an immune response provided herein comprises administering to a subject an effective amount of any RNA or DNA molecule, i.e., a nucleic acid molecule, provided herein. In one aspect, the method of eliciting an immune response comprises administering to a subject an effective amount of any composition comprising an RNA molecule and a lipid provided herein. In another aspect, the method of eliciting an immune response comprises administering to a subject an effective amount of any pharmaceutical composition comprising an RNA molecule and a lipid formulation provided herein. In some aspects, the RNA molecules, compositions, and pharmaceutical compositions provided herein are vaccines that can, for example, elicit a protective or therapeutic immune response.
[0320] As used herein, the term "subject" refers to any individual or patient on whom the methods disclosed herein are performed. The term "subject" may be used interchangeably with the term "individual" or "patient." A subject may be a human, but a subject may also be an animal as understood by those skilled in the art. Thus, the definition of a subject includes mammals, such as livestock including rodents (including mice, rats, hamsters, and guinea pigs), cats, dogs, rabbits, cows, horses, goats, sheep, pigs, and the like, as well as other animals including primates (including monkeys, chimpanzees, orangutans, and gorillas). As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount of an RNA molecule, composition, or pharmaceutical composition described herein that is sufficient to perform the intended use, including but not limited to inducing an immune response and / or disease treatment, as defined herein. The therapeutically effective amount may vary depending on the intended use (e.g., induction of immune response, treatment, in vivo application), or the subject or patient and disease state to be treated, such as the subject's weight and age, species, severity of disease state, method of administration, etc., which can be easily determined by one skilled in the art. The term also applies to a dose that induces a specific response in target cells. The specific dose will vary depending on the particular RNA molecule, composition, or pharmaceutical composition selected, the dosing regimen to be followed, whether it is administered in combination with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system that carries it.
[0321] Exemplary doses of nucleic molecules that can be administered include about 0.01 μg, about 0.02 μg, about 0.03 μg, about 0.04 μg, about 0.05 μg, about 0.06 μg, about 0.07 μg, about 0.08 μg, about 0.09 μg, about 0.1 μg, about 0.2 μg, about 0.3 μg, about 0.4 μg, about 0.5 μg, about 0.6 μg, about 0.7 μg, about 0.8 μg, about 0.9 μg, about 1.0μg, about 1.5μg, about 2.0μg, about 2.5μg, about 3.0μg, about 3.5μg, about 4.0μg, about 4.5μg, about 5.0μg, about 5.5μg, about 6.0μg, about 6. 5μg, about 7.0μg, about 7.5μg, about 8.0μg, about 8.5μg, about 9.0μg, about 9.5μg, about 10μg, about 11μg, about 12μg, about 13μ, about 14μg, about 15μ g, about 16 μg, about 17 μg, about 18 μg, about 19 μg, about 20 μg, about 21 μg, about 22 μg, about 23 μg, about 24 μg, about 25 μg, about 26 μg, about 27 μg, about 28 μg , about 29μg, about 30μg, about 35μg, about 40μg, about 45μg, about 50μg, about 55μg, about 60μg, about 65μg, about 70μg, about 75μg, about 80μg, about 85μg, Examples of the amount of the nucleic acid molecule include about 90 μg, about 95 μg, about 100 μg, about 125 μg, about 150 μg, about 175 μg, about 200 μg, about 250 μg, about 300 μg, about 350 μg, about 400 μg, about 450 μg, about 500 μg, about 600 μg, about 700 μg, about 800 μg, about 900 μg, about 1,000 μg, or more, and any number or range therebetween. In one embodiment, the nucleic acid molecule is an RNA molecule. In another embodiment, the nucleic acid molecule is a DNA molecule. The nucleic acid molecule may have a unit dosage containing about 0.01 μg to about 1,000 μg or more of nucleic acid in a single administration.
[0322] In some embodiments, the compositions provided herein that can be administered include about 0.01 μg, about 0.02 μg, about 0.03 μg, about 0.04 μg, about 0.05 μg, about 0.06 μg, about 0.07 μg, about 0.08 μg, about 0.09 μg, about 0.1 μg, about 0.2 μg, about 0.3 μg, about 0.4 μg, about 0.5 μg, about 0.6 μg, about 0.7 μg, about 0.8 μg, , about 0.9μg, about 1.0μg, about 1.5μg, about 2.0μg, about 2.5μg, about 3.0μg, about 3.5μg, about 4.0μg, about 4.5μg, about 5.0μg, about 5.5μg, about 6. 0μg, about 6.5μg, about 7.0μg, about 7.5μg, about 8.0μg, about 8.5μg, about 9.0μg, about 9.5μg, about 10μg, about 11μg, about 12μg, about 13μg, about 14μ g, about 15μg, about 16μg, about 17μg, about 18μg, about 19μg, about 20μg, about 21μg, about 22μg, about 23μg, about 24μg, about 25μg, about 26μg, about 27μg, about 28μg, about 29μg, about 30μg, about 35μg, about 40μg, about 45μg, about 50μg, about 55μg, about 60μg, about 65μg, about 70μg, about 75μg, about 80μg, about 85μ g, about 90 μg, about 95 μg, about 100 μg, about 125 μg, about 150 μg, about 175 μg, about 200 μg, about 250 μg, about 300 μg, about 350 μg, about 400 μg, about 450 μg, about 500 μg, about 600 μg, about 700 μg, about 800 μg, about 900 μg, about 1,000 μg or more, and any number or range therebetween of nucleic acid and lipid.In other aspects, the pharmaceutical compositions provided herein that can be administered include about 0.01 μg, about 0.02 μg, about 0.03 μg, about 0.04 μg, about 0.05 μg, about 0.06 μg, about 0.07 μg, about 0.08 μg, about 0.09 μg, about 0.1 μg, about 0.2 μg, about 0.3 μg, about 0.4 μg, about 0.5 μg, about 0.6 μg, about 0.7 μg, about 0.8 μg, Approximately 0.9μg, approximately 1.0μg, approximately 1.5μg, approximately 2.0μg, approximately 2.5μg, approximately 3.0μg, approximately 3.5μg, approximately 4.0μg, approximately 4.5μg, approximately 5.0μg, approximately 5.5μg, approximately 6.0 μg, approximately 6.5 μg, approximately 7.0 μg, approximately 7.5 μg, approximately 8.0 μg, approximately 8.5 μg, approximately 9.0 μg, approximately 9.5 μg, approximately 10 μg, approximately 11 μg, approximately 12 μg, approximately 13 μg, approximately 14 μg, Approximately 15μg, approximately 16μg, approximately 17μg, approximately 18μg, approximately 19μg, approximately 20μg, approximately 21μg, approximately 22μg, approximately 23μg, approximately 24μg, approximately 25μg, approximately 26μg, approximately 27μg, approximately 28 μg, approximately 29 μg, approximately 30 μg, approximately 35 μg, approximately 40 μg, approximately 45 μg, approximately 50 μg, approximately 55 μg, approximately 60 μg, approximately 65 μg, approximately 70 μg, approximately 75 μg, approximately 80 μg, approximately 85 μg, About 90 μg, about 95 μg, about 100 μg, about 125 μg, about 150 μg, about 175 μg, about 200 μg, about 250 μg, about 300 μg, about 350 μg, about 400 μg, about 450 μg, about 500 μg, about 600 μg, about 700 μg, about 800 μg, about 900 μg, about 1,000 μg or more, and any number or range therebetween of nucleic acid and lipid formulations.
[0323] In one aspect, the compositions provided herein may have a unit dosage of about 0.01 μg to about 1,000 μg or more of nucleic acid and lipid in a single dose. In another aspect, the pharmaceutical compositions provided herein may have a unit dosage of about 0.01 μg to about 1,000 μg or more of nucleic acid and lipid formulation in a single dose. The unit dosage of the vaccine may correspond to a unit dosage of a nucleic acid molecule, composition, or pharmaceutical composition provided herein that can be administered to a subject. In one aspect, the vaccine composition of the present disclosure has a unit dosage of about 0.01 μg to about 1,000 μg or more of nucleic acid and lipid formulation in a single dose. In another aspect, the vaccine composition of the present disclosure has a unit dosage of about 0.01 μg to about 50 μg of nucleic acid and lipid formulation in a single dose. In yet another aspect, the vaccine composition of the present disclosure has a unit dosage of about 0.2 μg to about 20 μg of nucleic acid and lipid formulation in a single dose.
[0324] The dosage form of the compositions of the present disclosure may be a solid, which can be reconstituted with a liquid prior to administration. A solid may be administered as a powder. A solid may take the form of a capsule, tablet, or gel. In some embodiments, the pharmaceutical composition comprises a nucleic acid-lipid formulation that is lyophilized. In some embodiments, the lyophilized composition may comprise one or more lyoprotectants, including, for example, but not necessarily limited to, glucose, trehalose, sucrose, maltose, lactose, mannitol, inositol, hydroxypropyl-β-cyclodextrin, and / or polyethylene glycol. In some embodiments, the lyophilized composition comprises a poloxamer, potassium sorbate, sucrose, or any combination thereof. In certain embodiments, the poloxamer is poloxamer 188. In some embodiments, the lyophilized compositions described herein may comprise about 0.01 to about 1.0% w / w of a poloxamer. In some embodiments, the lyophilized compositions described herein may comprise about 1.0 to about 5.0% w / w of potassium sorbate. The percentage may be any value or subvalue within the recited range, including the endpoints.
[0325] In some embodiments, the lyophilized composition may comprise about 0.01 to about 1.0% w / w nucleic acid molecule. In some embodiments, the composition may comprise about 1.0 to about 5.0% w / w lipid. In some embodiments, the composition may comprise about 0.5 to about 2.5% w / w TRIS buffer. In some embodiments, the composition may comprise about 0.75 to about 2.75% w / w NaCl. In some embodiments, the composition may comprise about 85 to about 95% w / w sugar. The percentages may be any value or subvalue within the recited range, including the endpoints.
