Humanized chimeras for the prospective evaluation of cell addition and replacement therapy
Patent Information
- Application Number
- JP2024523841
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-20
- Filing Date
- 2022-10-08
- Publication Date
- 2025-10-10
AI Technical Summary
Existing technologies are unclear about the ability of healthy human glial progenitor cells to outcompete and replace diseased human glial cells in the brain, which is crucial for therapeutic replacement in neurological disorders such as Huntington's disease and schizophrenia.
A chimeric non-human mammal model is created with at least 30% of glial cells in the corpus callosum or 5% in the brain and brainstem being human glial cells, tagged with distinct labels to track healthy and disease-specific glial cells, demonstrating that healthy human glial cells can outcompete and replace diseased counterparts.
The model shows that healthy human glial cells can effectively replace diseased glial cells through sustained proliferative benefits and active evacuation, providing a therapeutic approach for neurological disorders.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] This application claims priority from U.S. Provisional Application No. 63 / 257,727, filed October 20, 2021, which is incorporated herein by reference.
[0002] Field The present invention relates to humanized chimeras for the predictive evaluation of cell addition and replacement therapy. [Background technology]
[0003] background Glial dysfunction is a causative contributor to a wide range of neurological conditions. In addition to the many disorders of myelin, it is now apparent that astrocyte and oligodendrocyte pathology underlie the development and progression of many both neurodegenerative and neuropsychiatric disorders, including amyotrophic lateral sclerosis (ALS) (Giorgio, FPD et al., "Non-Cell Autonomous Effect of Glia on Motor Neurons in an Embryonic Are Sensitive to the Toxic Effect of Glial Cells Carrying an ALS-Causing Mutation," Cell Stem Cell 3:637-648 (2008); Yamanaka, K. et al., "Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis," Nat Neurosci 11:251-253 (2008); Lee, Y. et al., "Oligodendroglia Metabolically Support Axons and Contribute to Neurodegeneration," Nature 11:251-253 (2008)). 487:443-448 (2012); and Meyer, K. et al., "Direct Conversion of Patient Fibroblasts Demonstrates Non-Cell Autonomous Toxicity of Astrocytes to Motor Neurons in Familial and Sporadic ALS," Proc National Acad Sci 111:829-832 (2014)) and Huntington's Disease (HD) (Shin, J.-Y. et al., "Expression of Mutant Huntingtin in Glial Cells Contributes to Neuronal Excitotoxicity," J Cell Biology 171:1001-1012 (2005); Faideau, M."In Vivo Expression of Polyglutamine-Expanded Huntingtin by Mouse Striatal Astrocyte Impairs Glutamate Transport: A Correlation with Huntington's Disease Subjects", Hum Mol Genet 19:3053~3067 (2010); Tong, X. et al. "Astrocyte Kir4.1 Ion Channel Deficits Contribute to Neuronal Dysfunction in Huntington's Disease Model Mice", Nat Neurosci 17, 694~703(2014); Benraiss, A. et al., Human Glia can both Induce and Rescue Aspects of Disease Phenotype in Huntington Disease", Nat Commun 7, 11758(2016); Diaz-Castro, B. et al., "Astrocyte Molecular Signatures in Huntington's Disease", Sci Transl Med 11, eaaw8546(2019);Benraiss, A. et al. "Cell-intrinsic Glial Pathology is Conserved Across Human and Murine Models of Huntington's Disease", Cell Reports 36, 109308(2021)), and schizophrenia and bipolar disorders (Tkachev, D. et al. "Oligodendrocyte Dysfunction in Schizophrenia and Bipolar Disorder", Lancet 362, 798-805(2003);Katsel, P.et al., "Astrocyte and Glutamate Markers in the Superficial, Deep, and White Matter Layers of the Anterior Cingulate Gyrus in Schizophrenia", Neuropsychopharmacol 36, 1171-1177 (2011); Voineskos, AN et al., "Oligodendrocyte Genes, White Matter Tract Integrity, and Cognition in Schizophrenia", Cereb Cortex 23, 2044~2057 (2013); Aleksovska, K. et al., “Systematic Review and Meta-Analysis of Circulating S100B Blood Levels in Schizophrenia”, Plos One 9, e106342 (2014); Windrem, MS et al., “Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia”, Cell Stem Cell 21, 195-208.e6 (2017) includes many states such as.
[0004] In such conditions, replacement of diseased glia by healthy wild-type glial progenitors is due to the migration and expansion competence of human glial progenitor cells (hGPCs) and their ability to generate both astrocytes and myelinating oligodendrocytes in a lineage plastic and context-dependent manner (Nunes, MC, et al., "Identification and Isolation of Multipotential Neural Progenitor Cells from the Subcortical White Matter of the Adult Human Brain," Nat Med 9, 439-447 (2003); Sim, FJ, et al., "CD140a Identifies a Population of Highly Myelinogenic, Migration-competent and Efficiently Engrafting Human Oligodendrocyte Progenitor cells," Nat Biotechnol 29, 934-941 (2011); Windrem, MS, et al., "A Competitive Advantage by Neonatally Engrafted Human Glial Progenitors "Yields Mice Whose Brains Are Chimeric for Human Glia", J Neurosci 34, 16153-16161 (2014); and Windrem, MS et al., "Human Glial Progenitor Cells Effectively Remyelinate the Demyelinated Adult Brain", Cell Reports 31, 107658 (2020)), which may provide substantial therapeutic benefit (Goldman, SA, "Stem and Progenitor Cell-Based Therapy of the Central Nervous System: Hopes, Hype, and Wishful Thinking", Cell Stem Cell 18, 174-188 (2016) and Franklin, RJM(Givogri, M. I. et al., "Remyelination in the CNS: from Biology to Therapy," Nat Rev Neurosci 9, 839-855 (2008)). However, to provide therapeutic replacement, allogeneic hGPCs must compete for and displace endogenous pools and ultimately relocate to diseased regions of the host brain. In previous studies of mouse-to-mouse allogeneic transplantation, competitive interactions between healthy glial progenitor cells (GPCs) and diseased glial progenitor cells favor the expansion and integration of the healthy donor population (Givogri, M. I. et al., "Oligodendroglial Progenitor Cell Therapy Limits Central Neurological Deficits in Mice with Metachromatic Leukodystrophy," J Neurosci 26, 3109-3119 (2006); U.S. Patent No. 10,279,051 to Goldman, and U.S. Patent No. 10,779,519 to Goldman). Nevertheless, it remains unclear whether healthy human GPCs can outcompete and replace their diseased human counterparts. Summary of the Invention [Problem to be solved by the invention]
[0005] The present invention is directed to overcoming these and other deficiencies in the art. [Means for solving the problem]
[0006] overview One aspect of the present invention relates to a chimeric non-human mammal, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brain stem of the chimeric non-human mammal are human glial cells, wherein the human glial cells comprise a combination of human disease-specific glial cells and healthy human glial cells, wherein the human disease-specific glial cells are tagged with a first detectable label and the healthy human glial cells are tagged with a second detectable label that is distinguishable from the first detectable label.
[0007] Another aspect of the present invention relates to a chimeric non-human mammal, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brain stem of the chimeric non-human mammal are human glial cells, the human glial cells comprising a first population of healthy human glial cells tagged with a first detectable label and a second population of healthy human glial cells tagged with a second detectable label distinguishable from the first detectable label.
[0008] Another aspect of the invention relates to a method for generating a chimeric non-human mammal comprising human glial cells, the method comprising the steps of: introducing a first population of human glial progenitor cells into the brain and / or brain stem of the non-human mammal, wherein the first population of human glial progenitor cells are tagged with a first detectable label; introducing a second population of human glial progenitor cells into the brain and / or brain stem of the non-human mammal, wherein the second population of human glial progenitor cells are tagged with a second detectable label that is distinguishable from the first detectable label; and recovering a chimeric non-human mammal having human glial cells that at least partially replace native glial cells in the brain or brain stem as a result of the introducing step, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brain stem of the chimeric non-human mammal are human glial cells. [Brief description of the drawings]
[0009] [Figure 1-1] Panels A-B of Figure 1 show representative images of WT-mCherry and HD-EGFP expression. Panel A shows the workflow used in the genetic engineering of the adeno-associated virus integration site (AAVS1) locus of hESC lines that constitutively express a transgene of interest. Panel A' shows the mechanism of CRISPR-Cas9-mediated transgene integration into the AAVS1 locus (located in the first intron of the protein phosphatase 1 regulatory subunit 12C (PPP1R12C) gene). [Figure 1-2] Panels B-B' show representative images of WT-mCherry and HD-EGFP expression. [Figure 1-3] Panels C-D depict transgene constructs driving expression of either mCherry or EGFP (enhanced green fluorescent protein) inserted into the AAVS1 safe harbor locus of WT GENEA019 (mcherry) and HD GENEA020 (EGFP) hESCs. [Figure 1-4] Panel E shows representative images of WT-mCherry (Panel B) and HD-EGFP expression (Panel B') in the brain. [Figure 2-1] FIG. 2, panel A, shows representative karyotypes from WT-mCherry and HD-EGFP to assess acquired copy number variations (CNVs) and loss of heterozygosity (LOH). [Figure 2-2] Panels B-C show karyotype analysis. [Figure 3-1] FIG. 3, panel A, illustrates the generation of HD chimeric mice. [Figure 3-2] Panel B shows representative images and characterization of cells in HD chimeric mice. [Figure 3-3] Panel C shows representative images and characterization of cells in HD chimeric mice. [Diagram 3-4] Panel D shows representative images and characterization of cells in HD chimeric mice. [Figure 4-1] FIG. 4 shows that adult transplanted WT human GPCs outcompete and replace neonatally resident HD hGPCs. Panel A: Experimental design and analytical endpoints. Panel B: Engraftment of WT glia (mCherry+, red) into the striatum of HD chimeras resulted in progressive replacement of HD glia (EGFP+, green) creating extensive exclusive domains in their development. The dashed outline (white) demarcates the outline of the striatum within which human cells were mapped and quantified. Scale: Panel B, 500 μm. [Figure 4-2] Panels C-D: The border between developing WT and repopulating HD hGPCs is typically well delineated, such that exclusive domains are formed as WT GPCs (Olig2+, white) replace their HD counterparts. Panel E: GPC replacement precedes astrocyte replacement, as stray HD astrocytes (hGFAP+, white) can still be found within areas colonized by WT hGPCs. Scale; Panel C': 100 μm; Panel D: 50 μm; Panel E: 10 μm. [Figure 4-3]Panel F: Distribution of mapped human glia in the host striatum. Human glia were mapped in 15 equal sections (five shown as examples) and reconstructed in 3D. Their distribution was easily measured as a function of distance to the injection site. Panel G: Example display of mapped striatum. Panel H: Volumetric quantification shows that WT gradually replaced their HD counterparts as they expanded and proliferated from their replacement site; H1: WT vs. HD (allograft; n=8 for 54 weeks, n=7 for 72 weeks). The progression of WT cells was accompanied by progressive elimination of HD glia from the tissue compared to untransplanted HD chimeras (HD control); H2: HD (allograft; n=8 for 54 weeks, n=7 for 72 weeks) vs. HD control (n=4 for both time points; 2-way ANOVA with Sidak's multiple comparison test. ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05; data are expressed as mean ± SEM). [Figure 4-4] Panel I: At the border between WT and HD glia, a high incidence of Ki67+ (white) cells can be seen exclusively within the WT glial population. Panel I': Higher magnification of two WT daughter cells at the edge of the competitive border. Panel J: Quantification of Ki67+ glia within each population as a function of time showing a significant proliferation benefit by WT glia, sustained throughout the experiment. HD control: 54 weeks (n=4), 72 weeks (n=4); WT control: 54 weeks (n=5), 72 weeks: n=3; WT vs. HD allografts: 54 weeks (n=5), 72 weeks (n=3). Comparisons by 2-way ANOVA with Sidak's multiple comparison test; mean ± SEM. STR, striatum (caudate putamen); LV, lateral ventricle; CTX, cortex. Dashed rectangle (orange) represents insert (B'). Scale; Panel I: 100 μm; Panel I': 10 μm. [Diagram 5] FIG. 5 illustrates the experimental design of HD versus WT and HD control mice. [Figure 6-1]Panels A-C of Figure 6 show that human wild-type glia outcompete pre-integrated human HD glia. Panel A provides stereological estimates demonstrating that the total number of HD glia progressively declines relative to HD chimera controls as WT glia expand and proliferate within the humanized striatum; 2-way ANOVA with Sidak's multiple comparison test. Panels B and C show that the proportion of GPCs (Olig2+, Panel B) and astrocytes (GFAP+, Panel C) in both populations was maintained as they competed for striatal dominance; HD control-n=4 for both time points; WT control-n=4 for 54 weeks, n=3 for 72 weeks; HD vs. WT-n=5 for 54 weeks, n=3 for 72 weeks; orange arrows point to co-labeled cells. Data are presented as mean ± sem with individual data points. [Figure 6-2] Panels D-E show representative images of HD glia (panel D) and WT glia (panel E) in which Olig2+ (white) GPCs expanded as they replaced their HD counterparts, and within the areas where they became dominant, they further differentiated into hGFAP+ (white) astrocytes. [Figure 7-1] Panels A-B of Figure 7 illustrate the experimental design and analysis time points of the WT control group (Panel A). Panel B shows representative images demonstrating that engraftment of WT glia (mCherry+, red) into the adult striatum of Rag1(- / -) mice results in substantial humanization of the mouse striatum over time. [Figure 7-2] Panels C-D show volumetric quantification demonstrating that WT glia infiltrate and disperse throughout the mouse striatum over time and that they are more widespread than those transplanted into HD chimeras; WT (HD vs. WT group)—n=8 for 54 weeks, n=7 for 72 weeks vs. WT control—n=7 for 54 weeks, n=5 for 72 weeks; 2-way ANOVA with Sidak's multiple comparison test; main effects are shown as numerical P values; data are presented as mean ± sem. [Figure 8]FIG. 8 illustrates the experimental design for mice receiving a 1:1 mixture of mCherry-tagged (WT-mCherry) and untagged (WT-untagged) WT glia. [Figure 9] Panels A-D of FIG. 9 show that co-engrafted isogenic clones of wild-type glia develop and intermix, replacing HD glia. Panel A shows that immunolabeling for human nuclear antigen (hN) shows that both WT-mCherry (mCherry+hN+, red, white) and WT untagged (mCherry-EGFP-hN+, white) glia expand and proliferate within the previously humanized striatum, progressively replacing HD glia (EGFP+hN+, green, white). Scale bar 500 μm. Panel B shows that extensive homotypic domains are formed as the mixed WT glia expand and replace resident HD glia. Scale bar 100 μm. Panel C shows that isogenic WT-mCherry and WT untagged are found intermixed. Scale bar 100 μm. Panel D shows that within domains dominated by WT glia, only more complex astrocyte-like HD glia are typically found within white matter tracts. Scale bar: 10 μm. [Figure 10] FIG. 10 shows that quantification of the proportion of WT-mCherry and WT untagged glia in the striatum showed no significant differences between the two populations at any of the quantification time points (n=6 for each time point); 2-way ANOVA with Sidak's multiple comparison test; mean±sem. [Figure 11] FIG. 11 illustrates the experimental design for co-engraftment of WT and HT glia in neonatal mice. [Figure 12-1] Panels A-C of Figure 12 show representative images of the percentage of WT and HD glia within the striatum in mice co-engrafted with WT and HT glia. The images show no significant growth advantage for either cell population; n=5; two-tailed paired t-test. [Figure 12-2] Panel C shows representative images of the percentage of WT and HD glia in the striatum in mice co-engrafted with WT and HT glia. [Figure 13]Figure 13, panels A-B, demonstrates that equal growth of WT and HD glia engrafted in neonates is sustained by a similarly proliferative Ki67+ (white) glial pool; HD control-n=3; WT control-n=4; HD vs. WT-n=5; one-way ANOVA with Tukey's multiple comparison test. [Figure 14] FIG. 14, panels A-B, demonstrate that differences in cellular age are sufficient to drive human glial repopulation. [Figure 15-1] Panels A-B show that mouse chimeras with striatum substantially humanized by HD glia were created to provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHTT-expressing hESCs engineered to express EGFP were implanted into the neostriatum of immunocompromised Rag1(- / -) mice and their expression was monitored histologically. [Figure 15-2] Panels C-D show that mouse chimeras with striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 15-3] Panels E-F show that mouse chimeras with striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 15-4] Panels G-I show that mouse chimeras with striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 15-5] Panel J shows that mouse chimeras with striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 16]FIG. 16, panels AB, show that a proliferative benefit drives WT glia to progress through the humanized HD striatum. [Figure 17-1] Panels A-E of FIG. 17 show that differences in cell age are sufficient to drive competitive glial repopulation in humanized striatum. Panel A: Experimental design and analysis endpoints. Panel B: Engraftment of younger WT glia (EGFP+, green) into the striatum of WT chimeras resulted in selective replacement of their older counterparts (mCherry+, red). The dashed contour demarcates the striatal region within which human cells were mapped and quantified. Panel B: STR, striatum (caudate-putamen); LV, lateral ventricle; CTX, cortex). Scale: Panel B, 500 μm. [Figure 17-2] Panel C: WT chimeric control, engrafted only at birth. Panel D: Example display of a mapped striatum. Volumetric quantification shows that younger WT glia replace their older isogenic