Compositions and methods for inhibiting PCSK9

Abstract

To provide a dsRNA composition targeting PCSK9, a method for inhibiting PCSK9 gene expression, and a method for treating one or more diseases associated with PCSK9 gene expression.SOLUTION: Provided herein is a double stranded ribonucleic acid (dsRNA) comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, where the first and second sequences are complementary, and the first sequence comprises a specific sequence. The dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and optionally inhibits the expression of proprotein converting enzyme subtilisin-kexin 9 (PCSK9) gene.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to dsRNA compositions targeting proprotein convertase subtilisin kexin 9 (PCSK9), methods of inhibiting PCSK9 gene expression, and methods of treating one or more diseases associated with PCSK9 gene expression.

[0002] Submission of sequence listing The nucleic acid sequences disclosed herein serve as references. The same sequences are also shown in the sequence listing, which is formatted according to the standard requirements for patent purposes. If any sequence differs from the standard sequence listing, it should refer to the sequence described herein. [Background technology]

[0003] PCSK9 is a member of the subtilisin serine protease family. The other eight mammalian subtilisin proteases PCSK1-8 are proprotein convertases that process a wide variety of proteins in the secretory pathway and play a role in diverse biological processes. PCSK9 has been proposed to play a role in cholesterol metabolism. PCSK9 messenger RNA (mRNA) expression is downregulated by dietary cholesterol intake in mice (Non-Patent Document 1), upregulated by statins in HepG2 cells (Non-Patent Document 2), and upregulated in sterol regulatory element binding protein (SREBP) transgenic mice (Non-Patent Document 3), and is similar to cholesterol biosynthetic enzymes and low-density lipoprotein receptor (LDLR). Furthermore, PCSK9 missense mutations have been found to be associated with a form of autosomal dominant hypercholesterolemia (Non-Patent Document 4, Non-Patent Document 5, Non-Patent Document 6). PCSK9 may also play a role in determining low-density lipoprotein (LDL) cholesterol levels in the general population, because single nucleotide polymorphisms (SNPs) have been associated with cholesterol levels in the Japanese population (Non-Patent Document 7).

[0004] Autosomal dominant hypercholesterolemia (ADH) is a monogenic disease in which patients exhibit elevated total and LDL cholesterol levels, tendon xanthomas, and early atherosclerosis (Non-Patent Document 8). The pathogenesis of ADH and the recessive form of autosomal recessive hypercholesterolemia (ARH) (Non-Patent Document 9) is due to defective LDL uptake by the liver. ADH is caused by LDLR mutations that prevent LDL uptake or by mutations in apolipoprotein B, a protein on LDL that binds to LDLR. ARH is caused by mutations in the low density lipoprotein receptor adaptor protein 1 (LDLRAP1) protein, which is required for endocytosis of the LDLR-LDL complex via interaction with clathrin.

[0005] Overexpression studies have shown a role for PCSK9 in controlling LDLR levels (and thus LDL uptake by the liver) (Non-Patent Document 10, Non-Patent Document 11, Non-Patent Document 12). Adenovirus-mediated overexpression of mouse PCSK9 or human PCSK9 in mice increases total and LDL cholesterol levels, an effect that is not seen in LDLR knockout animals (Non-Patent Document 10, Non-Patent Document 11, Non-Patent Document 12). In addition, PCSK9 overexpression significantly reduces hepatic LDLR protein without affecting LDLR mRNA levels, SREBP protein levels, or the nuclear to cytoplasmic ratio of SREBP protein.

[0006] Loss-of-function mutations in PCSK9 have been engineered in mouse models (Non-Patent Document 13), It has been identified in human individuals (Non-Patent Document 14). In both cases, loss of PCSK9 function reduces total LDL cholesterol (LDL-C). The effect of a lifelong reduction in plasma LDL-C associated with sequence variations in the PCSK9 gene has been studied, and data showed that a modest lifelong reduction in plasma levels of LDL-C is associated with a substantial reduction in the incidence of coronary events, providing protection against coronary heart disease (Non-Patent Document 15).

[0007] Double-stranded RNA molecules (dsRNA) are known to block gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi). Patent document 1 disclosed the use of dsRNA of at least 25 nucleotides in length to inhibit gene expression in C.elegans. dsRNA has also been shown to degrade target RNA in other organisms, such as plants (see, for example, Patent Document 2 and Patent Document 3), fruit flies (Drosophila) (see, for example, Non-Patent Document 16), and mammals (see, for example, Patent Document 4). This natural mechanism is currently the focus of the development of a new class of pharmaceuticals for treating disorders caused by abnormal or unwanted regulation of genes. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] International Publication No. 99 / 32619 Brochure [Patent Document 2] WO 99 / 53050 Brochure [Patent Document 3] International Publication No. 99 / 61631 Brochure [Patent Document 4] International Publication No. 00 / 44895 Brochure [Non-patent literature]

[0009] [Non-Patent Document 1] Maxwell, KN (2003) J. Lipid Res. 44, pp. 2109-2119. [Non-Patent Document 2] Duboc, G. (2004) Arterioscler. Thromb. Vasc. Biol. 24, pp. 1454-1459 [Non-Patent Document 3] Horton, J.D. (2003) PNAS 100, pp. 12027 - 12032 [Non - Patent Document 4] Abifadel, M. (2003) Nat. Genet. 34, pp. 154 - 156 [Non - Patent Document 5] Timms, K.M. (2004) Hum. Genet. 114, pp. 349 - 353 [Non - Patent Document 6] Leren, T.P. (2004) Clin. Genet. 65, pp. 419 - 422 [Non - Patent Document 7] Shioji, K. (2004) J. Hum. Genet. 49, pp. 109 - 114 [Non - Patent Document 8] Rader, D.J. (2003) J. Clin. Invest. 111, pp. 1795 - 1803 [Non - Patent Document 9] Cohen, J.C. (2003) Curr. Opin. Lipidol. 14, pp. 121 - 127 [Non - Patent Document 10] Maxwell, K.N. (2004) PNAS 101, pp. 7100 - 7105 [Non - Patent Document 11] Benjannet, S. et al. (2004) J. Biol. Chem. 279, pp. 48865 - 48875 [Non - Patent Document 12] Park, S.W. (2004) J. Biol. Chem. 279, pp. 50630 - 50638 [Non - Patent Document 13] Rashid et al. (2005) PNAS, 102, pp. 5374 - 5379 [Non - Patent Document 14] Cohen et al. (2005) Nature Genetics 37: pp. 161 - 165 [Non - Patent Document 15] Cohen et al. (2006) N. Engl. J. Med. 354: pp. 1264 - 1272 [Non - Patent Document 16] Yang, D. et al. (2000) Curr. Biol. 10:1191~1200 pages Summary of the Invention [Problem to be solved by the invention]

[0010] Due to the importance of PCSK9 in controlling LDL cholesterol and the prevalence of cardiovascular diseases such as hypercholesterolemia, there is a continuing need to identify inhibitors of PCSK9 expression, such as dsRNA, and to test such inhibitors for efficacy and unwanted side effects (e.g., cytotoxicity).

[0011] Patent applications, patent publications, non-patent literature, and UniProtKB / Swiss-Prot All references cited herein, including accession numbers, are hereby incorporated by reference in their entirety, to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference. [Means for solving the problem]

[0012] To meet these and other needs, provided herein are double-stranded ribonucleic acid (dsRNA) useful for inhibiting expression of the proprotein convertase subtilisin kexin 9 (PCKS9) gene.

[0013] Thus, in one aspect, provided herein is a double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, the first sequence and the second sequence being complementary, the first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321, a dsRNA.

[0014] According to another aspect, the disclosure provides a double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein the first sequence and the second sequence are complementary, and the first sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321, the dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and the dsRNA optionally inhibits expression of a proprotein convertase subtilisin kexin 9 (PCSK9) gene.

[0015] In another embodiment, the disclosure provides a double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein the first sequence and the second sequence are complementary, the first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321, said selected sequence comprising less than 30% GC, the dsRNA optionally being a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and the dsRNA optionally inhibits expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene.

[0016] In some embodiments, the dsRNA contains (1) UUUUAUUAAUAUGGUGACU (SEQ ID NO: 6) in the sense strand and AGUCACCAUAUUAAUAAAA (SEQ ID NO: 373) in the antisense strand; or (2) UAUUAAUAUGGU (3) AUUAAUAUGGUGACUUUUU (SEQ ID NO: 8) in the sense strand and AAAAAGUCACCAUAUUAAU (SEQ ID NO: 375) in the antisense strand; (4) UUAAUAUGGUGACUUUUUA (SEQ ID NO: 9) in the sense strand and UAAAAAGUCACCAUAUUAA (SEQ ID NO: 376) in the antisense strand; (5) UAAUAUGGUGACUUUU in the sense strand. (6) UAUGGUGACUUUUUAAAAU (SEQ ID NO: 11) in the sense strand and AUUUUAAAAAGUCACCAUA (SEQ ID NO: 378) in the antisense strand; (7) UUAUUAAUAUGGUGACUUU (SEQ ID NO: 310) in the sense strand and AAAGUCACCAUAUUAAUAA (SEQ ID NO: 380) in the antisense strand; (8) AUAUGGUGACUUUUUAA in the sense strand. (9) AUUUUUAUUAAUAUGGUGACU (SEQ ID NO: 312) in the sense strand and AGUCACCAUAUUAAUAAAAAU (SEQ ID NO: 382) in the antisense strand; (10) UUUUAUUAAUAUGGUGACUUU (SEQ ID NO: 313) in the sense strand and AAAGUCACCAUAUUAAUAAAA (SEQ ID NO: 383) in the antisense strand; (11) UUUAUU (12) containing UAUUAAUAUGGUGACUUUUA (SEQ ID NO: 315) in the sense strand and UAAAAAGUCACCAUAUUAAUA (SEQ ID NO: 385) in the antisense strand; (13) containing AAUAUGGUGACUUUUUAAAAU (SEQ ID NO: 316) in the sense strand and AUUUUAAAAAAAAGUCACCAUAUU (SEQ ID NO: 386) in the antisense strand;(14) GCAUUUUUAUUAAUAUGGUGACU (SEQ ID NO: 317) in the sense strand and AGUCACCAUAUUAAUAAAAAUGC (SEQ ID NO: 387) in the antisense strand; (15) AUUUUUAUUAAUAUGGUGACUUU (SEQ ID NO: 318) in the sense strand and AAAGUCACCAUAUUAAUAAAAAU (SEQ ID NO: 388) in the antisense strand; (16) UUUUUAUUAAUAUGGUGACUUUU (SEQ ID NO: 319) in the sense strand and (17) UUUAUUAAUAUGGUGACUUUUUA (SEQ ID NO: 320) in the sense strand and UAAAAAGUCACCAUAUUAAUAAA (SEQ ID NO: 390) in the antisense strand; or (18) UUAUUAAUAUGGUGACUUUUUAA (SEQ ID NO: 321) in the sense strand and UUAAAAAGUCACCAUAUUAAUAA (SEQ ID NO: 391) in the antisense strand. In some embodiments, the dsRNA comprises: (1) CCAUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO: 176) in the sense strand and AGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 177) in the antisense strand; (2) CCAUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 180) in the sense strand and AAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO: 181) in the antisense strand; or (3) CCAAUUAAUAUGGUGACUUUUUinvdT (sequence (4) comprising CCAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 184) in the sense strand and UAAAAAGUCACCAUAUUAAdTdT (SEQ ID NO: 185) in the antisense strand; (5) comprising CCAUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 186) in the sense strand and UUAAAAAGUCACCAUAUUAdTdT (SEQ ID NO: 187) in the antisense strand;(6) CCAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO: 188) in the sense strand and antisense; (7) comprising CCAUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 322) in the sense strand and AAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 323) in the antisense strand; (8) comprising CCAAUAUGGUGACUUUUUAAAAinvdT (SEQ ID NO: 324) in the sense strand and UUUUAAAAAAAAGUCACCAUAUdtdt (SEQ ID NO: 325) in the antisense strand; (9) comprising CCAUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 322) in the sense strand and AAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 323) in the antisense strand; (10) CCAUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 328) in the sense strand and AAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 329) in the antisense strand; (11) CCAUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 330) and AAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 331) in the antisense strand; (12) CCAUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 332) in the sense strand and UAAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO: 333) in the antisense strand; (13) CCAAAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO: 334) in the sense strand and AUUUUAAAAAGU (14) comprising CCAGCAUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO: 336) in the sense strand and AGUCACCAUAUUAAUAAAAAUGCdTdT (SEQ ID NO: 337) in the antisense strand; (15) comprising CCAAUUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 338) in the sense strand and AAAGUCACCAUAUUAAUAAAAAUdTdT (SEQ ID NO: 339) in the antisense strand;(16) comprising CCAUUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 340) in the sense strand and AAAAGUCACCAUAUUAAUAAAAAdTdT (SEQ ID NO: 341) in the antisense strand; (17) comprising CCAUUUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 342) in the sense strand and UAAAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 343) in the antisense strand; or (18) comprising CCAUUAUUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 344) in the sense strand and UUAAAAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 345) in the antisense strand. In some embodiments, the first sequence is identical to at least 15 contiguous nucleotides of UUGUAGCAUUUUUAUUAAUAUGGUGACUUUUUAAAAUAAAAACAAACA (SEQ ID NO: 2) and is not one of GCAUUUUUAUUAAUAUGGU (SEQ ID NO: 5), UUUGUAGCAUUUUUAUUAAUAUGGU (SEQ ID NO: 576), or AUUUUUAUUAAUAUGGUGA (SEQ ID NO: 577);

[0017] In another aspect, the disclosure relates to a double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, where only the first sequence and the second sequence are complementary, the first sequence being one of SEQ ID NOs: 3, 4, and 13. In another aspect, the disclosure relates to a double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, where only the first sequence and the second sequence are complementary, the first sequence being one of SEQ ID NOs: 3, 4, and 13, the dsRNA optionally being a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), the dsRNA optionally inhibiting expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene. In some embodiments, the disclosure provides that the dSNAs include a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein only the first sequence and the second sequence are complementary, and the first sequence is selected from the group consisting of SEQ ID NOs: 3, 4, and 5. and 13, wherein the first sequence comprises less than 30% GC, the dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and the dsRNA optionally inhibits expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene. In some embodiments, the dsRNA comprises: (19) UUGUAGCAUUUUUAUUAAU (SEQ ID NO: 3) in the sense strand and AUUAAUAAAAAUGCUACAA (SEQ ID NO: 370) in the antisense strand; (20) GUAGCAUUUUUAUUAAUAU (SEQ ID NO: 4) in the sense strand and AUAUUAAUAAAAAUGCUAC (SEQ ID NO: 371) in the antisense strand; or (21) GAGUGUGAAAGGUGCUGAU (SEQ ID NO: 13) in the sense strand and AUCAGCACCUUUCACACUC (SEQ ID NO: 379) in the antisense strand. In some embodiments, the dsRNA comprises: (19) CCAUUGUAGCAUUUUUAUUAAUinvdT (SEQ ID NO: 162) in the sense strand and AUUAAUAAAAAUGCUACAAdTdT (SEQ ID NO: 163) in the antisense strand; (20) CCAGUAGCAUUUUUAUUAAUAUinvdT (SEQ ID NO: 166) in the sense strand and AUAUUAAUAAAAAUGCUACdTdT (SEQ ID NO: 167) in the antisense strand; or (21) CCAGAGUGAAAGGUGCUGAUinvdT (SEQ ID NO: 290) in the sense strand and AUCAGCACCUUUCACACUCdTdT (SEQ ID NO: 291) in the antisense strand.

[0018] In some embodiments that are combined with any of the previous embodiments, the first sequence and the second sequence are each 30 nucleotides or less in length.In some embodiments that are combined with any of the previous embodiments, the first sequence and the second sequence are each at least 19 nucleotides and / or 23 nucleotides or less in length.In some embodiments that are combined with any of the previous embodiments, the dsRNA is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).

[0019] In some embodiments combined with any of the previous embodiments, the dsRNA comprises one or more modified nucleotides. In some embodiments, at least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-phosphorothioate nucleotide, or a terminal nucleotide linked to a cholesterol derivative or lipophilic moiety. In some embodiments, at least one of the one or more modified nucleotides is a 2'-fluoro, 2'-deoxy, 2'-O-methoxyethyl, constrained ethyl (cEt), deoxy, inverted deoxy, inverted dideoxy, locked nucleic acid, abasic, 2'-amino, 2'-alkyl, morpholino, phosphoramidate, or non-natural base-containing nucleotide. In some embodiments, the dsRNA comprises one or more 2'-O-methyl nucleotides and one or more 2'-fluoro nucleotides. In some embodiments, the dsRNA comprises two or more 2'-O-methyl nucleotides and two or more 2'-fluoro nucleotides in the pattern OMe-F-OMe-F or F-OMe-F-OMe, where OMe represents a 2'-O-methyl nucleotide and F represents a 2'-fluoro nucleotide. In some embodiments, the dsRNA comprises up to 10 consecutive nucleotides that are each a 2'-O-methyl nucleotide or up to 10 consecutive nucleotides that are each a 2'-fluoro nucleotide.

[0020] In some embodiments that are combined with any of the previous embodiments, the dsRNA comprises one or more phosphorothioate groups. In some embodiments that are combined with any of the previous embodiments, the dsRNA does not comprise phosphorothioate groups. In some embodiments that are combined with any of the previous embodiments, the dsRNA comprises one or more phosphotriester groups. In some embodiments that are combined with any of the previous embodiments, the dsRNA does not comprise phosphotriester groups.

[0021] In some embodiments combined with any of the previous embodiments, the dsRNA is attached to one or more GalNAc derivatives via a linker.In some embodiments, the dsRNA is attached to three GalNAc derivatives via a trivalent branched linker.In some embodiments, at least one of the one or more GalNAc derivatives is attached to the 3' end of the sense strand, the 3' end of the antisense strand, or the 5' end of the sense strand of the dsRNA.

[0022] In some embodiments combined with any of the previous embodiments, one or both of the sense strand and the antisense strand further comprises a 5' overhang comprising one or more nucleotides. In some embodiments combined with any of the previous embodiments, one or both of the sense strand and the antisense strand further comprises a 3' overhang comprising one or more nucleotides. In some embodiments, the 3' overhang comprises two nucleotides. In some embodiments, the overhang comprises one or more thymines.

[0023] In some embodiments, one or both strands of the dsRNA have Formula (I): [ka] (In the formula, - B is a heterocyclic nucleobase; - one of L1 and L2 is an internucleoside linking group that links the compound of formula (I) to a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or an internucleoside linking group that links the compound of formula (I) to a polynucleotide; - Y is O, NH, NR1, or NC(=O)-R1, where R1 is a (C1-C20) alkyl group, optionally substituted with one or more groups selected from a halogen atom, a (C1-C6) alkyl group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, a (C5-C14) heteroaryl group, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN, -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2), and -N(Z1)-C(=J)-Z2, wherein J is O or S; Each of Z1 and Z2 is independently H, a (C1-C6) alkyl group, optionally a (C1-C6) alkyl group substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group, a (C1-C20) alkyl group; (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; The group -[C(=O)]-R-(O-CH-CH)-R, where m is an integer having a value of 0 or 1; p is an integer ranging from 0 to 10; R2 is a (C1-C20) alkylene group, optionally substituted with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN, -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4), or -N(Z3)-C(=K)-Z4, where K is O or S; Each of Z3 and Z4 is independently H, a (C1-C6) alkyl group, optionally substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group; R3 is selected from the group consisting of a hydrogen atom, a (C1-C6) alkyl group, a (C1-C6) alkoxy group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, or a (C5-C14) heteroaryl group, or R3 is a cell targeting moiety, the group -[C(=O)]m-R2-(O-CH2-CH2)p-R3 and - X1 and X2 each independently represent a hydrogen atom or a (C1-C6) alkyl group; - each of Ra, Rb, Rc, and Rd is independently H or a (C1-C6) alkyl group; or a pharma- ceutically acceptable salt thereof.

[0024] In some embodiments, the dSRNA has the formula (I), a) NR1, where R1 is an unsubstituted (C1-C20) alkyl group; b) NR1, where R1 is an unsubstituted (C1-C16) alkyl group, including an alkyl group selected from the group consisting of methyl, isopropyl, butyl, octyl, and hexadecyl; c) NR1, where R1 is a (C3-C8)cycloalkyl group, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; d) NR1, where R1 is a cyclohexyl group; e) NR1, where R1 is a (C1-C20) alkyl group substituted with a (C6-C14) aryl group; f) NR1, where R1 is a methyl group substituted with a phenyl group; g) NC(=O)-R1, where R1 is an optionally substituted (C1-C20) alkyl group; or h) NC(=O)-R1, where R1 is methyl or pentadecyl. The compound includes one or more of the following compounds:

[0025] In some embodiments, the dsRNA comprises one or more compounds of formula (I), wherein B is selected from the group consisting of pyrimidines, substituted pyrimidines, purines, and substituted purines, or a pharma- ceutically acceptable salt thereof.

