Aptamer and applications therefor

Abstract

To provide an aptamer that binds to a GPCR selected from a group consisting of A1R-mGluR1 and MOR, and applications therefor.SOLUTION: There is disclosed, an aptamer that binds to a GPCR selected from a group consisting of A1R-mGluR1 and MOR. Preferably, the aptamer includes a base sequence S1 represented by a specific sequence, a base sequence S2 formed by replacing T in the base sequence S1 with U, a base sequence S3 having at least 80% identity to the base sequence S1 or S2, or a base sequence S4 with 1-5 base substitutions, deletions, insertions, or additions relative to the base sequence S1 or S2.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to aptamers and uses thereof. [Background technology]

[0002] G protein-coupled receptors (GPCRs) are a general term for membrane receptor proteins that share a common structural motif of seven transmembrane domains. There are three categories of GPCRs that are attracting attention as targets for drug discovery: class A (rhodopsin receptor family), class B (secretin receptor family), and class C (metabotropic glutamate receptor family).

[0003] Although dimerization is not essential for the function of class A GPCRs, it is known that opioid receptors, including the μ-opioid receptor (MOR), form heterodimers between subtypes and allosterically regulate each other. In addition, metabotropic glutamate receptors (mGluRs), which are class C GPCRs, always function by forming homodimers via their large extracellular ligand-binding domains. Thus, GPCR subunits form homo- or hetero-oligomers (in most cases, dimers) and act as a single functional GPCR.

[0004] The classical theory was that various functional GPCRs are expressed on the surface of all cells and each one signals individually. However, in recent years, it has become clear that heterogeneous functional GPCRs form even larger complexes (hereafter referred to as "supercomplexes"), and that within the supercomplexes, mutual modulation between functional GPCRs results in complex signaling that cannot be achieved by a single functional GPCR. For example, it has been reported that functional type 1 metabotropic glutamate receptors (functional mGluR1; homomultimers of mGluR1), which are expressed on the postsynaptic membrane of cerebellar Purkinje neurons and act as trigger molecules to induce cerebellar long-term depression (a type of synaptic plasticity) that supports motor learning, may form complexes with functional adenosine type 1 receptors (functional A1R; homomultimers of A1R) or functional type B γ-aminobutyric acid receptors (functional GABAbR; heteromultimers of GABAbR1 and GABAbR2) and, upon receiving adenosine / GABA accumulated in the cerebrospinal fluid, attenuate / increase the glutamate sensitivity of mGluR1, thereby inhibiting / promoting cerebellar long-term depression and motor learning (Non-Patent Documents 1 and 2). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Tabata et al., J. Physiol. 2007 Jun 1; 581(2): 693-708 [Non-Patent Document 2] Kamikubo et al., J. Physiol. 2007 Dec 1; 585(2): 549-563 Summary of the Invention [Problem to be solved by the invention]

[0006] A primary object of the present disclosure is to provide an aptamer that binds to a GPCR selected from the group consisting of A1R-mGluR1 (heterocomplex) and MOR (homocomplex), and uses thereof. [Means for solving the problem]

[0007] The present disclosure includes the following embodiments. [Section 1] An aptamer that binds to a GPCR selected from the group consisting of A1R-mGluR1 and MOR. [Section 2] Item 2. The aptamer according to Item 1, comprising a base sequence S1 represented by any one of SEQ ID NOs: 1 to 43, a base sequence S2 in which T in the base sequence S1 is replaced with U, a base sequence S3 having 80% or more identity to the base sequence S1 or S2, or a base sequence S4 in which 1 to 5 bases have been substituted, deleted, inserted, and / or added to the base sequence S1 or S2. [Section 3] Item 3. The aptamer according to item 1 or 2, comprising a base sequence S11 shown in SEQ ID NO: 1 or 31, a base sequence S21 in which T in the base sequence S11 is replaced with U, a base sequence S31 having 80% or more identity to the base sequence S11 or S21, or a base sequence S41 in which 1 to 5 bases have been substituted, deleted, inserted, and / or added to the base sequence S11 or S21. [Section 4] Item 4. The aptamer according to any one of Items 1 to 3, comprising a base sequence forming three or four stem-loop structures. [Section 5] K for the GPCR d Item 5. The aptamer according to any one of Items 1 to 4, wherein the affinity of the aptamer is 100 nM or less. [Section 6] An aptamer (Dapt-AM) that binds to A1R-mGluR1, The nucleic acid sequence includes a nucleic acid sequence S12 shown in SEQ ID NO: 1, a nucleic acid sequence S32 having 80% or more identity to the nucleic acid sequence S12, or a nucleic acid sequence S42 in which 1 to 5 nucleic acids have been substituted, deleted, inserted, and / or added to the nucleic acid sequence S12, An aptamer comprising a base sequence forming a stem-loop structure represented by the following formula (H1), a base sequence forming a stem-loop structure represented by any of the following formulas (H2-1) to (H2-2) and any of the following formulas (H2-3) to (H2-5), or a base sequence forming a stem-loop structure represented by the following formulas (H3-1) to (H3-3). [ka] (In the formula, L 1a is a loop of 6 to 8 bases, and L 1b and L 1c are each independently a loop consisting of 14 to 17 bases, L 2a and L 2b are each independently a loop consisting of 5 to 8 bases, and L 2c is a loop consisting of 30 to 32 bases, and L 2d is a loop consisting of 10 to 12 bases, L 2e is a loop consisting of 10 to 12 bases, L 2f is a loop consisting of 5 to 8 bases, L 2g is a loop consisting of 5 to 8 bases, L 3a is a loop consisting of 5 to 8 bases, L 3b is a loop consisting of 15 to 17 bases, L 3c is a loop consisting of 5 to 8 bases. [Section 7] Item 7. The aptamer according to Item 6, comprising a base sequence forming a stem-loop structure represented by the following formula (H11), a base sequence forming a stem-loop structure represented by any one of the following formulae (H21) to (H22) and any one of the following formulae (H23) to (H25), or a base sequence forming a stem-loop structure represented by the following formulae (H31) to (H33). [ka] [Section 8] An aptamer that binds to MOR (Dapt-μ), The nucleic acid sequence includes a nucleic acid sequence S13 shown in SEQ ID NO: 31, a nucleic acid sequence S33 having 80% or more identity to the nucleic acid sequence S13, or a nucleic acid sequence S43 having 1 to 5 nucleotides substituted, deleted, inserted, and / or added to the nucleic acid sequence S13, An aptamer comprising a base sequence forming a stem-loop structure represented by any one of the following formulae (H4-1) to (H4-3), any one of the following formulae (H4-4) to (H4-5), and any one of the following formulae (H4-6) to (H4-7). [ka] (In the formula, L 4a , L 4b , L 4c , L 4d , L 4e , L 4f , and L 4g are each independently a loop consisting of 5 to 8 bases, L 4h is a loop of 8 to 10 bases, L 4i is a loop consisting of 20 to 22 bases. [Section 9] Item 9. The aptamer according to Item 8, comprising a base sequence forming a stem-loop structure represented by any one of the following formulas (H41) to (H43), a base sequence forming a stem-loop structure represented by any one of the following formulas (H44) to (H45), and a base sequence forming a stem-loop structure represented by any one of the following formulas (H46) to (H48). [ka] [Section 10] Item 10. A pharmaceutical or reagent comprising the aptamer according to any one of Items 1 to 9. Effect of the Invention

