Treatment of tumors by combination of oncolytic adenovirus and CDK4 / 6 inhibitor

Abstract

To provide means to increase the efficacy of tumor therapy based on oncolytic viruses and adenovirus in particular.SOLUTION: The present invention provides a combination comprising an adenovirus and a CDK4 / inhibitor.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to combinations of oncolytic viruses and CDK4 / 6 inhibitors, the use of such combinations in the treatment of diseases, e.g. tumors, oncolytic viruses, preferably oncolytic adenoviruses, in combination with CDK4 / 6 inhibitors for use in the treatment of diseases, e.g. tumors, and oncolytic viruses, preferably oncolytic adenoviruses, in combination with CDK4 / 6 inhibitors for use in the treatment of diseases, e.g. tumors.

[0002] Currently, numerous therapeutic concepts are used for the treatment of tumors. Besides using surgery, chemotherapy and radiotherapy predominate. However, all these techniques are associated with significant side effects. The use of replication-selective oncolytic viruses provides a new platform for the treatment of tumors. In connection therewith, selective intratumoral replication of the viral agent is initiated, which leads to viral replication, lysis of the infected tumor cells, and spread of the virus to neighboring tumor cells. Since the replicative capacity of the virus is limited to tumor cells, normal tissues are spared from replication and therefore from lysis by the virus.

[0003] The problem underlying the present invention is to provide a means for increasing the efficacy of tumor therapy based on oncolytic viruses and in particular adenoviruses.

[0004] These and other problems are solved by the subject matter of the attached independent claims, preferred embodiments can be taken from the attached dependent claims.

[0005] The problem underlying the present invention is also solved in a first aspect, which is also a first embodiment of such a first aspect by a combination comprising an adenovirus and a CDK4 / 6 inhibitor.

[0006] Further embodiments of such a first aspect are disclosed below.

[0007] Embodiment 2: The combination of embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0008] Embodiment 3: A combination of any one of embodiments 1 and 2, wherein the adenovirus is replicating in a YB-1-dependent manner.

[0009] Embodiment 4: The combination of embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus but replicates in cells which have YB-1 in the nucleus.

[0010] Embodiment 5: The combination of any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0011] Embodiment 6: The combination of embodiment 5, wherein the oncogene protein is an E1A protein.

[0012] Embodiment 7: A combination of embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0013] Embodiment 8: The combination of embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0014] Embodiment 9: A combination of any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0015] Embodiment 10: The combination of any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0016] Embodiment 11: A combination according to embodiment 10, wherein the deletions are selected from the group comprising deletions of the CR3 stretch and N-terminal deletions and C-terminal deletions.

[0017] Embodiment 12: A combination of any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0018] Embodiment 13: A combination of any one of embodiments 6 to 12, wherein the E1A protein contains one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0019] Embodiment 14: A combination of embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0020] Embodiment 15: The combination of any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0021] Embodiment 16: The combination of any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0022] Embodiment 17: The combination of any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0023] Embodiment 18: The combination of any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0024] Embodiment 19: The combination of any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0025] Embodiment 20: The combination of any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0026] Embodiment 21: The combination of any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0027] Embodiment 22: The combination of embodiment 21, wherein the adenovirus is XVir-N-31.

[0028] Embodiment 23: A combination of embodiment 21, wherein the adenovirus is dl520, in which the adenovirus E3 region is functionally inactive.

[0029] Embodiment 24: The combination of any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0030] Embodiment 25: The combination of any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0031] Embodiment 26: A combination of any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0032] Embodiment 27: The combination of embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0033] Embodiment 28: A combination of embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0034] Embodiment 29: The combination of any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in a cell, preferably a tumor cell.

[0035] Embodiment 30: A combination according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0036] Embodiment 31: The combination of any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0037] Embodiment 32: The combination of any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor arrests cells in G1 and inhibits E2F1.

[0038] Embodiment 33: The combination of any one of embodiments 1 to 32, wherein the composition further comprises a PARP inhibitor.

[0039] Embodiment 34: The combination of embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0040] Embodiment 35: A combination of any one of embodiments 1 to 32, wherein the composition further comprises a bromodomain inhibitor.

[0041] Embodiment 36: The combination of embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0042] Embodiment 37: The combination of any one of embodiments 1 to 36, wherein the components of the combination are for separate administration.

[0043] The problem underlying the present invention is also solved in a second aspect, which is also a first embodiment of such second aspect by a combination of the first aspect (including any embodiment thereof) for use in the treatment of a disease, more preferably a tumor or cancer, comprising an adenovirus and a CDK4 / 6 inhibitor.

[0044] Further embodiments of such a second aspect are disclosed below.

[0045] Embodiment 1: A method for the treatment and / or prevention of a disease, preferably a tumor or cancer, comprising an adenovirus and a CDK4 / 6 inhibitor, combination.

[0046] Embodiment 2: A combination for use according to embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0047] Embodiment 3: A combination for use according to any one of embodiments 1 and 2, wherein the adenovirus is replicating in a YB-1-dependent manner.

[0048] Embodiment 4: A combination for use according to embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells which have YB-1 in the nucleus.

[0049] Embodiment 5: A combination for use according to any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0050] Embodiment 6: A combination for use according to embodiment 5, wherein the oncogene protein is an E1A protein.

[0051] Embodiment 7: A combination for use according to embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0052] Embodiment 8: A combination for use according to embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0053] Embodiment 9: A combination for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0054] Embodiment 10: A combination for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0055] Embodiment 11: A combination for use according to embodiment 10, wherein the deletions are selected from the group comprising deletions of the CR3 stretch and deletions of the N-terminus and deletions of the C-terminus.

[0056] Embodiment 12: A combination for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0057] Embodiment 13: A combination for use according to any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0058] Embodiment 14: A combination for use according to embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0059] Embodiment 15: A combination for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0060] Embodiment 16: A combination for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0061] Embodiment 17: A combination for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0062] Embodiment 18: A combination for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0063] Embodiment 19: A combination for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0064] Embodiment 20: A combination for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0065] Embodiment 21: A combination for use according to any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0066] Embodiment 22: A combination for use according to embodiment 21, wherein the adenovirus is XVir-N-31.

[0067] Embodiment 23: A combination for use of embodiment 21, wherein the adenovirus is dl520, in which the adenovirus E3 region is functionally inactive.

[0068] Embodiment 24: A combination for use according to any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0069] Embodiment 25: A combination for use according to any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0070] Embodiment 26: A combination for use according to any one of embodiments 1 to 25, wherein the virus codes for YB-1.

[0071] Embodiment 27: A combination for use according to embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0072] Embodiment 28: A combination for use according to embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0073] Embodiment 29: A combination for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0074] Embodiment 30: A combination for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0075] Embodiment 31: The combination for use according to any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0076] Embodiment 32: A combination according to any one of embodiments 1 to 31 for use, wherein the CDK4 / 6 inhibitor arrests cells in G1 and inhibits E2F1.

[0077] Embodiment 33: A combination for use according to any one of embodiments 1 to 32, wherein the composition further comprises a PARP inhibitor.

[0078] Embodiment 34: A combination for use according to embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0079] Embodiment 35: A combination for use according to any one of embodiments 1 to 32, wherein the composition further comprises a bromodomain inhibitor.

[0080] Embodiment 36: A combination for use according to embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0081] Embodiment 37: A combination according to any one of embodiments 1 to 36 for use, wherein the components of the combination are for separate administration.

[0082] Embodiment 38: A combination for use according to any one of embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0083] Embodiment 39: A combination for use according to any one of embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0084] Embodiment 40: A combination for use according to any one of embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0085] Embodiment 41: A combination for use according to any one of embodiments 1 to 38, wherein the tumor cells have gene amplification and / or gene activating mutations.

[0086] Embodiment 42: A combination for use according to embodiment 41, wherein the genes are selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0087] Embodiment 43: A combination for use according to embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signalling pathway.

[0088] Embodiment 44: A combination for use according to embodiment 43, wherein the mitogenic signalling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0089] Embodiment 45: A combination for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

[0090] Embodiment 46: A combination for use according to embodiment 45, wherein the pharma- ceutically active agent is a cytostatic agent.

[0091] Embodiment 47: A combination for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0092] Embodiment 48: A combination for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0093] Embodiment 49: A combination for use according to any one of embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular multiple resistance or polyresistance to cytostatic agents and / or radiation.

[0094] Embodiment 50: A combination for use according to any one of embodiments 1 to 49, wherein the tumor cells are Rb positive.

[0095] Embodiment 51: A combination for use according to any one of embodiments 1 to 50, wherein the tumor cells have YB-1 in the nucleus.

[0096] Embodiment 52: A combination according to any one of embodiments 1 to 51 for use, wherein the tumor cells have YB-1 in the nucleus after attraction.

[0097] Embodiment 53: A combination for use according to embodiment 52, wherein transport of YB-1 into the nucleus is induced by at least one means selected from the group comprising irradiation, administration of cytostatic drugs and hyperthermia.

[0098] Embodiment 54: A combination for use according to embodiment 53, wherein the means is applied to a cell, an organ or an organism, preferably to an organism in need thereof, more preferably to an organism suffering from a tumor.

[0099] Embodiment 55: A combination for use according to any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

[0100] The problem underlying the present invention is also solved in a third aspect, which is also a first embodiment of such a third aspect by an adenovirus for use in treating and / or preventing a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering to the subject an adenovirus and a CDK4 / 6 inhibitor.

[0101] Further embodiments of such a third aspect are disclosed below.

[0102] Embodiment 2: The adenovirus for use according to embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0103] Embodiment 3: An adenovirus for use according to any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0104] Embodiment 4: An adenovirus for use according to embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells which have YB-1 in the nucleus.

[0105] Embodiment 5: An adenovirus for use according to any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0106] Embodiment 6: An adenovirus for use according to embodiment 5, wherein the oncogene protein is an E1A protein.