counterparts as they expand and proliferate from their injection site. Panel C: STR, striatum (caudate-putamen); LV, lateral ventricle; CTX, cortex). Scale; Panel C, 100 μm. [Figure 17-3] Panel E: Aged vs. young (syngeneic), n=3. Their development tracked the progressive elimination of aged WT glia from the tissue compared to control WT chimeras (aged control). Panel F: Aged (syngeneic) vs. Aged (control), n=3 each; 2-way ANOVA with Sidak's multiple comparison test; interactions or main effects are shown as numerical P values, whereas post hoc comparisons are shown as ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05; data are expressed as mean±SEM. Scale; Panel E, 100 μm. [Figure 17-4]Panel G: At the interface between young and aged WT glia, a higher incidence of Ki67+ (white) cells can be seen within the younger population. The dashed box represents the inset color division (Panel H). Panel I: Quantification of Ki67+ cells shows that younger WT glia are significantly more proliferative than their aged counterparts; n=3 for all experimental groups; one-way ANOVA with Sidak's multiple comparison test; data are presented as mean±SEM with individual data points. Scale; Panel G, 50 μm. [Figure 18-1] Panel A shows the gating strategy for flow cytometry analysis. [Figure 18-2] Panel B shows the gating strategy for flow cytometry analysis. [Figure 19-1] Figure 19 shows that WT glia acquire a dominant competitor transcriptional profile in the face of resident HD glia. Panel A: Experimental design. Panels B and C: Uniform manifold approximation and projection (UMAP) visualization of integrated (Panel B) and partitioned by groups (Panel C) scRNA-seq data identifies six major cell populations. [Figure 19-2] Panel D: Stacked bar plots of percentage of cell types in each group. Panel E: Notched box plots of cell cycle analysis of cycling GPCs and G2 / M phase GPCs. Boxes indicate interquartile ranges, notches indicate 95% confidence intervals with median at center of notches, error bars represent minimum and maximum non-outliers. Panel F: Venn diagram of pairwise differentially expressed GPC genes (Log2 fold change >0.15, adjusted p-value <0.05). [Figure 19-3] Panel G: Curated ingenuity pathway analysis of differentially expressed genes between GPC groups. Circle size represents p-value while shading indicates activation Z-score, with red being more active in the upper group and green being more active in the lower group. [Figure 19-4]Panel H: Heatmap of selected pairwise differentially expressed GPC genes. Panel I: Violin plot of log2 fold change of pairwise differentially expressed GPC ribosomal genes. Comparisons between groups in E) utilized Dunn's test followed by Kruskal-Wallis test with multiple comparisons adjusted via the Benjamini-Hochberg method. *=<0.05, **<0.01, ***=<0.001, ****=<0.0001 adjusted p-values. [Figure 20-1] Figure 20 shows that aged human glia are eliminated by their younger counterparts by induced apoptosis. Panel A: At the border between young (EGFP+, green) and aged WT glia (mCherry+, red), a higher incidence of apoptotic TUNEL+ (white) cells is evident in the aged population. Panel B: Higher magnification of the competitive interface between these distinct populations shows resident glia selectively undergoing apoptosis. Scale: Panel A, 100 μm; Panel B, 50 μm. [Figure 20-2] Panel C: Quantification of TUNEL+ cells shows a significantly higher incidence of TUNEL+ cells among aged resident WT glia compared to both their younger isogenic counterparts and aged WT chimeric controls that were not challenged with younger cells. Quantification was performed on pooled samples (n=5 for all experimental groups) at 60-80 weeks. One-way ANOVA with Sidak's multiple comparison test; data are presented as mean ± SEM with individual data points. [Figure 21-1] Figure 21 shows that WT glia gain a transcriptional advantage when confronted with their aged counterparts. Panel A: Experimental design. Panels B-C: Uniform manifold approximation and projection (UMAP) visualization of integrated (Panel B) and partitioned by groups (Panel C) scRNA-seq data identifies six major cell populations. [Figure 21-2]Panel D: Stacked bar plots of percentage of cell types in each group. Panel E: Notched box plots of cell cycle analysis of cycling GPCs and G2 / M phase GPCs. Boxes indicate interquartile ranges, notches indicate 95% confidence intervals with median at center of notches, error bars represent minimum and maximum non-outliers. Panel F: Venn diagram of pairwise differentially expressed GPC genes (Log2 fold change >0.15, adjusted p-value <0.05). [Figure 21-3] Panel G: Ingenuity Pathway analysis of curated genes differentially expressed between GPC groups. Circle size represents p-value while shading indicates activation Z-score, red is more active in the upper group and green is more active in the lower group. [Figure 21-4] Panel H: Heatmap of selected pairwise differentially expressed GPC genes. Panel I: Violin plot of log2 fold change of pairwise differentially expressed GPC ribosomal genes. Comparisons between groups in E utilized Dunn's test followed by Kruskal-Wallis test with multiple comparisons adjusted via the Benjamini-Hochberg method. *=<0.05, **<0.01, ***=<0.001, ****=<0.0001 adjusted p-values. [Figure 22-1] Figure 22 shows the transcriptional signature of competitive advantage. Panel A: Schematic of candidate transcription factor identification. [Figure 22-2] Panel B: Violin plot of the first principal component of the identified WGCNA modules per condition. Significant modules (black, green, blue, brown, red, cyan) are depicted whose members are enriched for downstream targets of the five transcription factors in panel E. Panel C: Relative importance analysis to estimate the differential contribution of each biological factor (age vs. genotype) to the first principal component of each module. [Figure 22-3] Panel D: Gene Set Enrichment Analysis (GSEA) highlighting these prioritized transcription factors enriched for upregulated genes in young WT cells where their regulon dominates. Panel E: Key transcription factors predicted via SCENIC to establish competitive advantage and their relative activity across groups. [Figure 22-4] Panel F: Regulatory network representing downstream targets and their functional signaling pathways. The targets belong to the highlighted modules in panel B and their expression is controlled by at least one other important transcription factor in panel E. NES: Network enrichment score. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0010] Detailed Description Certain aspects and exemplary embodiments of the present invention are described in detail, with examples shown in the accompanying structures and drawings. Aspects of the present invention are described in conjunction with exemplary embodiments, including methods, materials, and examples, and such descriptions are non-limiting, and the scope of the present invention is intended to encompass all equivalents, alternatives, and modifications generally known or incorporated herein. The described aspects, features, benefits, and characteristics of the present invention may be combined in any suitable manner with one or more additional embodiments. Those skilled in the art will recognize that the present invention may be practiced without one or more of the specific aspects or benefits of a particular embodiment. In other instances, additional aspects, features, and benefits may be recognized in certain embodiments that may not be shown in all embodiments of the present invention and may be claimed. Furthermore, those skilled in the art will recognize many techniques and materials similar or equivalent to those described herein, which may be used in the practice of the aspects and embodiments of the present invention. The described aspects and embodiments of the present invention are not limited to the described methods and materials.
[0011] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0012] Ranges may be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that each of the endpoints of a range is meaningful in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are several values disclosed herein, and that each value is also disclosed herein as "about" that particular value, in addition to the value itself. For example, if a value of "10" is disclosed, "about 10" is also disclosed. When a value is disclosed, it is also understood that "less than or equal to" the value, "greater than or equal to" the value, and possible ranges between the values are also disclosed, as appropriately understood by one of ordinary skill in the art. For example, if a value of "10" is disclosed, "less than or equal to 10" and "greater than or equal to 10" are also disclosed.
[0013] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a peptide" includes "one or more" peptides or "multiple" such peptides.
[0014] The present invention utilizes a human glial chimeric mouse model (Goldman, SA et al., "Modeling Cognition and Disease Using Human Glial Chimeric Mice," Glia 63:1483-1493 (2015), which is incorporated herein by reference in its entirety) in which a substantial degree of glial humanization can be achieved following perinatal delivery of human glial progenitor cells (GPCs) to model the competition between healthy and diseased human glia in vivo. To that end, healthy hGPCs were engrafted into the striatum of adult glial chimeras that had already been chimerized at the neonatal stage with hGPCs generated from human embryonic stem cells (ESCs) derived from subjects with Huntington's disease (HD). HD is a prototypic monogenic neurodegenerative disease that results from expression of a mutant CAG repeat expanded HTT gene (Waldvogel, HJ et al., "Behavioral Neurobiology of Huntington's Disease and Parkinson's Disease," Curr Top Behav Neurosci 22:33-80 (2014); Bates, GP et al., "Huntington Disease," Nat Rev Dis Primers 1:15005 (2015); and Tabrizi, SJ et al., "Huntington Disease: New Insights into Molecular Pathogenesis and Therapeutic Opportunities," Nat Rev Neurol 16:529-546 (2020), which are incorporated by reference in their entireties). It was previously established that glial pathology is inevitably involved in synaptic dysfunction in HD, and that replacement of mouse huntingtin gene (mHTT)-expressing mouse glia with normal wild-type human glia in a transgenic mouse model of HD was sufficient to rescue aspects of the HD phenotype. However, it was not known whether human wild-type glia could replace mHTT-expressing human hGPCs in vivo.
[0015] The ability to replace mHTT-expressing hGPCs in vivo was previously unknown. Applicants established that when healthy hGPCs were delivered to the striatum of adult mice neonatally chimerized with mHTT-expressing hGPCs, the healthy hGPCs spread to the humanized host striatum, outcompeting and replacing already resident mHTT-expressing parenchymal human glial progenitor cells. The dominance of healthy cells persisted with a sustained proliferation advantage and proceeded with the active expulsion of resident HD glia from the tissue. However, the disease state alone was insufficient to explain all the results, as the birth co-engraftment of wild-type (WT) and HD hGPCs together revealed that while expression of mHTT conferred a competitive disadvantage to HD glia, both populations expanded and survived when co-injected. Rather, competitive repopulation of the HD striatum by healthy glia was not driven by the disease state, but by the difference in age, and therefore proliferative capacity, between newly implanted healthy GPCs and resident HD glia. These observations highlight the potential of human GPCs as therapeutic vectors for a variety of neurological disorders that may benefit from glial replacement.
[0016] I. Definition As used herein, the following terms or phrases (in parentheses) shall have the following meanings:
[0017] As used herein, the term "mammal" refers to the group of vertebrates that make up the class Mammalia, characterized in females by the presence of mammary glands that produce milk to nourish (feed) their young neocortex (region of the brain), fur or hair, and the three middle ear bones. Humans are mammals. The term "non-human mammals" includes all mammals except humans.
[0018] As used herein, the term "chimera" refers to an organism that contains a mixture of genetically distinct tissues, formed by processes such as the fusion, transplantation or mutation of early embryos.
[0019] As used herein, the term "corpus callosum" refers to a bundle of nerve fibers in the longitudinal fissure of the brain that allows corresponding regions of the left and right cerebral hemispheres to communicate. The axons and dendrites of neurons at the callosal synapse with cortical neurons are symmetrically associated to points in the hemispheres. Therefore, electrical stimulation of a point in one hemisphere usually results in a response at a symmetrically associated point in the other hemisphere, thanks to these callosal connections. Neurons in the corpus callosum are also shielded by myelin sheaths, which facilitates rapid conduction of electrical action potentials between the hemispheres.
[0020] As used herein, the term "brainstem" refers to the posterior stalk-like portion of the brain that connects the cerebrum with the spinal cord. In the human brain, the brainstem is composed of the midbrain, pons, and medulla oblongata. The midbrain continues to the thalamus in the diencephalon through the tentorial notch, and the diencephalon may be included in the brainstem.
[0021] As used herein, the term "glial cells" refers to a population of non-neuronal cells that provide support and nutrition, maintain homeostasis, form or promote myelination, and participate in signal transduction in the nervous system. As used herein, "glial cells" encompass fully differentiated cells of the glial lineage, such as oligodendrocytes or astrocytes, and glial progenitor cells, each of which may be referred to as macroglial cells. As used herein, the term "HD glia" refers to glia that express mHTT. As used herein, the term "WT glia" refers to glia that do not express mHTT.
[0022] As used herein, the term "human disease-specific glial cells" refers to glial cells that exhibit certain human disease states that are associated with impaired glial cell function or other behavior in a manner that negatively impacts the health of individuals harboring such cells. Such diseases may include, but are not limited to, Huntington's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis.
[0023] As used herein, the term "healthy human glial cells" refers to glial cells, including glial progenitor cells, that function normally and can expand and / or differentiate into functional oligodendrocytes and astrocytes. Healthy human glial cells can include functional oligodendrocytes and astrocytes. In some embodiments, transplanted healthy human glial cells can outcompete the host glial pool and ultimately colonize and dominate the recipient brain.
[0024] As used herein, the term "human neurodegenerative disorder-specific glial cells" refers to glial cells that exhibit a state of certain human neurodegenerative disorders associated with impaired glial cell function or other behavior in a manner that negatively impacts the health of individuals harboring such cells. Such neurodegenerative disorders may include Huntington's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis.
[0025] As used herein, the term "Huntington's disease (HD)" refers to an autosomal dominant neurodegenerative disease characterized by a relentless progressive motor disorder accompanied by devastating mental and cognitive decline. Huntington's disease is associated with consistent severe atrophy of the neostriatum, associated with a marked loss of GABAergic medium spiny neurons, the striatum's main output neurons. Huntington's disease is characterized by an abnormally long CAG repeat expansion in the first exon of the huntingtin gene ("HTT"). The polyglutamine expansion encoded by mutant huntingtin protein disrupts its normal function and protein-protein interactions, ultimately resulting in widespread neuropathology, most rapidly evident in the neostriatum.
[0026] As used herein, the term "frontotemporal dementia" refers to a group of related conditions that result from the progressive degeneration of the temporal and frontal lobes of the brain. These areas of the brain play key roles in decision-making, behavioral control, emotion, and language.
[0027] As used herein, the term "Parkinson's disease" refers to a progressive nervous system disorder that affects movement. Parkinson's disease is characterized by progressive neurodegeneration.
[0028] As used herein, the term "multiple system atrophy" refers to a progressive neurodegenerative disorder characterized by a combination of symptoms affecting both the autonomic nervous system (the part of the nervous system that controls involuntary activities such as blood pressure or digestion) and movement. The symptoms reflect the progressive loss of function and death of different types of nerve cells in the brain and spinal cord.
[0029] As used herein, the term "amyotrophic lateral sclerosis (ALS, commonly referred to as "Lou Gehrig's disease")" refers to the most common motor neuron disease in adults. Motor neuron disease is a neurodegenerative disorder that causes selective loss of nerve cells that directly connect the brain to muscles.
[0030] As used herein, the term "human neuropsychiatric disorder-specific glial cells" refers to glial cells that exhibit the condition of certain human neuropsychiatric disorders associated with impaired glial cell function or other behavior in a manner that negatively impacts the health of individuals harboring such cells. Such neuropsychiatric disorders may include schizophrenia, bipolar disorder, and autism spectrum disorder.
[0031] As used herein, the term "schizophrenia" refers to a serious mental illness that affects how people think, feel, and behave. Symptoms of schizophrenia are generally classified into three categories: 1) psychotic symptoms, including changes in perception; 2) negative symptoms, including loss of motivation, apathy, and lack of pleasure; and 3) cognitive symptoms, including problems with attention, concentration, and memory.
[0032] As used herein, the term "autism spectrum disorder" refers to a neurodevelopmental disorder that causes pervasive impairments in social communication, as well as restricted and repetitive behaviors.