[0008] The present disclosure provides an aptamer that binds to a GPCR selected from the group consisting of A1R-mGluR1 and MOR, and uses thereof. [Brief description of the drawings]

[0009] [Figure 1] FIG. 1 is a schematic diagram of the improved Cell-SELEX method. [Diagram 2] FIG. 1 is a schematic diagram of the EV-SELEX method. [Diagram 3] FIG. 1 shows the presence of HA-MOR in EV-purified fractions using sucrose gradient ultracentrifugation. [Figure 4] FIG. 1 shows the predicted secondary structure of Dapt-μ. [Diagram 5] 13 is a micrograph showing that Dapt-μ recognizes the MOR but not the labeling tag. [Figure 6] 13 shows micrographs showing that Dapt-μ specifically recognizes MOR. [Figure 7] 13 is a micrograph showing that Dapt-μ binds to cell surface MOR. [Figure 8] This is a graph showing the time-dependent change in the absolute amount of Dapt-μ contained in EVs analyzed by qPCR. [Figure 9] 13 is a micrograph showing that Dapt-μ binds to cell surface MOR. [Figure 10A] 1 is a graph showing the dose-dependency of the binding ability of Dapt-μ. [Figure 10B] 1 is a graph showing the dose dependency of the cAMP suppressive effect of Dapt-μ. [Figure 11] 1 is a graph showing the cAMP suppression effect of Dapt-μ in the presence or absence of naloxone. [Figure 12] 1 shows photomicrographs and a graph showing that Dapt-μ recognizes mouse spinal dorsal horn MOR. [Figure 13] 1 is a graph showing that Dapt-μ activates MOR in primary cultured rat striatal neurons. [Figure 14] 1 is a graph showing the dose-dependence of Dapt-μ on MOR activation in primary cultured rat striatal neurons. [Figure 15] FIG. 1 shows the predicted secondary structure of Dapt-AM. [Figure 16] 1 is a graph showing the mGluR1 signal suppressing effect of Dapt-AM. [Figure 17] 1 is a graph showing the dose-dependence of the mGluR1 signal suppression ability of Dapt-AM. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] In this specification, the term "comprise" is used in the sense that it encompasses "consist essentially of" and "consist only of".

[0011] All patent and non-patent literature cited herein is hereby incorporated by reference in its entirety.

[0012] The aptamer according to an embodiment of the present disclosure is an aptamer that binds to a GPCR selected from the group consisting of A1R-mGluR1 and MOR. In this specification, the phrase "binds to a GPCR selected from the group consisting of A1R-mGluR1 and MOR" is used to mean binding to A1R-mGluR1 or MOR that does not form a multimer such as a dimer, binding to A1R-mGluR1 or MOR that forms a multimer such as a dimer, and binding to A1R-mGluR1 or MOR modified with a labeling tag or the like.

[0013] The aptamer preferably specifically binds to A1R-mGluR1 or MOR. In this specification, the term "specifically binds" is used to mean selectively or preferentially binding to A1R-mGluR1 or MOR. For example, the aptamer that specifically binds to MOR includes an aptamer that binds to MOR but does not bind to subtypes (similar protein sequence GPCRs) such as DOR (δ-opioid receptor) and KOR (κ-opioid receptor).

[0014] The aptamer preferably comprises a base sequence S1 shown in any one of SEQ ID NOs: 1 to 43, a base sequence S2 in which T in base sequence S1 is replaced with U, a base sequence S3 having 80% or more identity to base sequence S1 or S2, or a base sequence S4 in which 1 to 5 bases have been substituted, deleted, inserted, and / or added to base sequence S1 or S2.

[0015] The base sequence S1 is preferably the base sequence S11 shown in SEQ ID NO: 1 or 31. In one embodiment, the base sequence S1 may be the base sequence S12 shown in SEQ ID NO: 1. In another embodiment, the base sequence S1 may be the base sequence S13 shown in SEQ ID NO: 31.

[0016] The base sequence S2 is preferably a base sequence S21 in which T in the base sequence shown in SEQ ID NO: 1 or 31 is replaced with U. In one embodiment, the base sequence S2 may be a base sequence S22 in which T in the base sequence shown in SEQ ID NO: 1 is replaced with U. In another embodiment, the base sequence S2 may be a base sequence S23 in which T in the base sequence shown in SEQ ID NO: 31 is replaced with U.

[0017] The base sequence S3 has, for example, 85% or more, preferably 90% or more, more preferably 95% or more, even more preferably 97% or more, and even more preferably 99% or more identity to the base sequence S1 or S2. The identity may be identity of the base sequence other than the region forming the stem-loop structure. The identity of the base sequence can be calculated using the National Center for Biotechnology Information (NCBI) homology algorithm BLAST (Basic local alignment search tool) (http: / / www.ncbi.nlm.nih.gov / BLAST / ) with default (initial setting) parameters.

[0018] The base sequence S4 may have, for example, 1 to 4, preferably 1 to 3, more preferably 1 or 2 bases substituted, deleted, inserted, and / or added to the base sequence S1 or S2. The bases are preferably substituted, deleted, inserted, and / or added outside the region forming the stem-loop structure.

[0019] The aptamer may include a plurality of (e.g., 2, 3, or 4) base sequences (e.g., S1-S1, S1-S2, S1-S3) selected from the group consisting of base sequences S1, S2, S3, and S4. The plurality of base sequences may be linked via a linker. Examples of such linkers include nucleotide linkers; alkylene linkers, polyethylene glycol (PEG) linkers, peptide linkers, and other non-nucleotide linkers.