[0026] In some embodiments, R3 is a group represented by formula (II): [ka] (In the formula, A1, A2, and A3 are OH; A4 is OH or NHC(=O)-R5, where R5 is (C1-C6 alkyl group, optionally substituted with a halogen atom (C1-C6) alkyl). or a pharma- ceutically acceptable salt thereof.

[0027] In some embodiments, R3 is N-acetyl-galactosamine or a pharma- ceutically acceptable salt thereof.

[0028] In some embodiments, the dsRNA comprises one or more nucleotides from Table A.

[0029] In some embodiments, the dsRNA comprises 2 to 10 compounds of formula (I) or a pharma- ceutically acceptable salt thereof. In some embodiments, the 2 to 10 compounds of formula (I) are present on the sense strand.

[0030] In some embodiments, the sense strand comprises 2-5 compounds of formula (I) at the 5' end and / or 1-3 compounds of formula (I) at the 3' end.

[0031] In some embodiments, a) 2 to 5 compounds of formula (I) at the 5' end of the sense strand include lgT3 and optionally include three consecutive lgT3 nucleotides; and / or b) One to three compounds of formula (I) at the 3' end of the sense strand include an lT4; optionally, two consecutive lT4s.

[0032] In some embodiments, the dsRNA comprises one or more internucleoside linkage groups independently selected from the group consisting of phosphodiester backbone linkage groups, phosphotriester backbone linkage groups, phosphorothioate backbone linkage groups, phosphorodithioate backbone linkage groups, alkyl-phosphonate backbone linkage groups, and phosphoramidate backbone linkage groups, or a pharma- ceutically acceptable salt thereof.

[0033] In some embodiments, the dsRNA is selected from the dsRNAs in Tables 2-4.

[0034] In some embodiments, a) the sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 578, 585, 587, 620, 621, 622, and 627; and / or b) the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 589, 591, 631, 632, 634, 635, and 639.

[0035] In some embodiments, the sense and antisense strands of the dsRNA each have a) SEQ ID NOs: 578 and 589; [C027.001] b) SEQ ID NOs: 620 and 631; [C027.003] c) SEQ ID NOs: 585 and 591; [C027.001#40] d) SEQ ID NOs: 587 and 591; [C027.001#58] e) SEQ ID NOs: 621 and 634; [C027.003#03] f) SEQ ID NOs: 622 and 632; [C027.003#06] g) SEQ ID NOs: 622 and 635; [C027.003#08] h) SEQ ID NOs: 627 and 639; [C027.003#47] The nucleotide sequence of

[0036] In some embodiments combined with any of the preceding embodiments, the dsRNA inhibits expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene. In some embodiments, the PCSK9 gene is a human PCSK9 gene (e.g., comprising the polynucleotide sequence of SEQ ID NO: 1). In some embodiments, the PCSK9 gene is a non-human PCSK9 gene. In some embodiments, the PCSK9 gene is a non-human primate PCSK9 gene (e.g., cynomolgus PCSK9, such as that represented by UniprotKB Accession No. G7NVZ1).

[0037] In another aspect, the disclosure pertains to vectors encoding one or more of the dsRNAs described herein.

[0038] In another aspect, the present disclosure relates to an isolated host cell comprising one or more dsRNAs and / or vectors described herein.

[0039] In another aspect, the disclosure relates to articles of manufacture or kits that include one or more of the dsRNAs and / or vectors described herein.

[0040] In another aspect, the present disclosure relates to a composition comprising one or more dsRNAs and / or vectors described herein.In some embodiments, the composition is a pharmaceutical composition.In some embodiments, the composition comprises a pharma-ceutically acceptable carrier.In some embodiments, the composition comprises a delivery vehicle.In some embodiments, the delivery vehicle is selected from liposomes, lipoplexes, complexes, and nanoparticles.

[0041] In another aspect, the present disclosure relates to a method of inhibiting expression of the PCSK9 gene in a subject, comprising administering to the subject an effective amount of one or more dsRNAs described herein and / or one or more compositions described herein. In another aspect, the present disclosure relates to the use of one or more dsRNAs described herein and / or one or more compositions described herein in a method of inhibiting expression of the PCSK9 gene in a subject. In another aspect, the present disclosure relates to one or more dsRNAs described herein and / or one or more compositions described herein for use in the manufacture of a medicament for inhibiting expression of the PCSK9 gene in a subject. In another aspect, the present disclosure relates to a method of treating or preventing a PCSK9-mediated disease in a subject in need thereof, comprising administering to the subject an effective amount of one or more dsRNAs described herein and / or one or more compositions described herein. In another aspect, the present disclosure relates to the use of one or more dsRNAs described herein and / or one or more compositions described herein in a method of treating or preventing a PCSK9-mediated disease in a subject in need thereof. In some embodiments, the disclosure relates to one or more dsRNAs described herein and / or one or more compositions described herein for use in the manufacture of a medicament for treating or preventing a PCSK9-mediated disease in a subject in need thereof. In some embodiments combined with any of the preceding embodiments, expression of the PCSK9 gene in the liver of the subject is inhibited by the dsRNA. In some embodiments combined with any of the preceding embodiments, the PCSK9-mediated disorder is hypercholesterolemia. In some embodiments combined with any of the preceding embodiments, the administration is subcutaneous, intravenous, or pulmonary. In some embodiments combined with any of the preceding embodiments, the subject is a human. In some embodiments combined with any of the preceding embodiments, the administration reduces serum cholesterol in the subject. In some embodiments combined with any of the preceding embodiments, the method further comprises administering to the subject an effective amount of one or more additional therapeutic agents for treating or preventing a PCSK9-mediated disease.

[0042] It should be understood that one, some, or all of the characteristics of the various embodiments described herein may be combined to form other embodiments of the present disclosure. These and other aspects of the present disclosure will be apparent to those skilled in the art. [Brief description of the drawings]

[0043] [Figure 1] Figure 1 shows qPCR analysis of PCSK9 mRNA expression in untransfected human Hep3B cells or in human Hep3B cells transfected with increasing concentrations of 14 different test siRNAs targeting PCSK9 compared to positive and negative control treatments. * indicates the siRNA that showed the most potent reduction in PCSK9 expression in this assay. [Diagram 2]Figure 2 shows qPCR analysis of PCSK9 mRNA expression in untransfected human C3A cells or in human C3A cells transfected with increasing concentrations of 14 different test siRNAs targeting PCSK9 compared to positive and negative control treatments. * indicates the siRNA that showed the most potent reduction in PCSK9 expression in this assay. [Figure 3A] Figures 3A and 3B show the results of cytotoxicity assay for cells transfected with siRNA targeting PCSK9. Figure 3A shows the results of cytotoxicity assay for human Hep3B cells transfected with siRNA targeting PCSK9. Figure 3B shows the results of cytotoxicity assay for human C3A cells transfected with siRNA targeting PCSK9. [Figure 3B] Figures 3A and 3B show the results of cytotoxicity assay for cells transfected with siRNA targeting PCSK9. Figure 3A shows the results of cytotoxicity assay for human Hep3B cells transfected with siRNA targeting PCSK9. Figure 3B shows the results of cytotoxicity assay for human C3A cells transfected with siRNA targeting PCSK9. [Figure 4] Figure 4 shows qPCR analysis of PCSK9 mRNA expression in untransfected human Hep3B cells or in human Hep3B cells transfected with increasing concentrations of 60 different test siRNAs targeting PCSK9 compared to positive and negative control treatments. * indicates the siRNA that showed the most potent reduction in PCSK9 expression in this assay. [Diagram 5] Figure 5 shows qPCR analysis of PCSK9 mRNA expression in human C3A cells transfected with increasing concentrations of five different test siRNAs targeting PCSK9 compared to positive and negative control treatments. * indicates the siRNA that showed the most potent reduction in PCSK9 expression in this assay. [Figure 6A]Figures 6A and 6B show the results of cytotoxicity assay for cells transfected with siRNA targeting PCSK9. Figure 6A shows the results of cytotoxicity assay for human Hep3B cells transfected with siRNA targeting PCSK9. Figure 6B shows the results of cytotoxicity assay for human C3A cells transfected with siRNA targeting PCSK9. [Figure 6B] Figures 6A and 6B show the results of cytotoxicity assay for cells transfected with siRNA targeting PCSK9. Figure 6A shows the results of cytotoxicity assay for human Hep3B cells transfected with siRNA targeting PCSK9. Figure 6B shows the results of cytotoxicity assay for human C3A cells transfected with siRNA targeting PCSK9. [Figure 7] FIG. 7 shows the amount of PCSK9 protein secreted into the supernatant of human C3A cell cultures for cells transfected with increasing concentrations of the 10 test siRNAs targeting PCSK9, as determined by ELISA assay. [Figure 8] FIG. 8 shows the amount of PCSK9 protein secreted into the supernatant of human C3A cell cultures transfected with three different concentrations of siRNA targeting PCSK9, as determined by ELISA. [Figure 9] FIG. 9 shows the results of a cytotoxicity assay during free uptake of three different concentrations of siRNA targeting PCSK9 in human primary hepatocytes. [Figure 10] FIG. 10 shows the amount of interferon α (IFNα) protein released into the supernatant of human peripheral blood mononuclear cells (PBMCs) isolated from three donors and transfected with siRNA targeting PCSK9, as determined by ELISA. [Figure 11]FIG. 11 shows the in vitro serum stability and relative half-life of siRNA targeting PCSK9 in 50% mouse serum. [Figure 12] FIG. 12 shows a summary of the results of in vitro analysis of siRNAs targeting PCSK9. [Figure 13-1] Figure 13A shows serum PCSK9 levels over time in human PCSK9 transgenic mice treated with a single 10 mg / kg subcutaneous dose of the indicated siRNA targeting PCSK9 on day 0 as measured by ELISA. Figure 13B shows serum total cholesterol levels in these same mice as determined by the COBAS INTEGRA instrument. Figure 13C shows the results of acute toxicity measurements in serum samples on day 3 as determined by the COBAS INTEGRA instrument. Figure 13D shows the results of acute toxicity measurements in serum samples on day 10 as determined by the COBAS INTEGRA instrument. AST = aspartate aminotransferase; ALT = alanine aminotransferase; BUN = blood urea nitrogen. [Figure 13-2] Continued from Figure 13-1. [Figure 14A] FIG. 14A shows qPCR analysis of PCSK9 mRNA expression in untransfected human Hep3B cells or in human Hep3B cells transfected with two different concentrations of additional test siRNA targeting PCSK9, compared to positive and negative control treatments. [Figure 14B] Figure 14B shows qPCR analysis of PCSK9 mRNA expression in untransfected human C3A cells or in human C3A cells transfected with two different concentrations of additional test siRNAs targeting PCSK9, compared to positive and negative control treatments. Arrows indicate siRNAs that showed greater than 50% knockdown of PCSK9 at a concentration of 0.1 nM or greater than 85% knockdown of PCSK9 at a concentration of 1 nM in both Hep3B and C3A cell lines. [Figure 15-1]Figure 15 shows the results of a cytotoxicity assay in Hep3B and C3A cells transfected with two different concentrations of additional test siRNAs targeting PCSK9. X indicates an siRNA with >50% toxicity at a concentration of 50 nM compared to the LV2 negative control. [Figure 15-2] Continued from Figure 15-1. [Figure 15-3] Continued from Figure 15-2. [Figure 15-4] Continued from Figure 15-3. [Figure 16] Figure 16A shows the correlation between the calculated IC50 values ​​in human Hep3B and C3A cells for the siRNAs tested. Figure 16B shows the correlation between the calculated Imax values ​​in human Hep3B and C3A cells for additional siRNAs tested that target PCSK9. [Figure 17] FIG. 17 shows a graph depicting residual PCSK9 mRNA expression levels, normalized to the LV2 non-silencing control, in human primary hepatocytes treated with 100 nM and 1000 nM GalNAc-siRNA from optimized libraries based on parental sequences C027.001, C027.002, and C027.003. [Figure 18] FIG. 18 shows the amount of interferon alpha 2a (IFNα2a) protein (pg / mL) released into the supernatant of human peripheral blood mononuclear cells (PBMCs) isolated from three donors and transfected with siRNA targeting PCSK9, as determined by ELISA. [Figure 19A]Figures 19A-C are graphs showing the relative amounts of serum PCSK9 levels in human PCSK9 transgenic mice treated subcutaneously with a single dose of 42 optimized PCSK9 GalNAc-siRNAs and 6 mg / kg of each parent molecule on day 0. Figures 19A-C represent data for optimized PCSK9 GalNAc-siRNAs based on parent sequences C027.001, C027.002, and C027.003, respectively. Protein expression is expressed relative to animals treated with PBS vehicle control. Human PCSK9 levels were quantified by ELISA and error bars indicate SEM. [Figure 19B] Figures 19A-C are graphs showing the relative amounts of serum PCSK9 levels in human PCSK9 transgenic mice treated subcutaneously with a single dose of 42 optimized PCSK9 GalNAc-siRNAs and 6 mg / kg of each parent molecule on day 0. Figures 19A-C represent data for optimized PCSK9 GalNAc-siRNAs based on parent sequences C027.001, C027.002, and C027.003, respectively. Protein expression is expressed relative to animals treated with PBS vehicle control. Human PCSK9 levels were quantified by ELISA and error bars indicate SEM. [Figure 19C] Figures 19A-C are graphs showing the relative amounts of serum PCSK9 levels in human PCSK9 transgenic mice treated subcutaneously with a single dose of 42 optimized PCSK9 GalNAc-siRNAs and 6 mg / kg of each parent molecule on day 0. Figures 19A-C represent data for optimized PCSK9 GalNAc-siRNAs based on parent sequences C027.001, C027.002, and C027.003, respectively. Protein expression is expressed relative to animals treated with PBS vehicle control. Human PCSK9 levels were quantified by ELISA and error bars indicate SEM. [Figure 19D] Figures 19D and E show serum LDL cholesterol levels in these same mice 14 days (19D) and 28 days (19E) after siRNA dosing, as determined by a COBAS INTEGRA instrument. [Figure 19E] Figures 19D and E show serum LDL cholesterol levels in these same mice 14 days (19D) and 28 days (19E) after siRNA dosing, as determined by a COBAS INTEGRA instrument. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] The following description sets forth example methods, parameters, etc., however, it should be recognized that such description is not intended as a limitation on the scope of the present disclosure, but rather is provided as a description of example embodiments.

[0045] 1.Definition As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a molecule" optionally includes a combination of two or more such molecules, and the like.

[0046] The term "about" as used herein refers to a normal error range for each value that is readily apparent to one of ordinary skill in the art. Reference herein to "about" a value or parameter includes (and describes) embodiments that are directed to the value or parameter itself.

[0047] Aspects and embodiments of the disclosure described herein are understood to include aspects and embodiments "comprising," "consisting of," and "consisting essentially of." Also, disclosures of embodiments using the term "comprises" or equivalents should be understood to encompass embodiments in which "comprises" is replaced with "consists in."

[0048] As used herein, the term "ribonucleotide" or "nucleotide" includes natural or modified nucleotides, or alternative replacement moieties, as further detailed below. Those skilled in the art will understand that the guanine, cytosine, adenine, uracil, or thymine of the nucleotide can be replaced by other moieties without substantially changing the base pairing properties of the oligonucleotide containing the nucleotide with the replacement moiety. For example, without limitation, a nucleotide containing inosine as a base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, the nucleotide containing uracil, guanine, or adenine of the nucleotide sequence of the present disclosure may be replaced by, for example, a nucleotide containing inosine. Sequences containing such replacement moieties are included as embodiments of the present disclosure.

[0049] As used herein, the term "PCSK9" refers to the proprotein convertase subtilisin kexin 9 gene or protein (also known as FH3, HCHOLA3, NARC-1, and NARC1). As used herein, the term "PCSK9" includes human PCSK9, whose amino acid and nucleotide sequences can be found, for example, in NCBI Reference Sequence: NM_174936.3; mouse PCSK9, whose amino acid and nucleotide sequences can be found, for example, in NCBI Reference Sequence: NM_153565.2; and rat PCSK9, whose amino acid and nucleotide sequences can be found, for example, in NCBI Reference Sequence: NM_199253.2. PCSK9 Additional examples of mRNA sequences are readily available using, for example, GenBank.

[0050] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule, including the mRNA that is the product of RNA processing of a primary transcript formed during transcription of a target gene, e.g., the PCSK9 gene, or a portion thereof.

[0051] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide that comprises a strand of nucleotides represented by a sequence referenced using standard nucleotide nomenclature.

[0052] As used herein, unless otherwise indicated, the term "complementary" when used to describe a first nucleotide sequence with respect to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to react with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions, as would be understood by one of skill in the art. It refers to the ability of an oligonucleotide or polynucleotide to hybridize with a nucleotide sequence and form a double-stranded structure. This includes base pairing of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of the first or second nucleotide sequence. Such sequences can be referred to herein as "fully complementary" to each other. When a first sequence is referred to herein as "substantially complementary" to a second sequence, the two sequences may be fully complementary, or they may form one or more, but not more than four, three, or two mismatched base pairs upon hybridization while retaining the ability to hybridize under the conditions most relevant to their ultimate application. However, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered as mismatches in determining complementarity. For example, a double-stranded RNA (dsRNA) comprising a first oligonucleotide 21 nucleotides in length and a second oligonucleotide 23 nucleotides in length, where the second oligonucleotide comprises a 21 nucleotide sequence that is fully complementary to the first oligonucleotide, may still be referred to as "fully complementary" for the purposes of this disclosure. Also, a "complementary" sequence may include or be entirely composed of non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, so long as the above requirements for their ability to hybridize are met. The terms "complementary," "fully complementary," and "substantially complementary" may be used to refer to base matching between the sense and antisense strands of a dsRNA or between the antisense strand of a dsRNA and a target sequence, as understood with respect to their use.As used herein, a polynucleotide that is "substantially complementary to at least a portion" of an mRNA refers to a polynucleotide that is substantially complementary to a continuous portion of an mRNA of interest (e.g., an mRNA encoding PCSK9). For example, a polynucleotide is substantially complementary to at least a portion of a PCSK9 mRNA if the sequence is substantially complementary to a non-interrupted portion of the mRNA encoding PCSK9.

[0053] As used herein, the term "double-stranded RNA" or "dsRNA" refers to a complex of ribonucleic acid molecule(s) having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands as defined above. The two strands forming the double-stranded structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules. If they are separate RNA molecules, such dsRNA is often referred to in the literature as short interfering RNA (siRNA). If the two strands are parts of one larger molecule and are therefore connected by an uninterrupted chain of nucleotides between the 3' end of the first strand and the 5' end of the second strand forming the double-stranded structure, the connecting RNA strand is referred to as a "hairpin loop", "short hairpin RNA", or "shRNA". If the two strands are covalently linked by means other than an uninterrupted chain of nucleotides between the 3' end of the first strand and the 5' end of the second strand forming the double-stranded structure, the connecting structure is referred to as a "linker". The "RNA" strands may have the same or different number of nucleotides. The maximum number of base pairs is the number of oligonucleotides in the short strand of dsRNA minus any overhangs present in the double strand.In addition to double strand structure, dsRNA can include one or more nucleotide overhangs.In addition, as used herein, the term "dsRNA" can include substantial modifications in multiple nucleotides, and can include chemical modifications to ribonucleotides, including all types of modifications disclosed herein or known in the art.Any such modifications are included in "dsRNA" for the purpose of this disclosure when used in siRNA type molecules.

[0054] In some embodiments, the dsRNA comprises modified ribonucleosides, including, for example, deoxyribonucleosides that comprise deoxyribonucleoside overhang(s), one or more deoxyribonucleosides within the double-stranded portion of the dsRNA, etc. However, it is self-evident that double-stranded DNA molecules are not in any way encompassed by the term "dsRNA".

[0055] As used herein, the term "nucleotide overhang" refers to an unpaired nucleotide when the 3' end of the first strand of dsRNA extends beyond the 5' end of the second strand or vice versa, or a nucleotide that protrudes from the double-stranded structure of dsRNA. "Blunt" or "blunt-ended" means that there is no unpaired nucleotide at the end of the dsRNA, i.e., there is no nucleotide overhang. A "blunt-ended" dsRNA is a dsRNA that is double-stranded throughout its entire length, i.e., there is no nucleotide overhang at either end of the molecule. For clarity, the chemical cap or non-nucleotide chemical moiety conjugated to the 3' end and / or 5' end of the dsRNA is not taken into account in determining whether the dsRNA has an overhang or is blunt-ended.

[0056] As used herein, the term "antisense strand" refers to the strand of a dsRNA that contains a sequence that is substantially complementary to a target sequence.

[0057] As used herein, the term "sense strand" refers to the strand of a dsRNA that contains a sequence that is substantially complementary to a region of the antisense strand.