[0326] In a preferred embodiment, the dosage form of the pharmaceutical composition described herein may be a liquid suspension of the RNA lipid nanoparticles described herein. In some embodiments, the RNA of the RNA lipid nanoparticles is a self-replicating RNA. In some embodiments, the RNA of the RNA lipid nanoparticles is an mRNA. In some embodiments, the liquid suspension is a suspension in a buffer solution. In some embodiments, the buffer solution comprises a buffer selected from the group consisting of HEPES, MOPS, TES, and TRIS. In some embodiments, the buffer has a pH of about 7.4. In some preferred embodiments, the buffer is HEPES. In some further embodiments, the buffer solution further comprises a cryoprotectant. In some embodiments, the cryoprotectant is selected from a combination of a sugar and glycerol, or a sugar and glycerol. In some embodiments, the sugar is a dimeric sugar. In some embodiments, the sugar is sucrose. In some preferred embodiments, the buffer comprises HEPES, sucrose, and glycerol at a pH of 7.4. In certain embodiments, the composition comprises a HEPES, MOPS, TES, or TRIS buffer at a pH of about 7.0 to about 8.5. In some embodiments, the HEPES, MOPS, TES, or TRIS buffer may be at a concentration ranging from 7 mg / ml to about 15 mg / ml. The pH or concentration may be any value or subvalue within the recited range, including the endpoints.
[0327] In some embodiments, the suspension is frozen during storage and thawed prior to administration. In some embodiments, the suspension is frozen at a temperature below about 70° C. In some embodiments, the suspension is diluted with sterile water during intravenous administration. In some embodiments, intravenous administration comprises diluting the suspension with about 2 volumes to about 6 volumes of sterile water. In some embodiments, the suspension comprises about 0.1 mg to about 3.0 mg RNA / mL, about 15 mg / mL to about 25 mg / mL ionizable cationic lipid, about 0.5 mg / mL to about 2.5 mg / mL PEG lipid, about 1.8 mg / mL to about 3.5 mg / mL helper lipid, about 4.5 mg / mL to about 7.5 mg / mL cholesterol, about 7 mg / mL to about 15 mg / mL buffer, about 2.0 mg / mL to about 4.0 mg / mL NaCl, about 70 mg / mL to about 110 mg / mL sucrose, and about 50 mg / mL to about 70 mg / mL glycerol. In some embodiments, the lyophilized RNA-lipid nanoparticle formulation can be resuspended in a buffer, as described herein.
[0328] In some embodiments, the subject is administered a composition of the present disclosure such that an RNA concentration of at least about 0.05 mg / kg, at least about 0.1 mg / kg, at least about 0.5 mg / kg, at least about 1.0 mg / kg, at least about 2.0 mg / kg, at least about 3.0 mg / kg, at least about 4.0 mg / kg, or at least about 5.0 mg / kg of body weight is administered in a single dose or as part of a single treatment cycle. In some embodiments, a total amount of at least about 0.1 mg, at least about 0.5 mg, at least about 1.0 mg, at least about 2.0 mg, at least about 3.0 mg, at least about 4.0 mg, at least about 5.0 mg, at least about 6.0 mg, at least about 7.0 mg, at least about 8.0 mg, at least about 9.0 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 70 mg, at least about 80 mg, at least about 90 mg, at least about 100 mg, at least about 150 mg, at least about 200 mg, at least about 250 mg, at least about 300 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 70 mg, at least about 80 mg, at least about 90 mg, at least about 100 mg, at least about 150 mg, at least about 100 mg, at least about 150 mg, at least about 200 mg, at least about The compositions of the present disclosure are administered to a subject such that at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 110 mg, at least about 115 mg, at least about 120 mg, or at least about 125 mg of RNA is administered in one or more doses, up to a maximum dose of about 300 mg, about 350 mg, about 400 mg, about 450 mg, or about 500 mg of RNA.
[0329] Any route of administration may be included in the methods provided herein. In some aspects, the nucleic acid molecules, i.e., RNA or DNA molecules, compositions, and pharmaceutical compositions provided herein are administered, for example, intramuscularly, subcutaneously, intradermally, transdermally, intranasally, orally, sublingually, intravenously, intraperitoneally, topically, by aerosol, or by pulmonary routes such as inhalation or spray. In some embodiments, the described pharmaceutical compositions are administered systemically. Suitable routes of administration include, for example, oral, rectal, vaginal, transmucosal, intratracheal or pulmonary, including inhalation, or intestinal administration; intradermal, transdermal (topical), intramuscular, subcutaneous, intramedullary injection, and parenteral delivery, including intrathecal, direct intraventricular, intravenous, intraperitoneal, or intranasal. In certain embodiments, the intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, the pharmaceutical composition is administered intravenously.
[0330] Pharmaceutical composition can be administered to any desired tissue.In some embodiments, the RNA delivered is expressed in tissue different from the tissue that lipid formulation or pharmaceutical composition is administered to.In a preferred embodiment, RNA is delivered and expressed in liver.
[0331] In other aspects, the nucleic acid molecules, ie, RNA or DNA molecules, compositions, and pharmaceutical compositions provided herein are administered intramuscularly.
[0332] In some embodiments, the subject to which the immune response is elicited is a healthy subject. As used herein, the term "healthy subject" refers to a subject that does not have a pathology or disease, including, for example, infectious disease or cancer, or does not have a pathology or disease that elicits an immune response. Thus, in some embodiments, the nucleic acid molecule, composition, or pharmaceutical composition provided herein is administered prophylactically, for example, to prevent infectious disease. The nucleic acid molecule, composition, or pharmaceutical composition provided herein can also be administered therapeutically, i.e., to treat a pathology or disease, for example, infectious disease, after the onset of the pathology or disease.
[0333] As used herein, the terms "treat", "treatment", "therapy", "therapeutic" and the like refer to obtaining a desired pharmacological and / or physiological effect, including, but not limited to, alleviating a disease or disorder, delaying or slowing its progression, reducing its effects or symptoms, preventing its onset, inhibiting its onset, remission, obtaining a beneficial or desired result with respect to a disease, disorder, or condition, e.g., a therapeutic effect and / or a prophylactic effect. As used herein, "treatment" includes any treatment of a disease in a mammal, particularly a human; including (a) preventing the disease from developing in a subject, including a subject susceptible to or at risk of having a disease, but not yet diagnosed as having the disease, (b) inhibiting the disease, i.e., preventing its onset, and (c) relieving the disease, i.e., causing regression of the disease. A therapeutic effect includes eradication or amelioration of the underlying disease being treated. The therapeutic effect is also achieved by eradicating or improving one or more of the physiological symptoms associated with the underlying disease, such that an improvement is observed in the subject, even though the subject may still be suffering from the underlying disease. In some embodiments, for preventative benefit, the administration of a treatment or a therapeutic composition, including a pharmaceutical composition, is performed on a subject who is at risk of developing a particular disease or who reports one or more of the physiological symptoms of the disease, even if the disease has not been diagnosed. The method of the present disclosure may be used on any mammal or other animal. In some embodiments, the treatment results in a reduction or cessation of symptoms. The preventative effect includes delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, stopping, or reversing the progression of a disease or condition, or any combination thereof.
[0334] The nucleic acid molecules, i.e., RNA or DNA molecules, compositions, and pharmaceutical compositions provided herein can be administered one or more times. Thus, the nucleic acid molecules, compositions, and pharmaceutical compositions provided herein can be administered one, two, three, four, five, six, seven, eight, nine, ten, or more times. The timing between two or more administrations can be 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, 48 weeks, 49 weeks, 50 weeks, 51 weeks, 52 weeks, or more weeks, and any number or range therebetween. In some embodiments, the timing between two or more administrations is 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months, or more months, and any number or range therebetween. In other embodiments, the timing between two or more administrations can be 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more years, and any number or range therebetween, and the timing between the first administration and any subsequent administrations can be the same or different. In one embodiment, the nucleic acid molecule, composition, or pharmaceutical composition provided herein is administered once.
[0335] In the methods provided herein, multiple nucleic acid molecules, compositions, or pharmaceutical compositions can be administered. In one embodiment, two or more nucleic acid molecules, compositions, or pharmaceutical compositions provided herein are administered simultaneously. In another embodiment, two or more nucleic acid molecules, compositions, or pharmaceutical compositions provided herein are administered sequentially. Simultaneous and sequential administration can include any number and combination of nucleic acid molecules, compositions, or pharmaceutical compositions provided herein. Multiple nucleic acid molecules, compositions, or pharmaceutical compositions administered simultaneously or sequentially can include transgenes encoding different antigenic proteins or fragments thereof. In this way, immune responses against different antigenic targets can be elicited. Two, three, four, five, six, seven, eight, nine, ten, or more nucleic acid molecules, compositions, or pharmaceutical compositions (including transgenes encoding different antigenic proteins or fragments thereof) can be administered simultaneously or sequentially. Any combination of nucleic acid molecules, compositions, and pharmaceutical compositions, including any combination of transgenes, can be administered simultaneously or sequentially. In some embodiments, administration is simultaneous administration. In other embodiments, administration is sequential administration. The timing between two or more administrations can be 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, 48 weeks, 49 weeks, 50 weeks, 51 weeks, 52 weeks, or more weeks, and any number or range therebetween. In some embodiments, the timing between two or more administrations is 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months or more, and any number or range therebetween.In other embodiments, the timing between two or more administrations can be 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more, and any number or range therebetween, and the timing between the first administration and any subsequent administrations can be the same or different. The nucleic acid molecules, compositions, and pharmaceutical compositions provided herein can be administered with any other vaccine or treatment.
