Systems and methods for identifying MHC-associated antigens for therapeutic intervention - Patents.com

Abstract

The present disclosure relates to compositions and methods of use of monoallelic MHC expressing cell lines, as well as methods for identifying neoepitope-MHC binding pairs and methods for treating subjects with cancers or tumors that express neoantigens and MHC alleles.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 272,933, filed October 28, 2021; U.S. Provisional Application No. 63 / 349,525, filed June 6, 2022; and U.S. Provisional Application No. 63 / 409,072, filed September 22, 2022. The entire contents of these applications are incorporated herein by reference in their entireties.

[0002] Sequence Listing This application contains a Sequence Listing submitted via EFS-Web. The contents of the text file named "048893-559001WO_Sequence_Listing.xml", created on October 26, 2022, and having a size of 193,168 bytes, are incorporated herein by reference in their entirety. [Background technology]

[0003] background Major histocompatibility complex-I (MHCI) is a nearly ubiquitously expressed protein complex responsible for presenting self- and foreign-derived display peptides on the surface of antigen-presenting cells to lymphocytes. Presentation of display peptides by MHCI is one of the first steps of adaptive immune responses for the destruction of diseased cells or the preservation of healthy cells. MHCI complexes are non-covalently linked protein heterodimers consisting of heavy (α) and light (β2 microglobulin, B2M) chains, and generally, MHCI complexes are unstable without display peptide ligands. The pathway for generating display peptides involves the proteasome, which degrades ubiquitinated cytoplasmic proteins into potential display peptides. These display peptides are subsequently transported into the endoplasmic reticulum, where they are further refined and form active MHCI / display peptide complexes by a process assisted by protein chaperones, which are then transported to the cell surface and presented to cytotoxic or CD8(+) T cells for recognition and cell fate determination.

[0004] MHCI proteins are encoded by the major histocompatibility complex, also known as members of the human leukocyte antigen (HLA) system. The most common HLA family members are encoded by the HLA-A, HLA-B, and HLA-C loci, with a total of approximately 24 known HLA families. Each HLA group contains at least 12 or more alleles, and the differential expression of these alleles results in a rich diversity in the protein output (HLA allele variants). In fact, there are over 20,000 possible different HLA-A, HLA-B, and HLA-C protein complexes, each with its own stability and canonical ligand specificity. The high diversity of the HLA system of proteins allows the system as a whole to recognize a large number of potential antigens, including peptides derived from non-human sources, post-translationally modified self-peptides, and peptides synthesized ex vivo.

[0005] Somatic mutations occurring in tumor tissues, such as neo-antigens, can be found across multiple patients or can be unique to an individual's tumor. There is an unmet need to develop therapeutics against these neo-antigens, for example by inducing T cell responses through the use of vaccines or engineered T cell therapy. Summary of the Invention

[0006] overview This application relates to the identification of major histocompatibility class I (MHCI)-associated antigens and related systems, methods and kits. The discovery of specific binding between antigens consisting of HLA proteins derived from polymorphic HLA genes and conserved B2M proteins in humans and MHCI complexes allows screening of subjects with genes of specific HLA alleles and tumors or cancers expressing neoantigens that can be cleaved into multiple neoepitopes for immunotherapy. For example, cancer vaccines can be designed to encode neoepitopes that bind within the MHCI (e.g., HLA) complex in a subject and thus induce an immune response in the subject. T cell therapy can also be used to recognize specific neoepitope-HLA binding pairs in a subject.

[0007] In one aspect, the present disclosure provides a method for producing a monoallelic MHC expressing cell line. In some embodiments, the method comprises: (i) obtaining cells that do not express endogenous MHC alleles; (ii) introducing into the cell a polynucleotide encoding an exogenous MHC allele polypeptide, such that the exogenous MHC allele polypeptide is expressed by the cell to generate a monoallelic MHC expressing cell; (iii) expanding the monoallelic MHC expressing cells under conditions to obtain a monoallelic MHC expressing cell line; Includes.

[0008] In some embodiments, the cells of step (i) have been genetically modified to mutate or delete one or more endogenous MHC alleles. In some embodiments, the cells of step (i) have been genetically modified to mutate or delete one or more endogenous MHC alleles.

[0009] In some embodiments, step (i) comprises genetically modifying the cell to mutate or delete one or more endogenous MHC alleles. In some embodiments, step (i) comprises genetically modifying the cell to mutate or delete an endogenous MHC allele.

[0010] In some embodiments, the MHC alleles described herein are MHCI alleles.

[0011] In some embodiments, the monoallelic MHC expressing cell line expresses β2-microglobulin (B2M).

[0012] In some embodiments, the MHCI allele is encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. Exemplary MHCI alleles described herein can include MHCI alleles known in the art (e.g., HLA alleles in public databases). In some embodiments, the MHCI allele is selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02.

[0013] In some embodiments, the methods described herein further comprise introducing a polynucleotide cassette encoding multiple neo-antigen associated peptides into a monoallelic MHC expressing cell line. In some embodiments, the multiple neo-antigen associated peptides are expressed in the monoallelic MHC expressing cell line and cleaved into multiple neo-epitopes, at least one neo-epitope specifically binding to an exogenous MHC allele polypeptide. In some embodiments, at least one neo-epitope is 8, 9, 10, 11, 12 or 13 amino acids in length. In some embodiments, the neo-antigen associated peptides were identified by bioinformatics and / or clinical analysis of tumor mutations. In some embodiments, at least one of the neo-antigen associated peptides comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more (and any value or subrange within the ranges provided, including endpoints) sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222. In some embodiments, at least one of the neo-antigen associated peptides consists of at least one of SEQ ID NOs: 1-72, 75-191, and 195-222. In some embodiments, each of the multiple neo-antigen associated peptides is about 20 to about 50 amino acids in length, about 25 to about 45 amino acids, about 30 to about 40 amino acids, about 20 to about 30 amino acids, about 30 to about 40 amino acids, about 40 to about 50 amino acids, and any value or subrange within the ranges provided (including endpoints).

[0014] In some embodiments, at least one of the neo-antigen associated peptides is selected from the neo-antigens listed herein, in the sequence listing, and / or in the figures.

[0015] In some embodiments, the cells described herein are antigen-presenting cells (APCs). In some embodiments, the cells are HMy2.C1R cells. In some embodiments, the cells are K562 cells (e.g., ATCC product CCL-243™).

[0016] In another aspect, the present disclosure provides a monoallelic MHC expressing cell line produced by the methods described herein.

[0017] In another aspect, the disclosure provides a system comprising a plurality of mono-allelic MHC-expressing cell lines, each cell line expressing an exogenous MHC allele, such that each cell line does not express an endogenous MHC allele, and each cell line expresses a different exogenous MHC allele.

[0018] In some embodiments, each of the monoallelic MHC expressing cell lines has been genetically modified to mutate or delete one or more endogenous MHC alleles.In some embodiments, each of the monoallelic MHC expressing cell lines has been genetically modified to mutate or delete an endogenous MHC allele.

[0019] In some embodiments, each of the expressed MHC alleles is a MHCI allele.

[0020] In some embodiments, the monoallelic MHC expressing cell line expresses β2-microglobulin (B2M).

[0021] Exemplary MHCI alleles described herein may include MHCI alleles known in the art (e.g., HLA alleles in public databases). In some embodiments, the MHCI alleles are encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. In some embodiments, the MHC alleles are selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02.

[0022] In some embodiments, each cell line comprises a polynucleotide cassette encoding multiple neo-antigen associated peptides. In some embodiments, multiple neo-antigen associated peptides are expressed in multiple monoallelic MHC expressing cell lines and cleaved into multiple neo-epitopes, at least one neo-epitope specifically binding to an exogenous MHC allele polypeptide. In some embodiments, at least one neo-epitope is 8, 9, 10, 11, 12 or 13 amino acids in length. In some embodiments, multiple neo-antigen associated peptides were identified by bioinformatics and / or clinical analysis of tumor mutations. In some embodiments, at least one of the plurality of neo-antigen associated peptides comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more (and any value or subrange within the ranges provided, including endpoints) sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222. In some embodiments, at least one of the neo-antigen associated peptides consists of at least one of SEQ ID NOs: 1-72, 75-191, and 195-222. In some embodiments, each of the plurality of neo-antigen associated peptides is about 20 to about 50 amino acids in length, about 25 to about 45 amino acids, about 30 to about 40 amino acids, about 20 to about 30 amino acids, about 30 to about 40 amino acids, about 40 to about 50 amino acids, and any value or subrange within the ranges provided (including endpoints). In some embodiments, at least one of the neo-antigen associated peptides is selected from the neo-antigens listed herein, in the sequence listing, and / or in the figures.

[0023] In some embodiments, each of the monoallelic MHC expressing cell lines is an antigen presenting cell (APC). In some embodiments, the cell is an HMy2.C1R cell. In some embodiments, the cell is a K562 cell (e.g., ATCC product CCL-243™).

[0024] In another aspect, the disclosure provides an isolated polynucleotide cassette encoding a plurality of neo-antigen associated peptides. In some embodiments, each of the plurality of neo-antigen associated peptides is about 20 to about 50 amino acids in length, about 25 to about 45 amino acids in length, about 30 to about 40 amino acids in length, about 20 to about 30 amino acids in length, about 30 to about 40 amino acids in length, about 40 to about 50 amino acids in length, and any value or subrange within the provided ranges (including the endpoints). In some embodiments, the plurality of neo-antigen associated peptides were identified by bioinformatics and / or clinical analysis of tumor mutations.

[0025] In some embodiments, the isolated polynucleotide cassette further comprises at least a linker between the two neo-antigen associated peptides, hi some embodiments, the linker comprises a peptide linker, such as one of glycine-serine (GS) linkers.

[0026] In some embodiments, the isolated polynucleotide cassette further comprises at least one promoter capable of initiating translation of the multiple neo-antigen associated peptides into a single polypeptide in a cell. In some embodiments, the single polypeptide is cleaved into multiple neo-epitopes within the cell. In some embodiments, the multiple neo-epitopes are displayed on the surface of the cell.

[0027] In some embodiments, at least one of the plurality of neo-antigen associated peptides comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more (and any value or subrange within the provided ranges, including the endpoints) sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222.

[0028] In another aspect, the disclosure provides a method for identifying a neoepitope-MHC binding pair. In some embodiments, the method comprises: (i) providing a mono-allelic MHC expressing cell line comprising cells, each cell expressing a first exogenous MHC allele and comprising a polynucleotide cassette encoding a plurality of neo-antigen associated peptides; (ii) expressing a plurality of neo-antigen associated peptides in each cell, wherein a plurality of neo-epitopes are produced in each cell by cleaving the plurality of neo-antigen associated peptides, such that one or more neo-epitopes bind to a first exogenous MHC at the cell surface; (iii) eluting the neoepitope from the bound first exogenous MHC at the cell surface; (iv) identifying the eluted neoepitopes from step (iii), thereby identifying neoepitope-MHC binding pairs; Includes.

[0029] In another aspect, the present disclosure provides a method for identifying a neoepitope-MHC binding pair, comprising: (i) providing a monoallelic MHC expressing cell line comprising cells, each cell expressing a first exogenous MHC allele; (ii) contacting the cell with a synthetic neoepitope; (iii) eluting peptides bound to the first exogenous MHC allele at the cell surface; (iv) identifying the eluted neoepitopes from step (iii), thereby identifying neoepitope-MHC binding pairs; The present invention provides a method comprising:

[0030] In some embodiments, multiple neo-antigen related peptides are determined to bind to one or more MHC by peptide exchange assays.

[0031] In some embodiments, multiple neo-antigen associated peptides were identified by bioinformatics and / or clinical analysis of tumor mutations.

[0032] In some embodiments, at least one of the multiple neoepitopes is 8, 9, 10, 11, 12, or 13 amino acids in length.

[0033] In some embodiments, at least one of the plurality of neo-antigen associated peptides comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more (and any value or subrange within the provided ranges, including the endpoints) sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222.

[0034] In some embodiments, each of the multiple neo-antigen related peptides is about 20 to about 50 amino acids in length, about 25 to about 45 amino acids in length, about 30 to about 40 amino acids in length, about 20 to about 30 amino acids in length, about 30 to about 40 amino acids in length, about 40 to about 50 amino acids in length, and any value or subrange within the provided ranges (including the endpoints).

[0035] In some embodiments, at least one of the multiple neo-antigen associated peptides is selected from the neo-antigens listed herein, the sequence listing, and / or the figures.

[0036] In some embodiments, multiple neo-antigen associated peptides are expressed in a single polypeptide. In some embodiments, the single polypeptide comprises at least one linker between two neo-antigen associated peptides. In some embodiments, the linker comprises a peptide linker, such as one of the glycine-serine (GS) linkers.

[0037] In some embodiments, the synthetic neoepitopes are determined to bind to one or more MHC allele polypeptides by peptide exchange assays.

[0038] In some embodiments, steps (i)-(iv) of the methods described herein are repeated in a second mono-allelic MHC expressing cell line comprising cells, each cell expressing a second exogenous MHC allele polypeptide.

[0039] In some embodiments, each cell of the monoallelic MHC expressing cell line in step (i) of the methods described herein has been genetically modified to mutate or delete an endogenous MHC allele.

[0040] In some embodiments, step (i) of the method described herein comprises genetically modifying one or more cells of a monoallelic MHC expressing cell line to mutate or delete one or more (e.g., one) endogenous MHC alleles. In some embodiments, the MHC allele is an MHCI allele. In some embodiments, the monoallelic MHC expressing cell line expresses β2-microglobulin (B2M). Exemplary MHCI alleles described herein may include MHCI alleles known in the art (e.g., HLA alleles in public databases). In some embodiments, the MHCI allele is encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. In some embodiments, the MHC allele is selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02.

[0041] In another aspect, the disclosure provides a vaccine, such as a cancer vaccine. In some embodiments, the cancer vaccine comprises an isolated polypeptide or an isolated polynucleotide encoding a polypeptide, wherein the polypeptide comprises a neoepitope in a neoepitope-MHC binding pair identified by the methods described herein.

[0042] In another aspect, the disclosure provides a method of preparing a T cell expressing a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR), comprising introducing the TCR and / or CAR into a T cell, wherein the TCR and / or CAR specifically binds to a neoepitope-MHC complex formed by a neoepitope-MHC binding pair identified by the methods described herein.

[0043] In another aspect, the present disclosure provides recombinant T cells expressing a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR). In some embodiments, the TCR and / or CAR is selected from the following: Neoepitopes produced by cleaving neoantigen-related peptides expressed by the tumor or cancer; and MHC alleles expressed by the tumor or cancer The MHC-binding pair comprises a neoepitope-MHC binding pair comprising:

[0044] In some embodiments, the MHC allele peptide is a MHCI allele peptide.

[0045] In some embodiments, the monoallelic MHC expressing cell line expresses β2-microglobulin (B2M).

[0046] Exemplary MHCI alleles described herein can include MHCI alleles known in the art (e.g., HLA alleles in public databases). In some embodiments, the MHCI alleles are encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. In some embodiments, the MHC allele peptide is encoded by an MHC allele selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02.

[0047] In some embodiments, neo-antigen associated peptides were identified by bioinformatics and / or clinical analysis of tumor mutations.

[0048] In some embodiments, the neoepitope is 8, 9, 10, 11, 12, or 13 amino acids in length.

[0049] In some embodiments, the neo-antigen associated peptide comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more (and any value or subrange within the provided ranges, including the endpoints) sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222.

[0050] In some embodiments, each of the neo-antigen-related peptides is about 20 to about 50 amino acids in length, about 25 to about 45 amino acids, about 30 to about 40 amino acids, about 20 to about 30 amino acids, about 30 to about 40 amino acids, about 40 to about 50 amino acids in length, and any value or subrange within the provided ranges (including the endpoints).

[0051] In another aspect, the disclosure provides a method of selecting a subject having a cancer or tumor for treatment with T cells expressing a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR). In some embodiments, the method comprises: (i) genotyping a subject to identify MHC alleles expressed by the subject and neo-antigens expressed by the cancer or tumor, where the neo-antigens can be cleaved by cells to produce multiple neo-epitopes; (ii) determining whether the expressed MHC is capable of binding to one or more of the neoepitopes, and if the identified MHC and a neoepitope of the plurality of neoepitopes form a neoepitope-MHC binding pair, the subject is determined to be treatable by the T cells; Including, The TCR and / or CAR specifically bind to the neoepitope-MHC binding pair.

[0052] In another aspect, the disclosure provides a method of selecting a subject having cancer or a tumor for treatment with a cancer vaccine, comprising: (i) genotyping a subject to identify MHC proteins expressed by the subject and neo-antigens expressed by the cancer or tumor, where the neo-antigens may be cleaved by cells to produce multiple neo-epitopes; (ii) determining whether the MHC is capable of binding to one or more of the neoepitopes; Including, If the identified MHC protein and a neoepitope of the plurality of neoepitopes form a neoepitope-MHC binding pair, the subject is determined to be treatable with a cancer vaccine comprising the neoepitope or a polynucleotide encoding the neoepitope. A method is provided.

[0053] In another aspect, the disclosure provides a method of treating a subject having a cancer or tumor that expresses a neoantigen-associated peptide and an MHC, wherein the MHC is determined to bind to a neoepitope from the neoantigen, the method comprising administering to the subject a therapeutically effective amount of a T cell expressing a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR), wherein the TCR and / or CAR specifically binds to a neoepitope-MHC binding pair comprising the MHC and the neoepitope.

[0054] In another aspect, the disclosure provides a method of treating a subject having cancer or a tumor. In some embodiments, the method comprises: (i) selecting a subject with cancer who expresses an MHC allele and expresses a neoantigen, wherein the MHC is determined to bind a neoepitope from the neoantigen; (ii) administering to the subject a therapeutically effective amount of T cells expressing a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR); Including, The TCR and / or CAR specifically bind to a neoepitope-MHC binding pair that includes the MHC and the neoepitope.

[0055] In another aspect, the disclosure provides a method of treating a subject having a cancer or tumor that expresses a neoantigen and an MHC allele, wherein the MHC is determined to bind to a neoepitope from the neoantigen, the method comprising administering to the subject a therapeutically effective amount of a vaccine comprising the neoepitope or a polynucleotide encoding the neoepitope.

[0056] In some embodiments, the neoepitopes are determined to bind to one or more MHC by peptide exchange assays.

[0057] In some embodiments, neoantigens are identified by bioinformatics and / or clinical analysis of tumor mutations.

[0058] In some embodiments, the neo-antigen is a neo-antigen listed in the specification, the sequence listing and / or the figures.

[0059] In some embodiments, the neoepitope is 8, 9, 10, 11, 12, or 13 amino acids in length.

[0060] In some embodiments, the neoepitope comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more (and any value or subrange within the provided ranges, including the endpoints) sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222.

[0061] In some embodiments, the MHC allele is a MHCI allele.

[0062] In some embodiments, the monoallelic MHC expressing cell line expresses β2-microglobulin (B2M).

[0063] Exemplary MHCI alleles described herein may include MHCI alleles known in the art (e.g., HLA alleles in public databases). In some embodiments, the MHCI alleles are encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. In some embodiments, the MHC alleles are selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02. [Brief description of the drawings]