[0020] The aptamer preferably contains a base sequence that forms multiple stem-loop structures. Whether a certain base sequence forms a stem-loop structure can be determined by estimating the most energetically stable secondary structure using Mfold (http: / / www.unafold.org / mfold.php), an in silico web analysis program. The multiple stem-loop structures may be structures in which each stem-loop exists independently, or may be structures in which some or all of the stem-loops are integrated (for example, a structure in which the stem of the second stem-loop protrudes from the loop of the first stem-loop). The aptamer may contain, for example, a base sequence that forms 2, 3, or 4, preferably 3 or 4, more preferably 3, stem-loop structures.

[0021] The aptamer may further include any base sequence. An example of such a base sequence is a primer sequence for PCR. The primer sequence includes a forward primer sequence and a reverse primer sequence. Examples of the forward primer sequence include 5'-CGGACAACACTCGGAGGA-3' (SEQ ID NO: 45) and 5'-GCCTGTTGTGAGCCTCCT-3' (SEQ ID NO: 46). Examples of the reverse primer sequence include 5'-CCCTCTGTTCTTATTCGC-3' (SEQ ID NO: 47) and 5'-GGGAGACAAGAATAAGCG-3' (SEQ ID NO: 48). The 5' end of the primer sequence may be biotinylated. The primer sequence may be directly linked to both ends of the base sequence S1, or may be linked via a linker (e.g., 1, 2, or 3 bases). The above-mentioned aptamer containing a primer sequence includes, for example, 5'-(SEQ ID NO: 45 or 46)-(SEQ ID NO: S1, S2, S3, or S4)-(complementary strand of SEQ ID NO: 47 or 48)-3'.

[0022] In one embodiment, the aptamer is preferably a DNA aptamer.

[0023] In one embodiment, the aptamer is preferably single-stranded.

[0024] At least one nucleotide in the base sequence of the aptamer may be chemically modified as shown below. The phosphate residue (P(=O)O) of the nucleotide may be replaced with a chemically modified phosphate residue such as thioate (P(=O)S), dithioate (P(=S)S), or amidate (P(=O)NR2; each R represents an alkyl group such as CH3). The 2'-position of the sugar of the nucleotide may be replaced with -F, -OR, or -SR (R represents an alkyl group such as CH3, or an acyl group such as CHO), or -NH2. Furthermore, the base of the nucleotide (pyrimidine, purine, etc.) may be chemically modified, for example, by introducing a methyl group or a cationic functional group into the 5-position of pyrimidine, or by replacing the carbonyl group at the 2-position with a thiocarbonyl group. Furthermore, the phosphate moiety or hydroxy moiety may be modified with, for example, a biotinyl group, an amino group, a lower alkylamino group, an acetyl group, etc., but is not limited thereto. In addition, artificial nucleic acids such as BNA and LNA, in which the conformation of the sugar moiety of the nucleotide is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety, can also be preferably used.

[0025] The base length of the aptamer is not particularly limited, but is, for example, 25 bases or more, preferably 30 bases or more, more preferably 35 bases or more, and further preferably 40 bases or more. The base length of the aptamer may be, for example, 100 bases or less, 95 bases or less, 90 bases or less, 85 bases or less, or 80 bases or less. The base length of the aptamer may be selected, for example, within the range of 25 to 100 bases.

[0026] The K d is not particularly limited, but is preferably 100 nM or less, more preferably 80 nM or less, even more preferably 70 nM or less, even more preferably 60 nM or less, and particularly preferably 50 nM or less. d The smaller the dissociation constant, the more preferable, and may be, for example, 1 pM or more. The dissociation constant can be measured by the method described in the Examples below.

[0027] In certain embodiments of the present disclosure, the aptamer that binds to A1R-mGluR1 (Dapt-AM) is preferred. Dapt-AM is an A1R-mGluR1 antagonist, a Ca 2+ It is preferable that Dapt-AM contains the base sequence S12 shown in SEQ ID NO: 1, the base sequence S22 in which T in the base sequence S12 is replaced with U, the base sequence S32 having 80% or more identity to the base sequence S12 or S22, or the base sequence S42 in which 1 to 5 bases are substituted, deleted, inserted, and / or added to the base sequence S12 or S22. It is more preferable that Dapt-AM contains the base sequence S12 shown in SEQ ID NO: 1, the base sequence S32 having 80% or more identity to the base sequence S12, or the base sequence S42 in which 1 to 5 bases are substituted, deleted, inserted, and / or added to the base sequence S12. It is preferable that Dapt-AM contains at least one base sequence selected from the stem-loop structures represented by the following formulae (H1), (H2-1) to (H2-5), and (H3-1) to (H3-3). It is further preferable that Dapt-AM contains a base sequence forming a stem-loop structure represented by the following formula (H1), a base sequence forming a stem-loop structure represented by any one of the following formulas (H2-1) to (H2-2) and any one of the following formulas (H2-3) to (H2-5), or a base sequence forming a stem-loop structure represented by the following formulas (H3-1) to (H3-3).

[0028] [ka] (In the formula, L 1a is a loop of 6 to 8 bases, and L 1b and L 1c are each independently a loop consisting of 14 to 17 bases, L 2a and L 2b are each independently a loop of 6 to 8 bases, and L 2c is a loop consisting of 30 to 32 bases, and L 2d is a loop consisting of 10 to 12 bases, L 2e is a loop consisting of 10 to 12 bases, L 2f is a loop consisting of 5 to 8 bases, L 2g is a loop consisting of 5 to 8 bases, L 3a is a loop consisting of 5 to 8 bases, L 3b is a loop consisting of 15 to 17 bases, L 3c is a loop consisting of 5 to 8 bases.

[0029] In formula (H1), L 1a is preferably a loop of 6 or 7 bases, more preferably a loop of 7 bases, and even more preferably the following L 11 This is a loop represented as follows:

[0030] [ka]

[0031] In formula (H1), L 1b is preferably a loop consisting of 15 or 16 bases, more preferably a loop consisting of 15 bases, and even more preferably the following L 12 This is a loop expressed as:

[0032] [ka]

[0033] In formula (H1), L 1c is preferably a loop consisting of 15 or 16 bases, more preferably a loop consisting of 16 bases, and even more preferably the following L 13 This is a loop represented as follows:

[0034] [ka]

[0035] The three stem-loop structures represented by formula (H1) are preferably represented by the following formula (H11).