[0336] Following administration of the composition to a subject, the protein product (e.g., antigen) encoded by the RNA of the present disclosure is detectable in the target tissue for at least about 1-7 days or more. The amount of protein product required to achieve a therapeutic effect will vary depending on the antibody titer required to generate immunity to a pathogen or disease, such as COVID-19, in the patient. For example, the protein product may be at least about 0.025-1.5 μg / ml (e.g., at least about 0.050 μg / ml, at least about 0.075 μg / ml, at least about 0.1 μg / ml, at least about 0.2 μg / ml, at least about 0.4 μg / ml, at least about 0.6 μg / ml, at least about 0.8 μg / ml, at least about 0.9 μg / ml, at least about 10 μg / ml, at least about 15 μg / ml, at least about 16 μg / ml, at least about 17 μg / ml, at least about 18 μg / ml, at least about 19 μg / ml, at least about 20 μg / ml, at least about 21 μg / ml, at least about 22 μg / ml, at least about 23 μg / ml, at least about 24 μg / ml, at least about 25 μg / ml, at least about 26 μg / ml, at least about 27 μg / ml, at least about 28 μg / ml, at least about 29 μg / ml, at least about 30 μg / ml, at least about 35 μg / ml, at least about 36 μg / ml, at least about 37 μg / ml, at least about 38 μg / ml, at least about 39 μg / ml, at least about 40 μg / ml, at least about 40 μg / ml, at least about 45 days or more after administration of the composition to the subject. In some embodiments, the therapeutic concentration may be at least about 3 μg / ml, at least about 0.4 μg / ml, at least about 0.5 μg / ml, at least about 0.6 μg / ml, at least about 0.7 μg / ml, at least about 0.8 μg / ml, at least about 0.9 μg / ml, at least about 1.0 μg / ml, at least about 1.1 μg / ml, at least about 1.2 μg / ml, at least about 1.3 μg / ml, at least about 1.4 μg / ml, or at least about 1.5 μg / ml).
[0337] In some embodiments, the compositions described herein may be administered once. In some embodiments, the compositions described herein may be administered twice.
[0338] In some embodiments, the composition may be administered in the form of a booster dose to a subject who has previously been vaccinated against a coronavirus.
[0339] In some embodiments, the pharmaceutical composition of the present disclosure is administered to the subject once a month. In some embodiments, the pharmaceutical composition of the present disclosure is administered to the subject twice a month. In some embodiments, the pharmaceutical composition of the present disclosure is administered to the subject three times a month. In some embodiments, the pharmaceutical composition of the present disclosure is administered to the subject four times a month.
[0340] Alternatively, the compositions of the present disclosure may be administered locally, rather than systemically, preferably in a depot or sustained release formulation, for example, by injecting the pharmaceutical composition directly into the target tissue. Local delivery may be performed in a variety of ways, depending on the tissue to be targeted. For example, an aerosol containing the compositions of the present disclosure may be inhaled (for nasal, tracheal, or bronchial delivery); the compositions of the present disclosure may be injected, for example, at the site of injury, the site of disease appearance, or the site of pain; the compositions may be provided in a lozenge for oral, tracheal, or esophageal application; they may be provided in the form of a liquid, tablet, or capsule for administration to the stomach or intestines, or in the form of a suppository for rectal or vaginal application; or may be delivered to the eye using a cream, drop, or even an injection. Formulations containing the compositions of the present disclosure complexed with therapeutic molecules or ligands may be further administered surgically, for example, in combination with a polymer or other structure or material that can allow the composition to diffuse from the implantation site to surrounding cells. Alternatively, they may be applied surgically without the use of a polymer or support.
[0341] combination The RNA, e.g., self-replicating RNA or mRNA, formulations thereof, or encoded proteins described herein may be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. "In combination with" is not intended to mean that the agents must be administered simultaneously and / or formulated for delivery together, although these delivery methods are within the scope of the present disclosure. The compositions may be administered simultaneously with, prior to, or after one or more other desired therapeutics or medical procedures. Generally, each agent will be administered at a dose and / or time schedule determined for that agent. Preferably, the treatment methods of the present disclosure include delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions in combination with agents that may improve their bioavailability, reduce and / or alter metabolism, inhibit excretion, and / or alter biodistribution. As a non-limiting example, the RNA molecules of the present disclosure may be used in combination with pharmaceutical agents to immunize or vaccinate a subject. In general, agents utilized in combination with the RNA molecules and formulations thereof disclosed herein are expected to be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels when utilized in combination will be lower than the levels when utilized individually, hi one embodiment, the combinations may be administered according to split dosing schedules known in the art, either individually or together.
[0342] range Throughout this disclosure, various aspects may be presented in a range format. It should be understood that any description of a range format is merely for convenience and brevity, and is not intended to be limiting. Thus, the description of a range should be considered to specifically disclose all possible subranges and individual numerical values within that range. For example, the description of a range such as 1-6 should be considered to specifically disclose subranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, and individual numerical values within that range, such as 1, 2, 2.1, 2.2, 2.5, 3, 4, 4.75, 4.8, 4.85, 4.95, 5, 5.5, 5.75, 5.9, 5.00, and 6. This applies to any width range. EXAMPLES
[0343] Example 1 This example describes the design and construction of a SARS-CoV-2 RNA vaccine.
[0344] A self-replicating RNA vaccine encoding a SARS-CoV-2 spike glycoprotein variant was designed and constructed. Figure 1 shows a schematic diagram of an exemplary self-replicating RNA (not to scale) of approximately 11,860 kb. The self-replicating RNA vaccine designed for the studies described herein is a single-stranded molecule that typically contains a 5' cap, a 5' untranslated region (UTR), an open reading frame encoding a replicase polyprotein from Venezuelan equine encephalitis virus (VEEV) including nsP1, nsP2, nsP3, and nsP4 proteins, a transgene 5' UTR located in an intergenic region that contains a portion of the subgenomic promoter sequence in the negative orientation, a transgene open reading frame encoding the primary structure of the antigen protein, a 3' UTR, and a polyA tail. The relative positions of the replicase polyprotein and the transgene, e.g., the open reading frame encoding the SARS-CoV-2 spike glycoprotein, are shown (Figure 1A). The SARS-CoV-2 spike glycoprotein is divided into two domains, namely, S1 and S2. The ACE2 receptor binding domain is located within the S1 domain. The S2 domain includes the intracellular fusion domain, the transmembrane domain, and the cytoplasmic domain. Self-replicating RNA vaccines are generally made from natural unmodified RNA bases: adenine, guanine, cytosine, and uracil. The 5' cap of the self-replicating RNA vaccines designed as described herein usually has the Cap1 structure (CAP1, m7G(5')pppA(2'-OMe)pU, where U in RNA is represented as T in DNA and vice versa).
[0345] To address the continuing threat posed by the emergence of variant strains of SARS-CoV-2, we designed a self-replicating RNA vaccine that targets the D614G and South African (D614G, D80A, D215G, N501Y, K417N, E484K, A701V point mutations) variants and is suitable for delivery using lipid nanoparticles (LNPs). In addition to these point mutations in the spike protein, the sequence encoding the SARS-CoV-2 glycoprotein transgene contains codon changes resulting in prolines at positions 986 and 987 (K986P and V987P mutations), stabilizing the SARS-CoV-2 glycoprotein in the prefusion conformation and increasing the immunogenicity of the S1 receptor binding domain (Baden, et al., 2021, N Engl J Med 384:403-416 & Polack, et al., 2020, N Engl J Med 383:2603-2615; Keech, et al., 2020, N Engl J Med,383:2320-2332). The furin cleavage site of the SARS-CoV-2 glycoprotein was inactivated by including the R682G, R683S, and R685S mutations, thereby changing the RRAR motif at the S1 / S2 cleavage junction to GSAS (Wrapp, et al. 2020, Science, 367:1260-1263). The RRAR motif can also be changed to RRAG or GRAR to inactivate furin cleavage. The transgene sequences encoding variant SARS-CoV-2 spike glycoproteins that were included in the self-replicating RNA vaccine were as follows: SEQ ID NO:10 encoding South African variant B.1.351 (beta); SEQ ID NO:11 encoding SARS-CoV-2 spike glycoprotein (B.1) with a D614G mutation; SEQ ID NO:12 encoding UK variant B.1.1.7 (alpha); SEQ ID NO:13 encoding Brazilian variant P1 (gamma).
[0346] The self-replicating RNA vaccine contained codon-optimized nsP1, nsP2, nsP3, and nsP4 (i.e., replicase), as well as codon-optimized transgene sequences. The codon-optimized replicase and transgene sequences were included in the self-replicating RNA vaccine to increase the amount and duration of SARS-CoV-2 glycoprotein expression by increasing translation without altering the encoded amino acid sequence. For example, the input sequence of SEQ ID NO:20 (nucleotides 463-7455) yielded the sequence of SEQ ID NO:6 using the hCAI algorithm, which generated an intermediate sequence of SEQ ID NO:185. The luciferase open reading frame (ORF) was used to generate the self-replicating RNA sequence of SEQ ID NO:186, after which the T7 promoter and BspQ1 restriction enzyme site sequences were deleted. Table 6 summarizes the steps and parameters of the codon optimization. [Table 6-1] [Table 6-2]
[0347] The miRanda algorithm (Enright, AJ, John, B., Gaul, U. et al. MicroRNA targets in Drosophila. Genome Biol 5, R1 (2003). doi.org / 10.1186 / gb-2003-5-1-r1) was then used to identify putative microRNA (miRNA) binding sites within the VEEV nonstructural protein coding region (Figure 1B, Table 6). The sequences of the miRNA binding sites in skeletal muscle and dendritic cells corresponding to SEQ ID NOs: 54-184 were input into miRanda to identify putative miRNA binding sites in the self-replicating RNA target sequence, including the codon-optimized nsP1, nsP2, nsP3, and nsP4 (i.e., replicase) sequences and the luciferase transgene (SEQ ID NO: 186). Fifteen putative miRNA binding sites representing targets of miRNAs in mouse and human dendritic cells and mouse and human skeletal muscle were identified (Figure 1B, Table 6).