[0064] [Figure 1A]Figures 1A-1D show an example of a neoepitope discovery pipeline. Figure 1A shows a clinical genomics analysis of all known neoantigens, including a summary of the shared neoepitope discovery pipeline (bottom panel). Neoepitope-HLA pairs were tested in high-throughput binding assays. Binders were further investigated in engineered cell lines expressing 47mer neoantigen cassettes by non-targeted and targeted immunized peptide animals to confirm presentation of neoepitope-HLA pairs. Selected neoepitopes were then validated for immunogenic potential through the discovery of specific TCRs enabling T cell activation and target cell killing. Figure 1B is a schematic of a TR-FRET assay to measure neoepitope-HLA binding and stability. Figure 1C is a schematic of cells with engineered single alleles and neoantigens. Figure 1D is a schematic of targeted mass spectrometry to measure neoepitope presentation. [Figure 1B] See legend to Figure 1A. [Figure 1C] See legend to Figure 1A. [Figure 1D] See legend to Figure 1A. [Figure 2A]2A-2F are a set of graphs showing neoepitope binders identified by TR-FRET and NetMHC. FIG. 2A shows TR-FRET (dots / left axis) and NetMHC (squares / right axis) analysis of KRAS G12R neoepitope binders to the B*07:02 allele. KRAS G12R neoepitopes listed from left to right are defined as SEQ ID NOs: 1-37. FIG. 2B shows TR-FRET (dots / left axis) and NetMHC (squares / right axis) analysis of ESR K303R neoepitope binders to the B*07:02 allele. ESR K303R neoepitopes listed from left to right are defined as SEQ ID NOs: 38-72. FIG. 2C shows the percentage of binders identified by TR-FRET and NetMHC 4.0 analysis. Figure 2D compares the percentage of neoepitope-HLA combinations determined to be stable binders by TR-FRET (right bar in each panel) and NetMHC (left bar in each panel) analysis across HLA A, B and C alleles. Figure 2E is a graph further illustrating the results of Figure 2A, showing the TR-FRET RZ score (lower panel) and 1 / NetMHC percentile rank (upper panel) of all neoepitope-HLA combinations for the B*07:02 allele and KRAS G12R neoantigen. The dotted lines in the upper and lower panels represent the stable binder cutoffs for NetMHC and TR-FRET analysis, respectively.The KRAS G12R neoantigens are, from left to right in FIG. 2E , ARGVGKSA (SEQ ID NO:5), ARGVGKSAL (SEQ ID NO:6), ARGVGKSALT (SEQ ID NO:7), ARGVGKSALTI (SEQ ID NO:8), EYKLVVVGAR (SEQ ID NO:35), EYKLVVVGARG (SEQ ID NO:36), GARGVGKS (SEQ ID NO:9), GARGVGKSA (SEQ ID NO:10), GARGVGKSAL (SEQ ID NO:11), GARGVGKSALT (SEQ ID NO:12), KLVVVGAR (SEQ ID NO:28), KLVVVGARG (SEQ ID NO:29), KLVVVGARGV (SEQ ID NO:30), KLVVVGARGVG (SEQ ID NO:31), LVVVGARGV (SEQ ID NO:25), LVVVGARGVG (SEQ ID NO:26), LVVVGARGVGK (SEQ ID NO:27), RGVGKSAL (SEQ ID NO:1), RGV GKSALT (SEQ ID NO:2), RGVGKSALTI (SEQ ID NO:3), RGVGKSALTIQ (SEQ ID NO:4), TEYKLVVVGAR (SEQ ID NO:37), VGARGVGK (SEQ ID NO:13), VGARGVGKS (SEQ ID NO:14), VGARGVGKSA (SEQ ID NO:15), VGARGVGKSAL (SEQ ID NO:16), VVGARGVG (SEQ ID NO:17), VVGARGVGK (SEQ ID NO:18), VVGARGVGKS (SEQ ID NO:19), VVGARGVGKSA (SEQ ID NO:20), VVVGARGV (SEQ ID NO:21), VVVGARGVG (SEQ ID NO:22), VVVGARGVGK (SEQ ID NO:23), VVVGARGVGKS (SEQ ID NO:24), YKLVVVGAR (SEQ ID NO:32), YKLVVVGARG (SEQ ID NO:33), and YKLVVVGARGV (SEQ ID NO:34). Figure 2F is a graph further illustrating the results of Figure 2B, showing the TR-FRET robust Z-scores (boxes in the lower panel) and 1 / percentile ranks (dots in the upper panel) of all neoepitope-HLA combinations for the B*07:02 allele and the ESR1 K303R neoantigen. The dotted lines in the upper and lower panels represent the cutoffs for stable binders for NetMHC and TR-FRET analysis, respectively.The ESR1 K303R neoantigens are, from left to right in FIG. 2F , IKRSKRNS (SEQ ID NO: 56), IKRSKRNSLA (SEQ ID NO: 57), IKRSKRNSLAL (SEQ ID NO: 58), KRNSLALS (SEQ ID NO: 42), KRNSLALSL (SEQ ID NO: 43), KRNSLALSLT (SEQ ID NO: 44), KRNSLALSLTA (SEQ ID NO: 45), KRSKRNSLA (SEQ ID NO: 53), KRSKRNSLAL (SEQ ID NO: 54), KRSKRNSLALS (SEQ ID NO: 55), LMIKRSKR (SEQ ID NO: 63), LMIKRSKRN (SEQ ID NO: 64), LMIKRSKRNS (SEQ ID NO: 65), LMIKRSKRNSL (SEQ ID NO: 66), MIKRSKRN (SEQ ID NO: 59), MIKRSKRNS (SEQ ID NO: 60), MIKRSKRNSL (SEQ ID NO: 61), MIKR SKRNSLA (SEQ ID NO:62), PLMIKRSKR (SEQ ID NO:67), PLMIKRSKRN (SEQ ID NO:68), PLMIKRSKRNS (SEQ ID NO:69), PSPLMIKRSKR (SEQ ID NO:72), RNSLALSL (SEQ ID NO:38), RNSLALSLT (SEQ ID NO:39), RNSLALSLTA (SEQ ID NO:40), RNSLALSLTAD (SEQ ID NO:41), RSKRNSLAL (SEQ ID NO:50), RSKRNSLALS (SEQ ID NO:51), RSKRNSLALSL (SEQ ID NO:52), SKRNSLAL (SEQ ID NO:46), SKRNSLALS (SEQ ID NO:47), SKRNSLALSL (SEQ ID NO:48), SKRNSLALSLT (SEQ ID NO:49), SPLMIKRSKR (SEQ ID NO:70), and SPLMIKRSKRN (SEQ ID NO:71). [Figure 2B] See legend to Figure 2A. [Figure 2C] See legend to Figure 2A. [Figure 2D] See legend to Figure 2A. [Figure 2E] See legend to Figure 2A. [Figure 2F] See legend to Figure 2A. [Figure 3A]3A-3E are a set of graphs comparing the results of TR-FRET and NetMHC analysis. FIG. 3A shows a comparison of the concordance rates between TR-FRET and NetMHC analysis in identifying binders and non-binders. FIG. 3B shows a comparison of the concordance rates between TR-FRET and NetMHC analysis in identifying binders. FIG. 3C shows a comparison of the concordance rates between TR-FRET and NetMHC analysis in identifying non-binders. FIG. 3D shows a comparison of the concordance rates between TR-FRET and NetMHC analysis in HLA-A, HLA-B and HLA-C alleles. FIG. 3E shows the percent of neoepitope-HLA pairs found to be binders by both NetMHCpan 4.0 and TR-FRET across individual alleles, representing the results of FIG. 3B after correction. [Figure 3B] See legend to Figure 3A. [Figure 3C] See legend to Figure 3A. [Figure 3D] See legend to Figure 3A. [Figure 3E] See legend to Figure 3A. [Figure 4A] Figures 4A-4D are a set of graphs comparing all binders identified between the TR-FRET and NetMHC analyses. Figure 4A shows a heat map showing the number of neoepitope binders for each neo-antigen across all HLAs screened for the TR-FRET analysis. Figure 4B shows a heat map showing the number of neoepitope binders for each neo-antigen across all HLAs screened for the NetMHC analysis. Figures 4C and 4D show heat maps showing the number of neoepitope binders for each neo-antigen (y-axis) across all 15 HLAs (x-axis) screened for the NetMHC analysis (Figure 4C) or TR-FRET analysis (Figure 4D) from a similar experiment. [Figure 4B] See legend to Figure 4A. [Figure 4C-1] See legend to Figure 4A. [Figure 4C-2] See legend to Figure 4A. [Figure 4D-1] See legend to Figure 4A. [Figure 4D-2] See legend to Figure 4A. [Figure 5A] 5A-5C are a set of graphs showing an example of a cell engineering process. FIG. 5A shows the structure of an example of a piggybac neo-antigen cassette containing a linked neo-antigen expression array with or without a linker between each of the neo-antigens in the expression array, and a control construct containing several viral peptides known to be presented by A*02:01 at the C-terminus. FIG. 5B shows the process of introducing a piggybac neo-antigen expression construct or control with or without a linker into a K562 cell line stably expressing the A*02:01 allele. Using HLA IP+LC-MS, any neo-epitopes cleaved from the neo-antigens and bound to the expressed A*02:01 allele can be detected. FIG. 5C is a graph showing several identified viral control peptides on the control construct, as expected. Exemplary peptides include ELAGIGILTV (SEQ ID NO: 75), NLVPMVATV (SEQ ID NO: 76), and SLLMWITQV (SEQ ID NO: 214). Those identified by the Control Set 1 constructs are boxed and those identified by the "All Controls" construct are indicated by arrows. [Figure 5B] See legend to Figure 5A. [Figure 5C-1] See legend to Figure 5A. [Figure 5C-2] See legend to Figure 5A. [Figure 6A]Figures 6A-6H are a set of graphs showing an example of a cell engineering process. Figure 6A shows an example of a CRISPR / Cas9 knockout strategy to create an HLA-class I knockout (class I KO) HMy2.C1R population useful for removing residual HLA-C alleles (HLA-C*04:01) from HMy2.C1R cells and producing a monoallelic cell line expressing exogenous A*02:01. The HLA-C*04:01 specific sgRNA (long) comprises the sequence TGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGA (SEQ ID NO: 73) and the HLA-C*04:01 specific sgRNA target sequence comprises the sequence TTCATCGCAGTGGGCTACG (SEQ ID NO: 74). Figure 6B shows flow cytometric detection of pan-HLA-I expression in wild-type (WT) or HMy2.C1R HLA I knockout (KO) cells using pan-HLA-I detection antibody W6 / 32 or isotype (ISO) control, comparing the difference in HLA expression between such class I KO cells and parental wild-type HMy2.C1R. Expression of exogenous A*02:01 and piggyBac neoantigen expression constructs in class I KO cells was detected by FACS as shown in Figure 6C. Figure 6D shows an example of transducing class I KO cells into producer cells expressing the HLA variant of interest for further analysis. Figure 6E shows the vector map of the piggyBac poly neoantigen expression construct utilized in this study. A single transcript containing 47 concatenated neoantigens (approximately 25 amino acids long for each neoantigen) followed by 7 control peptides and an IRES-linked BFP reporter is driven by the pol II Ef1 alpha promoter. Neoantigens were either directly linked (no linker) or dispersed by a short flexible linker sequence (linker). Figure 6F shows flow cytometry detection of HLA-I expression (using W6 / 32 antibody) and polyantigen cassette expression (BFP, a.k.a. blue fluorescent protein) of selected cell lines or class I knockout parental lines.Figure 6G shows flow cytometric detection of pan-HLA expression (by W6 / 32 antibody; upper panel) or expression of a transcriptionally linked TagBFP2 reporter gene (by BFP, lower panel) in the indicated polyneoantigen-expressing monoallelic cell line HMy2.CIRMHCInull. Figure 6H shows targeted immunopeptidic detection of expression of control antigen peptides (left dark column: NLVPMVATV (SEQ ID NO: 76) from pp65; right grey column: VLEETSVML (SEQ ID NO: 79) from IE-1) in both linker and no linker HLA-A*02:01 engineered cells. [Figure 6B] See legend to Figure 6A. [Figure 6C] See legend to Figure 6A. [Figure 6D] See legend to Figure 6A. [Figure 6E] See legend to Figure 6A. [Figure 6F] See legend to Figure 6A. [Figure 6G-1] See legend to Figure 6A. [Figure 6G-2] See legend to Figure 6A. [Figure 6H] See legend to Figure 6A. [Figure 7] FIG. 7 is a graph showing counts of 8-11 mer unique peptides per allele for the 17 HLA variants of interest. [Figure 8A]8A-8B are a set of graphs showing identified neoepitope-HLA binding pairs. Figure 8A shows examples of 18 neoepitope-HLA binding pairs from 15 shared neoantigens across four HLA alleles that were identified by the non-targeted analysis described herein. The identified neoantigens, represented by blocks from top to bottom, are as follows: NRAS Q61K (ILDTAGKEEY, SEQ ID NO:125) and NRAS Q61R / HRAS Q61R (ILDTAGREEY, SEQ ID NO:126) for A*01:01; BRAF V600M (KIGDFGLATM, SEQ ID NO:112), FGFR3 S249C (YTLDVLERC, SEQ ID NO:115), FLT3 D835Y (YIMSDSNYV, SEQ ID NO:116), FLT3 D835Y (YIMSDSNYVV, SEQ ID NO:117), and TP53 R175H (HMTEVVRHC, SEQ ID NO:128) for A*11:01; EGFR G719A (ASGAFGTVYK, SEQ ID NO:113), KRAS G12A (VVVGAAGVGK, SEQ ID NO:118), KRAS G12C (VVVGACGVGK, SEQ ID NO:119), KRAS G12D (VVVGADGVGK, SEQ ID NO:120), KRAS G12S (VVVGASGVGK, SEQ ID NO:121), KRAS G12V (VVGAVGVGK, SEQ ID NO:122), KRAS G12V (VVVGAVGVGK, SEQ ID NO:123), KRAS G13C (VVVGAGCVGK, SEQ ID NO:124), and TP53 R248Q (SCMGGMNQR, SEQ ID NO:129); GFGR3 S249C (ERCPHRPIL, SEQ ID NO:114) and PIK3CA H1047L (FMKQMNDAL, SEQ ID NO:127) for B*08:01. Figure 8B compares the NetMHC-presenting predicted scores ("EL-mut") with the measured robust z-scores ("robust z-scores"; indicated by arrows or enclosed by ellipses) for these 18 pairs. [Figure 8B] See legend to Figure 8A. [Figure 9]Figure 9 is a set of graphs showing neoepitope-HLA binding pairs identified by non-targeted + targeted analysis or targeted analysis only. The NetMHC presentation prediction scores ("EL-mut", top panel) and measured robust Z scores ("Robust Z scores", bottom panel) of these identified pairs are compared. [Figure 10] Figure 10 is a graph showing a scatter plot of TR-FRET RZ scores and Log2 NetMHC percentile ranks. The horizontal dashed line represents the cutoff for stable binders as measured by TR-FRET, and values ​​higher than the horizontal dashed line are considered stable binders. The vertical dashed line represents the cutoff for binders based on NetMHC analysis, and values ​​lower (to the left of) the vertical dashed line are considered binders. [Figure 11] FIG. 11 is a graph showing a scatter plot similar to that of FIG. 10, but for each specific allele. [Figure 12A]Figures 12A-B are a set of graphs showing differences in protein turnover rates comparing C1R A*11:01 KRAS full-length samples with shared Neo no-linker samples. For these analyses, A*11:01 monoallelic cells were engineered to express doxycycline (dox)-inducible full-length KRAS wild-type (WT) or mutant proteins (G12C, G12D, G12V). These were compared to an A*11:01 monoallelic cell line containing a linkerless polyantigen cassette. The bars in each panel represent, from left to right, experiments with WT not induced by dox, WT induced by dox, G12C not induced by dox, G12C induced by dox, G12D not induced by dox, G12D induced by dox, G12V not induced by dox, G12V induced by dox, or a shared Neo no-linker control. Figure 12A shows the absolute amount of KRAS WT and the expression of the indicated mutant proteins in cell lysates by targeted mass spectrometry. Identified peptides include SFEDIHHYR (SEQ ID NO: 175), LVVVGACGVGK (SEQ ID NO: 176), LVVVGADGVGK (SEQ ID NO: 177) and LVVVGAVGVGK (SEQ ID NO: 178). Figure 12B shows the copies per cell of presented KRAS-derived peptides measured by isotope A*11:01 monomer containing heavy synthetic neoepitope-related peptides spiked in prior to affinity purification and targeted mass spectrometry. NL refers to no linker. n=1 (NL samples were processed only for heavy isotope-encoded peptide MHC (hipMHC) experiments). Identified peptides include VVGAGGVGK (SEQ ID NO: 179), VVVGAGGVGK (SEQ ID NO: 180), VVGACGVGK (SEQ ID NO: 157), VVVGACGVGK (SEQ ID NO: 119), VVGADGVGK (SEQ ID NO: 160), VVVGADGVGK (SEQ ID NO: 120), VVGAVGVGK (SEQ ID NO: 122) and VVVGAVGVGK (SEQ ID NO: 123). [Figure 12B] See legend to Figure 12A. [Figure 13A]13A-13D are a set of graphs showing an exemplary non-targeted immune peptide analysis of a monoallelic cell line expressing a poly-antigen cassette. FIG. 13A shows the workflow of the non-targeted immune peptide analysis. Exemplary peptide sequences include DARHGGWTT (SEQ ID NO: 181), MKQMNDAR (SEQ ID NO: 182), KICDFGLARY (SEQ ID NO: 183), PIIIGHHAY (SEQ ID NO: 174), VGGLRSERRKW (SEQ ID NO: 184), DILDTAGKEEY (SEQ ID NO: 185), SKITEQEK (SEQ ID NO: 186), ATMKSRWSG (SEQ ID NO: 187), LSEITKQEK (SEQ ID NO: 188), MNDARHGGWT (SEQ ID NO: 189), KQMNDARH (SEQ ID NO: 190), and the like. FIG. 13B shows the number of unique 8-11 mer peptides of each allele identified in the non-targeted immune peptide analysis. FIG. 13C shows the shared cancer neo-antigen epitopes identified. Colors represent the log10 maximum area across multiple analyses (arrows indicate the two blocks with maximum values). Identified neoantigenic epitopes include, from left to right: KIGDFGLATMK (SEQ ID NO: 133), ASGAFGTVYK (SEQ ID NO: 113), ERCPHRPIL (SEQ ID NO: 114), YIMSDSNYV (SEQ ID NO: 116), YIMSDSNYVV (SEQ ID NO: 117), VVVGAAGVGK (SEQ ID NO: 118), VVVGACGVGK (SEQ ID NO: 119), VVVGADGVGK (SEQ ID NO: 120), VVVGASGVGK (SEQ ID NO: 121), VVVGASGVGK (SEQ ID NO: 122), VVVGASGVGK (SEQ ID NO: 123), VVVGASGVGK (SEQ ID NO: 124), VVVGASGVGK (SEQ ID NO: 125), VVVGASGVGK (SEQ ID NO: 126), VVVGASGVGK (SEQ ID NO: 127), VVVGASGVGK (SEQ ID NO: 128), VVVGASGVGK (SEQ ID NO: 129), VVVGASGVGK (SEQ ID NO: 130), VVVGASGVGK (SEQ ID NO: 131), VVVGASGVGK (SEQ ID NO: 132), VVVGASGVGK (SEQ ID NO: 133), VVVGASGVGK (SEQ ID NO: 134), VVVGASGVGK (SEQ ID NO: 135), VVVGASGVGK (SEQ ID NO: 136), VVVGASGVGK (SEQ ID NO: 137), VVVGASGVGK (SEQ ID NO: 138), VVVGASGVGK ( (SEQ ID NO:121), VVGAVGVGK (SEQ ID NO:122), VVVGAVGVGK (SEQ ID NO:123), VVVGAGCVGK (SEQ ID NO:124), ILDTAGKEEY (SEQ ID NO:125), ILDTAGREEY (SEQ ID NO:126), ALHGGWTTK (SEQ ID NO:170), FMKQMNDAL (SEQ ID NO:127), HMTEVVRHC (SEQ ID NO:128), and SCMGGMNQR (SEQ ID NO:129). Figure 13D compares the TR-FRET robust Z-score (RZ-score) and NetMHC percentile rank (% rank) scores for each epitope identified by untargeted immunopeptidome analysis. [Figure 13B] See legend to Figure 13A. [Figure 13C]See legend to Figure 13A. [Figure 13D] See legend to Figure 13A. [Figure 14] Figure 14 is a graph showing exemplary numbers of unique peptides (8-11 mer) identified in untargeted proteomic analysis stratified by allele and linker status of the neo-antigen construct. Each dot represents a measurement from a cell pellet. Boxes represent interquartile ranges and lines represent medians. [Figure 15A-1] Figure 15A and Figure 15B are a set of graphs showing the consistency between the binding motif sequences of the proposed peptides (Figure 15B for experimental motifs) and the corresponding predicted motifs (Figure 15A for known motifs). The binding motifs were determined by untargeted mass spectrometry. The motifs were generated using GibbsCluster 2.0, with two bins allowing one bin for dominant motifs and a second bin for non-specific peptides. [Figure 15A-2] See description of Figure 15A-1. [Figure 15A-3] See description of Figure 15A-1. [Figure 15B-1] See description of Figure 15A-1. [Figure 15B-2] See description of Figure 15A-1. [Figure 15B-3] See description of Figure 15A-1. [Figure 16A]Figures 16A-F are a set of graphs showing an exemplary targeted immune peptide analysis of a monoallelic cell line expressing a poly-antigen cassette. Figure 16A shows the targeted immune peptide workflow. Figure 16B shows the number of targeted (left bar for each allele) and detected (right bar for each allele) shared cancer neo-antigen epitopes for each allele. Figure 16C compares the TR-FRET RZ score and NetMHC% rank score for each epitope identified by targeted MS. Figure 16D shows the NetMHC% rank score for neo-epitopes detected in both non-targeted and targeted analyses (left) or only in targeted analyses (right). Figure 16E shows the TR-FRET RZ score for neo-epitopes detected in both non-targeted and targeted analyses (left) or only in targeted analyses (right). Figure 16F shows a summary of neo-epitope-HLA pairs detected from shared cancer neo-antigens. The colors represented the attomoles of neoepitopes detected on the columns during the analysis (arrows indicate blocks with higher Log2(attomole) values ​​than others). Bold boxes with a dot in the middle represent neoepitopes that are also detected in the non-targeted analysis. The results identify 84 unique neoepitope-HLA combinations from 37 mutations across 12 alleles. The "FRMVDVGGL" (SEQ ID NO: 146) peptide on the heatmap originates from both GNA11 and GNAQ proteins with an accurate NetMHC EL_mut score of 0.0918. However, this peptide associated with GNAQ protein based on a robust Z-score of 8.32 (as reflected in the plot) in contrast to 4.42 when associated with GNA11. Similarly, the "VDVGGLRSER" (SEQ ID NO: 147) peptide on the heatmap originates from both GNA11 and GNAQ proteins with an accurate NetMHC EL_mut score of 58.4. However, this peptide associated with the GNA11 protein (as reflected in the plot) based on a robust Z-score of 5.00, in contrast to 0.069 when associated with GNAQ. The identified neoepitopes include, from top to bottom, EKSRWSGSHQF (SEQ ID NO: 130);KIGDFGLATEK (SEQ ID NO: 131), IGDFGLATM (SEQ ID NO: 132), KIGDFGLATMK (SEQ ID NO: 133), KMRRKMSP (SEQ ID NO: 134), YTDVSNMSH (SEQ ID NO: 135), YTDVSNMSHLA (SEQ ID NO: 136), MPFGSLLDY (SEQ ID NO: 137), ASGAFGTVY (SEQ ID NO: 138), ASGAFGTVYK (SEQ ID NO: 113), FKKIKVLAS (SEQ ID NO: 139), LASGAFGTVYK (SEQ ID NO: 140), FGRAKLLGA (SEQ ID NO: 141), KITDFGRAK (SEQ ID NO: No. 222), LTSTVQLIM (SEQ ID NO: 142), STDVGFCTL (SEQ ID NO: 143), KRNSLALSL (SEQ ID NO: 43), MIKRSKRNSL (SEQ ID NO: 61), RSKRNSLAL (SEQ ID NO: 50), SKRNSLAL (SEQ ID NO: 46), CPHRPILQA (SEQ ID NO: 144), ERCPHRPIL (SEQ ID NO: 114), YTLDVLERC (SEQ ID NO: 115), FGLARYIM (SEQ ID NO: 145), YIMSDSNYV (SEQ ID NO: 116), YIMSDSNYVV (SEQ ID NO: 117), FRMVDVGGL (SEQ ID NO: 146), V DVGGLRSER (SEQ ID NO: 147), KPIIIGCH (SEQ ID NO: 148), WVKPIIIGC (SEQ ID NO: 149), IIIGGHAY (SEQ ID NO: 150), IIIGHHAY (SEQ ID NO: 151), PIIIGGHAY (SEQ ID NO: 152), VKPIIIGHHAY (SEQ ID NO: 153), SPNGTIQNIL (SEQ ID NO: 154), VVGAAGVGK (SEQ ID NO: 155), VVVGAAGVGK (SEQ ID NO: 118), GACGVGKSAL (SEQ ID NO: 156), VVGACGVGK (SEQ ID NO: 157), VVVGACGVGK (SEQ ID NO: 119), DGVGKSAL (SEQ ID NO: 158), GADGVGKSAL (SEQ ID NO: 159), VVGADGVGK (SEQ ID NO: 160), VVVGADGVGK (SEQ ID NO: 120), GARGVGKSA (SEQ ID NO: 10), GARGVGKSAL (SEQ ID NO: 11), VVVGARGVGK (SEQ ID NO: 23), VVGASGVGK (SEQ ID NO: 161), VVVGASGVGK (SEQ ID NO: 121), GAVGVGKSAL (SEQ ID NO: 162), VVGAVGVGK (SEQ ID NO: 122), VVVGAVGVGK (SEQ ID NO: 123), VVGAGCVGK (SEQ ID NO: 163),VVVGAGCVGK (SEQ ID NO: 124), VVGAGDVGK (SEQ ID NO: 164), RPIPIKYKAM (SEQ ID NO: 165), ILDTAGKEEY (SEQ ID NO: 125), LDTAGKEEY (SEQ ID NO: 166), AGREEYSAM (SEQ ID NO: 167), DTAGREEY (SEQ ID NO: 168), ILDTAGREEY (SEQ ID NO: 126), STRDPLSEITK (SEQ ID NO: 169), ALHGGWTTK (SEQ ID NO: 170), FMKQMNDAL (SEQ ID NO: 127), CNTTARAFAVV (SEQ ID NO: 171), HMTEVVRHC (SEQ ID NO: 128), SCMGGMNQR (SEQ ID NO: 129), GRNSFEVCV (SEQ ID NO: 172), and GRNSFEVHV (SEQ ID NO: 173). [Figure 16B] See legend to Figure 16A. [Figure 16C] See legend to Figure 16A. [Figure 16D] See legend to Figure 16A. [Figure 16E] See legend to Figure 16A. [Figure 16F-1] See legend to Figure 16A. [Figure 16F-2] See legend to Figure 16A. [Figure 17-1] Figure 17 is a set of graphs comparing the absolute amount of neoepitopes detected for each allele with the predicted presentation score by either the Robust Z-score (lower panel) or NetMHCpan-4.0 (upper panel) methods. Each dot represents a neoepitope-HLA pair detected within the targeted proteomic analysis. When multiple neoepitope-HLA pairs are detected, the attomole value is the maximum value of that peptide-HLA pair across all analyses. [Figure 17-2] See description of Figure 17-1. [Figure 18-1]Figure 18 is a set of graphs comparing epitope presentation of cell lines containing linkers and cell lines that do not contain the analogous construct. Each line represents a specific epitope, and the slope of the line demonstrates whether expression is lower, higher, or similar between monoallelic cell lines containing linkers and polyantigen cassettes without linkers. [Figure 18-2] See description of Figure 18-1. [Figure 19-1] Figure 19 is a set of graphs showing the analysis of epitope presentation across analysis batches taking into account the presence of linkers in the constructs. Each column represents a specific batch analysis of a cell line expressing a polyantigen cassette with or without a linker. The colors represent the absolute abundance measured by the attomole amount detected on the column for each neoepitope. The neoepitopes for each HLA are listed from top to bottom in the same order as in Figure 16F. [Figure 19-2] See description of Figure 19-1. [Figure 20-1] Figure 20 is a graph comparing epitope presentation between analytical batches. For each allele, detection of the epitope is displayed for each batch that includes analysis of a monoallelic cell line containing that particular allele. Colors represent the absolute amount of peptide in attomoles detected on the column for each neoepitope. Neoepitopes are listed from top to bottom in the same order as in Figure 16F. [Figure 20-2] See description of Figure 20-1. [Figure 20-3] See description of Figure 20-1. [Figure 21A]Figures 21A-M are a set of graphs showing functional validation of the identified tumor-associated neoepitope-HLA pairs. Human CD8+ T cells transfected with (A) FLT3-p.D835Y-specific or (B) PIK3CA-p.E545K-specific TCR RNA. Flt3-p.D835Y / HLA-A*02:01-specific TCR was transfected into primary human CD8+ T cells. Transfected T cells were co-cultured overnight with YIMSDSNYV (SEQ ID NO: 116) peptide-pulsed HLA-A*02:01+ T2 cells. Figure 21A evaluates CD137 expression by transfected T cells at different YIMSDSNYV (SEQ ID NO: 116) peptide concentrations pulsed on T2 cells. Traces represent, from top to bottom, T cells expressing various FLT3-p.D835Y-specific TCRs (FLT3_TCR_1, FLT3_TCR_2, and FLT3_TCR_3, respectively) and mock controls with no TCR expression. T cells were then co-cultured with monoallelic A*02:01 K562 cells expressing either the wild-type FLT3 transgene or the mutant FLT3-p.D835Y transgene. The resulting T cell activation is assessed by expression of CD137 (Figure 21B), TNF (pg / mL, Figure 21C), IFN gamma (pg / mL, Figure 21D), and granzyme B (pg / mL, Figure 21E) by activated T cells, as well as by killing / lysis of target K562 cells in Figure 21F. In Figures 21B-21F, the bars above each transgene condition represent, from left to right, a mock control with no TCR expression, and T cells expressing FLT3_TCR_1, FLT3_TCR_2, or FLT3_TCR_3 (as shown in Figure 21B). A similar experiment was performed by transfecting human CD8+ T cells with the predicted PIK3CA-p.E545K / HLA-A*11:01 TCR and mixing with monoallelic HLA-A*11:01 expressing K562 cells incubated with increasing concentrations of the predicted neo-epitope, STRDPLSEITK (SEQ ID NO: 169) (found only by targeted MS). Figure 21G evaluates CD137 expression by transfected T cells at different STRDPLSEITK (SEQ ID NO: 169) peptide concentrations pulsed onto K562 cells.Traces represent, from top to bottom, T cells expressing various PIK3CA-p.E545K-specific TCRs (PIK3CA_TCR_3, PIK3CA_TCR_1, PIK3CA_TCR_2, and PIK3CA_TCR_4, respectively), and a mock control with no TCR expression. T cells were then co-cultured with monoallelic HLA-A*11:01 K562 cells expressing either the wild-type PIK3CA transgene or the mutant PIK3CA-p.E545K transgene. The resulting T cell activation is assessed by expression of CD137 (Figure 21H), TNF (pg / mL, Figure 21J), IFN gamma (pg / mL, Figure 21K) and granzyme B (pg / mL, Figure 21L) by activated T cells, and by killing / lysis of target K562 cells in Figure 21M. In Figures 21H-21M, the bars above each transgene condition represent, from left to right, mock control with no TCR expression, and T cells expressing PIK3CA_TCR_1, PIK3CA_TCR_2, PIK3CA_TCR_3, or PIK3CA_TCR_4 (as shown in Figure 21H). [Figure 21B] See legend to Figure 21A. [Figure 21C] See legend to Figure 21A. [Figure 21D] See legend to Figure 21A. [Figure 21E] See legend to Figure 21A. [Figure 21F] See legend to Figure 21A. [Figure 21G] See legend to Figure 21A. [Fig. 21H] See legend to Figure 21A. [Figure 21J] See legend to Figure 21A. [Figure 21K] See legend to Figure 21A. [Figure 21L] See legend to Figure 21A. [Figure 21M] See legend to Figure 21A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0065] Detailed Description After reading this description, it will be clear to those skilled in the art how to implement the present disclosure in various alternative embodiments and alternative applications. However, not all of the various embodiments of the present invention are described herein. It is understood that the embodiments presented herein are presented by way of example only and are not limiting. Therefore, this detailed description of various alternative embodiments should not be interpreted as limiting the scope or breadth of the present disclosure described herein.

[0066] Before disclosing and describing the present technology, it is to be understood that the embodiments described below are not limited to particular compositions, methods of preparing such compositions, or uses thereof, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0067] The detailed description is divided into various sections solely for the convenience of the reader, and disclosures found in any section may be combined with those of another section. Titles or subtitles may be used herein for the convenience of the reader and are not intended to affect the scope of the disclosure.

[0068] I. Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In this specification and the claims that follow, reference will be made to certain terms that shall be defined to have the following meanings.

[0069] As described herein, any concentration range, percentage range, ratio range, or integer range should be understood to include every integer value within the recited range, and, where appropriate, fractions thereof (such as tenths and hundredths of integers), unless otherwise indicated.

[0070] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0071] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes cases where the event or circumstance occurs and cases where it does not occur.

[0072] The term "about" when used prior to a numerical designation, e.g., temperature, time, amount, concentration, etc., including a range, indicates an approximation that may vary by (+) or (-) 10%, 5%, 1%, or any subrange or subvalue therebetween. Preferably, the term "about" when used in reference to an amount means that the amount may vary by + / - 10%.

[0073] "Comprising" or "comprising" is intended to mean that the compositions and methods include the recited elements but do not exclude others. "Consisting essentially of," when used to define compositions and methods, is intended to mean excluding other elements that are essential to the combination for the described purpose. Thus, a composition consisting essentially of the elements defined herein does not exclude other materials or steps that do not materially affect the basic and novel feature(s) of the claimed invention. "Consisting of" is intended to mean excluding more than trace amounts of other components and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0074] As used herein, the term "cancer" refers to all types of cancer, neoplasm, or malignant tumor found in mammals (e.g., humans), including leukemia, lymphoma, carcinoma, and sarcoma.Exemplary cancers that can be treated using the compounds or methods provided herein include brain cancer, glioma, glioblastoma, neuroblastoma, prostate cancer, colorectal cancer, pancreatic cancer, medulloblastoma, melanoma, cervical cancer, gastric cancer, ovarian cancer, lung cancer, head cancer, Hodgkin's disease, and non-Hodgkin's lymphoma.Exemplary cancers that can be treated using the compounds or methods provided herein include thyroid, endocrine system, brain, breast, cervix, colon, head and neck, liver, kidney, lung, ovary, pancreas, rectum, stomach, and uterus cancer. Further examples include thyroid cancer, bile duct cancer, pancreatic adenocarcinoma, cutaneous melanoma, colon adenocarcinoma, rectal adenocarcinoma, gastric adenocarcinoma, esophageal cancer, squamous cell carcinoma of the head and neck, invasive carcinoma of the breast, lung adenocarcinoma, squamous cell carcinoma of the lung, non-small cell lung carcinoma, mesothelioma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, premalignant skin lesions, testicular cancer, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical carcinoma, endocrine or exocrine pancreatic neoplasms, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid carcinoma, hepatocellular carcinoma, or prostate cancer.

[0075] "Sample" or "biological sample" as used herein refers to any specimen intended for analysis. In some embodiments, the sample is taken from a patient. In some embodiments, the sample is a "biological fluid sample." "Biological fluid sample" as used herein refers to any biological fluid derived from an organism or subject. Examples include whole blood, plasma, tears, saliva, lymph, urine, serum, cerebrospinal fluid, pleural fluid, and peritoneal fluid.

[0076] "Immune response" and like terms are used in their normal accustomed sense to refer to a response by an organism that protects against disease. The response can be initiated by the innate or adaptive immune system, as is well known in the art.

[0077] "Modulating an immune response" and like terms refer to a change in a subject's immune response as a result of administration of an agent, such as a compound disclosed herein, including embodiments thereof. Thus, the immune response can be activated or deactivated as a result of administration of an agent, such as a compound disclosed herein, including embodiments thereof.

[0078] "B cell" or "B lymphocyte" refer to their standard usage in the art. B cells are lymphocytes, a type of white blood cell (leukocyte), that develop into antibody-producing plasma cells ("mature B cells"). "Immature B cells" are cells that can develop into mature B cells. Generally, pro-B cells undergo immunoglobulin heavy chain rearrangement to become pro-B pre-B cells, which further undergo immunoglobulin light chain rearrangement to become immature B cells. Immature B cells include T1 and T2 B cells.

[0079] "T cells" or "T lymphocytes", as used herein, are a type of lymphocyte (a subtype of white blood cells) that play a central role in cell-mediated immunity. They can be distinguished from other lymphocytes, e.g., B cells and natural killer cells, by the presence of T cell receptors on the cell surface. T cells include, for example, natural killer T (NKT) cells, cytotoxic T lymphocytes (CTLs), regulatory T (Treg) cells, and helper T cells. Different types of T cells can be distinguished by the use of T cell detection agents.

[0080] "Regulatory T cells" or "suppressor T cells" are lymphocytes that modulate the immune system, maintain tolerance to self-antigens, and prevent autoimmune disease.

[0081] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may likewise be referred to by their commonly accepted one-letter codes.

[0082] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, which in embodiments may be conjugated to a moiety not consisting of amino acids. These terms apply not only to naturally occurring and non-naturally occurring amino acid polymers, but also to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of a corresponding naturally occurring amino acid. A "fusion protein" refers to a chimeric protein encoding two or more separate protein sequences recombinantly expressed as a single moiety.

[0083] The "position" of an amino acid or nucleotide base is designated by a number that sequentially identifies each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5'-terminus). Due to deletions, insertions, truncations, fusions, etc., which must be taken into account when determining the optimal alignment, in general, the amino acid residue number in the test sequence, determined by simply counting from the N-terminus, will not necessarily be the same as the number of its corresponding position in the reference sequence. For example, if a variant has a deletion relative to the aligned reference sequence, there will be no amino acid in the variant that corresponds to the position in the reference sequence at the site of the deletion. If there is an insertion in the aligned reference sequence, the insertion will not correspond to a numbered amino acid position in the reference sequence. In the case of truncations or fusions, there may be stretches of amino acids in either the reference sequence or the aligned sequence that do not correspond to any amino acid in the corresponding sequence.

[0084] The terms "numbered with reference to" or "corresponding to," when used in the context of numbering a given amino acid or polynucleotide sequence, refer to the numbering of the residues of a specified reference sequence when comparing the given amino acid or polynucleotide sequence to a reference sequence.

[0085] The term "amino acid side chain" refers to a functional substituent contained in an amino acid. For example, the amino acid side chain can be the side chain of a naturally occurring amino acid. Naturally occurring amino acids are those encoded by the genetic code (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine), as well as amino acids that are later modified, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. In embodiments, the amino acid side chain can be an unnatural amino acid side chain.