[0107] Embodiment 7: An adenovirus for use according to embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0108] Embodiment 8: An adenovirus for use according to embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0109] Embodiment 9: An adenovirus for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0110] Embodiment 10: An adenovirus for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0111] Embodiment 11: Adenovirus for use according to embodiment 10, wherein the deletion is selected from the group comprising a deletion of the CR3 stretch and a deletion of the N-terminus and a deletion of the C-terminus.

[0112] Embodiment 12: An adenovirus for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0113] Embodiment 13: An adenovirus for use according to any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0114] Embodiment 14: An adenovirus for use according to embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0115] Embodiment 15: Adenovirus for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0116] Embodiment 16: An adenovirus for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0117] Embodiment 17: Adenovirus for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0118] Embodiment 18: An adenovirus for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0119] Embodiment 19: An adenovirus for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0120] Embodiment 20: Adenovirus for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0121] Embodiment 21: An adenovirus for use according to any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0122] Embodiment 22: The adenovirus for use according to embodiment 21, wherein the adenovirus is XVir-N-31.

[0123] Embodiment 23: The adenovirus for use of embodiment 21, wherein the adenovirus is dl520, in which the adenovirus E3 region is functionally inactive.

[0124] Embodiment 24: An adenovirus for use according to any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0125] Embodiment 25: Adenovirus for use according to any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0126] Embodiment 26: An adenovirus for use according to any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0127] Embodiment 27: An adenovirus for use according to embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific, a tumor-specific and / or a YB-1-dependent promoter.

[0128] Embodiment 28: An adenovirus for use according to embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0129] Embodiment 29: Adenovirus for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in a cell, preferably a tumor cell.

[0130] Embodiment 30: Adenovirus for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0131] Embodiment 31: The adenovirus for use according to any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0132] Embodiment 32: An adenovirus for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor arrests the cell in G1 and inhibits E2F1.

[0133] Embodiment 33: An adenovirus for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0134] Embodiment 34: Adenovirus for use of embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0135] Embodiment 35: An adenovirus for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the subject.

[0136] Embodiment 36: An adenovirus for use according to embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0137] Embodiment 37: Adenovirus for use according to any one of embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0138] Embodiment 38: An adenovirus for use according to any one of embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0139] Embodiment 39: Adenovirus for use according to any one of embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0140] Embodiment 40: An adenovirus for use according to any one of embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group including the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0141] Embodiment 41: Adenovirus for use according to any one of embodiments 1 to 38, wherein the tumor cells have gene amplification and / or gene activating mutations.

[0142] Embodiment 42: Adenovirus for use according to embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0143] Embodiment 43: An adenovirus for use in embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signaling pathway.

[0144] Embodiment 44: Adenovirus for use in embodiment 43, wherein the mitogenic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0145] Embodiment 45: Adenovirus for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

[0146] Embodiment 46: Adenovirus for use according to embodiment 45, wherein the pharma- ceutical active agent is a cytostatic agent.

[0147] Embodiment 47: An adenovirus for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0148] Embodiment 48: Adenovirus for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0149] Embodiment 49: Adenovirus for use according to any one of embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular multiple resistance or polyresistance to cytostatic agents and / or radiation.

[0150] Embodiment 50: Adenovirus for use according to any one of embodiments 1 to 49, wherein the tumor cells are Rb positive.

[0151] Embodiment 51: An adenovirus for use according to any one of embodiments 1 to 50, wherein the tumor cells have YB-1 in the nucleus.

[0152] Embodiment 52: An adenovirus for use according to any one of embodiments 1 to 51, wherein the tumor cells have YB-1 in the nucleus after attraction.

[0153] Embodiment 53: Adenovirus for use according to embodiment 52, wherein transport of YB-1 into the nucleus is induced by at least one means selected from the group comprising irradiation, administration of a cytostatic drug and hyperthermia.

[0154] Embodiment 54: Adenovirus for use according to embodiment 53, wherein the means is applied to a cell, an organ or an organism, preferably to an organism in need thereof, more preferably to an organism suffering from a tumor.

[0155] Embodiment 55: The adenovirus for use according to any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

[0156] The problem underlying the present invention is also solved in a fourth aspect, which is also a first embodiment of such fourth aspect by a CDK4 / 6 inhibitor for use in the treatment and / or prevention of a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering an adenovirus and a CDK4 / 6 inhibitor to the subject.

[0157] Further embodiments of such a fourth aspect are disclosed below.

[0158] Embodiment 2: The CDK4 / 6 inhibitor for use in embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0159] Embodiment 3: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 and 2, wherein the adenovirus is replicating in a YB-1-dependent manner.

[0160] Embodiment 4: A CDK4 / 6 inhibitor for use in embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells which have YB-1 in the nucleus.

[0161] Embodiment 5: A CDK4 / 6 inhibitor for use according to any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0162] Embodiment 6: A CDK4 / 6 inhibitor for use in embodiment 5, wherein the oncogene protein is an E1A protein.

[0163] Embodiment 7: A CDK4 / 6 inhibitor for use in embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0164] Embodiment 8: A CDK4 / 6 inhibitor for use in embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0165] Embodiment 9: A CDK4 / 6 inhibitor for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0166] Embodiment 10: A CDK4 / 6 inhibitor for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0167] Embodiment 11: A CDK4 / 6 inhibitor for use according to embodiment 10, wherein the deletion is selected from the group comprising deletions of the CR3 stretch and deletions of the N-terminus and deletions of the C-terminus.

[0168] Embodiment 12: A CDK4 / 6 inhibitor for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0169] Embodiment 13: A CDK4 / 6 inhibitor for use according to any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0170] Embodiment 14: A CDK4 / 6 inhibitor for use in embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0171] Embodiment 15: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0172] Embodiment 16: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0173] Embodiment 17: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0174] Embodiment 18: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0175] Embodiment 19: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0176] Embodiment 20: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0177] Embodiment 21: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0178] Embodiment 22: A CDK4 / 6 inhibitor for use in embodiment 21, wherein the adenovirus is XVir-N-31.

[0179] Embodiment 23: A CDK4 / 6 inhibitor for use in embodiment 21, wherein the adenovirus is dl520, wherein the adenovirus E3 region is functionally inactive.

[0180] Embodiment 24: A CDK4 / 6 inhibitor for use according to any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0181] Embodiment 25: A CDK4 / 6 inhibitor for use according to any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0182] Embodiment 26: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 25, wherein the virus codes for YB-1.

[0183] Embodiment 27: A CDK4 / 6 inhibitor for use according to embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0184] Embodiment 28: A CDK4 / 6 inhibitor for use in embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0185] Embodiment 29: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in a cell, preferably a tumor cell.

[0186] Embodiment 30: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0187] Embodiment 31: The CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0188] Embodiment 32: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor arrests cells in G1 and inhibits E2F1.

[0189] Embodiment 33: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0190] Embodiment 34: A CDK4 / 6 inhibitor for use according to embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0191] Embodiment 35: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the subject.

[0192] Embodiment 36: A CDK4 / 6 inhibitor for use in embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0193] Embodiment 37: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0194] Embodiment 38: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0195] Embodiment 39: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0196] Embodiment 40: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0197] Embodiment 41: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have gene amplification and / or gene activating mutations.

[0198] Embodiment 42: A CDK4 / 6 inhibitor for use in embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0199] Embodiment 43: A CDK4 / 6 inhibitor for use in embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signaling pathway.

[0200] Embodiment 44: A CDK4 / 6 inhibitor for use in embodiment 43, wherein the mitogenic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0201] Embodiment 45: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

[0202] Embodiment 46: A CDK4 / 6 inhibitor for use according to embodiment 45, wherein the pharma- ceutical active agent is a cytostatic agent.

[0203] Embodiment 47: A CDK4 / 6 inhibitor for use according to claim 46, wherein the resistance is mediated by ABC transporters.

[0204] Embodiment 48: A CDK4 / 6 inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0205] Embodiment 49: A CDK4 / 6 inhibitor for use according to any one of embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular multiple resistance or polyresistance to cytostatic drugs and / or radiation.

[0206] Embodiment 50: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 49, wherein the tumor cells are Rb positive.

[0207] Embodiment 51: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 50, wherein the tumor cells have YB-1 in the nucleus.

[0208] Embodiment 52: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 51, wherein the tumor cells have YB-1 in the nucleus after attraction.

[0209] Embodiment 53: A CDK4 / 6 inhibitor for use according to embodiment 52, wherein transport of YB-1 into the nucleus is induced by at least one means selected from the group comprising irradiation, administration of a cytostatic drug and hyperthermia.

[0210] Embodiment 54: A CDK4 / 6 inhibitor for use according to embodiment 53, wherein the method is applied to a cell, an organ or an organism, preferably to an organism in need thereof, more preferably to an organism suffering from a tumor.

[0211] Embodiment 55: A CDK4 / 6 inhibitor for use according to any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

[0212] The problem underlying the present invention is also solved in a fifth aspect. The fifth aspect is also a first embodiment of such fifth aspect by a PARP inhibitor for use in treating and / or preventing a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering to the subject an adenovirus, a CDK4 / 6 inhibitor and a PARP inhibitor.

[0213] Further embodiments of such a fifth aspect are disclosed below.

[0214] Embodiment 2: A PARP inhibitor for use in embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0215] Embodiment 3: A PARP inhibitor for use according to any one of embodiments 1 and 2, wherein the adenovirus is replicating in a YB-1-dependent manner.

[0216] Embodiment 4: A PARP inhibitor for use in embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells which have YB-1 in the nucleus.

[0217] Embodiment 5: A PARP inhibitor for use according to any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0218] Embodiment 6: A PARP inhibitor for use in embodiment 5, wherein the oncogene protein is an E1A protein.