[0058] As used herein, the term "introducing into a cell" means facilitating uptake or absorption into a cell, as understood by those skilled in the art. Absorption or uptake of dsRNA can occur through unaided diffusion or active cellular processes, or by auxiliary agents or devices. The meaning of this term should not be limited to cells in vitro; dsRNA can also be "introduced into a cell" when the cell is part of an organism. In such cases, introduction into a cell includes delivery to the organism. For example, for in vivo delivery, dsRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be mediated by a beta-glucan delivery system (see, for example, Tesz, GJ et al. (2011) Biochem J. 436(2):351-62). In vitro introduction into a cell includes methods known in the art, such as electroporation and lipofection. Further techniques are described herein below or known in the art.

[0059] As used herein, the term "target gene" refers to a gene of interest, e.g., PCSK9, that is targeted for inhibition of expression by a dsRNA of the present disclosure.

[0060] As used herein, the term "PCSK9-related disease" is intended to include any disease associated with PCSK9 gene or protein.Such diseases are caused, for example, by overproduction of PCSK9 protein, by PCSK9 gene mutation, by abnormal cleavage of PCSK9 protein, by abnormal interaction between PCSK9 and other proteins or other endogenous or exogenous substances.Exemplary PCSK9-related diseases include, but are not limited to, lipidemia, such as hyperlipidemia, and other types of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart disease and circulatory disease.

[0061] As used herein, the terms "inhibit expression of" or "inhibiting expression of," as they refer to the PCSK9 gene, refer to inhibiting expression of a first cell or a second cell. "Inhibiting" refers to at least partial suppression of expression of the PCSK9 gene as represented by a reduction in the amount of mRNA transcribed from the PCSK9 gene isolated from a first cell or group of cells in which the PCSK9 gene is transcribed and treated to inhibit expression of the PCSK9 gene, compared to a second cell or group of cells (control cells) that is substantially identical to the first cell or group but has not been treated to inhibit expression of the PCSK9 gene. As used herein, the term "inhibiting" is used interchangeably with "reducing," "silencing," "downregulating," "suppressing," and other similar terms, and includes any level of inhibition. The degree of inhibition is usually expressed in terms of (((mRNA in control cells)-(mRNA in treated cells)) / (mRNA in control cells))·100%.

[0062] Alternatively, the degree of inhibition may be shown in terms of parameters functionally linked to PCSK9 gene transcription, such as the amount of protein encoded by PCSK9 gene secreted by cells, or the number of cells that exhibit a certain phenotype, such as apoptosis.In principle, PCSK9 gene silencing can be determined in any cell that expresses target constitutively or by genomic engineering, and by any suitable assay.However, when a criterion is required to determine whether a given dsRNA inhibits the expression of PCSK9 gene to a certain degree and therefore is included in the present disclosure, the assay provided in the following examples can be used as such a criterion.

[0063] As used herein, with respect to PCSK9 expression, the terms "treat", "treatment" and the like refer to alleviation or relief from pathological processes mediated by target gene expression. With respect to the present disclosure, insofar as it relates to any of the other conditions (other than pathological processes mediated by target expression) listed herein below, the terms "treat", "treatment" and the like refer to alleviating or relieving one or more symptoms associated with such conditions. For example, with respect to hyperlipidemia, treatment includes reducing serum lipid levels.

[0064] As used herein, the terms "prevent" or "delay the progression of" (and grammatical variations thereof) in reference to a disease or disorder refer to the prophylactic treatment of the disease, for example, in an individual suspected of having the disease or at risk of developing the disease. Prevention can include, but is not limited to, preventing or delaying the onset or progression of the disease, and / or maintaining one or more symptoms of the disease below a desired level or pathological level. For example, with respect to hyperlipidemia, prevention can include maintaining serum lipid levels at a desired level in an individual suspected of having or at risk of developing hyperlipidemia.

[0065] As used herein, the terms "therapeutically effective amount" and "prophylactically effective amount" refer to an amount that provides a therapeutic effect in the treatment, prevention, or management of a pathological process mediated by target gene expression, e.g., PCSK9 gene expression, or overt symptoms of a pathological process mediated by target gene expression, e.g., PCSK9 gene expression. The specific amount that is therapeutically effective can be easily determined by a medical practitioner of ordinary skill, and can vary depending on factors known in the art, such as, for example, the type of pathological process mediated by target gene expression, e.g., PCSK9 gene expression, the patient's medical history and age, the stage of the pathological process mediated by target gene expression, e.g., PCSK9 gene expression, and the administration of other agents that inhibit the process mediated by target gene expression, e.g., PCSK9 gene expression.

[0066] As used herein, the term "individual" or "subject" refers to a mammal. Mammals include domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., For example, humans and non-human primates such as monkeys, rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0067] 2. Double-stranded RNA (dsRNA) Certain aspects of the present disclosure relate to double-stranded ribonucleic acid (dsRNA) molecules targeting PCSK9. In some embodiments, the dsRNA comprises two strands, a sense strand comprising a first sequence and an antisense strand comprising a second strand, and the first strand and the second strand are sufficiently complementary to hybridize to form a double-stranded structure. In some embodiments, the sense strand comprises a first sequence that is substantially complementary or completely complementary to the second sequence in the antisense strand. In some embodiments, the second sequence in the antisense strand is substantially complementary or completely complementary to the target sequence. In some embodiments, the target sequence is derived from the sequence of an mRNA formed during expression of a target gene (e.g., an mRNA formed during expression of a PCSK9 gene). In some embodiments, the PCSK9 gene is a human PCSK9 gene, such as a human PCSK9 gene described herein. In some embodiments, the PCSK9 gene is a non-human PCSK9 gene. In some embodiments, the PCSK9 gene is a non-human primate PCSK9 gene (e.g., cynomolgus monkey PCSK9 (UniprotKB Accession No. G7NVZ1)). In some embodiments, the dsRNA inhibits expression of the PCSK9 gene. In some embodiments, the dsRNA is a small interfering RNA (siRNA). In some embodiments, the dsRNA is a short hairpin RNA (shRNA).

[0068] In some embodiments, the sense strand and the antisense strand of the dsRNA are present in two separate molecules. In some embodiments, the double-stranded region is formed between a first sequence in the sense strand and a second sequence in the antisense strand of the two separate molecules. In some embodiments, the dsRNA is an siRNA. In some embodiments, the two separate molecules are not covalently linked to each other. In some embodiments, the two separate molecules are covalently linked to each other. In some embodiments, the two separate molecules are covalently linked to each other by means other than a hairpin loop. In some embodiments, the two separate molecules are covalently linked to each other by a connecting structure (referred to herein as "covalent linker").

[0069] In some embodiments, each of the first sequence (in the sense strand) and the second sequence (in the antisense strand) can range from 9 to 30 nucleotides in length. For example, each sequence can be 12 to 30 nucleotides in length, 14 to 30 nucleotides in length, 15 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 15 to 26 nucleotides in length, 15 to 23 nucleotides in length, 15 to 22 nucleotides in length, 15 to 21 nucleotides in length, 15 to 20 nucleotides in length, 15 to 19 nucleotides in length, 15 to 18 nucleotides in length, 15 to 17 nucleotides in length, 17 to 30 nucleotides in length, or 18 to 24 nucleotides in length. may be 17-23 nucleotides in length, may be 17-21 nucleotides in length, may be 17-19 nucleotides in length, may be 18-30 nucleotides in length, may be 18-26 nucleotides in length, may be 18-25 nucleotides in length, may be 18-23 nucleotides in length, may be 18-22 nucleotides in length, may be 18-21 nucleotides in length, may be 18-20 nucleotides in length, may be 19-30 nucleotides in length, may be 19-25 nucleotides in length, may be 19-24 nucleotides in length, may be 19-23 nucleotides in length may be 19-22 nucleotides in length, may be 19-21 nucleotides in length, may be 19-20 nucleotides in length, may be 20-30 nucleotides in length, may be 20-26 nucleotides in length, may be 20-25 nucleotides in length, may be 20-24 nucleotides in length, may be 20-23 nucleotides in length, may be 20-22 nucleotides in length, may be 20-21 nucleotides in length, may be 21-30 nucleotides in length, may be 21-26 nucleotides in length, may be 21-25 nucleotides in length, may be 21-24 nucleotides in length, may be 21-23 nucleotides in length, or may be 21-22 nucleotides in length. In some embodiments, each sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 or more nucleotides in length. In some embodiments, each sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or less nucleotides in length. That is, each sequence can be anywhere in the range of nucleotide lengths having an upper limit of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides and an independently selected lower limit of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides less than the upper limit. In some embodiments, each sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the first sequence and the second sequence are each no more than 30 nucleotides in length. In some embodiments, the first sequence and the second sequence are at least 19 and no more than 23 nucleotides in length, respectively.In some embodiments, the first sequence and the second sequence are different in length.In some embodiments, the first sequence is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides longer than the second sequence.In some embodiments, the second sequence is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides longer than the first sequence.In some embodiments, the first sequence and the second sequence are the same in length.

[0070] In some embodiments, each of the sense and antisense strands can range from 9 to 36 nucleotides in length. For example, each strand can be 12 to 30 nucleotides in length, 14 to 30 nucleotides in length, 15 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 15 to 26 nucleotides in length, 15 to 23 nucleotides in length, 15 to 22 nucleotides in length, 15 to 21 nucleotides in length, 15 to 20 nucleotides in length, 15 to 19 nucleotides in length, 15 to 18 nucleotides in length, 15 to 17 nucleotides in length, 17 to 30 nucleotides in length, or 17 to 23 nucleotides in length. , may be 17-21 nucleotides in length, may be 17-19 nucleotides in length, may be 18-30 nucleotides in length, may be 18-26 nucleotides in length, may be 18-25 nucleotides in length, may be 18-23 nucleotides in length, may be 18-22 nucleotides in length, may be 18-21 nucleotides in length, may be 18-20 nucleotides in length, may be 19-30 nucleotides in length, may be 19-25 nucleotides in length, may be 19-24 nucleotides in length, may be 19-23 nucleotides in length, may be 19-22 nucleotides in length, may be 19-21 ... It may be 20 nucleotides, may be 20-30 nucleotides in length, may be 20-26 nucleotides in length, may be 20-25 nucleotides in length, may be 20-24 nucleotides in length, may be 20-23 nucleotides in length, may be 20-22 nucleotides in length, may be 20-21 nucleotides in length, may be 21-30 nucleotides in length, may be 21-26 nucleotides in length, may be 21-25 nucleotides in length, may be 21-24 nucleotides in length, may be 21-23 nucleotides in length, or may be 21-22 nucleotides in length. In some embodiments, each strand is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 or more nucleotides in length. In some embodiments, each strand is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 or less nucleotides in length. That is, each strand can be any nucleotide length range having an upper limit of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides and an independently selected lower limit of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides, which is less than the upper limit. In some embodiments, each strand is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 nucleotides in length.In some embodiments, sense strand and antisense strand are the same number of nucleotides in length.In some embodiments, sense strand and antisense strand are different number of nucleotides in length.

[0071] In some embodiments, the first sequence (in the sense strand) and the second sequence (in the antisense strand) contain less than 30% GC. "Less than 30% GC" means that less than 30% of the nucleotides of the sequence are G (guanine) or C (cytosine) compared to the total nucleotide content of the first sequence and / or the second sequence. The G (guanine) nucleotide content and the C (cytosine) nucleotide content also include modified G and C nucleotides. Such modifications are described below, and include, for example, 2'-O-methylguanosine (mG), 2'-methylcytidine (mC), 2'-fluoro-guanosine (fG), 2'-fluoro-cytidine (fC), or locked guanine and locked cytosine (lG and lC). Without wishing to be bound by any theory, the inventors note that the dsRNA of the present disclosure with a GC content of less than 30% shows relatively high efficacy in knocking down the expression of human PCSK9.

[0072] Overhang In some embodiments, the dsRNA of the present disclosure comprises one or more overhangs at the 3' end, 5' end, or both ends of one or both of the sense strand and the antisense strand.In some embodiments, the one or more overhangs improve the stability and / or inhibitory activity of the dsRNA.

[0073] In some embodiments, the overhang comprises 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, or 6 or more nucleotides. For example, the overhang may comprise 1-6 nucleotides, 2-6 nucleotides, 3-6 nucleotides, 4-6 nucleotides, 5-6 nucleotides, 1-5 nucleotides, 2-5 nucleotides, 3-5 nucleotides, 4-5 nucleotides, 1-4 nucleotides. , 2-4 nucleotides, 3-4 nucleotides, 1-3 nucleotides, 2-3 nucleotides, or 1-2 nucleotides. In some embodiments, the overhang is 1, 2, 3, 4, 5, or 6 nucleotides in length.

[0074] In some embodiments, the overhang of the present disclosure comprises one or more ribonucleotides. In some embodiments, the overhang of the present disclosure comprises one or more deoxyribonucleotides. In some embodiments, the overhang comprises one or more thymines.

[0075] In some embodiments, the dsRNA comprises an overhang located at the 3' end of the antisense strand. In some embodiments, the dsRNA comprises a blunt end at the 5' end of the antisense strand. In some embodiments, the dsRNA comprises an overhang located at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand. In some embodiments, the dsRNA comprises an overhang located at the 3' end of the sense strand. In some embodiments, the dsRNA comprises a blunt end at the 5' end of the sense strand. In some embodiments, the dsRNA comprises an overhang located at the 3' end of the sense strand and a blunt end at the 5' end of the sense strand. In some embodiments, the dsRNA comprises an overhang located at the 3' end of both the sense strand and the antisense strand of the dsRNA.

[0076] In some embodiments, the dsRNA comprises an overhang located at the 5' end of the antisense strand. In some embodiments, the dsRNA comprises a blunt end at the 3' end of the antisense strand. In some embodiments, the dsRNA comprises an overhang located at the 5' end of the antisense strand and a blunt end at the 3' end of the antisense strand. In some embodiments, the dsRNA comprises an overhang located at the 5' end of the sense strand. In some embodiments, the dsRNA comprises a blunt end at the 3' end of the sense strand. In some embodiments, the dsRNA comprises an overhang located at the 5' end of the sense strand and a blunt end at the 3' end of the sense strand. In some embodiments, the dsRNA comprises an overhang located at the 5' end of both the sense strand and the antisense strand of the dsRNA.

[0077] In some embodiments, the overhang is the result of a longer sense strand compared to the antisense strand. In some embodiments, the overhang is the result of a longer antisense strand compared to the sense strand. In some embodiments, the overhang is the result of a shift in the sense strand and the antisense strand of the same length. In some embodiments, the overhang forms a mismatch with the target mRNA. In some embodiments, the overhang is complementary to the target mRNA.

[0078] In some embodiments, the dsRNA of the present disclosure comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence, and the first sequence and the second sequence are substantially complementary or complementary.In some embodiments, the first sequence and the second sequence are substantially complementary or complementary to form a double-stranded region of the dsRNA.In some embodiments, the double-stranded region of the dsRNA is 9-36 nucleotide pairs in length. For example, the double-stranded region may be 12-30 nucleotide pairs in length, 14-30 nucleotide pairs in length, 15-30 nucleotide pairs in length, 15-26 nucleotide pairs in length, 15-23 nucleotide pairs in length, 15-22 nucleotide pairs in length, 15-21 nucleotide pairs in length, 15-20 nucleotide pairs in length, 15-19 nucleotide pairs in length, 15-18 nucleotide pairs in length, 15-17 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, nucleotide pairs, may be 17-19 nucleotide pairs in length, may be 18-30 nucleotide pairs in length, may be 18-26 nucleotide pairs in length, may be 18-25 nucleotide pairs in length, may be 18-24 nucleotide pairs in length, may be 18-23 nucleotide pairs in length, may be 18-22 nucleotide pairs in length, may be 18-21 nucleotide pairs in length, may be 18-20 nucleotide pairs in length, may be 19-30 nucleotide pairs in length, may be 19-25 nucleotide pairs in length, may be 19-24 nucleotide pairs in length, may be 19-23 nucleotide pairs in length, may be 19-22 nucleotide pairs in length, may be 19-21 nucleotide pairs in length, 19-20 nucleotide pairs in length, 20-30 nucleotide pairs in length, 20-26 nucleotide pairs in length, 20-25 nucleotide pairs in length, 20-24 nucleotide pairs in length, 20-23 nucleotide pairs in length, 20-22 nucleotide pairs in length, 20-21 nucleotide pairs in length, 21-30 nucleotide pairs in length, 21-26 nucleotide pairs in length, 21-25 nucleotide pairs in length, 21-24 nucleotide pairs in length, 21-23 nucleotide pairs in length, or 21-22 nucleotide pairs in length. In some embodiments, the double-stranded region of dsRNA is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 or more nucleotide pairs in length.In some embodiments, the double-stranded region of dsRNA is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 or less nucleotide pairs in length.That is, the double-stranded region of the dsRNA can be anywhere in the range of nucleotide pairs in length having an upper limit of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotide pairs and an independently selected lower limit of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotide pairs, which is less than the upper limit. In some embodiments, the double-stranded region is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotide pairs in length. When multiple dsRNAs are used, the double-stranded region of each dsRNA may be the same length as one or more additional dsRNAs or may be of different lengths.

[0079] The target sequence, and the first and second sequences in the dsRNA In some embodiments, the target sequence is derived from the PCSK9 gene (e.g., the human PCSK9 gene). The human PCSK9 gene and associated mRNA sequences are known in the art. In some embodiments, the target mRNA has a sequence as set forth in NCBI Ref.Seq.NM_174936.3. In some embodiments, the human PCSK9 cDNA has the sequence GTCCGATGGGGCTCTGGTGGGCGTGATCTGCGCGCCCCAGGCGTCAAGCACCCACACCCTAGAAGGTTTCCGCAGCGACGTCGAGGCGCTCATGGTTGCAGGCGGGCGCCGCCGTTCAGTTCAGGGTCTGAGCCTGGAGGA GTGAGCCAGGCAGTGAGACTGGCTCGGGCGGGCCGGGACGCGTCGTTGCAGCAGCGGCTCCCAGCTCCCAGCCAGGATTCCGCGCGCCCCTTCACGCGCCCTGCTCCTGAACTTCAGCTCCTGCACAGTCCTCCCCACCG has.

[0080] In some embodiments, the dsRNA antisense strand comprises a sequence that is substantially complementary or complementary to 12-30 nucleotides of a target sequence. For example, the sequence in the antisense strand may be 12-30 nucleotides, 14-30 nucleotides, 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 17-30 nucleotides, 27-30 nucleotides, 17-23 nucleotides, 17-21 nucleotides, 17-19 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-25 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, 19-25 nucleotides, or 12-30 nucleotides of the target sequence. The antisense strand may be substantially complementary to or complementary to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 or more nucleotides of the target sequence. In some embodiments, the sequence in the antisense strand may be substantially complementary or may be complementary to no more than 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides of the target sequence. That is, the sequence in the antisense strand can be substantially complementary to or complementary to any of a range of nucleotides of the target sequence having an upper limit of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29, which is less than the upper limit. In some embodiments, the sequence in the antisense strand may be substantially complementary or complementary to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. When multiple dsRNAs are used, the region of complementarity of each dsRNA may be the same length as one or more additional dsRNAs or may be of different lengths.

[0081] In some embodiments, the target sequence comprises UUGUAGCAUUUUUAUUAAUAUGGUGACUUUUUAAAAUAAAAACAAACA (SEQ ID NO: 2). In some embodiments, the target sequence comprises GAGUGUGAAAGGUGCUGAUGGCCCUCAUCU (SEQ ID NO: 12). In some embodiments, the target sequence (e.g., the first sequence of the sense strand of a dsRNA of the present disclosure) is a sequence set forth in Table 1A.

[0082] [Table 1]

[0083] In some embodiments, the dsRNA of the present disclosure comprises a sense strand comprising a first sequence. In some embodiments, the first sequence comprises a target sequence shown in Table 1A. In some embodiments, the first sequence is a target sequence shown in Table 1A. In some embodiments, the first sequence comprises a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321. In some embodiments, the first sequence comprises a sequence selected from SEQ ID NOs: 6-11 and 310-321. In some embodiments, the first sequence is a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321. In some embodiments, the first sequence is a sequence selected from SEQ ID NOs: 3, 4, and 13. In some embodiments, the first sequence is not any of GCAUUUUUAUUAAUAUGGU (SEQ ID NO: 5), UUUGUAGCAUUUUUAUUAAUAUGGU (SEQ ID NO: 576), or AUUUUUAUUAAUAUGGUGA (SEQ ID NO: 577).

[0084] In some embodiments, the dsRNA of the present disclosure comprises a first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321, and the sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321 comprises less than 30% GC. In some embodiments, the dsRNA of the present disclosure comprises a first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321. The first sequence comprises the selected sequence, and the first sequence comprises less than 30% GC. In some embodiments, the dsRNA of the present disclosure comprises a first sequence that is one of SEQ ID NOs: 3, 4 and 13, and the first sequence comprises less than 30% GC.