[0348] Exemplary miRNA binding sites within the VEEV nsP1, nsP2, nsP3, and nsP4 regions identified using miRanda are shown in Table 7. The relative positions of the putative miRNA binding sites are shown along with the nucleotide numbering of nsP1, nsP2, nsP3, and nsP4 (which serves as a reference). [Table 7-1] [Table 7-2]
[0349] For the identified seed sequences of putative miRNA target sites, synonymous codons were manually mutated in silico to remove or reduce miRNA binding. Removal of miRNA binding sites was confirmed using miRanda. Without being limited by theory, mutation of miRNA binding sites to remove or reduce miRNA binding based on predictions using miRanda should result in increased expression of sequences encoding VEEV nonstructural proteins. Codon-optimized sequences encoding the SARS-CoV-2 spike glycoprotein and its variants were introduced into a self-replicating RNA scaffold with codon-optimized nsP1-4 sequences and mutated miRNA binding sites.
[0350] Exemplary mutations in putative miRNA binding sites in the nsP1-nsP4 coding regions of self-replicating RNAs are summarized in Table 8. Mutations that occurred in 15 putative miRNA binding sites identified in the VEEV nsP1, nsP2, nsP3, and nsP4 regions are shown. The relative positions of the putative miRNA binding sites are shown with the nucleotide numbering of nsP1, nsP2, nsP3, and nsP4 (which serves as a reference), and point mutations are shown below the putative miRNA and their positions in bold italics. [Table 8-1] [Table 8-2]
[0351] Exemplary characteristics of self-replicating RNA vaccines are summarized in Table 9. [Table 9]
[0352] Table 10 summarizes the characteristics of the self-replicating RNA constructs encoding the SARS-CoV-2 South African and D614G spike glycoprotein variants. [Table 10-1] [Table 10-2]
[0353] In addition to the self-replicating RNA vaccines encoding the SARS-CoV-2 South African and D614G spike glycoprotein variants (e.g., SEQ ID NO:1 and SEQ ID NO:2, respectively, for full-length self-replicating RNA sequences; U in RNA is represented as T in DNA and vice versa), we have designed self-replicating RNA vaccines encoding the SARS-CoV-2 UK B.1.1.7 and Brazil P.1 spike glycoprotein variants (SEQ ID NO:3 and SEQ ID NO:4, respectively, for full-length self-replicating RNA sequences; U in RNA is represented as T in DNA and vice versa). In addition to the sequences of the full-length constructs, the sequences of construct features such as 5'UTR, 3'UTR, and transgene sequences are provided below.
[0354] Messenger RNA (mRNA) vaccines have also been designed that encode antigenic proteins, such as the SARS-CoV-2 spike glycoprotein or another viral glycoprotein. mRNA vaccines typically include a 5'UTR, an open reading frame encoding the antigenic protein, a 3'UTR, and a polyA tail. Other sequence elements of mRNA vaccines typically include Kozak sequences and translational enhancers located in the untranslated region, 5'UTR, 3'UTR, or both.
[0355] We designed and constructed mRNA vaccines encoding the SARS-CoV-2 South African and D614G spike glycoprotein variants (SEQ ID NO:29 and SEQ ID NO:32 for full-length mRNA sequences, respectively. U in RNA is shown as T in DNA and vice versa). The mRNA constructs included the 5' TEV UTR (SEQ ID NO:35) and the 3' Xenopus beta globin (Xbg) UTR (SEQ ID NO:36 (with polyA tail); SEQ ID NO:37 (without polyA tail)).
[0356] Self-replicating RNA and mRNA vaccines encoding any SARS-CoV-2 spike glycoprotein variant, any SARS-CoV-2 spike glycoprotein with any mutation or combination of mutations, or any other viral glycoprotein can be designed and constructed similarly to the constructs described above. SARS-CoV-2 spike glycoprotein variants, any SARS-CoV-2 spike glycoprotein with any mutation or combination of mutations, or any other viral glycoprotein can be included in self-replicating RNA and mRNA vaccines with a backbone containing any combination of the above features. Exemplary SARS-CoV-2 spike glycoprotein variants and SARS-CoV-2 spike glycoprotein mutations that can be encoded are shown in Table 11. Additional SARS-CoV-2 spike glycoprotein variants are described, for example, at outbreak.info / situation-reports. Exemplary RNA molecules encoding influenza virus hemagglutinin (HA) were designed and prepared, including a self-replicating RNA having the sequence of SEQ ID NO: 40 and an mRNA having the sequence of SEQ ID NO: 48. [Table 11]
[0357] Example 2 This example describes the expression and efficacy of SARS-CoV-2 RNA vaccine constructs.
[0358] Initial experiments were performed to establish assay conditions for measuring protein expression from SARS-CoV-2 RNA vaccine constructs. Hep3b cells were transfected with 125 ng, 62.5 ng, or 31.25 ng of self-replicating RNA encoding the SARS-CoV-2 Wuhan spike glycoprotein (mARM3015, SEQ ID NO: 18) or the SARS-CoV-2 D614G spike glycoprotein variant (mARM3280; SEQ ID NO: 2) (Figure 2A). Throughout this disclosure, RNAs designated with a ".1" suffix are designated N 1 RNAs synthesized in the presence of -methylpseudouridine (N1MPU) were N1MPU with 100% of the uridines, whereas RNAs designated with a ".5" suffix contained no modified nucleotides unless otherwise noted. Cells were harvested by scraping into a buffer containing 10 mM PBS and 50 mM EDTA or by trypsinization. Total protein was isolated and protein concentrations were measured in duplicate by BCA assay with comparable results in duplicate. Proteins were separated by polyacrylamide gel electrophoresis and transferred to membranes for Western blotting with an antibody detecting the SARS-CoV-2 spike glycoprotein at 45 V for 1.5 h.
[0359] Total protein was comparable for cells transfected with SARS-CoV-2 vaccine constructs encoding either the SARS-CoV-2 Wuhan spike glycoprotein or the SARS-CoV-2 D614G spike glycoprotein variant. For cells harvested with or without trypsinization, a similar banding pattern was observed for the self-replicating RNA vaccine construct expressing the SARS-CoV-2 Wuhan spike glycoprotein, with bands corresponding to the full-length spike and the S1 and S2 domains (Figure 2A, arrows). In contrast, for the SARS-CoV-2 D614G spike glycoprotein variant, bands corresponding to S1 and S2 were observed for protein extracts prepared from cells harvested by trypsinization, but this band was not observed in protein extracts prepared from cells that were not treated with trypsin (Figure 2A). Without being limited by theory, these results indicate that cell recovery by trypsin treatment may alter the banding pattern observed in the SARS-CoV-2 D614G spike glycoprotein variant, but trypsin treatment has no detectable effect on the SARS-CoV-2 Wuhan spike glycoprotein. Unlike the SARS-CoV-2 D614G spike glycoprotein variant expressed from the self-replicating RNA construct of SEQ ID NO:2, the SARS-CoV-2 Wuhan spike glycoprotein expressed from the self-replicating RNA construct of SEQ ID NO:18 did not contain the two proline modifications and inactivated furin cleavage site that stabilize the spike glycoprotein in the prefusion conformation (described in Example 1 above). Without being limited by theory, these differences may contribute to trypsin sensitivity in addition to the variant-specific point mutations.
[0360] Figure 2B shows quantification of SARS-CoV-2 spike protein expressed from the indicated constructs based on the S1 signal using protein extracts prepared from cells transfected as above and harvested without trypsinization. Comparable levels of SARS-CoV-2 spike protein were observed for constructs expressing the SARS-CoV-2 Wuhan glycoprotein or the D614G spike glycoprotein variant.
[0361] We next investigated the efficacy of self-replicating RNA vaccine constructs encoding the SARS-CoV-2 D614 (mARM3280; SEQ ID NO:2) or South African (mARM3326; SEQ ID NO:1) variant spike glycoproteins. An mRNA construct encoding the SARS-CoV-2 D614 variant spike glycoprotein (mARM3290; SEQ ID NO:32) was also included in these studies (Figure 3A-C). 700,000 Hep3B cells were seeded in 6-well plates the day before transfection and then transfected in quadruplicate with 31.3 ng, 62.5 ng, or 125 ng of self-replicating RNA or mRNA. The day after transfection, cells were treated with EDTA, scraped, and subsequently sonicated to lyse the cells in the absence of trypsin. Lysates were treated with PNGase and S1 and S2 protein levels were measured by Western blot using anti-S1 rabbit polyclonal antibody (Sino Biological, 40150-T62-COV2). Western blot results for the indicated constructs are shown in Figure 3A-C, with the full-length spike glycoprotein indicated by the arrow. Figure 3D shows quantification of SARS-CoV-2 spike glycoprotein expression (y-axis) detected from the indicated constructs as a function of the amount of RNA transfected (x-axis). Data analysis of cell-based potency for quadruplicate replicates is shown in Table 12 and is expressed as relative potency compared to a reference representing a previously characterized construct. [Table 12]
[0362] The results of analyses comparing the signal obtained (y-axis) for the indicated constructs, as a function of the amount of RNA transfected (x-axis), for the reference, i.e., internally characterized constructs, and the samples are shown in Figures 4A-C, with the data shown in Tables 13-15. [Table 13] [Table 14] [Table 15]
[0363] These results demonstrate efficient expression and efficacy for self-replicating RNA and mRNA constructs encoding SARS-CoV-2 spike glycoprotein variants.
[0364] Example 3 This example describes the immunogenicity of an RNA vaccine encoding a SARS-CoV-2 spike glycoprotein variant in mice.