[0219] Embodiment 7: A PARP inhibitor for use in embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0220] Embodiment 8: A PARP inhibitor for use in embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0221] Embodiment 9: A PARP inhibitor for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0222] Embodiment 10: A PARP inhibitor for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0223] Embodiment 11: A PARP inhibitor for use according to embodiment 10, wherein the deletion is selected from the group comprising deletions of the CR3 stretch and deletions of the N-terminus and deletions of the C-terminus.

[0224] Embodiment 12: A PARP inhibitor for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0225] Embodiment 13: A PARP inhibitor for use according to any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0226] Embodiment 14: A PARP inhibitor for use in embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0227] Embodiment 15: A PARP inhibitor for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0228] Embodiment 16: A PARP inhibitor for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0229] Embodiment 17: A PARP inhibitor for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0230] Embodiment 18: A PARP inhibitor for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0231] Embodiment 19: A PARP inhibitor for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0232] Embodiment 20: A PARP inhibitor for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0233] Embodiment 21: A PARP inhibitor for use according to any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0234] Embodiment 22: A PARP inhibitor for use in embodiment 21, wherein the adenovirus is XVir-N-31.

[0235] Embodiment 23: A PARP inhibitor for use in embodiment 21, wherein the adenovirus is dl520, wherein the adenovirus E3 region is functionally inactive.

[0236] Embodiment 24: A PARP inhibitor for use according to any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0237] Embodiment 25: A PARP inhibitor for use according to any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0238] Embodiment 26: A PARP inhibitor for use according to any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0239] Embodiment 27: A PARP inhibitor for use according to embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0240] Embodiment 28: A PARP inhibitor for use in embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0241] Embodiment 29: A PARP inhibitor for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in a cell, preferably a tumor cell.

[0242] Embodiment 30: A PARP inhibitor for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0243] Embodiment 31: The PARP inhibitor for use according to any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0244] Embodiment 32: A PARP inhibitor for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor arrests the cell in G1 and inhibits E2F1.

[0245] Embodiment 33: A PARP inhibitor for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0246] Embodiment 34: PARP for use of embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0247] Embodiment 35: A PARP inhibitor for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the subject.

[0248] Embodiment 36: A PARP inhibitor for use in embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0249] Embodiment 37: A PARP inhibitor for use according to any one of embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0250] Embodiment 38: A PARP inhibitor for use according to any one of embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0251] Embodiment 39: A PARP inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0252] Embodiment 40: A PARP inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0253] Embodiment 41: A PARP inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have gene amplification and / or gene activating mutations.

[0254] Embodiment 42: A PARP inhibitor for use in embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0255] Embodiment 43: A PARP inhibitor for use in embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signaling pathway.

[0256] Embodiment 44: A PARP inhibitor for use in embodiment 43, wherein the mitogenic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0257] Embodiment 45: A PARP inhibitor for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

[0258] Embodiment 46: A PARP inhibitor for use according to embodiment 45, wherein the pharma- ceutically active agent is a cytostatic agent.

[0259] Embodiment 47: A PARP inhibitor for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0260] Embodiment 48: A PARP inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0261] Embodiment 49: A PARP inhibitor for use according to any one of embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular multiple resistance or polyresistance to cytostatic drugs and / or radiation.

[0262] Embodiment 50: A PARP inhibitor for use according to any one of embodiments 1 to 49, wherein the tumor cells are Rb positive.

[0263] Embodiment 51: A PARP inhibitor for use according to any one of embodiments 1 to 50, wherein the tumor cells have YB-1 in the nucleus.

[0264] Embodiment 52: A PARP inhibitor for use according to any one of embodiments 1 to 51, wherein the tumor cells have YB-1 in the nucleus after attraction.

[0265] Embodiment 53: A PARP inhibitor for use according to embodiment 52, wherein transport of YB-1 into the nucleus is induced by at least one means selected from the group comprising irradiation, administration of a cytostatic drug and hyperthermia.

[0266] Embodiment 54: A PARP inhibitor for use according to embodiment 53, wherein the method is applied to a cell, an organ or an organism, preferably to an organism in need thereof, more preferably to an organism suffering from a tumor.

[0267] Embodiment 55: A PARP inhibitor for use in any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

[0268] The problem underlying the present invention is solved in a sixth aspect. The sixth aspect is also a first embodiment of such sixth aspect by a bromodomain inhibitor for use in the treatment and / or prevention of a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering to the subject an adenovirus, a CDK4 / 6 inhibitor and a bromodomain inhibitor.

[0269] Further embodiments of such a sixth aspect are disclosed below.

[0270] Embodiment 2: A bromodomain inhibitor for use in embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0271] Embodiment 3: A bromodomain inhibitor for use according to any one of embodiments 1 and 2, wherein the adenovirus is replicating in a YB-1-dependent manner.

[0272] Embodiment 4: A bromodomain inhibitor for use in embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus, but replicates in cells which have YB-1 in the nucleus.

[0273] Embodiment 5: A bromodomain inhibitor for use according to any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0274] Embodiment 6: A bromodomain inhibitor for use in embodiment 5, wherein the oncogene protein is an E1A protein.

[0275] Embodiment 7: A bromodomain inhibitor for use in embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0276] Embodiment 8: A bromodomain inhibitor for use in embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0277] Embodiment 9: A bromodomain inhibitor for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0278] Embodiment 10: A bromodomain inhibitor for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0279] Embodiment 11: A bromodomain inhibitor for use according to embodiment 10, wherein the deletion is selected from the group comprising deletions of the CR3 stretch and deletions of the N-terminus and deletions of the C-terminus.

[0280] Embodiment 12: A bromodomain inhibitor for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0281] Embodiment 13: A bromodomain inhibitor for use according to any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0282] Embodiment 14: A bromodomain inhibitor for use in embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0283] Embodiment 15: A bromodomain inhibitor for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing E1A12S protein.

[0284] Embodiment 16: A bromodomain inhibitor for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of E1A13S protein.

[0285] Embodiment 17: A bromodomain inhibitor for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0286] Embodiment 18: A bromodomain inhibitor for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0287] Embodiment 19: A bromodomain inhibitor for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0288] Embodiment 20: A bromodomain inhibitor for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0289] Embodiment 21: A bromodomain inhibitor for use according to any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0290] Embodiment 22: A bromodomain inhibitor for use in embodiment 21, wherein the adenovirus is XVir-N-31.

[0291] Embodiment 23: A bromodomain inhibitor for use in embodiment 21, wherein the adenovirus is dl520, wherein the adenovirus E3 region is functionally inactive.

[0292] Embodiment 24: A bromodomain inhibitor for use according to any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0293] Embodiment 25: A bromodomain inhibitor for use according to any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0294] Embodiment 26: A bromodomain inhibitor for use according to any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0295] Embodiment 27: A bromodomain inhibitor for use according to embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0296] Embodiment 28: A bromodomain inhibitor for use in embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0297] Embodiment 29: A bromodomain inhibitor for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in a cell, preferably a tumor cell.

[0298] Embodiment 30: A bromodomain inhibitor for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0299] Embodiment 31: A bromodomain inhibitor for use according to any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0300] Embodiment 32: A bromodomain inhibitor for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor arrests the cell in G1 and inhibits E2F1.

[0301] Embodiment 33: A bromodomain inhibitor for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0302] Embodiment 34: A bromodomain inhibitor for use in embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0303] Embodiment 35: A bromodomain inhibitor for use according to any one of embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the subject.

[0304] Embodiment 36: A bromodomain inhibitor for use in embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0305] Embodiment 37: The bromodomain inhibitor for use according to any one of embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0306] Embodiment 38: A bromodomain inhibitor for use according to any one of embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0307] Embodiment 39: A bromodomain inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0308] Embodiment 40: A bromodomain inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0309] Embodiment 41: A bromodomain inhibitor for use according to any one of embodiments 1 to 38, wherein the tumor cells have gene amplification and / or gene activating mutations.

[0310] Embodiment 42: A bromodomain inhibitor for use in embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0311] Embodiment 43: A bromodomain inhibitor for use in embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signaling pathway.

[0312] Embodiment 44: A bromodomain inhibitor for use in embodiment 43, wherein the mitogenic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0313] Embodiment 45: A bromodomain inhibitor for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

[0314] Embodiment 46: A bromodomain inhibitor for use according to embodiment 45, wherein the pharma- ceutical active agent is a cytostatic agent.

[0315] Embodiment 47: A bromodomain inhibitor for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0316] Embodiment 48: A bromodomain inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0317] Embodiment 49: A bromodomain inhibitor for use according to any one of embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular multiple resistance or polyresistance to cytostatic agents and / or radiation.

[0318] Embodiment 50: A bromodomain inhibitor for use according to any one of embodiments 1 to 49, wherein the tumor cells are Rb positive.

[0319] Embodiment 51: A bromodomain inhibitor for use according to any one of embodiments 1 to 50, wherein the tumor cells have YB-1 in the nucleus.

[0320] Embodiment 52: A bromodomain inhibitor for use according to any one of embodiments 1 to 51, wherein the tumor cells have YB-1 in the nucleus after attraction.

[0321] Embodiment 53: A bromodomain inhibitor for use according to embodiment 52, wherein transport of YB-1 into the nucleus is induced by at least one means selected from the group comprising irradiation, administration of a cytostatic drug and hyperthermia.

[0322] Embodiment 54: A bromodomain inhibitor for use according to embodiment 53, wherein the method is applied to a cell, an organ or an organism, preferably to an organism in need thereof, more preferably to an organism suffering from a tumor.

[0323] Embodiment 55: A bromodomain inhibitor for use in any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

[0324] The problem underlying the present invention is solved in a seventh aspect, which is also a first embodiment of such seventh aspect by a method for the treatment and / or prevention of a disease, more preferably a tumor or cancer, in a subject, comprising administering to the subject an adenovirus and a CDK4 / 6 inhibitor.

[0325] Further embodiments of such seventh aspect are disclosed below.