[0086] The term "UV-cleavable amino acid side chain" or "UV-cleavable amino acid" refers to a compound that has the same base chemical structure as a naturally occurring amino acid, i.e., a functional substituent at the alpha carbon attached to a hydrogen, a carboxyl group, an amino group, and an R group. UV-cleavable amino acids are non-proteinogenic amino acids that are either naturally occurring or chemically synthesized. Such analogs may have modified R groups or modified peptide backbones, but retain the same base chemical structure as a naturally occurring amino acid. UV-cleavable amino acids include, without limitation, 2-nitrophenylglycine (NPG), extended o-nitrobenzyl linker, o-nitrobenzyl caged phenol, o-nitrobenzyl caged thiol, 32 nitroveratryloxycarbonyl (NVOC) caged aniline, o-nitrobenzyl caged selenide, bis-azobenzene, coumarin, cinnamyl, spiropyran, 2-nitrophenylalanine (2-nF), and 3-amino-3-(2-nitrophenyl)propionic acid (ANP) amino acid analogs.

[0087] The term "MHC" or "major histocompatibility complex" as provided herein includes a large genetic locus on vertebrate DNA that contains a set of closely linked polymorphic genes that code for cell surface proteins essential to the adaptive immune system. These cell surface proteins are MHC molecules. In this application, MHC can refer to either the DNA or polynucleotides that contain the relevant genes, or the proteins or polypeptides encoded by the relevant DNA or polynucleotides.

[0088] The term "MHCI" or "Major Histocompatibility Complex Class I" or "Major Major Histocompatibility Complex I" or "MHCI monomer" as provided herein includes any recombinant or naturally occurring form of Major Histocompatibility Complex-1 (MHCI) protein, or a variant, paralog, or homolog thereof that maintains MHCI activity (e.g., has at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, or more activity compared to MHCI). In some embodiments, the variant, paralog, or homolog has at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150, or 200 contiguous amino acids) compared to a naturally occurring MHCI polypeptide. In embodiments, MHCI is a heterodimer of two non-covalently associated proteins: a heavy chain (α) and a light chain (β2-microglobulin), homologs or functional fragments thereof. In embodiments, MHCI comprises a peptide ligand. In some embodiments, the term "MHCI" or "Major Histocompatibility Complex Class I" may also refer to DNA or polynucleotides encoding recombinant or naturally occurring forms of the MHCI proteins described herein.

[0089] The term "HLA" or "human leukocyte antigen" refers to the group of proteins encoded by the MHC gene complex, or the group of DNA or polynucleotides that comprise the genes encoding such proteins on human chromosome 6. In some embodiments, the MHC gene complex encodes the HLA-A, HLA-B, and HLA-C proteins.

[0090] The term "beta-2 microglobulin" or "B2M" or "β2 microglobulin" or "β chain" refers to the invariant smaller or light chain protein of the cell surface MHCI or HLA protein complex. B2M forms a heterodimeric complex with one α chain (heavy chain). B2M is encoded by the B2M gene.

[0091] The term "α chain" or "alpha chain" refers to the larger, or heavy, chain protein of the MHCI or HLA protein complex. The α chain is further divided into subunits α1, α2, and α3 and contains one transmembrane helix. The α chain binds to B2M via the α3 subunit to form a heterodimer known as the MHCI or HLA complex. The α chain is polymorphic and is primarily encoded by the HLA-A, HLA-B, and HLA-C genes, and to a lesser extent by HLA-E, HLA-F, HLA-G, HLA-K, and HLA-L.

[0092] As used herein, the term "antigen" is used to describe a compound, composition, or chemical that, when administered to an immunocompetent subject, induces an immune response, such as a cytotoxic T lymphocyte (CTL) response, a B cell response (e.g., the production of antibodies that specifically bind to an epitope), a NK cell response, or any combination thereof. Thus, an immunogenic or antigenic composition is a composition that can elicit an immune response in an immunocompetent subject.

[0093] As used herein, the term "neo-antigen" or "neo-antigen-related peptide" is used to describe newly formed antigens or antigen-related peptides that can be recognized as "non-self" by the host's immune system. Neo-antigens can arise from altered tumor proteins formed as a result of tumor mutations, or from bacteria or other pathogens (e.g., from viral proteins). Alternatively, they may also be derived from transplants, e.g., tissue grafts, or allografts or other transplanted cells. Non-limiting examples of neo-antigens are listed in Table 2 below or elsewhere in this specification and the figures.

[0094] As used herein, the term "tumor associated antigen" or "TAA" is used to describe proteins that are significantly overexpressed in cancer compared to normal cells and are therefore also abundantly displayed on the surface of cancer cells. Non-limiting examples of TAAs are listed in Table 1 below or elsewhere in this specification and the figures.

[0095] Table 1. Exemplary tumor-associated antigens TIFF2024541968000002.tif4128

[0096] Table 2. Exemplary shared neoantigens TIFF2024541968000003.tif58156

[0097] The terms "bond" and "bonded", as used herein, are used according to their clear and ordinary meaning and refer to an association between atoms or molecules. The association may be direct or indirect. For example, the bonded atoms or molecules may be direct, for example, by a covalent bond or linker (e.g., a first linker or a second linker), or indirect, for example, by a non-covalent bond (e.g., electrostatic interactions (e.g., ionic bonds, hydrogen bonds, halogen bonds), van der Waals interactions (e.g., dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (pi effect), hydrophobic interactions, etc.).

[0098] The term "antibody" refers to a polypeptide encoded by immunoglobulin genes or functional fragments thereof that specifically binds and recognizes an antigen. Immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes as well as a myriad of immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta or epsilon, which in turn define the immunoglobulin classes IgG, IgM, IgA, IgD and IgE, respectively.

[0099] When referring to a protein or peptide, the phrases "specifically (or selectively) bind" to an antibody or "specifically (or selectively) immunoreactive with" often refer to a binding reaction that determines the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under specified immunoassay conditions, a specified antibody will bind to a particular protein at least twice background, and more typically more than 10-100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only a subset of antibodies that are specifically immunoreactive with a selected antigen and not with other proteins. This selection can be accomplished by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats can be used to select antibodies that are specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Using Antibodies, A Laboratory Manual (1998), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).

[0100] The term "denaturing" refers to a process in which the three-dimensional structure of a protein, polypeptide, DNA, RNA, or other biopolymer is disrupted by chemical or mechanical means, or by heating or cooling.

[0101] The process of "peptide exchange" refers to first forming an MHCI or HLA complex bound to a peptide that can be replaced or exchanged with another peptide of interest, e.g., a putative neo-antigen-associated peptide. In some cases, exchange can be facilitated by decreasing the binding affinity of the first peptide for the peptide of interest, e.g., through chemical, enzymatic, or UV-mediated cleavage of the first peptide.

[0102] A "1D-LC" or "one-dimensional liquid chromatography" process refers to a single liquid chromatographic separation; in contrast, "2D-LC" or "two-dimensional liquid chromatography" refers to a chromatographic method in which two separations are performed.

[0103] "Size Exclusion Chromatography" or "SEC" is a means of chromatography in which molecules are separated by size in a solid-phase chromatographic medium, with larger molecules moving through a solid-phase column at a different rate than smaller molecules. In some embodiments, SEC is used in a 1D-LC process. SEC may also be used in a 2D-LC process in combination with a different form of separation, for example, a reversed-phase liquid chromatography step, or ion exchange or cation exchange or affinity separation may be used as the second dimension.

[0104] "Capillary electrophoresis" or "CE" refers to the process of using an electric current to move molecules through a capillary. The mobility of each molecule may depend on its charge, size, and shape. Several types of CE exist, including capillary zone electrophoresis (CZE), capillary gel electrophoresis (CGE), micellar electrokinetic capillary chromatography (MEKC), capillary electrochromatography (CEC), capillary isoelectric focusing (CIEF), and capillary isoelectric focusing (CITP), among others.

[0105] "Capillary zone electrophoresis" or "CZE," as used herein, refers to a type of CE in which different molecules in a buffer solution can be separated based on their different mobilities.

[0106] "Mass spectrometry" or "MS" refers to a technique that measures the mass-to-charge ratio (m / z) of one or more molecules in a sample. As used herein, "tandem MS" or "MS / MS" refers to a process in which a single ion, multiple ions, or the entire mass envelope (precursor(s)) are transferred to a fragmentation chamber and the fragmented products are then sent to a mass analyzer. Depending on the design of the mass analyzer, the fragmentation events may occur before a single mass analyzer, between two or more different analyzers, or within a single mass analyzer.

[0107] MS analysis can have various options. In some embodiments, the MS instrument does not include a quadrupole. In some embodiments, the MS instrument includes at least one quadrupole. In some embodiments, the MS instrument includes at least two quadrupole analyzers. In some cases, the MS instrument includes an octapole. In some embodiments, the MS instrument includes at least three quadrupole analyzers. In some MS, the detector is an ion trap, a quadrupole, an orbitrap, or a TOF. In some embodiments, the MS instrument or method is multiple reaction monitoring (MRM), single ion monitoring (SIM), triple quadrupole (TSQ), quadrupole / time of flight (QTOF), quadrupole linear ion trap (QTRAP), hybrid ion trap / FTMS, time of flight / time of flight (TOF / TOF), an Orbitrap instrument, an ion trap instrument, parallel reaction monitoring (PRM), data dependent acquisition (DDA), data independent acquisition (DIA), multi-stage fragmentation, or tandem in time MS / MS. In some embodiments, an electrospray, an Orbitrap instrument is used.

[0108] "Native mass spectrometry" is the MS process performed on a molecule in its native state, ie, the molecule has not been unfolded or denatured.

[0109] As used herein, the abbreviation "SEC-MS" refers to SEC followed / coupled with a mass spectrometry (MS) process. As used herein, the abbreviations "CE-MS" and "CZE-MS" refer to capillary electrophoresis (CE) or capillary zone electrophoresis (CZE) followed by an MS process. "SEC-native MS" refers to SEC followed / coupled with a native MS process. "CE native MS" and "CZE native MS" refer to capillary electrophoresis (CE) or capillary zone electrophoresis (CZE) followed by / coupled with a native MS process.

[0110] The term "quantification" or "quantifying" as used herein means to numerically determine the level or amount or number or concentration of an analyte in a sample.

[0111] Generally, a "subject" as referred to herein is an individual whose biological sample is tested for the presence of an analyte and / or whose disease is evaluated and / or treated. In some embodiments, the subject is a human. However, in some embodiments, the subject may also be another mammal, such as a livestock or farm animal species, such as dog, cat, rabbit, horse, pig, cow, goat, sheep, etc., or a laboratory animal, such as a mouse or rat. Mammals include, but are not limited to, livestock animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans, and non-human primates, such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0112] As used herein, an "automated" or "automatically controlled" process is one that can be performed, for example, by a computer-controlled system with appropriate software, as opposed to a system that requires active manual intervention during or between at least one step, such as to move an analyte-containing sample from one part of the system to another.

[0113] II. Neoantigens and Neoepitopes Presentation of neo-antigen-associated peptides to cytotoxic T lymphocytes is central to eliciting anti-tumor immune responses. However, identification of these neo-antigen-associated peptides in the correct HLA context remains a challenge. The present disclosure relates to an immunopeptide drug pipeline for identifying clinically relevant neo-antigens in a wide range of HLA alleles. Candidate shared neo-antigens can be selected based on unmet clinical need, while their peptide-HLA binding affinity can be predicted using a predictive process, e.g., an artificial neural network such as NetMHCpan4.0. Experimental binding data is then obtained using a novel high-throughput in vitro binding assay. The predicted binding affinity of the neo-antigen-associated peptides to the HLA protein of interest is highly correlated with the resulting experimental binding affinity found through the high-throughput binding assay. To enable detection of neo-epitopes by mass spectrometry, a CRISPR / Cas9 engineered HLA-deficient antigen-presenting cell line (e.g., HMy2.C1R) may be electroporated with a minigene containing one or several shared cancer neo-antigens, followed by transduction with the HLA of interest. The engineered monoallelic cell lines containing the neo-antigen minigenes may then be processed for automated pan-Class-I HLA enrichment and subsequent data-dependent and targeted mass spectrometry assays. Pan-HLA Class-I enrichment of cell lines can produce hundreds or thousands of peptides with matching motifs, such as approximately 850-7300 unique 8-11mers (8mers, 9mers, 10mers and 11mers). Targeted mass spectrometry assays identified previously identified neo-antigen-HLA combinations as well as many novel combinations. Interestingly, unique neo-antigen-HLA combinations were detected to have unfavorable NetMHC binding scores, but were assayed based on in vitro binding assay performance. These data demonstrate that engineered monoallelic cells expressing a neo-antigen of interest are an excellent model system for studying neo-antigen presentation.Current neo-antigen prediction algorithms and binding assays have inherent limitations that can be overcome by combining both prediction and high-throughput (HTP) binding assays. Finally, the immunogenicity of selected hits identified in the assay was validated by in vitro T cell activation and T cell-directed tumor killing assays.

[0114] In some embodiments, the present disclosure relates to identifying neoepitopes (e.g., peptides cleaved from single or multiple neoantigens expressed by a cancer or tumor) that can specifically bind to major histocompatibility class I (MHCI) peptides (e.g., HLA peptides) to form neoepitope-HLA complexes for presenting the neoepitopes as foreign antigens on the surface of HLA-expressing cells. In some embodiments, immune cells (e.g., engineered or natural T cells) expressing the corresponding T cell receptor (TCR) or chimeric antigen receptor (CAR) can recognize the presented foreign antigen by binding to the HLA-neoepitope complex, which can result in activation and proliferation of T cells to produce anti-cancer cytokines or exert cytotoxicity to kill or inhibit the growth of the cancer or tumor.

[0115] In some embodiments, neoantigens as described herein refer to newly formed antigens or peptides that have not been previously recognized by the immune system. Neoantigens may arise from altered tumor proteins formed as a result of tumor mutations, or from bacteria or other pathogens (e.g., from viral proteins). They may also be derived from transplants, such as tissue grafts, or allografts or other transplanted cells. Non-limiting examples of neoantigens are listed in Table 2.

[0116] In some embodiments, the neo-antigens described herein comprise peptides expressed by tumor or cancer cells of a subject. In some embodiments, the neo-antigen-associated peptide comprises at least one mutation (including, for example, substitution, deletion, insertion, cross-linking, etc.) to at least one amino acid residue compared to the sequence of the corresponding wild-type peptide expressed by wild-type cells, healthy cells, or non-tumor or non-cancer cells. For example, the difference between the sequence of the neo-antigen-associated peptide and the wild-type peptide caused by the at least one mutation may render the neo-antigen-associated peptide "previously unrecognized" by the immune system in the subject and thus capable of inducing an immune response in the subject. In some embodiments, the neoantigens described herein are about 5 to about 100, about 5 to about 90, about 5 to about 80, about 5 to about 70, about 5 to about 60, about 5 to about 50, about 5 to about 40, about 5 to about 30, about 5 to about 20, about 10 to about 100, about 10 to about 90, about 10 to about 80, about 10 to about 70, about 10 to about 60, about 10 to about 50, about 10 to about 40, about 10 to about 30, about 10 to about 20, about 20 to about 90, about 20 to about 80, about 20 to about 70, about 20 to about 60, about 20 to about 50, about 20 to about 40, or about 20 to about 30 amino acids in length (and all subvalues ​​and subranges therebetween, inclusive of endpoints). In some embodiments, the neoantigens described herein are about 20 to about 50 amino acids in length.

[0117] In some embodiments, the neoantigens described herein are expressed by tumor or cancer cells in a subject and are further cleaved inside the tumor or cancer cells. Such cleavage can be induced by various proteinases or via the proteasome system. In some embodiments, multiple peptides can be produced by cleavage of the neoantigen. For example, multiple peptides can be produced by cleavage, including at least one mutation that differentiates the neoantigen from the corresponding wild-type peptide. In some embodiments, these multiple peptides are then secreted from the cell and presented by the expressed HLA allele peptides on the cell surface for recognition by immune cells (e.g., T cells). Among the multiple peptides, those that have the potential to activate immune cells upon recognition of the presented peptides, thus inducing an immune response in the subject, can be determined as neoepitopes.

[0118] In some embodiments, the neoepitopes described herein are about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids in length. In some embodiments, the neoepitopes described herein are about 8, 9, 10, 11, 12, or 13 amino acids in length. In some embodiments, the neoepitopes described herein are 8-13 amino acids in length. In some embodiments, the neoepitopes described herein are 8-11 amino acids in length.

[0119] Examples of neo-antigen and neo-epitope sequences can be found in the present specification and figures.

[0120] The neoantigens and neoepitopes described herein may be specific to a tumor or cancer in a subject. In some embodiments, multiple subjects may have the same neoantigen and / or the same multiple neoepitopes ("shared neoantigen / neoepitope" scenario). In some embodiments, a subject may have a specific neoantigen and / or a specific multiple neoepitopes (e.g., at least one neoantigen or neoepitope that is different from other control neoantigens or neoepitopes) ("individualized neoantigen / neoepitope" scenario). One aspect of the present disclosure relates to the identification of specific MHC (e.g., MHCI or HLA) alleles expressed by immune cells that specifically recognize neoepitope-HLA binding pairs in a single or multiple subjects. Such information is useful for designing cancer / tumor vaccines or T cell therapies in subjects expressing specific neoantigens and / or neoepitopes.

[0121] In some embodiments, specific HLA alleles are known (e.g., by genotyping the subject) and neoepitopes that specifically bind to HLA proteins are discovered. In some embodiments, peptide exchange assays may be used to identify such neoepitopes. For example, multiple neoepitopes, cleavage with single or multiple neoantigens may be used in peptide exchange assays. To prepare multiple neoepitopes, single or multiple neoantigens expressed by cancer or tumor cells in subjects with specific HLA alleles may be randomly combined and cleaved to generate multiple neoepitopes ("non-targeted"). Alternatively, various analyses (e.g., bioinformatics analyses, clinical analyses, etc.) may be performed to screen for neoantigens and / or neoepitopes of interest or indications of possible role in cancer / tumor prevalence and / or clinical value to prepare multiple neoepitopes for peptide exchange assays ("targeted").

[0122] Peptide exchange assay In some embodiments, the disclosure provides a peptide exchange assay for binding of a major histocompatibility complex class I (MHCI) allele to a test peptide, comprising providing a first mixture comprising a released test peptide and an MHCI / ligand (e.g., HLA / ligand) complex comprising an alpha chain, a beta chain, and a peptide ligand comprising a non-natural ultraviolet (UV) cleavable amino acid in its sequence, exposing the first mixture to UV light to cleave the peptide ligand at the UV cleavable amino acid, incubating the first mixture for a period of time to form a second mixture comprising a second MHCI (e.g., HLA) complex comprising the alpha chain, the beta chain, and the test peptide, and determining whether the MHCI (e.g., HLA) allele bound to the test peptide.

[0123] In embodiments, the amount of free test peptide in the first mixture is 1:100 to 100:1 relative to the HLA / ligand complex. In some embodiments, the amount of free test peptide in the first mixture is 1:10 to 10:1 relative to the HLA / ligand complex. In embodiments, the amount of free test peptide in the first mixture is 1:1 to 100:1 relative to the HLA / ligand complex. In embodiments, the amount of free test peptide in the first mixture is 10:1 to 100:1 relative to the HLA / ligand complex. In embodiments, the amount of free test peptide in the first mixture is about 10:1 relative to the HLA / ligand complex. This ratio may be any value or subrange within the ranges provided, including the endpoints.

[0124] In embodiments, the HLA binding to the test peptide is determined by measuring the level of HLA / test peptide complexes in the second mixture. In some embodiments, the HLA complexes in the assay are partially occupied by the bound test peptides in the second mixture (a portion of the total HLA complexes in the second mixture are bound by the test peptides). In some embodiments, the HLA complexes are fully occupied by the bound test peptides in the second mixture (all of the total HLA complexes in the second mixture are bound by the test peptides).

[0125] In embodiments, the level of HLA / second peptide complex is measured by two-dimensional liquid chromatography-mass spectrometry (2D LC / MS) of the second mixture. In some embodiments, the 2D LC / MS comprises removing the released test peptide from the second mixture. In some embodiments, the released test peptide is removed by size exclusion chromatography. In some embodiments, the released test peptide is removed by size cutoff filtration. In some embodiments, the released peptide is removed by dialysis.

[0126] In some embodiments, high performance liquid chromatography (HPLC) and mass spectrometry (MS) to distinguish the identity of HLA and test peptide. In some embodiments, the second mixture is run on an HPLC (or FPLC) equipped with a size exclusion column. In some embodiments, the HPLC (or FPLC) is equipped to collect fractions. In some embodiments, the HLA and test peptide are identified and eluted in the same HPLC fraction. In some embodiments, the released test peptide is eluted in a different fraction than the released HLA and HLA / test peptide complex. In some embodiments, the co-elution of HLA and test peptide indicates that HLA can bind to the test peptide.

[0127] In embodiments, there is more than one test peptide (e.g., more than one peptide sequence) added to the first HLA / test peptide mixture. In some embodiments, there are two or more test peptides in the first HLA / test peptide mixture. In embodiments, there are three or more test peptides in the first HLA / test peptide mixture. In embodiments, there are four or more test peptides in the first HLA / test peptide mixture. In embodiments, there are five or more test peptides in the first HLA / test peptide mixture. In embodiments, there are six or more test peptides in the first HLA / test peptide mixture. In embodiments, there are seven or more test peptides in the first HLA / test peptide mixture. In embodiments, there are eight or more test peptides in the first HLA / test peptide mixture. In embodiments, there are nine or more test peptides in the first HLA / test peptide mixture. In an embodiment, there are 10 or more test peptides present in the first HLA / test peptide mixture.

[0128] In an embodiment, the first HLA / test peptide mixture contains 10 to 1000 test peptides. In an embodiment, the first HLA / test peptide mixture contains 10 to 500 test peptides. In an embodiment, the first HLA / test peptide mixture contains 10 to 200 test peptides. In an embodiment, the first HLA / test peptide mixture contains 10 to 20 test peptides. In an embodiment, the first HLA / test peptide mixture contains 20 to 30 test peptides. In an embodiment, the first HLA / test peptide mixture contains 30 to 40 test peptides. In an embodiment, the first HLA / test peptide mixture contains 40 to 50 test peptides. In an embodiment, the first HLA / test peptide mixture contains 50 to 60 test peptides. In an embodiment, the first HLA / test peptide mixture contains 60 to 70 test peptides. In an embodiment, the first HLA / test peptide mixture contains 70 to 80 test peptides. In an embodiment, the first HLA / test peptide mixture contains 80 to 90 test peptides. In an embodiment, the first HLA / test peptide mixture contains 90 to 100 test peptides. In an embodiment, the first HLA / test peptide mixture contains 100 to 110 test peptides. In an embodiment, the first HLA / test peptide mixture contains 110 to 120 test peptides. In an embodiment, the first HLA / test peptide mixture contains 120 to 130 test peptides. In an embodiment, the first HLA / test peptide mixture contains 130 to 140 test peptides. In an embodiment, the first HLA / test peptide mixture contains 140 to 150 test peptides. In an embodiment, the first HLA / test peptide mixture contains 150 to 200 test peptides. In an embodiment, the first HLA / test peptide mixture contains 200 to 300 test peptides. In an embodiment, there are between 300 and 400 test peptides present in the first HLA / test peptide mixture.In an embodiment, there are 400-500 test peptides present in the first HLA / test peptide mixture. In an embodiment, there are 500-600 test peptides present in the first HLA / test peptide mixture. In an embodiment, there are 600-700 test peptides present in the first HLA / test peptide mixture. In an embodiment, there are 700-800 test peptides present in the first HLA / test peptide mixture. In an embodiment, there are 800-900 test peptides present in the first HLA / test peptide mixture. In an embodiment, there are 900-1000 test peptides present in the first HLA / test peptide mixture. The number of test peptides may be any value or subrange within the ranges provided, including the endpoints. The number of test peptides is limited only by the number of test peptides that one of skill in the art would recognize as suitable for use in an exchange assay.

[0129] In embodiments, there is more than one test peptide that co-elutes in the HLA / peptide complex HPLC fraction.

[0130] In embodiments, mass spectrometry is used to identify the identity of the HLA and / or test peptide(s) in the second mixture. In some embodiments, the mass spectrometer is in-line with the HPLC. In some embodiments, the HPLC fractions are first collected and then analyzed by mass spectrometry. In embodiments, the liberated test peptides are removed prior to mass spectrometry detection of the HLA complexes. In embodiments, the amount of test peptide present in the fractions or second mixture is quantified by mass spectrometry by comparison to an internal standard peptide.

[0131] In embodiments, the HLA / test peptide complex is labeled. In some embodiments, the HLA / test peptide is fluorescently labeled. In some embodiments, the HLA / test peptide complex is labeled by contacting with a fluorescently labeled antibody. In some embodiments, the HLA / test peptide complex is labeled by contacting with a fluorescent antibody, the fluorescent antibody being anti-HLA. In some embodiments, the HLA / peptide complex is labeled by biotinylation of the alpha protein.

[0132] In embodiments, the level of peptide exchange is determined by contacting the labeled HLA / peptide complex with an antibody complex comprising an anti-HLA antibody covalently bound to a fluorescence resonance energy transfer (FRET) donor and a FRET acceptor complex comprising a FRET acceptor conjugated to a second label, thereby forming a reaction composition, and detecting the FRET emission of the second label in the reaction composition, thereby detecting the formation of a stable HLA, which is a surrogate measure of peptide binding. In some embodiments, the first label is an anti-HLA antibody, which is anti-B2M. In some embodiments, the first label is an anti-HLA antibody, which chelates europium ions. In some embodiments, the alpha protein of the HLA / peptide complex is biotinylated. In some embodiments, the biotinylated HLA / peptide complex binds to the second label. In some embodiments, the second label is a streptavidin protein. In some embodiments, the second label is a streptavidin protein covalently linked to allophycocyanin. In some embodiments, the first and second labels have a spectral overlap integral suitable for FRET when an HLA / peptide complex containing the first and second labels is present. In some embodiments, the FRET donor / acceptor pair label includes fluorescein and tetramethylrhodamine. In some embodiments, the FRET donor / acceptor pair label includes 5-({2-[(iodoacetyl)amino]ethyl}amino)naphthalene-1-sulfonic acid (IAEDANS) and fluorescein. In some embodiments, the FRET donor / acceptor pair label includes (5-((2-aminoethyl)amino)naphthalene-1-sulfonic acid (EDANS) and 4-((4-(dimethylamino)phenyl)azo)benzoic acid (Dabcyl). In some embodiments, the FRET donor / acceptor pair label includes Alexa Fluor 488 and Alexa Fluor 555.In some embodiments, the donor / acceptor pair label includes Alexa Fluor 594 and Alexa Fluor 647. In some embodiments, the donor / acceptor pair label includes Europium (Eu-cryptate) and Allophycocyanin (XL665). In some embodiments, the donor / acceptor pair label includes Terbium and Fluorescein. The first and second labels can be any suitable label pair known in the art.

[0133] In embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for between about 1 hour and about 48 hours. In embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 1 hour. In some embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 5 hours. In embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 10 hours. In some embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 12 hours. In some embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 15 hours. In some embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 20 hours. In some embodiments, the peptide exchange detection assay reagent and the HLA / peptide complex are incubated for at least about 24 hours. The incubation time may be any value or subrange within the ranges provided, including the endpoints.

[0134] In some embodiments, the first label comprises a streptavidin protein. In some embodiments, the first label comprises an anti-HLA antibody. In some embodiments, the first label comprises a monobody. In some embodiments, the first label comprises a partial antibody. In some embodiments, the first label comprises an scFv domain. In some embodiments, the first label comprises an antibody fragment.

[0135] In some embodiments, the second label is streptavidin.

[0136] In embodiments, the emission from the FRET acceptor indicates binding of the test peptide to an HLA complex. In some embodiments, the level of bound peptide is determined by time-resolved (TR) FRET detection. In some embodiments, the signal from the TR-FRET acceptor label indicates the level of HLA complex present. In some embodiments, the level of HLA complex present indicates the presence of an HLA / peptide complex. In some embodiments, the HLA / peptide complex comprises the test peptide. In some embodiments, the signal from the FRET emission is normalized between two or more HLA. In some embodiments, the TR-FRET assay is performed at a temperature of about 4°C to about 50°C. In some embodiments, the TR-FRET assay is performed at room temperature. In some embodiments, the TR-FRET assay is performed at about 37°C.

[0137] Peptide exchange assays and FRET assays are also described in PCT Application No. PCT / US21 / 47537, filed August 25, 2021, and published as WO 2022 / 046895, which is incorporated by reference in its entirety for all that is taught therein (including, but not limited to, all methods, reagents, neoantigens, neoepitopes, examples, systems, etc.).