[0365] To determine the immunogenicity of RNA constructs encoding SARS-CoV-2 spike glycoprotein variants, Balb / C female mice were administered the indicated RNAs as shown in Table 16. [Table 16]
[0366] Serum was collected on day 0 (before blood collection) and days 14, 28, 42, and 56 after the first immunization. Serum was simultaneously probed for responses to four SARS-CoV-2 spike glycoprotein variants: SARS-CoV-2 spike (Wuhan, wild type), SARS-CoV-2 spike (P.1, Brazil, gamma), SARS-CoV-2 spike (B.1.351, South Africa, beta), and SARS-CoV-2 spike (B.1.1.7, UK, alpha). MSD's V-PLEX SARS-CoV-2 Panel 5 IgG and ACE2 kits (catalog numbers K15429U and K15432U) were used to measure serum IgG antibody levels. For total IgG binding, serum was diluted 1:10,000 in Kit Dilution100 buffer (MSD, catalog number R50AA). A goat anti-mouse IgG antibody (MSD, Cat. No. R32AC) was used for signal detection. Results were reported as AU / ml using a human serum-based reference standard. For the surrogate virus neutralization test (sVNT) assay, serum was diluted 1:200 in kit Dilution100 buffer (MSD, Cat. No. R50AA) and results were reported as percentage inhibition of ACE2 binding using the following formula: 1-(mean of sample signal / mean of signal with Diluent100 alone) x 100. An ACE2 calibration reagent (included in the MSD kit) showing 100% inhibition was used as a positive control.
[0367] Total IgG and neutralizing antibody results upon immunization with lipid-formulated self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO: 18; ARCT-021 / mARM3015.5), the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO: 2; ARCT-154 / mARM3280), or the SARS-CoV-2 South African variant glycoprotein (SEQ ID NO: 1; ARCT-165 / mARM3325) are shown in Figures 5A-F. Total IgG and neutralizing antibody results upon immunization with 2 μg or 15 μg lipid-formulated mRNA encoding the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO: 32; ARCT-143 / mARM3290) are shown in Figures 6A-D.
[0368] Immunization of mice with lipid-formulated self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO:18; ARCT-021 / mARM3015.5; Figures 5A-B), the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO:2; ARCT-154 / mARM3280; Figures 5C-D), or the SARS-CoV-2 South African variant spike glycoprotein (SEQ ID NO:1; ARCT-165 / mARM3325; Figures 5E-F) elicited SARS-CoV-2-specific IgG and neutralizing antibody responses against both wild-type and variant SARS-CoV-2 spike glycoproteins, including the Wuhan (wild-type), UK (B.1.1.7; alpha), Brazilian (P1; gamma), and South African (B.1.351; beta) variants. Compared to immunization with lipid-formulated self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO:18; ARCT-021 / mARM3015.5; Figures 5A-B), greater IgG and neutralizing antibody responses were observed against both the wild-type and variant SARS-CoV-2 spike glycoproteins upon immunization with lipid-formulated self-replicating RNA encoding the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO:2; ARCT-154 / mARM3280; Figures 5C-D) or the SARS-CoV-2 South African variant spike glycoprotein (SEQ ID NO:1; ARCT-165 / mARM3325; Figures 5E-F).
[0369] Immunization of mice with 2 μg or 15 μg of lipid-formulated mRNA encoding the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO: 32; ARCT-143 / mARM3290), which included a boost on day 28, also produced higher specific IgG levels against both the wild-type and the different variant SARS-CoV-2 spike glycoproteins compared to immunization with self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO: 18; ARCT-021 / mARM3015.5; Figure 5A; Figure 6A-B). Similarly, neutralizing antibody levels upon immunization with mRNA encoding the SARS-CoV-2 D614G spike glycoprotein were higher compared to neutralizing antibody levels observed upon immunization with self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (Figure 5B; Figure 6C-D).
[0370] These results demonstrate that immunization of mice with self-replicating RNA or mRNA encoding the SARS-CoV-2 variant D614G or variant South African spike glycoproteins elicits effective humoral immune responses, including neutralizing antibodies that were effective against wild-type and multiple SARS-CoV-2 variant glycoproteins. Example 4
[0371] This example describes the immunogenicity of RNA vaccines encoding SARS-CoV-2 spike glycoprotein variants in non-human primates (NHPs).
[0372] To determine the immunogenicity of RNA constructs encoding SARS-CoV-2 spike glycoprotein variants in NHPs, the indicated RNA constructs were administered as shown in Table 17. [Table 17]
[0373] Serum was collected on day 0 (before blood collection) and days 15, 29, and 43 after the first immunization. Serum was simultaneously probed for responses to four SARS-CoV-2 spike glycoprotein variants: SARS-CoV-2 spike (Wuhan, wild type), SARS-CoV-2 spike (P.1, Brazil, gamma), SARS-CoV-2 spike (B.1.351, South Africa, beta), and SARS-CoV-2 spike (B.1.1.7, UK, alpha). MSD's V-PLEX SARS-CoV-2 Panel 5 IgG and ACE2 kits (catalog numbers K15429U and K15432U) were used to measure serum IgG antibody levels. For total IgG binding, serum was diluted 1:1,000 in Kit Dilution100 buffer (MSD, catalog number R50AA). SULFO-TAG anti-human IgG antibody (included in the MSD kit catalog number K15429U) was used for signal detection. Results were reported as AU / ml using a human serum-based reference standard. For the sVNT assay, serum was diluted 1:100 or 1:200 in kit Dilution100 buffer (MSD, catalog number R50AA) and results were reported as percentage inhibition of ACE2 binding using the following formula: 1-(mean sample signal / mean signal with Diluent100 alone) x 100. ACE2 calibration reagent (included in the MSD kit) showing 100% inhibition was used as a positive control.
[0374] Total IgG and neutralizing antibody results upon immunization with lipid-formulated self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO: 18; ARCT-021 / mARM3015.5), the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO: 2; ARCT-154 / mARM3280), or the SARS-CoV-2 South African variant spike glycoprotein (SEQ ID NO: 1; ARCT-165 / mARM3325) are shown in Figures 7A-F. Total IgG and neutralizing antibody results upon immunization with lipid-formulated mRNA encoding the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO: 32; ARCT-143 / mARM3290) are shown in Figures 7G-H.
[0375] Immunization of NHPs with lipid-formulated self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO:18; ARCT-021 / mARM3015.5; Figures 7A-B), the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO:2; ARCT-154 / mARM3280; Figures 7C-D), or the SARS-CoV-2 South African variant spike glycoprotein (SEQ ID NO:1; ARCT-165 / mARM3325; Figures 7E-F) elicited SARS-CoV-2-specific IgG and neutralizing antibody responses against both wild-type and variant SARS-CoV-2 glycoproteins, including the Wuhan (wild-type), UK (B.1.1.7; alpha), Brazilian (P1; gamma), and South African (B.1.351; beta) variants. Greater IgG and neutralizing antibody responses were observed against both wild-type and variant SARS-CoV-2 glycoproteins upon immunization with lipid-formulated self-replicating RNA encoding the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO:2; ARCT-154 / mARM3280; Figures 7C-D) or the SARS-CoV-2 South African variant glycoprotein (SEQ ID NO:1; ARCT-165 / mARM3325; Figures 7E-F) compared with immunization with lipid-formulated self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO:18; ARCT-021 / mARM3015.5; Figures 7A-B).
[0376] Immunization of NHPs with lipid-formulated mRNA encoding the SARS-CoV-2 D614 variant spike glycoprotein (SEQ ID NO: 32; ARCT-143 / mARM3290) also resulted in higher specific IgG levels against both the wild-type and the different SARS-CoV-2 variant spike glycoproteins compared to immunization with self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (SEQ ID NO: 18; ARCT-021 / mARM3015.5 (Figure 7A; Figure 7G). Similarly, neutralizing antibody levels upon immunization with mRNA encoding the SARS-CoV-2 D614G spike glycoprotein were higher compared to neutralizing antibody levels observed upon immunization with self-replicating RNA encoding the wild-type (Wuhan) SARS-CoV-2 spike glycoprotein (Figure 7B; Figure 7H).
[0377] These results indicate that immunization of NHPs with self-replicating RNA or mRNA encoding the SARS-CoV-2 variant D614G or variant South African spike glycoproteins elicits effective humoral immune responses, including neutralizing antibodies that were effective against wild-type and multiple SARS-CoV-2 variant glycoproteins.
[0378] Example 5 This example describes the immunogenicity of influenza hemagglutinin (HA) expressed from self-replicating RNA or mRNA.
[0379] Self-replicating RNA and mRNA vaccine constructs were designed to encode the full-length hemagglutinin (HA) protein from influenza virus A / California / 07 / 2009 (H1N1) (HA amino acid sequences: SEQ ID NOs: 47 and 53 for the self-replicating RNA and mRNA, respectively; nucleic acid sequences: SEQ ID NOs: 46 and 52 for the self-replicating RNA and mRNA, respectively). As described above for Example 1, the mRNA vaccine constructs encoding HA included the tobacco etch virus (TEV) 5'UTR (SEQ ID NO: 49) and Xenopus beta globin (Xbg) 3'UTR (SEQ ID NO: 50 (without polyA tail); SEQ ID NO: 52 (with polyA tail)). Both self-replicating RNA (SEQ ID NO:40; total RNA mARM3124) and mRNA (SEQ ID NO:48; total RNA sequence mARM3038) vaccine constructs were encapsulated in the same lipid nanoparticle (LNP) composition containing four lipid excipients (ionizable cationic lipid, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and PEG2000-DMG) dispersed in HEPES buffer (pH 8.0) containing sodium chloride and the cryoprotectants sucrose and glycerol. The N:P ratio of the lipid and RNA complexes was approximately 9:1. The ionizable cationic lipid had the following structure: [ka]
[0380] Five 8- to 10-week-old female Balb / c mice were injected intramuscularly with 2 μg of mRNA or self-replicating RNA encoding HA. Mice were bled on days 14, 28, 42, and 56, and serially diluted sera were subsequently used to perform hemagglutination inhibition (HAI) assays. The reciprocal of the highest dilution of serum that caused inhibition of hemagglutination was considered the HAI titer; a titer of 1 / 40 is protective against influenza virus infection, and a titer 4-fold higher than baseline indicates seroconversion.