[0326] Embodiment 2: The method of embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0327] Embodiment 3: The method of any one of embodiments 1 and 2, wherein the adenovirus is replicating in a YB-1-dependent manner.

[0328] Embodiment 4: The method of embodiment 3, wherein the adenovirus is replication-deficient in cells lacking YB-1 in the nucleus but replicates in cells which have YB-1 in the nucleus.

[0329] Embodiment 5: The method of any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group including E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0330] Embodiment 6: The method of embodiment 5, wherein the oncogene protein is an E1A protein.

[0331] Embodiment 7: The method of embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0332] Embodiment 8: The method of embodiment 6, wherein the E1A protein is incapable of binding to a functional Rb tumor suppressor gene product.

[0333] Embodiment 9: The method of any one of embodiments 6 to 8, wherein the E1A protein does not induce localization of YB-1 in the nucleus.

[0334] Embodiment 10: The method of any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or more mutations or deletions compared to the wild-type oncogene protein E1A.

[0335] Embodiment 11: The method of embodiment 10, wherein the deletion is selected from the group comprising a deletion of the CR3 stretch and a deletion of the N-terminus and a deletion of the C-terminus.

[0336] Embodiment 12: A method of any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0337] Embodiment 13: A method according to any one of embodiments 6 to 12, wherein the E1A protein contains one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletions are preferably deletions in the CR1 and / or CR2 regions.

[0338] Embodiment 14: The method of embodiment 13, wherein the E1A protein is incapable of binding to Rb.

[0339] Embodiment 15: The method of any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing E1A12S protein.

[0340] Embodiment 16: The method of any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of E1A13S protein.

[0341] Embodiment 17: The method of any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0342] Embodiment 18: The method of any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0343] Embodiment 19: The method of any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif in the fiber.

[0344] Embodiment 20: The method of any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0345] Embodiment 21: The method of any one of embodiments 1 to 20, wherein the adenovirus is selected from the group including XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding to a functional Rb tumor suppressor gene product.

[0346] Embodiment 22: The method of embodiment 21, wherein the adenovirus is XVir-N-31.

[0347] Embodiment 23: The method of embodiment 21, wherein the adenovirus is dl520, wherein the adenovirus E3 region is functionally inactive.

[0348] Embodiment 24: The method of any one of embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0349] Embodiment 25: The method of any one of embodiments 21 to 24, wherein the adenovirus is dl520 expressing an RGD motif in the fiber.

[0350] Embodiment 26: The method of any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0351] Embodiment 27: The method according to embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0352] Embodiment 28: The method of embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0353] Embodiment 29: The method of any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in a cell, preferably a tumor cell.

[0354] Embodiment 30: The method of any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in a cell, preferably a tumor cell.

[0355] Embodiment 31: The method of any one of embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

[0356] Embodiment 32: The method of any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor arrests the cell in G1 and inhibits E2F1.

[0357] Embodiment 33: The method of any one of embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0358] Embodiment 34: The method of embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0359] Embodiment 35: The method of any one of embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the subject.

[0360] Embodiment 36: The method of embodiment 35, wherein the bromodomain inhibitor is selected from the group including JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS436.

[0361] Embodiment 37: The method of any one of embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0362] Embodiment 38: The method of any one of embodiments 1 to 37, wherein the tumor cells have a disrupted CDK4 / 6 signaling pathway.

[0363] Embodiment 39: The method of any one of embodiments 1 to 38, wherein the tumor cells have an uncontrolled G1-S transition of the cell cycle.

[0364] Embodiment 40: The method of any one of embodiments 1 to 38, wherein the tumor cells have a loss-of-function mutation or deletion in a gene selected from the group including the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0365] Embodiment 41: The method of any one of embodiments 1 to 38, wherein the tumor cells have gene amplification and / or gene activating mutations.

[0366] Embodiment 42: The method of embodiment 41, wherein the gene is selected from the group including CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0367] Embodiment 43: The method of embodiment 41, wherein the gene is a gene encoding a component of the mitogenic signaling pathway.

[0368] Embodiment 44: The method of embodiment 43, wherein the mitogenic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0369] Embodiment 45: The method of any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

[0370] Embodiment 46: The method of embodiment 45, wherein the pharma- ceutical active agent is a cytostatic agent.

[0371] Embodiment 47: The method of claim 46, wherein the resistance is mediated by an ABC transporter.

[0372] Embodiment 48: The method of claim 47, wherein the ABC transporter is selected from the group including MRP and MDR, in particular MDR-1.

[0373] Embodiment 49: The method of any one of embodiments 45 to 48, wherein the resistance is multiple resistance or polyresistance, in particular multiple resistance or polyresistance to cytostatic agents and / or radiation.

[0374] Embodiment 50: The method of any one of embodiments 1 to 49, wherein the tumor cells are Rb positive.

[0375] Embodiment 51: The method of any one of embodiments 1 to 50, wherein the tumor cell has YB-1 in the nucleus.

[0376] Embodiment 52: The method of any one of embodiments 1 to 51, wherein the tumor cells have YB-1 in the nucleus after attraction.

[0377] Embodiment 53: The method of embodiment 52, wherein transport of YB-1 into the nucleus is induced by at least one means selected from the group comprising irradiation, administration of a cytostatic drug and hyperthermia.

[0378] Embodiment 54: A method according to embodiment 53, wherein the means is applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0379] Embodiment 55: The method of any one of claims 1 to 54, wherein the tumor is selected from the group including bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

[0380] Also, in an eighth aspect, the present invention relates to the use of the composition for the manufacture of a medicament, wherein the composition is as disclosed in relation to the first aspect of the invention (including any embodiment thereof), and the medicament is for the treatment and / or prevention of a disease specified in relation to the second aspect of the invention (including any embodiment thereof).

[0381] Also, in a ninth aspect, the present invention relates to the use of an adenovirus for the manufacture of a medicament, wherein the adenovirus is an adenovirus as disclosed in connection with the third aspect of the invention (including any embodiment thereof), and wherein the medicament is for the treatment and / or prevention of a disease as identified in connection with the third aspect of the invention (including any embodiment thereof).

[0382] Also, in a tenth aspect, the present invention relates to the use of a CDK4 / 6 inhibitor for the manufacture of a medicament, wherein the CDK4 / 6 inhibitor is a CDK4 / 6 inhibitor as disclosed in connection with the fourth aspect of the invention (including any embodiment thereof), and the medicament is for the treatment and / or prevention of a disease identified in connection with the fourth aspect of the invention (including any embodiment thereof).

[0383] Also, in an eleventh aspect, the present invention relates to the use of a PARP inhibitor for the manufacture of a medicament, wherein the PARP inhibitor is a PARP inhibitor as disclosed in connection with the fifth aspect of the invention (including any embodiment thereof), and the medicament is for the treatment and / or prevention of a disease identified in connection with the fifth aspect of the invention (including any embodiment thereof).

[0384] Also, in a twelfth aspect, the present invention relates to the use of a bromodomain inhibitor for the manufacture of a medicament, wherein the bromodomain inhibitor is a bromodomain inhibitor as disclosed in relation to the sixth aspect of the invention (including any embodiment thereof), and the medicament is for the treatment and / or prevention of a disease identified in relation to the sixth aspect of the invention (including any embodiment thereof).

[0385] It will be recognized by those skilled in the art that each and every embodiment of one aspect of the present invention is also an embodiment of each and every other aspect of the present invention, including any embodiment thereof.

[0386] Without wishing to be bound by any theory, the present inventors have surprisingly found that by combining oncolytic virus, preferably oncolytic adenovirus, with CDK4 / 6 inhibitor, the efficacy of tumor therapy based on such oncolytic adenovirus is improved.More specifically, it is presumed that CDK4 / 6 inhibitor inhibits E2F-1, thereby preferably reducing its effective concentration in tumor cells, and synchronizing G1 arrest in cells.Therefore, more infected cells can complete the entire life cycle of the virus.

[0387] Based on the evidence and insights provided herein, one skilled in the art will understand that any mutant adenovirus is suitable for use in the practice of the present invention, which allows such adenovirus to achieve at least 10%, 20% or 30% of wild-type expression of E1B55K and E4orf6 activity, respectively. One skilled in the art will understand that such mutant adenoviruses can be generated by modifying E1A. Exemplary mutant adenoviruses are adenovirus XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev, and viruses lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

[0388] Adenoviruses were named after the first isolation of the virus from human tonsillar and pharyngeal tissues in 1953 by Wallace P. Rowe and Robert J. Huebner (Rowe, et al., 1953). The family Adenoviridae includes five genera, namely Mastadenoviruses, Aviadenoviruses, Siadenoviruses, Atadenoviruses, and Ichtadenoviruses (Modeow, 2013). Due to their oncogenic potential in rodent neonates, they can be classified into seven subgroups, HAdV-A to HAdV-G (Boulanger and Blair, 1991), with a total of 62 serotypes. Thus, research on oncolytic virotherapy has mainly focused on Mastadenovirus C serotype 5.

[0389] The uncoated icosahedral capsid, with a size of 80-110 nm, is composed of 252 capsomeres, consisting of 12 pentons, which are constructed from spike-like protein structures called penton bases and fibers at the apexes of the capsid, and 249 faces, called hexons (Modrow, 2013). The entire life cycle of adenoviruses can be subdivided into an early stage with cell entry, a late stage with nuclear import of the viral genome, transcription and translation of early genes, and transcription and translation of late genes. Thereby, the late proteins are mainly responsible for the assembly of structural proteins and maturation of the virion (Russell, 2000). In permissive cells, the early stage takes about 6-8 hours, followed by the late stage, which takes about 4-6 hours. Binding occurs through the interaction of knob structures present at every end of the fiber structure with receptors on the target cells, at least for the adenoviruses HAdV-A, -C, -E, and -F. This receptor was detected as the same one responsible for Coxsackie B virus adsorption, and therefore it is called the Coxsackie and Adenovirus Receptor (CAR) (Bergelson, 1997). In addition, the binding to the surface of the target cell is supported by "bridging molecules", such as blood clotting factors VII and X, which are soluble proteins in body fluids that mediate the binding of the fiber proteins of certain adenovirus types (Modrow, 2013). After this adsorption step, the RGD motif (arginine-glycine-aspartic acid) in the penton base interacts with the heterodimeric integrins αvβ3 or αvβ5, which function as co-receptors in this process. This interaction leads to the internalization of the virus (Wickham et al., 1993). Then, endocytosis occurs via clathrin-mediated internalization at the cell membrane, and the virus resides in endosomes. After acidification of the intracellular vesicles, the viral fiber proteins change their conformation and disrupt the endosomal membrane (Greber et al., 1996). At this point, the virus particles are floating in the cytoplasm. The viral genome is imported into the nucleus by binding of the remaining particles to dynein on microtubules (Modrow, 2013).