[0138] III. MHC alleles In some embodiments, the present disclosure relates to identifying neoepitopes (e.g., peptides cleaved from single or multiple neoantigens expressed by a cancer or tumor) that can specifically bind to major histocompatibility class I (MHCI) peptides (e.g., HLA peptides) to form neoepitope-MHCI complexes (neoepitope-HLA complexes in humans) for presenting the neoepitopes as foreign antigens on the surface of MHCI-expressing cells. In some embodiments, immune cells (e.g., engineered or natural T cells) expressing the corresponding T cell receptor (TCR) or chimeric antigen receptor (CAR) can recognize the presented foreign antigen (i.e., neoepitope) by binding to the MHCI-neoepitope complex, which can result in activation and proliferation of T cells to produce anti-cancer cytokines or exert cytotoxicity to kill or inhibit the growth of the cancer or tumor.

[0139] In embodiments, the HLA / ligand complex contains an alpha chain, the alpha chain being encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. In some embodiments, the alpha chain is encoded by the HLA-A locus. In some embodiments, the alpha chain is encoded by the HLA-B locus. In some embodiments, the alpha chain is encoded by the HLA-C locus.

[0140] In an embodiment, the HLA / ligand complex comprises a beta-2 microglobulin domain (B2M), the B2M domain being encoded by the HLA gene complex.

[0141] In embodiments, the HLA / ligand complex contains a peptide ligand, e.g., a neoepitope cleaved from a neoantigen described herein. In embodiments, the peptide ligand (e.g., neoepitope) is 8-13 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 8 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 9 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 10 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 11 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 12 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 13 amino acid residues in length.

[0142] In embodiments, the HLA / ligand complex comprises a peptide ligand, and the peptide ligand comprises a non-natural amino acid (e.g., in the case of a peptide exchange assay). In some embodiments, the non-natural amino acid is activated by UV irradiation. In some embodiments, the peptide ligand comprising the non-natural amino acid is cleaved after irradiation with UV light. In some embodiments, the non-natural amino acid is selected from 2-nitrophenylglycine (NPG), expanded o-nitrobenzyl linker, o-nitrobenzyl caged phenol, o-nitrobenzyl caged thiol, 32 nitroveratryloxycarbonyl (NVOC) caged aniline, o-nitrobenzyl caged selenide, bis-azobenzene, coumarin, cinnamyl, spiropyran, 2-nitrophenylalanine (2-nF), and 3-amino-3-(2-nitrophenyl)propionic acid (ANP) amino acid analog. In some embodiments, the non-natural amino acid is 3-amino-3-(2-nitrophenyl)propionic acid (ANP).

[0143] In embodiments, the unnatural amino acid may be located at any position between the N-terminus and the C-terminus of the peptide ligand. In some embodiments, the unnatural amino acid is located at the N-terminus of the peptide ligand. In some embodiments, the unnatural amino acid is located at the second position of the peptide ligand (i.e., the second position from the N-terminus). In some embodiments, the unnatural amino acid is located at the third position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the fourth position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the fifth position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the sixth position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the seventh position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the eighth position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the ninth position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the tenth position of the peptide ligand. In some embodiments, the unnatural amino acid is located at the C-terminus of the peptide ligand.

[0144] Non-limiting examples of HLA alleles can be found in the specification and figures. Additional alleles are known in the art.

[0145] Although most mammals have MHC variants similar to humans, with a large allelic diversity, especially among the nine classical genes (possibly due mainly to gene duplication) (Sznarkowska et al., “MHC Class I Regulation: The Origin Perspective”. Cancers. 2020;12(5):1155), the human MHC region has many pseudogenes. The most diverse loci, namely HLA-A, HLA-B and HLA-C, have approximately 6000, 7200 and 5800 known alleles, respectively (see “HLA Alleles Numbers” at the World Wide Web site at hla.alleles.org). Many HLA alleles are ancient and may have closer homology to chimpanzee MHC alleles than to some other human alleles of the same genes.

[0146] The human leukocyte antigen (HLA) system or complex is a complex of genes on human chromosome 6 that encode cell surface proteins involved in regulating the immune system (Choo. “The HLA system: genetics, immunology, clinical testing, and clinical implications”. Yonsei Medical Journal. 2007;48(1):11-23). ​​The HLA system is also known as the human form of the major histocompatibility complex (MHC) found in many animals.

[0147] In some embodiments, the MHC alleles described herein (e.g., MHCI alleles) comprise HLA alleles of a human subject. In some embodiments, the MHC alleles described herein (e.g., MHCI alleles) comprise non-human MHC alleles.

[0148] The MHC alleles described herein may be carried by subjects with tumors or cancers that express neo-antigens that can be cleaved into multiple neo-epitopes. In some embodiments, multiple subjects (or tumors / cancers) may have the same neo-antigen ("shared neo-antigen" scenario). In some embodiments, a subject (or tumor / cancer) may have a specific neo-antigen or multiple specific neo-antigens (e.g., at least one neo-antigen that is different from the neo-antigens of other subjects) ("individualized neo-antigen" scenario). One aspect of the present disclosure relates to the identification of neo-epitopes that are specifically recognized and presented by specific MHC (e.g., MHCI or HLA) alleles in single or multiple subjects. Such information is useful for designing cancer / tumor vaccines or T cell therapies in subjects expressing specific MHC allele peptides.

[0149] In some embodiments, multiple subjects with tumors or cancers may have the same or different HLA alleles, which may be identified, for example, by genotyping the subjects. The subjects may have different neoantigen-associated peptides expressed by tumors or cancer cells (e.g., different individuals may have different tumor / cancer-associated mutations). In some embodiments, screening methods (either targeted or non-targeted) may be used to identify subjects among multiple subjects for immunotherapy through the identification of specific neoepitope-HLA binding pairs. For example, if a subject with a neoepitope cleaved from a neoantigen expressed by a tumor or cancer cell can be recognized and presented by a specific HLA protein in the same subject by forming a neoepitope-HLA complex, the subject is determined to be treatable by T cell therapy (e.g., via TCR or CAR) utilizing T cells that can recognize and activate the neoepitope-HLA complex. In some embodiments, for a single or multiple subjects having the same HLA protein, if at least one neoepitope is identified to form a neoepitope-HLA complex with a particular HLA protein by the same methods described herein, a cancer / tumor vaccine can be prepared containing at least one neoepitope for administration to a subject(s) to induce an immune response against the tumor or cancer.

[0150] In some embodiments, the present disclosure provides a general treatment strategy / plan / method for multiple subjects with tumors or cancer. For example, the HLA alleles in each of the multiple subjects can be determined (e.g., by genotyping the subjects). In some embodiments, the HLA allele information for each of the subjects was known from any of the previous analyses. Then, at least one specific neoepitope-HLA binding pair is identified by combining all (e.g., in a "non-targeted" analysis) or a portion (e.g., in a "targeted" analysis) of the neoantigens in the subjects and all (e.g., in a "non-targeted" analysis) or a portion (e.g., in a "targeted" analysis) of the neoepitopes cleaved by the specific HLA alleles in these subjects. Any known method, such as peptide exchange assay, fluorescence assay, immunological assay, etc., may be used to test whether a specific neoepitope-HLA binding pair is formed. Subjects having a specific HLA allele that forms a neoepitope-HLA binding pair with a specific neoepitope are determined to be potentially treatable and can then optionally be treated with a cancer / tumor vaccine or T cell therapy that targets the neoepitope-HLA binding pair.

[0151] Methods for identifying specific neoepitope-HLA binding pairs are disclosed herein. In some embodiments, peptide exchange assays or other cell-based assays may be used. Other examples of assays may include, for example, complex detection assays, HLA-binding ligand identification assays, native SEC-MS and CE-MS methods, or other methods described in PCT Application No. PCT / EP2019 / 066811 (published as International Publication No. WO2020 / 002320), the contents of which are incorporated herein by reference in their entirety.

[0152] In some embodiments, monoallelic cells are used to test the binding of HLA proteins to neoepitopes. For example, monoallelic cells can be prepared by knocking down or knocking out endogenous HLA alleles in cells and then transducing a single HLA allele into the cells for expression. Multiple monoallelic cells can be prepared such that each cell expresses a different HLA allele, thus forming a group of monoallelic cells to identify specific neoepitope-HLA binding pairs for single or multiple neoepitopes.

[0153] IV. Composition Neoantigens and neoepitopes Nucleic acid compositions are disclosed for nucleic acids encoding neo-antigen and / or neo-epitope sequences. In some embodiments, at least one nucleic acid in the compositions described herein encodes a neo-antigen and / or neo-epitope having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (and all subvalues ​​and subranges therebetween, inclusive of endpoints) sequence identity to a neo-antigen and / or neo-epitope sequence described herein as described herein and in the drawings. In some embodiments, at least one nucleic acid in a composition described herein has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (and all subvalues ​​and subranges therebetween, inclusive of endpoints) sequence identity to a neoantigen and / or neoepitope nucleic acid sequence described herein as described in the specification and drawings.

[0154] In some embodiments, the compositions described herein include an isolated polynucleotide cassette encoding multiple neoantigens or neoepitopes. For example, multiple neoantigens can be expressed by tumor or cancer cells in a subject or multiple subjects. In other examples, multiple neoepitopes can be cleaved from a single neoantigen or multiple neoantigens expressed by tumor or cancer cells in a subject or multiple subjects. The isolated polynucleotide cassette can encode a polypeptide that includes a fusion of multiple neoantigens or neoepitopes, with or without a linker (e.g., a peptide linker such as a glycine-serine (GS) linker) between two adjacent neoantigens or neoepitopes. In some embodiments, each of the neoantigens / neoepitopes encoded by the isolated polynucleotide cassettes is about 5 to about 100, about 5 to about 90, about 5 to about 80, about 5 to about 70, about 5 to about 60, about 5 to about 50, about 5 to about 40, about 5 to about 30, about 5 to about 20, about 10 to about 100, about 10 to about 90, about 10 to about 80, about 10 to about 70, about 10 to about 60, about 10 to about 50, about 10 to about 40, about 10 to about 30, about 10 to about 20, about 20 to about 90, about 20 to about 80, about 20 to about 70, about 20 to about 60, about 20 to about 50, about 20 to about 40, or about 20 to about 30 amino acids in length (and all subvalues ​​and subranges therebetween, inclusive of endpoints). In some embodiments, each of the neoantigens / neoepitopes encoded by the isolated polynucleotide cassette is about 20 to about 50 amino acids in length. In some embodiments, each of the neoantigens encoded by the isolated polynucleotide cassette can be cleaved intracellularly to produce multiple neoepitopes, each of which can have a length of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more amino acids. In some embodiments, each of the neoantigens encoded by the isolated polynucleotide cassette can be cleaved intracellularly to produce multiple neoepitopes, each of which can have a length of about 8, 9, 10, 11, 12 or 13 amino acids.In some embodiments, the isolated polynucleotide cassette encodes multiple neoepitopes, each of which may have a length of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more amino acids. In some embodiments, the isolated polynucleotide cassette encodes multiple neoepitopes, each of which may have a length of about 8, 9, 10, 11, 12 or 13 amino acids.

[0155] In some embodiments, the isolated polynucleotide cassettes described herein may encode any number of neo-antigens or neo-epitopes described herein. For example, in the experiments shown in the Examples and Figures, 24 or 47 neo-antigens were prepared in a piggyback cassette containing a linked neo-antigen expression array, with or without a peptide linker. There is generally no limit to the exact number of neo-antigens conjugated to the polynucleotide cassette, except in cases where the cassette cannot be transduced into or expressed in a cell. In some embodiments, the isolated polynucleotide cassette encodes at least 2 neo-antigens, e.g., 2-200 neo-antigens, e.g., 20-100 neo-antigens, 20-75 neo-antigens, or 30-50 neo-antigens (and all subvalues ​​and subranges therebetween, inclusive of endpoints). In some embodiments, the isolated polynucleotide cassette encodes 2, 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80 or more neo-antigens.

[0156] In some embodiments, the nucleic acid compositions (e.g., isolated polynucleotide cassettes) described herein may be inserted into an expression vector (e.g., a plasmid or viral vector). In some embodiments, the expression vector may further comprise at least one promoter capable of initiating transgene expression and translation of multiple neo-antigens or neo-epitopes into a single polypeptide within a cell. In some embodiments, expression markers and / or selection markers, including antibiotic resistance markers, may be added to the expression vector. In some embodiments, the expression vectors described herein are stably or transiently delivered into cells using methods described herein or known to those of skill in the art.

[0157] In some embodiments, the neo-antigens described herein comprise peptides expressed by tumor or cancer cells of a subject. In some embodiments, the neo-antigen-associated peptide comprises at least one mutation (including, for example, a substitution, deletion, insertion, cross-linking, etc.) to at least one amino acid residue compared to the sequence of the corresponding wild-type peptide expressed by wild-type cells, healthy cells, or non-tumor or non-cancer cells. For example, the difference between the sequence of the neo-antigen-associated peptide and the wild-type peptide caused by the at least one mutation may render the neo-antigen-associated peptide "previously unrecognized" by the immune system in the subject ("non-self") and thus capable of inducing an immune response in the subject. In some embodiments, the neoantigens described herein are about 5 to about 100, about 5 to about 90, about 5 to about 80, about 5 to about 70, about 5 to about 60, about 5 to about 50, about 5 to about 40, about 5 to about 30, about 5 to about 20, about 10 to about 100, about 10 to about 90, about 10 to about 80, about 10 to about 70, about 10 to about 60, about 10 to about 50, about 10 to about 40, about 10 to about 30, about 10 to about 20, about 20 to about 90, about 20 to about 80, about 20 to about 70, about 20 to about 60, about 20 to about 50, about 20 to about 40, or about 20 to about 30 amino acids in length (and all subvalues ​​and subranges therebetween, inclusive of endpoints). In some embodiments, the neoantigens described herein are about 20 to about 50 amino acids in length.

[0158] In some embodiments, the neoantigens described herein include neoantigens that are expressed by tumor or cancer cells of a subject and can be further cleaved inside the tumor or cancer cells. Such cleavage can be induced by various proteinases or via the proteasome system. In some embodiments, multiple peptides can be produced by cleavage of the neoantigen. For example, multiple peptides can be produced by cleavage that include at least one mutation that differentiates the neoantigen from the corresponding wild-type peptide. In some embodiments, the multiple peptides are then presented by the expressed HLA allele peptides on the cell surface for recognition by immune cells (e.g., T cells). Among the multiple peptides, those that have the potential to activate immune cells upon recognition of the presented peptides, thus inducing an immune response in the subject, can be determined as neoepitopes.

[0159] In some embodiments, the neoepitopes described herein are about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids in length. In some embodiments, the neoepitopes described herein are about 8, 9, 10, 11, 12, or 13 amino acids in length.

[0160] Examples of neo-antigen and neo-epitope sequences in the compositions described herein can be found herein and in the Figures. In some embodiments, at least one of the neo-antigen associated peptides in the compositions described herein comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity (and all subvalues ​​and subranges therebetween, inclusive of endpoints) to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222. In some embodiments, at least one of the neoepitopes in the compositions described herein comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity (and all subvalues ​​and subranges therebetween, inclusive of endpoints) to at least one of SEQ ID NOs:75-111.

[0161] In some embodiments, the neoantigens and / or neoepitopes described herein are known to those of skill in the art or have been identified by bioinformatics and / or clinical analysis of tumor mutations.

[0162] MHC alleles An MHC allele (e.g., MHC class I or MHCI, allele) as described herein can include an MHC molecule (e.g., an MHCI or HLA molecule) that includes an alpha chain, a beta chain, and a ligand, where the ligand is a peptide that includes a non-naturally occurring UV-cleavable amino acid (e.g., in the case of peptide exchange assays) or includes a neoepitope as described herein (e.g., to discover or utilize neoepitope-HLA binding pairs).

[0163] In some embodiments, the HLA described herein comprises an alpha chain. In some embodiments, the alpha chain is encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C. In some embodiments, the alpha chain is encoded by the HLA-A locus. In some embodiments, the alpha chain is encoded by the HLA-B locus. In some embodiments, the alpha chain is encoded by the HLA-C locus. In some embodiments, the HLA described herein further comprises a beta chain. For example, the HLA described herein may comprise an alpha chain and a beta chain in a single polypeptide (e.g., as a fusion protein). In some embodiments, the HLA described herein does not comprise a beta chain. For example, the HLA described herein (e.g., a nucleic acid encoding an HLA polypeptide) may be introduced into a cell that expresses a beta chain. The beta chain described herein may comprise β2-microglobulin (B2M). Unless expressly stated, expressing an HLA in a cell in this disclosure generally refers to expressing the alpha chain of the HLA in a cell.

[0164] In embodiments, HLA can specifically bind to a peptide ligand, e.g., a neoepitope cleaved from a neoantigen as described herein, and present the peptide ligand on the surface of a cell expressing HLA. In embodiments, the peptide ligand (e.g., neoepitope) is 8-13 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 8 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 9 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 10 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 11 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 12 amino acid residues in length. In some embodiments, the peptide ligand (e.g., neoepitope) is 13 amino acid residues in length.

[0165] In embodiments, the peptide ligand contains an unnatural amino acid as described herein (e.g., in the case of a peptide exchange assay). In some embodiments, the unnatural amino acid is activated by UV irradiation. In some embodiments, the peptide ligand comprising the unnatural amino acid is cleaved after irradiation with UV light. In some embodiments, the unnatural amino acid is selected from 2-nitrophenylglycine (NPG), expanded o-nitrobenzyl linker, o-nitrobenzyl caged phenol, o-nitrobenzyl caged thiol, 32 nitroveratryloxycarbonyl (NVOC) caged aniline, o-nitrobenzyl caged selenide, bis-azobenzene, coumarin, cinnamyl, spiropyran, 2-nitrophenylalanine (2-nF), and 3-amino-3-(2-nitrophenyl)propionic acid (ANP) amino acid analog. In some embodiments, the unnatural amino acid is 3-amino-3-(2-nitrophenyl)propionic acid (ANP).

[0166] Examples of HLA allele sequences can be found in the present specification and figures.

[0167] Although most mammals have MHC variants similar to humans, with a large allelic diversity, especially among the nine classical genes (possibly due mainly to gene duplication) (Sznarkowska et al., “MHC Class I Regulation: The Origin Perspective”. Cancers. 2020;12(5):1155), the human MHC region has many pseudogenes. The most diverse loci, namely HLA-A, HLA-B and HLA-C, have approximately 6000, 7200 and 5800 known alleles, respectively (see “HLA Alleles Numbers” at the World Wide Web site at hla.alleles.org). Many HLA alleles are ancient and may have closer homology to chimpanzee MHC alleles than to some other human alleles of the same genes. Examples of HLA proteins identified in neoepitope-MHC binding pairs can include A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02.

[0168] The human leukocyte antigen (HLA) system or complex is a complex of genes on human chromosome 6 that encode cell surface proteins involved in regulating the immune system (Choo. “The HLA system: genetics, immunology, clinical testing, and clinical implications”. Yonsei Medical Journal. 2007;48(1):11-23). ​​The HLA system is also known as the human form of the major histocompatibility complex (MHC) found in many animals.

[0169] In some embodiments, a composition comprising an MHC molecule (e.g., MHCI or HLA) described herein includes a composition comprising an HLA molecule in a human subject. In some embodiments, a composition comprising an MHC molecule (e.g., MHCI) described herein includes a composition comprising a non-human MHC molecule.

[0170] Nucleic acid compositions for nucleic acids encoding MHC molecules are also disclosed. In some embodiments, at least one nucleic acid in the compositions described herein encodes an HLA allele peptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity (and all subvalues ​​and subranges therebetween, including endpoints) with the HLA allele peptide sequences described herein and in the figures. In some embodiments, at least one nucleic acid in the compositions described herein encodes an HLA allele peptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity (and all subvalues ​​and subranges therebetween, including endpoints) with the HLA allele nucleic acid sequences described herein and in the figures.

[0171] In some embodiments, the compositions described herein include isolated polynucleotides encoding single or multiple HLA allele peptides. For example, multiple HLA allele peptides can be expressed in a subject or multiple subjects. The isolated polynucleotides can encode polypeptides that include a fusion of multiple HLA allele peptides. Examples of MHC proteins (such as HLA) identified in neoepitope-MHC binding pairs can include A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.02. Any one or more alleles may be explicitly excluded, including HLA I alleles encoded by any one of the following loci: HLA-A, HLA-B and HLA-C.

[0172] In some embodiments, the nucleic acid compositions (e.g., isolated polynucleotides) described herein may be inserted into an expression vector (e.g., a plasmid or viral vector). In some embodiments, the expression vector may further comprise at least one promoter capable of initiating translation of the HLA allele peptide(s) into a single polypeptide within a cell. In some embodiments, expression markers and / or selection markers, including antibiotic resistance markers, may be added to the expression vector. In some embodiments, the expression vectors described herein are stably or transiently delivered to cells using methods described herein or known to those of skill in the art.

[0173] As disclosed in more detail below in the section on expressing cells, monoallelic cells can be prepared by knocking down or knocking out endogenous HLA alleles in a cell and further expressing an exogenous HLA protein introduced into the cell by an expression vector (e.g., a plasmid or viral vector). Such monoallelic cells, or multiple monoallelic cells, each of which expresses a different HLA protein, can be used to contact multiple neoepitopes to identify specific neoepitope-HLA binding pairs.

[0174] Engineered monoallelic cells and cell lines In embodiments, cells are provided that are engineered to express at least one MHC allele, e.g., an MHCI or HLA allele, as described herein. In embodiments, cells are provided that are engineered to express a single MHC allele, e.g., an MHCI or HLA allele, as described herein.

[0175] In some embodiments, an MHC allele polynucleotide (e.g., all or part of an MHC allele gene or exon) for expression of an MHC allele peptide is introduced into the engineered cell. In some embodiments, the MHC allele polynucleotide or peptide is an MHCI allele polynucleotide or peptide. In some embodiments, the MHCI allele peptide is encoded by any one of the MHC allele genes of a human or non-human animal, including loci such as HLA-A, HLA-B, and HLA-C. In some embodiments, the HLA allele polynucleotide encodes an alpha chain. In some embodiments, the engineered cell expresses a beta chain of an HLA peptide, such as β2-microglobulin (B2M). In some embodiments, the HLA allele polynucleotide is introduced into the engineered cell as an HLA composition as described herein. In some embodiments, the HLA allele polynucleotide is in an expression vector as described herein. The HLA allele polynucleotide or peptide for introduction may be endogenous or exogenous to the cell. In an embodiment, the HLA allele polynucleotide or peptide for introduction is exogenous to the cell.

[0176] In some embodiments, the engineered cells are monoallelic cells, i.e., express only one MCHI allele. Without being limited thereto, cells can be engineered to reduce or completely inhibit the expression of all endogenous HLA alleles except one, resulting in a cell that expresses only one type of HLA allele peptide. In other examples, cells can be engineered to reduce or completely inhibit the expression of all endogenous HLA alleles, and then HLA allele polynucleotides or HLA allele peptides for expression can be introduced, resulting in a cell that expresses only one type of HLA allele peptide. Examples of reducing or completely inhibiting the expression of endogenous HLA allele expression can include at least knockout methods (e.g., CRISPR technology) and knockdown methods (e.g., siRNA, shRNA, antisense oligonucleotides, miRNA, etc.). In embodiments, the HLA alleles are expressed transiently. In embodiments, the HLA alleles are expressed stably.

[0177] In some embodiments, the engineered cell is further introduced with a polypeptide comprising single or multiple neo-antigens or neo-epitopes, or a polynucleotide encoding such a polypeptide. Once introduced into the engineered cell, the single or multiple neo-antigens may be cleaved to generate multiple neo-epitopes. In some embodiments, the neo-epitopes bind to HLA allele peptides expressed by the engineered cell and are presented on the cell surface. In some embodiments, at least one of the neo-epitopes binds to a single type of HLA expressed by the mono-allelic engineered cell and are presented on the cell surface. In some embodiments, the polypeptide, or a polynucleotide encoding such a polypeptide, comprises a single polypeptide or polynucleotide chain comprising a fusion of multiple neo-antigens or neo-epitopes, with or without a linker(s) as described herein between two adjacent neo-antigens or neo-epitopes, or their encoding polynucleotides.

[0178] In some embodiments, the engineered cells are further introduced with a polynucleotide cassette encoding multiple neo-antigen-associated peptides or neo-epitopes, as described herein. Examples of polynucleotide cassettes may include the piggyBac expression constructs described in the Examples section, which include 24 or 47 neo-antigens. In general, there is no particular limit to the exact number of neo-antigens or neo-epitopes for fusion to the polynucleotide cassette, so long as transduction of the cassette or expression of the cassette in the cell is not adversely affected or inhibited. In some embodiments, the isolated polynucleotide cassette encodes at least 2 neo-antigens, for example, 2-200 neo-antigens, for example, 20-100 neo-antigens, 20-75 neo-antigens, or 30-50 neo-antigens (and all subvalues ​​and subranges therebetween, inclusive of endpoints). In some embodiments, the isolated polynucleotide cassette encodes 2, 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80 or more neo-antigens.

[0179] In general, there are no particular limitations on the cell type for engineering described herein. In some embodiments, the engineered cell is any type of nucleated cell. In some embodiments, the engineered cell is an animal cell. In some embodiments, the engineered cell is a mammalian cell, such as a human cell or a non-human mammalian cell. In some embodiments, the engineered cell is an antigen-presenting cell (APC) or is capable of presenting antigens (e.g., intracellularly expressed neoepitopes and / or neoepitopes cleaved from intracellularly expressed neoantigen-associated peptides) on the cell surface for recognition by immune cells (e.g., T cells). In some embodiments, the engineered cell is an HMy2.C1R cell. In some embodiments, the engineered cell is a K562 cell (e.g., ATCC product CCL-243™).

[0180] In an aspect, a cell line is provided that comprises a plurality of the single-allelic cells described herein. In an embodiment, the cells of the cell line stably or transiently express a single HLA allele.

[0181] In an embodiment, a plurality of cell lines are provided. In an embodiment, each cell line comprises cells that stably or transiently express a single HLA allele. In an embodiment, the cell lines express different HLA alleles. In an embodiment, each cell line expresses different HLA alleles. In an embodiment, each cell line expresses at least one different HLA allele.

[0182] Tumor / Cancer Vaccines In an embodiment, a tumor vaccine or cancer vaccine is provided for inducing immune response in a subject or subjects with tumor or cancer or susceptible to tumor or cancer.Examples of tumor / cancer vaccines include at least treatment or therapeutic vaccines that can prevent cancer from coming back, induce targeting / destruction of cancer cells remaining in the body after treatment is completed, stop tumor growth or spread, etc.

[0183] In some embodiments, the tumor / cancer vaccines described herein comprise a polypeptide comprising a neoantigen or a neoepitope cleaved from a neoantigen expressed by a tumor or cancer cell, or a polynucleotide encoding such a polypeptide. In some embodiments, the tumor / cancer vaccines described herein comprise a neoantigen or neoepitope composition described herein.

[0184] In some embodiments, at least one of the opitopes or neoepitopes cleaved from the neoantigen(s) in the tumor / cancer vaccine described herein forms a specific neoepitope-HLA binding pair with the HLA expressed by tumor or cancer cells, or another APC cell, in the subject(s) with which the vaccine is administered. In a non-limiting example, some or all of the HLA alleles expressed in the subject(s) are known prior to administration with the vaccine. An example of identifying the HLA allele subtype in the subject(s) may include at least genotyping or other sequencing methods known to those skilled in the art. Once information of the HLA allele subtype in the subject(s) is provided, the methods described herein may be used to identify a neoepitope-HLA binding pair that includes a neoepitope that is specifically recognized by the HLA allele subtype in the subject(s). Such neoepitopes, or the corresponding neoantigens from which the neoepitopes are cleaved, can be used to prepare the tumor / cancer vaccines described herein for administration to a subject(s).

[0185] In some embodiments, a single or multiple subjects may be sequenced or genotyped to provide information regarding the specific HLA allele subtype in the subject(s) to identify neoepitope-HLA binding pairs for the specific HLA allele subtype, and the identified neoepitopes, or the corresponding neoantigen(s) from which the neoepitopes are cleaved, may be used to prepare the tumor / cancer vaccines described herein for administration to the subject(s).

[0186] In some embodiments, tumor / cancer vaccines comprising the neoantigens or neoepitopes described herein are known to those skilled in the art. In a non-limiting example, a single or multiple subjects may be sequenced or genotyped to identify neoepitope-HLA binding pairs for specific HLA allele subtypes by the methods described herein, providing information regarding the specific HLA allele subtypes in the subject(s). Any subject with a specific HLA allele subtype in the identified binding pair that is included in the tumor / cancer vaccine or has a specific neoepitope cleavable by the neoantigen included in the tumor / cancer vaccine may be determined as a subject for administration of the vaccine to treat or prevent tumor / cancer. In a non-limiting example, the screening method described herein may be applied to a single or multiple subjects to identify a subgroup of subjects to be administered with the vaccine.

[0187] Engineered T cells In an embodiment, an engineered T cell is provided. In an embodiment, the engineered T cell comprises a nucleic acid sequence encoding a polypeptide comprising an exogenous TCR-beta domain and an exogenous TCR-alpha (VJ) domain. In an embodiment, the nucleic acid sequence is inserted into the TCR-alpha locus of the engineered T cell. In an embodiment, the engineered T cell comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR) polypeptide.