[0381] The results in Figure 8 show that self-replicating RNA and mRNA encoding HA conferred protective HAI titers. The HAI titers of the self-replicating RNA construct encoding HA were higher than those of the mRNA encoding HA at all time points. Furthermore, the self-replicating RNA construct encoding HA conferred protective HAI titers beginning at day 14 and maintained them through at least day 56. The mRNA encoding HA conferred protective HAI titers on day 56.
[0382] These results show that both self-replicating RNA and HA-encoding mRNA constructs induced protective HA antibody titers, and that self-replicating RNA induced protective HAI titers earlier after immunization compared with mRNA.
[0383] Example 6 Freeze-drying of self-replicating RNA-lipid nanoparticle formulation materials and methods in general The process carried out in this example was carried out using lipid nanoparticle compositions produced according to known processes, such as those described in U.S. Patent Application No. 16 / 823,212, the contents of which are incorporated by reference for the specific purpose of teaching lipid nanoparticle production processes. The lipid nanoparticle compositions and the lyophilized products were characterized for several properties. This example provides materials and methods for these characterization processes, as well as the general method of producing the lipid nanoparticle compositions used in the lyophilization experiments.
[0384] Production of lipid nanoparticles The lipid nanoparticle formulation used in this example was prepared by mixing lipids (ionizable cationic lipid (ATX-126):helper lipid:cholesterol:PEG-lipid) in ethanol with RNA dissolved in citrate buffer. The mixed material was immediately diluted with phosphate buffer. Ethanol was removed by dialysis against phosphate buffer using a regenerated cellulose membrane (MWCO of 100 kD) or by tangential flow filtration (TFF) using a modified polyethersulfone (mPES) hollow fiber membrane (MWCO of 100 kD). Once the ethanol was completely removed, the buffer was replaced with HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer (pH 7.3) containing 10-300 (e.g., 40-60) mM NaCl and 5-15% sucrose. The formulation was concentrated and then filtered at 0.2 μm using a PES filter. The RNA concentration in the formulations was then measured by RiboGreen fluorescence assay and the concentration was adjusted to the desired final concentration by dilution with HEPES buffer (pH 7.2-8.5) containing 10-100 (e.g., 40-60) mM NaCl, 0-15% sucrose containing glycerol. The final formulations were then filtered through a 0.2 μm filter, filled into glass vials, stoppered, capped, and placed at -70 ± 5 °C if not used immediately for further studies. The lipid nanoparticle formulations were characterized for pH and osmolality. Lipid and RNA content were measured by high performance liquid chromatography (HPLC) and mRNA integrity was measured by fragment analyzer.
[0385] Dynamic Light Scattering (DLS) The mean particle size (z) and polydispersity index (PDI) of the lipid nanoparticle formulations used in the examples were measured by dynamic light scattering on a Malvern Zetasizer Nano ZS (UK).
[0386] RiboGreen assay The RiboGreen fluorescence assay was used to characterize the encapsulation efficiency of lipid nanoparticle formulations. RiboGreen is a proprietary fluorescent dye (Molecular Probes / Invitrogen, a division of Life Technologies, now part of Thermo Fisher Scientific of Eugene, Oregon, USA) used for the detection and quantification of nucleic acids, including both RNA and DNA. In the free form, RiboGreen exhibits little fluorescence and has negligible absorption properties. Upon binding to nucleic acids, the dye fluoresces with an intensity several orders of magnitude greater than the unbound form. The fluorescence can then be detected with a sensor (fluorometer) and the nucleic acids can be quantified.
[0387] Freeze-Drying Process Self-replicating RNA (aka replicon RNA) is usually larger than the average mRNA, and a study was designed to determine whether self-replicating RNA lipid nanoparticle formulations could be successfully lyophilized. The quality of the lyophilized lipid nanoparticle formulation was assayed by analyzing the formulation after lyophilization and comparing it to the lipid nanoparticle formulation before lyophilization and after a conventional freeze / thaw cycle (i.e., frozen at approximately -70°C and then thawed at room temperature).
[0388] Analysis of lipid nanoparticle formulations included analysis of particle size and polydispersity (PDI) and encapsulation efficiency (%Encap). Particle size after lyophilization can be compared to the particle size before lyophilization and the difference can be reported as delta (δ). Various compositions tested were screened for meeting threshold properties including minimal increase in particle size (δ<10 nm), maintenance of PDI (<0.2), and maintenance of high encapsulation efficiency (>85%).
[0389] A lipid nanoparticle formulation was prepared using the self-replicating RNA (SEQ ID NO: 18) as described above. The resulting lipid nanoparticle formulation was then treated with buffer exchange to form a pre-lyophilized suspension having a concentration of 0.05-2.0 mg / mL of the self-replicating RNA, 0.01-0.05 M potassium sorbate, 0.01-0.10% w / v poloxamer 188 (Kolliphor®), 14-18% w / v sucrose, 25-75 mM NaCl, and 15-25 mM pH 8.0 Tris buffer. The pre-lyophilized formulation was then lyophilized in a Millrock Revo Freeze Dryer (Model No. RV85S4) using 2.0 mL aliquots of the suspension and the lyophilization cycle provided in Table 18 below. [Table 18]
[0390] The lyophilized particles prepared according to the above method were reconstituted with 2 mL of water and characterized using DLS and RiboGreen. The results provided in Table 19 below show that the lyophilized composition was found to produce a lyophilized lipid nanoparticle formulation with appropriate size, polydispersity, and delta value (about 5.3 nm) upon reconstitution. [Table 19]
[0391] Any self-replicating RNA and any mRNA, including any self-replicating RNA and any mRNA-delivered antigenic protein provided herein, can be prepared as a lyophilized formulation using the above process. Furthermore, the lyophilized formulation can be administered to elicit an immune response against the encoded antigenic protein, such as the SARS-CoV-2 spike glycoprotein and variants thereof.
[0392] Example 7 This example describes the immunogenicity of liquid and lyophilized self-replicating RNA formulations.
[0393] The immunogenicity of self-replicating RNA (SEQ ID NO: 18) formulated as lyophilized lipid nanoparticles (LYO-LNP) was tested in BALB / c mice in two separate preclinical studies and compared to a liquid (frozen) LNP formulation (Liquid-LNP). Each study included a PBS-treated group used as a negative control and a liquid-treated group (Liquid-LNP) as a positive control. Both LYO-LNP and Liquid-LNP formulations were administered at 0.2 and 2 μg. There were n=5 animals per treatment group in each study. The test formulations were administered intramuscularly (IM) and serum was collected at various time points after immunization (days 10, 19, and 31 for the first study and days 10, 20, and 30 for the second study) to measure the production of anti-SARS-CoV-2 spike protein IgG by using a Luminex bead fluorescence assay.
[0394] In both studies, anti-SARS-CoV-2 spike protein IgG was detected in serum in a time- and dose-dependent manner for both Liquid-LNP and LYO-LNP formulations, whereas PBS injection did not induce an immunogenic response (Figures 9A-9D). In the first study, no statistical difference in immunogenicity was observed between the Liquid-LNP and LYO-LNP treatment groups, whereas in the second study, LYO-LNP produced more IgG, statistically different from Liquid-LNP. Without being limited by theory, it is possible that the underpowered nature of these two separate studies (n=5 / group) contributed to the statistical difference in immunogenicity results observed in the two studies. Combining the results of both studies, no statistically significant differences were observed between the Liquid-LNP and LYO-LNP formulations at the 0.2 and 2 μg dose levels (Figures 10A, 10B). Taken together, the results of these studies indicate that the immunogenicity of the liquid and lyophilized formulations is comparable.
[0395] In summary, liquid and lyophilized formulations of the self-replicating RNA vaccine (SEQ ID NO: 18) demonstrated comparable immunogenicity. The vaccine could induce effective and adaptive humoral (neutralizing antibodies) and cellular (CD8+) immune responses targeting the SARS-CoV-2 spike (S) glycoprotein. The vaccine also induced higher anti-spike glycoprotein antibody (IgG) levels than conventional mRNA vaccines and induced the production of IgG antibodies at a faster rate than conventional mRNA vaccines. It continued to induce increasing levels of IgG up to 50 days after vaccination, whereas conventional mRNA vaccines plateaued by day 10 after vaccination. It produced an RNA dose-dependent increase in CD8+ T lymphocytes and generated a balanced Th1-dominated CD4+ T helper cell immune response without bias toward Th2 responses. array SEQ ID NO:1 - mARM3325 (South African B.1.351) SEQ ID NO:2-mARM3280(D614G) SEQ ID NO:3 - mARM3333 (UK B.1.1.7) SEQ ID NO:4-mARM3346 (Brazil P.1) SEQ ID NO:5-5'UTR (SEQ ID NO:1-4) ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA SEQ ID NO:6-nsP1 to nsP4 (SEQ ID NO:1 to 4) SEQ ID NO: 7-Intergenic region (SEQ ID NO: 1 to 4) CCTGAATGGACTACGACATAGTCTAGTCCGCCAAGGCCGCCACC SEQ ID NO:8-3'UTR (SEQ ID NO:1 to 4), with polyA ACTCGAGTATGTTACGTGCAAAGGTGATTGTCACCCCCCGAAAGACCATATTGTGACACACCCTCAGTATCACGCCCAAACATTTACAGCCGCGGTGTCAAAAACCGCGTGGACGTGGTTAACATCCCTGCTGGGAGGATCAGCCGTAATTATTATAATTGGCTTGGTGCTGGCTACTATTGTGGCCATGTACGTGCTGACCAACCAGAAACATAATTGAATACAGCAGCAATT GGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA...