[0036] [ka]

[0037] In formula (H2-1), L 2a is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, further preferably a loop consisting of 7 bases, and even more preferably the following L 21 This is a loop represented as follows:

[0038] [ka]

[0039] In formula (H2-1), L 2b is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, further preferably a loop consisting of 7 bases, and even more preferably the following L 22 This is a loop represented as follows:

[0040] [ka]

[0041] The two stem-loop structures represented by formula (H2-1) are preferably represented by the following formula (H21).

[0042] [ka]

[0043] In formula (H2-2), L 2c is preferably a loop of 30 or 31 bases, more preferably a loop of 31 bases, and even more preferably the following L 23 This is a loop represented as follows:

[0044] [ka]

[0045] In formula (H2-2), L 2d is preferably a loop consisting of 10 or 11 bases, more preferably a loop consisting of 11 bases, and even more preferably the following L 24 This is a loop represented as follows:

[0046] [ka]

[0047] The two stem-loop structures represented by formula (H2-2) are preferably represented by the following formula (H22).

[0048] [ka]

[0049] In formula (H2-3), L 2e is preferably a loop consisting of 10 or 11 bases, more preferably a loop consisting of 11 bases, and even more preferably the following L 25 This is a loop represented as follows:

[0050] [ka]

[0051] That is, one stem-loop structure represented by formula (H2-3) is preferably represented by the following formula (H23).

[0052] [ka]

[0053] In formula (H2-4), L2f is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, further preferably a loop consisting of 7 bases, and even more preferably the following L 26 This is a loop represented as follows:

[0054] [ka]

[0055] That is, one stem-loop structure represented by formula (H2-4) is preferably represented by the following formula (H24).

[0056] [ka]

[0057] In formula (H2-5), L 2g is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, further preferably a loop consisting of 7 bases, and even more preferably the following L 27 This is a loop represented as follows:

[0058] [ka]

[0059] That is, one stem-loop structure represented by formula (H2-5) is preferably represented by the following formula (H25).

[0060] [ka]

[0061] The stem-loop structure represented by any of formulas (H2-1) to (H2-2) and any of formulas (H2-3) to (H2-5) is preferably any of (H21) to (H22) and any of (H23) to (H25).

[0062] In formula (H3-1), L 3a is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, further preferably a loop consisting of 7 bases, and even more preferably the following L 31 This is a loop represented as follows:

[0063] [ka]

[0064] That is, one stem-loop structure represented by formula (H3-1) is preferably represented by the following formula (H31).

[0065] [ka]

[0066] In formula (H3-2), L 3b is preferably a loop consisting of 15 or 16 bases, more preferably a loop consisting of 16 bases, and even more preferably the following L 32 This is a loop represented as follows:

[0067] [ka]

[0068] That is, one stem-loop structure represented by formula (H3-2) is preferably represented by the following formula (H32).

[0069] [ka]

[0070] In formula (H3-3), L 3c is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, further preferably a loop consisting of 7 bases, and further preferably the following L33 This is a loop represented as follows:

[0071] [ka]

[0072] That is, one stem-loop structure represented by formula (H3-3) is preferably represented by the following formula (H33).

[0073] [ka]

[0074] The stem-loop structures represented by formulae (H3-1) to (H3-3) are preferably those represented by formulae (H31) to (H33).

[0075] In a specific embodiment of the present disclosure, the aptamer (Dapt-μ) that binds to MOR is preferred. Dapt-μ can act as an MOR agonist, a cAMP inhibitor, or the like. Dapt-μ preferably includes the base sequence S13 shown in SEQ ID NO: 2, the base sequence S23 in which T in the base sequence S13 is replaced with U, the base sequence S33 having 80% or more identity to the base sequence S13 or S23, or the base sequence S43 in which 1 to 5 bases are substituted, deleted, inserted, and / or added to the base sequence S13 or S23. Dapt-μ preferably includes the base sequence S13 shown in SEQ ID NO: 2, the base sequence S33 having 80% or more identity to the base sequence S13, or the base sequence S43 in which 1 to 5 bases are substituted, deleted, inserted, and / or added to the base sequence S13. Dapt-μ preferably includes at least one base sequence that forms a stem-loop structure selected from the following formulae (H4-1) to (H4-8). Dapt-μ preferably contains a base sequence forming a stem-loop structure represented by any one of the following formulae (H4-1) to (H4-3), any one of the following formulae (H4-4) to (H4-5), and any one of the following formulae (H4-6) to (H4-8).

[0076] [ka] (In the formula, L 4a , L 4b , L 4c , L 4d , L 4e , L 4f , and L 4g are each independently a loop consisting of 5 to 8 bases, L 4h is a loop of 8 to 10 bases, L 4i is a loop consisting of 20 to 22 bases.

[0077] In formula (H4-1), L 4a is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases. 41 This is a loop represented as follows:

[0078] [ka]

[0079] That is, one stem-loop structure represented by formula (H4-1) is preferably represented by the following formula (H41).

[0080] [ka]

[0081] In formula (H4-2), L 4b is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases. 42 This is a loop represented as follows:

[0082] [ka]

[0083] That is, one stem-loop structure represented by formula (H4-2) is preferably represented by the following formula (H42).

[0084] [ka]

[0085] In formula (H4-3), L 4c is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases. 43 This is a loop represented as follows:

[0086] [ka]

[0087] In formula (H4-3), L 4d is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases. 44 This is a loop represented as follows:

[0088] [ka]

[0089] The two stem-loop structures represented by formula (H4-3) are preferably represented by the following formula (H43).

[0090] [ka]

[0091] In formula (H4-4), L 4e is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases.45 This is a loop represented as follows:

[0092] [ka]

[0093] That is, one stem-loop structure represented by formula (H4-4) is preferably represented by the following formula (H44).

[0094] [ka]

[0095] In formula (H4-5), L 4f is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases. 46 This is a loop represented as follows:

[0096] [ka]

[0097] That is, one stem-loop structure represented by formula (H4-5) is preferably represented by the following formula (H45).

[0098] [ka]

[0099] In formula (H4-6), L 4g is preferably a loop consisting of 6 to 8 bases, more preferably a loop consisting of 6 or 7 bases, and further preferably a loop consisting of 7 bases. 47 This is a loop represented as follows:

[0100] [ka]

[0101] That is, one stem-loop structure represented by formula (H4-6) is preferably represented by the following formula (H46).