[0085] In some embodiments, the dsRNA of the present disclosure comprises an antisense strand that comprises a second sequence. In some embodiments, the second sequence is substantially complementary or completely complementary to the first sequence (i.e., in the sense strand). In some embodiments, the second sequence is substantially complementary to the first sequence (i.e., in the sense strand), and the second strand comprises at least one mismatch (e.g., one mismatch, two mismatches, three mismatches, or four mismatches) with the first strand. In some embodiments, the second sequence is substantially complementary to the first sequence (i.e., in the sense strand), and the second strand comprises one or two mismatches with the first strand. In some embodiments, the second sequence is substantially complementary to a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321, and the second strand comprises at least one mismatch (e.g., one mismatch, two mismatches, three mismatches, or four mismatches) to a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321. In some embodiments, the second sequence is substantially complementary to a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321, and the second strand comprises one or two mismatches to a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321. In some embodiments, the second sequence is fully complementary to the first sequence (i.e., in the sense strand). In some embodiments, the second sequence is fully complementary to a sequence selected from SEQ ID NOs: 3-11, 13, and 310-321.

[0086] In some embodiments, the dsRNA of the disclosure comprises a second sequence that is substantially complementary to a sequence selected from the group consisting of SEQ ID NOs: 3-11 and 310-321, the second sequence comprising less than 30% GC. In some embodiments, the dsRNA of the disclosure comprises a second sequence that is completely complementary to a sequence selected from the group consisting of SEQ ID NOs: 3-11 and 310-321, the second sequence comprising less than 30% GC.

[0087] In some embodiments, the second sequence is substantially complementary or fully complementary to a sequence in SEQ ID NO:2 or a sequence in SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or fully complementary to at least 15 contiguous nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or fully complementary to at least 19 contiguous nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or fully complementary to no more than 30 contiguous nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or fully complementary to at least 19 and no more than 23 contiguous nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence comprises a sequence shown in Table 1B. In some embodiments, the second sequence is a sequence shown in Table 1B.

[0088] [Table 2]

[0089] In some embodiments, the second sequence in the dsRNA of the present disclosure or the antisense strand of the dsRNA comprises one or more mismatches to the target sequence. In some embodiments, the target sequence is SEQ ID NO: 2 or SEQ ID NO: 12. In some embodiments, the second sequence in the dsRNA or the antisense strand of the dsRNA comprises no more than 4, 3, or 2 mismatches to the target sequence. In some embodiments, the second sequence in the dsRNA or the antisense strand of the dsRNA comprises no more than one mismatch to the target sequence. In some embodiments, the one or more mismatches are not located in the center of the region of complementarity. In some embodiments, the one or more mismatches are located within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, within 2 nucleotides, or within 1 nucleotide of the 5'-end and / or 3'-end of the region of complementarity. For example, in the case of a 23 nucleotide dsRNA strand that is complementary to a region of the PCSK9 gene, the dsRNA generally does not contain any mismatches within the central 13 nucleotides of the region of complementarity between the dsRNA strand and the PCSK9 mRNA.

[0090] In some embodiments, the dsRNA of the present disclosure comprises a sense strand and / or an antisense strand as set forth in Table 2 or Table 3. Although the exemplary siRNAs shown in Table 2 contain modifications, siRNAs having the same sequence but differing in number / pattern / type of modifications are also contemplated. siRNAs having the same sequence but without the 2'-O-Me and 2'-fluoro modifications are shown in Table 3. In some embodiments, the dsRNA comprises a sense strand shown in Table 3 but lacks 5'CCA and / or 3'invdT. In some embodiments, the dsRNA comprises an antisense strand shown in Table 3 but lacks 3'dTdT.

[0091] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]

[0092] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

[0093] In some embodiments, the dsRNA comprises one or more modified nucleotides as described in PCT Publication WO 2019 / 170731, the disclosure of which is incorporated herein in its entirety. In such modified nucleotides, the ribose ring is replaced with a six-membered heterocycle. Such modified nucleotides have the formula (I): [ka] (In the formula, - B is a heterocyclic nucleobase; - one of L1 and L2 is an internucleoside linking group that links the compound of formula (I) to a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or an internucleoside linking group that links the compound of formula (I) to a polynucleotide; - Y is O, NH, NR1, or NC(=O)-R1, where R1 is a (C1-C20) alkyl group, optionally substituted with one or more groups selected from a halogen atom, a (C1-C6) alkyl group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, a (C5-C14) heteroaryl group, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN, -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2), and -N(Z1)-C(=J)-Z2, wherein J is O or S; Each of Z1 and Z2 is independently H, a (C1-C6) alkyl group, optionally a (C1-C6) alkyl group substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group, a (C1-C20) alkyl group; (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; The group -[C(=O)]-R-(O-CH-CH)-R, where m is an integer having a value of 0 or 1; p is an integer ranging from 0 to 10; R2 is a (C1-C20) alkylene group, optionally substituted with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN, -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4), or -N(Z3)-C(=K)-Z4, where K is O or S; Each of Z3 and Z4 is independently H, a (C1-C6) alkyl group, optionally substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group; R3 is selected from the group consisting of a hydrogen atom, a (C1-C6) alkyl group, a (C1-C6) alkoxy group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, or a (C5-C14) heteroaryl group, or R3 is a cell targeting moiety, the group -[C(=O)]m-R2-(O-CH2-CH2)p-R3 and - X1 and X2 each independently represent a hydrogen atom or a (C1-C6) alkyl group; - each of Ra, Rb, Rc, and Rd is independently H or a (C1-C6) alkyl group; or a pharma- ceutically acceptable salt thereof.

[0094] In some embodiments, Y is NR1, R1 is an unsubstituted (C1-C20) alkyl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0095] In some embodiments, Y is NR1, R1 is an unsubstituted (C1-C16) alkyl group, the unsubstituted (C1-C16) alkyl group comprising an alkyl group selected from the group including methyl, isopropyl, butyl, octyl, and hexadecyl, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0096] In some embodiments, Y is NR1, R1 is a (C3-C8)cycloalkyl group, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0097] In some embodiments, Y is NR1, R1 is a cyclohexyl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0098] In some embodiments, Y is NR1, R1 is a (C1-C20) alkyl group substituted with a (C6-C14) aryl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0099] In some embodiments, Y is NR1, and R1 is a methyl substituted with a phenyl group. groups, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0100] In some embodiments, Y is NC(=O)-R1, R1 is an optionally substituted (C1-C20) alkyl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0101] In some embodiments, Y is NC(=O)-R1, R1 is selected from the group including methyl and pentadecyl, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meanings as defined for general formula (I) or a pharma- ceutically acceptable salt thereof.

[0102] In some embodiments, the dsRNA has the formula (I), a) NR1, where R1 is an unsubstituted (C1-C20) alkyl group; b) NR1, where R1 is an unsubstituted (C1-C16) alkyl group, including alkyl groups selected from the group consisting of methyl, isopropyl, butyl, octyl, and hexadecyl; c) NR1, where R1 is a (C3-C8)cycloalkyl group, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; d) NR1, where R1 is a cyclohexyl group; e) NR1, where R1 is a (C1-C20) alkyl group substituted with a (C6-C14) aryl group; f) NR1, where R1 is a methyl group substituted with a phenyl group; g) NC(=O)-R1, where R1 is an optionally substituted (C1-C20) alkyl group; or h) NC(=O)-R1, where R1 is methyl or pentadecyl. The compound includes one or more of the following compounds:

[0103] In some embodiments, B is selected from the group comprising pyrimidines, substituted pyrimidines, purines, and substituted purines, or pharma- ceutically acceptable salts thereof.

[0104] In some embodiments, the internucleoside linkage group in the dsRNA is independently selected from the group consisting of phosphodiester backbone linkage group, phosphotriester backbone linkage group, phosphorothioate backbone linkage group, phosphorodithioate backbone linkage group, alkyl-phosphonate backbone linkage group, and phosphoramidate backbone linkage group, or a pharmaceutically acceptable salt thereof.In some embodiments, the dsRNA comprises one or more internucleoside linkage groups, independently selected from the group consisting of phosphodiester backbone linkage group, phosphotriester backbone linkage group, phosphorothioate backbone linkage group, phosphorodithioate backbone linkage group, alkyl-phosphonate backbone linkage group, and phosphoramidate backbone linkage group, or a pharmaceutically acceptable salt thereof.

[0105] In some embodiments, the dsRNA comprises 2 to 10 compounds of formula (I) or a pharma- ceutically acceptable salt thereof. In some embodiments, the 2 to 10 compounds of formula (I) are present on the sense strand.

[0106] In a further embodiment, the dsRNA comprises one or more target nucleotides or a pharma- ceutically acceptable salt thereof.

[0107] In some embodiments, R3 is represented by formula (II): [ka] (In the formula, A1, A2, and A3 are OH; A4 is OH or NHC(=O)-R5, where R5 is a (C1-C6) alkyl group optionally substituted with a halogen atom, or a pharma- ceutically acceptable salt thereof. It is.

[0108] In some embodiments, R3 is N-acetyl-galactosamine or a pharma- ceutically acceptable salt thereof.

[0109] The precursors used to prepare modified siRNAs having nucleotides of formula (I) are illustrated in Table A below. Table A shows examples of phosphoramidite nucleotide analogs for oligonucleotide synthesis. In the (2S,6R) diastereomeric series, phosphoramidites as nucleotide precursors are abbreviated as "pre-l", nucleotide analogs are abbreviated as "l", followed by the nucleobase and number, which defines the group Y in formula (I). To distinguish between both stereochemistries, analogs (2R,6R)-diastereoisomers are indicated by an additional "b". Target nucleotide precursors, target nucleotide analogs, and solid supports are abbreviated as described above, but with "lg" instead of "l".

[0110] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6]

[0111] The modified nucleotide of formula (I) can be incorporated into the 5'-end, 3'-end, or both ends of the sense strand and / or antisense strand of dsRNA.For example, one or more (for example, 1, 2, 3, 4, or 5 or more) modified nucleotides can be incorporated into the 5'-end of the sense strand of dsRNA.In some embodiments, one or more (for example, 1, 2, 3, or more) modified nucleotides are located at the 5'-end of the sense strand, and this modified nucleotide is not complementary to antisense, but optionally forms a pair with the same number or less of the complementary nucleotides of the corresponding 3'-end of antisense strand.

[0112] In some embodiments, the dsRNA is a sense strand having a sense sequence that is 17, 18, or 19 nucleotides in length and is comprised of 3 to 5 nucleotides of Formula (I), e.g. For example, the sense strand may comprise three consecutive nucleotides of formula (I) (e.g., lgT3 or lgT7) with or without additional nucleotides of formula (I) located at the 5'-end of the sense sequence, resulting in a sense strand of 20, 21, or 22 nucleotides in length. In such an embodiment, the sense strand may further comprise two consecutive nucleotides of formula (I) (e.g., lT4 or lT3) at the 3'-end of the sense sequence, resulting in a sense strand of 22, 23, or 24 nucleotides in length. The dsRNA may comprise an antisense sequence of 19 nucleotides in length, further linked to two modified nucleotides or deoxyribonucleotides (e.g., dT) at the 3'-end, resulting in a sense strand of 21 nucleotides in length. In a further embodiment, the sense strand of the dsRNA may comprise only naturally occurring internucleotide bonds (phosphodiester bonds), and the antisense strand may optionally comprise non-naturally occurring internucleotide bonds. For example, the antisense strand can contain phosphorothioate linkages near its backbone or at its 5' and / or 3' end.

[0113] In some embodiments, the use of modified nucleotide of formula (I) avoids the need for other RNA modifications, such as the use of non-naturally occurring internucleotide bonds, thereby simplifying the chemical synthesis of dsRNA.Moreover, modified nucleotide of formula (I) can easily include cell targeting moieties, such as GalNAc derivatives (including GalNAc itself), and improve the delivery efficiency of the dsRNA that incorporates such nucleotides.Moreover, it has been found that the dsRNA that incorporates modified nucleotide of formula (I), for example in sense strand, significantly improves the stability and therapeutic potency of this dsRNA.

[0114] In some embodiments, the dsRNA of the present disclosure is a sense strand and / or antisense strand as described in double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, the first sequence and the second sequence being complementary, the first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321. The siRNA in Table 4 may comprise any one or more of the following modifications: mX=2'-O-methyl-nucleotides, fX=2'-fluoro-nucleotides, lX=locked nucleotides, dT=deoxythymidine, lgT3=lgT3 nucleotide analogs, lT4=lT4 nucleotide analogs, PO=phosphodiester linkage; and PS=phosphorothioate linkage.

[0115] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5]

Table 6-6

Table 6-7

Table 6-8

Table 6-9

Table 6-10

Table 6-11

Table 6-12

Table 6-13

Table 6-14

Table 6-15

Table 6-16

Table 6-17

Table 6-18

Table 6-19

Table 6-20

Table 6-21

Table 6-22

[0116] In some embodiments, the dsRNA of the present disclosure comprises: a) a sense strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 578, 585, 587, 620, 621, 622, and 627; and / or b) an antisense strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 589, 591, 631, 632, 634, 635, and 639; Includes.

[0117] In some embodiments, the sense and antisense strands of the dsRNA each have a) SEQ ID NOs: 578 and 589; [C027.001] b) SEQ ID NOs: 620 and 631; [C027.003] c) SEQ ID NOs: 585 and 591; [C027.001#40] d) SEQ ID NOs: 587 and 591; [C027.001#58] e) SEQ ID NOs: 621 and 634; [C027.003#03] f) SEQ ID NOs: 622 and 632; [C027.003#06] g) SEQ ID NOs: 622 and 635; [C027.003#08] And h) SEQ ID NOs: 627 and 639; [C027.003#47] The nucleotide sequence of

[0118] In some embodiments, the dsRNA of the present disclosure (e.g., a first dsRNA) is used in a method or composition (e.g., a pharmaceutical composition) together with one or more additional dsRNAs (e.g., at least a second dsRNA). In some embodiments, the second dsRNA also targets PCSK9. In some embodiments, the second dsRNA targets a region of PCSK9 that is different from the region targeted by the first dsRNA. In some embodiments, the second dsRNA targets a sequence derived from the sequence of an mRNA formed during expression of a target gene other than the PCSK9 gene. In some embodiments, the second dsRNA targets a gene that interacts with PCSK9 and / or a gene involved in lipid or cholesterol metabolism.

[0119] dsRNA modification In some embodiments, the dsRNA of the present disclosure comprises one or more modifications. The modifications can include any modifications known in the art, including, for example, terminal modifications, base modifications, sugar modifications / substitutions, and backbone modifications. Terminal modifications can include, for example, 5'-terminal modifications (such as phosphorylation, conjugation, inverted linkage, etc.) and 3'-terminal modifications (such as conjugates, DNA nucleotides, inverted linkage, etc.). Base modifications can include, for example, stabilizing bases, destabilizing bases, replacement with bases that base-pair with an extended repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases. Sugar modifications / substitutions can include, for example, modifications at the 2' or 4' position, or replacement of sugars. Backbone modifications can include, for example, modification or replacement of phosphodiester bonds.

[0120] The dsRNA of the present disclosure may contain one or more of modified nucleotides known in the art, including 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, 2'-O-methoxyethyl modified nucleotides, modified nucleotides containing alternative internucleotide linkages such as thiophosphates and phosphorothioates (e.g., 5'-phosphorothioates), phosphotriester modified nucleotides, modified nucleotides terminally linked to cholesterol derivatives or lipophilic moieties, peptide nucleic acid (PNA; see Nielsen et al. (1991) Science 254, 1497-1500), constrained ethyl (cEt) modified nucleotides, reverse deoxy modified nucleotides, reverse dideoxy modified nucleotides, locked nucleic acid modified nucleotides, abasic modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino modified nucleotides, phosphoramidate modified nucleotides, modified nucleotides containing modifications at other sites on the sugar or base of the oligonucleotide, and non-natural base-containing modified nucleotides. In some embodiments, at least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-phosphorothioate nucleotide, or a terminal nucleotide that is bound to a cholesterol derivative or a lipophilic moiety.The incorporation of 2'-O-methyl, 2'-O-ethyl, 2'-O-propyl, 2'-O-allyl, 2'-O-aminoalkyl, or 2'-deoxy-2'-fluoro groups into the nucleoside of oligonucleotide can provide the oligonucleotide with improved hybridization properties and / or improved nuclease stability.Furthermore, the oligonucleotide that contains phosphorothioate backbone can have improved nuclease stability.

[0121] In some embodiments, the dsRNA of the present disclosure comprises one or more 2'-O-methyl nucleotides, and one or more 2'-fluoro nucleotides. In some embodiments, the dsRNA comprises two or more 2'-O-methyl nucleotides, and two or more 2'-fluoro nucleotides. In some embodiments, the dsRNA comprises an alternating pattern of two or more 2'-O-methyl nucleotides (OMe) and two or more 2'-fluoro nucleotides (F), for example, the pattern OMe-F-OMe-F or the pattern F-OMe-F-OMe. In some embodiments, the dsRNA comprises up to 10 consecutive nucleotides, each of which is a 2'-O-methyl nucleotide. In some embodiments, the dsRNA comprises up to 10 consecutive nucleotides, each of which is a 2'-fluoro nucleotide.

[0122] In some embodiments, the dsRNA of the present disclosure comprises one or more phosphorothioate groups.In some embodiments, the dsRNA of the present disclosure comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more phosphorothioate groups.In some embodiments, the dsRNA does not comprise phosphorothioate groups.

[0123] In some embodiments, dsRNA comprises one or more phosphotriester groups.In some embodiments, dsRNA comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more phosphotriester groups.In some embodiments, dsRNA does not comprise phosphotriester groups.

[0124] In some embodiments, the dsRNA comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different modified nucleotides as described herein. In some embodiments, the dsRNA comprises up to two consecutive modified nucleotides, up to three consecutive modified nucleotides, up to four consecutive modified nucleotides, up to five consecutive modified nucleotides, up to six consecutive modified nucleotides, up to seven consecutive modified nucleotides, up to eight consecutive modified nucleotides, up to nine consecutive modified nucleotides, or up to ten consecutive modified nucleotides. In some embodiments, the consecutive modified nucleotides are the same modified nucleotides. In some embodiments, the consecutive modified nucleotides are two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different modified nucleotides.

[0125] dsRNA conjugates The dsRNA of the present disclosure may be chemically / physically linked to one or more ligands, moieties, or conjugates. In some embodiments, the dsRNA is conjugated / linked to one or more ligands via a linker. Any linker known in the art may be used, including, for example, a trivalent branched linker. Conjugating a ligand to the dsRNA allows the distribution of the dsRNA to be altered, the cellular absorption of the dsRNA to be improved, and / or the targeting of the dsRNA to a specific tissue and / or the uptake by one or more specific cell types (e.g., hepatocytes), and / or the duration of the dsRNA agent to be improved. In some embodiments, a hydrophobic ligand is conjugated to the dsRNA to facilitate direct penetration of cell membranes and / or uptake through cells (e.g., hepatocytes).

[0126] In some embodiments, the dsRNA is linked to one or more N-acetylgalactosamine (GalNAc) derivatives via a linker. In some embodiments, the dsRNA is linked to three or more GalNAc derivatives via a linker. In some embodiments, the linker is a trivalent branched linker. In some embodiments, the dsRNA is linked to three or more GalNAc derivatives via a trivalent branched linker. In some embodiments, one or more GalNAc derivatives are linked to the 3' end of the sense strand, the 3' end of the antisense strand, the 5' end of the sense strand, and / or the 5' end of the antisense strand of the dsRNA.

[0127] Exemplary, non-limiting conjugates and linkers are described, for example, in Biessen et al., Bioconjugate Chem. 13(2):295-302 (2002); Cedillo et al., Molecules 22(8):E1356 (2017); Grijalvo et al., Genes 9(2):E74 (2018); Huang et al., Molecular Therapy: Nucleic Acids 6:116-132 (2017); Nair et al., J. Am. Chem. Soc. 136:16958-16961 (2014); Ostergaard et al., Bioconjugate Chem. 26:1451-1455 (2015); Springer et al., Nucleic Acids Therapeutics 28(3):109-118 (2018); and U.S. Patent Nos. 8,106,022, 9,127,276, and 8,927,705. GalNAc conjugation can be readily performed by methods well known in the art (e.g., as described in the above references).

[0128] In some embodiments, the dsRNA of the disclosure is conjugated to the following compound: [ka]

[0129] In some embodiments, the ligand is a molecule that has specific affinity for one or more targeting groups (e.g., cell or tissue targeting agents), such as one or more proteins, glycoproteins, peptides, or co-ligands. Such ligands can include, but are not limited to, lectins, glycoproteins, lipids, or proteins, such as antibodies, that bind to specific cell types, such as hepatocytes. The targeting group can be thyroid stimulating hormone, melanotropin, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, or biotin.

[0130] Ligands may include, for example, natural substances such as proteins, carbohydrates (e.g., N-acetylglucosamine or N-acetylgalactosamine), lipopolysaccharides, lipids; recombinant or synthetic molecules such as synthetic polymers; polyamines; alpha-helical peptides; lectins; vitamins; and cofactors. In some embodiments, the ligand is one or more dyes, cross-linking agents, polycyclic aromatic hydrocarbons, peptide conjugates (e.g., antennapedia peptide, Tat peptide), polyethylene glycol (PEG), enzymes, haptens, transport / absorption enhancers, synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, or imidazole clusters), human serum albumin (HSA), or LDL.