[0033] As used herein, the term "bipolar disorder" refers to a serious mental illness characterized by extreme mood swings. They may include episodes of extreme agitation or extreme depressive feelings. Three types of bipolar disorder include: 1) bipolar I disorder, defined by manic episodes; 2) bipolar II disorder, defined by depressive episodes; and 3) cyclothymic disorder, defined by periods of hypomanic and depressive symptoms.
[0034] As used herein, the term "human myelin disease-specific glial cells" refers to glial cells that exhibit a state of a particular human myelin disease associated with impaired glial cell function or other behavior in a manner that negatively impacts the health of an individual harboring such cells. Such human myelin diseases may include leukodystrophies or white matter diseases.
[0035] As used herein, the term "leukodystrophies" refers to a group of rare, primarily inherited neurological disorders known as leukodystrophies that result from abnormal production, processing, or development of myelin and other components of central nervous system (CNS) white matter, such as cells called oligodendrocytes and astrocytes. All leukodystrophies are the result of a genetic defect (mutation).
[0036] As used herein, the term "white matter" relates to components of the central nervous system in the brain and superficial spinal cord, which consists primarily of glial cells and myelinated axons that transmit signals from one area of the cerebrum to another, and between the cerebral and lower brain centers.
[0037] As used herein, the term "detectable label" refers to any means of labeling a target, whether it is labeled visually or by other means, which labeling should enable it to be identified or distinguished from its background. Examples of detectable labels include, but are not limited to, green fluorescent protein (GFP) and red fluorescent protein (RFP).
[0038] As used herein, the term "prenatal" refers to before, during, or relating to conception.
[0039] As used herein, the term "neonatal period" refers to the period relating to or affecting an infant in the first month of life.
[0040] As used herein, the term "postnatal" refers to the stage of development after birth, including adulthood.
[0041] As used hereinafter, the term "youth-associated genes" refers to genes that have significantly increased expression in young glial progenitor cells compared to older glial progenitor cells.
[0042] In some embodiments, the term "young glial cells" refers to stem cells induced to begin differentiation into glial progenitor cells in an in vitro context at differentiation stage 6 according to the protocol of Wang et al. Cell Stem Cell 12, 252-264, 2013, or at equivalent differentiation stages according to other protocols. Compared to older glial cells, young glial cells may have one or more of the following characteristics: (i) grow or proliferate or divide faster, and (ii) have longer telomeres or higher telomerase activity. In some embodiments, the term "young glial cells" refers to glial progenitor cells or their progeny that are within 1-20 weeks of transplantation into a host. The terms "older glial cells" or "old glial cells" are used in contrast to the term "young glial cells". In some embodiments, the young glial cells are glial cells cultured at differentiation stage 6 according to the protocol of Wang et al. Cell Stem Cell 12, 252-264, 2013, or at an equivalent differentiation stage according to other protocols, for 1-5, 5-10, 5-20, 5-30, 10-20, 10-30, or 20-30 weeks.
[0043] In some embodiments, the older glial cells are 5-10, 5-20, 5-30, 5-40, 5-50, 5-60, 5-70, 5-80, 5-90, 5-100, 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 30-40, 30-50, 30-40, 30-50, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 30-40, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 30-40, 30-50, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 30-100, 30-20, 30-30, 30-40, 30-50, 30-60, 30-70, 30-80, 30-9 ...4 In some embodiments, the older glial cells are derived from glial progenitor cells that have been transplanted into a host for 60, 30-70, 30-80, 30-90, 30-100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-100, 50-60, 50-70, 50-80, 50-90, 50-100, 60-70, 60-80, 60-90, 60-100, 70-80, 70-90, 70-100, 80-90, 80-100, or 90-100 weeks. 12, 252-264, 2013, or at equivalent differentiation stages based on other protocols, 5-100, 5-10, 5-20, 5-30, 5-40, 5-50, 5-60, 5-70, 5-80, 5-90, 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20- The glial cells are cultured for 90, 20 to 100, 30 to 40, 30 to 50, 30 to 60, 30 to 70, 30 to 80, 30 to 90, 30 to 100, 40 to 50, 40 to 60, 40 to 70, 40 to 80, 40 to 90, 40 to 100, 50 to 60, 50 to 70, 50 to 80, 50 to 90, 50 to 100, 60 to 70, 60 to 80, 60 to 90, 60 to 100, 70 to 80, 70 to 90, 70 to 100, 80 to 90, 80 to 100, or 90 to 100 weeks.
[0044] II. Chimeric Non-human Mammal Models One aspect of the present invention relates to a chimeric non-human mammal, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brain stem of the chimeric non-human mammal are human glial cells, wherein the human glial cells comprise a combination of human disease-specific glial cells and healthy human glial cells, wherein the human disease-specific glial cells are tagged with a first detectable label and the healthy human glial cells are tagged with a second detectable label that is distinguishable from the first detectable label.
[0045] In some embodiments, the human disease-specific glial cells comprise human neurodegenerative disorder-specific glial cells, or human neuropsychiatric disorder-specific glial cells, or human myelin disease-specific glial cells.
[0046] In some embodiments, the human disease-specific glial cells comprise human neurodegenerative disorder-specific glial cells, and the human neurodegenerative disorder is selected from the group consisting of Huntington's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis.
[0047] In some embodiments, the human disease-specific glial cells comprise Huntington's disease-specific glial cells.
[0048] In some embodiments, the human disease-specific glial cells comprise human neuropsychiatric disorder-specific glial cells, wherein the human neuropsychiatric disorder is selected from the group consisting of schizophrenia, autism spectrum disorder, and bipolar disorder.
[0049] In some embodiments, the human disease-specific glial cells comprise human myelin disease-specific glial cells, and the human myelin disease is a leukodystrophy or a white matter disease.
[0050] In some embodiments, the human disease-specific glial cells are derived from human disease-specific glial progenitor cells implanted on a first implantation date, and the healthy human glial cells are derived from healthy human glial progenitor cells implanted on a second implantation date, wherein the first implantation date is the same as the second implantation date.
[0051] In some embodiments, the human disease-specific glial cells are derived from human disease-specific glial progenitor cells implanted on a first implantation date, and the healthy human glial cells are derived from healthy human glial progenitor cells implanted on a second implantation date, wherein the first implantation date is earlier than the second implantation date.
[0052] In some embodiments, the first implantation date is 5-100, 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 10-15, 10-20, 10-25, 10-30, 10-35, 10-40, 10-45, 10-50, 10-55, 10-60, 10-65, 10-70, 10-75, 10-80, 10-85, 10-90, 10-95, 10-100, 15-20, 15-25, 1 5~30, 15~35, 15~40, 15~45, 15~50, 15~55, 15~60, 15~65, 15~70, 15~75, 15~80, 15~85, 15~90, 15~95, 15~100, 20~25, 20~30, 20~35, 20~40, 20~45, 20~5 0, 20~55, 20~60, 20~65, 20~70, 20~75, 20~80, 20~85, 20~90, 20~95, 20~100, 25~30, 25~35, 25~40, 25~45, 25~50, 25~55, 25~60, 25~65, 25~70, 25~75, 25 ~80, 25~85, 25~90, 25~95, 25~100, 30~35, 30~40, 30~45, 30~50, 30~55, 30~60, 30~65, 30~70, 30~75, 30~80, 30~85, 30~90, 30~95, 30~100, 35~40, 35~4 5, 35~50, 35~55, 35~60, 35~65, 35~70, 35~75, 35~80, 35~85, 35~90, 35~95, 35~100, 40~45, 40~50, 40~55, 40~60, 40~65, 40~70, 40~75, 40~80, 40~85, 40 ~90, 40~95, 40~100, 45~50, 45~55, 45~60, 45~65, 45~70, 45~75, 45~80, 45~85, 45~90, 45~95, 45~100, 50~55, 50~60, 50~65, 50~70, 50~75, 50~80, 50~8 5, 50~90, 50~95, 50~100, 55~60, 55~65, 55~70, 55~75, 55~80, 55~85, 55~90, 55~95, 55~100, 60~65, 60~70, 60~75, 60~80, 60~85, 60~90, 60~95, 60~100,65-70, 65-75, 65-80, 65-85, 65-90, 65-95, 65-100, 70-75, 70-80, 70-85, 70-90, 70-95, 70-100, 75-80, 75-85, 75-90, 75-95, 75-100, 80-85, 80-90, 80-95, 80-100, 85-90, 85-95, 85-100, 90-95, 90-100 or 95-100 weeks ago.
[0053] In some embodiments, the first implantation date is 30 to 40 weeks prior to the second implantation date.
[0054] In some embodiments, the human neurodegenerative disorder-specific glial cells of the non-human mammal described herein exhibit glial cell pathology, such as glial cell-specific gene expression, growth, structure, organization, differentiation, proliferation, etc., associated with the neurodegenerative disorder. Similarly, the non-human mammal model of a human neurodegenerative disease described herein exhibits at least some of the pathological, physiological, and behavioral characteristics and phenotypes associated with the human neurodegenerative disorder. For example, in one embodiment, the non-human mammal model is a model of Huntington's disease. In this embodiment, the mammal model exhibits significantly slower motor learning and attenuated motor coordination, characteristic of Huntington's disease, compared to a healthy non-human mammal (i.e., a non-human mammal comprising non-diseased human glial cells). Similarly, the striatal neurons of the non-human mammal model of Huntington's disease exhibit increased neuronal excitability and decreased input resistance, compared to the striatal neurons of a healthy non-human mammal. This neuronal phenotype is characteristic of the neuronal phenotype in human patients with Huntington's disease.
[0055] In some embodiments, the human neurodegenerative disorder-specific glial cells of the non-human mammalian model are derived from a human patient with the disorder. In another embodiment, the human neurodegenerative disorder-specific glial cells of the non-human mammalian model are engineered to be neurodegenerative disorder-specific, i.e., the cells are engineered to contain one or more gene mutations associated with a neurodegenerative disease and / or to increase or decrease the expression of one or more disease-associated biomolecules (e.g., proteins, polysaccharides, lipids, or nucleic acid molecules). For example, as described herein, an exemplary non-human mammalian model of Huntington's disease may include human glial cells engineered to express a mutant Huntingtin gene with an expansion of CAG (cytosine-adenine-guanine) triplet repeats.
[0056] The human neurodegenerative disorder-specific glial cells of the non-human mammal models described herein may be derived from any suitable source of glial cells, such as, for example, but not limited to, human induced pluripotent stem cells (iPSCs), embryonic stem cells, fetal tissue, glial progenitor cells, and / or astrocytes, as described in more detail below.
[0057] In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of all glial cells in the white matter of the brain and / or brain stem of the chimeric non-human mammal are human glial cells. In some embodiments, the white matter is cerebellar white matter, and at least 50% of all glial cells in the cerebellar white matter of the mammalian brain are human glial cells.
[0058] In some embodiments, at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of all glial cells in the corpus callosum of the brain of the chimeric non-human mammal are human glial cells.
[0059] In some embodiments, at least 70% of all glial cells in the corpus callosum of the brain of the chimeric non-human mammal are human glial cells.
[0060] In some embodiments, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of the glial cells in the corpus callosum of the chimeric non-human mammal are human neurodegenerative disorder-specific glial cells.
[0061] In another embodiment, at least 50% of all glial cells in the corpus callosum of the chimeric non-human mammal are human neurodegenerative disorder-specific glial cells.
[0062] In another embodiment, at least 70% of all glial cells in the corpus callosum of the chimeric non-human mammal are human neurodegenerative disorder-specific glial cells.
[0063] In yet another embodiment, at least 90% of all glial cells in the corpus callosum of the non-human mammal are human neurodegenerative disorder-specific glial cells.
[0064] In some embodiments, the brain or brainstem of the chimeric non-human mammal comprises human neurodegenerative disorder glial cells, and the human neurodegenerative disorder is selected from the group consisting of Huntington's disease, Alzheimer's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis. The non-human mammal models described herein are models of human neurodegenerative disorders. Neurodegenerative disorders or diseases are chronic, progressive neuropathies characterized by selective and generally symmetric loss of neurons in the motor, sensory, or cognitive systems.
[0065] In some embodiments, the brain or brainstem of the chimeric non-human mammal comprises human neuropsychiatric disorder glial cells, and the human neuropsychiatric disorder is selected from the group consisting of schizophrenia, autism spectrum disorder, and bipolar disorder.
[0066] In some embodiments, the brain or brain stem of the chimeric non-human mammal has a human myelin disease, and the human myelin disease is a leukodystrophy or a white matter disease. In one embodiment, the chimeric non-human mammal is hypomyelinated. A hypomyelinated mammal comprises an abnormally reduced amount of myelin. In another embodiment, the chimeric non-human mammal has normal levels of myelin throughout its brain and brain stem.
[0067] Another aspect of the present invention relates to a chimeric non-human mammal, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brain stem of the chimeric non-human mammal are human glial cells, the human glial cells comprising a first population of healthy human glial cells tagged with a first detectable label and a second population of healthy human glial cells tagged with a second detectable label distinguishable from the first detectable label.
[0068] In some embodiments, the first population of healthy human glial cells is derived from a first population of healthy human glial progenitor cells implanted on a first implantation date, and the second population of healthy human glial cells is derived from a second population of healthy human glial progenitor cells implanted on a second implantation date, wherein the first implantation date is the same as the second implantation date.
[0069] In some embodiments, the first population of healthy human glial cells is derived from a first population of healthy human glial progenitor cells implanted on a first implantation date, and the second population of healthy human glial cells is derived from a second population of healthy human glial progenitor cells implanted on a second implantation date, wherein the first implantation date is earlier than the second implantation date.
[0070] In some embodiments, the first implantation date is 5-100, 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 10-15, 10-20, 10-25, 10-30, 10-35, 10-40, 10-45, 10-50, 10-55, 10-60, 10-65, 10-70, 10-75, 10-80, 10-85, 10-90, 10-95, 10-100, 15-20, 15-25, 1 5~30, 15~35, 15~40, 15~45, 15~50, 15~55, 15~60, 15~65, 15~70, 15~75, 15~80, 15~85, 15~90, 15~95, 15~100, 20~25, 20~30, 20~35, 20~40, 20~45, 20~5 0, 20~55, 20~60, 20~65, 20~70, 20~75, 20~80, 20~85, 20~90, 20~95, 20~100, 25~30, 25~35, 25~40, 25~45, 25~50, 25~55, 25~60, 25~65, 25~70, 25~75, 25 ~80, 25~85, 25~90, 25~95, 25~100, 30~35, 30~40, 30~45, 30~50, 30~55, 30~60, 30~65, 30~70, 30~75, 30~80, 30~85, 30~90, 30~95, 30~100, 35~40, 35~4 5, 35~50, 35~55, 35~60, 35~65, 35~70, 35~75, 35~80, 35~85, 35~90, 35~95, 35~100, 40~45, 40~50, 40~55, 40~60, 40~65, 40~70, 40~75, 40~80, 40~85, 40 ~90, 40~95, 40~100, 45~50, 45~55, 45~60, 45~65, 45~70, 45~75, 45~80, 45~85, 45~90, 45~95, 45~100, 50~55, 50~60, 50~65, 50~70, 50~75, 50~80, 50~8 5, 50~90, 50~95, 50~100, 55~60, 55~65, 55~70, 55~75, 55~80, 55~85, 55~90, 55~95, 55~100, 60~65, 60~70, 60~75, 60~80, 60~85, 60~90, 60~95, 60~100,65-70, 65-75, 65-80, 65-85, 65-90, 65-95, 65-100, 70-75, 70-80, 70-85, 70-90, 70-95, 70-100, 75-80, 75-85, 75-90, 75-95, 75-100, 80-85, 80-90, 80-95, 80-100, 85-90, 85-95, 85-100, 90-95, 90-100 or 95-100 weeks ago.
[0071] In some embodiments, the first implantation date is 30 to 40 weeks prior to the second implantation date.
[0072] The chimeric non-human mammal of the present invention can be of any age. In some embodiments, the chimeric non-human mammal is postnatal. As used herein, the term "postnatal" refers to a mammal of any age after birth, including an adult mammal. In some embodiments, the chimeric non-human mammal is neonatal. In some embodiments, the chimeric non-human mammal is an adult.