[0188] In another related aspect, there is provided a composition comprising isolated T cells, wherein at least 5% of the cells are engineered T cells, each engineered T cell comprising a nucleic acid sequence encoding a polypeptide comprising an exogenous TCR-beta and an exogenous TCR-alpha (VJ) domain. In an embodiment, the nucleic acid sequence is inserted into the TCR-alpha locus of the engineered T cell.

[0189] In an embodiment, expression of the endogenous TCR-beta gene is disrupted by gene editing.

[0190] In an embodiment, the exogenous TCR-alpha (VJ) domain forms part of a heterologous TCR-alpha that includes at least a portion of the T cell's endogenous TCR-alpha. In an embodiment, the TCR-alpha locus is a TCR-alpha constant region. In an embodiment, the exogenous TCR-beta and the heterologous TCR-alpha are expressed from a nucleic acid to form a functional TCR. In an embodiment, the engineered T cell is bound to an antigen. In an embodiment, the engineered T cell is bound to a cancer cell. In an embodiment, the TCR is bound to an antigen presented on a major histocompatibility complex class I (MHCI) molecule.

[0191] In embodiments, the antigen is a neo-antigen (e.g., a tumor associated antigen (TAA)) or a neo-epitope cleaved or cleavable from a neo-antigen. In embodiments, the antigen is a neo-antigen. In embodiments, the antigen is a neo-epitope. In embodiments, the neo-antigen or TAA is selected from WT1, JAK2, NY-ISO1, PRAME, KRAS, or an antigen from Table 1 or Table 2. In embodiments, the antigen is specific to the cancer of the subject receiving the engineered T cells. In embodiments, the antigen is expressed by or associated with the cancer of the subject receiving the engineered T cells.

[0192] In an embodiment, the nucleic acid sequence further encodes an auto-cleaving peptide. In an embodiment, the auto-cleaving peptide is an auto-cleaving viral peptide. In an embodiment, the auto-cleaving viral peptide is T2A. In an embodiment, the auto-cleaving viral peptide is P2A. In an embodiment, the auto-cleaving viral peptide is E2A. In an embodiment, the auto-cleaving viral peptide is F2A.

[0193] In an embodiment, the engineered T cells express CD45RO, CC chemokine receptor type 7 (CCR7) and L-selectin (CD62L). In an embodiment, the engineered T cells have a central memory (CM) T cell phenotype. In an embodiment, the engineered T cells have a naive T cell phenotype. In an embodiment, the engineered T cells have a naive T cell phenotype are CD45RA+CD45RO-CD27+CD95- (i.e., the cells express CD45RA and CD27 and do not express detectable levels of CD45RO and CD95). In an embodiment, the engineered T cells have a stem cell memory T cell phenotype. In an embodiment, the engineered T cells have a stem cell memory T cell phenotype are CD45RA+CD45RO-CD27+CD95+CD58+CCR7-Hi TCF1+. In an embodiment, the engineered T cells have a central memory T cell phenotype. In embodiments, the engineered T cells with a central memory T cell phenotype are CD45RO+CD45RA-CD27+CD95+CD58+. In embodiments, the engineered T cells have a progenitor exhausted T cell phenotype. In embodiments, the engineered T cells with a progenitor exhausted T cell phenotype are PD-1+SLAMF6+TCF1+TIM3-CD39-. In embodiments, the engineered T cells with a progenitor exhausted T cell phenotype express low or intermediate levels of PD-1. The expression level of each marker can be compared to a control, such as (but not limited to) a cell type known to express the marker, a cell type, cell population, population of T cells known not to express the marker.

[0194] In embodiments, the T cells are autologous to a subject in need thereof. In embodiments, the T cells are allogeneic to a subject in need thereof.

[0195] In another related aspect, a pharmaceutical composition is provided, the pharmaceutical composition comprising a plurality of engineered Ti9 cells as described herein, including embodiments thereof, and a pharma- ceutical acceptable excipient.

[0196] In embodiments, at least 10% of the cells in the composition comprising isolated T cells are engineered T cells. In embodiments, at least 20% of the cells are engineered T cells. In embodiments, at least 30% of the cells are engineered T cells. In embodiments, at least 40% of the cells are engineered T cells. In embodiments, at least 50% of the cells are engineered T cells. In embodiments, at least 60% of the cells are engineered T cells. In embodiments, at least 70% of the cells are engineered T cells. In embodiments, at least 80% of the cells are engineered T cells. In embodiments, at least 90% of the cells are engineered T cells.

[0197] In an embodiment, the composition comprises about 0.1×10 5 pieces~approx. 1×10 9 In an embodiment, the composition comprises at least 1×10 engineered T cells. 8 In an embodiment, the composition comprises at least 1×10 engineered T cells. 9 The number of cells can be any value or subrange between the recited ranges, including the endpoints.

[0198] In an embodiment, the composition further comprises a pharma- ceutically acceptable excipient. Means for making such compositions or implants are described in the art (see, for example, Remington's Pharmaceutical Sciences, 16th Ed., Mack, ed. (1980)). Where appropriate, the engineered T cells may be formulated into semi-solid portable or liquid form preparations, such as capsules, solutions, injections, inhalants or aerosols, in the usual manner for each route of administration. In an embodiment, the excipient is a balanced salt solution, such as Hank's balanced salt solution, or physiological saline. It will also be understood that, if desired, the compositions of the present invention may be administered in combination with other agents, such as cytokines, growth factors, hormones, small molecules, chemotherapeutic agents, prodrugs, drugs, antibodies, or various other pharma- ceutical active agents. There is virtually no limit to the other components that may be included in the composition, so long as the additional agents do not adversely affect the ability of the composition to deliver the intended therapy.

[0199] In a non-limiting example, the engineered T cells described herein express a TCR (endogenous or exogenous) or CAR molecule that specifically recognizes a neoepitope-HLA binding pair on the engineered cells (e.g., monoallelic cells) described in the above section. In some embodiments, the neoepitope-HLA binding pair presents a neoepitope on the cell surface that is recognized by and binds to the expressed TCR or CAR molecule via the extracellular antigen-binding domain of the TCR or CAR molecule. Such recognition can result in activation and proliferation of the engineered T cells, which can further increase their ability to produce anti-tumor / cancer cytokines and / or cytotoxicity against tumor / cancer cells.

[0200] In a non-limiting example, a single or multiple subjects may be sequenced or genotyped to identify neoepitope-HLA binding pairs for a particular HLA allele subtype by the methods described herein, providing information regarding the particular HLA allele subtype in the subject(s). The engineered T cells described herein may be prepared to specifically recognize a neoepitope-HLA binding pair and thus may be used as a treatment for a subject(s) having at least one identified neoepitope-HLA binding pair.

[0201] In some embodiments, the screening methods described herein may be applied to single or multiple subjects to identify a subgroup of subjects to be administered engineered T cells, which specifically recognize neoepitope-HLA binding pair(s) in the subject(s), identified using HLA allele subtype information of the subject(s).

[0202] V. System In an aspect, provided herein is a system comprising a plurality of monoallelic HLA expressing cell lines as described herein. In some embodiments, cells in each cell line do not express an endogenous HLA allele. In some embodiments, cells in each cell line express an exogenous HLA allele as described herein. In some embodiments, each cell line expresses a different exogenous HLA allele as described herein. In some embodiments, cells in each cell line express a beta chain of the HLA complex, such as β2-microglobulin (B2M). In some embodiments, each cell line comprises a polynucleotide cassette encoding a plurality of neo-antigen associated peptides as described herein.

[0203] In some embodiments, the systems described herein include parent cells engineered to produce a monoallelic cell line using the methods described herein, in some embodiments, the systems described herein further include a polynucleotide cassette encoding a plurality of neo-antigen associated peptides described herein.

[0204] In some embodiments, the systems described herein include an array or library of MHC (e.g., MHCI) alleles and / or a library of known or putative neoantigens or neoepitopes, e.g., based on pathogenic diseases, tumor types, etc., and / or cells expressing HLA and / or neoantigens or neoepitopes. Such HLA alleles and neoantigens or neoepitopes can be used to identify specific neoepitope-HLA binding pairs as described herein.

[0205] VI. Kit In an embodiment, a kit or reagent composition is provided herein that includes the system or composition described herein.The kit or reagent composition herein may also include reagents for preparing engineered cell lines, performing assays to identify specific neoepitope-HLA binding pairs, and / or analyzing the binding between neoepitopes and HLA proteins as described herein.The kit or reagent composition herein may also include instructions for performing the method herein or a part of such a method.

[0206] VII. Preparation method In an aspect, provided herein are methods of producing the compositions described herein.

[0207] In one aspect, the application provides a method of producing the neoantigen and / or neoepitope compositions or HLA compositions described herein. Single or multiple nucleotides encoding neoantigens or neoepitopes or HLA peptides may be manipulated (e.g., isolated, cloned, etc.) using a suitable method or methods known to those of skill in the art. Expression vectors (e.g., plasmids, viral vectors, etc.) may be used to introduce the neoantigens, neoepitopes, and / or HLA compositions into cells. Selection markers may be used to identify engineered cells containing such expression vectors or polynucleotides for expression. In some embodiments, the expression vectors described herein are stably or transiently delivered to cells using methods described herein or methods known to those of skill in the art.

[0208] In another interrelated aspect, a method for producing engineered (e.g., monoallelic) cells and / or cell lines is provided. In some embodiments, engineered cells are introduced with HLA allele polynucleotides (e.g., whole or part of HLA allele genes or exons) for expression of HLA allele peptides by a suitable method or methods known to those skilled in the art. In some embodiments, cells are engineered to reduce or completely inhibit expression of all endogenous MHC alleles (e.g., MHCI alleles), except one, resulting in cells expressing only one type of HLA allele peptide. In some embodiments, cells are engineered to reduce or completely inhibit expression of all endogenous MHC alleles (e.g., MHCI alleles), and then introduced with MHC allele polynucleotides for expression of MHC allele peptides, resulting in cells expressing only one type of MHC allele peptide. Examples of reducing or completely inhibiting expression of endogenous HLA allele expression may include at least knockout methods (e.g., CRISPR technology) and knockdown methods (e.g., siRNA, shRNA, antisense oligonucleotides, miRNA, etc.).

[0209] In some embodiments, the engineered cells are further introduced with a polypeptide comprising single or multiple neo-antigens or neo-epitopes, or a polynucleotide encoding such a polypeptide. Once introduced into the engineered cells, the single or multiple neo-antigens may be cleaved to generate multiple neo-epitopes. In some embodiments, the engineered cells are further introduced with a polynucleotide cassette encoding multiple neo-antigen-related peptides or neo-epitopes, as described herein.

[0210] In another interrelated aspect, a method of making a tumor / cancer vaccine is provided. In some embodiments, the tumor / cancer vaccine described herein comprises a polypeptide comprising a neo-antigen or a neo-epitope cleavable from a neo-antigen expressed by a tumor or cancer cell, or a polynucleotide encoding such a polypeptide. In some embodiments, the tumor / cancer vaccine described herein comprises a neo-antigen or neo-epitope composition described herein. In some embodiments, at least one of the opitopes or neo-epitopes cleavable from the neo-antigen(s) in the tumor / cancer vaccine described herein forms a specific neo-epitope-HLA binding pair with an HLA expressed by a tumor or cancer cell, or another APC cell, in a single or multiple subjects with whom the vaccine is administered.

[0211] In a non-limiting example, the neoantigen may be expressed by tumor or cancer cells in a single or multiple subjects. Based on the information of the specific HLA allele information of the subject(s), a specific neoepitope-HLA binding pair is identified using the methods described herein. In some embodiments, the tumor / cancer vaccine described herein is produced to include a neoepitope, or a neoantigen from which the neoepitope is truncated, in the identified neoepitope-HLA binding pair. In some embodiments, at least one tumor / cancer vaccine is selected from the multiple vaccines to have a neoepitope, or a neoantigen from which the neoepitope is truncated, in the identified neoepitope-HLA binding pair. In some embodiments, at least one subject is selected from the multiple subjects administered the tumor / cancer vaccine, while the HLA and neoepitope in the subject, or the neoantigen from which the neoepitope is truncated in the vaccine, can form an identified neoepitope-HLA binding pair.

[0212] In another interrelated aspect, a method for producing an engineered T cell is provided. In an embodiment, the engineered T cell comprises a nucleic acid sequence encoding a polypeptide comprising an exogenous TCR-beta domain and an exogenous TCR-alpha (VJ) domain. In an embodiment, the nucleic acid sequence is inserted into the TCR-alpha locus of the engineered T cell. In an embodiment, the engineered T cell comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR) polypeptide.

[0213] In a non-limiting example, the engineered T cells described herein express a TCR (endogenous or exogenous) or CAR molecule that specifically recognizes the neoepitope-HLA binding pair on the engineered cells (e.g., monoallelic cells) described in the above section. In a non-limiting example, a single or multiple subjects may be sequenced or genotyped to identify the neoepitope-HLA binding pair for a particular HLA allele subtype by the methods described herein, providing information regarding the particular HLA allele subtype in the subject(s). The engineered T cells described herein may be prepared by introducing a TCR or CAR molecule that specifically recognizes the neoepitope-HLA binding pair into the T cells. In some embodiments, the screening methods described herein may be applied to a single or multiple subjects to identify a subgroup of subjects to be administered engineered T cells, where the engineered T cells specifically recognize the neoepitope-HLA binding pair(s) in the subject(s) and are identified using the HLA allele subtype information of the subject(s).

[0214] VIII.How to use Methods for identifying neoepitope-HLA binding pairs In an embodiment, provided herein is a method for identifying a neoepitope-HLA binding pair.

[0215] In some embodiments, a first optional step of the method includes providing or harvesting engineered cells (such as a monoallelic HLA expressing cell line comprising cells), each cell expressing a first exogenous HLA and comprising a polynucleotide (e.g., a polynucleotide cassette) encoding a plurality of neo-antigen associated peptides or neo-epitopes. A second optional step of the method includes expressing a plurality of neo-antigens or neo-epitopes in each cell, the plurality of neo-epitopes being produced by cleaving the plurality of neo-antigen associated peptides in each cell such that one or more neo-epitopes bind to the first exogenous HLA allele at the cell surface. A third optional step of the method includes eluting the neo-epitopes bound to the first exogenous HLA at the cell surface from the HLA using a suitable elution solution. A fourth optional step of the method includes identifying the neo-epitope(s) eluted from the third optional step, thereby identifying neo-epitope-HLA binding pairs. Such multiple neo-antigen-associated peptides may be determined to bind to one or more HLAs by peptide exchange assays or may be identified by bioinformatics and / or clinical analysis of tumor mutations.

[0216] In some embodiments, the first optional step of the method includes providing or collecting engineered cells (such as a monoallelic HLA expressing cell line comprising cells), each cell expressing a first exogenous HLA allele. The second optional step of the method includes contacting the cells with a synthetic neoepitope. The third optional step of the method includes eluting peptides bound to the first exogenous HLA allele on the cell surface from the HLA alleles using a suitable elution solution. The fourth optional step of the method includes identifying the neoepitope(s) eluted from the third optional step, thereby identifying neoepitope-HLA binding pairs. In some embodiments, multiple synthetic neoepitopes are used in the second optional step, providing for screening of neoepitopes capable of forming binding pairs with specific HLA proteins.

[0217] In an embodiment, the monoallelic cell line is a monoallelic cell line described herein (or generated as described). In an embodiment, the polynucleotide cassette is a polynucleotide cassette described herein.

[0218] In an embodiment, the synthetic neoepitope comprises a detectable moiety. In an embodiment, the detectable moiety is a heavy amino acid. The term "heavy amino acid" refers to the presence of one or more heavy isotopes, such as non-radioactive isotopes. Suitable isotopes include, for example, 2 H, 13 C. 15 N or 18 In an embodiment, identification of the eluted neoepitope comprises detection of a detectable moiety.

[0219] In an embodiment, the synthetic neoepitopes are determined to bind to one or more HLA by peptide exchange assays.

[0220] In an embodiment, the steps are repeated in a second mono-allelic HLA-expressing cell line comprising cells, each cell expressing a second exogenous HLA allele polypeptide. In an embodiment, the steps are repeated in a plurality of cell lines, each cell line expressing a different exogenous HLA allele polypeptide.

[0221] Methods for selecting subjects for treatment In one aspect, the present specification provides a method for selecting subjects with cancer or tumor for immunotherapy.In some embodiments, the method is for selecting subjects for T cell therapy (such as using T cell expressing T cell receptor (TCR) and / or chimeric antigen receptor (CAR)).

[0222] In some embodiments, the first optional step of the method includes genotyping a single or multiple subjects to identify HLA allele(s) and neoantigens, or neoepitopes cleavable from neoantigens, expressed by the subject(s) and / or predisposed to cancer or tumors in the subject(s) or to develop in the subject(s). In some embodiments, such HLA allele and neoantigen / neoepitope information of the subject(s) is known to those skilled in the art. The second optional step of the method includes determining whether any of the expressed HLA protein(s) in the subject(s) can form a specific binding pair with one or more neoepitopes in the same subject. In a non-limiting example, if at least a neoepitope-HLA binding pair is identified, a subject having both the neoepitope, or the neoantigen from which the neoepitope is cleaved, and an HLA allele can be determined to be treatable by a T cell that contains a TCR or CA that specifically binds to the neoepitope-HLA binding pair, and optionally can be treated by the T cell.

[0223] In some embodiments, the method is for selecting a subject for cancer / tumor vaccine therapy.

[0224] In some embodiments, the first optional step of the method includes genotyping a single or multiple subjects to identify HLA allele(s) and neoantigens, or neoepitopes cleavable from neoantigens, expressed by the subject(s) and / or predisposed to cancer or tumors in the subject(s) or to develop in the subject(s). In some embodiments, such HLA alleles and neoantigen / neoepitope information of the subject(s) is known to those skilled in the art. The second optional step of the method includes determining whether any of the expressed HLA allele(s) in the subject(s) can form a specific binding pair with one or more neoepitopes. In a non-limiting example, if at least a neoepitope-HLA binding pair is identified, a subject having an HLA can be determined to be treatable with a tumor / cancer vaccine comprising a neoepitope, or a neoantigen in which the neoepitope is cleaved, in the identified neoepitope-HLA binding pair having an HLA allele in the subject, and can optionally be treated with the vaccine.

[0225] In an embodiment, whether a neoepitope and an HLA form a neoepitope-HLA binding pair (e.g., identification of a neoepitope-HLA binding pair) is determined by analysis of a database of such interactions. In an embodiment, the binding pairs in the database were determined, at least in part, using the methods described therein.

[0226] Method of Treating a Subject In embodiments, provided herein are methods of treating a subject having cancer or a tumor or preventing a subject from having / developing cancer or a tumor.

[0227] In some embodiments, the method includes administering to a subject a therapeutically effective amount of T cells expressing a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR). In some embodiments, the TCR and / or CAR specifically binds to a neoepitope-HLA binding pair that includes an HLA expressed in the subject and a neoepitope expressed by a tumor or cancer cell in the subject or prone to develop in the subject.

[0228] In some embodiments, the methods include selecting a subject for treatment as described in the section above, and treating the selected subject with a composition described herein, including a tumor / cancer vaccine or T cell therapy with engineered T cells.

[0229] In some embodiments, the first optional step of the method comprises selecting a subject with cancer that expresses an HLA allele and expresses a neoantigen. Optionally, the HLA is known or determined to bind to a neoepitope that is cleavable from the neoantigen. In some embodiments, the second optional step of the method comprises administering to the subject a therapeutically effective amount of a T cell that expresses a T cell receptor (TCR) and / or a chimeric antigen receptor (CAR) as described herein. Such a TCR and / or CAR can specifically bind to a neoepitope-HLA binding pair that includes an HLA and a neoepitope.

[0230] In some embodiments, the method includes administering to a subject a therapeutically effective amount of a vaccine comprising a neoepitope or a polynucleotide encoding a neoepitope, such a neoepitope capable of specifically binding to HLA expressed in the subject to form a specific neoepitope-HLA binding pair.

[0231] The dosage and route of administration of the formulations useful for the treatments described herein can be determined as appropriate by a physician. In the case of engineered T cells, the expanded plurality of engineered T cells can be administered in any suitable amount, for example, about 1×10 5~1×10 9 In embodiments, the expanded plurality of engineered T cells may be administered to a subject in the amount of at least 1×10 8 In embodiments, the expanded plurality of engineered T cells comprises at least 1×10 9 engineered T cells. The number can be any value or subrange within the recited range, including the endpoints.

[0232] It is to be understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes taking into account thereof will be suggested to those skilled in the art and are to be included within the spirit and scope of this application and the scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0233] Those skilled in the art will appreciate that the illustrations of making and using the conjugates described herein are for illustrative purposes only, and that the disclosure is not limited by these illustrations.

[0234] The publications described herein are provided solely for their disclosure prior to the filing date of this patent application.Nothing herein should be construed as an admission that such publications are prior art to the appended claims.All publications referenced herein are incorporated herein by reference in their entirety for all of their teachings, including but not limited to all compositions, components, reagents, and methods. EXAMPLES

[0235] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not intended to limit the scope of the disclosure or claims in any way.

[0236] Example 1: Discovery of neoepitopes across shared neoantigens: biochemistry, cell engineering and mass spectrometry Neoantigen-specific T cells play a key role in immune-mediated elimination of tumors, and substantial resources have been devoted to developing clinically active drugs that amplify the cancer-immunity cycle to improve the magnitude and breadth of the immune response elicited (Chen and Mellman, Oncology meets immunology: the cancer-immunity cycle. Immunity 2013;39(1):1-10; Rosenberg, Decade in review-cancer immunotherapy: entering the mainstream of cancer treatment. Nat Rev Clin Oncol. 2014;11(11):630-2). Alone or in combination with broad immune system activation, targeted immunotherapeutics may enable enhanced efficacy and safety profiles (Melero et al., Evolving synergistic combinations of targeted immunotherapies to combat cancer. Nat Rev Cancer. 2015;15(8):457-72; Panchal et al., Role of targeted immunotherapy for pancreatic ductal adenocarcinoma (PDAC) treatment: An overview. Int Immunopharmacol. 2021;95:107508). Furthermore, T cells programmed to eradicate neoantigen-expressing cells may facilitate the design of next-generation cell therapies, especially for solid tumors (Leidner et al., Neoantigen T-Cell Receptor Gene Therapy in Pancreatic Cancer. N Engl J Med. 2022;386(22):2112-2119; Yang and Rosenberg, Adoptive T-Cell Therapy for Cancer. Adv Immunol. 2016;130:279-94).

[0237] Over the past decade, major histocompatibility complex class I (MHCI) presentation of epitopes (e.g., neoepitopes) derived from cancer-specific mutations has emerged as an important mode of action by which our immune system can control tumor growth. Presentation of these non-self neoepitopes has been shown to induce neoantigen-specific T cell responses via the cancer immune cycle that can drive antitumor immune responses. Due to the role that neoantigen-specific T cells play in tumor killing, substantial resources across academia and biotechnology have been put into developing clinically active drugs, such as checkpoint inhibitors, cytokines, and TNF superfamily agonists, that amplify the cancer immune cycle and improve the magnitude and breadth of neoantigen-specific T cell responses. For these therapeutic modalities, the primary objective is to amplify the entire immune response rather than targeted therapies that selectively enhance specific neoantigen T cell responses, so that these treatments are agonistic against the actual neoantigens and neoepitopes presented on a given tumor.

[0238] There is research to amplify specific neoantigen T cell responses through the use of vaccines and engineered T cell therapies. These types of therapies target two broad categories of neoantigens, shared neoantigens or personalized / private neoantigens (Zhang et al.,Neoantigen: A New Breakthrough in Tumor Immunotherapy. Front Immunol. 2021;12:672-356). Private (aka personalized) neoantigens represent the majority of mutations that arise during cancer progression and are somatic mutations that are unique to an individual's tumor and are not seen across multiple patients or indications (Jhunjhunwala et al.,Antigen presentation in cancer: insights into tumour immunogenicity and immune evasion. Nat Rev Cancer. 2021;21(5):298-312). Developing therapeutics against autologous neoantigens requires personalized drug development, which has several inherent challenges and requires genomic analysis of patient biopsies, HLA typing, and a complex process of bioinformatics-based neoantigen prediction to rank epitopes all before therapeutics are designed and manufactured (Capietto et al., Characterizing neoantigens for personalized cancer immunotherapy. Curr Opin Immunol. 2017;46:58-65; Lang et al., Identification of neoantigens for individualized therapeutic cancer vaccines. Nat Rev Drug Discov. 2022;21(4):261-282).Although some success has been demonstrated in this field (Ott et al., An immunogenic personal neoantigen vaccine for patients with melanoma. Nature 2017;547(7662):217-221; Sahin et al., Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity against cancer. Nature 2017;547(7662):222-226), the path to broadly available personalized neoantigen targeted therapy has yet to be established.

[0239] In contrast to the individualized nature of personalized neoantigens, an increasing number of mutations have been identified across a broad range of patients and indications, termed shared neoantigens (Zhang et al., Front Immunol. 2021). The prevalence of shared neoantigens is related to their biological function, with many putative shared neoantigens derived from oncogenic mutations within proteins such as KRAS, EGFR, TP53 and BRAF (Klebanoff and Wolchok, Shared cancer neoantigens: Making private matters public. J Exp Med. 2018;215(1):5-7). Prior knowledge of specific mutations allows for the discovery and validation of target epitopes, as well as a route to “off-the-shelf” therapeutics that can be administered to any patient whose tumor has the targeted mutation and the appropriate HLA haplotype. Early examples of vaccines targeting shared neo-antigens have shown promising preclinical efficacy including vaccines targeting IDH1 (Schumacher et al., Nature 2014;512(7514):324-327), KRAS (Wang et al., Cancer Immunol Res. 2016;4(3):204-214) and H3.3K27M (Chheda et al., J Exp Med. 2018;215(1):141-157). In addition to vaccines, T cell therapies targeting shared neo-antigens have recently shown clinical efficacy. Some early evidence has shown that T cells specific for the KRAS G12D HLA-C*08:02-restricted neoepitope can provide effective antitumor responses in human patients with lung metastatic tumors (Tran et al., N Engl J Med. 2016;375(23):2255-2262; Leidner et al., Neoantigen T-Cell Receptor Gene Therapy in Pancreatic Cancer. N Engl J Med. 2022;386(22):2112-2119).Efficacy has also been demonstrated in preclinical models of KRAS G12V / G12D HLA-A*11:01-restricted neoepitopes (Wang et al., Cancer Immunol Res. 2016;4(3):204-214). However, despite the potential for "off-the-shelf" vaccines and T cell therapies, identifying common neoantigenic epitopes and the HLA context in which they are presented remains a major challenge to drug development.

[0240] Neoantigen-specific T cell responses against tumor-associated mutations require processing of the neoantigen into neoepitopes, i.e., peptides derived from the mutant protein, which must then be presented via cell surface-associated class I HLA molecules (HLA-I). T cell receptors (TCRs) interact with specific neoepitope-HLA complexes such that the therapeutic target definition includes both the neoepitope sequence and the HLA-I subtype on which it is presented. Neoepitopes are generally 8-11 amino acids long, such that there can be a single amino acid substitution within the 38 possible neoepitopes (i.e., 8mer, 9mer, 10(10)mer and 11(11)mer). Furthermore, HLA-I molecules are highly polymorphic, with over 1000 documented variants, each with the ability to bind a distinct subset of peptides. As a result, the number of potential neoepitope-HLA targets has grown rapidly, and even if the generation was focused on neoepitopes derived from the 15 most common cancer neoantigens across the 50 most common HLA alleles, more than 28,000 neoepitope-HLA pairs could be formed. However, not all of these combinations are therapeutically significant, since even if a neoepitope can bind to an HLA molecule, there is no guarantee that a specific neoepitope will be presented within the biological context of the tumor cell. Most of these alleles are very rare and would not constitute strong candidates for drug development, given the rarity of patients with both neoantigen mutations and these rare alleles.

[0241] Therefore, the top 15 most common HLAs were tested for their interactions with each of the 38 neoepitopes, resulting in 570 possible HLA-neoepitope combinations that could be derived from a single neoantigen. Furthermore, to perform a comprehensive analysis of neoepitope targets across all clinically relevant neoantigens in terms of prevalence and clinical development, the number of combinations increases to over 28,000 (assuming approximately 50 clinically relevant neoantigen targets), which is a fairly large number of combinations to evaluate. However, not all of these combinations are therapeutically relevant, since even if a neoepitope can bind to an HLA molecule, there is no guarantee that a specific neoepitope is available for binding within the biological context of the tumor cell.

[0242] One approach to rapidly select biologically relevant target neoepitope-HLA pairs from 28,000 possible combinations is to use neoepitope prediction algorithms. Several different algorithms have been developed to rank neoepitope-HLA pairs for a given neoantigen. However, these algorithms cannot accurately predict the presentation of neoepitopes by HLA. Despite significant advances in the accuracy of neoepitope-HLA prediction algorithms, these methods cannot be relied upon solely to identify presented neoepitopes that are true targets for neoantigen-targeted vaccines and T cell therapeutics.