[0131] In some embodiments, the dsRNA is conjugated to one or more cholesterol derivatives or lipophilic moieties, including but not limited to cholesterol or cholesterol derivatives; cholic acid; vitamins (such as folate, vitamin A, vitamin E (tocopherol), biotin, pyridoxal); bile acid or fatty acid conjugates, including both saturated and unsaturated, such as lauroyl (C 12 ), myristoyl (C 14 ) and palmitoyl (C 16 ), stearoyl (C 18 ) and docosanyl (C 22 ), lithocholic acid and / or lithocholic acid oleylamine conjugate (lithocholic acid oleyl, C 43 Any lipophilic compound known in the art may be conjugated to the dsRNA, including: polymer backbones or scaffolds (such as PEG, triethylene glycol (TEG), hexaethylene glycol (HEG), poly(lactic-co-glycolic acid) (PLGA), poly(lactide-co-glycolide) (PLG), hydrodynamic polymers); steroids (such as dihydrotestosterone); terpenes (such as triterpenes); cationic lipids or peptides; and / or lipids or lipid-based molecules. Such lipids or lipid-based molecules may bind to serum proteins, such as human serum albumin (HSA). Lipid-based ligands may be used to modulate (e.g., control) the binding of the conjugate to the target tissue. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidney and therefore less likely to be cleared from the body. The target tissue may be the liver, including the parenchymal cells of the liver.

[0132] I. Composition Certain aspects of the present disclosure relate to compositions (e.g., pharmaceutical compositions) comprising the dsRNA described herein. In some embodiments, the compositions (e.g., pharmaceutical compositions) further comprise a pharma- ceutically acceptable carrier. In some embodiments, the compositions (e.g., pharmaceutical compositions) are useful for treating diseases or disorders associated with the expression or activity of the PCSK9 gene. In some embodiments, the diseases or disorders associated with the expression of the PCSK9 gene are pathological conditions associated with these disorders, such as lipemia (e.g., hyperlipidemia), and / or other types of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and heart and circulatory diseases. The compositions (e.g., pharmaceutical compositions) of the present disclosure are formulated based on the mode of delivery, including compositions formulated for delivery to the liver via parenteral delivery, for example.

[0133] The compositions (e.g., pharmaceutical compositions) of the present disclosure can be administered at a dosage sufficient to inhibit expression of the PCSK9 gene. In some embodiments, a suitable dose of dsRNA is in the range of 0.01 mg / kg to 200 mg / kg of recipient body weight.

[0134] Those skilled in the art will recognize, without limitation, the severity of the disease or disorder, previous treatments, the general health of the subject, and It is understood that certain factors, including age and / or age, and one or more other diseases that exist, can affect the dosage and timing required to effectively treat a subject.Furthermore, the treatment of a subject with a therapeutically effective amount of pharmaceutical composition can include a single treatment or a series of treatments.Estimation of effective dosage and in vivo half-life for dsRNA disclosed herein can be carried out by using conventional methods or based on in vivo test using suitable animal model.

[0135] The dsRNA molecule of the present disclosure may be formulated in pharmaceutically acceptable carrier or diluent.The pharmaceutically acceptable carrier may be liquid or solid, and may be selected according to the planned administration mode, with the intention of providing the desired bulk, consistency, and other suitable transport and chemical properties.Any known pharmaceutically acceptable carrier or diluent may be used, including, for example, water, saline, binder (e.g., polyvinylpyrrolidone or hydroxypropylmethylcellulose), filler (e.g., lactose and other sugars, gelatin, or calcium sulfate), lubricant (e.g., starch, polyethylene glycol, or sodium acetate), disintegrant (e.g., starch or sodium starch glycolate), calcium salt (e.g., calcium sulfate, calcium chloride, calcium phosphate, etc.), and wetting agent (e.g., sodium lauryl sulfate).

[0136] The dsRNA molecules of the present disclosure may be formulated into compositions (e.g., pharmaceutical compositions) that contain dsRNA mixed with, encapsulated in, conjugated to, or otherwise associated with other molecules, molecular structures, or nucleic acid mixtures.For example, a composition that includes one or more dsRNAs described herein may contain other therapeutic agents, such as other lipid-lowering agents (e.g., statins).In some embodiments, the composition (e.g., pharmaceutical composition) further includes a delivery vehicle (described herein).

[0137] II. Methods for Producing dsRNA The dsRNA of the present disclosure can be synthesized by any method known in the art.For example, dsRNA can be synthesized by using an automatic synthesizer, by in vitro transcription and purification (for example, using commercially available in vitro RNA synthesis kit), by transcription and purification from cells (for example, cells that contain expression cassettes / vectors that code for dsRNA), etc.

[0138] Production of modified dsRNA The ligand-conjugated dsRNA and sequence-specific binding nucleosides of the present disclosure bearing ligand molecules may be assembled by any method known in the art, including, for example, by assembly on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors; or nucleotide or nucleoside conjugate precursors that already bear a binding moiety; ligand-nucleotide or nucleoside conjugate precursors that already bear a ligand molecule; or nucleoside ligand-free building blocks.

[0139] The ligand-conjugated dsRNA of the present disclosure may be synthesized by any method known in the art, including, for example, by using a dsRNA with a pendant reactive functional group, such as that resulting from the attachment of a binding molecule to the dsRNA. In some embodiments, the reactive oligonucleotide can be directly reacted with a commercially available ligand, a ligand synthesized with any of a variety of protecting groups, or a ligand with a binding moiety attached to the ligand. In some embodiments, the method facilitates the synthesis of the ligand-conjugated dsRNA by using a nucleoside monomer that is appropriately conjugated to a ligand and may further be attached to a solid support material. In some embodiments, the dsRNA with an aralkyl ligand attached to the 3' end of the dsRNA is first They are prepared by covalently attaching the monomer building blocks to a controlled pore glass support via long chain aminoalkyl groups; then attaching nucleotides to the solid support-bound monomer building blocks by standard solid phase synthesis techniques. The monomer building blocks may be nucleosides or other organic compounds compatible with solid phase synthesis.

[0140] In some embodiments, the functionalized nucleoside sequences of the present disclosure that possess an amino group at the 5' end are prepared using a DNA synthesizer and then reacted with an active ester derivative of a selected ligand. Active ester derivatives are well known to those skilled in the art. The reaction of the amino group with the active ester produces an oligonucleotide in which the selected ligand is attached to the 5' position through a linking group. The amino group at the 5' end can be prepared utilizing the 5'-amino modifier C6 reagent. In some embodiments, the ligand molecule is conjugated to the oligonucleotide at the 5' position by using a ligand-nucleoside phosphoramidite, where the ligand is linked to the 5' hydroxyl group directly or indirectly through a linker. Such ligand-nucleoside phosphoramidites are typically used at the end of an automated synthesis procedure to provide a ligand-conjugated oligonucleotide with a ligand at the 5' end.

[0141] III. Vectors and dsRNA Delivery The dsRNA of the present disclosure can be delivered directly or indirectly.In some embodiments, the dsRNA is delivered directly by administering a composition (e.g., pharmaceutical composition) that contains the dsRNA to a subject.In some embodiments, the dsRNA is delivered indirectly by administering one or more vectors as described herein.

[0142] delivery The dsRNAs of the disclosure can be used to deliver nucleic acid molecules in a variety of therapeutic applications, for example, by adapting methods for delivering nucleic acid molecules for use with dsRNA (see, e.g., Akhtar, S. et al. (1992) Trends Cell. Biol. 2(5):139-144; WO 94 / 02595), or by additional methods known in the art (see, e.g., Kanasty, R. et al. (2013) Nature Materials 12:967-977; Wittrup, A. and Lieberman, J. (2015) Nature Reviews Genetics 16:543-552; Whitehead, K. et al. (2009) Nature Reviews Drug Discovery 8:129-138; Gary, D. et al. (2007) 121(1-2):64-73; Wang. J. et al. (2010) AAPS J. 12(4):492-503; Draz, M. et al. (2014) Theranostics 4(9):872~892;Wan, C. et al. (2013) Drug Deliv. And Transl. Res. 4(1):74~83;Erdmann, V. The delivery can be by any method known in the art, including by injection (see, for example, Wang, A. and Barciszewski, J. (eds.) (2010) RNA Technologies and Their Applications, Springer-Verlag Berlin Heidelberg, DOI 10.1007 / 978-3-642-12168-5; Xu, C. and Wang, J. (2015) Asian Journal of Pharmaceutical Sciences 10(1):1-12).

[0143] In some embodiments, the dsRNA of the present disclosure is delivered by a delivery vehicle that contains the dsRNA. In some embodiments, the delivery vehicle is a liposome, a lipoplex, a complex, or a nanoparticle.

[0144] Liposomal formulation Liposomes are unilamellar or multilamellar vesicles with a membrane formed from a lipophilic material and an aqueous interior. In some embodiments, liposomes are vesicles composed of amphiphilic lipids arranged in a spherical bilayer(s). The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse to the cell wall. Advantages of liposomes include, for example, that liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water- and lipid-soluble drugs; and liposomes can protect drugs encapsulated within their internal compartment from metabolism and degradation (Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (eds.), 1988, Marcel (Dekker, Inc., New York, NY, vol. 1, p. 245). Important considerations in the preparation of liposomal formulations are the lipid surface charge, vesicle size, and aqueous volume of the liposome. For example, engineered cationic liposomes and sterically stabilized liposomes can be used to deliver dsRNA. See, for example, Podesta et al. (2009) Methods Enzymol. 464, 343-54; U.S. Patent No. 5,665,710.

[0145] Nucleic acid-lipid particles In some embodiments, the dsRNA of the present disclosure is fully encapsulated in lipid formulations to form, for example, nucleic acid-lipid particles, such as SPLPs, pSPLPs, or SNALPs. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle, including SPLPs. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle that includes plasmid DNA encapsulated within lipid vesicles. Nucleic acid-lipid particles, such as SNALPs, typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALPs and SPLPs exhibit extended circulatory lifetimes after intravenous (iv) injection and accumulate at distal sites (e.g., sites physically separated from the site of administration), making them useful for systemic application. SPLPs include "pSPLPs" that include encapsulated condensing agent-nucleic acid complexes as shown in PCT Publication No. 00 / 03683.

[0146] In some embodiments, when dsRNA is present in nucleic acid-lipid particle, it is resistant to decomposition by nuclease in aqueous solution.Nucleic acid-lipid particle and their preparation method are disclosed in, for example, United States Patent (USP) 5,976,567; United States Patent (USP) 6,534,484; United States Patent (USP) 6,815,432; and PCT Publication No. 96 / 40964.

[0147] In some embodiments, the nucleic acid-lipid particles comprise cationic lipids. Any cationic lipid or mixture thereof known in the art can be used. In some embodiments, the nucleic acid-lipid particles comprise non-cationic lipids. Any non-cationic lipid or mixture thereof known in the art can be used. In some embodiments, the nucleic acid-lipid particles comprise conjugated lipids (e.g., to prevent aggregation). Any conjugated lipid known in the art can be used.

[0148] Further formulations Important factors to consider for successful delivery of dsRNA molecules in vivo include: (1) the biological stability of the delivered molecule, (2) preventing non-specific effects, and (3) accumulation of the delivered molecule in the target tissue. Non-specific effects of dsRNA can be minimized by local administration, for example, by direct injection or implantation into tissues, or by administering the preparation locally. To administer dsRNA systemically for the treatment of disease, the dsRNA may be modified or alternatively delivered using a drug delivery system; both methods act to prevent rapid degradation of the dsRNA by endonucleases and exonucleases in vivo. Additionally, the RNA or drug carrier may be modified or delivered using a drug delivery system. The modification of the body can allow the targeting of the dsRNA composition to the target tissue and avoid undesirable off-target effects. As explained above, the dsRNA molecule can be modified by chemical conjugation to a lipophilic group such as cholesterol to improve cellular uptake and prevent degradation. In some embodiments, the dsRNA is delivered using a drug delivery system such as a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system. The positively charged cationic delivery system promotes the binding of the dsRNA molecule (which is negatively charged) and also improves the interaction with the negatively charged cell membrane, allowing the efficient uptake of the dsRNA by the cell. The cationic lipid, dendrimer, or polymer can be bound to the dsRNA or induced to form a vesicle or micelle that encases the dsRNA (see, for example, Kim SH et al. (2008) Journal of Controlled Release 129(2):107-116). The formation of a vesicle or micelle further prevents the degradation of the dsRNA when administered systemically. Methods for preparing and administering cationic dsRNA complexes are known in the art. In some embodiments, the dsRNA is complexed with cyclodextrin for systemic administration.

[0149] Vector-encoded dsRNA The dsRNA of the present disclosure may be encoded by a recombinant vector. In some embodiments, the vector is a DNA vector or an RNA vector. In some embodiments, the vector is a plasmid, a cosmid, or a viral vector. In some embodiments, the vector is compatible with expression in a prokaryotic cell. In some embodiments, the vector is compatible with expression in E. coli. In some embodiments, the vector is compatible with expression in a eukaryotic cell. In some embodiments, the vector is compatible with expression in a yeast cell. In some embodiments, the vector is compatible with expression in a vertebrate cell. Any expression vector known in the art that can encode dsRNA can be used, including vectors derived from adenovirus (AV), adeno-associated virus (AAV), retrovirus (e.g., lentivirus (LV), rhabdovirus, murine leukemia virus, etc.), herpes virus, SV40 virus, polyoma virus, papilloma virus, picorna virus, pox virus (e.g., orthopox or avipox), etc. The tropism of viral or virus-derived vectors can be modified by pseudotyping the vector with envelope proteins or other surface antigens from one or more other viruses, or by replacing various viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be engineered to express different capsid protein serotypes, allowing them to target different cells.For example, the AAV vector that expresses the serotype 2 capsid of the serotype 2 genome is called AAV2 / 2.The serotype 2 capsid gene of the AAV2 / 2 vector can be replaced with the serotype 5 capsid gene to produce AAV2 / 5 vector.Techniques for constructing AAV vectors expressing various capsid protein serotypes have been previously described, for example, in Rabinowitz et al. (2002) J. Virol. 76:791-801.

[0150] Selection of recombinant vectors, methods for inserting nucleic acid sequences into vectors to express dsRNA, and methods for delivering vectors to one or more cells of interest are known in the art. See, for example, Domburg (1995) Gene Therap. 2:301-310; Eglitis (1998) Biotechniques 6:608-614; Miller (1990) Hum. Gene Therap. ap. 1:5-14; Anderson (1998) Nature 392:25-30; Xia et al. (2002) Nat. Biotech. 20:1006-1010; Robinson et al. (2003) Nat. Genet. 33:401-406; Samulski et al. (1987) J. Virol. 61:3096-3101; Fisher et al. (1996) J. Virol. 70:520-532; Samulski et al. (1989) J. Virol. 63-3822-3826; U.S. Patent Nos. 5,252,479; 5,139,941; WO 94 / 13788; and WO 93 / 24641.

[0151] A vector useful for delivery of dsRNA described herein may contain sufficient regulatory elements (e.g., heterologous promoters, enhancers, etc.) for expression of dsRNA in a desired target cell or tissue. In some embodiments, the vector contains one or more sequences encoding dsRNA linked to one or more heterologous promoters. Any heterologous promoter known in the art capable of expressing dsRNA can be used, including, for example, U6 or H1 RNA pol III promoters, T7 promoters, and cytomegalovirus promoters. The one or more heterologous promoters may be inducible, repressible, regulatable, and / or tissue-specific promoters. Selection of additional promoters is within the capabilities of one of ordinary skill in the art. In some embodiments, the regulatory elements are selected to provide constitutive expression. In some embodiments, the regulatory elements are selected to provide regulated / inducible / repressible expression. In some embodiments, the regulatory elements are selected to provide tissue-specific expression. In some embodiments, the regulatory elements and the sequences encoding dsRNA form a transcription unit.

[0152] The dsRNA of the present disclosure is expressed from a transcription unit inserted into a DNA or RNA vector (see, e.g., Couture, A et al. (1996) TIG 12:5-10; WO 00 / 22113; WO 00 / 22114; and U.S. Pat. No. 6,054,299). Expression may be transient (on the order of hours to weeks) or sustained (for weeks to months or longer) depending on the particular construct used and the target tissue or cell type. These transgenes may be introduced as linear constructs, circular plasmids, or viral vectors that may be integrative or non-integrative vectors. Transgenes may also be constructed to allow the transgene to be inherited as an extrachromosomal plasmid (Gassmann et al. (1995) PNAS 92:1292).

[0153] In some embodiments, the sense and antisense strands of dsRNA are encoded in separate expression vectors. In some embodiments, the sense and antisense strands are expressed in two separate expression vectors that are co-introduced (e.g., by transfection or infection) into the same target cell. In some embodiments, the sense and antisense strands are encoded in the same expression vector. In some embodiments, the sense and antisense strands are transcribed from separate promoters located in the same expression vector. In some embodiments, the sense and antisense strands are transcribed from the same promoter of the same expression vector. In some embodiments, the sense and antisense strands are transcribed from the same promoter as an inverted repeat that is joined by a linker polynucleotide sequence, so that the dsRNA has a stem and loop structure.

[0154] IV.Cells Certain aspects of the present disclosure relate to one or more isolated cells comprising the dsRNA described herein, or one or more cells comprising a vector encoding the dsRNA described herein. The cell is a prokaryotic cell. In some embodiments, the one or more cells is an E. coli cell. In some embodiments, the one or more cells is a eukaryotic cell. For example, yeast cells, SV40 transformed monkey kidney CV1 line (COS-7, ATCC CRL 1651); human embryonic kidney line (293 cells, or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); Human hepatocytes (Hep G2, HB Any eukaryotic cell known in the art, including mouse mammary tumor (MMT 060562, ATCC CCL51); CHO cells (such as DHFR-CHO cells, e.g., ATCC CRL-9096); TRI cells (Mather et al., Annals NY Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; myeloma cell lines (such as NS0 and Sp2 / 0); and primary cells from a subject (such as primary cells isolated from a human or non-human primate), can contain the dsRNA or vectors described herein.

[0155] V. How to Use dsRNA Certain aspects of the present disclosure relate to a method for inhibiting the expression of PCSK9 gene in a mammal, comprising administering an effective amount of one or more dsRNAs of the present disclosure, one or more vectors of the present disclosure, or a composition (e.g., pharmaceutical composition) of the present disclosure comprising one or more dsRNAs of the present disclosure. Certain aspects of the present disclosure relate to a method for treating and / or preventing one or more PCSK9-mediated diseases or disorders, comprising administering a composition (e.g., pharmaceutical composition) comprising one or more dsRNAs of the present disclosure, and / or one or more vectors of the present disclosure, and / or one or more dsRNAs of the present disclosure. In some embodiments, downregulating PCSK9 expression in a subject alleviates one or more symptoms of PCSK9-mediated diseases or disorders in the subject. Examples of dsRNAs are described in Section II.

[0156] In some embodiments, expression of the PCSK9 gene in a subject is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or about 100% after treatment compared to pre-treatment levels. In some embodiments, the expression of PCSK9 gene is inhibited at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 4.5 times, at least about 5 times, at least about 5.5 times, at least about 6 times, at least about 6.5 times, at least about 7 times, at least about 7.5 times, at least about 8 times, at least about 8.5 times, at least about 9 times, at least about 9.5 times, at least about 10 times, at least about 25 times, at least about 50 times, at least about 75 times, or at least about 100 times after treatment compared to the level before treatment.In some embodiments, PCSK9 gene is inhibited in the liver of the subject.

[0157] In some embodiments, the subject is a human. In some embodiments, the subject has or has been diagnosed as having a PCSK9-mediated disorder or disease. In some embodiments, the subject is suspected of having a PCSK9-mediated disorder or disease. In some embodiments, the subject is at risk of developing a PCSK9-mediated disorder or disease.

[0158] The dsRNA and compositions (e.g., pharmaceutical compositions) described herein can be used to treat lipidemia (e.g., hyperlipidemia) and / or other types of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart disease and circulatory disease.In some embodiments, the method comprises administering an effective amount of dsRNA to a subject with a heterozygous LDLR genotype.

[0159] In some embodiments, the effect of inhibiting PCSK9 gene expression by any of the methods described herein results in a reduction in cholesterol levels in a subject. In some embodiments, the effect of inhibiting PCSK9 gene expression results in a reduction in cholesterol in the blood of a subject. In some embodiments, the effect of inhibiting PCSK9 gene expression results in a reduction in cholesterol in the serum of a subject. In some embodiments, cholesterol levels are reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60% or more compared to pre-treatment levels. In some embodiments, cholesterol levels are reduced by at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 4.5 fold, at least about 5 fold, at least about 5.5 fold, at least about 6 fold, at least about 6.5 fold, at least about 7 fold, at least about 7.5 fold, at least about 8 fold, at least about 8.5 fold, at least about 9 fold, at least about 9.5 fold, at least about 10 fold, at least about 25 fold, at least about 50 fold, at least about 75 fold, at least about 100 fold or more compared to pre-treatment levels.