[0102] [ka]

[0103] In formula (H4-7), L 4h is preferably a loop of 8 or 9 bases, more preferably a loop of 9 bases, 48 This is a loop represented as follows:

[0104] [ka]

[0105] That is, one stem-loop structure represented by formula (H4-7) is preferably represented by the following formula (H47).

[0106] [ka]

[0107] In formula (H4-8), L 4i is preferably a loop consisting of 20 or 21 bases, more preferably a loop consisting of 21 bases, 49 This is a loop represented as follows:

[0108] [ka]

[0109] That is, one stem-loop structure represented by formula (H4-8) is preferably represented by the following formula (H48).

[0110] [ka]

[0111] The stem-loop structure represented by any of formulae (H4-1) to (H4-3), any of (H4-4) to (H4-5), and (H4-6) to (H4-8) is preferably represented by any of formulae (H41) to (H43), any of (H44) to (H45), and (H46) to (H48).

[0112] In a preferred embodiment of the present disclosure, Dapt-μ preferably comprises the base sequence shown in SEQ ID NO: 44 (CCTAACATTTAGAGCCGTGTCGTACGA).

[0113] The aptamer can be produced by, for example, the SELEX (Systematic Evolution of Ligands by Exponential enrichment) method. Among the SELEX methods, it is preferable to adopt the improved Cell-SELEX method shown in Figure 1, the EV-SELEX method shown in Figure 2, or both of them, and it is more preferable to adopt at least the EV-SELEX method.

[0114] The aptamer may form a complex by binding (covalently or non-covalently) to a functional substance. Examples of the functional substance include proteins, antibodies, peptides, amino acids, lipids, sugars, labeling substances (fluorescent substances, luminescent substances, radioisotopes, etc.), enzymes, drugs, toxins, etc. These may be used alone or in combination of two or more.

[0115] A medicine or reagent according to one embodiment of the present disclosure includes the above-mentioned aptamer. The medicine or reagent preferably further includes a pharma- ceutically acceptable excipient or carrier and / or additive.

[0116] Examples of the excipient or carrier include solid carriers such as starch, lactose, crystalline cellulose, sorbitol, calcium hydrogen phosphate, etc., and liquid carriers such as water, ethanol, (poly)ethylene glycol, (poly)propylene glycol, glycerol, vegetable oil, etc. These may be used alone or in combination of two or more.

[0117] Examples of the additives include binders, disintegrants, dispersants, surfactants, lubricants, buffers, isotonicity agents, thickeners, chelating agents, emulsifiers, colorants, preservatives, flavoring agents, etc. These may be used alone or in combination of two or more.

[0118] The medicament may be for oral, parenteral or topical administration, for example for intraocular, otic, intranasal, sublingual, intrabronchial, intravenous, intramuscular, intraperitoneal, rectal, intravaginal or transdermal administration, or for injection.

[0119] The above-mentioned medicines can be used for the prevention and / or treatment of diseases associated with mGluR1, A1R, or MOR (homocomplex) or A1R-mGluR1 (heterocomplex) (specifically, diseases that can be prevented or treated by agonistic, antagonistic, or allosteric ligand actions on these GPCRs), such as neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, spinocerebellar degeneration, and amyotrophic lateral sclerosis, pain, etc. The above-mentioned medicines may be used in combination with other drugs used for these diseases.

[0120] The reagent can measure mGluR1, A1R, or MOR or A1R-mGluR1 in a sample. Such measurement includes, for example, detecting the presence or absence and quantifying. The reagent can also be used as a biomarker for diseases related to mGluR1, A1R, or MOR or A1R-mGluR1.

[0121] The above reagent can be used in various immunological assays, such as immunochromatography, enzyme immunoassay (EIA, ELISA), chemiluminescent immunoassay (ClIA), chemiluminescent enzyme immunoassay (CLEIA), fluorescent enzyme immunoassay (FEIA), radioimmunoassay (RIA), electrochemiluminescent immunoassay (ECLIA), immunoturbidimetry, or latex agglutination, by using the above aptamer instead of or in combination with an antibody. EXAMPLES

[0122] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0123] 1. Construction of cells expressing target factors in a tetracycline-stimulated manner According to the method described in J Pharmacol Sci. 2015 Jul;128(3):125-30, HEK cells (Flp-In T-REx293 HA-MOR cells) were constructed using the Flp-In T-REx293 system (Invitrogen) in which HA-MOR, an HA tag added to the N-terminus of MOR, was expressed in a tetracycline (Tet)-stimulated manner. Tet-stimulation-dependent induction of HA-MOR expression was confirmed by fluorescent immunohistochemical staining and Western blotting using an anti-HA tag antibody. Flp-In T-REx293 HA-DOR cells and Flp-In T-REx293 HA-KOR cells were constructed in which HA-MOR, HA-DOR, and HA-KOR, as well as HA-MOR, were expressed in a Tet-stimulation-dependent manner. These cells are stable expression cell lines cloned and expanded from single cells, and the only difference in the cell surface components is thought to be the target factor induced by Tet stimulation.

[0124] 2. Preparation of MOR-binding aptamer (Dapt-μ) Dapt-μ was obtained by screening a chemically synthesized single-stranded DNA library (76 bases) with PCR primer sequences (18 bases) added to both ends of a random sequence (40 bases) using 24 cycles of the improved Cell-SELEX method and 4 cycles of the EV-SELEX method.

[0125] (Improved Cell-SELEX method) One cycle of screening by the improved Cell-SELEX method shown in Figure 1 includes two rounds of counter selection and one round of selection. In the first round of counter selection, Flp-In T-REx293 HA-MOR(-) cells (without Tet stimulation induction) were used to eliminate DNA aptamers that nonspecifically bind to the HEK293 cell surface. In the second round of counter selection, Flp-In T-REx293 HA-DOR(+) cells (with Tet stimulation induction) were used to eliminate DNA aptamers that nonspecifically bind to HA-DOR. In the selection, Flp-In T-REx293 HA-MOR(+) cells (with Tet stimulation induction) were used to enrich DNA aptamers that specifically bind to HA-MOR.

[0126] To eliminate non-specifically binding DNA aptamers, conditions were set to increase the selection bias with each screening cycle by changing the DNA aptamer binding conditions (incubation time, dish size), DNA aptamer reaction solution composition (testis DNA, yeast tRNA, BSA, fetal bovine serum (FBS)), and washing conditions (solution volume, number of times, time) as shown in Table 1. In anticipation of using the obtained DNA aptamers in an in vivo animal model, a process was introduced to eliminate DNA aptamers that non-specifically bind to FBS in the final screening step.