[0243] The generation of neoepitopes depends on the antigen processing pathway (APP) as cancer neoantigens are degraded by the proteasome and the resulting peptides are imported into the ER where they are further processed by ER-resident aminopeptidases before finally being loaded onto HLA molecules for presentation (Pishesha et al., A guide to antigen processing and presentation. Nat Rev Immunol. 2022 Apr 13. doi:10.1038 / s41577-022-00707-2). As a result, synthetic neoepitopes may be able to bind to HLA molecules in vitro but not be observed as presented peptides in cellular or in vivo contexts. A prime example is the description of a bispecific antibody targeting the A*02:01 restricted neoepitope of KRAS G12V (KLVVVGAVGV, SEQ ID NO: 191) (see Skora et al. 2015 Proc Natl Acad Sci USA 112(32):9967-9972; Douglass et al., Bispecific antibodies targeting mutant RAS neoantigens. Sci Immunol. 2021 Mar 1;6(57):eabd5515). When HLA molecules were loaded with synthetic peptides, the molecule showed binding in vitro, but failed to induce cell killing when tested in cell lines harboring KRAS mutations. For this reason, direct identification of presented peptides by mass spectrometry (MS)-based immunopeptidomic approaches is a key aspect of neoantigen target validation. For example, using a targeted MS approach, we provided further evidence that the previously described KRAS A*02:01 neoepitope is not presented in a cellular context (Choi et al., Systematic discovery and validation of T cell targets directed against oncogenic KRAS mutations. Cell Rep Methods. 2021;1(5):100084).Although highly sensitive, such targeted MS assays require heavy isotope-labeled peptides for each potential neoepitope, as well as cell lines expressing the cancer neoantigen of interest. Due to these limitations, targeted MS assays are typically used to evaluate a small number of cancer neoantigens within a given study.

[0244] To address this limitation, a pipeline for the comprehensive discovery and validation of neo-epitope-HLA pairs presented on the surface of cells is presented herein. The first step in this process was to perform a clinical genomics analysis of all known neo-antigens to identify those neo-antigens that are valuable as clinical targets. This analysis assessed prevalence within and across indications as well as clinical developability. From this analysis, 48 ​​neo-antigens were selected.

[0245] The next step was to develop a high-throughput HLA binding assay to screen neoepitope-HLA combinations displayed on the surface of cells (e.g., 27,360 combinations for 48 neoantigens, 38 neoepitopes / neoantigens, and 15 HLA alleles, or 26,220 neoepitope-HLA combinations for 47 neoantigens as shown in Table 3, 38 neoepitopes / neoantigens, and 15 HLA alleles as shown in Table 4). Using a clinical genomics approach, 47 common cancer point mutations and 15 common HLA-I alleles were selected to enable characterization of the neoepitope landscape for clinically actionable neoantigen targets. We then used a novel high-throughput HLA binding assay to experimentally screen all 24,149 possible neoepitope-HLA combinations for in vitro stabilization and identified 587 stable complexes (Darwish et al., Protein Sci. 2021;30(6):1169-1183; Rodenko et al., Generation of peptide-MHC class I complexes through UV-mediated ligand exchange. Nat Protoc. 2006;1(3):1120-32). To understand the complementarity of in vitro and in silico identification of neoepitope-HLA complexes, results from the high-throughput binding assays were supplemented with an additional subset of neoepitope-HLA combinations that did not form stable complexes in vitro but were predicted to bind by NetMHCpan4.0 (Jurtz et al., NetMHCpan-4.0: Improved Peptide-MHC Class I Interaction Predictions Integrating Eluted Ligand and Peptide Binding Affinity Data. J Immunol. 2017;199(9):3360-3368).The resulting neoepitope-HLA pairs were assayed for presentation using both non-targeted and targeted mass spectrometry of HLA-I monoallelic cell lines that simultaneously expressed approximately 25 amino acid segments corresponding to each of 47 cancer neoantigens. This analysis yielded a list of 84 neoepitope-HLA pairs that, to the best of our knowledge, represents the broadest list of experimentally confirmed presented neoepitopes. Finally, characterization of the therapeutic potential of these targets utilized TCRs discovered using the well-established Multiple Identification of T Cell Receptor Antigens (MIRA) assay in a parallel therapeutic discovery effort to demonstrate mutant-selective T cell activation and killing of cells expressing either the A*02:01 FLT3 D835Y or A*11:01 PIK3CA E454K neoepitopes. For example, in one exemplary experiment, through the development of a high-throughput peptide-HLA binding assay, we characterized the binding of 26,790 peptide-HLA combinations, resulting in 643 stable complexes. Using these results, we constructed a sensitive targeted mass spectrometry assay to validate neoepitope presentation in 15 monoallelic cell lines containing constructs encoding 47 cancer neoantigens. This analysis detected 79 unique peptide-HLA pairs derived from 34 shared cancer neoantigens and presented across 12 HLA alleles. Together, these data represent a valuable resource of therapeutically relevant neoepitopes and the HLA context in which they may be targeted.

[0246] material and method Clinical genomics analysis of shared cancer neoantigens Prevalence data for common cancer mutations (SNVs and indels) were obtained from the Cancer Hotspots database (World Wide Web at cancerhotspots.org; see Chang et al., 2018 Cancer Discov. 8(2):174-183) and cross-referenced with TCGA data from cBioPortal for Cancer Genomics (World Wide Web at cbioportal.org). Prevalence data for common HLA alleles from the general population were obtained from the Allele Frequency Net database (World Wide Web at allelefrequencies.net) and from HLA typing of over 8,000 TCGA cases. From these datasets, 48 ​​most common cancer mutations were determined (based on prevalence per cancer type) and 48 most common HLA-I alleles were determined. These mutations were further ranked taking into account the overall prevalence of each cancer type and whether neo-antigen-specific therapies could be readily developed in the clinical setting.

[0247] Predictive neoepitope landscape analysis After translating the mutations into peptide sequences, neoepitope-HLA binding predictions were generated using NetMHCpan-4.0 (Jurtz et al., NetMHCpan-4.0: Improved Peptide-MHC Class I Interaction Predictions Integrating Eluted Ligand and Peptide Binding Affinity Data. J Immunol. 2017;199(9):3360-3368) for all combinations of 8, 9, 10, 11, 12 or 13 mer peptides derived from 47 cancer neoantigens combined with the 15 most common HLA alleles. Both binding affinity (BA) and eluted ligand (EL) predictions were obtained, which were then used for downstream analysis. Predicted neoepitopes were defined as neoepitope-HLA combinations with mutant EL percentile rank <2.

[0248] Protein expression and purification Recombinant HLA and B2M were overexpressed in E. coli, purified from inclusion bodies, and stored in denaturing buffer (6M guanidine HCl, 25mM Tris, pH8) at -80°C as previously described (Darwish et al., Protein Sci. 2021;30(6):1169-1183). Briefly, B2M and HLA biomass pellets were resuspended in lysis buffer (PBS+1% Triton X-114) at 5mL / g and homogenized twice in a microfluidic device at 1000 bar. The homogenized suspension was spun in an ultracentrifuge at 30000g for 20 minutes. The pellet was collected and washed with 500ml of 0.5% Triton X-114 in PBS. The collected samples were then centrifuged at 30000g for 20 minutes. The pellet was again collected and washed as above. The purified inclusion bodies were dissolved in denaturation buffer (20 mM MES, pH 6.0, 6 M guanidine) at a concentration of 10 ml / g and stirred overnight at 4°C. The dissolved pellet was centrifuged at 40,000 g for 60 min and the supernatant was collected and filtered through a 0.22 mm filter. The concentration was determined by UV-vis at 280 nm using the extinction coefficient of the protein. Samples were then flash frozen and stored at -80°C prior to complex formation.

[0249] HLA-I-peptide refolding, biotinylation and purification Conditional HLA-I complexes were produced in a 5 L refolding reaction in refolding buffer (100 mM Tris, pH 8.0, 400 mM L-arginine, 2 mM EDTA) as previously described (Darwish et al., 2021). Briefly, the refolding reaction consisted of conditional HLA-I ligand peptides containing non-natural UV-cleavable amino acids (0.01 mM), oxidized and reduced glutathione (0.5 mM and 4.0 mM, respectively), recombinant HLA (0.03 mg / ml) and β2M (0.01 mg / ml). The refolding mixture was stirred at 4 °C for 3-5 days, filtered through a 0.22 μm filter, concentrated and buffer exchanged by tangential flow filtration (TFF) (Millipore P2C010C01) into 25 mM Tris, pH 7.5. The concentrated and refolded HLA-I complexes were then biotinylated by addition of BirA [1:50 (wt:wt) for enzyme:HLA-I ratio], 100 mM ATP and 10x reaction buffer (100 mM MgOAc, 0.5 mM biotin) over a 2 hour incubation period at room temperature. Samples were dialyzed and analyzed by LC / MS to quantify biotinylation. Biotinylated HLA-I complexes were purified by anion exchange chromatography using a 1ml HiTrap Q HP column on an AKTA Avant FPLC. The column was equilibrated with 10 column volumes (CV) of 25 mM TrisHCl, pH 7.5 at a flow rate of 5 ml / min. The refolded peptide-HLA-I sample was loaded onto the column at a flow rate of 5 ml / min and eluted with a 0-60% 2.5 mM TrisHCl, pH 7.5, 1M NaCl gradient over 30 CV. Fractions from the entire elution peak were run on SDS-PAGE and fractions containing both B2M and HLA bands were pooled. Pooled fractions were buffer exchanged into storage buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl). Protein concentration was determined by UV absorbance at 280 nm and samples were flash frozen and stored at -80°C.

[0250] Peptide synthesis for in vitro binding assays Peptides for binding screening were synthesized by JPT Peptide Technologies GmbH (Germany) and purified to >70% purity by HPLC. Peptides were dissolved in ethylene glycol (Sigma) at 1 mg / mL and stored at -80°C in Matrix 1.0 mL 2D screw-cap tubes (Thermo Fisher Scientific). UV-cleavable peptides were synthesized by Elim Biopharm using 3-amino-3-(2-nitrophenyl)propionic acid and purified to >70% purity by HPLC.

[0251] Automated high-throughput neoepitope exchange Peptides were diluted to 10 μM in 25 mM TRIS pH 8.0, 150 mM NaCl, 4 mM EDTA, 4.35% ethylene glycol in 96 deep-well plates (VWR) using a Biomek i5 automated liquid handler (Beckman Coulter). The peptide-buffer mixture was dispensed and reformatted in a volume of 47.5 μl / well into 384-well plates (Labcyte) to obtain an identical plate of up to 352 unique neoepitopes for screening against each of the 15 HLA alleles. The first two rows of the plate were saved for controls. HLA A*02:01 with and without exchanged peptide was included on each plate as positive and negative controls for the exchange, respectively. A well-characterized HLA A*02:01 specific viral epitope, CMV pp65 peptide (NLVPMVATV, SEQ ID NO: 76, Elim Biopharm), was plated in quadruplicate as a positive control for peptide exchange. Negative controls for replacement included wells where no peptide was added, but instead received ethylene glycol only during the peptide dilution step. Negative control wells for the HLA alleles being screened were plated in eight replicates.

[0252] Using a Mantis liquid handler (Formulatrix), 2.5 μl of 0.1 mg / ml UV peptide-HLA complex with one HLA allele screened for binding per plate was added to each well. Positive control wells received HLA A*02:01 and negative control wells received either HLA A*02:01 or the HLA allele specific for the plate. The resulting peptide exchange reaction mixture contained 10 μM peptide, 0.1 μM UV-HLA complex and 5% ethylene glycol v / v.

[0253] The peptide exchange protocol was adapted from a previously described method (Rodenko et al., Nat Protoc. 2006;1(3):1120-1132) by shortening the UV exposure time and adding an incubation step after UV exposure. Plates containing peptide exchange reaction mixtures were incubated under a UV lamp (UVP 3UV lamp, Analytik Jena) for 25 min using one lamp per plate. Plates were then sealed and incubated at room temperature for 18 h.

[0254] TR-FRET assay To determine HLA binders, we developed a TR-FRET assay that provides a signal only when B2M and HLA complexes are in close proximity. The assay uses an antibody against B2M that contains a TR-FRET donor (anti-B2M donor), and streptavidin that is labeled with a TR-FRET acceptor (streptavidin-allophycocyanin (SA)-acceptor), which binds to the biotinylated HLA component of the complex. If B2M and HLA form a complex together, the anti-B2M donor and the SA acceptor will be in close proximity in solution, resulting in a TR-FRET signal. In contrast, if the complex is disrupted, these reagents will be homogeneously distributed and there will be no TR-FRET signal.

[0255] A 384-well source plate (Echo Qualified 384-Well Polypropylene 2.0 Plus Microplate, Labcyte PPL-0200) containing UV-exchanged HLA / peptide complexes was incubated overnight at 37°C. The plate was equilibrated for 1 h at room temperature followed by centrifugation. Each well of the source plate was dispensed in quadruplicate in various volumes (160 nL, 80 nL, 40 nL and 20 nL) into backfilled wells of a destination plate (MAKO 1536-well white solid bottom, Aurora Microplate, Whitefish, Montana) using an automated acoustic dispenser (Echo 550, Labcyte) for a total volume of 4 μL / well (2 μL of diluted sample and 2 μL of reagent mixture) at final sample concentrations of 10, 5, 2.5 and 1.25 nM. Briefly, 1.8 μL / well of assay diluent (PBS, 0.5% BSA + 0.05% Tween 20 + 10 PPM Proclin, Genentech, Inc.) was added to a 1536-well destination plate by a Multidrop™ Combi nL Dispenser (Thermo Fisher Scientific, Waltham, MA). 200 nL of 5 μg / mL HLA complex sample was then dispensed from an Echo-qualified 384-well source plate (Beckman Coulter Life Sciences, Indianapolis, IN) to the destination plate by an Echo 550 acoustic liquid dispenser (Beckman Coulter Life Sciences, Indianapolis, IN).After centrifugation for 3 min, 2 μL of 2 nM master mix donor (Europium mouse anti-human β2-microglobulin (β2M), Biolegend (San Diego, CA), custom labeled by Perkin Elmer (Waltham, MA)) and 40 nM acceptor (SureLight allophycocyanin-conjugated streptavidin (SA-APC), PerkinElmer (Waltham, MA)) assay dilution was dispensed into each well of the destination plate using a Multidrop™ Combi nL dispenser. The destination plate was then centrifuged, incubated at room temperature for 1 h, and the TR-FRET signal was recorded using a PHERAstar FSX plate reader (BMG Labtech, Cary, NC) equipped with an HTRF module (Eu donor excitation 337 nm, Eu donor emission 615 nm; APC acceptor emission 660 / 20 nm, e.g. 665 nm). The raw signal of TR-FRET was expressed as the ratio of relative fluorescence units (RFU ratio = (RFU[665 nm] / RFU[615 nm] × 10. 4 ) The detection window was calculated by subtracting the background signal from the assay mix in the absence of HLA / peptide complexes. For binder ranking, a double normalization was applied to obtain %DeltaF: DeltaF(%)={(RFU[sample]-mean RFU[negative]) / mean RFU[negative]}×100. Robust Z-scores were calculated on a sample plate basis. For quality control of screening, a large-scale prepared positive control (A*02:01 with pp65) and a negative control (A*02:01 only) were added to designated wells of each sample plate. Screening acceptance was determined by the Z-factor calculated from the assay controls (Z-factor=1-{(3SD[positive]-3SD[negative]) / (mean[positive]-mean[negative])}. The Z-factor of the sample plate was >0.4 and was qualified for data processing.

[0256] Peptides were determined to be true binders based on their predicted binding affinity (Andreatta M, and Nielsen, M. Gapped sequence alignment using artificial neural networks: application to the MHC class I system. Bioinformatics (2016) Feb 15;32(4):511-517), calculated using a binding prediction algorithm. TR-FRET and 2D LC / MS assays were used to identify peptide binders and corresponding HLA alleles. Peptide sequences were run through the prediction algorithm and each sequence was assigned a percentile rank. If the percentile rank was 2 or lower, it was considered a binder.

[0257] Engineering HMy2.CR1 cell lines expressing monoallelic and polyantigen cassettes An effective HLA class I knockout cell population was generated by CRISPR / Cas9-mediated gene disruption of the endogenous HLA-C locus in HMy2.C1R cells. Wild-type HMy2.C1R cells were electroporated with gRNA (Synthego; HLA-C specific sgRNA sequence: TTCATCGCAGTGGGCTACG (SEQ ID NO: 74) (see FIG. 6A)) / Cas9 (Invitrogen) RNP using the Amaxa V system (program D-023). After an expansion period, cells were stained with anti-pan-HLA (W6 / 32) antibody and antigen-negative cells were enriched by FACS (see FIG. 6B) to generate a class I knockout population.

[0258] HLA-I null HMy2.C1R cells were stably engineered with a piggyback neoantigen expression plasmid system designed to co-express 47 shared cancer neoantigens and 7 HLA-A*02:01 control antigens. Briefly, neoantigen segments (approximately 25 amino acids each) were concatenated and converted into codon-optimized DNA segments (IDTs) with or without flexible linkers separating most of the neoantigen sequences. Polyantigen cassettes were synthesized and cloned into a piggyback transposon plasmid downstream of constitutive human EF1a and transcriptionally linked to an IRES-TagBFP2 reporter element. A separate hPGK promoter-driven puromycin resistance gene was included in the same vector for selection purposes. To generate cell lines stably expressing the 47 neoantigens of interest, class I knockout HMy2.C1R cells were electroporated using a NEON (Invitrogen) electroporation device. Piggyback co-delivery of piggyback plasmids (neo-antigen cassettes) containing 47mers with or without linkers was performed. Neo-antigen cassette-containing cells were enriched by culture in 1 μg / mL puromycin (Gibco) and further purified by FACS enrichment of tagBFP-positive cells. Two million C1R class I KO cells were resuspended in 120 buffer R. 3.0 μg of piggyback expression construct and 0.5 μg of piggyback transposase were added and electroporation was performed using 100 μl of Neon kit (buffer R, 1230V, 20 ms, 3 pulses). Poly-antigen expressing cells were selected by culture in 1 μg / ml puromycin (Gibco) and further purified by FACS enrichment of TagBFP2-positive population. Immediately after electroporation, cells were added to 5 ml of antibiotic-free medium in 6-well plates. Seven days after electroporation, 1 μg / ml puromycin was added. After 3 days in puromycin, cells were analyzed and then sorted for BFP positive cells.

[0259] HLA-expressing lentivirus was generated by co-transfecting the Ef1a-HLA expression construct with Delta8.9 and VSVG packaging plasmids into 293 cells using Lipofectamine 2000 (Invitrogen) (lipid:DNA=2:1). 72 hours after transfection, viral supernatants were harvested, filtered through 0.45 μM filters, and concentrated via LentiX concentrator reagent (Takara) according to the manufacturer's recommended protocol.

[0260] To generate monoallelic cell lines expressing neo-antigens, linker or linker-free 47mer-expressing class I knockout HMy2.C1R cells were transduced by spin infection. HLA-expressing cells (biotin-W6 / 32) were purified by magnetic bead-based enrichment (SA-MACS). Identification of HLA alleles was confirmed by barcode sequencing, and uniform expression of both HLA alleles and neo-antigen cassettes was confirmed by flow cytometry prior to analysis by mass spectrometry. Specifically, unique HLA-I allele ORFs, each with a distinct 19 bp DNA barcode, were cloned downstream of the human EF1a promoter (Genscript) in a custom modified pLenti6.3 backbone (ThermoFisher). Lentiviruses were generated by Lipofectamine 2000 (Invitrogen)-mediated co-transfection of HEK293T cells with individual lenti-HLA expression constructs and packaging plasmids. 72 hours after transfection, viral supernatants were harvested, filtered through 0.45 μM filters, and concentrated via LentiX concentrator reagent (Takara) according to the manufacturer's recommended protocol. Polyantigen-expressing HLA-I-null HMy2.C1R cells with or without linker were transduced with HLA-expressing vectors via spin infection (800 × g for 30 min at room temperature with 8 μg / ml polybrene). Transgenic HLA-expressing cells were then purified by magnetic bead-based enrichment (Biotin-W6 / 32 Biolegend / SA-MACS). Identification of HLA alleles was confirmed by barcode sequencing (amplicon primers: Fwd-CTCCCAGAGCCACCGTTACAC (SEQ ID NO: 192), Rev-GACTTAACGCGTCCTGGTTGC (SEQ ID NO: 193); sequencing primer: CTGGTTGCAGGCGTTTAGCGT; SEQ ID NO: 194) and uniform expression of both HLA alleles and polyantigen cassette was confirmed by flow cytometry (Figures 6B, 6F and 6G) ​​prior to analysis by mass spectrometry.

[0261] In addition to HMy2.C1R cells, similar results were detected by experiments using K562 cells.

[0262] Antibody Coupling and Crosslinking Pan-HLA class I specific antibody (clone W6 / 32) was coupled to Protein A resin packed in AssayMAP Bravo compatible large capacity cartridge (PA-W 25μL) (Agilent, part number G5496-60018). The coupled antibody was then cross-linked with 100mM dimethyl pimelimidate dihydrochloride (DMP) (Sigma-Aldrich, cat. no. D8388-25O MG) in 20mM sodium borate cross-linking buffer at pH 9.0 immediately after the end of the coupling step. Impurities in the cartridge were washed out with simultaneous dispensing of 200mM ethanolamine (Sigma-Aldrich, cat. E9508-100ML) pH 8.0 and deionized H2O. Flow rates and other parameters for affinity purification applications in AssayMAP Bravo software (VWorks) were used with default settings. Antibody-crosslinked Protein A cartridges were stored in racks filled with TBS / 0.025% sodium azide, sealed with parafilm, and kept at 4°C.

[0263] Affinity purification of HLA-peptide complexes The engineered single allele cell pellets (500 million cells / sample) were lysed at 4°C in 1% CHAPS (Roche Diagnostics, cat. no. 10810126001) lysis buffer pH 8.0 containing 20 mM TRIS, 150 mM NaCl, 1 tablet of cOmplete Protease Inhibitor Cocktail (Roche, cat. 4693159001) per 10 mL of lysis buffer, and 0.2 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma). The cell pellets were lysed in 2 mL of lysis buffer by vortexing every 5 min for a total of 20 min at 4°C. The lysates were then transferred to LoBind tubes and centrifuged at 20,000 g for 20 min at 4°C. The supernatant was then carefully transferred to a 0.45 μm polyethersulfone filter (Pall, cat. MCPM45C68). The samples were then centrifuged at 7000g for 30 min at 4°C. The filtrate of each sample was carefully transferred to an AssayMAP Bravo compatible 96-well deep-well plate, without disturbing any particulates that may have settled to the bottom of the conical tube. The deep-well plate containing the HLA-peptide complexes was transferred to the AssayMAP Bravo sample loading platform for automated dispensing of the samples with the W6 / 32 cross-linked Protein A cartridge. The cartridge was primed and equilibrated with 20 mM Tris pH 8.0 and 150 mM NaCl in water. Sample impurities in the cartridge were washed out by automated dispensing of 20 mM Tris pH 8.0 and 400 mM NaCl in water, followed by a final wash with 20 mM Tris pH 8.0 in water. The antibody-bound HLA-peptide complexes were eluted with 0.1 M acetic acid in 0.1% trifluoroacetic acid (TFA). The flow rate and wash cycles were used at default settings.

[0264] The eluate was transferred to an ultra-low binding ProteoSave autosampler vial (AMR Incorporated catalog PSVial100) and dried in a speed vacuum. The dried sample was then reconstituted in 100 μL of 20 mM HEPES pH 8.0, reduced with 5 mM dithiothreitol (DTT) (Thermofisher, cat. A39255) at 65 °C for 30 min in the dark, and alkylated with 15 mM iodoacetamide (IAA) (Sigma, cat. I1149-5G) at room temperature for 30 min in the dark. The sample was then acidified with 50% TFA to reduce the pH to approximately 3.0, vortexed, and centrifuged at 14,000 g for 5 min at room temperature to pellet debris. Samples were then carefully transferred to a 96-well PCR, Full Skirt, PolyPro plate (Eppendorf, part number 30129300) and loaded onto the AssayMAP Bravo platform for final cleanup before injection into the mass spectrometer. Four C18 cartridges (Agilent, part number 5190-6532) were used per sample. Cartridges were primed with 80% acetonitrile (ACN) 0.1% TFA and equilibrated with 0.1% TFA. Samples were then loaded onto the cartridge, washed with 0.1% TFA, and eluted with 30% ACN 0.1% TFA. After drying the samples in a speed vacuum, the samples were reconstituted in 6 μL of 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, catalog number 25003).

[0265] Untargeted mass spectrometry and database searching One-third of each sample was loaded onto a 25 cm × 75 μm ID, 1.6 μm C18 IonOpticks Aurora Series column (IonOpticks, part number AUR2-25075C18A) on a Thermo UltiMate 3000 high performance liquid chromatography (HPLC) system (Thermo Fisher Scientific) at a flow rate of 400 nL / min. Peptides were separated with a 90 min gradient of 2% to 35% or 40% Buffer B (98% ACN, 2% HO and 0.1% FA) at a flow rate of 300 nL / min. The gradient was further increased to 75% Buffer B for 5 min and 90% Buffer B for 4 min at the same flow rate, followed by a final equilibration with 98% Buffer A (98% HO, 2% ACN and 0.1% FA) and 2% Buffer B for 10 min at a flow rate of 400 nL / min.

[0266] Peptide mass spectra were analyzed using a MS of 240,000. 1 Acquisition was performed using either an Orbitrap Fusion Lumos or Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher Scientific) with Orbitrap resolution and MS / MS fragmentation of precursor ions by collision-induced dissociation (CID), followed by 15000 MS 2Spectra were acquired at Orbitrap resolution. All data-dependent acquisition (DDA) spectral raw files were searched in PEAKSOnline (Bioinformatics Solutions Inc.) against the Uniprot-derived Homo sapiens human proteome (downloaded October 3, 2019) containing the sequence of blue fluorescent protein (BFP) along with the added concatenated sequence flanked by 13mer sequences of the 47 most common mutations on either end of each mutation with or without a stretch of glycine and serine residues (GS) linkers. Within PEAKSOnline, enzyme specificity was set as none, CID was selected as activation method, and Orbitrap (Orbi-Orbi) was selected as instrument parameter, as HLA-peptides are non-tryptic. In-depth de novo-assisted database searching and quantification were performed using a precursor mass error tolerance of 15 parts per million (ppm), a fragment mass error tolerance of 0.02 Da, and a missed cleavage allowance of 3. Carbamidomethylation (Cys+57.02) was set as a fixed modification, and deamidation (Asn+0.98, Gln+0.98) and oxidation (Met+15.99) were set as variable post-translational modifications (PTMs), allowing up to three variable PTMs per peptide. Additional reporting filters included a peptide spectrum match (PSM) false discovery rate (FDR) of 1%, protein-10LgPs ≥ 20, and a de novo-only amino acid residue average local confidence (ALC) of 50%. For label-free analysis, a new group was created for each sample and run-to-run matching was performed using default parameters except that the retention time (RT) shift tolerance was set to 4 min and the base sample was selected as "average." Output csv files were exported and further analyzed in R.

[0267] Targeted mass spectrometry Absolute Quantification (AQUA) synthetic heavy peptides (8-11 mer) (Elim Biopharm) for all 47 mutation-derived neoantigens with TR-FRET RZ score ≥ 5 (i.e., robust z-score ≥ 5) or predicted NetMHC% rank ≤ 2 (for a subset of mutations) were reconstituted in 30% ACN 0.1% FA. For peptides that were not readily soluble in 30% ACN 0.1% FA, dimethyl sulfoxide (DMSO) was added. For each AQUA peptide for which an allele-specific master mix was made at 25 pmol / peptide, a working solution of 25 μM was made. Peptides were reduced / alkylated and purified on a C18 cartridge on an AssayMAP Bravo. After drying, peptides were reconstituted in 0.1% FA 0.05% HFBA at 100 fmol / peptide. For each allele-specific assay, the intact modified mass was calculated for each peptide in that assay using TomahaqCompanion software (Rose et al., JProteome Res. 2019;18(2):594-605), which was then used to build an inclusion list mass spectrometry method for a scouting run to obtain the RT and mass-to-charge ratio (m / z) of each target peptide. 1 μL of each assay was injected onto an IonOpticks C18 column and sprayed into the mass spectrometer for a 125 min run as above, and the raw files were imported and analyzed in Skyline (64-bit, 19.1.0.193) to select the appropriate charge for each peptide. A mass list table was built for each assay, creating 4 min RT windows on either side of the RT for each target peptide, which was then imported into the Xcalibur instrument method application and saved as the allele-specific parallel reaction monitoring (PRM) method. For both the Fusion Lumos and Eclipse instruments, MS 1 were acquired with an Orbitrap resolution of 240000 and a maximum injection time of 50 ms, followed by a quadrupole isolation window of 1.2 m / z, CID fragmentation of the parent ion, a maximum injection time of 300 ms, and MS 2 was acquired at an Orbitrap resolution of 60,000. For the Eclipse acquisition, MS 1and M.S. 2 AGC targets were set at 250% and 400%, respectively. One-third of each single-allele sample was spiked with 100 fmol of the corresponding AQUA master mix and injected into the mass spectrometer using the same HPLC setup as above. Raw PRM data were imported and analyzed in Skyline in an allele-specific manner. The ratios of light peptides to their heavy counterparts across samples were exported as csv files and further analyzed in R. For each neoepitope, background signals detected in the analysis of synthetic peptides only were subtracted from the endogenous peptide signal before the calculation of the final attomole amounts.