[0160] The dsRNA or compositions (e.g., pharmaceutical compositions) described herein can be administered by any means known in the art, including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, pulmonary, transdermal, and airway (aerosol) administration. Typically, when treating a mammal with hyperlipidemia, the dsRNA molecule is administered systemically by parenteral means. In some embodiments, the dsRNA and / or composition is administered by subcutaneous administration. In some embodiments, the dsRNA and / or composition is administered by intravenous administration. In some embodiments, the dsRNA and / or composition is administered by pulmonary administration.

[0161] The therapeutic or preventive effect of dsRNA is evident when there is a statistically significant improvement in one or more parameters of the disease state, or when symptoms are aggravated or do not develop where symptoms would otherwise be expected.For example, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more favorable changes in measurable parameters of disease may indicate effective treatment.The efficacy of a given dsRNA or a composition comprising dsRNA may also be determined using an experimental animal model for a given disease or disorder known in the art.When using an experimental animal model, the efficacy of treatment is demonstrated when a statistically significant reduction in markers or symptoms is observed.

[0162] Additional Agents In some embodiments, the dsRNA of the present disclosure is administered in combination with one or more additional therapeutic agents. In some embodiments, the dsRNA and the additional therapeutic agent are administered in the same composition. In some embodiments, the dsRNA and the additional therapeutic agent are administered in combination in a single composition. In some embodiments, the dsRNA and the additional therapeutic agent are administered as part of separate compositions. In some embodiments, the separate compositions are administered simultaneously. In some embodiments, the composition comprising the dsRNA is administered to the subject first, and then the additional therapeutic agent is administered to the subject. In some embodiments, the composition comprising the additional therapeutic agent is administered to the subject first, and then the composition comprising the dsRNA is administered to the subject.

[0163] Examples of additional therapeutic agents include any known in the art for treating lipid disorders such as hypercholesterolemia, atherosclerosis, or dyslipidemia.For example, additional agent can be one or more of HMG-CoA reductase inhibitors (e.g., statins), fibrates, bile acid sequestrants, niacin, antiplatelet drugs, angiotensin converting enzyme inhibitors, angiotensin II receptor antagonists (e.g., losartan potassium), acylCoA cholesterol acetyltransferase (ACAT) inhibitors, cholesterol absorption inhibitors, cholesterol ester transfer protein (CETP) inhibitors, microsomal triglyceride transfer protein (MTTP) inhibitors, cholesterol modulators, bile acid modulators, or peroxisome proliferation activated receptor (PPAR) agonists. Specific examples include, but are not limited to, atorvastatin, pravastatin, simvastatin, lovastatin, fluvastatin, cerivastatin, rosuvastatin, ezetimibe, bezafibrate, clofibrate, fenofibrate, gemfibrozil, ciprofibrate, cholestyramine, colestipol, colesevelam, and niacin. Exemplary combination therapies suitable for administration with dsRNA targeting PCSK9 include, for example, niacin / lovastatin, amlodipine / atorvastatin, and ezetimibe / simvastatin.

[0164] In some embodiments, the present disclosure provides a method for instructing an end user (e.g., a caregiver or a subject) how to administer the dsRNA described herein.The method optionally includes providing the end user with one or more doses of dsRNA, and instructing the end user to administer the dsRNA in the regimen described herein, thereby instructing the end user.

[0165] Patient Identification In some embodiments, the present disclosure provides a method for treating a subject by selecting the subject based on the subject's need for LDL reduction, LDL reduction without HDL reduction, ApoB reduction, or total cholesterol reduction.In some embodiments, the method comprises administering dsRNA to the subject in an amount sufficient to reduce the subject's LDL level or ApoB level (without substantially reducing HDL level).

[0166] Genetic predisposition plays a role in the development of target gene-related diseases, such as hyperlipidemia. Therefore, subjects who need dsRNA can be identified by taking a family history or by screening for, for example, one or more genetic markers or variants. Examples of genes involved in hyperlipidemia include LDL receptor (LDL receptor:LDLR), apolipoproteins (ApoAl, ApoB, ApoE, etc.), cholesteryl ester transfer protein (cholesteryl ester lipoprotein lipase (LPL), hepatic lipase (LIPC), endothelial lipase (EL), lecithin:cholesteryl acyltransferase ( ... Examples of such enzymes may include, but are not limited to, lyl acyltransferase (LCAT).

[0167] A medical provider, such as a doctor, nurse, or family member, may take a family history before prescribing or administering dsRNA. In addition, a test may be performed to determine a genotype or phenotype. For example, before administering PCSK9 dsRNA to a subject, a DNA test may be performed on a sample, such as a blood sample, from the subject to identify the PCSK9 genotype and / or phenotype. In some embodiments, a test is performed to identify the relevant genotype and / or phenotype, such as the LDLR genotype. Examples of genetic variants with the LDLR gene are known in the art (Costanza et al., 2003). (2005) Am. J. Epidemiol. 15;161(8):714~24; Yamada et al. (2008) J. Med. Genet. Jan;45(1):22~8; and Boes et al. (2009) Exp. Gerontol. 44:136~160).

[0168] VI. KITS AND ARTICLES OF MANUFACTURE Certain aspects of the present disclosure relate to an article of manufacture or kit that includes one or more of the dsRNA, vector(s), or composition(s) (e.g., pharmaceutical composition(s)) described herein that are useful for treating and / or preventing a PCSK9-mediated disorder or disease described herein. The article of manufacture or kit may further include a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, and the like. The container may be formed from a variety of materials, such as glass or plastic. The container may hold a composition that is effective for treating or preventing a disease, either by itself or in combination with another composition, and may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). At least one active agent in the composition is a dsRNA described herein. The label or package insert indicates that the composition is used to treat a PCSK9-mediated disorder or disease. In some embodiments, the disease is a pathological condition associated with lipemia (e.g., hyperlipidemia) and / or other types of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia, and these disorders such as heart disease and circulatory disease.Furthermore, the article of manufacture or kit may include (a) a first container containing a composition, the first container containing the dsRNA described herein; and (b) a second container containing a composition, the second container containing the composition containing a second therapeutic agent.The article of manufacture or kit in this embodiment of the present disclosure may further include a package insert indicating that the composition can be used to treat a particular disease.Alternatively or in addition, the article of manufacture or kit may further include a second (or third) container containing a pharma- ceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate buffer, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0169] Without intending to limit the disclosure, several embodiments of the present disclosure are described below for purposes of illustration.

[0170] Item 1: A double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, the first sequence and the second sequence being complementary, the first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6 to 11 and 310 to 321.

[0171] Item 2: dsRNA is (1) CCAUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO: 176) in the sense strand and AGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 177) in the antisense strand; or (2) CCAUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 180) in the sense strand and AAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO: 181) in the antisense strand; or (3) containing CCAAUUAAUAUGGUGACUUUUUinvdT (SEQ ID NO: 182) in the sense strand and AAAAAGUCACCAUAUUAAUdTdT (SEQ ID NO: 183) in the antisense strand; or (4) CCAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 184) in the sense strand and UAAAAGUCACCAUAUUAAdTdT (SEQ ID NO: 185) in the antisense strand; or (5) CCAUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 186) in the sense strand and UUAAAAAGUCACCAUAUUAdTdT (SEQ ID NO: 187) in the antisense strand; or (6) CCAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO: 188) in the sense strand and AUUUUAAAAGUCACCAUAdTdT (SEQ ID NO: 189) in the antisense strand; or (7) CCAUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 322) in the sense strand and AAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 323) in the antisense strand; or (8) CCAAUAUGGUGACUUUUUAAAAinvdT (SEQ ID NO: 324) in the sense strand and UUUUAAAAGUCACCAUAUdtdt (SEQ ID NO: 325) in the antisense strand; or (9) CCAAUUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO: 326) in the sense strand and AGUCACCAUAUUAAUAAAAAUdTdT (SEQ ID NO: 327) in the antisense strand; or (10) CCAUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 328) in the sense strand and AAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 329) in the antisense strand; or (11) CCAUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 330) in the sense strand and AAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 331) in the antisense strand; or (12) CCAUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 332) in the sense strand and UAAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO: 333) in the antisense strand; or (13) CCAAAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO: 334) in the sense strand and AUUUUAAAAGUCACCAUAUUdTdT (SEQ ID NO: 335) in the antisense strand; or (14) CCAGCAUUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO: 336) in the sense strand and AGUCACCAUAUUAAUAAAAAUGCdTdT (SEQ ID NO: 337) in the antisense strand; or (15) CCAAUUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 338) in the sense strand and AAAGUCACCAUAUUAAUAAAAAUdTdT (SEQ ID NO: 339) in the antisense strand; or (16) CCAUUUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 340) in the sense strand and AAAAGUCACCAUAUUAAUAAAAAdTdT (SEQ ID NO: 341) in the antisense strand; or (17) CCAUUUAUUAAUAUGGUGACUUUUUAinv in the sense strand dT (SEQ ID NO: 342) and in the antisense strand UAAAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 343); or (18) CCAUUAUUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 344) in the sense strand and UUAAAAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 345) in the antisense strand; The dsRNA according to item 1.

[0172] Item 3: A double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein only the first sequence and the second sequence are complementary, and the first sequence is one of SEQ ID NOs: 3, 4, and 13.

[0173] Item 4: dsRNA is (19) CCAUUGUAGCAUUUUUAUUAAUinvdT (SEQ ID NO: 162) in the sense strand and AUUAAUAAAAAUGCUACAAdTdT (SEQ ID NO: 163) in the antisense strand; or (20) CCAGUAGCAUUUUUAUUAAUAUinvdT (SEQ ID NO: 166) in the sense strand and AUAUUAAUAAAAAUGCUACdTdT (SEQ ID NO: 167) in the antisense strand; or or (21) CCAGAGUGUGAAAGGUGCUGAUinvdT (SEQ ID NO: 290) in the sense strand and AUCAGCACCUUUCACACUCdTdT (SEQ ID NO: 291) in the antisense strand; dsRNA according to item 3.

[0174] Item 5: The dsRNA according to any one of Items 1 to 4, wherein the first sequence and the second sequence are each 30 nucleotides or less in length.

[0175] Item 6: The dsRNA according to any one of items 1 to 5, wherein the first sequence and the second sequence are at least 19 and no more than 23 nucleotides in length, respectively.

[0176] Item 7: The dsRNA according to any one of items 1 to 6, wherein the dsRNA is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).

[0177] Item 8: The dsRNA according to any one of items 1 to 7, wherein the dsRNA comprises one or more modified nucleotides.

[0178] Item 9: The dsRNA according to item 8, wherein at least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-phosphorothioate nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a lipophilic moiety.

[0179] Item 10: The dsRNA of item 8, wherein at least one of the one or more modified nucleotides is a 2'-fluoro, 2'-deoxy, 2'-O-methoxyethyl, constrained ethyl (cEt), inverted deoxy, inverted dideoxy, locked nucleic acid, abasic, 2'-amino, 2'-alkyl, morpholino, phosphoramidate, or non-natural base-containing nucleotide.

[0180] Item 11: dsRNA comprises one or more 2'-O-methyl nucleotides and one 11. The dsRNA according to item 10, comprising one or more 2'-fluoro nucleotides.

[0181] Item 12: The dsRNA contains two or more 2'-O-methyl nucleotides and two or more 2'-fluoro nucleotides in the following pattern: OMe-F-OMe-F or F-OMe-F-OMe (wherein OMe represents a 2'-O-methyl nucleotide and F represents a 2'-fluoro nucleotide), Item 12. The dsRNA according to item 11.

[0182] Item 13: The dsRNA according to item 11, wherein the dsRNA comprises up to 10 consecutive nucleotides, each of which is a 2'-O-methyl nucleotide, or up to 10 consecutive nucleotides, each of which is a 2'-fluoro nucleotide.

[0183] Item 14: The dsRNA according to any one of items 1 to 13, wherein the dsRNA comprises one or more phosphorothioate groups.

[0184] Item 15: The dsRNA according to any one of Items 1 to 13, wherein the dsRNA does not contain a phosphorothioate group.

[0185] Item 16: The dsRNA according to any one of items 1 to 15, wherein the dsRNA comprises one or more phosphotriester groups.

[0186] Item 17: The dsRNA according to any one of items 1 to 15, wherein the dsRNA does not contain a phosphotriester group.

[0187] Item 18: The dsRNA according to any one of items 1 to 17, wherein the dsRNA is attached to one or more GalNAc derivatives via a linker.

[0188] Item 19: The dsRNA according to item 18, wherein the dsRNA is attached to three GalNAc derivatives via a trivalent branched linker.

[0189] Item 20: The dsRNA according to item 18 or 19, wherein at least one of the one or more GalNAc derivatives is attached to the 3' end of the sense strand, the 3' end of the antisense strand, or the 5' end of the sense strand of the dsRNA.

[0190] Item 21: The dsRNA according to any one of items 1, 3, and 5 to 20, wherein one or both of the sense strand and the antisense strand further comprises a 5' overhang comprising one or more nucleotides.

[0191] Item 22: The dsRNA according to any one of items 1, 3, and 5 to 21, wherein one or both of the sense strand and the antisense strand further comprises a 3' overhang comprising one or more nucleotides.

[0192] Item 23: The dsRNA according to Item 22, wherein the 3' overhang comprises two nucleotides.

[0193] Item 24: The dsRNA according to any one of Items 21 to 23, wherein the overhang comprises one or more thymines.

[0194] Item 25: The dsRNA according to any one of Items 1 to 24, wherein the dsRNA inhibits expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene.

[0195] Item 26: One or both strands of the dsRNA have the formula (I): [ka] (In the formula, - B is a heterocyclic nucleobase; - one of L1 and L2 is an internucleoside linking group that links the compound of formula (I) to a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or an internucleoside linking group that links the compound of formula (I) to a polynucleotide; - Y is O, NH, NR1, or NC(=O)-R1, where R1 is a (C1-C20) alkyl group, optionally substituted with one or more groups selected from a halogen atom, a (C1-C6) alkyl group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, a (C5-C14) heteroaryl group, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN, -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2), and -N(Z1)-C(=J)-Z2, wherein J is O or S; Each of Z1 and Z2 is independently H, a (C1-C6) alkyl group, optionally a (C1-C6) alkyl group substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group, a (C1-C20) alkyl group; (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; The group -[C(=O)]-R-(O-CH-CH)-R, where m is an integer having a value of 0 or 1; p is an integer ranging from 0 to 10; R2 is a (C1-C20) alkylene group, optionally substituted with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN, -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4), or -N(Z3)-C(=K)-Z4, where K is O or S; Each of Z3 and Z4 is independently H, a (C1-C6) alkyl group, optionally substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group; R3 is selected from the group consisting of a hydrogen atom, a (C1-C6) alkyl group, a (C1-C6) alkoxy group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, or a (C5-C14) heteroaryl group, or R3 is a cell targeting moiety, the group -[C(=O)]m-R2-(O-CH2-CH2). p-R3 and - X1 and X2 each independently represent a hydrogen atom or a (C1-C6) alkyl group; - each of Ra, Rb, Rc, and Rd is independently H or a (C1-C6) alkyl group; or a pharma- ceutically acceptable salt thereof, The dsRNA according to item 1.

[0196] Item 27: A compound represented by formula (I) (wherein Y is a) NR1, where R1 is an unsubstituted (C1-C20) alkyl group; b) NR1, where R1 is an unsubstituted (C1-C16) alkyl group, including an alkyl group selected from the group consisting of methyl, isopropyl, butyl, octyl, and hexadecyl; c) NR1, where R1 is a (C3-C8)cycloalkyl group, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; d) NR1, where R1 is a cyclohexyl group; e) NR1, where R1 is a (C1-C20) alkyl group substituted with a (C6-C14) aryl group; f) NR1, where R1 is a methyl group substituted with a phenyl group; g) NC(=O)-R1, where R1 is an optionally substituted (C1-C20) alkyl group; or h) NC(=O)-R1, where R1 is methyl or pentadecyl. 27. The dsRNA according to item 26, comprising one or more compounds:

[0197] Item 28: The dsRNA according to item 26 or 27, comprising one or more compounds of formula (I) (wherein B is selected from the group consisting of pyrimidine, substituted pyrimidine, purine, and substituted purine), or a pharma- ceutically acceptable salt thereof.

[0198] Item 29: R3 is a compound represented by the formula (II) [ka] (In the formula, A1, A2, and A3 are OH; A4 is OH or NHC(=O)-R5, where R5 is a (C1-C6) alkyl group, optionally substituted with a halogen atom. 29. The dsRNA according to any one of items 26 to 28, which is a medicament for the treatment of a dsRNA comprising the dsRNA of any one of items 26 to 28, or a pharma- ceutically acceptable salt thereof.

[0199] Item 30: The dsRNA according to any one of Items 26 to 29, wherein R3 is N-acetyl-galactosamine or a pharma- ceutically acceptable salt thereof.

[0200] Item 31: A dsRNA according to any one of items 26 to 30, comprising one or more nucleotides from Table A.

[0201] Item 32: The dsRNA according to any one of items 26 to 31, comprising 2 to 10 compounds of formula (I) or a pharma- ceutically acceptable salt thereof.

[0202] Item 33: The dsRNA according to Item 32, wherein 2 to 10 compounds of formula (I) are present on the sense strand.

[0203] Item 34: The dsRNA according to any one of items 26 to 33, wherein the sense strand comprises 2 to 5 compounds of formula (I) at the 5'-end and / or 1 to 3 compounds of formula (I) at the 3'-end.

[0204] Item 35: a) 2 to 5 compounds of formula (I) at the 5' end of the sense strand include lgT3 and optionally include three consecutive lgT3 nucleotides; and / or b) 1 to 3 compounds of formula (I) at the 3' end of the sense strand include lT4; optionally, two consecutive lT4; 35. The dsRNA according to any one of items 26 to 34.

[0205] Item 36: The dsRNA according to any one of items 26 to 35, comprising one or more internucleoside linkage groups, independently selected from the group consisting of phosphodiester backbone linkage groups, phosphotriester backbone linkage groups, phosphorothioate backbone linkage groups, phosphorodithioate backbone linkage groups, alkyl-phosphonate backbone linkage groups, and phosphoramidate backbone linkage groups, or a pharma- ceutically acceptable salt thereof.

[0206] Item 37: The dsRNA according to any one of Items 26 to 36, selected from the dsRNAs in Tables 2 to 4.

[0207] Item 38: a) the sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 578, 585, 587, 620, 621, 622, and 627; and / or b) the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 589, 591, 631, 632, 634, 635, and 639; 38. The dsRNA according to any one of items 26 to 37.

[0208] Item 39: The sense strand and the antisense strand of the dsRNA are, respectively, a) SEQ ID NOs: 578 and 589; [C027.001] b) SEQ ID NOs: 620 and 631; [C027.003] c) SEQ ID NOs: 585 and 591; [C027.001#40] d) SEQ ID NOs: 587 and 591; [C027.001#58] e) SEQ ID NOs: 621 and 634; [C027.003#03] f) SEQ ID NOs: 622 and 632; [C027.003#06] g) SEQ ID NOs: 622 and 635; [C027.003#08] And h) SEQ ID NOs: 627 and 639; [C027.003#47] 39. The dsRNA according to item 38, comprising a nucleotide sequence of:

[0209] Item 40: A vector encoding the dsRNA according to any one of Items 1 to 39.

[0210] Item 41: An isolated host cell comprising the dsRNA according to any one of items 1 to 39 or the vector according to item 40.

[0211] Item 42: A kit comprising the dsRNA according to any one of Items 1 to 39.

[0212] Item 43: A composition comprising the dsRNA according to any one of items 1 to 39.

[0213] Item 44: The composition according to Item 43, further comprising a pharma- ceutically acceptable carrier.

[0214] Item 45: The composition according to item 43 or 44, further comprising a delivery vehicle.

[0215] Item 46: The composition of item 31, wherein the delivery vehicle is selected from the group consisting of a liposome, a lipoplex, a complex, and a nanoparticle.

[0216] Item 47: A method for inhibiting expression of the PCSK9 gene in a subject, comprising administering to the subject an effective amount of a dsRNA according to any one of items 1 to 39 or a composition according to item 44.

[0217] Item 48: A method for treating or preventing a PCSK9-mediated disease in a subject in need thereof, comprising administering to the subject an effective amount of a dsRNA according to any one of items 1 to 39 or a composition according to item 44.

[0218] Item 49: The method of item 48, wherein the PCSK-mediated disorder is hypercholesterolemia.

[0219] Item 50: The method of items 48 or 49, wherein expression of the PCSK9 gene in the liver of the subject is inhibited by dsRNA.

[0220] Item 51: The method of any one of Items 48 to 50, wherein the administration is subcutaneous administration, intravenous administration, or pulmonary administration.

[0221] Item 52: The method according to any one of Items 48 to 51, wherein the subject is a human.

[0222] Item 53: The method according to any one of Items 48 to 52, wherein the administration reduces serum cholesterol in the subject.