[0073] The chimeric non-human mammal of the present invention may be any mammal, including mice, rats, guinea pigs, other small rodents, dogs, cats, sheep, goats, and monkeys. In a preferred embodiment of the present invention, the chimeric non-human mammal is a mouse. Suitable strains of mice include, but are not limited to, CD-1 nude mice, NU / NU mice, BALB / C nude mice, BALB / C mice, NIH-III mice, SCID mice, outbred SCID mice, SCID Beige mice, C3H mice, C57BL / 6 mice, DBA / 2 mice, FVB mice, CB17 mice, 129 mice, SJL mice, B6C3F1 mice, BDF1 mice, CDF1 mice, CB6F1 mice, CF-1 mice, Swiss Webster mice, SKH1 mice, PGP mice, and B6SJL mice.
[0074] In some embodiments, the chimeric non-human mammals of the invention are immunocompetent, immunodeficient, or immunosuppressed.
[0075] III. Methods for Generating Chimeric Non-Human Mammals Another aspect of the present invention relates to a method for generating a chimeric non-human mammal comprising human glial cells. In some embodiments, the method comprises the steps of: introducing a first population of human glial progenitor cells into the brain and / or brainstem of the non-human mammal, the first population of human glial cells being tagged with a first detectable label; introducing a second population of human glial progenitor cells into the brain and / or brainstem of the non-human mammal, the second population of human glial cells being tagged with a second detectable label that is distinguishable from the first detectable label; and recovering a chimeric non-human mammal having human glial cells that at least partially replace native glial cells in the brain or brainstem as a result of the introducing step, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brainstem of the chimeric non-human mammal are human glial cells.
[0076] In some embodiments, the first population of human glial progenitor cells are human disease-specific glial progenitor cells and the second population of human glial progenitor cells are healthy human glial progenitor cells. In some embodiments, the human disease-specific glial progenitor cells comprise human neurodegenerative disorder-specific glial progenitor cells, or human neuropsychiatric disorder-specific glial progenitor cells, or human myelin disease-specific glial progenitor cells. In some embodiments, the human disease-specific glial progenitor cells comprise Huntington's disease-specific glial progenitor cells.
[0077] In some embodiments, the first population of human glial progenitor cells are healthy human glial progenitor cells and the second population of human glial progenitor cells are healthy human glial progenitor cells.
[0078] In some embodiments, the first population of human glial progenitor cells and the second population of human glial progenitor cells are introduced into the brain and / or brain stem of the non-human mammal at the same time.
[0079] In some embodiments, a first population of human glial progenitor cells is introduced into the brain and / or brain stem of the non-human mammal on a first implantation date and a second population of human glial progenitor cells is introduced into the brain and / or brain stem of the non-human mammal on a second implantation date, the first implantation date being earlier than the second implantation date.
[0080] In some embodiments, the first implantation date is 5-100, 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 10-15, 10-20, 10-25, 10-30, 10-35, 10-40, 10-45, 10-50, 10-55, 10-60, 10-65, 10-70, 10-75, 10-80, 10-85, 10-90, 10-95, 10-100, 15-20, 15-25, 1 5~30, 15~35, 15~40, 15~45, 15~50, 15~55, 15~60, 15~65, 15~70, 15~75, 15~80, 15~85, 15~90, 15~95, 15~100, 20~25, 20~30, 20~35, 20~40, 20~45, 20~5 0, 20~55, 20~60, 20~65, 20~70, 20~75, 20~80, 20~85, 20~90, 20~95, 20~100, 25~30, 25~35, 25~40, 25~45, 25~50, 25~55, 25~60, 25~65, 25~70, 25~75, 25 ~80, 25~85, 25~90, 25~95, 25~100, 30~35, 30~40, 30~45, 30~50, 30~55, 30~60, 30~65, 30~70, 30~75, 30~80, 30~85, 30~90, 30~95, 30~100, 35~40, 35~4 5, 35~50, 35~55, 35~60, 35~65, 35~70, 35~75, 35~80, 35~85, 35~90, 35~95, 35~100, 40~45, 40~50, 40~55, 40~60, 40~65, 40~70, 40~75, 40~80, 40~85, 40 ~90, 40~95, 40~100, 45~50, 45~55, 45~60, 45~65, 45~70, 45~75, 45~80, 45~85, 45~90, 45~95, 45~100, 50~55, 50~60, 50~65, 50~70, 50~75, 50~80, 50~8 5, 50~90, 50~95, 50~100, 55~60, 55~65, 55~70, 55~75, 55~80, 55~85, 55~90, 55~95, 55~100, 60~65, 60~70, 60~75, 60~80, 60~85, 60~90, 60~95, 60~100,65-70, 65-75, 65-80, 65-85, 65-90, 65-95, 65-100, 70-75, 70-80, 70-85, 70-90, 70-95, 70-100, 75-80, 75-85, 75-90, 75-95, 75-100, 80-85, 80-90, 80-95, 80-100, 85-90, 85-95, 85-100, 90-95, 90-100 or 95-100 weeks ago.
[0081] In some embodiments, the first implantation date is 30 to 40 weeks prior to the second implantation date.
[0082] A non-human mammal suitable for carrying out the method of the present invention may be of any age. In some embodiments, the non-human mammal is prenatal. In some embodiments, the non-human mammal is neonatal. In some embodiments, the non-human mammal is adult.
[0083] Any non-human mammal, including mice, rats, guinea pigs, other small rodents, dogs, cats, sheep, goats, and monkeys, is suitable for carrying out the method of the present invention. In a preferred embodiment of the present invention, the non-human mammal is a mouse. Suitable strains of mice include, but are not limited to, CD-1 nude mice, NU / NU mice, BALB / C nude mice, BALB / C mice, NIH-III mice, SCID mice, outbred SCID mice, SCID Beige mice, C3H mice, C57BL / 6 mice, DBA / 2 mice, FVB mice, CB17 mice, 129 mice, SJL mice, B6C3F1 mice, BDF1 mice, CDF1 mice, CB6F1 mice, CF-1 mice, Swiss Webster mice, SKH1 mice, PGP mice, and B6SJL mice.
[0084] In some embodiments, non-human mammals suitable for carrying out the methods of the invention are immunocompetent, immunodeficient, or immunosuppressed.
[0085] According to the method of the present invention, the population of human glial cells to be transplanted into the chimeric non-human mammal is preferably bipotential glial progenitor cells. In one embodiment, the glial progenitor cells can be biased towards the generation of oligodendrocytes. Alternatively, the glial progenitor cells can be biased towards the generation of astrocytes. In a further embodiment of the present invention, the human glial cells to be transplanted into the non-human mammal can be astrocytes.
[0086] The glial precursor cells may be obtained from embryonic, fetal or adult brain tissue, embryonic stem cells, or induced pluripotent cells. Preferably, the glial precursor cells are isolated from the ventricular and subventricular zones of the brain or from the subcortical white matter.
[0087] iPSCs are pluripotent cells derived from non-pluripotent cells, such as somatic cells. For example, but not limited to, iPSCs can be derived from tissues, peripheral blood, umbilical cord blood, and bone marrow (see, e.g., Cai et al., "Generation of Human Induced Pluripotent Stem Cells from Umbilical Cord Matrix and Amniotic Membrane Mesenchymal Cells," J. Biol. Chem. 285(15):11227-11234 (2010); Giorgetti et al., "Generation of Induced Pluripotent Stem Cells from Human Cord Blood Cells with only Two Factors: Oct4 and Sox2," Nat. Protocol. 5(4):811-820 (2010); Streckfuss-Bomeke et al., "Comparative Study of Human-Induced Pluripotent Stem Cells Derived from Bone Marrow Cells, Hair Keratinocytes, and Skin Fibroblasts," Eur. Heart. See, J. (2012); Hu et al., "Efficient Generation of Transgene-Free Induced Pluripotent Stem Cells from Normal and Neoplastic Bone Marrow and Cord Blood Mononuclear Cells," Blood (2011); Sommer et al., "Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood using the STEMCCA Lentiviral Vector," J. Vis. Exp. 68:e4327 (2012), which are incorporated by reference in their entireties. Somatic cells are reprogrammed to an embryonic stem cell-like state using genetic manipulation.Exemplary somatic cells suitable for generating iPSCs include fibroblasts (see, e.g., Streckfuss-Bomeke et al., "Comparative Study of Human-Induced Pluripotent Stem Cells Derived from Bone Marrow Cells, Hair Keratinocytes, and Skin Fibroblasts," Eur. Heart J. (2012), which is incorporated by reference in its entirety), such as dermal fibroblasts obtained by skin sample or biopsy, synoviocytes from synovial tissue, keratinocytes, mature B cells, mature T cells, pancreatic beta cells, melanocytes, hepatocytes, foreskin cells, cheek cells, or lung fibroblasts.
[0088] Methods for generating induced pluripotent stem cells are known in the art and typically include expressing a combination of reprogramming factors in somatic cells. Suitable reprogramming factors that promote and induce iPSC generation include one or more of octamer-binding transcription factor 4 (Oct4), Krüppel-like factor 4 (Klf4), SRY (sex determining region Y)-box 2 (Sox2), c-Myc, Nanog, CCAAT enhancer binding protein alpha (C / EBPα), estrogen-related receptor beta (Esrrb), Lin28, and nuclear receptor subfamily 5, group A, member 2 (Nr5a2). In certain embodiments, at least two reprogramming factors are expressed in somatic cells to successfully reprogram somatic cells. In other embodiments, at least three reprogramming factors are expressed in somatic cells to successfully reprogram somatic cells.
[0089] iPSCs may be derived by methods known in the art, including the use of integrative viral vectors (e.g., lentiviral vectors, inducible lentiviral vectors, and retroviral vectors), excisable vectors (e.g., transposon and loxP-introduced lentiviral vectors), and non-integrative vectors (e.g., adenoviral and plasmid vectors) to deliver genes that promote cellular reprogramming (Takahashi, K. and Yamanaka, S., "Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors," Cell 126:663-676 (2006); Okita. et al., "Generation of Germline-Competent Induced Pluripotent Stem Cells," Nature 448:313-317 (2007); Nakagawa et al., Nat. Biotechnol. 26:101-106 (2007); Takahashi et al., "Induction of Pluripotent "Stem Cells from Adult Human Fibroblasts by Defined Factors", Cell 131:1~12 (2007); Meissner et al., "Direct Reprogramming of Genetically Unmodified Fibroblasts into Pluripotent Stem Cells", Nat.Biotech.25:1177-1181 (2007); Yu et al., "Induced Pluripotent Stem Cell Lines Derived from Human Somatic Cells," Science 318:1917-1920 (2007); Park et al., "Reprogramming of Human Somatic Cells Pluripotency with Defined Factors," Nature 451:141-146 (2008); and U.S. Patent Application Publication No. 2008 / 0233610, which are incorporated by reference in their entireties. Other methods for generating IPS cells include those described in WO2007 / 069666, WO2009 / 006930, WO2009 / 006997, WO2009 / 007852, WO2008 / 118820, U.S. Patent Application Publication No. 2011 / 0200568 to Ikeda et al., U.S. Patent Application Publication No. 2010 / 0156778 to Egusa et al., U.S. Patent Application Publication No. 2012 / 0276070 to Music, and U.S. Patent Application Publication No. 2012 / 0276636 to Nakagawa, Shi et al., "Induction of Pluripotent Stem Cells from Mouse Embryonic Fibroblasts by Oct4 and Klf4 with Small-Molecule Compounds" Cell Stem Cell 3(5):568~574(2008), Kim et al., "Pluripotent Stem Cells Induced from Adult Neural Stem Cells by Reprogramming with Two Factors", Nature 454:646~650(2008), Kim et al., "Oct4-induced Pluripotency in Adult Neural Stem Cells", Cell 136(3):411~419 (2009), Huangfu et al., “Induction of Pluripotent Stem Cells from Primary Human Fibroblasts with Only Oct4 and Sox2”, Nat.Biotechnol.26:1269-1275 (2008), Zhao et al., "Two Supporting Factors Greatly Improve the Efficiency of Human iPSC Generation", Cell Stem Cell 3:475-479 (2008), Feng et al., "Reprogramming of Fibroblasts into Induced Pluripotent Stem Cells with Orphan Nuclear Receptor Esrrb", Nat. Cell Biol. 11:197-203 (2009), and Hanna et al., "Direct Reprogramming of Terminally Differentiated Mature B Lymphocytes to Pluripotency" Cell 133(2):250-264 (2008), which are incorporated herein by reference in their entireties.
[0090] The methods of iPSC generation described above can be modified to include small molecules that enhance reprogramming efficiency or even substitutions for reprogramming factors. These small molecules include, but are not limited to, epigenetic modulators, such as the DNA methyltransferase inhibitor 5'-azacytidine, the histone deacetylase inhibitor VPA, and the G9a histone methyltransferase inhibitors BIX-01294 and BayK8644, L-type calcium channel agonists. Other small molecule reprogramming factors include those that target signaling pathways, such as transforming growth factor beta (TGF-β) inhibitors and kinase inhibitors (e.g., Kenpaullone) (see review by Sommer and Mostoslavsky, "Experimental Approaches for the Generation of Induced Pluripotent Stem Cells," Stem Cell Res. Ther. 1:250-264 (2010), which is incorporated herein by reference in its entirety).
[0091] Methods for obtaining highly enriched preparations of glial progenitor cells from iPSCs, which are suitable for generating the chimeric non-human mammalian models described herein, are disclosed in WO 2014 / 124087 to Goldman and Wang, and in Wang et al., “Human iPSC-Derived Oligodendrocyte Progenitors Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination,” Cell Stem Cell 12(2):252-264 (2013), which are incorporated by reference in their entireties.
[0092] In some embodiments, the human neurodegenerative disorder-specific glial cells of the chimeric non-human mammalian model described herein are derived from embryonic stem cells. Human embryonic stem cells provide a virtually unlimited source of cloned / genetically modified cells potentially useful for tissue replacement therapy. Methods for obtaining highly enriched preparations of embryonic cell-derived glial progenitor cells suitable for generating the chimeric non-human mammalian model of the present disclosure are described herein as disclosed in Wang et al., "Human iPSC-Derived Oligodendrocyte Progenitor Cells can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety.
[0093] In some embodiments, the human glial cells of the chimeric non-human mammal are derived from human fetal tissue. Glial progenitor cells can be extracted directly from fetal brain tissue containing a mixed population of cells by using a promoter-specific isolation technique, as described in US Patent Application Publication Nos. 20040029269 and 20030223972 to Goldman, which are incorporated herein by reference in their entirety. The method includes selecting a promoter that functions specifically in glial progenitor cells, and introducing a nucleic acid encoding a marker protein under the control of the promoter into the mixed population cells. The mixed population of cells is capable of expressing the marker protein, and the cells expressing the marker protein are separated from the population of cells, and the separated cells are glial progenitor cells. Human glial progenitor cells can be isolated from the ventricular or subventricular zone of the brain, or from subcortical white matter.
[0094] Glial progenitor cells can be extracted directly from brain tissue containing a mixed population of cells by using a promoter-specific isolation technique, as described in U.S. Patent Application Publication Nos. 20040029269 and 20030223972 to Goldman, which are incorporated by reference in their entireties. The method includes selecting a promoter that functions specifically in glial progenitor cells, and introducing a nucleic acid encoding a marker protein under the control of the promoter into the mixed population cells. The mixed population of cells is allowed to express the marker protein, and the cells expressing the marker protein are separated from the population of cells, and the separated cells are glial progenitor cells.
[0095] Glial-specific promoters that can be used to isolate glial precursor cells from a mixed population of cells include the CNP promoter (Scherer et al., "Differential Regulation of the 2',3'-cyclic Nucleotide 3'phosphodiesterase Gene During Oligodendrocyte Development", Neuron 12:1363-75 (1994), which is incorporated herein by reference in its entirety), the NCAM promoter (Hoist et al., J. Biol. Chem. 269:22245-52 (1994), which is incorporated herein by reference in its entirety), the myelin basic protein promoter (Wrabetz et al., "Analysis Of Human MBP Promoter In Primary Cultures Of Oligodendrocytes: Positive And Negative Cis-Acting Elements In Proximal MBP Promoter Mediate Oligodendrocyte-Specific Expression Of MBP", J. Neurosci. Res. 36:455-71 (1993), which is incorporated herein by reference in its entirety), the JC virus minima core promoter (Krebs et al., J. Virol. 69:2434-42 (1995), which is incorporated herein by reference in its entirety), the myelin-associated glycoprotein promoter (Laszkiewicz et al., "Structural Characterization of Myelin-associated Glycoprotein Gene Core Promoter", J. Neurosci. Res. 50(6):928-36 (1997), which is incorporated herein by reference in its entirety), or the proteolipid protein promoter (Cook et al., "Regulation of Rodent Myelin Proteolipid Protein Gene Expression", Neurosci. Lett.137(1):56-60 (1992); Wight et al., "Regulation of Murine Myelin Proteolipid Protein Gene Expression," J. Neurosci. Res. 50(6):917-27 (1997); and Cambi et al., Neurochem. Res. 19:1055-60 (1994), which are incorporated by reference in their entireties. See also U.S. Patent No. 6,245,564 to Goldman et al., which is incorporated by reference in its entirety.