[0390] The adenovirus genome consists of double-stranded, linear DNA 36-38 kb in length. A quasi-circular state is formed by the interaction of two terminal protein (TP) molecules covalently attached to both 5' ends (Modrow, 2013). In general, the five coding regions of the adenovirus genome can be subdivided into early genes E1-E4, which are active during the initial stage of infection, and late genes (L1-L5), which mainly code for proteins required for viral particle formation (Modrow, 2013).

[0391] Adenovirus replication is particularly dependent on the expression of the early viral gene E2, which is strongly driven by the large E1A protein (E1A13S). The first viral gene transcribed after infection is the early region 1A (E1A). The primary E1A transcript is processed by differential splicing to generate five different messages with sedimentation coefficients of 13S, 12S, 11S, 10S and 9S. The 13S and 12S mRNAs are most abundant early in infection, whereas the 9S mRNA is most abundant at later times. The 11S and 10S mRNAs are minor species that become more abundant at later times after infection. The 13S, 12S, 11S, 10S and 9S E1A mRNAs encode proteins of 289 residues (R), 243R, 217R, 171R and 55R, respectively, all of which are detectable in vivo, except for the 9S product, which is only detected in vitro. In general, adenovirus gene expression is highly regulated and highly complex during the infection process, whereby the transcription of the E2 gene, which encodes the viral DNA polymerase and other proteins required for efficient viral replication, is under the control of two promoters, the E2 early promoter and the E2 late promoter.

[0392] Due to its two overlapping transcriptional control regions, the E2-early promoter can be subdivided into a major promoter starting at position +1 and a minor promoter starting at position -26, both of which contain TATA motifs (Swaminathan and Thimmapaya, 1996). These motifs function as binding sites for the TATA box-binding protein (TBP). In addition, one binding site for activating transcription factor (ATF) between positions -68 and -77 and two E2F / DP-1 binding sites (TTTCGCGC) arranged in inverse orientation to each other are located at positions -35 and -63 of the major E2-early promoter (Swaminathan and Thimmapaya, 1996). E1A-mediated activation of the E2-early promoter mainly depends on two E2F binding sites located in the major promoter portion.

[0393] At the intermediate stage of infection, after about 6 hpi (hours post infection), the expression of the E2 gene is controlled by the E2 late promoter. At positions nt -33 to -22 of the 157 bp sequence, there is a TATA box, which can bind to and be activated by cellular TBP (Swaminathan and Thimmapaya, 1996). In addition, two SP1 recognition sites and three CCAAT boxes are characteristic of the E2 late promoter.

[0394] The interaction between Y-box binding protein 1 (YB-1) and the E2 late promoter was investigated, since the cellular factor YB-1 was shown to be capable of binding to the inverted CCAAT box. Holm et al. in 2002 indeed showed that the specific interaction of YB-1 with the Y-box (inverted CCAAT box) present in the E2 late promoter has the ability to control the activity of this promoter (Holm et al., 2002). To exert its transactivation activity, YB-1 must be translocated into the nucleus via the adenovirus complex E1B-55k / E4-orf6. These early viral genes are expressed after transactivation of E1A-13S (Frisch and Mymryk, 2002).

[0395] The cellular factor YB-1, encoded by the YBX1 gene, is a cold shock domain-bearing DNA binding protein with multiple functions in transcription, splicing, translational control and DNA damage repair (Kohno et al., 2003). Furthermore, the cellular factor YB-1 plays an important role in drug resistance through its activation of MDR1 and MRP1 genes, which are involved in the development of multidrug resistance phenotypes in cancer cells (Mantwill et al., 2006). The expression of YB-1 is induced via exposure to exogenous stressors, such as adenovirus infection, chemotherapy or UV radiation, with subsequent nuclear transport (Mantwill et al., 2006).

[0396] Transcriptional activation of adenovirus early and late genes is crucial for the viral life cycle. Briefly, the viral life cycle is initiated by activation of E1A transcription, followed by a cascade of activation of E2, E3, and E4 genes. Finally, the major late promoter (MLP) is activated and orchestrates the expression of capsid and accessory proteins, mainly involved in genome encapsidation (Turner et al. 2015). To overcome defenses against viral DNA replication present in non-proliferating cells, the virus expresses early 1A proteins (E1A). These immediate early proteins drive the cell into S phase and trigger the expression of all other viral early genes. During infection, several E1A isoforms are expressed as proteins of 289, 243, 217, 171, and 55 residues present in human adenovirus type 5. With regard to infection, the main driver of viral gene expression is the large E1A 289R protein (Radko et al. 2015).

[0397] Upon infection, expression of adenovirus E1A proteins promotes cell cycle progression from G0 / G1 to S phase and viral replication, even in terminally differentiated epithelial cells, which are the primary targets of human adenoviruses, a process thought to be essential for the adenovirus life cycle.

[0398] Adenoviruses have been designed to infect, replicate and kill cancer cells while sparing normal cells.Following infection and replication in tumor cells, oncolytic viruses kill the cells and release virions for subsequent amplification cycles.Two types of genetic modifications have been made to achieve replication only in tumor cells, and three subclasses of oncolytic adenoviruses (also referred to herein as CRAds) have been designed, all of which can be used in the implementation of the present invention.Furthermore, oncolytic adenoviruses suitable for use in the implementation of the present invention are described, among others, in WO 2003 / 099859.

[0399] Type I CRAds are characterized by mutations or deletions in the E1 region of the genome, which prevent the inactivation of cell cycle regulators, such as p53 and retinoblastoma protein (Rb). As a result, type I CRAds replicate in actively dividing tumor cells. For example, Onyx-015 (also known as dl1520), which cannot express the E1B-55kDa protein, cannot inactivate p53 and cannot avoid p53-induced cell cycle arrest. Some studies have suggested that the molecular basis of Onyx-015 selectivity is due to the lack of expression of p53 or one of the genes involved in the p53 pathway. However, O'Shea et al. showed that late viral RNA ejection, rather than p53 inactivation, determines Onyx-015 viral selectivity. Other type I CRAds with deletions in the E1A region are unable to bind Rb and induce progression into S phase. For example, dl922-947 and Δ24 contain a 24-nucleotide deletion in the CR2 domain of the E1A region that disrupts the E1A-Rb interaction, so that these viruses replicate primarily in tumor cells where free, unbound E2F is available.

[0400] Another way to restrict adenovirus replication to tumor cells is to regulate the transcription of viral genes necessary for viral replication. In type II CRAds, the genome is placed under the control of tumor-specific promoters. These promoters were derived from genes known to be preferentially expressed in some tumors compared to normal tissues (e.g., telomerase or cyclooxygenase II); or from genes overexpressed in tumors compared to normal tissues (e.g., prostate-specific antigen, PSA, or alpha-fetoprotein, AFP). Type III CRAds, such as XVir-N-31 (Ad-Delo3-RGD), are characterized by the deletion of the transactivation domain CR3 in the E1A13S protein. XVir-N-31 is a replication-deficient adenovirus in normal cells. XVir-N-31's replication capacity is restored by the presence of the cellular multifunctional protein YB-1 in the nucleus. Thus, CRAds can only replicate in tumor cells, thus ultimately lysing them. Mutations in p53, ras, or RB are not effective in complementing the replication defect of XVir-N-31. XVir-N-31 lacks E1A13S and therefore does not express E1B55k and E4orf6 proteins. This defect is complemented by the presence of YB-1 in the nucleus of tumor cells, which induces the expression of E1B55k and E4orf6 independently of E1A13S. Once triggered by the presence of YB-1 in the nucleus, E1B55k and E4orf6 further import cellular YB-1 into the nucleus and drive viral replication.

[0401] The cell cycle progresses sequentially through gap 1 (G1), synthesis (S), gap 2 (G2) and mitosis (M) phases. This progression is regulated through a complex signaling network. The CDK (cyclin-dependent kinase) proteins CDK1, CDK2, CDK4 and CDK6 are the main regulators of cell cycle progression when complexed with specific cyclin proteins. Constitutive expression of CDKs and temporal control of the various cyclins allow specific cell cycle regulation by different cyclin-CDK complexes. CDK activity is negatively regulated by several inhibitory proteins. Various aspects of CDK biology and function have been comprehensively reviewed previously.

[0402] CDK4 and CDK6, which show structural and functional homology, regulate the transition of resting cells in the G1 phase to the S phase when complexed with cyclin D protein. The cyclin D protein has three subtypes, cyclin D1 to 3, and accumulates in the presence of mitogenic stimuli. Negative regulators of CDK4 / 6 include p16INK4A, p15INK4B, p18INK4C, and p19INK4D, which are inhibitors of the CDK4 (INK4) protein. They inhibit CDK4 / 6 activity by reducing binding to cyclin D1 or by directly occupying their catalytic domains.