[0223] Item 54: The method of any one of items 48 to 53, further comprising administering to the subject an effective amount of one or more additional therapeutic agents for treating or preventing a PCSK-mediated disease.

[0224] Although the foregoing disclosure has been described in some detail by way of illustration and example for clarity of understanding, this illustration and examples should not be construed as limiting the scope of the disclosure.

[0225] Working Example The present disclosure will be more fully understood with reference to the following examples, which should not, however, be construed as limiting the scope of the disclosure. It is understood that the embodiments are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to those skilled in the art and are to be included within the spirit and scope of this application and the appended claims. EXAMPLES

[0226] Identification of siRNAs for inhibition of human PCSK9 expression method siRNA production siRNAs, including negative control siRNAs ("LV2 Negative Control" and "LV2 Negative Control 2"), were produced using solid-phase oligonucleotide synthesis. Positive control siRNA s48694 was purchased from Ambion. The sequence of each siRNA, including nucleotide modifications, is shown in Table 2 above.

[0227] Cell and tissue culture Human Hep3B and human C3A cells were cultured as follows: Human Hep3B cells were grown at 37°C, 5% CO2, and 95% RH and cultured in EMEM medium (ATCC, Cat. No. 30-2003) supplemented with 10% FBS. Human C3A cells were grown at 37°C, 5% CO2, and 95% RH and cultured in MEM medium (ThermoFisher, Cat. No. 41090) supplemented with 10% FBS.

[0228] Transfection For knockdown experiments, 20,000 cells / well of Hep3B or C3A cells were used in 96-well plates. Cells were transfected with the indicated concentrations of siRNA using 0.2 μl / well of Lipofectamine® RNAiMAX transfection reagent (ThermoFisher) in a reverse transfection setup according to the manufacturer's protocol and incubated for 48 hours without medium change. Usually, N=4 technical replicates were performed per test sample. To test siRNA-related toxicity, 15,000 Hep3B or C3A cells were transfected as described above and incubated for 72 hours.

[0229] mRNA expression analysis Forty-eight hours after siRNA transfection, cellular RNA was harvested using the SV96 total RNA isolation system from Promega (catalog no. Z3500) according to the manufacturer's protocol, including an intermediate DNase step.

[0230] For cDNA synthesis, the Reverse Transcriptase kit from ThermoFisher (catalog number N8080234) was used. cDNA synthesis from 30 ng of RNA was performed using 1.2 μl 10xRT buffer, 2.64 μl MgCl2 (25 mM), 2.4 μl dNTPs (10 mM), 0.6 μl random hexamers (50 μM), 0.6 μl oligo(dT)16 (50 μM), 0.24 μl RNase inhibitor (20 U / μl), and 0.3 μl Multiscribe (50 U / μl) (total volume 12 μl). Samples were incubated at 25° C. for 10 min and at 42° C. for 60 min. The reaction was stopped by heating at 95° C. for 5 min.

[0231] PCSK9 mRNA levels were quantified by qPCR using TaqMan Universal PCR Master Mix (cat. no. 4305719) from ThermoFisher and TaqMan® Gene Expression assay Hs00545399_m1. PCR was performed in technical duplicate on an ABI Prism 7900 under the following PCR conditions: 50°C for 2 min, 95°C for 10 min, 95°C for 15 sec, and 60°C for 1 min for 40 cycles. PCR was performed for 1000 samples of the target gene in one reaction. The PCR reaction was set up as a simplex PCR to detect a gene (PCSK9) in one reaction, and a housekeeping gene (RPL37A) for normalization in the second reaction. The final volume of the PCR reaction was 12.5 μl in 1x PCR master mix, with RPL37A primers used at a final concentration of 50 nM and 200 nM of probe. The ΔΔCt method was applied to calculate the relative expression levels of the target transcripts. The percentage of PCSK9 expression was calculated by normalization based on the level of the LV2 non-silencing siRNA control sequence.

[0232] I C 50 measurement Hep3B or C3A cells were transfected with the indicated siRNAs at concentrations ranging from 10 nM to 0.01 pM using 10-fold dilution steps. The half-maximal inhibitory concentration (IC) for each siRNA was determined. 50 ) was calculated by applying the Biostat-Speed ​​statistical calculation tool. Results were obtained using a four-parameter logistic model according to Ratkovsky and Reedy (1986). Adjustments were made by nonlinear regression using the Levenberg-Marquardt algorithm in SAS v9.1.3 software.

[0233] ELISA assay 48 hours after transfection with the indicated concentrations of siRNA, PCSK9 protein concentrations in the supernatants of 25,000 C3A cell cultures were quantified using the Human PCSK9 Quantikine ELISA kit from R&D Systems (Cat. No. DPC900). ELISA assays were performed according to the manufacturer's protocol using 50 μl of undiluted cell culture supernatant. Percentages of PCSK9 expression were calculated by normalization based on the average levels of a non-silencing siRNA control sequence.

[0234] cytotoxicity 72 hours after transfection of 15,000 Hep3B or C3A cell cultures, the cytotoxicity of each siRNA was measured by determining the cell viability / toxicity ratio in each sample. Cell viability was measured by determining the intracellular ATP content using the CellTiter-Glo® assay (Promega, Catalog No. G7570) according to the manufacturer's protocol. Cytotoxicity was measured in the supernatant using the ToxiLight™ assay (Lonza, Catalog No. LT07-217) according to the manufacturer's protocol.

[0235] result To identify siRNAs useful in targeting human PCSK9, the following criteria were applied. First, 19-mers from the human PCSK9 mRNA sequence shown in NM_174936.3 (SEQ ID NO: 1) were identified in silico with 18 nucleotide overlaps. After the first round of filtering, 715 potential siRNAs of interest were identified. Next, all 19-mers that overlap with known SNPs (identified by their occurrence in the Caucasian population of more than 10%) were removed, leaving a pool of 692 19-mer sequences. Then, all 692 19-mers were aligned against the PCSK9 mRNA sequence of cynomolgus monkeys (Macaca fascicularis), and all sequences with 2 or more mismatches to cynomolgus monkey PCSK9 were removed, leaving 130 siRNA sequences with 0 mismatches and an additional 267 siRNA sequences with one mismatch.

[0236] An in silico analysis was then performed to identify any potential off-target transcripts in the human transcriptome (RefSeq RNA version 2015-10-20). Human off-target sequences with RNAseq expression (Illumina Body Atlas) FPKM below 0.5 in liver tissue were not considered. All siRNA sequences of interest had three or more mismatches to any human transcript other than PCSK9 or had two mismatches with four or fewer human genes; sequences not meeting one of these two criteria were excluded. After filtering, 229 potential siRNAs remained. A final filtering step was performed to identify siRNA sequences with less than 30% GC content, and 14 siRNAs were identified for functional characterization. All 14 of these siRNAs recognized target sequences in the 3' untranslated region (UTR) of human PCSK9.

[0237] As described above, 14 siRNAs were produced with nucleotides having 2'O-methyl and 2'-fluoro groups, but without additional modifications such as GalNAc ligands or phosphorothioates. To test the ability of these 14 siRNAs to reduce the expression of PCSK9, human Hep3B cells were transfected with 0.1 nM or 1.0 nM of each siRNA and incubated for 48 hours. After incubation, the expression of PCSK9 mRNA in each sample was measured and compared with positive and negative controls (Figure 1). Nine of the 14 siRNAs showed the most potent hPCSK9 inhibition, reducing PCSK9 mRNA expression by at least 80% at a concentration of 1.0 nM and at least 50% at a concentration of 0.1 nM.

[0238] The activity of 14 of the siRNAs of interest was further tested in human C3A cells, which are characterized by higher levels of PCSK9 expression than Hep3B cells (Figure 2). The siRNAs were tested at the following concentrations: 0.5 nM, 0.05 nM, and 0.005 nM. In this more rigorous assay, five of the 14 siRNAs showed the most potent inhibition of hPCSK9 expression (B001, B003, B006, B013, and B014). These siRNAs reduced PCSK9 mRNA expression by at least 80% at a concentration of 0.5 nM and by at least 50% at a concentration of 0.05 nM.

[0239] Next, cellular cytotoxicity was measured in Hep3B and C3A cells 72 hours after transfection with 14 siRNAs of interest. Surprisingly, no obvious cytotoxicity in Hep3B or C3A cells was observed for any of the siRNAs tested, even when used at concentrations up to 50 nM (Figures 3A and 3B).

[0240] Taken together, these results demonstrate the identification of siRNAs capable of potent inhibition of PCSK9 expression without significant cytotoxicity in multiple human cell lines. EXAMPLES

[0241] Further characterization of siRNAs for inhibition of human PCSK9 expression Additional siRNA sequences were selected as described above, but excluding sequences with 30-65% G+C content. Sixty siRNAs were produced as described in Example 1. These siRNAs recognize targets distributed throughout the 5'UTR, 3'UTR, and open reading frame (ORF) of human PCSK9.

[0242] To test the ability of these 60 siRNAs to reduce PCSK9 expression, human Hep3B cells were transfected with 0.1 nM or 1.0 nM of each siRNA and incubated for 48 hours. After incubation, PCSK9 mRNA expression in each sample was measured and compared to positive and negative controls (Figure 4). Five of the 60 siRNAs showed potent inhibition of hPCSK9 expression, reducing PCSK9 mRNA expression by at least 86% at a concentration of 1.0 nM.

[0243] The activity of the five most potent 60 siRNAs was further tested in human C3A cells (Figure 5). siRNAs were tested at the following concentrations: 0.5 nM, 0.05 nM, and 0.005 nM. Three of the tested siRNAs showed potent inhibition of hPCSK9 expression, reducing PCSK9 mRNA expression by at least 75% at a concentration of 0.5 nM.

[0244] Next, cell cytotoxicity was measured in Hep3B and C3A cells 72 hours after siRNA transfection (Figures 6A and 6B). One siRNA, C060, caused significant cytotoxicity in both cell lines, and another siRNA, C052, caused significant cytotoxicity in C3A cells. Based on the results of the activity and cytotoxicity data in C3A and Hep3B cells described above, ten siRNAs (B001, B003, B006, B008, B010, B013, B014, and C051) were selected as the IC50 All ten siRNAs were selected for measurement. All ten siRNAs were similarly potent. The ten siRNAs were further found to reduce hPCSK9 protein in C3A cells as measured by ELISA assay, especially at the higher concentrations tested (Figure 7).

[0245] The results of these experiments are summarized in Table A. The portion of each siRNA that contains the hPCSK9 target sequence is shown in Table B.

[0246] [Table 7]

[0247] [Table 8]

[0248] Compared to the 14 siRNAs described in Example 1, these 60 siRNAs had a significantly lower percentage of siRNAs that were effective in knocking down hPCSK9 expression (5 / 60 were effective in Hep3B cells compared to 9 / 14 in Example 1). Without being bound by theory, it is believed that the siRNAs of Example 1 may exhibit higher efficacy due to their lower G+C content and / or the specific region of PCSK9 targeted (e.g., 3'UTR). Taken together, these results further illustrate the unpredictability of effective siRNA knockdown of human PCSK9 expression. Furthermore, the results obtained using the 60 siRNA sequences further highlight the efficacy and low level of cytotoxicity of the siRNAs described in Example 1. EXAMPLES

[0249] In vitro and in vivo assessment of PCSK9 siRNA molecules method siRNA production siRNAs, including negative control siRNAs, were produced using solid phase oligonucleotide synthesis.

[0250] Cell and tissue culture Human C3A cells were grown at 37°C, 5% CO , and 95% RH and cultured in MEM medium (ThermoFisher, cat. no. 41090) supplemented with 10% FBS.

[0251] Human peripheral blood mononuclear cells (PBMCs) were isolated from approximately 16 mL of blood of three healthy donors collected in sodium heparin-coated Vacutainer tubes (BD, Heidelberg Germany) according to the manufacturer's instructions.

[0252] Human and cynomolgus monkey primary hepatocytes were cultured as follows: cryopreserved cells were thawed; The cells were seeded using a Plating and Thawing Kit (PTK-1, Primacyt) and incubated at 37°C, 5% CO2, and 95% RH. Six hours after seeding, the medium was replaced with maintenance medium (KLC-MM, KaLy-Cell) supplemented with 1% FBS.

[0253] Transfection For knockdown experiments in C3A cells, 25,000 cells / well were used in 96-well plates. Cells were transfected with the indicated concentrations of siRNA using 0.2 μl / well Lipofectamine® RNAiMAX transfection reagent (ThermoFisher) in a reverse transfection setup according to the manufacturer's protocol and incubated for 48 hours without medium change. Usually, N=4 technical replicates were performed per test sample.

[0254] For transfection of human PBMCs, 100 nM of siRNA was added to the PBMCs. 1×10 5Each well was reverse transfected with 0.3 μL Lipofectamine 2000 per 96-well (n=2) in a total volume of 150 μL serum-free RPMI medium for 24 hours. Single-stranded RNA ("R-0006") and DNA ("CpG ODN") oligonucleotides, as well as double-stranded unmodified and 2'-O-methyl modified siRNA ("132 / 161"), were applied as controls.

[0255] mRNA expression analysis Forty-eight hours after siRNA transfection or 72 hours after free siRNA uptake, cellular RNA was harvested using the SV96 total RNA isolation system from Promega (catalog no. Z3500) according to the manufacturer's protocol, including an intermediate DNase step.

[0256] For cDNA synthesis, the Reverse Transcriptase kit from ThermoFisher (catalog number N8080234) was used. cDNA synthesis from 30 ng of RNA was performed using 1.2 μl 10xRT buffer, 2.64 μl MgCl2 (25 mM), 2.4 μl dNTPs (10 mM), 0.6 μl random hexamers (50 μM), 0.6 μl oligo(dT)16 (50 μM), 0.24 μl RNase inhibitor (20 U / μl), and 0.3 μl Multiscribe (50 U / μl) (total volume 12 μl). Samples were incubated at 25° C. for 10 min and at 42° C. for 60 min. The reaction was stopped by heating at 95° C. for 5 min.

[0257] PCSK9 mRNA levels were quantified by qPCR using ThermoFisher TaqMan Universal PCR Master Mix (Cat. No. 4305719) and TaqMan® Gene Expression assays Hs00545399_m1 and Mf03418189_m1 for human and cynomolgus monkey samples, respectively. PCR was performed in technical duplicate on an ABI Prism 7900 under the following PCR conditions: 50°C for 2 minutes, 95°C for 10 minutes, 95°C for 15 seconds, and 60°C for 1 minute for 40 cycles. PCR was set up as a simplex PCR to detect the target gene (PCSK9) in one reaction, and a housekeeping gene (RPL37A) for normalization in the second reaction. The final volume of the PCR reaction was 12.5 μl in 1xPCR master mix, and RPL37A primers were used at a final concentration of 50 nM and 200 nM of probe. The ΔΔCt method was applied to calculate the relative expression levels of target transcripts. The percentage of PCSK9 expression was calculated by normalization based on the level of the LV2 non-silencing siRNA control sequence.

[0258] I C 50 measurement C3A cells were transfected with the indicated siRNAs at concentrations ranging from 25 nM to 0.1 pM using 8-fold dilution steps. The half-maximal inhibitory concentration (IC) for each siRNA was determined. 50 ) was calculated by applying the Biostat-Speed ​​statistical calculation tool. Results were obtained using a four-parameter logistic model according to Ratkovsky and Reedy (1986). Adjustments were made by nonlinear regression using the Levenberg-Marquardt algorithm in SAS v9.1.3 software.

[0259] IC in human and cynomolgus monkey primary hepatocytes 50 For the measurements, 70,000 cells in a 96-well plate were incubated for 72 h under free uptake conditions with siRNA at concentrations ranging from 10 μM to 0.005 nM using 5-fold dilution steps.

[0260] ELISA assay 48 hours after transfection with the indicated concentrations of siRNA, PCSK9 protein concentrations in the supernatants of C3A cells were quantified by the Human PCSK9 Quantikine ELISA Kit from R&D Systems (Cat. No. DPC900). ELISA assays were performed according to the manufacturer's protocol using 50 μl of undiluted cell culture supernatant. Percentages of PCSK9 expression were calculated by normalization based on the average levels of a non-silencing siRNA control sequence.

[0261] IFNα protein concentration in the supernatants of PBMCs was quantified as follows: 25 μL of cell culture supernatant was used for measurement of IFNα concentration applying a self-established electrochemiluminescence assay based on MesoScale Discovery technology, using a pan-IFNα monoclonal capture antibody (MT1 / 3 / 5, Mabtech).

[0262] cytotoxicity After 72 hours of incubation under free uptake conditions with 50,000 human primary hepatocytes, the cytotoxicity of each siRNA was measured by determining the cell viability / toxicity ratio in each sample.Cell viability was measured by determining the intracellular ATP content using the CellTiter-Glo® assay (Promega, Catalog No. G7570) according to the manufacturer's protocol.Cytotoxicity was measured in the supernatant using the ToxiLight™ assay (Lonza, Catalog No. LT07-217) according to the manufacturer's protocol.

[0263] Nuclease Stability siRNAs were tested for nuclease stability in 50% mouse serum. For this purpose, 160 μL of mouse serum (Sigma, Cat. No. M5905) was incubated at 37° C. for 0, 8, 24, 32, 48, 56, and 72 hours. At each time point, 21 μL was taken from the reaction and stopped with 23 μL of stop solution (for 3,000 μL of stop solution: 1123 μL of Tissue & Cell Lysis Solution (Epicentre, Cat. No. MTC096H), 183 μL of 20 mg / mL Proteinase K (Sigma, Cat. No. P2308), 1694 μL of water) at 65° C. for 30 minutes. 33 μL of RNase-free water was added to each sample before HPLC analysis on a Waters 2695 Separation Module and 2487 Dual Absorbance Detector. 50 μL of the solution was analyzed by HPLC using a DNAPac PA200 analytical column (Thermo Scientific, Cat. No. 063000) and the following gradient:

[0264] [Table 9]

[0265] Mouse model Female mice used in the following experiments carried a transgene encoding full-length human PCSK9 and were knocked out for the corresponding mouse PCSK9. The transgenic model "hTg-mKO line no. 2" was licensed from IRCM (Institut de Recherches Cliniques do Montreal) via Univalor Inc.

[0266] In vivo measurements Serum PCSK9 levels in mice treated with siRNA were determined using the same R&D Systems human PCSK9 Quantikine ELISA kit (catalog number DPC900) with a 1:40 pre-dilution. Relative PCSK9 serum levels to pre-dosing values ​​were calculated.

[0267] Serum total cholesterol and LDL cholesterol levels in transgenic mice treated with PCSK9 siRNA were measured using a COBAS INTEGRA instrument and Roche's LDLC3 assay or Horiba's ABX Pentra LDL Determined by Direct CP assay.

[0268] Serum AST, ALT, and BUN levels were determined using standard clinical chemistry assays on a COBAS INTEGRA instrument.

[0269] result Ten PCSK9 siRNA sequences, shown in Tables A and B, were conjugated and characterized in vitro. IC 50 Measurements were performed (Table C). IC in human C3A cells transfected with the indicated siRNAs. 50 Values ​​ranged from 9.7 to 125.0 pM.

[0270] [Table 10]

[0271] PCSK9 protein knockdown was confirmed by quantification of PCSK9 levels in the supernatants of C3A cells transfected with three different concentrations (25, 0.39, and 0.0061 nM) of siRNA (Figure 8).

[0272] In addition, IC of each siRNA 50 was measured using free uptake into primary cells. Cynomolgus monkey primary hepatocytes were treated with siRNA and the IC 50 was calculated (Table D). IC 50Values ​​ranged from 94.2 to 486.0 nM. siRNA sequences C032.004 and C032.005 (with no mismatches to cynomolgus PCSK9) showed excellent dose-dependent knockdown activity, whereas sequence C032.012 (with one mismatch to a macaque species) showed poorer but still dose-dependent knockdown activity.

[0273] [Table 11]

[0274] We also treated human primary hepatocytes with siRNAs and determined the IC of each siRNA in this human primary cell type. 50 was calculated (Table E). 50 The values ​​ranged from 9.4 to 189.0 nM. We also investigated the cytotoxicity of siRNAs under free uptake conditions in this human primary cell type (Figure 9). No dose-dependent cytotoxic effects were observed for any of the siRNAs tested.

[0275] [Table 12]

[0276] The immune response to siRNA in human primary cells was measured by investigating the production of interferon-α secreted in response to siRNA transfection from human primary PBMCs isolated from three different healthy donors (Figure 10). No indication of immune stimulation in human PBMCs was observed for any of the siRNAs tested.

[0277] Ten PCSK9 siRNAs were also tested for their in vitro nuclease stability in 50% mouse serum to determine relative stability and half-life (Figure 11). All siRNAs were stable for at least 24 hours, with compound C032.005 identified as the most stable with little or no degradation at the last time point measured (72 hours).