[0096] In some embodiments, glial precursor cells are first isolated by removing neurons or neuronal precursor cells from a mixed cell population.If neuronal precursor cells are to be separated from a mixed cell population, they can be removed based on their surface expression of neural cell adhesion molecule (NCAM), polysialic acid-NCAM (PSA-NCAM), or any other surface moiety specific for neurons or neuronal precursor cells.Neurons or neuronal precursor cells can also be separated from a mixed cell population using promoters based on separation techniques. Neuron or neuronal precursor cell specific promoters that can be used to separate neural cells from a mixed population of cells include the Tα1 tubulin promoter (Gloster et al., J. Neurosci. 14:7319-30 (1994), which is incorporated herein by reference in its entirety), the Hu promoter (Park et al., "Analysis of Upstream Elements in the HuC Promoter Leads to the Establishment of Transgenic Zebrafish with Fluorescent Neurons", Dev. Biol. 227(2):279-93 (2000), which is incorporated herein by reference in its entirety), the ELAV promoter (Yao et al., "Neural Specificity of ELAV Expression: Defining a Drosophila Promoter for Directing Expression to the Nervous System", J. Neurochem. 63(1):41-51 (1994), which is incorporated herein by reference in its entirety), the microtubule-associated protein (MAP)-IB promoter (Liu et al., Gene 171:307-08 (1996), which is incorporated herein by reference in its entirety), or the GAP-43 promoter. See U.S. Patent No. 6,245,564 to Goldman et al., which is incorporated herein by reference in its entirety.
[0097] A promoter specific for the cells of interest is selected, and a nucleic acid molecule encoding a protein marker, preferably green fluorescent protein, under the control of the promoter is introduced into the number of cells to be sorted. The isolated nucleic acid molecule encoding green fluorescent protein can be deoxyribonucleic acid (DNA) or ribonucleic acid (including RNA, messenger RNA or mRNA), genomic, recombinant, or mutant, biologically isolated or synthetic, as described in U.S. Patent Application No. 20040029269 to Goldman, which is incorporated herein by reference in its entirety. Other suitable marker proteins include lacZ / beta-galactosidase or alkaline phosphatase.
[0098] A nucleic acid molecule encoding a marker protein is then placed under the control of a selected cell-specific promoter using standard techniques, which generally involve the use of restriction enzymes and ligation.
[0099] The resulting construct (optionally with other suitable regulatory elements) containing a nucleic acid molecule encoding a marker protein under the control of a selected promoter (the nucleic acid molecule itself) is then introduced into a number of cells to be selected, which are then selected. Techniques for introducing the nucleic acid molecule of the construct into a number of cells and then selecting the cells are described in U.S. Patent Application No. 20040029269 to Goldman et al., which is incorporated herein by reference in its entirety.
[0100] When a nucleic acid molecule encoding a marker protein is introduced into a large number of cells, only the promoter that controls the expression of the marker protein functions in the cells of interest. Thus, the marker protein is expressed only in the cells of interest, and the cells can be identified from among the large number of cells by the expression of the marker protein (e.g., the fluorescence of green fluorescent protein (GFP) using any suitable means of fluorescence detection). For GFP, the cells can be identified using epifluorescence optics, and can be physically removed and brought together by Laser Tweezers (Cell Robotics Inc., Albuquerque, N.Mex.). Alternatively, the cells can be separated in bulk by fluorescence-activated cell sorting, a method that efficiently separates fluorescent cells from non-fluorescent cells.
[0101] As an alternative to using promoter-based cell sorting to recover glial progenitor cells from a mixed population, immunoisolation procedures can be utilized. In positive immunoselection techniques, the desired cells (i.e., glial progenitor cells) are isolated based on the proteinaceous surface markers that naturally occur on progenitor cells. For example, the surface marker A2B5 is the first early marker to be expressed. See Nunes et al., "Identification and Isolation of Multipotential Neural Progenitor Cells from the Adult Human White Matter," Soc.Neurosci.Abstr. (2001), which is incorporated herein by reference. Using an antibody specific to that marker, glial progenitor cells can be separated from a mixed population of cell types. Using an antibody specific to A2B5, glial progenitor cells can be separated from a mixed population of cell types. Similarly, the surface marker CD44 identifies astrocyte-biased glial precursor cells (Liu et al., "CD44 Expression Identifies Astrocyte-Restricted Precursor Cells," Dev. Biol. 276:31-46 (2004), which is incorporated herein by reference in its entirety).
[0102] Using CD44-conjugated microbead technology, astrocyte-biased glial progenitor cells can be separated from a mixed population of cell types. Oligodendrocyte-biased glial progenitor cells can be separated from a mixed population of cell types based on expression of platelet-derived growth factor receptor alpha (PDGFαR), PDGFαR ectodomain CD140a, or CD9. Cells expressing markers of non-glial cell types (e.g., neurons, inflammatory cells, etc.) can be removed from the preparation of glial cells using immunoisolation techniques to further enrich the preparation for the desired glial cell type. For example, the glial progenitor cell population is preferably negative for the PSA-NCAM marker and / or other markers for cells of neuronal lineage, negative for one or more inflammatory cell markers, such as negative for the CD11 marker, negative for the CD32 marker, and / or negative for the CD36 marker, which is a marker for microglia. Exemplary microbead technologies include MACS® microbeads, MACS® columns, and MACS® separators.Additional examples of immunoisolation are described in Wang et al., "Prospective Identification, Direct Isolation, and Expression Profiling of a Telomerase Expressing Subpopulation of Human Neural Stem Cells, Using Sox2 Enhancer-Directed FACS," J. Neurosci. 30:14635-14648 (2010); Keyoung et al., "High-Yield Selection and Extraction of Two Promoter-Defined Phenotypes of Neural Stem Cells from the Fetal Human Brain," Nat. Biotechnol. 19:843-850 (2001); and Windrem et al., "Neonatal Chimerization with Human Glial Progenitor Cells can both Remyelinate and Rescue the Otherwise Lethally Hypomyelinated Shiverer Mouse," Cell Stem Cell 2:553-565 (2008), which are incorporated by reference in their entireties.
[0103] Alternatively, or in combination with the positive immunoselection method described above, the mixed cell population can be depleted of undesired cell types, leaving the desired cell population. This method includes separating cells based on proteinaceous cell markers that are specific for cell populations other than glial progenitor cells (i.e., neurons, endothelial cells, etc.) and retaining the glial progenitor cell population. According to the method of generating a non-human mammalian model of a human neurodegenerative disorder, the selected preparation of human neurodegenerative disorder-specific glial cells administered comprises at least about 80% glial cells, for example, about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% glial cells. The selected preparation of glial cells can be relatively devoid (e.g., contain less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1%) of other cell types, such as neurons or cells of neuronal lineage, fibrous astrocytes and cells of fibrous astrocyte lineage, and pluripotent stem cells (such as embryonic stem cells). Optionally, an exemplary cell population is a substantially pure population of glial cells.
[0104] Cell-specific antibodies for immunoseparation techniques can be labeled with fluorescent, biotin, or hapten labels to facilitate separation of the cells to which they bind.
[0105] Alternatively, the antibodies can be attached to paramagnetic beads such that cells that bind to the beads through the attached antibodies can be recovered by a biomagnetic separation process. Any other suitable method for cell separation known in the art, including attachment to and detachment from a solid phase (i.e., immunopanning), is also within the scope of the present invention.
[0106] To generate the chimeric non-human mammalian model described herein, a population of isolated human neurodegenerative disorder-specific glial cells is introduced into multiple locations within the forebrain and / or brainstem of the non-human mammalian model. The population of introduced cells may be a population of glial progenitor cells and / or astrocyte cells. As described above, the glial progenitor cells and / or astrocytes may be derived from any suitable source, e.g., iPSCs, embryonic stem cells, fetal tissue, glial progenitor cells. As described above, the glial progenitor cells and / or astrocytes may be derived from a patient with a neurodegenerative disease. Alternatively, the glial progenitor cells or astrocytes are engineered into a neurodegenerative disorder-specific state. Suitable methods of introducing cells into the forebrain and / or brainstem of the non-human mammalian model are well known to those skilled in the art and include, but are not limited to, injection, deposition, and transplantation as described herein.
[0107] Glial progenitor cells can be transplanted bilaterally into multiple sites in a non-mammalian host animal. Methods for transplanting neural tissue and cells into a host brain are described by Bjorklund and Stenevi (eds.), Neural Grafting in the Mammalian CNS, Chapters 3-8, Elsevier, Amsterdam (1985); U.S. Patent No. 5,082,670 to Gage et al.; and U.S. Patent No. 6,497,872 to Weiss et al., which are incorporated herein by reference in their entireties. In one embodiment, glial progenitor cells are prepared by the method of the present invention as described in U.S. Pat. No. 7,524,491 to Goldman; Windrem et al., "Neonatal Chimerization With Human Glial Progenitor Cells Can Both Remyelinate and Rescue the Otherwise Lethally Hypomyelinated Shiverer Mouse," Cell Stem Cell 2:553-565 (2008); Han et al., "Forebrain Engraftment by Human Glial Progenitor Cells Enhances Synaptic Plasticity and Learning Adult Mice," Cell Stem Cell 12:342-353 (2013); and Wang et al., "Human iPSC-Derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12:342-353 (2013), which are incorporated by reference in their entireties. 12:252-264 (2013), the cells are then bilaterally implanted into multiple sites in a non-mammalian host animal.Methods for transplanting neural tissue and cells into a host brain have been described, and in one embodiment, glial progenitor cells are used in the transplantation of neural tissue and cells into a host brain, as described in U.S. Pat. No. 7,524,491 to Goldman; Windrem et al., "Neonatal Chimerization With Human Glial Progenitor Cells Can Both Remyelinate and Rescue the Otherwise Lethally Hypomyelinated Shiverer Mouse," Cell Stem Cell 2:553-565 (2008); Han et al., "Forebrain Engraftment by Human Glial Progenitor Cells Enhances Synaptic Plasticity and Learning Adult Mice," Cell Stem Cell 12:342-353 (2013); and Wang et al., "Human iPSC-Derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12:342-353 (2013), which are incorporated by reference in their entireties. 12:252-264 (2013), bilaterally into multiple sites of a non-mammalian host animal. Methods for grafting neural tissue and cells into a host brain are described by Bjorklund and Stenevi (eds.), Neural Grafting in the Mammalian CNS, Chapters 3-8, Elsevier, Amsterdam (1985); U.S. Patent No. 5,082,670 to Gage et al.; and U.S. Patent No. 6,497,872 to Weiss et al., which are incorporated herein by reference in their entireties. Exemplary procedures include intraparenchymal, intracallosal, intraventricular, intrathecal, and intravenous transplants, which are incorporated herein by reference in their entireties.
[0108] Intraparenchymal transplantation is achieved by injection or deposition of tissue in the host brain so that it is apposed to the brain parenchyma at the time of transplantation. The two main procedures for intraparenchymal transplantation are 1) injecting donor cells into the host brain parenchyma, or 2) preparing a cavity by surgical means to expose the host brain parenchyma and then depositing the graft into the cavity (Bjorklund and Stenevi (eds.), Neural Grafting in the Mammalian CNS, Chapter 3, Elsevier, Amsterdam (1985), which is incorporated herein by reference in its entirety). Both methods provide parenchymal apposition between the donor cells and the host brain tissue at the time of transplantation, and both facilitate anatomical integration between the graft and the host brain tissue. This is important if the donor cells are required to become an integral part of the host brain and survive for the life of the host.
[0109] Glial progenitor cells can also be delivered into the corpus callosum as described in US Patent Application No. 20030223972 to Goldman. In a preferred embodiment of the present application, glial progenitor cells are delivered directly into the forebrain subcortex, specifically into the anterior and posterior anlagen of the corpus callosum. Glial progenitor cells can also be delivered into the cerebellar peduncle white matter to gain access to major cerebellar and brainstem tracts. Glial progenitor cells can also be delivered into the spinal cord.
[0110] Alternatively, the cells may be placed in a chamber, such as the ventricle. The implantation of cells in the chamber may be accomplished by injection of donor cells, or by growing the cells on a substrate such as 30% collagen to form a solid tissue plug that can then be embedded in the chamber to prevent dislocation of the implanted cells. For subdural implantation, the cells may be injected around the surface of the brain after making a slit in the dura.
[0111] As set forth above, the isolated population of human neurodegenerative disorder-specific glial cells is introduced into a myelin-deficient or myelin-depleted non-human mammal. Alternatively, the isolated population of human neurodegenerative disorder-specific glial cells is introduced into a normal myelinating non-human mammal.
[0112] In another embodiment of the invention, transplantation of glial progenitor cells can be performed using intravenous or intrathecal administration as described by Pluchino et al., "Injection of Adult Neurospheres Induces Recovery in a Chronic Model of Multiple Sclerosis," Nature 422(6933):678-94 (2003), which is incorporated by reference in its entirety.
[0113] Once the human glial progenitor cells are introduced, the mammal is allowed to age, causing the mammal to generate more human glial cells as it ages, and in addition, the mammal undergoes myelination as it ages.
[0114] The isolated population of human neurodegenerative disorder-specific glial cells is introduced into the forebrain and / or brainstem of the non-human mammal, and then the non-human mammal is harvested. As used herein, the term "recovering a non-human mammal" refers to a process or means that allows the introduced human glial cells to functionally engraft in the brain of the non-human mammal. Exemplary percentages of human glial cells present in the white matter and / or corpus callosum of the brain and brainstem of the harvested non-human mammal model are described above.
[0115] The survival of human glial precursor cells in the host mammal can be examined using various non-invasive scans, such as computed tomography (CAT scan or CT scan), nuclear magnetic resonance imaging or magnetic resonance imaging (NMR or MRI), or more preferably, positron emission tomography (PET) scan. Post-mortem examination of cell survival and incorporation can be performed by macroscopic histological examination of various brain regions, or more preferably, using microscopy. Cells can be labeled with any stain visible under light or electron microscopic conditions, more specifically, with stains that are specific for host glial cells. Antibodies that specifically identify human donor cells are particularly useful, including antibodies that demonstrate myelin production by donor cells, including mouse anti-human nuclei, clone 235-1, and anti-myelin basic protein antibodies. Transplanted cells can also be identified by prior incorporation of tracer dyes, such as rhodamine or fluorescein-labeled microspheres, fast blue, bisbenzamide, or retrovirally introduced histochemical markers, such as the lac Z gene producing beta-galactosidase.
[0116] IV. Methods for Providing Specific Glial Progenitor Cells Another aspect of the invention relates to a method comprising providing a population of isolated human neurodegenerative disorder-specific glial progenitor cells or human neuropsychiatric disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells, human neurodegenerative disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells tagged with a first detectable label, the method further comprising introducing the population of isolated human neurodegenerative disorder-specific glial progenitor cells or human neuropsychiatric disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells with the first detectable label into the brain and / or brainstem of a non-human mammal to generate a chimeric non-human mammal.
[0117] The method also includes providing a population of isolated healthy human glial progenitor cells, the healthy human glial progenitor cells expressing a second detectable label distinguishable from the first detectable label. The method further includes introducing the population of isolated healthy human glial progenitor cells into the brain and / or brainstem of the chimeric non-human mammal. The method additionally includes recovering the treated chimeric non-human mammal having healthy human glial cells in its brain and / or brainstem expressing the second detectable label that at least partially replace the human neurodegenerative disorder-specific glial cells or human neuropsychiatric disorder-specific glial cells or human white matter disease-specific glial cells tagged with the first detectable label as a result of the step of introducing the population of isolated healthy human glial progenitor cells into the brain and / or brainstem of the chimeric non-human mammal.
[0118] In an embodiment of the invention, the method comprises the step of isolating from the chimeric non-human mammal a population of glial cells in which the native glial cells have at least partially been replaced.