[0268] For copy number representation of KRAS wild type (WT) and G12C / D / V mutants, dox-inducible C1R A*11:01 KRAS full-length (FL) cell line and C1R A*11:01 47-neo sample recombinant heavy isotope-encoded peptide MHC (hipMHC) (Stopfer et al., Multiplexed relative and absolute quantitative immunopeptidomics reveals MHC I repertoire alterations induced by CDK4 / 6 inhibition. Nat Commun. 2020;11(1):2760) monomers were generated in-house for the A*11:01 allele and KRAS WT / G12C / D / V (9-mer and 10-mer per target). These monomers were spiked at 1 pmol per 500 million cell lysates (KRAS FL sample) or 4.7 pmol per 500 million cell lysates (47-neo sample) immediately prior to the pan HLA class I affinity purification step. Similar to the shared neoantigen sample, an encapsulation and 125 min PRM method was developed for the A*11:01 KRAS FL sample, in which only 8 AQUA peptides were in the hipMHC assay mix. Raw data were analyzed as above with the additional step of calculating antigen copies per cell taking into account the on-column AQUA peptide concentration and input cell number.

[0269] For absolute quantification of total KRAS WT and G12C / D / V protein in dox-inducible C1R A*11:01 KRAS FL cell line, 20 million cells per sample were lysed in 1 mL of 8 M urea lysis buffer 20 mM HEPES pH 8.0. Yeast digests (25 μg) and 50 μg from each sample were spiked with 2.5 pmol KRAS Quantitative Concatamer (QconCAT) polypeptide (Polyquant), generated by ligation of heavy WT and selected mutant RAS tryptic proteotypic peptides. Samples were reduced with 5 mM DTT for 10 min in the dark at 56 °C with shaking and alkylated with 15 mM IAA for 15 min in the dark at RT. The urea concentration in control and sample tubes was reduced to approximately 2 M with 20 mM HEPES pH 8.0 and digested with 1 μg sequencing grade trypsin (Promega) overnight at 37 °C in a nutator. The next day, trypsinization was quenched with 50% TFA and samples were washed with a C18 cartridge, dried and reconstituted at 100 fmol / μL (yeast digest control) or 50 fmol / μL (samples) in 0.1% FA. Digested samples were analyzed on a Fusion Lumos mass spectrometer using a 65-minute PRM method specific for RAS tryptic peptides present on the QconCAT polypeptide. Data was analyzed in Skyline and absolute quantification of each of the targeted KRAS peptides was calculated.

[0270] TCR discovery 376 predicted and mass spectrometry identified neoantigen-derived peptides were synthesized (GenScript) and each was added to 6 of 11 peptide pools such that each neoepitope (or group of similar neoepitopes) accounted for a unique combination in the 6 pools (Klinger et al. 2015 PLoS One. 10(10):e0141561). CD8+ T cells were isolated from leukopaks of healthy human donors (StemCell) and expanded on anti-CD3 coated plates (+anti-CD28 / IL-2, BioLegend) or in the presence of matched donor-derived monocyte-derived dendritic cells (Wolfl and Greenberg. 2014 Nat Protoc. 9(4):950-966) and a pool of all 376 neoepitopes. On days 10–15, T cells were harvested, supplemented with one of 11 neoepitope pools, incubated for 8–14 h, enriched (Miltenyi), and then sorted using an anti-CD137 antibody (BioLegend). Sorted cells were then subjected to either immunoSEQ or pairSEQ (Adaptive Biotechnologies) to identify TCRβ sequences exhibiting neoepitope-specific responsiveness and to associate TCRβ in parallel with TCRα sequences, respectively. TCR sequences were encoded in a pcDNA vector as a single open reading frame, in frame with the complete TCRβ sequence followed by a RAKR motif and the porcine teschovirus 2a cleavage peptide followed by the complete TCRA sequence. The pcDNA vector encoding the TCR was then used as a template to generate in vitro transcribed RNA (ivtRNA; mMessage mMachine, ThermoFisher) encoding the TCR for electroporation of primary human T cells.

[0271] TCR reactivity assay CD8+ cells were enriched from human PBMCs using the EasySep Human CD8+T Cell Isolation Kit (Stemcell) and stimulated with 5 μg / mL Ultra-LEAF anti-human CD3 (Biolegend) and 2.5 μg / mL Ultra-LEAF anti-human CD28 (Biolegend). Cells were cultured for 6 days in the presence of 20 ng / mL recombinant human IL-2. Human expanded CD8+T cells were transfected with FLT3-p.D835Y-specific or PIK3CA-p.E545K-specific TCR RNA using the Lonza 4D-Nucleofector, P3 Primary Cell 4D-nucleofector Kit, program EO-115 (Lonza). RNA was purchased from Trilink or in vitro transcribed. FLT3-p.D835Y-specific TCRs were co-cultured overnight with HLA-A*02:01-expressing T2 cells pulsed with YIMSDSNYV (SEQ ID NO: 116) or HLA-A*02:01-expressing K562 cells transfected with constructs encoding mutant or wild-type sequences. K562 cells were transfected using the Lonza 4D-Nucleofector, SF cell line 4D-nucleofector kit, program FF-120 (Lonza). To determine specific cell lysis, equal mixtures of transfected HLA-A*02:01+K562 cells and non-transfected cellTrace FarRed (Thermofisher)-labeled HLA-A*02:01+K562 cells were co-cultured overnight with T cells at an E:T ratio of 2:1. % specific cell lysis = (P モックトランスフェクトT細胞 -P TCRトランスフェクトT細胞 ) / (P mockトランスフェクトT細胞 )) × 100, where P is the ratio of transfected K562 targets to non-transfected K562 cells measured by flow cytometry. CD137 expression on CD8+ T cells was assessed after overnight co-culture with anti-CD137 PE antibody (BD Biosciences). TNF and IFNg levels were determined using Cytometric Bead Array (BD Biosciences).

[0272] PIK3CA-p.E545K-specific TCRs were co-cultured overnight with HLA-A*11:01-expressing K562 cells pulsed with STRDPLSEITK (SEQ ID NO: 169) or transfected with constructs encoding mutant or wild-type sequences. An equal mixture of cellTrace Far Red-labeled HLA-A*11:01+K562 cells was added to each well. T cell responses to PIK3CA-presenting K562 cells were evaluated as described above.

[0273] Results and Discussion Clinical genomics analysis of shared cancer neoantigens The schematic highlighted in Figure 1A provides a high-level overview of the workflow developed to enable neo-epitope discovery in this study. The first step in this process was to perform a clinical genomics analysis of all known neo-antigens to identify neo-antigens with high value as clinical targets. In this exemplary analysis, the most common recurrent point mutations were identified across cancer types from large total tumor and normal sequencing data (see, e.g., Chang et al., Accelerating Discovery of Functional Mutant Alleles in Cancer. Cancer Discov. 2018;8(2):174-183) and filtered at a case prevalence per indication of 2%. Gene fusions were excluded due to the high diversity of their breakpoints and resulting coding sequences, resulting in a list of 37 shared cancer neo-antigens (Table 3). Separately, the most common HLA-I alleles were identified across human populations and filtered at a carrier frequency of 10%. It was also confirmed that these alleles are present at comparable frequencies in patients from The Cancer Genome Atlas (TCGA). This further filtering resulted in a list of 15 HLA alleles. The co-prevalence of these shared cancer neo-antigens and HLA-I alleles in the TCGA data was analyzed to ensure biased co-representation of recurrent mutated genes and common HLA-I variants was prevented. The co-prevalence of each shared neo-antigen was found to be consistent with the expected value calculated as the product of the individual neo-antigen and HLA-I allele prevalences. Together, these 37 neo-antigens and 15 HLA alleles provided the basis for the development of the current platform.

[0274] Table 3. Exemplary shared neoantigens TIFF2024541968000004.tif182163TIFF2024541968000005.tif238163

[0275] High-throughput TR-FRET analysis of neoepitope exchange and neoepitope-HLA stability T cell-mediated neoantigen-specific therapy requires neoepitopes and HLA molecules to form stable complexes that can be presented on the surface of tumor cells. Although computational algorithms can predict whether a neoepitope will bind to a particular HLA, experimental evidence increases confidence that a potential neoepitope was not missed due to insufficient predictive models (e.g., not well trained for a particular allele or biased against a particular amino acid residue). The next step in the neoepitope-HLA discovery process was to apply a high-throughput (HTP) neoepitope binding screen across the 15 most dominant HLA alleles for all neoepitopes derived from the prioritized list of 48 neoantigens, resulting in a total of 27,360 neoepitope-HLA combinations that required screening. For these purposes, we developed a custom high-throughput (HTP) TR-FRET binding assay to use conditional HLA complexes. A schematic of the assay is shown in Figure 1B. In an exemplary experiment, a subset of 37 common shared cancer neo-antigens identified by the clinical genomic analysis described above (Table 3), as well as 11 additional antigens, were tested for binding. With regard to HLA allele coverage, of the 15 HLA alleles identified in the in silico screen, only 15 were available in the appropriate conditional HLA complex format required for the TR-FRET assay (Figure 1B). As a result, the final TR-FRET assay was used to probe stable binding of neo-epitopes from 47 shared cancer neo-antigens across the 15 most prevalent HLA alleles (Table 4), resulting in the characterization of 24,149 neo-epitope-HLA complexes.

[0276] Table 4: Exemplary 15 HLA alleles TIFF2024541968000006.tif32155

[0277] The TR-FRET assay utilized a previously described conditional HLA ligand, a peptide containing a UV-cleavable unnatural amino acid, to create conditional HLA complexes (HLA alpha chain and beta-2-microglobulin [B2M]) for 15 HLA alleles (Darwish et al., 2021). In the TR-FRET assay, the conditional HLA complexes were incubated with a 100-fold molar excess of the neoepitope of interest and exposed to UV light for 25 min, which was expected to cleave the conditional ligand and convert the peptide from a stable high affinity "binder" to an unstable binder that dissociates from the HLA groove. In the presence of the bound neoepitope, peptide exchange occurred, stabilizing the HLA complex (i.e., the conditional ligand, HLA alpha chain and beta-2-microglobulin [B2M]; Figure 1B, top). In the presence of the non-bound neoepitope, peptide exchange did not occur and the HLA complex dissociated (Figure 1B, bottom). These two distinct outcomes were monitored using a simple TR-FRET assay in which the TR-FRET donor (Europium) was conjugated to an anti-B2M antibody and the TR-FRET acceptor was conjugated to streptavidin, which binds to biotinylated HLA alpha chains. In these assays, a TR-FRET signal results only if the HLA complex remains intact due to the presence of a bound neoepitope. To ensure that the identified binders form stable complexes at physiological temperatures, samples were heated at 37 °C for 24 h prior to analysis. The TR-FRET signal was quantified based on the ratio of relative fluorescence units, and the signals were subjected to double normalization to generate a robust Z-score (RZ-score) for neoepitope comparison and ranking as described in the Materials and Methods section herein. In the current analysis, any neoepitope-HLA combination with an RZ score of 5 or higher was considered to be a "stable binder," but this cutoff resulted in the identification of 587 unique neoepitope-HLA pairs. This cutoff identified the unique neoepitope-HLA pairs shown in Table 5.To compare the results of the TR-FRET assay with computational prediction methods, NetMHCpan 4.0 (aka NetMHC) was used to predict neoepitope presentation for 24,149 neoepitope-HLA pairs assayed by TR-FRET. For this analysis, the "eluted ligand" percentile rank (%Rank) values ​​were used to determine whether a neoepitope was a "binder" (e.g., %Rank ≤ 2), resulting in the identification of 408 unique predicted neoepitope-HLA pairs.

[0278] (Table 5) The targeting assay contained a mixture of peptides that demonstrated in vitro binding and those predicted to bind. TIFF2024541968000007.tif94155

[0279] A comparison of TR-FRET robust Z scores with inverse percentile rank scores is shown in Figure 2A and Figure 2E. Robust Z scores with values ​​above 5 were considered binders (above the black dotted line), and as shown in Figure 2A, there was a strong correlation between the NetMHC4 binding predictions (above the dotted line) and the TR-FRET analysis, both of which identified the same two KRAS G12R neoepitopes as stable binders to B*07:02 (Figure 2E). This correlation was not consistently observed across all neoantigen-allele combinations. As TR-FRET generally identified more stable neoepitope-HLA pairs, there were some cases where NetMHC did not predict the same binding events identified by TR-FRET. For example, in a comparative analysis of the ESR K303R neoepitope across the B*07:02 allele, the TR-FRET assay identified nine stable binding neoepitopes, while NetMHC 4.0 predicted only two of these binders (Figure 2B and Figure 2F). When binder and non-binder neoepitopes were distinguished using the criteria described above (robust Z-score >5 and percentile rank <2), the % binders identified by TR-FRET and NetMHCpan 4.0 were 2.45% and 1.72%, respectively, of all neoepitope-HLA combinations tested. Figure 2C shows the distribution of % binders across different alleles for both TR-FRET and NetMHC 4.0 analyses, with NetMHC 4.0 on average resulting in a lower percentage of binders compared to the TR-FRET analysis. FIG. 2D also shows that TR-FRET generally identified more stable binders compared to NetMHC, especially for HLA-A and HLA-B alleles, when measured as a percentage of all potential neoepitope-HLA complexes.

[0280] To better understand the overall correlation between NetMHC 4.0 predictions and TR-FRET measurements, we compared the % agreement in classifying binders and non-binders across the two methods (Figure 3A). The % agreement between these methods across all alleles was very strong, ranging from 95.1 to 98.6% depending on the allele (Figure 3A). To further evaluate the correlation between these two methods, the overlap was assessed for neoepitopes classified as binders by the two methods. In contrast to when all neoepitopes were compared (binders + non-binders), the overlap between the two methods was significantly reduced when only binder identification was considered (Figure 3E), with the best performing alleles being around 40-60% agreement between the two methods and some alleles being as low as 10% (see, for example, only 2.04%-40% agreement in Figure 3D). Agreement was generally higher for HLA-A and HLA-B alleles compared to HLA-C alleles (Figure 3D). However, A*24:02 showed the lowest concordance at 2.04% (Figure 3E). When this same analysis was performed considering only non-binders, there was very strong concordance ranging from 94.1 to 98.4% (Figure 3C). These results demonstrate that while both methods generally concord non-binding events, positive interactions are seen with minimal overlap. This demonstrates the ability to combine both approaches to identify and prioritize unique neoepitope-HLA pairs for further characterization. These results were not surprising as the majority of neoepitopes were classified as non-binders.

[0281] To better visualize the complementarity of binder identification by TR-FRET and NetMHC, the TR-FRET RZ score and NetMHC % rank were plotted for all candidate neoepitope-HLA pairs (Figure 10). Approximately 0.63% of all candidate neoepitope-HLA pairs were found to be binders by both methods. Looking at the data at the allele level, the matches varied from 0.06% to 1.49% of all potential neoepitope-HLA pairs (Figures 10 and 11). Interestingly, each method identified approximately the same percentage of additional binding events for neoepitope-HLA pairs, 1.06% for NetMHC and 1.81% for TR-FRET, demonstrating that each method has the potential to identify unique binding combinations (Figure 10).

[0282] To more clearly visualize the discrepant binders observed by the TR-FRET and NetMHC analyses, heatmaps were generated to display the number of binders for each HLA allele and neo-antigen combination for the TR-FRET (Figure 4A) and NetMHC (Figure 4B) analyses. A similar experiment testing 47 candidate neo-antigens (i.e., not including the GTF2I L424H neo-antigen) yields similar results (Figure 4C and Figure 4D). Based on this analysis, there are clear overlapping regions as well as significant gaps between the different analyses. For example, TR-FRET identified 11 epitopes as binders for EGFR C797S and A*01:01, whereas NetMHC predicted only three binding epitopes (Figure 4C and Figure 4D). Interestingly, these combined results suggest that both assays can reliably distinguish non-binders with high correlation, but this drops off significantly when the analysis is performed on binders. These findings also provide further evidence of the value added by including biochemical binding screens in addition to predictive algorithms when selecting neoepitopes for inclusion in targeted mass spectrometry to measure neoepitope presentation. These findings highlight the power of high-throughput biochemical assays to identify potentially complementary sets of neoepitope-HLA pairs and suggest that using both methods together may result in more comprehensive neoepitope discovery.

[0283] Cell engineering - Generation of HLA-I monoallelic cell lines co-expressing 47 shared cancer neoantigens Despite the observed peptide-HLA stabilization in vitro, expression and processing of mutant proteins may not result in presentation of the neoepitope in a cellular context (Jappe et al., 2018 Immunology 154(3):407-417; Garstka et al., 2015 Proc Natl Acad Sci USA. 112(5):1505-1510). For this reason, validation of candidate neoepitopes typically requires the readout of gene expression of the target neoantigen followed by association with surface-bound HLA. The process of neoantigen-HLA discovery has been enhanced by the use of engineered "HLA monoallelic" cell lines, but these rely heavily on endogenous variant protein expression or expression of a relatively small number of variant transgenes and are therefore throughput-limited (Wang et al., Direct Detection and Quantification of Neoantigens. Cancer Immunol Res. 2019;7(11):1748-1754; Bear et al., 2021 Nat Commun 12(1):4365; Abelin et al., Mass Spectrometry Profiling of HLA-Associated Peptidomes in Mono-allelic Cells Enables More Accurate Epitope Prediction. Immunity 2017;46(2):315-326).

[0284] Following detection of peptide-HLA complexes by high-throughput TR-FRET binding assays, these identified epitopes were validated in a cellular context. Simultaneous encoding of all 47 candidate neo-antigens in a single HLA-null cell line dramatically improved the throughput of cell line generation, and subsequent TR-FRET validation identified neo-epitope-HLA pairs by targeted mass spectrometry. Since no cell line expresses all 47 neo-antigens, a piggyback cassette was generated to contain a concatenated neo-antigen expression array (Figure 5A). Because the local sequence context could potentially affect neo-antigen processing, vectors were used in which the neo-antigens were either concatenated (no linker) or separated by a g / s-enriched linker sequence (linker). Several viral peptides known to be presented by A*02:01 at the C-terminus were used as controls to confirm that the entire polypeptide sequence was efficiently expressed.

[0285] To validate the expression neo-antigen strategy, a series of piggyback neo-antigen expression constructs were introduced into a K562 cell line stably expressing the A*02:01 allele (Figure 5A and Figure 5B). HLA IP+LC-MS was used to detect the presentation of the expected viral control peptide (Figure 5C). Although some variation was observed between linker / no linker cassettes in neo-antigen levels, no clear trends emerged indicating which expression strategy was superior. Furthermore, there was no significant difference in control peptide detection between lines expressing 23, 24 or 47 neo-antigens. Based on these data, the 47mer neo-antigen construct was selected for further experiments in the context of both linker and no linker sequences.

[0286] The K562 cell line has historically been used as a model cell line for HLA antigen presentation studies due to its low endogenous HLA expression levels. However, this line expresses relatively low, but detectable levels of HLA-C*05:01 and C*03:04. Furthermore, HLA expression can be upregulated in response to certain stimuli. Preliminary studies have revealed the presence of putative HLA-C*05:01 peptides in an HLA-A*02:01 "monallelic" cell line, indicating that K562 may not be an ideal model system for the assay.

[0287] In another exemplary experiment, the HMy2.CIR lymphoblastoid cell line (aka C1R) was chosen as a model system because it is a robust, fast-growing line that has little to no expression of its endogenous HLA-A or B proteins but maintains ease of handling and robust expression of suspension cells in culture (Figure 6B) (for the HLA-C*04:01 allele, see Cleary et al., 2019 Hum Immunol 80(7):449-460). Using a CRISPR / Cas9 knockout strategy, the remaining HLA-C allele (HLA-C*04:01) was disrupted from HMy2.C1R cells (Figure 6A), generating an HLA-class I knockout (class I KO) HMy2.C1R population (Figure 6B and Figure 6C). The resulting HLA-null (C1R HLAnull ) population was enriched by cell surface staining using pan-HLA-I antibodies and fluorescence-activated cell sorting (FACS). There is precedence in the literature, suggesting expression of B*35:03 in C1R cell lines (Schittenhelm et al., A comprehensive analysis of constitutive naturally processed and presented HLA-C*04:01(Cw4)-specific peptides. Tissue Antigens. 2014;83(3):174-9). However, in this study, the obtained C1R HLAnullNo evidence of the B*35:03 motif was observed in immunopeptide analysis of cells. To generate the desired panel of monoallelic cell lines expressing neoantigens, class I KO populations were first generated to stably express the linker or no linker piggyback neoantigen cassette at all. The 17 HLA variants of interest were lentivirally transduced into these parental cells to generate a total of 34 populations for further analysis (Figure 6D). A summary of the 8-11mer unique peptides per allele for the 17 HLA variants of interest is shown in Figure 7.

[0288] C1R HLAnull Following generation of cell populations, synthesis and delivery of piggyBac expression vectors allowed for stable transgene integration. In an exemplary experiment, shown in Figure 6E, two foundational cell lines were generated, each co-expressing all 47 prioritized neo-antigens in a different configuration, to test whether local sequence context could affect antigen processing (Gomez-Perosanz et al., Identification of CD8 + T cell epitopes through proteasome cleavage site predictions. BMC Bioinformatics. 2020;21(Suppl 17):484). These two cell lines differ by the presence ("linker") or absence ("no linker") of a short amino acid linker sequence between most neo-antigen segments within the polyantigen cassette, and are hereafter referred to as linker and non-linker, respectively. Transgene-positive C1R HLAnull To select cells, a separate TagBFP2 (BFP) marker was used to enrich for stable linker and no-linker cell populations. 15 HLA alleles (Table 4) were then cloned into the linker and non-linker neoantigen-expressing C1R HLAnullHLA-I monoallelic cells were generated by introducing them as individual transgenes via stable lentiviral transduction of cell lines, and 30 total cell populations were obtained for further analysis. HLA expression was confirmed by cell surface staining with a pan-HLA antibody (Figure 6F and Figure 6G). To verify the functionality of these polyantigen cassettes, the linker and linkerless neo-antigen constructs contained a set of control antigens with epitopes known to be presented by A*02:01. HLA immunopeptidomics confirmed the presence of these peptides in both linker and linkerless HLA-A*02:01 engineered cells (Figure 6H).

[0289] In addition to HMy2.C1R cells, similar results were detected by experiments using K562 cells.

[0290] Engineered polyantigen cassettes enhance neoepitope presentation One potential concern with the above approach was that epitopes derived from constructs containing 47 concatenated neoantigens may not reflect epitopes derived from full-length mutant proteins. This was further investigated in the context of KRAS due to the recent description of A*11:01-restricted 9-mer and 10-mer neoepitopes detected by targeted proteomics assays (Bear et al., 2021 Nat Commun 12(1):4365). To this end, three C1R mice were transfected to express HLA-A*11:01 and doxycycline (dox)-inducible full-length, wild-type, G12C, G12D or G12V mutant KRAS proteins. HLAnull Cell lines were developed and neoepitope presentation from these cell lines was then compared to presentation from a cell line expressing a linker-less variant of the polyantigen cassette.

[0291] Expression of mutant proteins was confirmed by a whole-cell targeted proteomics assay that included a peptide capable of detecting total KRAS as well as three unique peptides that measured individual KRAS mutants (Figure 12A). This analysis validated dox-induced overexpression of KRAS alleles by demonstrating an increase in total KRAS detected upon addition of dox to the culture medium (Figure 12A). Note that little to no signal was seen at steady-state protein levels for these mutant peptides in cell lines containing the polyantigen cassette.

[0292] We then used targeted immunopeptidic assays to quantify the presentation levels of previously identified 9-mer and 10-mer KRAS epitopes in the same cell lines as above (Figure 12B). For cell lines containing full-length mutant proteins, induction of neoepitope presentation was observed for both the G12V epitope and the G12D 10-mer epitope (Figure 12B). Weak signals were detected for the G12C 9-mer epitope in both control and dox-treated cell lines. This may have been due to leaky / basal promoter activity, as weak signals for G12C were also detected at the protein level in both conditions (Figures 12A and 12B). Interestingly, all KRAS mutant 9-mer and 10-mer epitopes were detected in cell lines expressing polyantigen cassettes. Furthermore, polyantigen-modified cell lines also had higher absolute copy numbers per cell of KRAS mutant epitopes compared to cells expressing full-length proteins (Figure 12B). Combined with the lack of detection of mutant KRAS peptides at the protein level (Figure 12A), these results suggested that the protein product of the polyantigen cassette was unstable and likely degraded efficiently such that epitope presentation was enhanced. This effect has been previously demonstrated in systems that use induced proteolysis to increase the presentation of epitopes derived from degraded proteins (Moser et al., 2018 Front Immunol. 8:1920; Jensen et al. 2018 Front Immunol. 9:2697). Thus, monoallelic cells containing the polyantigen cassette provided both a higher throughput and more sensitive system for discovering neoepitopes from shared cancer neoantigens.

[0293] Detection of neoepitope presentation on cell lines engineered to present shared neoantigens In one exemplary experiment, after the generation of monoallelic cell lines expressing polyantigen cassettes with or without linkers, peptide presentation was verified by HLA immunoprecipitation followed by both non-targeted and targeted mass spectrometry (MS) analysis. Non-targeted MS analysis allowed unbiased identification of peptides from the entire immunopeptidome, including peptides derived from our neo-antigen constructs, but has limited sensitivity of detection. Targeted analysis allowed sensitive detection of peptides presented at low copy numbers per cell, but was restricted to peptides identified as binders within the TR-FRET assay, as well as select peptides predicted to bind by NetMHC.

[0294] non-targeted MS Untargeted MS data identified 852 to 7342 unique 8-11mer peptides across all samples, with the greatest number of peptides identified in HLA-A alleles and the least number of peptides identified in HLA-C alleles (Figure 7). For each allele, sequence motifs were created to demonstrate that the presented peptides fit predicted motifs derived from previous publications. Untargeted analysis found 18 neoepitope-HLA pairs from 15 shared neoantigen-HLA pairs across four HLA alleles (Figure 8A), representing approximately 3.455% of the neoepitope-HLA pairs predicted by NetMHC and approximately 3.005% of the neoepitope-HLA pairs identified within the TR-FRET assay. Interestingly, approximately 77.8% of these peptides exhibited a NetMHC presented prediction score ≤ 2, and 83.3% of these binders had a measured robust Z-score ≥ 5 (Figure 8B).

[0295] In addition to the neoantigen-derived epitope peptides, the non-targeted analysis allowed the detection of peptides derived from the non-mutation-containing parts of each neoantigen 27mer region, as well as from the junction region of the 49mer neoantigen constructs connecting consecutive 27mers. We found junction peptides from non-linker and linker constructs. The low number of peptides from the linker constructs could possibly be attributed to the fact that the linkers contained G and S amino acids, which are not typically anchor residues. Finally, viral control peptides as well as peptides derived from BFP were also identified, indicating that the neoantigen constructs were expressed in each of the cell lines tested.

[0296] targeted MS Although untargeted analysis allows for the identification of thousands of peptides, challenges lie in the stochastic sampling of peptides for identification and the need to detect intact peptide species within a survey scan that limits the detection of peptides presented at low levels. Conversely, targeted MS analysis dedicates the entire duty cycle of an instrument to the analysis of a small number of peptides (e.g., about 100), improving data reproducibility and detection of peptides presented at low copy numbers per cell. Due to the cost of synthesizing heavy amino acid labeled standard peptides, a challenge in targeted proteomics is the decision of which peptides to synthesize for MS analysis. Within the single-allelic system described herein, synthesizing all possible 8-11 mer peptides for our 48 neo-antigens would require the synthesis of approximately 1,800 different peptides. To limit the number of peptides for analysis, only prioritized peptides were synthesized, including peptides that exhibited a robust Z-score >5 within the TR-FRET assay described above. As a control, additional peptides were synthesized from a subset of mutations that had a predicted NetMHC presentation score of less than 2% but were not found as binders in the TR-FRET assay. Taken together, peptides were analyzed across 17 alleles in each individual assay, including peptides analyzed by targeted analysis.

[0297] Following targeted analysis, 81 neoepitope-HLA pairs were identified. Of these, all but one epitope (the BRAF epitope) was also identified in the non-targeted analysis. Interestingly, neoepitope-HLA pairs identified by targeted analysis had increased presentation scores by NetMHC and only slightly decreased robust Z-scores in our TR-FRET analysis (Figure 9). One advantage of performing targeted analysis is the ability to calculate absolute levels of peptides, demonstrating that median levels of epitope presentation ranged from approximately 50 amol to 200 fmol. Importantly, absolute quantification could be compared across independent replicates of immunopeptidase analysis (i.e., cell culture, MHC-IP and MS analysis), and comparison of replicates demonstrated a general concordance of absolute amounts of peptides presented. As with the control peptide analysis, there is no clear trend correlating presentation levels with the presence of a linker within the neoantigen construct.

[0298] Absolute quantification within targeted proteomics is made possible by the inclusion of synthetic peptides containing isotopically heavy amino acids; however, synthesis of all possible HLA peptides from the 48 shared neoantigens was impractical due to the cost of such reagents.