[0278] A summary of the results from the in vitro analysis is shown in FIG. 12. Next, the in vivo effects of a single subcutaneous injection of 10 mg / kg of the 10 conjugated siRNAs compared to a non-silencing control siRNA on serum PCSK9 protein levels (FIG. 13A) and serum total cholesterol levels (FIG. 13B) were investigated. Mice used in the in vivo efficacy experiments carried a transgene encoding full-length human PCSK9 and were knocked out for the corresponding mouse PCSK9. siRNAs C032.005, C032.007, and C032.012 had nearly identical patterns of PCSK9 reduction, with maximum PCSK9 knockdown of about 49-52% between days 3-7, returning to baseline between days 17-21. siRNA C032.006 was the most active on PCSK9 levels, with maximum knockdown of 65% at day 10, returning to baseline levels at day 52. The highest reduction in total cholesterol levels was obtained using siRNAs C032.005 and C032.012, with maximum reductions of 19% and 22%, respectively. Interestingly, no major effect on cholesterol levels was observed for siRNA C032.006, despite siRNA C032.006 having the greatest effect on PCSK9 levels.

[0279] Acute toxicity parameters were measured in serum samples on days 3 (FIG. 13C) and 10 (FIG. 13D) of the same in vivo study in human PCSK9 transgenic mice. No obvious hepatotoxicity (as determined by AST and ALT levels) or nephrotoxicity (as determined by BUN levels) was detected for any of the tested compounds. Taken together, the superior in vivo toxicity of PCSK9 siRNA C032.012 was also demonstrated. The in vitro profile was translated to an in vivo setting in a relevant transgenic mouse model. Furthermore, siRNA C032.005 inhibited the expression of PCSK9 and Two additional siRNAs, C032.006 and C032.007, were identified as having potent PCSK9 inhibition in vivo, but interestingly, these two siRNAs did not have a major effect on lowering cholesterol levels. EXAMPLES

[0280] In vitro assessment of further tested PCSK9 siRNA molecules method Unless otherwise indicated, all experiments were performed as described in the Examples above.

[0281] result An additional set of siRNAs targeting PCSK9 was designed using looser off-target filter criteria, allowing for greater variation in siRNA length (19, 21, and 23-mers), and these additional siRNAs were synthesized. Their ability to knockdown PCSK9 mRNA expression in human Hep3B cells (Figure 14A) and human C3A cells (Figure 14B) was then tested using 0.1 and 1 nM siRNA transfection. The relative cytotoxicity of the transfected siRNAs was also tested at 5 and 50 nM concentrations in these two human cell types (Figure 15). Toxic effects were observed in both human cell types when treated with siRNA C209.021. IC of siRNA was calculated for the 15 most active and non-toxic sequences using human Hep3B cells (Table F) and human C3A cells (Table G). 50 The IC values ​​were calculated in human Hep3B cells. 50 The values ​​ranged from 3.3 to 45.2 pM, while the IC 50 Values ​​ranged from 14.1 to 102.0 pM. The best maximal knockdown in both cell types was obtained using siRNA C209.016.

[0282] [Table 13]

[0283] [Table 14]

[0284] Finally, the calculated IC in Hep3B cells versus C3A cells 50 The correlation between the values ​​(Figure 16A) and the I max To understand the correlation between the values ​​(Figure 16B), a comparison was made.

[0285] The data obtained in this example taken together show that two additional PCSK9 siRNA sequences, C209.016 and C218.012, had superior activity profiles in all of the in vitro assays applied. C218.012 is a one nucleotide extended sequence compared to C032.012. EXAMPLES

[0286] Lead optimization of GalNAc-conjugated PCSK9 siRNA sequences method Unless otherwise indicated, all experiments were performed as described in the Examples above. GalNAc-siRNAs, including those containing the nucleotide analogs described above, were generated based on the sequences shown (see sequence listing above) as described in WO2019 / 170731.

[0287] result Based on the results from Examples 3 and 4, three parent PCSK9 siRNA sequences were selected (siRNA numbers B014 / C032.012 / C217.014, B006 / C032.006 / C217.001, and C209.016 / C217.007), and each molecule was synthesized with three consecutive GalNAc-conjugated nucleotide analogs at the 5'-end of each siRNA sense strand (siRNA numbers C027.001, C027.002, and C027.003; Table 4 above). The parent sequences of siRNA numbers C027.001, C027.002, and C027.003 were then used in an optimization effort involving 66 different chemical modifications per siRNA sequence. The resulting sequences and modification patterns are shown in Table 4 above.

[0288] The in vitro activity of these optimized libraries was tested in cryopreserved human primary hepatocytes under free uptake conditions using PCSK9 GalNAc-siRNA at concentrations of 10 nM, 100 nM, and 1000 nM. As shown in FIG. 17, the parent sequence Optimized libraries based on C027.001 and C027.003 were identified to exhibit overall higher in vitro activity compared to the parent sequence C027.002. Notably, many modification patterns were identified that strongly impair the siRNA activity of the molecules, especially for the parent sequence C027.002. On the other hand, numerous sequence modifications were identified that result in improved knockdown activity compared to the respective parent molecules.

[0289] To assess the improved stability characteristics of the optimized PCSK9 GalNAc-siRNAs, the optimized libraries were assayed for their in vitro half-lives in 50% mouse serum. As demonstrated in Table H, numerous modifications were identified that had improved nuclease stability compared to their respective parent molecules, with the improved nuclease stability being most evident for the optimized library of parent siRNA no. C027.001.

[0290] [Table 15-1] [Table 15-2]

[0291] Prior to in vivo activity testing, 14 siRNA modifications were selected for each of three different parental sequences, siRNA numbers C027.001, C027.002, and C027.003, based on siRNA activity, stability, and chemical considerations. Immune stimulatory potential was measured in a human PBMC assay using IFNα2a secretion into the supernatant as a readout ( FIG. 18 ). No indication of immune stimulation in human PBMC was observed for any of the PCSK9 GalNAc-siRNAs tested.

[0292] A total of 42 of the 198 optimized PCSK9 GalNAc-siRNAs based on three different parental sequences were then tested in human PCSK9 transgenic mice. The selected compounds were used in vivo pharmacology studies and compared to their respective parent molecules C027.001, C027.002, and C027.003 (Figures 19A-C). Following subcutaneous administration of a single 6 mg / kg dose of selected compounds, maximal target PCSK9 protein knockdown (KD) of 86% (C027.001 #58), 62% (C027.002 #19), and 82% (C027.003 #08) was achieved between days 7 and 14 for each of the three optimized libraries when compared to animals treated with PBS vehicle control. max ) was achieved. The increase in in vivo activity was most significant for the libraries of parent sequences C027.001 and C027.003, which had KDs of 32% and 31%, respectively. max Value and dosage 3 Interestingly, there was an increase in potency (KD max = 52%) was less clear. 50 Level (50% of max knockdown) is reflected in the KD 50The KD level was achieved at about day 20 for the best molecule of library C027.002 (C027.002 no. 19). Instead, libraries C027.001 and C027.003 showed KD levels at about day 26 and about day 30 for molecules C027.001 no. 40 and C027.003 no. 08, respectively. 50 The overall best in vivo pharmacological profile (KD max and K.D. 50 The molecules identified by were C027.001 no. 40, C027.001 no. 58, C027.003 no. 03, C027.003 no. 06, C027.003 no. 08, and C027.003 no. 47.

[0293] In the same study, serum LDL cholesterol (LDL-c) was measured 14 and 28 days after siRNA dosing (Figures 19D and 19E). This analysis confirmed the identification of a number of optimized molecules with improved in vivo pharmacological profiles compared to their respective parental sequences. Maximum LDL-c reduction of 32% was achieved 14 days after dosing for siRNA no. C027.003 06.

[0294] A summary of selected siRNAs used in the examples is provided in Table I below.

[0295] [Table 16]

[0296] Although the foregoing disclosure has been described in some detail by way of illustrations and examples for purposes of clarity of understanding, the illustrations and examples should not be construed as limiting the scope of the disclosure.

Claims

1. A double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, the first sequence and the second sequence being complementary, the first sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 6-11 and 310-321, the dsRNA optionally being a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), the dsRNA optionally inhibiting expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene.

2. The dsRNA is (1) CCAUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO: 176) in the sense strand and AGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 177) in the antisense strand; or (2) CCAUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 180) in the sense strand and AAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO: 181) in the antisense strand; or (3) CCAAUUAAUAUGGUGACUUUUUinvdT (SEQ ID NO: 182) in the sense strand and AAAAAGUCACCAUAUUAAUdTdT (SEQ ID NO: 183) in the antisense strand; or (4) CCAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 184) in the sense strand and UAAAAAGUCACCAUAUUAAdTdT (SEQ ID NO: 185) in the antisense strand; (5) CCAUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 186) in the sense strand and UUAAAAAAGUCACCAUAUUAdTdT (SEQ ID NO: 187) in the antisense strand; (6) CCAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO: 188) in the sense strand and AUUUUAAAAAAGUCACCAUAdTdT (SEQ ID NO: 189) in the antisense strand; (7) CCAUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 322) in the sense strand and AAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 323) in the antisense strand; (8) CCAAUAUGGUGACUUUUUAAAAinvdT (SEQ ID NO: 324) in the sense strand and UUUUAAAAAAGUCACCAUAUdtdt (SEQ ID NO: 325) in the antisense strand; (9) CCAAUUUUUAUUAAUAUUGGUGACUinvdT (SEQ ID NO: 326) in the sense strand and AGUCACCAUAUUAAUAAAAUdTdT (SEQ ID NO: 327) in the antisense strand; (10) CCAUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 328) in the sense strand and AAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 329) in the antisense strand; (11) CCAUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 330) in the sense strand and AAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 331) in the antisense strand; (12) CCAUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 332) in the sense strand and UAAAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO: 333) in the antisense strand; (13) CCAAAUAUGGUGAGACUUUUUAAAAUinvdT (SEQ ID NO: 334) in the sense strand and AUUUUAAAAAAGUCACCAUAUUdTdT (SEQ ID NO: 335) in the antisense strand; (14) CCAGCAUUUUUAUUAAUAUUGGUGACUinv in the sense strand dT (SEQ ID NO: 336) in the antisense strand and AGUCACCAUAUUAAUAAAAAAUGCdTdT (SEQ ID NO: 337) in the antisense strand; (15) CCAAUUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 338) in the sense strand and AAAGUCACCAUAUUAAUAAAAUdTdT (SEQ ID NO: 339) in the antisense strand; (16) CCAUUUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 340) in the sense strand and AAAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 341) in the antisense strand; (17) CCAUUUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO: 342) in the sense strand and UAAAAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 343) in the antisense strand; or (18) CCAUUAUUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 344) in the sense strand and UUAAAAAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 345) in the antisense strand; The dsRNA described in claim 1.

3. A double-stranded ribonucleic acid (dsRNA), the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein only the first sequence and the second sequence are complementary, the first sequence being one of SEQ ID NOs: 3, 4, and 13, the dsRNA optionally being a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), the dsRNA optionally inhibiting expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene.

4. The dsRNA is (19) CCAUUGUAGCAUUUUUAUUAAUinvdT (SEQ ID NO: 162) in the sense strand and AUUAAUAAAAAAUGCUACAAdTdT (SEQ ID NO: 163) in the antisense strand; (20) CCAGUAGCAUUUUUAUUAAUAUinvdT (SEQ ID NO: 166) in the sense strand and AUAUUAAUAAAAAAUGCUACdTdT (SEQ ID NO: 167) in the antisense strand; or (21) CCAGAGUGUGAAAGGUGCUGAUinvdT (SEQ ID NO: 290) in the sense strand and AUCAGCACCUUUCACACUCdTdT (SEQ ID NO: 291) in the antisense strand; The dsRNA described in claim 3.

5. The dsRNA of any one of claims 1 to 4, wherein the first strand and the second strand are each 30 nucleotides or less in length, and optionally the first strand and the second strand are at least 19 and no more than 23 nucleotides in length, respectively.

6. The dsRNA contains one or more modified nucleotides; At least one of the one or more modified nucleotides is optionally a 2'-O-methyl nucleotide, a 5'-phosphorothioate nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a lipophilic moiety; At least one of the one or more modified nucleotides is optionally 2'-fluoro, 2'-deoxy, 2'-O-methoxyethyl, constrained ethyl (cEt), deoxy, inverted deoxy, inverted dideoxy, locked nucleic acid, abasic, 2'-amino, 2'-alkyl, morpholino, phosphoramidate, or a non-natural base-containing nucleotide; The dsRNA optionally comprises one or more 2'-O-methyl nucleotides and one or more 2'-fluoro nucleotides; The dsRNA optionally contains two or more 2'-O-methyl nucleotides and two or more 2'-fluoro nucleotides in the following pattern: OMe-F-OMe-F or F-OMe-F-OMe where OMe represents a 2'-O-methyl nucleotide and F represents a 2'-fluoro nucleotide: The dsRNA optionally contains up to 10 consecutive nucleotides that are each 2'-O-methyl nucleotides, or up to 10 consecutive nucleotides that are each 2'-fluoro nucleotides. The dsRNA according to any one of claims 1 to 5.

7. (a) Does the dsRNA contain one or more phosphorothioate groups? or (b) the dsRNA does not contain phosphorothioate groups; The dsRNA according to any one of claims 1 to 6.

8. (a) the dsRNA contains one or more phosphotriester groups; or (b) the dsRNA does not contain a phosphotriester group; The dsRNA according to any one of claims 1 to 7.

9. The dsRNA of any one of claims 1 to 8, wherein the dsRNA is attached to one or more GalNAc derivatives via a linker, optionally wherein the dsRNA is attached to three GalNAc derivatives via a trivalent branched linker, and optionally wherein at least one of the one or more GalNAc derivatives is attached to the 3' end of the sense strand, the 3' end of the antisense strand, or the 5' end of the sense strand of the dsRNA.

10. One or both of the sense and antisense strands may be (a) a 5' overhang comprising one or more nucleotides, optionally comprising one or more thymines; and / or (b) a 3' overhang comprising one or more nucleotides, optionally comprising two nucleotides, and optionally comprising one or more thymines; The dsRNA according to any one of claims 1 to 9, further comprising:

11. One or both strands of the dsRNA have the formula (I): 【Chemistry 1】 (In the formula, - B is a heterocyclic nucleobase; one of L1 and L2 is an internucleoside linking group that links the compound of formula (I) to a polynucleotide and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or an internucleoside linking group that links the compound of formula (I) to a polynucleotide; Y is O, NH, NR1, or N-C(=O)-R1, where R1 is a (C1-C20) alkyl group, optionally substituted with one or more groups selected from halogen atoms, a (C1-C6) alkyl group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, a (C5-C14) heteroaryl group, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN, -C(=J)-O-Z1, -O-C(=J)-Z1, -C(=J)-N(Z1)(Z2), and -N(Z1)-C(=J)-Z2, wherein J is O or S; each of Z1 and Z2 is independently H, a (C1-C6) alkyl group, optionally a (C1-C6) alkyl group substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group; (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups; The group -[C(=O)]-R2-(O-CH2-CH2)p-R3, where m is an integer meaning 0 or 1, p is an integer ranging from 0 to 10; R2 is a (C1-C20) alkylene group, optionally substituted with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN, -C(=K)-O-Z3, -O-C(=K)-Z3, -C(=K)-N(Z3)(Z4), or -N(Z3)-C(=K)-Z4, where K is O or S; Each of Z3 and Z4 is independently H, a (C1-C6) alkyl group, optionally substituted with one or more groups selected from a halogen atom and a (C1-C6) alkyl group; R3 is selected from the group consisting of a hydrogen atom, a (C1-C6) alkyl group, a (C1-C6) alkoxy group, a (C3-C8) cycloalkyl group, a (C3-C14) heterocycle, a (C6-C14) aryl group, or a (C5-C14) heteroaryl group; or R3 is a cell targeting moiety, the group -[C(=O)]m-R2-(O-CH2-CH2)p-R3 and X1 and X2 are each independently a hydrogen atom or a (C1-C6) alkyl group; each of Ra, Rb, Rc, and Rd is independently H or a (C1-C6) alkyl group; or a pharma- ceutically acceptable salt thereof, The dsRNA described in claim 1.

12. Formula (I) (wherein Y is a) NR1, where R1 is an unsubstituted (C1-C20) alkyl group; b) NR1, where R1 is an unsubstituted (C1-C16) alkyl group, including alkyl groups selected from the group including methyl, isopropyl, butyl, octyl, and hexadecyl; c) NR1, where R1 is a (C3-C8)cycloalkyl group, optionally with one or more groups selected from halogen atoms and (C1-C6)alkyl groups. a substituted (C3-C8) cycloalkyl group; d) NR1, where R1 is a cyclohexyl group; e) NR1, where R1 is a (C1-C20) alkyl group substituted with a (C6-C14) aryl group; f) NR1, where R1 is a methyl group substituted with a phenyl group; g) N-C(=O)-R1, where R1 is an optionally substituted (C1-C20) alkyl group; or h) N-C(=O)-R1, where R1 is methyl or pentadecyl. The dsRNA of claim 11, comprising one or more compounds of the formula:

13. 13. The dsRNA of claim 11 or 12, comprising one or more compounds of formula (I), or a pharma- ceutically acceptable salt thereof, wherein B is selected from the group consisting of pyrimidines, substituted pyrimidines, purines, and substituted purines.

14. R3 is a group represented by formula (II) 【Chemistry 2】 (In the formula, A1, A2, and A3 are OH; A4 is OH or NHC(=O)-R5, where R5 is (a C1-C6 alkyl group, optionally substituted with a halogen atom (C1-C6) alkyl). The dsRNA of any one of claims 11 to 13, which is a medicament for treating or preventing osteoarthritis, or a pharma-ceutically acceptable salt thereof.

15. The dsRNA of any one of claims 11 to 14, wherein R3 is N-acetyl-galactosamine or a pharma- ceutically acceptable salt thereof.

16. The dsRNA of any one of claims 11 to 15, comprising one or more nucleotides from Table A.

17. The dsRNA according to any one of claims 11 to 16, comprising 2 to 10 compounds of formula (I) or a pharma- ceutically acceptable salt thereof.

18. The dsRNA of claim 17, wherein 2 to 10 compounds of formula (I) are present on the sense strand.

19. The dsRNA according to any one of claims 11 to 18, wherein the sense strand comprises 2 to 5 compounds of formula (I) at the 5'-end and / or 1 to 3 compounds of formula (I) at the 3'-end.

20. a) 2 to 5 compounds of formula (I) at the 5' end of the sense strand include lgT3, 3 consecutive IgT3 nucleotides; and / or b) one to three compounds of formula (I) at the 3' end of the sense strand include lT4; optionally, two consecutive lT4s; The dsRNA according to any one of claims 11 to 19.

21. 21. The dsRNA of any one of claims 1 to 20, comprising one or more internucleoside linkage groups independently selected from the group consisting of phosphodiester backbone linkage groups, phosphotriester backbone linkage groups, phosphorothioate backbone linkage groups, phosphorodithioate backbone linkage groups, alkyl-phosphonate backbone linkage groups, and phosphoramidate backbone linkage groups, or a pharma- ceutically acceptable salt thereof.

22. The dsRNA of any one of claims 1 to 21, selected from the dsRNAs in Tables 2 to 4.

23. a) the sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 578, 585, 587, 620, 621, 622, and 627; and / or b) the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 589, 591, 631, 632, 634, 635, and 639; The dsRNA according to any one of claims 1 to 22.

24. The sense and antisense strands of the dsRNA are a) SEQ ID NOs: 578 and 589; [C027.001] b) SEQ ID NOs: 620 and 631; [C027.003] c) SEQ ID NOs: 585 and 591; [C027.001#40] d) SEQ ID NOs: 587 and 591; [C027.001#58] e) SEQ ID NOs: 621 and 634; [C027.003#03] f) SEQ ID NOs: 622 and 632; [C027.003#06] g) SEQ ID NOs: 622 and 635; [C027.003#08] And h) SEQ ID NOs: 627 and 639; [C027.003#47] The dsRNA of claim 23, comprising the nucleotide sequence:

25. A vector encoding the dsRNA according to any one of claims 1 to 24.

26. An isolated host cell comprising the dsNRA of any one of claims 1 to 24 or the vector of claim 25.

27. A composition comprising the dsRNA of any one of claims 1 to 24, optionally further comprising a pharma- ceutically acceptable carrier, optionally further comprising a delivery vehicle, optionally wherein the delivery vehicle is selected from the group consisting of a liposome, a lipoplex, a complex, and a nanoparticle.

28. The dsRNA or composition according to any one of claims 1 to 24 for use in a method for inhibiting the expression of PCSK9 gene in a subject, wherein optionally the expression of PCSK9 gene in the liver of the subject is inhibited by the dsRNA, and optionally the subject is a human.

29. A claim for use in a method for treating or preventing a PCSK9-mediated disease in a subject in need thereof. The dsRNA or composition according to any one of claims 1 to 24 or claim 27, wherein the PCSK9-mediated disorder is hypercholesterolemia, and optionally the expression of the PCSK9 gene in the liver of the subject is inhibited by the dsRNA, and optionally the subject is a human.

Images