[0119] A method for preparing a population of isolated healthy human glial progenitor cells, wherein the healthy human glial progenitor cells express a second detectable label that is distinguishable from the first detectable label, may use any of the methods for isolating human glial progenitor cells from the brain disclosed above.
[0120] The method for introducing a population of isolated healthy human glial progenitor cells into the brain and / or brainstem of a chimeric non-human mammal may use any of the methods for introducing human glial progenitor cells into the brain disclosed above.
[0121] As a result of said introducing step of a population of isolated healthy human glial progenitor cells into the brain and / or brainstem of the chimeric non-human mammal, the method of recovering the treated chimeric non-human mammal having in its brain and / or brainstem healthy human glial cells expressing a second detectable label that at least partially replace the human neurodegenerative disorder-specific glial cells or human neuropsychiatric disorder-specific glial cells or human white matter disease-specific glial cells tagged with a first detectable label may use any of the methods for recovering disclosed above.
[0122] In an embodiment of the invention, the method further comprises imaging the brain and / or brain stem of the treated chimeric non-human mammal to generate an image indicative of glial cells having the first and second detectable labels. In an embodiment of the invention, the method further comprises evaluating the image to determine whether transplantation of healthy human glial progenitor cells into a human subject is useful for treating a human neurodegenerative disorder or a human neuropsychiatric disorder or a human myelin disease.
[0123] In an embodiment of the invention, the method further comprises isolating a population of glial cells from the treated chimeric non-human mammal, wherein the glial cells expressing a second detectable label at least partially replace the glial cells bearing the first label.
[0124] In an embodiment of the invention, the method is wherein the non-human mammal into which the population of isolated human neurodegenerative disorder-specific glial progenitor cells or human neuropsychiatric disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells having a first detectable label is introduced is a prenatal or neonatal non-human animal. In an embodiment of the invention, the method is wherein the non-human animal into which the population of isolated healthy human glial progenitor cells expressing a second detectable label is introduced is an adult non-human animal.
[0125] Another aspect of the present invention relates to a method comprising the step of providing a population of isolated human neurodegenerative disorder-specific glial progenitor cells or human neuropsychiatric disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells, wherein the human neurodegenerative disorder-specific glial progenitor cells or said human neuropsychiatric disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells are tagged with a first detectable label. The method further comprises the step of providing a population of isolated healthy human glial progenitor cells, wherein the healthy human glial progenitor cells express a second detectable label that is distinguishable from the first detectable label. The method additionally comprises the step of co-introducing (1) the population of isolated human neurodegenerative disorder-specific glial progenitor cells or human neuropsychiatric disorder-specific glial progenitor cells or human myelin disease-specific glial progenitor cells having the first detectable label, and (2) the population of isolated healthy human glial progenitor cells expressing the second detectable label into the brain and / or brainstem of a non-human mammal. The method also includes recovering the treated chimeric non-human mammal having, as a result of said co-introducing step, healthy human glial cells expressing a second detectable label, and human neurodegenerative disorder-specific glial cells, human neuropsychiatric disorder-specific glial cells, or human white matter disease-specific glial cells tagged with the first detectable label in its brain and / or brain stem.
[0126] In an embodiment of the invention, the method further comprises imaging the brain and / or brain stem of the treated chimeric non-human mammal to generate an image indicative of glial cells having the first and second detectable labels. In an embodiment of the present application, the method further comprises evaluating the image to determine whether transplantation of healthy human glial progenitor cells into a human subject is useful for treating a human neurodegenerative disorder or a human neuropsychiatric disorder or a human myelin disease.
[0127] To determine whether transplantation of healthy human glial progenitor cells into a human subject is useful for treating a human neurodegenerative disorder or a human neuropsychiatric disorder or a human myelin disease, the volume of cells expressing the second detectable marker may be compared to the volume of cells expressing the first detectable marker. To map human cell distribution in the mouse brain, the brain is cut into equally spaced slices spanning the distance of the brain structure of interest. In some embodiments of the present application, the brain structure of interest is the striatum. The slices are immunolabeled with a proliferation marker. In some embodiments of the present application, the proliferation marker is a marker of proliferation Ki-67 (MKI67) or Ki76. The slices may also be immunostained for any other marker of interest, such as markers for glia (glial fibrillary acidic protein, GFAP) and oligodendrocytes (oligodendrocyte transcription factor, Olig2). After imaging, the images of the slices are digitally aligned and reconstructed into a three-dimensional structure. The boundaries of the brain structures are determined and the volumes are determined. Cells in the brain structures are counted to determine cell density of cell types.
[0128] Specifically, the cell density of cells expressing a first detectable marker and the density of cells expressing a second detectable marker are determined, and the percentage of cells expressing the second detectable marker is compared to the first detectable marker to determine whether transplantation of healthy human glial progenitor cells was successful.
[0129] In an embodiment of the invention, the method further comprises isolating a population of glial cells from the treated chimeric non-human mammal in which glial cells expressing a second detectable label and glial cells having the first label are present.
[0130] In an embodiment of the invention, the method is provided wherein the human neurodegenerative disorder is selected from the group consisting of Huntington's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis. In an embodiment of the application, the method is provided wherein the human neuropsychiatric disorder is selected from the group consisting of schizophrenia, autism spectrum disorder, and bipolar disorder. In an embodiment of the invention, the method is provided wherein the human myelin disease is a leukodystrophy or white matter disease.
[0131] In an embodiment of the invention, the method is wherein said introducing step is independently performed by intraparenchymal, intracallosal, intraventricular, intrathecal, intracerebral, intracisternal, or intravenous implantation. In an embodiment of the invention, the method is wherein said introducing step is independently performed by intracerebral, intracisternal, or intravenous implantation. In an embodiment of the invention, the method is wherein said introducing step is independently performed by intracerebral, intracisternal, or intravenous implantation.
[0132] Another aspect of the invention relates to a method comprising the step of preparing a population of isolated diseased human selected organ-specific progenitor cells tagged with a first detectable label, the method further comprising the step of introducing the population of isolated diseased human selected organ-specific progenitor cells with the first detectable label into a selected organ of a non-human mammal to generate a chimeric non-human mammal. The method further comprises the step of preparing a population of isolated healthy human selected organ-specific progenitor cells expressing a second detectable label distinguishable from the first detectable label. The method also comprises the step of introducing the population of isolated healthy human selected organ-specific progenitor cells into the selected organ of the chimeric non-human mammal. The method further comprises the step of recovering a chimeric non-human mammal treated with a selected organ having healthy human organ-specific cells expressing the second detectable label and diseased human selected organ-specific cells tagged with the first detectable label as a result of the step of introducing the population of isolated healthy human selected organ-specific progenitor cells into the selected organ of the chimeric non-human mammal.
[0133] Another aspect of the invention relates to a method comprising the steps of providing a population of isolated diseased human selected organ-specific progenitor cells tagged with a first detectable label, and providing a population of isolated healthy human selected organ-specific progenitor cells expressing a second detectable label distinguishable from the first detectable label, wherein the population of isolated diseased human selected organ-specific progenitor cells with the first detectable label and the population of isolated healthy human selected organ-specific progenitor cells expressing the second detectable label are co-introduced into a selected organ of a non-human mammal. As a result of the co-introducing step, a chimeric non-human mammal treated with the selected organ having healthy human organ-specific cells expressing the second detectable label and the diseased human selected organ-specific cells tagged with the first detectable label is recovered.
[0134] The method of preparing a population of isolated diseased human selected organ-specific progenitor cells tagged with a first detectable label may use any of the methods described above and may be adapted to the selected organ as would be known to one skilled in the art.
[0135] The method of introducing a population of isolated diseased human selected organ-specific progenitor cells bearing a first detectable label into a selected organ of a non-human mammal to generate a chimeric non-human mammal may use any of the methods described above and may be adapted to the selected organ as would be known to one skilled in the art.
[0136] As a result of said step of introducing a population of isolated healthy human selected organ-specific progenitor cells into the selected organ of the chimeric non-human mammal, the method of recovering the treated chimeric non-human mammal with the selected organ having healthy human organ-specific cells expressing the second detectable label and the diseased human selected organ-specific cells tagged with the first detectable label may use any of the methods described above and may be adapted to the selected organ as known to the person skilled in the art.
[0137] In an embodiment of the invention, the method further comprises imaging the selected organ of the treated chimeric non-human mammal to generate an image indicative of cells having the first and second detectable labels. In an embodiment of the invention, the method further comprises evaluating the image to determine whether transplantation of healthy human selected organ-specific progenitor cells into a human subject is useful for treating a disease of the selected human organ. The method may use any of the methods described above and may be adapted to the selected organ as would be known to one of skill in the art.
[0138] In an embodiment of the invention, the method is wherein the non-human mammal into which the population of isolated diseased human selected organ-specific progenitor cells having a first detectable label is introduced is a prenatal or neonatal non-human animal. In an embodiment of the invention, the non-human animal into which the population of isolated healthy human selected organ-specific progenitor cells expressing a second detectable label is introduced is an adult non-human animal. The method may use any of the methods described above and may be adapted to the selected organ as known to the skilled artisan.
[0139] In an embodiment of the invention, the method is wherein the selected organ is liver, bone marrow and hematopoietic stem cells, skin, pancreas, heart, lung, and kidney.
[0140] The present invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patents and published patent applications, as well as figures and tables cited throughout this specification are hereby incorporated by reference. EXAMPLES
[0141] Example 1 Materials and Methods Human embryonic stem cell lines and culture conditions Sibling human embryonic stem cell (hESC) lines GENEA019 (WT:18;15 CAG; Giorgio, FPD et al., "Non-Cell Autonomous Effect of Glia on Motor Neurons in an Embryonic Stem Cell-Based ALS Model," Nat Neurosci 10:608-614 (2007), which is incorporated by reference in its entirety) and GENEA020 (HD:48;17 CAG; Giorgio, FPD et al., "Human Embryonic Stem Cell-Derived Motor Neurons Are Sensitive to the Toxic Effect of Glial Cells Carrying an ALS-Causing Mutation," Cell Stem Cell 3:637-648 (2008), which is incorporated by reference in its entirety) were obtained from GENEA, Inc. (Sydney, Australia). hESCs were cultured under feeder-free conditions at 0.55 μg / cm with mTeSR1 medium (StemCell Technologies, Cat. no. 85850). 2 hESCs were routinely cultured in human recombinant laminin 521 (Biolamina, Cat. No. LN521) coated cell culture flasks. Daily medium changes were performed. hESCs were routinely passaged at 80% confluency in fresh coated flasks. Passaging was performed using ReLeSR (StemCell Technologies, Cat. No. 05872). All hESC and differentiated cultures were maintained at 37°C in a 5% CO2 incubator and routinely checked for contamination and mycoplasma-free status.
[0142] Generation of fluorescent reporter hESCs For ubiquitous and distinct fluorescent labeling of wild-type (WT) and Huntington's disease (HD) cells (FIG. 1), reporter constructs driving expression of either mCherry or EGFP (enhanced green fluorescent protein) were inserted into the AAVS1 safe harbor locus of WT GENEA019 and HD GENEA020 hESCs, respectively, using a modified version of the CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR-associated protein 9)-mediated strategy previously described (Yamanaka, K. et al., "Astrocytes as Determinants of Disease Progression in Inherited Amyotrophic Lateral Sclerosis," Nat Neurosci 11:251-253 (2008), which is incorporated herein by reference in its entirety). To prepare hESCs for plasmid delivery by electroporation, hESCs were harvested as single cell suspensions after dissociation with Accutase (StemCell Technologies, Cat. No. 07920), washed in culture medium, and counted using an automated cell counter NucleoCounter NC-200 (ChemoMetec). A total of 1.5 × 10 6Cells were mixed with 5 μg of AAVS1-targeting CRISPR-Cas9 plasmid (pXAT2) and 5 μg of reporter donor plasmid (pAAVS1-P-CAG-mCh or pAAVS1-P-CAG-GFP). pXAT2 (Addgene plasmid no. 80494), pAAVS1-P-CAG-mCh (Addgene plasmid no. 80491) and pAAVS1-P-CAG-GFP (Addgene plasmid no. 80492) were kindly provided by Knut Woltjen. Electroporation was performed using an Amaxa 4D-Nucleofector (Lonza) with the P3 Primary Cell Kit (Lonza, catalog no. V4XP-3024) according to the manufacturer's guidelines. After nucleofection, the electroporated hESC suspension was transferred to a 10 cm cell culture dish and cultured with mTeSR1 supplemented with 10 μM Y-27632 (Tocris, S Catalog No. 1254) for an initial 24 h. Electroporated hESCs were grown for 48-72 h and then treated with 0.5 μg / μL puromycin (ThermoFisher, Catalog No. A1113803). Electroporated hESC cultures were kept under puromycin until individual colonies were large enough to be manually picked. Colonies were assessed by fluorescence microscopy and transferred to 96-well plates based on the uniformity of fluorescent protein expression. After their expression, individual clones were separated for further expansion and genotyping. For genotyping, DNA was extracted using the prepGEM Tissue DNA extraction kit (Zygem). Precisely targeted transgene integration at the AAVS1 locus was detected by PCR using the following primers: dna803: TCGACTTCCCCTCTTCCGATG (SEQ ID NO: 1) and dna804: CTCAGGTTCTGGGAGAGGGTAG (SEQ ID NO: 2), while heterozygosity of integration was determined by the presence or absence of the WT allele using additional primers: (dna803 and dna183: GAGCCTAGGGCCGGGATTCTC (SEQ ID NO: 3)).hESC clones harboring correctly targeted inserts were cryopreserved using Pro-Freeze CDM medium (Lonza, catalog no. BEBP12-769E) and expanded for karyotype analysis and array comparative genomic hybridization (aCGH) characterization prior to experimental application.
[0143] Karyotyping and aCGH The karyotypes of the generated reporter hESC lines were analyzed in metaphase spreads by G-banding (Institut für Medizinishche Genetik und Angewandte Genomik, Universitaetsklinikum Tuebingen). All hESC lines used in this study possess normal karyotypes. In addition, acquired copy number variations (CNVs) and loss of heterozygosity (LOH) were assessed by aCGH (Cell Line Genetics). Various CNVs and LOH within and outside the normal range were identified (Figure 2), but were not expected to affect the outcome of competitive interactions between the clones.
[0144] Induction of hGPCs from reporter WT and HD hESCs Human GPCs were derived from both reporter WT and HD hESCs using our well-established protocol (Lee, Y. et al., "Oligodendroglia Metabolically Support Axons and Contribute to Neurodegeneration," Nature 487:443-448 (2012), which is incorporated herein by reference in its entirety) with minor modifications to the embryoid body (EB) generation step. Details on the EB generation step are included in the Supplementary Information. Cells were harvested for xenografting at 150-200 DIV, at which time cultures derived from both WT-mCherry and HD-EGFP hESCs were enriched in PDGFRα+ / CD44+ bipotential glial progenitor cells. Detailed characterization of the generated cultures by flow cytometry and immunocytochemistry can be seen in Figure 3 and Figure 18 panels A and B.
[0145] Cell preparation for xenografting To prepare cells for xenografting, glial cultures were incubated with Ca 2+ / Mg 2+ The cells were collected in free Hank's Balanced Salt Solution (HBSS(- / -); ThermoFisher, Cat. No. 14170112), mechanically dissociated into small clusters by gentle pipetting, and counted using a hemocytometer. The cell suspension was then spun and diluted with 10 5 The cells were resuspended in cold HBSS(- / -) at a final concentration of 10 cells / μL and kept on ice until transplantation.
[0146] Host and xenograft paradigms In vivo modeling of human glial striatal repopulation: To generate human-mouse chimeras harboring mHTT-expressing human glia (HD chimeras), newborn immunocompromised Rag1(- / -) pups (Meyer, K. et al., "Direct Conversion Of Patient Fibroblasts Demonstrates Non-Cell Autonomous Toxicity Of Astrocytes To Motor Neurons In Familial And Sporadic ALS." Proc National Acad Sci 111:829-832 (2014), which is incorporated by reference in its entirety) were cryo-anesthetized, immobilized on a conventional clay stage, and injected bilaterally into the prospective striatum with 100,000 HD-EGFP glia (50,000 per hemisphere) within 48 hours of birth. Cells were delivered using a 10 μL syringe with a pulled glass pipette (Hamilton, Cat. No. 7653-01) at a depth of 1.2-1.4 mm. Pups were then returned to their mothers until weaning. To model human glial striatal repopulation, 36-week-old HD chimeras were anesthetized with ketamine / xylazine and fixed in a stereotaxic frame. 200,000 WT glia were delivered bilaterally into the humanized striatum (AP: +0.8 mm; ML: ±1.8 mm; DV: -2.5 to -2.8 mm) using a 10 μL syringe and metal needle. To minimize damage, cells were injected at a controlled rate of 175 nL / min using a controlled micropump system (World Precision Instruments). Backflow was prevented by leaving the needle in place for an additional 5 min. Experimental animals were compared with HD chimeric littermates that did not receive WT glia after this exact procedure and with non-chimeric Rag1(- / -) mice that received WT glia at 36 weeks of age.