Claims
1. (a) a first polynucleotide encoding one or more viral replication proteins, wherein one or more miRNA binding sites in the first polynucleotide are modified compared to a reference polynucleotide; and (b) a second polynucleotide comprising a first transgene encoding a first antigenic protein or a fragment thereof; An RNA molecule comprising: (i) modification of the one or more miRNA binding sites reduces or eliminates miRNA binding; or (ii) 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 miRNA binding sites in the first polynucleotide are modified; or (iii) the one or more miRNA binding site modifications are selected from miRNA binding regions having the sequences of SEQ ID NOs: 58, 59, 72, 80, 81, 83, 101, 102, 103, 112, 113, 114, 128, 131, 142, 156, 157, 171, 175, and any combination thereof; or (iv) a combination thereof; The RNA molecule of claim 1. (i) the one or more viral replication proteins are alphavirus proteins; or (ii) the first polynucleotide encodes a polyprotein comprising an alphavirus nsP1 protein, an alphavirus nsP2 protein, an alphavirus nsP3 protein, an alphavirus nsP4 protein, or any combination thereof; The RNA molecule of claim 1.
4. 2. The RNA molecule of claim 1, wherein the first polynucleotide comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:
6.
5. 2. The RNA molecule of claim 1, wherein the first polynucleotide encodes a polyprotein comprising a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:
187.
6. moreover, (i) the 5' untranslated region (UTR); or (ii) a 5'UTR comprising an alphavirus 5'UTR sequence; or (iii) a 5′UTR comprising the sequence of SEQ ID NO: 5; or (iv) a 3′ untranslated region (UTR); or (v) a 3'UTR comprising an alphavirus 3'UTR sequence; or (vi) a 3'UTR comprising the sequence of SEQ ID NO: 9; or (vii) a 3′UTR containing a polyA sequence; (viii) any one of (i) to (iii) in combination with any one of (iv) to (vi); or (ix) A combination of any one of (i) to (iii) with any one of (iv) to (vi), and (vii). The RNA molecule of claim 1, comprising:
7. The RNA molecule of claim 1 , wherein the first antigenic protein is a viral protein, a bacterial protein, a fungal protein, a protozoan protein, or a parasitic protein. (i) the viral protein is a coronavirus protein, an orthomyxovirus protein, a paramyxovirus protein, a picornavirus protein, a flavivirus protein, a filovirus protein, a rhabdovirus protein, a togavirus protein, an arterivirus protein, a bunyaviral protein, an arenavirus protein, a reovirus protein, a bornavirus protein, a retroviral protein, an adenovirus protein, a herpesvirus protein, a polyomavirus protein, a papillomavirus protein, a poxvirus protein, or a hepadnavirus protein; or (ii) the first antigen protein is a SARS-CoV-2 protein, an influenza virus protein, a respiratory syncytial virus (RSV) protein, a human immunodeficiency virus (HIV) protein, a hepatitis C virus (HCV) protein, a cytomegalovirus (CMV) protein, a Lassa fever virus (LFV) protein, an Ebola virus (EBOV) protein, a Mycobacterium protein, a Bacillus protein, a Yersinia protein, a Streptococcus protein, a Pseudomonas protein, a Shigella protein, a Campylobacter protein, a Salmonella protein, a Plasmodium protein, or a Toxoplasma protein; The RNA molecule of claim 7.
9. The RNA molecule of claim 1, wherein the first antigenic protein is a SARS-CoV-2 spike glycoprotein or an influenza virus glycoprotein.
10. 10. The RNA molecule of claim 9, wherein the SARS-CoV-2 spike glycoprotein comprises an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:
17.
11. 2. The RNA molecule of claim 1, wherein the second polynucleotide comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to the sequence of SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:
13.
12. The RNA molecule of claim 1 , wherein the first transgene is expressed from a first subgenomic promoter. (i) the second polynucleotide comprises at least two transgenes, optionally wherein the second transgene encodes a second antigenic protein or fragment thereof, or an immunomodulatory protein, optionally wherein the immunomodulatory protein is a cytokine, chemokine, or interleukin; or (ii) the second polynucleotide comprises at least two transgenes, and the first and second transgenes encode a viral protein, a bacterial protein, a fungal protein, a protozoan protein, a parasitic protein, an immunomodulatory protein, or any combination thereof; or (iii) the second polynucleotide comprises at least two transgenes, and the second polynucleotide further comprises a sequence encoding a 2A peptide, an internal ribosome entry site (IRES), a second subgenomic promoter, or a combination thereof, located between the transgenes; The RNA molecule of claim 1.
14. The RNA molecule of claim 1 , wherein the first polynucleotide is located 5′ of the second polynucleotide.
15. moreover, (i) comprises an intergenic region located between the first polynucleotide and the second polynucleotide; or (ii) an intergenic region located between the first polynucleotide and the second polynucleotide, wherein the intergenic region comprises a sequence having at least 85% identity to the sequence of SEQ ID NO: 7; The RNA molecule of claim 14.
16. The RNA molecule of claim 1 , wherein the RNA molecule is a self-replicating RNA molecule.
17. the RNA molecule (i) the sequence of SEQ ID NO: 1; or (ii) the sequence of SEQ ID NO: 2; or (iii) the sequence of SEQ ID NO: 3; or (iv) the sequence of SEQ ID NO: 4; or (v) a sequence comprising the sequences of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10, and SEQ ID NO:9; or (vi) a sequence comprising the sequences of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:11, and SEQ ID NO:9; or (vii) a sequence comprising the sequences of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:12, and SEQ ID NO:9; or (viii) a sequence comprising the sequences of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:13, and SEQ ID NO:9 and a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identity to 17. The RNA molecule of claim 16, wherein T is replaced with U.
18. The RNA molecule of claim 17, further comprising a 5' cap, optionally having a Cap1 structure, a Cap1(m6A) structure, a Cap2 structure, or a Cap0 structure.
19. 18. A DNA molecule encoding the RNA molecule of any one of claims 1 to 17, wherein optionally the DNA molecule comprises a promoter, and optionally the promoter is a T7 promoter, a T3 promoter, or an SP6 promoter.
20. (i) a first polynucleotide comprising a sequence having at least 80% identity to the sequence of SEQ ID NO: 6; and (ii) a second polynucleotide comprising a first transgene encoding a first antigenic protein or a fragment thereof; An RNA molecule comprising:
21. 21. A composition comprising an RNA molecule according to any one of claims 1 to 18 or 20 and a lipid formulation, optionally wherein the lipid formulation is selected from a lipoplex, a liposome, a lipid nanoparticle, a polymer-based carrier, an exosome, a lamellar body, a micelle, and an emulsion, and optionally wherein the lipid formulation encapsulates or is complexed with the RNA molecule.
22. (i) The lipid formulation is a lipid nanoparticle, and optionally, the lipid nanoparticle has a size of less than about 200 nm, less than about 150 nm, less than about 100 nm, or less than about 90 nm; (ii) the lipid formulation encapsulates or is complexed with an RNA molecule; or (iii) both (i) and (ii); 22. The composition of claim 21.
23. 22. The composition of claim 21, wherein the lipid formulation comprises an ionizable cationic lipid.
24. (i) The ionizable cationic lipid has the formula I: 【Chemical 1】 or a pharmaceutically acceptable salt or solvate thereof, wherein R 5 and R 6 are each independently a straight-chain or branched C 1 -C 31 Alkyl, C 2 -C 31 alkenyl, or C 2 -C 31 selected from the group consisting of alkynyl and cholesteryl; 5 and L 6 are each independently a linear C 1 -C 20 Alkyl and C 2 -C 20 alkenyl; X 5 is —C(O)O—, whereby —C(O)O—R 6 or —OC(O)—, whereby —OC(O)—R 6 is formed, and X 6 is —C(O)O—, whereby —C(O)O—R 5 or —OC(O)—, whereby —OC(O)—R 5 is formed, and X 7 is S or O, and L 7 is absent or lower alkyl, and R 4 is a straight chain or branched C 1 -C 6 alkyl, and R 7 and R 8 are each independently hydrogen and a straight-chain or branched C 1 -C 6 alkyl; or (ii) the ionizable cationic lipid is 【Chemistry 2-1】 【Chemistry 2-2】 【Chemistry 2-3】 【Chemistry 2-4】 【Chemistry 2-5】 【Chemistry 2-6】 【Chemistry 2-7】 【Chemistry 2-8】 【Chemistry 2-9】 【Chemistry 2-10】 【Chemistry 2-11】 【Chemistry 2-12】 【Chemistry 2-13】 【Chemistry 2-14】 or a pharmaceutically acceptable salt thereof; or (iii) the ionizable lipid has the following structure: 【change】 or a pharmaceutically acceptable salt thereof, 24. The composition of claim 23.
25. The lipid formulation (i) a helper lipid; or (ii) a helper lipid that is a phospholipid; or (iii) a helper lipid selected from dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylcholine (DPPC), and phosphatidylcholine (PC); or (iv) polyethylene glycol (PEG)-lipid conjugates; or (v) a PEG-lipid conjugate which is PEG-DMG, optionally wherein the PEG-DMG is PEG2000-DMG; or (vi) cholesterol; or (vii) any one of (i) to (iii) in combination with (iv) or (v) and (vi); or (viii) any one of (i) to (iii) in combination with (iv) or (v), or with (vi); 22. The composition of claim 21, comprising:
26. (i) the lipid portion of the lipid formulation comprises about 40 mol% to about 60 mol% of the ionizable cationic lipid, about 4 mol% to about 16 mol% DSPC, about 30 mol% to about 47 mol% cholesterol, and about 0.5 mol% to about 3 mol% PEG2000-DMG; or (ii) the lipid portion of the lipid formulation comprises about 42 mol% to about 58 mol% DSPC, about 6 mol% to about 14 mol% ionizable cationic lipid, about 32 mol% to about 44 mol% cholesterol, and about 1 mol% to about 2 mol% PEG2000-DMG; or (iii) the lipid portion of the lipid formulation comprises about 45 mol% to about 55 mol% ionizable cationic lipid, about 8 mol% to about 12 mol% DSPC, about 35 mol% to about 42 mol% cholesterol, and about 1.25 mol% to about 1.75 mol% PEG2000-DMG; 22. The composition of claim 21.