[0127] [Table 1]

[0128] The DNA aptamers collected in each cycle were amplified using a qPCR device to be used as the starting sample for screening in the next cycle, and the efficiency of selective enrichment of candidate DNA aptamers in each cycle was evaluated by monitoring the melting curve profile. As a result, the melting curve profile changed dramatically as the screening cycle progressed, so the progress of selective enrichment was successfully visualized and confirmed. In addition, since similar melting curve profiles were shown in cycles 21 to 24, the 24th cycle was selected as the final screening cycle.

[0129] At the end of the 24 cycles, the candidate DNA aptamers were collected, and DNA sequence analysis was performed on approximately 100 random clones to determine the base sequence and copy number of the obtained DNA aptamers. As a result, it was revealed that DNA aptamers with 13 different sequences, as shown in Table 2, were selected and enriched.

[0130] [Table 2]

[0131] (EV-SELEX method) One cycle of screening by the EV-SELEX method shown in Figure 2 includes one counter selection and two selections. In the counter selection, Flp-In T-REx293 HA-MOR(-) cells (without Tet stimulation induction) were used to eliminate DNA aptamers that nonspecifically bind to the HEK293 cell surface. In the first selection, Flp-In T-REx293 HA-MOR(+) cells (with Tet stimulation induction) were used to enrich DNA aptamers that specifically bind to HA-MOR. DNA aptamers that specifically bind to HA-MOR are internalized into cells by endocytosis, and some of them are taken up into multivesicular bodies via the endosomal pathway and released into the cell culture medium as a component of extracellular membrane vesicles (EVs) such as exosomes. In the second selection, EVs released from Flp-In T-REx293 HA-MOR(+) cells were collected.

[0132] The collected EVs were purified and fractionated (1 ml x 12 tubes) by 10-60% sucrose gradient ultracentrifugation. All purified fractions were subjected to immuno-Dot blot analysis using anti-HA and anti-CD63 antibodies to attempt to identify EV fractions containing HA-MOR as a component. As a result, fraction 10 (density 1.10 g / cm 3 ) were found to contain a large amount of EVs containing HA-MOR as a component (Figure 3).

[0133] In order to eliminate non-specifically binding DNA aptamers, conditions were set to increase the selection bias with each cycle, as shown in Table 3.

[0134] [Table 3]

[0135] In each cycle, DNA aptamers were recovered from EVs by genetic engineering techniques (phenol / chloroform extraction and ethanol precipitation) and amplified using a qPCR device (PCR reaction using biotinylated primers for recovery with streptavidin magnetic beads) to be used as the starting sample for screening in the next cycle. The efficiency of selective enrichment of candidate DNA aptamers in each cycle was evaluated by monitoring the melting curve profile. As a result, the melting curve profile changed dramatically as the screening cycle progressed, so the progress of selective enrichment was successfully visualized and confirmed. In addition, since similar melting curve profiles were shown in cycles 3 to 4, cycle 4 was designated as the final screening cycle.

[0136] By screening with both 24 cycles of the improved Cell-SELEX method and 4 cycles of the EV-SELEX method, only three types of aptamers having sequences shown in SEQ ID NO: 31, 37, and 43 were selectively enriched in common. In the screening with 4 cycles of the EV-SELEX method, the aptamer having the sequence shown in SEQ ID NO: 31 (percentage: 19.9%) was selectively enriched compared to, for example, the aptamer having the sequence shown in SEQ ID NO: 43 (percentage: 1.9%) and the aptamer having the sequence shown in SEQ ID NO: 37 (percentage: 14.1%). In addition, the aptamer having the sequence shown in SEQ ID NO: 31 showed a more significant improvement in enrichment efficiency compared to the screening with 24 cycles of the improved Cell-SELEX method (percentage: increased from 1.0% to 19.9%).

[0137] The secondary structure of the aptamer having the sequence shown in SEQ ID NO: 31 (hereinafter referred to as "Dapt-μ") was predicted using Mfold (http: / / www.unafold.org / mfold.php), an in silico web analysis program. Among the predicted secondary structures that support the results of the binding region prediction experiment using shortened Dapt-μ, the predicted secondary structure that is the most energetically stable is shown in Figure 4.

[0138] 3. MOR recognition specificity of Dapt-μ 293T cells transiently overexpressing HA-MOR, FLAG-MOR, and Myc-MOR were exposed to 10 nM fluorescently labeled Dapt-μ, and the binding between Dapt-μ and MOR was analyzed by fluorescent staining. The results showed that Dapt-μ recognized MOR but not the labeled Tag (Figure 5).

[0139] The binding properties of Dapt-μ (10 nM) were analyzed by fluorescent staining using Flp-In T-REx293 HA-MOR cells, Flp-In T-REx293 HA-DOR cells, and Flp-In T-REx293 HA-KOR cells, which express MOR in a Tet-dependent manner. As a result, a fluorescent signal was observed only when HA-MOR was expressed, indicating that Dapt-μ can specifically recognize MOR (Figure 6).

[0140] We investigated whether Dapt-μ binds to cell surface MOR using a T-Rex293 cell line stably expressing human MOR fused to a SNAP tag at its N-terminus (ST-MOR). ST-MOR cells were treated with SNAP-surface Alexa fluor 488 to fluorescently label the cell surface ST-MOR, and then incubated with 100 nM T-Dapt-μ and T-Scramble (the same number of bases as the random sequence of Dapt-μ but randomly rearranged; SEQ ID NO: 46-SEQ ID NO: 50 (TTGCGACAGACCTCCTACTTAGATTGCCACGCATTGAGCT-complementary strand of SEQ ID NO: 48)). Colocalization of the surface-labeled ST-MOR with T-Dapt-μ was confirmed by live cell confocal imaging (Figure 7).

[0141] After exposure of Flp-In T-REx293 HA-MOR(+) cells (with Tet stimulation) to 100 nM Dapt-μ, the time course of the absolute amount of Dapt-μ contained in the extracellular EVs was analyzed by qPCR. As a result, the presence of statistically significant Dapt-μ was detected in Flp-In T-REx293 HA-MOR(+) cells (with Tet stimulation) 24 to 26 hours after exposure to Dapt-μ, indicating that Dapt-μ can bind to cell surface MOR (Figure 8).