[0147] Neonatal striatal symbiotic engraftment To model the cell-specific effects of mHTT expression on the outcome of competition between human glia, neonatal Rag1(- / -) mice were injected following the same neonatal striatal xenograft protocol described above, but instead delivered a total of 200,000 human glia (100,000 per hemisphere) composed of a 1:1 mixture of WT-mCherry and HD-EGFP hESC-derived glia. Control littermates received injections composed of either WT-mCherry or HD-EGFP human glia.
[0148] Aseptic technique was used for all xenotransplants. All mice were housed in a pathogen-free environment with free access to food and water, and all procedures were performed in accordance with protocols approved by the University of Rochester Committee on Animal Resources.
[0149] Tissue processing Experimental animals were perfused with HBSS (- / -) followed by 4% PFA. Brains were removed, post-fixed in 4% PFA for 2 hours, and rinsed three times with PBS. They were then incubated in 30% sucrose solution (Sigma-Aldrich, Cat. No. S9378) until equilibrated to that point, embedded in OCT in the sagittal orientation (Sakura, Cat. No. 4583), frozen at temperatures between -60 and -70°C in 2-methylbutane (Fisher Scientific, Cat. No. 11914421), and transferred to a -80°C freezer. The resulting blocks were then cut into 20 μm sections in a CM1950 cryostat (Leica), sequentially collected on adhesive slides, and stored at -20°C until further use.
[0150] immunostaining Phenotyping of human cells was achieved by immunostaining for their respective fluorescent reporters together with specific phenotypic markers: Olig2 (oligodendrocyte transcription factor, marks GPCs) and GFAP (glial fibrillary acidic protein, marks astrocytes). Fluorescent reporters were used as markers for human cells since their expression remained ubiquitous throughout the lifespan of the animals (Figure 4). In animals that received a 1:1 mixture of WT-mCherry and WT untagged human glia, the latter were identified by expression of human nuclear antigen and lack of fluorescent reporter expression. For immunolabeling, sections were rehydrated in PBS and then permeabilized and blocked for 2 hours using permeabilization / blocking buffer (PBS + 0.1% Triton-X (Sigma-Aldrich Cat. No. T8787) + 10% normal goat serum (ThermoFisher, Cat. No. 16210072)). The sections were then incubated overnight at 4° C. with a primary antibody targeting a phenotypic marker. The following day, the primary antibody was thoroughly rinsed from the sections with PBS, and the secondary antibody was applied to the sections for 1 hour. After the secondary antibody was thoroughly rinsed with PBS, a second round of primary antibody was applied to the sections overnight at 4° C., this time against the fluorescent reporter. These were rinsed with PBS the following day, and the sections were incubated with the secondary antibody for 1 hour. The slides were again thoroughly washed with PBS and mounted on Vectashield Vibrance (Vector Labs, Cat. No. H-1800).
[0151] Xenograft mapping and 3D reconstruction To map human cell distribution within the mouse striatum, whole-brain montages of 15 equally spaced 160 μm apart sagittal sections spanning the entire striatum were captured at 10x magnification using a Nikon Ni-E Eclipse microscope equipped with a DS-Fi1 camera and processed in NIS-Elements imaging software (Nikon). The striatum within each section was outlined, and immunolabeled human cells were identified and mapped within the outlined striatum using StereoInvestigator software (MicroBrightField Bioscience). When applicable, injection sites for WT glia were mapped as reference points for further volumetric quantification of human cell distribution. The mapped sections were then aligned using the lateral ventricle as a reference to generate a 3D reconstructed model of the humanized mouse striatum.
[0152] After 3D reconstruction, the Cartesian coordinates for each human cell marker, the injection site and the outline of the striatum were exported for further analysis.
[0153] To assess the distribution and proportion of proliferating cells within each human cell population within the striatum, immunolabeled human cells expressing Ki67 were mapped in every third of 15 sections when 3D reconstructions were performed.
[0154] Volume quantification To quantify the spatial distribution of HD glia in HD chimeras, the volume for each quantified striatal section was calculated by multiplying the section thickness (20 μm) by the section area, and the cell density for each section was then calculated by dividing the number of marked cells in each section by their individual volumes.
[0155] To quantify the spatiotemporal dynamics of competing WT and HD glia, a program was developed to calculate the volume distribution of each cell population as a function of distance to the WT glial delivery site in the 3D reconstructed dataset (Figure 4). For that purpose, we calculated the upper and lower boundaries z by representing the outline of the striatum in each quantified section as two identical polygons separated from each other by the thickness of the section (20 μm). u , z l Then, since the depth location of each cell marker in each individual section is unknown, the marked cells in each section were expressed as a uniform point probability function with a constant probability across the section, i.e., z ll Fromzz uu Each cell marker in the slice has a probability function:
[0156]
number
[0157] The spatial distribution of each cell population was then measured by counting the number of marked cells within concentric spherical shells radiating from the WT glial delivery site at radial increments of 125 μm (the average of the coordinates of the WT glial delivery site for control HD chimeras was used). Marked cells were counted if their individual representative line segments were completely inside the spherical shell, completely outside it, or intersecting the spherical shell at either the upper or lower border. The density of each cell population, ρ a,b (where a, b represent the minimum and maximum radii of the spherical shell) was calculated by dividing the number of marked cells within the spherical shell by the total section volume within the shell.
[0158]
number
[0159] Here, N a,bis the sum of the integral point probability function over each section for each point, and V a,b is the total intercept volume within the spherical shell. Subsequent analyses were restricted to a sphere radius of 2 mm. Code was implemented in Python 3.8 and package Shapely 1.7 to represent polygons and calculate circle intersections of polygons.
[0160] Stereological estimation and phenotyping Estimation of the total amount of human cells and their individual phenotyping was performed stereologically in five equally spaced 480 μm apart sections spanning the entire striatum using optical fractionation (Shin, J.-Y. et al., "Expression Of Mutant Huntingtin In Glial Cells Contributes To Neuronal Excitotoxicity," J Cell Biology 171, 1001-1012 (2005), which is incorporated herein by reference in its entirety). First, a z-stack montage of the entire striatum was captured using a Nikon Ni-E Eclipse microscope equipped with a DS-Fi1 camera at 20x magnification and processed in NIS-Elements imaging software (Nikon). Each z-stack tile was captured using a step size of 0.9 μm. The montage was then loaded into StereoInvestigator and the outline of the striatum was defined. A set of 200 x 200 μm counting frames were positioned by the software in a systematic random manner within a 400 x 400 μm grid covering the outlined striatum of each section. Counts were performed over the entire height of the section (no guard zones) and cells were counted based on their immunolabeling in the optical section in which they were first focused.
[0161] Statistical analysis and reproducibility Samples showing technical problems from the experimental procedure, e.g., mistargeted injection, obvious surgical injury, or artifacts related to injection into gliotic foci, were excluded from this study. Statistical tests were performed using GraphPad Prism 9. For comparisons between more than two groups, one-way ANOVA (Tukey's multiple comparison test) was applied. For comparisons between two groups with more than two factors, two-way ANOVA (Sidak's multiple comparison test) was applied. When comparing between two matched groups, a paired two-tailed t-test was applied for normally distributed data sets, whereas for unmatched groups, an independent two-tailed t-test was applied. Significance was defined as P<0.05. Individual P values are presented in figures where possible, otherwise. **** P<0.0001, *** P<0.001, ** P < 0.01, * P<0.05 is presented. The number of replicates is indicated in the figure legends and n represents the number of independent experiments. Data are presented as mean ± standard error of the mean (sem).
[0162] Example 2 Generation of distinct color-tagged human glia from WT and HD hESCs To assess the ability of healthy glia to replace their diseased counterparts in vivo, we first created fluorescently tagged reporter lines of WT and HD human embryonic stem cells (hESCs) to allow the production of spectrally distinct GPCs of each genotype, and then monitored their growth independently in vivo. We first used a CRISPR-Cas9-mediated knock-in strategy to integrate EGFP and mCherry reporter cassettes into the AAVS1 locus of matched female sibling wild-type (WT, GENEA019) and mHTT-expressing (HD, GENEA020) hESCs (Figure 1, Panel A). We verified that the reporter cassette was stably integrated into each of these clones (Figure 1, Panel D), and that the editing did not affect the self-renewal, pluripotency, or karyotypic stability of the tagged hESCs (Figure 1, Panel E and Figure 2, Panel A). From these tagged and spectrally distinct lines, we used a differentiation protocol (Benraiss, A. et al. Human glia can both induce and rescue aspects of disease phenotype in Huntington disease. Nature Communications 7, 11758 (2016)) to generate color-coded human glial progenitor cells (hGPCs) from each line and compared their in vivo behavior, both alone and in competition. We verified the ability of each line to maintain EGFP or mCherry expression after maturation as astrocytes or oligodendrocytes, and their lack of any significant differentially expressed oncogene mutations or copy number variations (CNVs) that would result in growth bias (Figure 2, Panels B-C), and also verified that both WT and mHTT-expressing hGPCs colonized the mouse host brain when injected alone (Figure 15, Panels A-B, Figure 5, and Figure 6, Panel A).
[0163] Both WT-mCherry and HD-EGFP hESCs were differentiated using the protocol for generating hGPCs (Wang, S. et al. Human iPSC-Derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination. Cell Stem Cell 12, 252-264 (2013)) and assessed both their ability to differentiate into glia and the stability of their reporter expression upon acquisition of a glial fate (Figure 3, Panels A-D). By 150 days in vitro (DIV), glial cultures derived from both WT-mCherry and HD-EGFP were equally enriched for PDGFRα+ / CD44+ bipotential GPCs (P=0.78), comprising roughly half of the cells in the cultures, with the remainder being immature A2B5+ GPCs27 and PDGFRα- / CD44+ astrocytes and their progenitors (Figure 3, Panel C, and Figure 18, Panels A-B). Importantly, virtually all immunophenotyped cells derived from WT-mCherry and HD-EGFP hESCs, including mature astrocytes and GPCs, continued to express their respective fluorescent reporters, indicating that transgene expression remained stable upon acquisition of terminal glial identity (Figure 3, Panel D).
[0164] Example 3 Establishment of human HD glial chimeric mice Mouse chimeras with striatum substantially humanized by HD glia (HD chimeras, FIG. 5) were generated to provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHTT-expressing hESCs engineered to express EGFP (FIGS. 1 and 5; hereafter referred to as HD) were implanted into the neostriatum of immunocompromised Rag1(- / -) mice and their expansion was monitored histologically (FIG. 15, panel A).
[0165] After implantation, HD glia rapidly infiltrated the mouse striatum, initially migrating and expanding within the striatal white matter tracts (Figure 15, Panel B). Gradually, these cells expanded outward, progressively replacing their mouse counterparts from the striatal neuropil, such that by 36 weeks, the mouse striatum was substantially humanized by HD glia (Figure 15, Panel B, Figure 15, Panel F, and Figure 15, Panel G). The evolution of HD glia was driven by their mitotic expansion, with their total number doubling between 12 and 36 weeks (Figure 15, Panel C; P=0.0032). Conversely, as they expanded and matured within their newly established domains, their proliferative cell pool (Ki67+) was progressively depleted (Figure 15, Panels D and I; P=0.0036), slowing their expansion rate over time.
[0166] Most HD glia expanded as Olig2+ GPCs (72.7±1.9%), which persisted as a new resident pool after replacing their mouse counterparts. A fraction of these (4.8±0.9%) further differentiated into GFAP+ astrocytes (Figure 15, Panel I, and Figure 15, Panel J). Astrocyte differentiation was mostly observed within the striatal white matter tracts. These pathological astrocytes, lacking the structural complexity typically observed in their healthy counterparts, displayed abnormal fibrous structures, as previously reported (Figure 15, Panel J; Osipovitch, M. et al., "Human ESC-Derived Chimeric Mouse Models of Huntington's Disease Reveal Cell-Intrinsic Defects in Glial Progenitor Cell Differentiation," Cell Stem Cell 24:107-122 (2019), which is incorporated herein by reference in its entirety).
[0167] Example 4 Healthy WT hGPCs infiltrate and outcompete resident glia in HD-chimeric adult striatum Using established chimeras and humans in which striatal glia predominantly express mHTT, we determined to what extent resident HD human glia might respond to the introduction of healthy hGPCs and whether the resident glial population might be replaced to some extent. hGPCs derived from WT hESCs engineered to express mCherry (Figures 1, 2, and 3; hereafter referred to as WT) were engrafted into the striatum of 36-week-old HD chimeras and monitored for expansion using histology as they competed for striatal dominance (Figure 5).
[0168] After engraftment, WT glia spread into the previously humanized striatum, gradually replacing their HD counterparts as they expanded and outgrow their implantation sites (Figure 4). This process was slow but sustained, resulting in substantial regrowth of the HD striatum over time (Figure 4; 54 weeks, p<0.0001; 72 weeks, p<0.0001). Notably, the expansion of WT glia paralleled (and inversely to) the simultaneous elimination of HD glia from the tissue (Figure 4; 54 weeks - P<0.0001, 72 weeks - P<0.0001), typically characterized by their individual progression back and forth with few HD glia to be found (Figure 4).
[0169] Mutually exclusive domains formed due to competition between Olig2+ GPCs (Figure 4). These contained most of the WT glial population (80.1 ± 4.7% at 72 weeks), which persisted as a new resident GPC pool after replacing their HD counterparts. Their potential to create astroglia was maintained, as a fraction of these (4.0 ± 1.5% at 72 weeks) further differentiated into GFAP+ astrocytes (Figure 6) within their newly established domains. Curiously, within areas dominated by WT glia, HD astrocytes (GFAP+) remained predominantly within white matter tracts (Figure 4). Nevertheless, the overall ratio between Olig2+ and GFAP+ glia remained stable throughout the experiment in both populations (Figure 6), indicating that GPC replacement precedes astrocyte replacement, but proportional phenotypic repopulation is achieved over time.
[0170] Interestingly, human-human glial replacement developed at a slower rate than human-mouse glial replacement, as WT hGPCs implanted in naive adult Rag1(- / -) mice expanded and proliferated throughout the host striatum more widely than those transplanted into neonatally chimerized adult Rag1(- / -) mice (Figure 7; 54 weeks: P = 0.14, 72 weeks: P = 0.0009). These results indicate that competitive glial replacement develops with different interspecies kinetics between xenografts and allografts.
[0171] These results were not an artifact of off-target effects resulting from neither gene editing nor fluorescent reporter expression toxicity, since co-engrafted hGPCs derived from WT-mCherry and their unmodified counterparts (WT untagged) (Figure 8) expanded equally in the striatum of HD chimeras, resulting in similar glial regrowth (Figures 9 and 10; 54 weeks - P = 0.5075 - 72 weeks - P = 0.1460). Therefore, the analyses performed in (Figure 4) and (Figures 6 and 7) report samples from both experimental paradigms. Of note, WT and HD glia were strongly separated from each other, whereas the two isogenic clones of WT glia were found intermixed (Figure 9), indicating that active recognition precedes competitive exclusion of HD glia from the tissue.
[0172] Example 5 Human WT glia enjoy a proliferation advantage compared to resident HD glia Striatal repopulation by HD glia proceeded with a gradual depletion of their proliferative cell pool as they expanded and matured within the tissue. Therefore, we tested whether the selective expansion of younger WT glia within the HD striatum was sustained by differences in the proliferative capacity between the two populations. The temporal expression of Ki67 in both WT and HD glial populations was assessed as competitive repopulation of the unwound striatum.