[0403] The kinase activity of CDK4 / 6 leads to phosphorylation of members of the retinoblastoma (Rb) protein family, including Rb, p107, and p130, which results in their functional inactivation. In resting cells, active, hypophosphorylated Rb binds to members of the E2F transcription factor family that form a complex with DP-1 / 2, along with other corepressors, suppressing E2F function (Rubin et al 2005). Upon phosphorylation, Rb dissociates from this complex, allowing transcription of E2F target genes, including cyclin A, cyclin E, and DHFR, among others, that are required for entry into the S phase of the cell cycle. Thus, inhibition of CDK4 / 6 activity leads to Rb dephosphorylation and repression of E2F activity, which promotes G0 / G1 arrest. This has prompted the development of CDK4 / 6 inhibitors as targeted therapy in cancer cells.

[0404] Disruption of the CDK4 / 6-Rb signaling pathway and uncontrolled G1-S transition of the cell cycle are common features of cancer cells. This can occur due to various molecular alterations, including loss-of-function mutations or deletions of the RB1 gene (encoding Rb), CDKN2A (encoding p16INK4A and p14ARF) or CDKN2B (encoding p15INK4B). Such deregulation can also be due to amplification or activating mutations of components of CCND1 (encoding cyclin D1), E2F1-3, CDK4, CDK6 or various mitogenic signaling pathways, such as the PI3K pathway or the MAPK pathway.

[0405] Several ATP-competitive small molecule CDK inhibitors have been developed. However, first generation inhibitors, such as flavopiridol, are non-selective and may inhibit multiple CDKs, which may result in limited efficacy and high toxicity. Next generation CDK4 / 6 inhibitors show high selectivity and include palbociclib (PD-0332991 from Pfizer), abemaciclib (LY-2835219 from Eli Lilly) and ribociclib (LEE011 from Novartis) and trilaciclib (G1T28). These CDK4 / 6 inhibitors have been preclinical tested in in vitro and in vivo models of several cancer entities, including leukemia, breast cancer, melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and metastatic breast cancer (mBC). In most studies, they demonstrated a consistent molecular and functional phenotype, with a dose-dependent decrease in Rb phosphorylation, protein expression and transcription of E2F target genes that correlated with G0 / G1 arrest and inhibition of cell proliferation. In addition, all these reports demonstrated that Rb expression is a prerequisite for sensitivity to these inhibitors.

[0406] CDK4 / 6 inhibitors, such as PD-0332991, result in a dose-dependent decrease in total Rb protein, which correlates with a decrease in phosphorylated Rb. This decrease in total Rb partially correlates with a decrease in RB1 transcript levels and the transcription of E2F target genes CCNA2 and CCNE2. E2F expression is also significantly downregulated.

[0407] CDK4 / 6 inhibitors suitable for use in the practice of the present invention are disclosed in FIG.

[0408] As is evident from the examples section, any CDK4 / 6 inhibitor is suitable for use in combination with a virus, preferably an adenovirus, more preferably an oncolytic adenovirus, whereby the CDK4 / 6 inhibitor arrests cells in G1 and inhibits E2F1, more specifically E2F1 activity.

[0409] It will be appreciated by those of skill in the art that any CDK4 / 6 inhibitor will be used at a therapeutically effective concentration.

[0410] PARP1 is a protein important in repairing single-strand breaks ("nicks" in DNA). In mammals, 17 PARP family members have been found, and only six of these synthesize poly ADP-ribose (pADPr). PARP1, PARP2, and PARP3 have roles in DNA repair. PARP1 binds to DNA that has undergone single-strand breaks (SSBs) and double-strand breaks (DSBs). PARP1 then improves its activity by undergoing a conformational change that aligns key amino acid residues in the active site. When PARP1 is activated, it synthesizes pADPr. pADPr binds to proteins and alters their function. To ensure that the levels of pADPr present reflect DNA damage and that the response to pADPr is terminated after DNA repair, pADPr is rapidly degraded by pADPr glycohydrolase.

[0411] By inhibiting DNA repair pathways, PARP1 inhibitors increase single-strand breaks in DNA. Because BER no longer occurs, this DNA damage is not repaired and is passed on to daughter cells after replication. This leads to increased DSBs in tumors with BRCA1 and BRCA2 mutations (Scott et al. 2015, J Clin Oncol., 33(12): 1397-140). The chemical structures of PARP inhibitors, including the PARP drug candidates rucaparib, veliparib, and olaparib, including the benzamide moiety that characterizes all PARP inhibitor structures, are shown in Figure 26 and described in Antolin and Mestres 2014, Oncotarget, 30;5(10):3023-8.

[0412] In addition, it is well established that YB-1 enhances PARP activity and reduces the efficacy of PARP1 inhibitors (Alemasova et al.2018, Oncotarget, 34, 23349-65). This suggests that YB-1-dependent oncolytic adenoviruses may act synergistically in cancer cell killing in combination with both CDK4 / 6 inhibitors and PARP inhibitors. Olaparib and BMN673 (Talazolarib developed from Pfizer, USA, Clin Cancer Res. 2013, 15;19(18):5003-15) are examples of PARP inhibitors.

[0413] It will be appreciated by those of skill in the art that any PARP inhibitor will be used at a therapeutically effective concentration.

[0414] CDK4 / 6 inhibitors suitable for use in the practice of the present invention are disclosed in FIG.

[0415] Abnormalities in the epigenetic landscape are hallmarks of cancer, and acetylation of lysine residues is a post-translational modification that is widely relevant in cell signaling and disease biology. Enzymes that "write" acetylation sites (histone acetyltransferases, HATs) and "erase" acetylation sites (histone deacetylases, HDACs) are an extensive area of ​​research in current drug development. Recruitment of proteins to macromolecular complexes by acetylated lysine residues is mediated by bromodomains (BRDs), evolutionarily highly conserved protein interaction modules that recognize ε-N-lysine acetylation motifs. The conserved BRD fold contains a deep, predominantly hydrophobic acetyl-lysine binding site. The site presents an attractive pocket for the development of small pharma- ceutically active molecules. Proteins containing BRDs have been implicated in the pathogenesis of a wide variety of diseases.

[0416] Recently, two highly potent and selective inhibitors targeting the BET (bromodomain and extraterminal) family of BRDs have provided compelling data supporting the targeting of these BRDs in cancer. The BET (bromodomain and extraterminal) subfamily of bromodomain proteins, consisting of BRD2, BRD3, BRD4 and BRDT, play diverse roles in transcriptional regulation by RNA polymerase II (POLII) and are a new class of epigenetic drug targets. These proteins promote the initiation and elongation phases of transcription by binding to active chromatin at acetylated lysine residues. Recognition of active chromatin by these so-called epigenetic "readers" promotes the recruitment of RNA polymerase II complexes to sites of active transcription. The BRD4 / P-TEFb interaction is important for rapid transcription resumption after mitosis (Muller et al., 2011, Expert Rev. Mol. Medicine, 13, e19). P-TEFb was identified and purified as a factor required for the generation of long run-off transcripts using an in vitro transcription system derived from Drosophila cells. P-TEFb is a cyclin-dependent kinase that contains the catalytic subunit Cdk9 and the regulatory subunit cyclin T in Drosophila. In humans, there are multiple forms of P-TEFb that contain Cdk9 and one of several cyclin subunits, cyclins T1, T2, and K. P-TEFb has been found to associate with other factors, including the bromodomain protein BRD4, into a large protein complex called the super-elongation complex (Yang Z, et al.,2005. Mol Cell; 19:535-45;Fu et al., 1999, J Biol Chem., 274:34527-30).

[0417] JQ1 (thieno-triazolo-1-4-diazepine) is a potent inhibitor of the BET family of bromodomain proteins, including BRD2, BRD3, and BRD4 (Filippakopoulos et al., 2010 Nature 468, 1067-1073). JQ1 interferes with the interaction between the bromodomain and acetyl groups, resulting in downregulation of specific genes. Additional BET bromodomain inhibitors have been described, including OTOX15, BAY1238097, GSK2820151, I-BET762, and PLX51107 (Perez-Salvia and Esteller 2017, EPIGENETICS, 12, 323-339; Brandt et al., 2015ACS Chem. Biol., 10, 22-39). JQ-1 is structurally related to benzodiazepines. The formula is C23H25ClN4O2S.

[0418] Recently, it has been shown that the BET inhibitor JQ1 promotes adenovirus infection and adenovirus vector-mediated gene delivery. Treatment of cells with JQ1 induces increased BRD4 association with CDK9, a subunit of the transcriptional elongation P-TEFb. However, as stated in the paper, further studies are required to refine the mechanism that BED4 utilizes to regulate adenovirus infection and transgene expression (Baojie Lv et al. 2018, Scientific reports, 8, 11554). Importantly, viral replication and transcription were not investigated. However, CDK9 is known to activate transcription by stimulating the resumption of stalled polymerases, increasing the number of transcribing polymerases and thus the amount of mRNA synthesis per time (Gressel et al. 2017, eLife, 6, e29736). In addition, it was shown that BET inhibitor resistance could be overcome by CDK4 / 6 inhibitors (Jin et al. 2018, Mol Cell;71(4):592-605). Recently, a dramatic increase in P-TEFb-Brd4 interaction from late mitosis to early G1 phase of the cell cycle and active recruitment of P-TEFb to chromosomes followed by transcription initiation of genes important for G1 progression were demonstrated. Importantly, depletion of Brd4 halted the entire process by reducing the transcription of essential G1 genes, resulting in G1 cell cycle arrest and apoptosis (Yang et al., 2008, Mol Cell Biol., 28:967-976, Kohoutek, 2009, Cell Division, 4. 19).

[0419] However, nothing is known about the use of YB-1-dependent oncolytic adenoviruses in combination with CDK4 / 6 and BET inhibitors.

[0420] It will be understood and is within the scope of the present invention that other bromodomain inhibitors would be equally suitable for use in triple therapy using a virus, preferably an adenovirus, more preferably an oncolytic adenovirus, such as XVir-N-31, and a CDK4 / 6 inhibitor.

[0421] It will be appreciated by those of skill in the art that any bromodomain (Bet) inhibitor will be used at a therapeutically effective concentration.