[0142] It is known that the MOR receptor suppresses the amount of intracellular cAMP upon agonist binding. To verify the specific binding between Dapt-μ and MOR at the cell signaling level, we used the GloSensor TM Using the cAMP assay system (Promega), 293T Glo cAMP22F / HA-MOR co-stable cells were constructed, which stably co-expressed the cAMP sensor factor and HA-MOR. As a negative control cell line, 293T Glo cAMP22F cells stably expressing only the cAMP sensor factor were constructed. The stable expression of HA-MOR in the constructed cells was confirmed by fluorescent immunohistochemistry using an HA tag antibody.

[0143] 293T Glo cAMP22F / HA-MOR co-transfecting cells were exposed to 100 nM of fluorescently labeled Dapt-μ for 1 hour, and the binding activity was evaluated based on the intensity of the fluorescent signal. As a result, a significant fluorescent signal was observed only in 293T Glo cAMP22F / HA-MOR co-transfecting cells, indicating that Dapt-μ can specifically recognize MOR on the cells (Figure 9).

[0144] The dose-dependence of the binding ability of fluorescently labeled Dapt-μ to 293T Glo cAMP22F / HA-MOR co-transfected cells was evaluated by measuring the fluorescence signal intensity. d= 28.3 ± 2.8 (n = 5) (Figure 10A). In addition, the dose-dependence of the cAMP suppression effect of Dapt-μ was examined using 293T Glo cAMP22F / HA-MOR co-expressing cells. As a result, dose-dependence was confirmed, and ED 50 = 21.4 ± 7.8 (n = 3) (Figure 10B).

[0145] Morphine is known as the main agonist of MOR and is an essential drug for medical pain control. Therefore, the cAMP inhibitory effects of Dapt-μ and morphine were compared using 293T Glo cAMP22F / HA-MOR co-transfected cells. As a result, the cAMP inhibitory effects of 100 nM morphine and 100 nM Dapt-μ were almost the same, and a statistically significant inhibitory effect on cAMP levels was confirmed. Furthermore, the inhibitory effect was almost abolished by the coexistence of 10 nM naloxone, an antagonist of MOR. The above results suggest that Dapt-μ binds to MOR and exhibits an agonist effect similar to that of morphine (Figure 11).

[0146] Coronal sections of mouse spinal cord were incubated with T-Dapt-μ labeled with red fluorescent TAMRA and analyzed by confocal fluorescence microscopy. As a result, statistically significant strong red fluorescent signal intensity of T-Dapt-μ was observed in the dorsal horn of the spinal cord. It was shown that red fluorescent-labeled Dapt-μ can recognize the MOR of the dorsal horn of the mouse spinal cord (Figure 12).

[0147] MOR agonists are G i / o Induces protein activation and voltage-dependent Ca 2+ It is known that K channels are inhibited by K+. + Depolarization with rich saline solution increases cytoplasmic Ca 2+ The increase in K was measured by fluorescence imaging. + When rich saline (arrow) was administered for 0.5 seconds, voltage-dependent Ca 2+ Ca channel-mediated 2+In this reaction system, intracellular Ca influx was induced after application of the DNA aptamer (Scramble) with a scrambled sequence of Dapt-μ and Dapt-μ. 2+ The rate of decrease in the peak amplitude of the increase was compared. Striatal neurons are composed of not only MOR-positive neurons but also MOR-negative neurons. 2+ However, 100 nM Dapt-μ increased the Ca influx in most cells. 2+ The peak amplitude of the increase was reduced by 15-30%. The reduction in peak amplitude was statistically significantly greater with Dapt-μ (100 nM; median, 17.1%) than with Scramble (100 nM; median, 8.08%) (p=0.0008, Wilcoxon test). Furthermore, the effect of 100 nM Dapt-μ was partially abolished in the presence of 10 μM naloxone, a competitive antagonist against MOR. Thus, it was revealed that Dapt-μ activates MOR expressed in primary cultured rat striatal neurons (Figure 13).

[0148] The dose-response relationship of the effect of Dapt-μ on MOR in cultured rat striatal neurons was examined. K + Rich saline-induced Ca 2+ The rate of decrease in the increase in Ca after the addition of the Scramble aptamer was measured. Since striatal neurons are composed of not only MOR-positive neurons but also MOR-negative neurons, it is highly likely that data smaller than the median are derived from MOR-negative neurons. 2+ Apply the Hill equation to data that exceeds the median rate of increase or decrease to obtain K d When we estimated d was 45.2 nM (Figure 14).

[0149] 4. Preparation of an aptamer (Dapt-AM) that binds to the A1R-mGluR1 supercomplex Dapt-AM was obtained by screening a chemically synthesized single-stranded DNA library (76 bases) in which PCR primer sequences (18 bases) were added to both ends of a random sequence (40 bases) using nine cycles of the EV-SELEX method.

[0150] Details of the EV-SELEX method are as described above in "2. Construction of Dapt-μ."

[0151] In order to eliminate non-specifically binding DNA aptamers, conditions were set to increase the selection bias with each cycle, as shown in Table 4.

[0152] [Table 4]

[0153] In each cycle, DNA aptamers recovered from EVs by genetic engineering techniques (phenol / chloroform extraction and ethanol precipitation) were amplified using a qPCR device (PCR reaction using biotinylated primers for recovery with streptavidin magnetic beads; 93°C 30 sec → 52°C 20 sec → 72°C 60 sec for 20 cycles) to be used as the starting sample for screening in the next cycle. The selective enrichment efficiency of candidate DNA aptamers in each cycle was evaluated by monitoring the melting curve profile. As a result, the melting curve profile changed dramatically as the screening cycle progressed, so the progress of selective enrichment was successfully visualized and confirmed. In addition, since similar melting curve profiles were shown in the 9th cycle, the 9th cycle was designated as the final screening cycle.

[0154] At the end of the 9 cycles, the candidate DNA aptamers were collected, and DNA sequence analysis was performed on approximately 110 random clones to determine the base sequence and copy number of the obtained DNA aptamers. As a result, it was revealed that DNA aptamers with 30 different sequences, as shown in Table 5, were selected and enriched.