[0173] At both 54 and 72 weeks of age, the mitotic fraction of embedded WT glia was significantly greater than that of resident HD glia (Figure 4, panels I and J, 54 weeks - P<0.0001, 72 weeks - P=0.009). These data indicate that repopulation of the HD striatum by WT glia was accelerated by a relatively enriched proliferative cell pool. It is important to note that this proliferative benefit was maintained throughout the experiment, although it became less pronounced as the cells aged. With this in mind, the sustained proliferative benefit of embedded WT glia over their HD counterparts should provide the impetus for continued striatal repopulation beyond the observed experimental time points.
[0174] Example 6 Human WT glia adopt a dominant competitive profile when encountering HD glia Having established that implanted WT hGPCs effectively colonize HD glial chimeric striatum at the expense of resident mHTT-expressing glia, we next sought to define the molecular signals underlying their competitive advantage. To that end, transcriptional profiles of WT and HD human glia were isolated from the striatum of chimeras in which the two cell populations co-residented and competition was analyzed, as well as from their respective controls in which one or the other was transplanted without the other using single-cell RNA sequencing (scRNA-seq; 10X Genomics, v3.1 chemistry) (Figure 19, Panel A). After integration of all captures and alignments against human sequences, Louvain community detection revealed six main populations of human glia, including hGPCs, cycling hGPCs, immature oligodendrocytes (iOLs), neural progenitor cells (NPCs), astrocytes, and their intermediate progenitors (astrocyte progenitor cells, APCs) (Figure 19, Panels B-D). Within these populations, cell cycle analysis predicted a higher fraction of actively proliferating G2 / M phase cells competing with WT cells compared to their HD counterparts (Figure 19, Panel E), in concert with histological observations (Figure 4, Panel J). Moving forward, studies focused on hGPCs as the primary competing population in the model. Pairwise differential expression revealed distinct sets of differentially expressed genes across groups (Figure 19, Panel F), and subsequent functional analysis by Ingenuity pathway analysis (IPA) within the hGPC population revealed numerous salient terms related to their competition (Figure 19, Panel G).
[0175] During competition, WT GPC-activated pathways were found to drive protein synthesis, whereas HD GPCs were predicted to downregulate them. Predicted upstream transcription factor activation identified YAP1, MYC, and MYCN, conserved master regulators of cell growth and proliferation, significantly modulated across experimental groups. Importantly, YAP1 and MYC targets were found to be selectively downregulated in competing HD GPCs relative to their controls (Figure 19, Panel G). Notably, this downregulation was accompanied by a marked repression of ribosomal coding genes (Figure 19, Panel I). Conversely, competing WT hGPCs showed upregulation of both YAP1 and MYC targets, as well as upregulation in the expression of ribosomal coding genes, compared to controls (Figure 19, Panels G-H). Thus, these data suggest that embedded WT hGPCs actively adopt a competitively advantageous phenotype upon contact with their HD counterparts, driving the local elimination of the latter while promoting their own expansion and colony formation.
[0176] Example 7 Age differences drive competitive human glial repopulation Since WT cells transplanted into adult hosts were fundamentally younger than the resident host cells they replaced, this next prompted us to ask whether differences in cellular age might contribute to the later competitive success of donor cells, other than in disease state. To that end, newly engrafted hGPCs generated from WT hESCs were engineered to express EGFP in the striatum of 40-week-old in vivo glial chimeras, which were perinatally engrafted with mCherry-tagged hGPCs derived from otherwise isogenic WT hESCs (Figure 17, panel A). The expansion of transplanted cells was monitored histologically to map the relative fitness and competitive performance of these isogenic, but otherwise apparently aged, hGPC pools.
[0177] The outgrowth of implanted WT glia in the striatum of WT chimeras was strikingly similar to their outgrowth in the striatum of HD chimeras (Figure 4). After engraftment, younger WT glia rapidly infiltrated the previously humanized striatum and progressively replaced their older counterparts as they outgrow their implantation sites, eventually resulting in substantial recolonization of the tissue (Figure 17, panels B-D and E; P<0.0001). Their outgrowth was paralleled by a localized elimination of older WT glia (Figure 17, panels B-D and F; P<0.0001), which was also marked by a discrete advancing front, behind which some already resident WT glia were found (Figure 17, panel C). Accordingly, it was also noted that the mitotic fraction of embedded WT glia was significantly greater than that of their resident older counterparts (Figure 17, panels G-I; P=0.018). Together, these data indicated that repopulation of the human WT glial chimeric striatum by younger isogenic hGPCs was accompanied by replacement of older cells by their younger counterparts and was accelerated, in part, by an associated expansion proliferation of younger, more mitotically active cell populations.
[0178] Example 8 Young cells replace their older counterparts through the induction of apoptosis Since younger glia appeared to exhibit a clear competitive advantage over their older counterparts, we next asked whether the elimination of older glia by younger cells occurred passively, resulting in a relative attrition of the older residents during normal turnover as a consequence of the higher proliferation rate of the younger cells, or whether replacement was actively driven by the induction of programmed cell death of the older cells by the fitter younger cells. To address this question, we used the TUNEL assay to compare the rates of apoptosis in old and young WT glial populations as they competed in the host striatum as well as at their respective baselines in single transplanted controls. We found that as competitive repopulation spread, old WT glia underwent apoptosis at a significantly higher rate than their younger counterparts (Figure 20, panels A-C; P<0.0001). Critically, the increased apoptosis of older resident glia appeared to be driven by their interaction with younger cells, as a significantly higher proportion of aged glia was found to be apoptotic in chimeras transplanted with younger cells as adults than in controls that did not receive later adult injections (Figure 30, Panel C; P=0.0013). These data suggest that older resident glia confronted with their younger counterparts were actively eliminated, at least in part, via apoptosis triggered by their encounter with younger hGPCs, and that their greater relative fitness permitted their repopulation of the chimeric host striatum.
[0179] Example 9 Young hGPCs acquire a dominant signature when challenged with older isogenic cells To elucidate whether the molecular signals underlying the competitive advantage of younger WT glia over older WT glia are similar to those underlying their advantage over HD glia, the transcriptional signatures of competing young and older WT glia, as well as their respective controls, were analyzed using scRNA-seq (Figure 21, Panel A). Within the sequenced population (Figure 21, Panels B-D), and consistent with the histology data (Figure 17, Panel I), it was noted that the fraction of competing older WT cells in the G2 / M phase of the cell cycle was significantly lower than their younger counterparts (Figure 21, Panel E). Differential expression analysis revealed distinct sets of genes differentially expressed between competing young and aged WT GPCs (Figure 21, panels F and H), and subsequent IPA analysis of these gene sets revealed a similar signature to that observed between donor (young) WT and already resident (aged) HD GPCs in our competitive allograft model (Figure 21, panel G). Notably, genes functionally related to protein synthesis, including ribosomal genes, as well as upstream YAP1, MYC, and MYCN signaling, were all activated in competing young WT GPCs compared to their aged counterparts (Figure 21, panel G). However, despite these similarities, in other contexts, aged WT GPCs responded differently to newly implanted WT GPCs than HD GPCs. In contrast to HD GPCs, aged WT cells faced with younger isogenic competitors upregulated both YAP1 and MYC targets (Figure 21, Panel G) compared to their non-competitive controls with concomitant upregulation of ribosomal genes (Figure 21, Panel I). This difference in their profiles may represent an inherent ability to respond competitively when challenged, which mHTT-expressing HD hGPCs lack. Nevertheless, this upregulation is insufficient to match the greater fitness of their younger counterparts, and to a relatively large extent, this similarity exhibited selective upregulation of YAP1 and MYC targets, as well as ribosomal genes, compared to their non-competitive controls (Figure 21, Panels G-H).Together, these data indicate that determinations of relative cytofitness can be conserved across different challenge scenarios, and that the resulting competitive outcome is significantly influenced by the relative age of the competing populations.
[0180] Example 10 Competitive interests involve distinct sets of transcription factors This then prompted us to determine which gene signature defines the competitive advantage of newly transplanted human GPCs over resident cells. To that end, we applied a multistep analysis using lasso-adjusted logistic regression (Panel A of FIG. 22), which pointed to five TFs (CEBPZ, MYBL2, MYC, NFYB, TFDP1) whose activity largely explains the superiority of young WT GPCs over both old HD and old WT GPCs. These five TFs and their putative targets established a gene set (regulon) that was upregulated (normalized enrichment score [NES] > 0, adjusted p < 10-2) in young WT cells in both allogeneic and syngeneic transplantation models (Panel D of FIG. 22). It was also noted that although their activities in the absence of a competitive environment varied (aged HD, aged WT, young WT alone), their average activities were higher in the dominant young WT cells in both allograft (vs. HD) and syngeneic (vs. older isogenic self) paradigms, particularly for MYC (Figure 22, Panel E).
[0181] We then set out to identify cohorts of genes with the defined expression patterns as well as significant overlap with the five preferential regulons mentioned above. Weighted gene co-expression network analysis (WGCNA) was first used to detect a total of 19 modules in the GPC dataset (Panel A of FIG. 22). Six modules harbored genes with significant overlap with targets of CEBPZ, MYBL2, MYC, NFYB, and TFDP1 (Panel B of FIG. 22). This then required whether the preferential module expression patterns could be explained by the age of the cells (young vs. old), by their genotype (HD vs. WT), or both. WGCNA defined the first principal component of a module as the first major component of the gene cohort, thereby representing the general expression pattern of all genes within that module. Therefore, a linear model was constructed in which the first principal component of a module was the response described by both age and phenotype. It was observed that the brown, red, and cyan modules were most affected by age, while the black, blue, and green modules were affected by both age and phenotype (Figure 22, Panel C).
[0182] MYC, whose activation of regulated pathways has already been predicted to confer a competitive advantage, was also one of the five prioritized TFs. The MYC regulon and its downstream targets were further characterized, focusing on the extent to which these downstream targets were also regulated by other prioritized TFs (Figure 22, Panel F). Interestingly, although MYC was localized in the brown module, a high proportion of its targets belonged to the blue module. Although genes in the blue module were similarly expressed in the non-competitive control paradigm, their expression levels were higher in young WT compared to aged HD in the WT vs. HD allograft paradigm (Figure 22, Panel B), a pattern suggesting that the blue signature was not activated unless the cells were in a competitive environment. Furthermore, lower expression of these genes was noted in aged HD compared to aged WT hGPCs (Figure 22, panels E-F), which may highlight the inherently greater ability of WT cells to compete, consistent with previous observations that aged WT hGPCs respond differently from HD hGPCs when challenged with newly engrafted WT GPCs. Importantly, the first principal component of the blue module was described by both genotype and age, demonstrating that the competitive advantage associated with MYC signaling was driven by both of these variables. Accordingly, targets in this network were enriched for pathways regulating cell proliferation (TP53, RICTOR, YAP), gene transcription (MYCN, MLXIPL), and protein synthesis (LARP1), each of which had previously been noted as differentially expressed in the respective competitive scenarios (Figures 19 and 21). Therefore, the outcome of this competitive regulatory network appeared to confer a competitive advantage over young WT hGPCs when introduced into the adult brain, regardless of whether they were faced with older HD-derived or isogenic hGPCs.
[0183] While various embodiments have been described above, it should be understood that such disclosure is presented by way of example only, and not limitation. Thus, the breadth and scope of the subject compositions and methods should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.
[0184] The above description is for the purpose of teaching those skilled in the art how to carry out the invention, and is not intended to detail all obvious modifications and variations thereof that will become apparent to those skilled in the art upon reading the description. However, all such obvious modifications and variations are intended to be included within the scope of the invention as defined by the following claims. The claims are intended to cover the elements and steps in any order that is effective to fulfill the objectives intended therein, unless the context specifically indicates to the contrary.
Claims
1. A chimeric non-human mammal, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brainstem of the chimeric non-human mammal are human glial cells; (a) the human glial cells comprise a combination of human disease-specific glial cells and healthy human glial cells, wherein the human disease-specific glial cells are tagged with a first detectable label and the healthy human glial cells are tagged with a second detectable label that is distinguishable from the first detectable label; or (b) the human glial cells include a first group of healthy human glial cells tagged with a first detectable label and a second group of healthy human glial cells tagged with a second detectable label that is distinguishable from the first detectable label; wherein the non-human mammal is a mouse, rat, guinea pig, or other small rodent;
2. the human disease-specific glial cells include human neurodegenerative disorder-specific glial cells, or human neuropsychiatric disorder-specific glial cells, or human myelin disease-specific glial cells; (i) the human disease-specific glial cells comprise human neurodegenerative disorder-specific glial cells, and the human neurodegenerative disorder is selected from the group consisting of Huntington's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis; (ii) the human disease-specific glial cells comprise human neuropsychiatric disorder-specific glial cells, and the human neuropsychiatric disorder is selected from the group consisting of schizophrenia, autism spectrum disorder, and bipolar disorder; or (iii) the human disease-specific glial cells comprise human myelin disease-specific glial cells, and the human myelin disease is a leukodystrophy or a proteinopathy; The chimeric non-human mammal of claim 1.
3. 3. The chimeric non-human mammal of claim 2, wherein the human disease-specific glial cells comprise Huntington's disease-specific glial cells.
4. The chimeric non-human mammal of any one of claims 1 to 3, wherein the mammal is postnatal.
5. The chimeric non-human mammal according to any one of claims 1 to 3, wherein the mammal is a mouse.
6. The chimeric non-human mammal of any one of claims 1 to 3, wherein the mammal is immunocompetent, immunodeficient, or immunosuppressed.
7. 4. The chimeric non-human mammal of claim 1, wherein the human disease-specific glial cells are derived from human disease-specific glial progenitor cells implanted on a first implantation date, and the healthy human glial cells are derived from healthy human glial progenitor cells implanted on a second implantation date, and the first implantation date is the same as the second implantation date.
8. 8. The chimeric non-human mammal of claim 7, wherein the first implantation date is 30 to 40 weeks earlier than the second implantation date.
9. A chimeric non-human mammal, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brainstem of the chimeric non-human mammal are human glial cells; the human glial cells comprising a first population of healthy human glial cells tagged with a first detectable label and a second population of healthy human glial cells tagged with a second detectable label that is distinguishable from the first detectable label; Chimeric non-human mammals.
10. 1. A method for generating a chimeric non-human mammal comprising human glial cells, the method comprising the steps of: introducing a first population of human glial progenitor cells into the brain and / or brainstem of the non-human mammal, wherein the first population of human glial progenitor cells are tagged with a first detectable label; introducing a second population of human glial progenitor cells into the brain and / or brainstem of the non-human mammal, wherein the second population of human glial progenitor cells is tagged with a second detectable label that is distinguishable from the first detectable label; recovering, as a result of the introducing step, a chimeric non-human mammal having human glial cells that at least partially replace native glial cells in the brain or brainstem, wherein (1) at least 30% of all glial cells in the corpus callosum of the chimeric non-human mammal are human glial cells, and / or (2) at least 5% of all glial cells in the white matter of the brain and / or brainstem of the chimeric non-human mammal are human glial cells; wherein the non-human mammal is a mouse, rat, guinea pig, or other small rodent; A method comprising:
11. 11. The method of claim 10, wherein the first population of human glial progenitor cells are human disease-specific glial progenitor cells and the second population of human glial progenitor cells are healthy human glial progenitor cells.
12. The method of claim 11, wherein the human disease-specific glial progenitor cells comprise human neurodegenerative disorder-specific glial progenitor cells, or human neuropsychiatric disorder-specific glial progenitor cells, or human myelin disease-specific glial progenitor cells.
13. The method of claim 11 , wherein the human disease-specific glial progenitor cells comprise Huntington's disease-specific glial progenitor cells.
14. 12. The method of claim 11, wherein the first population of human glial progenitor cells are healthy human glial progenitor cells and the second population of human glial progenitor cells are healthy human glial progenitor cells.
15. 11. The method of claim 10, wherein the first population of human glial progenitor cells and the second population of human glial progenitor cells are introduced into the brain and / or brainstem of the non-human mammal at the same time.
16. a first population of human glial progenitor cells and a second population of human glial progenitor cells are introduced into the brain and / or brainstem of a non-human mammal at the same time; or A first population of human glial progenitor cells is introduced into the brain and / or brainstem of the non-human mammal on a first implantation date, and a second population of human glial progenitor cells is introduced into the brain and / or brainstem of the non-human mammal on a second implantation date, the first implantation date being earlier than the second implantation date. The method according to any one of claims 10 to 14.
17. 15. The method of any one of claims 10 to 14, wherein the first time is 30 to 40 weeks earlier than the second time.