[0422] Bromodomain inhibitors suitable for use in the practice of the present invention are disclosed in FIG.

[0423] Tumors that can be particularly treated with the viruses and combinations of the invention described herein are preferably such tumors selected from the group comprising tumors of the nervous system, eye tumors, skin tumors, soft tissue tumors, gastrointestinal tumors, respiratory system tumors, skeletal tumors, endocrine system tumors, female reproductive system tumors, breast tumors, male reproductive system tumors, urinary excretory system tumors, hematopoietic system tumors, including mixed tumors and embryonal tumors, and leukemias. It is within the scope of the present invention that these tumors are in particular resistant tumors, as specifically defined herein.

[0424] The group of tumors of the nervous system preferably includes:

[0425] 1. Tumors of the skull and brain (intracranial), preferably astrocytoma, oligodendroglioma, meningioma, neuroblastoma, ganglioneuroma, ependymoma, schwannoma, neurofibroma, hemangioblastoma, lipoma, craniopharyngioma, teratoma and chordoma;

[0426] 2. Tumors of the spinal cord and spinal canal, preferably glioblastoma, meningioma, neuroblastoma, neurofibroma, osteosarcoma, chondrosarcoma, angiosarcoma, fibrosarcoma and multiple myeloma; and

[0427] 3. Tumors of the peripheral nerves, preferably Schwannoma, neurofibroma, neurofibrosarcoma and perineural fibroblastoma.

[0428] The group of eye tumors preferably includes:

[0429] 1. Tumors of the eyelid and tumors of the eyelid glands, preferably adenomas, adenocarcinomas, papillomas, histiocytomas, mast cell tumors, basal cell tumors, melanomas, squamous cell carcinomas, fibromas and fibrosarcomas;

[0430] 2. Tumors of the conjunctiva and tumors of the nictitating membrane, preferably squamous cell carcinoma, hemangioma, angiosarcoma, adenoma, adenocarcinoma, fibrosarcoma, melanoma and papilloma; and

[0431] 3. Tumors of the orbit, optic nerve and eye, preferably retinoblastoma, osteosarcoma, mast cell tumor, meningioma, reticular cell tumor, glioma, Schwannoma, chondroma, adenocarcinoma, squamous cell carcinoma, plasma cell tumor, lymphoma, rhabdomyosarcoma and melanoma.

[0432] The group of skin tumors preferably includes histiocytoma, lipoma, fibrosarcoma, fibroma, mast cell tumor, malignant melanoma, papilloma, basal cell tumor, keratoacanthoma, hemangiopericytoma, tumor of the hair follicle, tumor of the sweat gland, tumor of the sebaceous gland, hemangioma, hemangiosarcoma, lipoma, liposarcoma, malignant fibrous histiocytoma, plasmacytoma and lymphangioma tumors.

[0433] The group of tumors of soft tissue preferably comprises the tumors alveolar soft part sarcoma, epithelioid cell sarcoma, chondrosarcoma of soft tissue, osteosarcoma of soft tissue, Ewing's sarcoma of soft tissue, primitive neuroectodermal tumor (PNET), fibrosarcoma, fibroma, leiomyosarcoma, leiomyoma, liposarcoma, malignant fibrous histiocytoma, malignant hemangiopericytoma, hemangioma, hemangiosarcoma, malignant mesenchymoma, malignant peripheral nerve sheath tumor (MPNST), malignant Schwann glioma, malignant melanocyte Schwann glioma, rhabdomyosarcoma, synovial sarcoma, lymphangioma and lymphangiosarcoma.

[0434] The group of gastrointestinal tumors preferably includes:

[0435] 1. Tumors of the oral cavity and of the tongue, preferably squamous cell carcinoma, fibrosarcoma, Merkel cell tumor, induced fibroblastoma, fibroma, fibrosarcoma, viral papillomatosis, idiopathic papillomatosis, nasopharyngeal polyp, leiomyosarcoma, myoblastoma and mast cell tumor;

[0436] 2. Tumors of the salivary glands, preferably adenocarcinoma;

[0437] 3. Tumors of the esophagus, preferably squamous cell carcinoma, leiomyosarcoma, fibrosarcoma, osteosarcoma, Barrett's carcinoma and paraesophageal tumors;

[0438] 4. Pancreatic exocrine tumors, preferably adenocarcinoma; and

[0439] 5. Gastric tumors, preferably adenocarcinoma, leiomyoma, leiomyosarcoma and fibrosarcoma.

[0440] The group of tumors of the respiratory system preferably includes:

[0441] 1. Tumors of the nose and nasal cavity, tumors of the larynx and trachea, preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, hemangiosarcoma, melanoma, mast cell tumor, osteosarcoma, chondrosarcoma, oncocytoma (rhabdomyoma), adenocarcinoma and myoblastoma; and

[0442] 2. Tumors of the lung, preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, hemangiosarcoma, melanoma, mast cell tumor, osteosarcoma, chondrosarcoma, oncocytoma (rhabdomyoma), adenocarcinoma, myoblastoma, small cell carcinoma, non-small cell carcinoma, bronchial adenocarcinoma, bronchioloalveolar adenocarcinoma and alveolar adenocarcinoma.

[0443] The group of skeletal tumors preferably comprises osteosarcoma, chondrosarcoma, parosteal sarcoma, angiosarcoma, synovial cell sarcoma, angiosarcoma, fibrosarcoma, malignant mesenchymal tumor, giant cell tumor, osteoma and multilobular osteoma.

[0444] The group of tumors of the endocrine system preferably includes:

[0445] 1. Thyroid / parathyroid tumors, preferably adenomas and adenocarcinomas;

[0446] 2. Tumors of the adrenal gland, preferably adenoma, adenocarcinoma and pheochromocytoma (adrenal medullomas);

[0447] 3. Tumors of the hypothalamus / pituitary gland, preferably adenomas and adenocarcinomas;

[0448] 4. Tumors of the endocrine pancreas, preferably insulinomas (beta cell tumors, APUDom) and Zollinger-Ellison syndrome (gastrin-secreting tumors of the delta cells of the pancreas); and

[0449] 5. Multiple endocrine neoplasms (MEN) and chemectodermal tumors.

[0450] The group of tumors of the female genital system preferably includes:

[0451] 1. Tumors of the ovary, preferably adenomas, adenocarcinomas, cystadenomas and undifferentiated carcinomas;

[0452] 2. Tumors of the uterus, preferably leiomyomas, leiomyosarcoma, adenoma, adenocarcinoma, fibroma, fibrosarcoma and lipoma;

[0453] 3. Tumors of the cervix, preferably adenocarcinoma, adenoma, leiomyosarcoma and leiomyoma;

[0454] 4. Tumors of the vagina and vulva, preferably leiomyoma, leiomyosarcoma, fibroleiomyoma, fibroma, fibrosarcoma, polyps and squamous cell carcinoma.

[0455] The group of tumors of the breast preferably includes fibroadenoma, adenoma, adenocarcinoma, mesenchymal tumor, carcinoma, carcinosarcoma.

[0456] The group of tumors of the male genital system preferably includes:

[0457] 1. Tumors of the testis, preferably seminoma, stromal cell tumor and Sertoli cell tumor;

[0458] 2. Tumors of the prostate, preferably adenocarcinoma, undifferentiated carcinoma, squamous cell carcinoma, leiomyosarcoma and transitional cell carcinoma; and

[0459] 3. Tumors of the penis and vulva, preferably mast cell tumors and squamous cell carcinoma.

[0460] The group of tumors of the urinary excretory system preferably includes:

[0461] 1. Tumors of the kidney, preferably adenocarcinoma, transitional cell carcinoma (epithelial tumor), fibrosarcoma, chondrosarcoma (mesenchymal tumor), Wilms' tumor, nephroblastoma and embryonal nephroma (embryonal pluripotent blastoma);

[0462] 2. Tumors of the ureter, preferably leiomyoma, leiomyosarcoma, fibropapilloma, transitional cell carcinoma;

[0463] 3. Tumors of the bladder, preferably transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, botryoid (embryonal rhabdomyosarcoma), fibroma, fibrosarcoma, leiomyoma, leiomyosarcoma, papilloma and angiosarcoma; and

[0464] 4. Tumors of the urethra, preferably transitional cell carcinoma, squamous cell carcinoma and leiomyosarcoma.

[0465] The group of tumors of the hematopoietic system preferably includes:

[0466] 1. Lymphoma, lymphocytic leukemia, non-lymphocytic leukemia, myeloproliferative leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma.

[0467] The group of mixed and embryonal tumors preferably comprises angiosarcoma, thymoma and mesothelioma.

[0468] Preferably, these tumors are selected from the group comprising breast cancer, ovarian cancer, prostate cancer, osteosarcoma, glioblastoma, melanoma, small cell lung cancer and colorectal cancer. Further tumors are also tumors that are resistant as described herein, preferably tumors that are multiresistant, in particular the tumor groups as described above.

[0469] It is also within the scope of the present invention that the subjects to whom the combination of the present invention is administered are identified and screened respectively. Such identification of patients who can benefit from the present invention in its various aspects is based on the detection of YB-1 in the nucleus of a sample from the subject.

[0470] In an embodiment, the examination of the tumor tissue is carried out by using an agent selected from the group comprising antibodies against YB-1, aptamers against YB-1 and spiegelmers against YB-1 and anticalins against YB-1. Essentially the same means can be made for the corresponding markers and used accordingly. The production of antibodies, in particular monoclonal antibodies, is known to the skilled artisan. A further means for the specific detection of YB-1 or a marker is a target structure, in this case a peptide which binds with high affinity to YB-1 or said marker. In the prior art, methods such as phage display for generating such peptides are known. Typically, one starts from a peptide library, where the individual peptides have a length of 8 to 20 amino acids and the size of the library is about 102 to 1018, preferably 108 to 1015, different peptides. A special form of target molecule-binding polypeptides are the so-called anticalins, which are described, for example, in German patent application DE 19742706.