[0155] [Table 5]

[0156] Nine cycles of EV-SELEX screening selectively enriched an aptamer (number of clones: 7, percentage: 6.3%) having a sequence represented by the complementary strand of SEQ ID NO: 45-SEQ ID NO: 1 (CGCCATCCAACCCCCACACCACCACACGGGCATCGTCACC)-SEQ ID NO: 47. The secondary structure of Dapt-AM was predicted by Mfold (http: / / www.unafold.org / mfold.php), an in silico web analysis program. The predicted secondary structure that is most energetically stable is shown in Figure 15.

[0157] 3. Dapt-AM specificity for A1R-mGluR1 supercomplex recognition The mGluR1 synthetic agonist DHPG (3,5-dihydroxyphenylglycine) was administered to the cells to induce mGluR1-G q / 11 The protein-protein kinase C (PKC)-IP3-IP3 receptor intracellular signaling cascade transports Ca from intracellular stores (endoplasmic reticulum) to the cytoplasm. 2+ The fluorescence ratio of the indicator dye fura-2, which had been permeated into the cells beforehand (fluorescence emitted by fura-2 in response to excitation light at 340 nm divided by fluorescence emitted by fura-2 in response to excitation light at 380 nm), was measured to determine cytoplasmic Ca. 2+ The change in concentration was measured (fluorescence imaging). The peak amplitude of the fluorescence ratio (cytoplasmic Ca 2+ The peak increase in mGluR1 concentration was used as an index of the strength of mGluR1 signaling.

[0158] DHPG was administered to the cells, and the peak amplitude of the fluorescence ratio was measured. Next, Dapt-AM was administered, followed by DHPG, and the peak amplitude of the fluorescence ratio was measured. Dapt-AM attenuated the peak amplitude of the fluorescence ratio. On the other hand, such a large attenuation was not observed in the negative control aptamer (hereinafter referred to as "Dapt-AMNC") with a scrambled sequence of 76 bases (SEQ ID NO: 45-SEQ ID NO: 49 (CACGCCGACGCACCCTCCACATTACACACCGCACCCCGCA)-complementary strand of SEQ ID NO: 47) (there was a slight run-down due to repeated administration of DHPG). The degree of attenuation was significantly greater in Dapt-AM than in Dapt-AMNC, indicating that Dapt-AM has a pharmacological effect of suppressing mGluR1 signals (Figure 16).

[0159] The above-mentioned DHPG administration → Apt-AM administration → DHPG administration was performed while changing the concentration of Dapt-AM, and the dose-response characteristics of Dapt-AM were measured (Figure 17). From the Hill function fitted to this data, K d = 13.4 nM. This binding affinity is equivalent to or greater than that of an antibody, indicating that Dapt-AM has extremely high target binding affinity.

Claims

1. An aptamer that binds to a GPCR selected from the group consisting of A1R-mGluR1 and MOR.

2. The aptamer described in claim 1, comprising a base sequence S1 shown in any one of SEQ ID NOs: 1 to 43, a base sequence S2 in which T in base sequence S1 is replaced with U, a base sequence S3 having 80% or more identity to base sequence S1 or S2, or a base sequence S3 in which 1 to 5 bases have been substituted, deleted, inserted, and / or added to base sequence S1 or S2.

3. The aptamer according to claim 1, comprising a base sequence S11 shown in SEQ ID NO: 1 or 31, a base sequence S21 in which T in base sequence S11 is replaced with U, a base sequence S31 having 80% or more identity to base sequence S11 or S21, or a base sequence S41 in which 1 to 5 bases have been substituted, deleted, inserted, and / or added to base sequence S11 or S21.

4. The aptamer according to any one of claims 1 to 3, comprising a base sequence that forms three or four stem-loop structures.

5. K for the GPCR d The aptamer according to any one of claims 1 to 3, wherein the affinity of the aptamer is 100 nM or less.

6. An aptamer that binds to A1R-mGluR1, The present invention includes a base sequence S12 shown in SEQ ID NO: 1, a base sequence S32 having 80% or more identity to the base sequence S12, or a base sequence S42 in which 1 to 5 bases are substituted, deleted, inserted, and / or added to the base sequence S12, An aptamer comprising a base sequence forming a stem-loop structure represented by the following formula (H1), a base sequence forming a stem-loop structure represented by any of the following formulas (H2-1) to (H2-2) and any of the following formulas (H2-3) to (H2-5), or a base sequence forming a stem-loop structure represented by the following formulas (H3-1) to (H3-3). 【Chemistry 1】 (In the formula, L 1a is a loop consisting of 5 to 8 bases, and L 1b and L 1c are each independently a loop consisting of 14 to 17 bases, L 2e is a loop consisting of 10 to 12 bases, L 2f is a loop consisting of 5 to 8 bases, L 2g is a loop consisting of 5 to 8 bases, L 3a is a loop consisting of 5 to 8 bases, L 3b is a loop consisting of 15 to 17 bases, L 3c is a loop consisting of 5 to 8 bases.)

7. The aptamer according to claim 6, comprising a base sequence forming a stem-loop structure represented by the following formula (H11), a base sequence forming a stem-loop structure represented by any of the following formulas (H21) to (H22) and any of the following formulas (H23) to (H25), or a base sequence forming a stem-loop structure represented by the following formulas (H31) to (H33). 【Chemistry 2】

8. An aptamer that binds to MOR, The nucleic acid sequence includes a nucleic acid sequence S13 shown in SEQ ID NO: 31, a nucleic acid sequence S33 having 80% or more identity to the nucleic acid sequence S13, or a nucleic acid sequence S43 having 1 to 5 nucleotide substitutions, deletions, insertions, and / or additions to the nucleic acid sequence S13, An aptamer comprising a base sequence forming a stem-loop structure represented by any one of the following formulas (H4-1) to (H4-3), any one of the following formulas (H4-4) to (H4-5), and any one of the following formulas (H4-6) to (H4-7). 【Chemistry 3】 (In the formula, L 4a , L 4b , L 4c , L 4d , L 4e , L 4f , and L 4g are each independently a loop of 5 to 8 bases, L 4h is a loop of 8 to 10 bases, L 4i is a loop consisting of 20 to 22 bases.)

9. The aptamer according to claim 8, comprising a base sequence that forms a stem-loop structure represented by any one of the following formulas (H41) to (H43), a base sequence that forms a stem-loop structure represented by any one of the following formulas (H44) to (H45), and a base sequence that forms a stem-loop structure represented by any one of the following formulas (H46) to (H48). 【Chemistry 4】

10. A pharmaceutical or reagent comprising the aptamer according to any one of claims 1 and 6 to 9.

Images