27. The composition comprises: (i) having a total lipid:RNA molecular weight ratio of about 50:1 to about 10:1; or (ii) having a total lipid:RNA molecular weight ratio of about 44:1 to about 24:1; or (iii) having a total lipid:RNA molecular weight ratio of about 40:1 to about 28:1; or (iv) having a total lipid:RNA molecular weight ratio of about 38:1 to about 30:1; or (v) having a total lipid:RNA molecular weight ratio of about 37:1 to about 33:1; 22. The composition of claim 21.
28. (i) the composition comprises a HEPES or TRIS buffer at a pH of about 7.0 to about 8.5; or (ii) the composition comprises a HEPES or TRIS buffer at a pH of about 7.0 to about 8.5, the HEPES or TRIS buffer being at a concentration of about 7 mg / mL to about 15 mg / mL; or (iii) the composition comprises about 2.0 mg / mL to about 4.0 mg / mL NaCl; or (iv) the composition comprises one or more cryoprotectants; or (v) the composition comprises one or more cryoprotectants selected from sucrose, glycerol, or a combination of sucrose and glycerol, and optionally, the composition comprises a combination of sucrose at a concentration of about 70 mg / mL to about 110 mg / mL and glycerol at a concentration of about 50 mg / mL to about 70 mg / mL; or (vi) the composition is a lyophilized composition; or (vii) the composition is a lyophilized composition, and the lyophilized composition comprises one or more lyoprotectants; or (viii) the composition is a lyophilized composition, and the lyophilized composition comprises poloxamer, potassium sorbate, sucrose, or any combination thereof; or (ix) the composition is a lyophilized composition comprising a poloxamer, and the poloxamer is poloxamer 188; or (x) the composition is a lyophilized composition comprising about 0.01 to about 1.0% w / w of the RNA molecule; or (xi) the composition is a lyophilized composition comprising about 1.0 to about 5.0% w / w lipid; or (xii) the composition is a lyophilized composition comprising about 0.5 to about 2.5% w / w TRIS buffer; or (xiii) the composition is a lyophilized composition comprising about 0.75 to about 2.75% w / w NaCl; or (xiv) the composition is a lyophilized composition comprising about 85 to about 95% w / w sugar, optionally wherein the sugar is sucrose; or (xv) the composition is a lyophilized composition comprising about 0.01 to about 1.0% w / w of a poloxamer, optionally wherein the poloxamer is poloxamer 188; or (xvi) the composition is a lyophilized composition comprising about 1.0 to about 5.0% w / w potassium sorbate; or (xvii) a combination of (i) to (v), or (xviii) A combination of (vi) to (xvi), 22. The composition of claim 21.
29. the RNA molecule (A) the sequence of SEQ ID NO: 1; or (B) the sequence of SEQ ID NO: 2; or (C) the sequence of SEQ ID NO: 3; or (D) the sequence of SEQ ID NO: 4; or (E) a sequence comprising the sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10 and SEQ ID NO: 9; or (F) a sequence comprising the sequences of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:11 and SEQ ID NO:9; or (G) a sequence comprising the sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12 and SEQ ID NO: 9; or (H) comprising a sequence comprising the sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 13 and SEQ ID NO: 9; 22. The composition of claim 21, wherein T is replaced with U.
30. a. i. ATX-126: 【Chemistry 3】 about 45 mol % to about 55 mol % of an ionizable cationic lipid having the structure: ii. about 8 mol % to about 12 mol % DSPC; iii. about 35 mol% to about 42 mol% cholesterol, and iv. about 1.25 mol % to about 1.75 mol % of PEG2000-DMG a lipid formulation comprising b. (A) the sequence of SEQ ID NO: 1; or (B) the sequence of SEQ ID NO: 2; or (C) the sequence of SEQ ID NO: 3; or (D) the sequence of SEQ ID NO: 4; or (E) a sequence comprising the sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 10 and SEQ ID NO: 9; or (F) a sequence comprising the sequences of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:11 and SEQ ID NO:9; or (G) a sequence comprising the sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12 and SEQ ID NO: 9; or (H) a sequence comprising the sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 13 and SEQ ID NO: 9 has at least 80% identity to an RNA molecule in which T is replaced with U; A lipid nanoparticle composition comprising: The lipid nanoparticle composition, wherein the lipid formulation encapsulates the RNA molecule, and the lipid nanoparticles have a size of about 60 to about 90 nm.
31. A method for preparing the composition of claim 21 for administration to a subject in need thereof, wherein the composition is lyophilized, and the method comprises reconstituting the lyophilized composition prior to administration.
32. 22. Use of the composition of claim 21 in the manufacture of a medicament for the prevention or amelioration of COVID-19, optionally wherein the medicament is administered in one or two doses.
33. 22. Use of the composition of claim 21 in the manufacture of a booster dose for a vaccinated subject, wherein the subject has previously been vaccinated against a coronavirus.
34. 33. The use of claim 32, wherein the composition is formulated for administration at a dose of about 0.01 μg to about 1,000 μg of RNA; optionally, the composition is formulated for administration at a dose of about 1, 2, 5, 7.5, or 10 μg of RNA.
35. Use of a composition in the manufacture of a medicament for eliciting an immune response in a subject, comprising: (i) the medicament comprises an effective amount of an RNA molecule according to any one of claims 1 to 18 or 20; and optionally (ii) the RNA molecule is formulated for administration intramuscularly, subcutaneously, intradermally, transdermally, intranasally, orally, sublingually, intravenously, intraperitoneally, topically, by aerosol, or by pulmonary route; The above use.
36. 21. The RNA molecule of any one of claims 1 to 18 or 20 for use in eliciting an immune response against said first antigenic protein or fragment thereof.
37. Use of an RNA molecule according to any one of claims 1 to 18 or 20 in the manufacture of a medicament for inducing an immune response against said first antigen protein or a fragment thereof.
38. An RNA molecule for expressing an antigen, comprising: (a) SEQ ID NO: 33, or (b) SEQ ID NO: 30 and an open reading frame having at least 80% identity to the sequence of The RNA molecule, wherein T is replaced with U.
39. (i) the RNA molecule further comprises a 5′UTR having a sequence selected from SEQ ID NO: 35, SEQ ID NOs: 189-218, or SEQ ID NOs: 233-279; or (ii) the RNA molecule further comprises a 3′ UTR having a sequence selected from SEQ ID NO: 37, SEQ ID NOs: 219-225, or SEQ ID NOs: 280-317; or (iii) the RNA molecule further comprises a 5' cap, optionally wherein the 5' cap has a Cap1 structure, a Cap1(m6A) structure, a Cap2 structure, or a Cap0 structure; or (iv) the RNA molecule further comprises a polyA tail; or (v) the RNA molecule comprises an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 33, a 5' UTR comprising the sequence of SEQ ID NO: 35, and a 3' UTR comprising the sequence of SEQ ID NO: 37, wherein T is replaced with U; or (vi) the RNA molecule comprises an open reading frame having at least 80% identity to the sequence of SEQ ID NO: 30, a 5' UTR comprising the sequence of SEQ ID NO: 35, and a 3' UTR comprising the sequence of SEQ ID NO: 37, wherein T is replaced by U; or (vii) a combination thereof, 39. The RNA molecule of claim 38.
40. A DNA molecule encoding the RNA molecule of claim 38 or claim 39, optionally comprising a promoter, optionally wherein the promoter is a T7 promoter, a T3 promoter, or an SP6 promoter.
41. 40. A composition comprising the RNA molecule of claim 38 or claim 39 and a lipid formulation, optionally wherein the lipid formulation is selected from a lipoplex, a liposome, a lipid nanoparticle, a polymer-based carrier, an exosome, a lamellar body, a micelle, and an emulsion, and optionally wherein the lipid formulation comprises an ionizable cationic lipid.
42. (i) The lipid formulation has Formula I: 【Chemistry 4】 or a pharmaceutically acceptable salt or solvate thereof, wherein R 5 and R 6 are each independently a straight-chain or branched C 1 -C 31 Alkyl, C 2 -C 31 alkenyl, or C 2 -C 31 selected from the group consisting of alkynyl and cholesteryl; 5 and L 6 are each independently a linear C 1 -C 20 Alkyl and C 2 -C 20 alkenyl; X 5 is —C(O)O—, whereby —C(O)O—R 6 or —OC(O)—, whereby —OC(O)—R 6 is formed, and X 6 is —C(O)O—, whereby —C(O)O—R 5 or —OC(O)—, whereby —OC(O)—R 5 is formed, and X 7 is S or O, and L 7 is absent or lower alkyl, and R 4 is a straight chain or branched C 1 -C 6 alkyl, and R 7 and R 8 are each independently hydrogen and a straight-chain or branched C 1 -C 6 alkyl; or (ii) the lipid formulation 【Chemistry 5】 or a pharmaceutically acceptable salt thereof; or (iii) the lipid formulation comprises a helper lipid; or (iv) the lipid formulation comprises a helper lipid, and the helper lipid is a phospholipid; or (v) the lipid formulation comprises a helper lipid selected from dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylcholine (DPPC), and phosphatidylcholine (PC); or (vi) the lipid formulation comprises cholesterol; or (vii) the lipid formulation comprises a polyethylene glycol (PEG)-lipid conjugate; or (viii) combinations thereof; 42. The composition of claim 41.
43. Use of a composition in the manufacture of a medicament for eliciting or boosting an immune response in a subject, comprising: (i) the composition comprises an effective amount of the RNA molecule of claim 38 or claim 39; and optionally, (ii) (a) the subject has previously been vaccinated against a coronavirus, and / or (b) the RNA molecule is formulated for administration by intramuscular, subcutaneous, intradermal, transdermal, intranasal, oral, sublingual, intravenous, intraperitoneal, topical, or pulmonary routes; The above use.
44. 40. An RNA molecule according to claim 38 or claim 39 for use in eliciting an immune response against said antigen.
45. 40. Use of an RNA molecule according to claim 38 or claim 39 in the manufacture of a medicament for inducing an immune response against said antigen.