[0299] In another exemplary experiment, after generation of 15 monoallelic cell lines with 47mers sharing the neo-antigen construct with or without a linker as described above, peptide presentation was verified by mass spectrometry using both non-targeted and targeted mass spectrometry (MS). Non-targeted MS analysis allowed unbiased identification of peptides from the entire immune peptidome, including peptides derived from the neo-antigen construct, but was limited in sensitivity of neo-epitope detection. Targeted analysis allowed sensitive detection of peptides presented at low copy numbers per cell, but was constrained to peptides identified as binders within the TR-FRET assay, as well as select peptides predicted to bind by NetMHCpan-4.0.

[0300] For untargeted MS analysis of each monoallelic cell line, the obtained data were searched using PEAKS (Zhang et al.,PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification.Mol Cell Proteomics.2012;11(4):M111.010587) against the human proteome database appended with linker and linker-free polyantigen cassette constructs as well as BFP sequences (Figure 13A). From this analysis, 218-6,663 unique 8-11mer peptides were identified within each monoallelic cell line, with the greatest number of peptides identified in HLA-A alleles and the least number of peptides identified in HLA-C alleles (Figure 13B). Furthermore, the number of 8-11mer peptides and the general sequence features of each allele overlapped regardless of polyantigen linker status, confirming that the presented peptides fit the expected motifs (Figure 14 and Figure 15A-B).

[0301] Non-targeted analysis found 22 neoepitope-HLA pairs (represented by boxes of each color in FIG. 13C; false discovery rate (FDR) of about 1%) from 15 shared neoantigens across five HLA alleles, representing about 5.4% of neoepitope-HLA pairs predicted by NetMHC and about 3.7% of neoepitope-HLA pairs identified within the TR-FRET assay (FIG. 13C). Although the intensity measurements cannot be directly converted to absolute abundance in non-targeted analysis, neoepitopes from EGFR G719A (ASGAFGTVYK; SEQ ID NO: 113) and FGFR3 S249C (ERCPHRPIL; SEQ ID NO: 114) demonstrate much greater intensity compared to other detected neoepitopes. For these 22 neoepitope-HLA pairs, TR-FRET and NetMHC showed good agreement, as 17 were identified as binders by both approaches (Figure 13D). However, there were also 1 and 3 neoepitope-HLA pairs that were uniquely identified as hits by TR-FRET and NetMHC, respectively, demonstrating that each approach has the ability to uniquely identify potential neoepitopes (Figure 13D). The final neoepitope-HLA pair identified by untargeted MS was derived from TP53 R175H (HMTEVVRHC; SEQ ID NO: 128) and was detected at A*02:01. This neoepitope-HLA pair had an RZ score of 3.9 and a NetMHC% rank of 3.98, and was not considered a hit by either approach. The detection of this neoepitope-HLA pair demonstrated that even for abundant epitopes, the cutoffs selected for the TR-FRET assay and presentation prediction algorithms yield some level of false-negative results.Finally, of the 22 neoepitope-HLA pairs detected by non-targeted analysis, 10 had been previously described in the literature, and the remaining 12 neoepitope-HLA pairs were presumed to be novel based on searches of both Tantigen (Olsen et al., TANTIGEN: a comprehensive database of tumor T cell antigens. Cancer Immunol Immunother. 2017;66(6):731-735), CAatlas (Yi et al., caAtlas: An immunopeptidome atlas of human cancer. iScience. 2021;24(10):103-107), and a cursory search of the literature.

[0302] In addition to the neo-epitopes, the non-targeted analysis allowed the detection of peptides derived from the non-mutation-bearing parts of each 25-mer neo-antigen sequence, as well as junction peptides created by consecutive 25-mers directly connected or separated by G-S linkers in the poly-antigen cassette. 27 epitopes presented were detected corresponding to amino acids adjacent but not containing the mutated residues of the cancer neo-antigens. As these peptides have the same exact sequence as the endogenous version of the protein, it was not possible to determine whether these epitopes originated from the neo-antigen construct or the endogenous genome. However, these peptides still provide information about protein processing, including potential proteasomal cleavage sites of these common cancer neo-antigens. In addition to these epitopes, 17 and 2 junction peptides were found from the non-linker and linker constructs, respectively (see Table 3). The low number of peptides from the linker construct is inferred to be due to the fact that the linkers contained G and S amino acids, which are not typically anchor residues. Finally, five epitopes were identified from the antigen sequence included as a control, as well as 13 epitopes derived from the BFP (Table 3), confirming that the neo-antigen constructs were expressed in each respective monoallelic cell line.

[0303] Although untargeted analysis allows for the identification of thousands of peptides, stochastic sampling and limited detection of peptides presented at low copy numbers per cell pose challenges. Conversely, targeted MS analysis dedicates the entire duty cycle of the instrument to the analysis of a small number of peptides, allowing for the detection of peptides presented at low copy numbers per cell, improving data reproducibility. However, targeted approaches require heavy isotope-labeled standard peptides, and targeted analysis of all potential neoepitopes of the 47 cancer neoantigens in the polyantigen cassette would require 1,748 peptides to be synthesized. Instead, we used the TR-FRET assay as a preliminary screen and synthesized 397 peptides with an RZ score ≥ 5 within the TR-FRET (after removing GTF2I L424H from the TR-FRET data). Due to the complementation of TR-FRET and NetMHC described above, we also synthesized an additional 81 peptides with an RZ score < 5 but a NetMHC% rank ≤ 2. Inclusion of these peptides allowed us to determine whether there were any neoepitopes predicted by NetMHC that would not have been found within the TR-FRET assay. In total, 479 peptides were divided into allele-specific peptide assays containing 21-88 peptides, which were used to quantify neoepitopes across 15 single-allelic cell lines (Figures S16A and S16B).

[0304] Targeted MS analysis identified 84 neoepitope-HLA pairs across 12 different HLA alleles and 37 common cancer neoantigens (mutations), showing a 4-fold improvement when compared to untargeted MS analysis of the same samples (Figure 16B). Interestingly, 20 out of 84 (approximately 24%) of all neoepitope-HLA pairs were identified within A*11:01 (Figure 16B). The large number of A*11:01 epitopes could be due to the presence of eight different KRAS neoantigen sequences within the polyantigen cassette, as 14 out of 20 A*11:01-specific neoepitopes mapped to KRAS G12X or G13X neoantigens. A similar pattern was observed for A*03:01, where 9 out of 14 neoepitopes belonged to KRAS neoantigens. No hits were found for A*24:02, B*51:01, or C*04:01. After searching the literature and relevant databases, 24 neoepitope-HLA pairs have been previously described and 60 are novel (see Table 6 below).

[0305] Table 6. Exemplary identified neoepitopes-HLA pairs TIFF2024541968000008.tif208161TIFF2024541968000009.tif250161

[0306] To illustrate the relative value of using the TR-FRET assay and NetMHC as methods to select peptides for targeted MS analysis, we plotted the RZ score versus NetMHC % rank for each of the 84 neoepitope-HLA pairs detected by targeted MS (Figure 16C). This analysis revealed that 53 neoepitopes were stable binders by TR-FRET and predicted to be presented by NetMHC. Furthermore, 12 neoepitope-HLA pairs were found as hits only in TR-FRET, whereas 17 neoepitope-HLA pairs were hits identified only by NetMHC (Figure 16C). These data again demonstrate that both TR-FRET and NetMHC generally matched peptides that would be presented, but each method also identified a unique set of potential neoepitope-HLA combinations.

[0307] To illustrate the binding characteristics of the 62 additional neoepitope-HLA pairs identified by targeted analysis (i.e., a total of 84 detected epitopes minus the 22 data-dependent acquisition (DDA) hits), we plotted the RZ scores and NetMHC% rank scores for peptides observed in both non-targeted and targeted analyses and compared them to peptides seen only in targeted analysis (Figure 16D and Figure 16E). We found that neoepitope-HLA pairs identified only by targeted analysis had a broader range of NetMHC% rank scores compared to neoepitopes also detected in non-targeted analysis (Figure 16D). Furthermore, neoepitope-HLA pairs identified only by targeted analysis had a broader spread of RZ scores within the TR-FRET assay (Figure 16E). These results suggest that targeted analysis can identify neoepitopes that are weaker binders compared to those identified by non-targeted analysis.

[0308] Unlike non-targeted approaches, targeted MS allows absolute quantification of peptide presentation, allowing comparison of presentation across neoepitopes. Here, measured amounts of neoepitopes presented ranged from 60 amol to 2.5 pmol (Figure 16F). Not surprisingly, peptides detected by non-targeted MS generally had higher absolute abundance. For example, both EGFR G719A (ASGAFGTVYK; SEQ ID NO: 113) and FGFR3 S249C (ERCPHRPIL; SEQ ID NO: 114) showed the highest absolute abundance, consistent with the results from the measured intensities from the non-targeted analysis (Figure 16F). However, some epitopes, such as PIK3CA H1047L (ALHGGWTTK; SEQ ID NO: 170), showed high absolute abundance in the targeted analysis but were not detected in the non-targeted analysis (Figure 16F). When comparing the absolute amount of detected neoepitopes with either the RZ score (FIG. 17, bottom panel) or the NetMHC% rank score (FIG. 17, top panel) for each allele, no clear correlation was found, suggesting that each score can predict whether a potential neoepitope is presented or not, but not the absolute amount presented.

[0309] Measurement of absolute levels of neoepitopes also allowed comparison of presentation from cells containing linker or linkerless constructs, as well as characterization of the reproducibility of measurements across different analytical batches. To account for the impact of the linker within the neoantigen construct, plots were prepared for the maximum absolute amount of peptide detected for a neoepitope from each cancer neoantigen within monoallelic cell lines containing linker or linkerless neoantigen constructs (Figure 18 and Figure 19). In this analysis, a consistent correlation between neoepitope presentation and the presence or absence of a linker in the polyantigen cassette was demonstrated (Figure 18 and Figure 19). Finally, absolute quantitative measurements were collected in 2-3 independent replicates of cell line growth and sample preparation (i.e., HLA-IP and MS analysis), and absolute measurements of peptide presentation were in good agreement between these replicates (Figure 20).

[0310] Functional verification of novel tumor-associated antigen-HLA-I pairs A large number of 84 neoepitope-HLA pairs identified above represent novel candidate neoepitopes. However, presentation of a neoepitope alone does not guarantee that it can induce a T cell response. To determine whether the identified neoepitopes can be recognized by human T cells, a modified multiplex TCR discovery method described by Klinger, et al. 2015 PLoS One.10(10):e0141561 was utilized. Focusing on two, neoepitope-HLA pairs were identified (Flt3-p.D835Y / HLA-A*02:01, PIK3CA-p.E545K / HLA-A*11:01). Briefly, healthy human donor CD8+ T cells were isolated, expanded using autologous monocyte-derived dendritic cells, restimulated with the neoepitope pool, sorted for upregulation of activation markers, and assigned neoepitopes to peptide pools in unique combinations first before being subjected to TCRβ sequencing. This method was utilized for donors across a range of HLA genotypes, allowing for association of the TCR with a variety of peptide-HLA pairs. However, due to the multiallelic nature of donor cells, the HLA restriction of the identified neoepitopes was not initially defined among the 3-6 donor HLA alleles.

[0311] For those neoepitopes that elicited T cell responses, the relevant TCRβ and TCRα sequences were determined using a parallel multiplexed assay (Howie et al., 2015 Sci Transl Med. 7(301):301ra131) that allowed for the construction of corresponding TCR expression vectors and the selection of candidate neoepitope-specific TCRs. The specificity and potential efficacy of each TCR was then assessed by cellular assays. In vitro transcribed RNA (ivtRNA) encoding the TCR was introduced into primary human T cells by electroporation and then incubated with increasing concentrations of candidate neoepitopes in the presence of either target cells expressing the predicted HLA alleles or monoallelic K562 cells expressing both the predicted HLA alleles and the neoantigen of interest. These two approaches allowed the characterization of TCR potency via the activity of exogenously loaded target cells and the potential of neoepitopes to elicit T cell responses when expressed, processed and presented in a cellular context.

[0312] Dose-dependent upregulation of CD137 was found following 12-hour co-culture of primary human CD8+ T cells transfected with the predicted Flt3-p.D835Y / HLA-A*02:01-specific TCR in response to T2 cells (expressing low levels of HLA-A*02:01) incubated with the indicated concentrations of exogenously delivered YIMSDSNYV (SEQ ID NO: 116) peptide (Figure 21A). Furthermore, these T cells were activated and specifically killed by monoallelic A*02:01 K562 cells expressing the mutant FLT3-p.D835Y transgene, but not by monoallelic A*02:01 K562 cells expressing the wild-type FLT3 transgene (Figures 21B-F). Interestingly, these TCRs appear to be highly specific for the mutant neoepitope, an important feature since a similar non-mutant epitope, IMSDSNYVV, was identified by non-targeting analysis in HLA-A*02:01 monoallelic cells. These data suggest the potential utility of these TCRs as a modality to address Flt3-p.D835Y-expressing malignancies.

[0313] As a second proof of concept, T cells were transfected with the predicted PIK3CA-p.E545K / HLA-A*11:01 TCR and mixed with monoallelic HLA-A*11:01 expressing K562 cells incubated with increasing concentrations of the predicted neoepitope, STRDPLSEITK (SEQ ID NO: 169) (Figure 21G). Here, TCR-transfected T cells showed dose-dependent activation as measured by CD137 expression. Furthermore, these T cells showed higher levels of activation and cell killing when mixed with monoallelic A*11:01 K562 cells expressing the PIK3CA-p.E545K transgene compared to cells that expressed the wild-type PIK3CA transgene (Figure 21H-M). Mutations introducing anchor residues are likely to have high immunogenic potential because the immune system has not built up tolerance to the analogous WT epitope. For PIK3CA-p.E545K / HLA-A*11:01, the E→K mutation introduces an anchor residue in the context of HLA-A*11:01, and the wild-type STRDPLSEITE epitope was not detected in untargeted MS analysis of A*11:01 monoallelic cells. The WT epitope was also not predicted to bind HLA-A*11:01 by NetMHC, although lack of detection in MS analysis does not demonstrate absence. Taken together, these data provide a clear mechanism for the specificity of PIK3CA-p.E545K TCRs to recognize mutant PIK3CA compared to wild-type, supporting these TCRs as potential therapeutic candidates.

[0314] Consideration To date, most neoepitope discovery efforts have focused on a limited number of neoantigens, HLA alleles, or both in search of immunogenic tumor-associated peptides. Recent reports have expanded the number of neoantigens and HLA alleles studied at once, but these neoepitopes were derived from mutations in the same gene - KRAS (Choi et al., Cell Rep Methods. 2021;1(5):100084). Here, we integrated high-throughput binding assays, computational neoepitope binding predictions, complex cellular engineering of monoallelic cell lines, and targeted mass spectrometry to develop a multiplexed platform to identify unique tumor-associated neoepitopes that can be presented in association with specific HLA-I alleles and serve as potential targets for neoantigen-based cancer immunotherapy. As demonstrated, the workflow leverages a combination of a high-throughput biochemical neoepitope-HLA binding assay and a computational neoepitope-HLA binding algorithm, enabling comprehensive screening of all potential neoepitopes across 47 shared cancer neoantigens and 15 common HLA alleles. The combined analysis resulted in a short list of 783 neoepitope-HLA combinations (out of 24,149 total combinations investigated) that were identified as stable binders and potential candidates for cell surface HLA-I presentation. Separately, a custom engineered monoallelic cell line panel containing a polyantigen cassette encoding all 47 neoantigens was generated to increase the breadth of putative neoepitope-HLA combinations presented on the cell surface. A combination of non-targeted and targeted mass spectrometry identified 84 unique neoepitope-HLA pairs, derived from 37 shared cancer neoantigens across 12 of the 15 investigated HLA alleles. To validate the immunogenicity of these unique neoepitope-HLA pairs and their potential as therapeutic targets, we selected two example combinations (Flt3-p.D835Y / HLA-A*02:01 and PIK3CA-p.E545K / HLA-A*11:01) and used cell-based assays to evaluate the cohort of neoantigen-specific TCRs identified in a separate MIRA workflow.Not only were T cells activated in the presence of the corresponding TCR-antigen / HLAI combinations, but some TCRs displayed mutant peptide selectivity.

[0315] Beyond the analysis provided here, the TR-FRET and MS data are valuable resources for future studies of neoepitope presentation. For example, the TR-FRET data could potentially be used as training or benchmark data for more advanced computational algorithms that predict neoepitope-HLA complex formation. Furthermore, we provided raw data for untargeted and targeted MS analysis, enabling future reanalysis with more advanced search algorithms (Vizcaino et al., The Human Immunopeptidome Project: A Roadmap to Predict and Treat Immune Diseases. Mol Cell Proteomics. 2020;19(1):31-49), peptide false discovery rate determination (Wilhelm et al., Deep learning boosts sensitivity of mass spectrometry-based immunopeptidomics. Nat Commun. 2021;12(1):3346), or specific workflows detecting rare events within the antigen presentation pathway, e.g., spliced ​​peptides (Faridi et al., Spliced ​​HLA-bound peptides: a Black Swan event in immunology. Clin Exp Immunol. 2021;204(2):179-188). In addition to the data generated in this study, monoallelic cell lines expressing polyantigen cassettes also represent an ideal system for future studies characterizing the processing and presentation of clinically actionable shared cancer neo-antigens. Taken together, the workflow described herein provides the most comprehensive analysis of the neoepitope landscape performed to date, providing important insights into therapeutic targets for neoepitope-based cancer immunotherapy targeting shared neoantigens. One striking finding from this analysis was the relatively small number of presented neoepitope-HLA pairs (a total of 84 out of 24,149 initially screened neoepitope-HLA combinations, i.e., 0.35%) that shared and were therefore available for therapeutic development. The limited presentation of shared cancer neoepitopes may be driven by HLA-I peptide binding diversity, as 18 neoepitopes out of 37 cancer neoantigens were detected in association with just one HLA-I allele. For the 19 cancer neoantigens that presented epitopes across multiple HLA-I alleles, 7 were KRAS G12X or G13X mutations. Due to the low incidence of presentation across multiple common HLA alleles, widespread use of this platform and further neoepitope-HLA discovery efforts are required to identify patient populations most likely to benefit from common neoantigen-specific immunotherapy. For example, KRAS G12D mutations were reported to be most frequent in CRC with a frequency of 14.9% (Araujo et al., Molecular profile of KRAS G12C-mutant colorectal and non-small-cell lung cancer. BMC Cancer. 2021;21(1):193). Based on the present analysis, the most common HLA allele presenting the KRAS G12D neoepitope is A*03:01, which, on average, constitutes an allele frequency of approximately 14% across patients of Caucasian and European descent. Thus, for this very common common neoantigen within this indication, the maximum patient coverage for European and Caucasian demographics is only approximately 2% (mutation frequency x allele frequency). This number decreases further when considering other demographics in which the prevalence of HLA-A*03:01 is even lower: African Americans (1.1%), Chinese (0.2%), Hispanics (1.0%), and Southeast Asians (0.75%).Although there is growing evidence that neoantigen-based therapeutics are highly effective in treating cancer, these collective findings suggest that targeting shared neoantigens remains challenging.

[0316] While this analysis was comprehensive, it is possible that neoepitope-HLA combinations were overlooked from either the biochemical assays and / or the prediction algorithms and were not included in the targeted mass spectrometry. Also, presentation was measured in engineered cell lines overexpressing a polyantigen cassette encoding a ~25mer amino acid fragment spanning the mutated amino acids, and processing and presentation in this format may be altered compared to the full-length antigen in tumor cells, potentially resulting in loss of neoepitopes. Given this potential limitation, we assessed neoepitope presentation from cell lines engineered with full-length neoantigens of KRAS G12C, G12D and G12V, with observation of the same neoepitopes presented (Figure 12A and Figure 12B). Similar validation may be performed across all 47 neoantigens described herein. Despite these caveats, this is one of the most comprehensive analyses of the neoepitope landscape across the most relevant shared neoantigens, and the collective findings yield valuable insights into druggable neoepitope targets for cancer immunotherapy.

[0317] While certain alternative forms of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims. Accordingly, there is no intention to be limited to the precise summary and disclosure presented herein.

[0318] Array Table The following table lists exemplary sequences for various molecules. TIFF2024541968000010.tif153160TIFF2024541968000011.tif221160TIFF2024541968000012.tif191160

Claims

1. 1. A method for producing a monoallelic MHC-expressing cell line, comprising: (i) obtaining cells that do not express endogenous MHC alleles; (ii) introducing into the cell a polynucleotide encoding an exogenous MHC allele polypeptide and a non-viral expression vector comprising a polynucleotide cassette encoding a plurality of neo-antigen associated peptides, such that the exogenous MHC allele polypeptide is expressed by the cell to generate a mono-allele MHC-expressing cell; (iii) expanding the monoallelic MHC-expressing cells under conditions to obtain a monoallelic MHC-expressing cell line; Including, the plurality of neo-antigen-associated peptides are expressed by the monoallelic MHC-expressing cells, and the polynucleotide cassette encodes at least 23 neo-antigen-associated peptides. method.

2. A method for producing a mono-allele MHC-expressing cell line, comprising: (i) obtaining cells that do not express endogenous MHC alleles; (ii) introducing into the cell a non-viral expression vector comprising a polynucleotide cassette encoding a plurality of neo-antigen-related peptides, wherein the plurality of neo-antigen-related peptides are expressed in the cell, and wherein the polynucleotide cassette encodes at least 23 neo-antigen-related peptides, and the polynucleotide cassette is introduced into the cell in the non-viral expression vector; (iii) expanding the cells under conditions to obtain a cell line; (iv) introducing a polynucleotide encoding an exogenous MHC allele polypeptide into the cell line; A method comprising:

3. 3. The method of claim 1 or 2, wherein the cells in step (i) have been genetically modified to mutate or delete endogenous MHC alleles.

4. 3. The method of claim 1 or 2, wherein step (i) comprises genetically modifying the cells to mutate or delete endogenous MHC alleles.

5. 3. The method of claim 1 or 2, wherein the MHC allele is an MHC I allele.

6. The method of claim 1 or 2, wherein the monoallelic MHC-expressing cell line expresses β2-microglobulin (B2M).

7. 6. The method of claim 5, wherein the MHCI allele is encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C.

8. 6. The method of claim 5, wherein the MHCI alleles are selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.

02.

9. The method described in claim 1 or 2, wherein the polynucleotide cassette encodes 23, 24, or 47 neo-antigen-related peptides.

10. 3. The method of claim 1 or 2, wherein the plurality of neoantigen-related peptides are cleaved into a plurality of neoepitopes, and at least one neoepitope specifically binds to the exogenous MHC polypeptide.

11. 11. The method of claim 10, wherein the at least one neoepitope is 8, 9, 10, 11, 12, or 13 amino acids in length.

12. The method of claim 1 or 2, wherein the neoantigen-associated peptides are identified by bioinformatics and / or clinical analysis of tumor mutations.

13. 3. The method of claim 1 or 2, wherein at least one of the neo-antigen associated peptides comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222.

14. 3. The method of claim 1, wherein each of the plurality of neo-antigen-related peptides is 20 to 50 amino acids in length.

15. At least one of the neoantigen-associated peptides is selected from the group consisting of KRAS G12C, KRAS G12D, KRAS G12V, KRAS G13D, KRAS G12A, KRAS G12S, KRAS G13C, KRAS G12R, JAK2 V617F, NRAS Q61K, NRAS Q61R, EGFR E746_A750de, EGFR G719A, EGFR L858R, EGFR T790M, EGFR C797S, EGFR T790M_C797S, PIK3CA E545K, PIK3CA H1047L, PIK3CA H1047R, PIK3CA E542K, ERBB2 S310F, BRAF V600E, BRAF V600M, DNMT3A R882H, FGFR3 S249C, MYD88 L265P, PTEN R130G, PTEN R130Q, TP53 R175H, TP53 R248Q, TP53 R273C, TP53 R273H, TP53 R273L, TP53 R282W, CALR fs, ESR1 K303R, FLT3 D835Y, GNA11 Q209L, GNA11 Q209P, GNAQ Q209L, GNAQ Q209P, IDH1 3. The method of claim 1 or 2, wherein the nucleotide sequence is IDH1 R132C, IDH1 R132G, IDH1 R132H, IDH2 R140Q, SF3B1 R625C, SF3B1 R625H, or HRAS Q61R.

16. The method of claim 1 or 2, wherein the cell is an antigen-presenting cell (APC).

17. 3. The method of claim 1 or 2, wherein the cell is an HMy2.C1R cell or a K562 cell.

18. The method described in claim 1 or 2, wherein the non-viral expression vector is a plasmid expression vector.

19. The method of claim 18, wherein the plasmid expression vector is a Piggybac plasmid expression vector.

20. The method described in claim 1 or 2, wherein the polynucleotide cassette further encodes a reporter element, and the reporter element is transcriptionally linked to the 23 neo-antigen-related peptides.

21. The method described in claim 1 or 2, wherein the polynucleotide cassette further comprises a promoter capable of initiating translation of the at least 23 neo-antigen-related peptides into a single polypeptide in a cell.

22. The method described in claim 1 or 2, wherein the polynucleotide cassette is 5 kb to 10.5 kb in size.

23. The method described in claim 1 or 2, wherein the polynucleotide cassette is at least 5 kb in size.

24. 3. A monoallelic MHC-expressing cell line produced by the method of claim 1 or 2, wherein the cell line expresses polynucleotide cassettes encoding at least 23 neo-antigen-associated peptides.

25. 1. A system comprising a plurality of monoallelic MHC-expressing cell lines, Each cell line does not express endogenous MHC alleles; each cell line expresses an exogenous MHC allele, such that each cell line expresses a different exogenous MHC allele; each cell line comprises a non-viral expression vector comprising a polynucleotide cassette encoding a plurality of neo-antigen-associated peptides, and each cell line expresses the polynucleotide cassette encoding a plurality of neo-antigen-associated peptides; and the polynucleotide cassette encodes at least 23 neo-antigen-related peptides; system.

26. 26. The system of claim 25, wherein each of the monoallelic MHC-expressing cell lines has been genetically modified to mutate or delete an endogenous MHC allele.

27. 27. The system of claim 25 or 26, wherein each of the expressed MHC alleles is an MHC I allele.

28. The system of claim 25 or 26, wherein the monoallelic MHC-expressing cell line expresses beta2-microglobulin (B2M).

29. 28. The system of claim 27, wherein the MHCI allele is encoded by any one of the following loci: HLA-A, HLA-B, and HLA-C.

30. 28. The system of claim 27, wherein the MHC alleles are selected from A*01.01, A*02.01, A*03.01, A*11.01, A*24.02, B*07.02, B*08.01, B*35.01, B*44.02, B*51.01, C*03.04, C*04.01, C*05.01, C*06.02, C*07.01, C*07.02, and C*08.

02.

31. 27. The system of claim 25 or 26, wherein the polynucleotide cassette encodes 23, 24, or 47 neo-antigen-associated peptides.

32. 27. The system of claim 25 or 26, wherein the plurality of neo-antigen-related peptides are expressed in the plurality of monoallelic MHC-expressing cell lines and cleaved into a plurality of neo-epitopes, at least one neo-epitope specifically binding to the exogenous MHC polypeptide.

33. 33. The system of claim 32, wherein the at least one neoepitope is 8, 9, 10, 11, 12, or 13 amino acids in length.

34. 27. The system of claim 25 or 26, wherein the plurality of neo-antigen-associated peptides are identified by bioinformatics and / or clinical analysis of tumor mutations.

35. 27. The system of claim 25 or 26, wherein at least one of the plurality of neo-antigen associated peptides comprises at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to at least one of SEQ ID NOs: 1-72, 75-191, and 195-222.

36. The system of claim 25 or 26, wherein each of the plurality of neo-antigen-related peptides is 20 to 50 amino acids in length.

37. At least one of the plurality of neo-antigen-associated peptides is selected from the group consisting of KRAS G12C, KRAS G12D, KRAS G12V, KRAS G13D, KRAS G12A, KRAS G12S, KRAS G13C, KRAS G12R, JAK2 V617F, NRAS Q61K, NRAS Q61R, EGFR E746_A750de, EGFR G719A, EGFR L858R, EGFR T790M, EGFR C797S, EGFR T790M_C797S, PIK3CA E545K, PIK3CA H1047L, PIK3CA H1047R, PIK3CA E542K, ERBB2 S310F, BRAF V600E, BRAF V600M, DNMT3A R882H, FGFR3 S249C, MYD88 L265P, PTEN R130G, PTEN R130Q, TP53 R175H, TP53 R248Q, TP53 R273C, TP53 R273H, TP53 R273L, TP53 R282W, CALR fs, ESR1 K303R, FLT3 D835Y, GNA11 Q209L, GNA11 Q209P, GNAQ Q209L, GNAQ Q209P, IDH1 SF3B1 R625C, SF3B1 R625H, or HRAS Q61R.

38. 27. The system of claim 25 or 26, wherein each of the monoallelic MHC-expressing cell lines is an antigen-presenting cell (APC).

39. 27. The system of claim 25 or 26, wherein the cells are HMy2.C1R cells or K562 cells.

Images