[0471] Further means for the specific binding of YB-1 or a corresponding marker disclosed herein and for the detection of the cell cycle independent localization of YB-1 in the cell nucleus are so-called aptamers, i.e. D-nucleic acids, which exist as either RNA or DNA, either single-stranded or double-stranded, and which specifically bind to target molecules. The production of aptamers is described, for example, in European Patent EP 0533838. A special form of aptamer is the so-called aptazymes, which are described, for example, in Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, no. 29, pages 4369 - 4373. These are special embodiments of aptamers insofar as they contain, apart from the aptamer part, a ribozyme part, which acquires catalytic activity upon binding or release of a target molecule bound to the aptamer part and cleaves the nucleic acid substrate, this cleavage proceeding with signal generation.

[0472] Further forms of aptamers are the so-called spiegelmers, i.e. target molecule-binding nucleic acids which are prepared with L-nucleic acids. A method for the preparation of such spiegelmers is described, for example, in WO 98 / 08856.

[0473] A sample of the tumor tissue can be obtained by puncture or surgery. The assessment of whether YB-1 is localized in the nucleus independently of the cell cycle is often carried out by using microscopic techniques and / or immunohistoanalysis, preferably by using antibodies or any of the other aforementioned means. Further means for detecting YB-1 in the nucleus, in particular for detecting that YB-1 is localized there independent of the cell cycle, are known to the skilled person. For example, the localization of YB-1 can be easily detected in stained tissue sections when screening them. The frequency of the presence of YB-1 in the nucleus already indicates that the localization is independent of the cell cycle. A further option for the detection of YB-1 in the nucleus independent of the cell cycle consists in staining for YB-1 and detecting whether YB-1 is localized in the nucleus and determining the stage of the cell. As with the detection of YB-1, this can also be done by using the aforementioned means for YB-1. The detection of this means is carried out by methods known to the skilled person. By means of said agents which specifically bind to YB-1 and not to any other structures, in particular cells, in the sample to be analyzed, their localization and due to their specific binding to YB-1, the localization of YB-1 can also be detected and established by suitable labeling of said means. Methods for labeling of said means are known to the person skilled in the art. [Brief description of the drawings]

[0474] In the following the invention will be further demonstrated by reference to the drawings and examples, from which novel features, embodiments and advantages can be derived. [Figure 1]Figure 1a is a bar graph showing relative absorbance as an indicator of cell viability for XVir-N-31 (XVir), wild-type adenovirus (WT) and control (Ctrl) when used in combination with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991) or LEE (LEE011). Figure 1b is a bar graph showing viral titers for XVir-N-31 (XVir) and wild-type adenovirus (WT) when combined with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991) or LEE (LEE011). FIG. 1c is a bar graph showing relative fiber DNA for XVir-N-31 (XVir) and wild-type adenovirus (WT) when combined with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011). [Diagram 2] FIG. 2 shows the results of the Western blot analysis. [Diagram 3] 3a-d are bar graphs. [Figure 4] 4a-d are bar graphs. [Diagram 5] FIG. 5 is a bar graph. [Figure 6] FIG. 6 is a series of photomicrographs. [Figure 7] FIG. 7 shows fluorescence microscopy images of T24 cells infected with E1-deleted adenovirus expressing GFP with or without palbociclib treatment. [Figure 8] FIG. 8 is a bar graph showing viral DNA replication of adenovirus dl703 after 48 hours using the compounds Nutlin 3a, Lee, Cl1040 and Roscovertine. [Figure 9A]Figures 9A-C show the results of Western blot analysis of UMUC cells treated with the indicated concentrations of Nutlin-3a and LEE011 (ribociclib) (Figure 9A), Roscovitine (Figure 9B), and CI-1040 (Figure 9C). Rb means retinoblastoma protein. phRB means phosphorylated retinoblastoma protein. E2F-1 means transcription factor E2F-1. GAPDH served as a loading control. [Figure 9B] Figures 9A-C show the results of Western blot analysis of UMUC cells treated with the indicated concentrations of Nutlin-3a and LEE011 (ribociclib) (Figure 9A), Roscovitine (Figure 9B), and CI-1040 (Figure 9C). Rb means retinoblastoma protein. phRB means phosphorylated retinoblastoma protein. E2F-1 means transcription factor E2F-1. GAPDH served as a loading control. [Figure 9C] Figures 9A-C show the results of Western blot analysis of UMUC cells treated with the indicated concentrations of Nutlin-3a and LEE011 (ribociclib) (Figure 9A), Roscovitine (Figure 9B), and CI-1040 (Figure 9C). Rb means retinoblastoma protein. phRB means phosphorylated retinoblastoma protein. E2F-1 means transcription factor E2F-1. GAPDH served as a loading control. [Figure 10] Figure 10 is a bar graph showing cell cycle distribution in UMUC3 cells measured 48 hours after treatment with the following concentrations of CDK4 / 6 inhibitors: Roscovetine: 10 μM, CI-1040: 1 μM, Nutlin-3a: 10 μM and LEE011: 10 μM. [Figure 11] FIG. 11 is a panel of microscopy images showing adenovirus hexon gene expression with and without palbociclib treatment. [Figure 12]12 is a bar graph showing the results of a potency assay, expressed as cell viability, of T24 cells exposed to XVir-N-31 alone, 15 nM PARP inhibitor PARPi, 500 nM PD (palbociclib) or a combination of 15 nM PARPi and 500 nM PD, where cells were either uninfected (left column), infected at an MOI of 10 (middle column) or infected at an MOI of 50 (right column). [Figure 13] FIG. 13 is a panel of photographs showing SRB-stained T24 cell cultures after treatment (1 dpi, 2 dpi, 3 dpi, 4 dpi, 5 dpi, and 6 dpi) with XVir-N-31 (20 MOI), XVir-N-31 and 15 nM PARPi, XVir-N-31 and 500 nM PD, and XVir-N-31, 15 nM PARPi, and 500 nM PD. [Figure 14] FIG. 14 is a panel of photographs showing cultures of SRB stained UMUC cells after treatment (1 dpi, 2 dpi, 3 dpi, 4 dpi, 5 dpi, and 6 dpi) with XVir-N-31 (10 MOI), XVir-N-31 and 160 nM PARPi, XVir-N-31 and 400 nM PD, and XVir-N-31, 160 nM PARPi, and 400 nM PD. [Figure 15] Figure 15 is a bar graph showing the results of a potency assay on T24 cells 5 days post-infection with XVir-N-31, the CDK4 / 6 inhibitor palbociclib and the bromodomain inhibitor JQ-1. Y-axis: % cell viability. [Figure 16] 16 is a bar graph showing the results of a potency assay of SK-N-MC cells, expressed as cell viability, 5 days after exposure to XVir-N-31 alone, 200 nM abemaciclib, 500 nM JQ1, or a combination of 200 nM abemaciclib and 500 nM JQ1, where cells were either uninfected or infected at an MOI of 5, 10, or 20. [Figure 17]Figure 17 shows the results of Western blot analysis of SK-N-MC cells treated with the CDK4 / 6 inhibitor LY-2835219 (Abemaciclib) and the Wee inhibitor MK-1775 (Adavosertib) at the indicated concentrations at 24 and 48 hours after treatment. Rb means retinoblastoma protein. phRB means phosphorylated retinoblastoma protein. E2F-1 means transcription factor E2F-1. GAPDH served as a loading control. [Figure 18] Figure 18 shows the results of efficacy assays on SK-N-MC cells 5 days post-infection with XVir-N-31, CDK4 / 6 inhibitors palbociclib and adavosertib (Wee inhibitor, MK-1775), expressed as cell viability. [Figure 19] FIG. 19 shows the cell cycle distribution after treatment of SK-N-MC cells with the indicated inhibitors. [Figure 20] Figure 20 is a bar graph showing the effect of E2F1-directed siRNAs on E2F1 expression in various cell lines. Y-axis: % E2F1 expression normalized to actin as siCTRL-transfected cells. [Figure 21] Figure 21 is a bar graph showing that E2F1 inhibition increases E2-early expression in T24 cells treated with siRNA-E2F-1. Y-axis: adenovirus gene expression normalized to actin (% siCTRL). [Figure 22] FIG. 22 is a scheme showing the location of primers for determining adenovirus E2 early expression. [Figure 23] FIG. 23 is a representation of the nucleotide sequence of the adenovirus wild-type E2 early promoter (top) and a mutant E2 early promoter carrying a mutation in the E2F binding site (bottom). [Figure 24] Figure 24 is a bar graph showing RNA expression in AdWT-RGD and AdE2Fm (also containing an RGD motive in the fiber) infected T24 cells obtained by RT-qPCR at 24 hours post-infection. AD-WT gene expression was set to 100%. [Figure 25-1] FIG. 25 shows various CDK4 / 6 inhibitors suitable for use in the present invention. [Figure 25-2] FIG. 25 shows various CDK4 / 6 inhibitors suitable for use in the present invention. [Figure 26] FIG. 26 shows various PARP inhibitors suitable for use in the present invention. [Figure 27-1] FIG. 27 shows various Bet inhibitors suitable for use in the present invention. [Figure 27-2] FIG. 27 shows various Bet inhibitors suitable for use in the present invention. [Figure 27-3] FIG. 27 shows various Bet inhibitors suitable for use in the present invention. [Figure 28] FIG. 28 shows the structures of WT-Ad5 and adenovirus dl520, an oncolytic adenovirus that expresses only the E1A12 protein due to deletion of the CR3 domain of the E1A gene. [Figure 29] FIG. 29 shows the structure of XVir-N-31, which features a deletion of the E1B19K protein, a 2 kb deletion in the E3 region, a deletion of the E1A13S protein, and the introduction of an RGD motif into the fiber protein. [Diagram 30] Figure 30 shows the structures of Ad-Delta24 and Ad-Delta24-RGD, also described in Kleijn et al. (Kleijn et al., PLoS One. 2014; 9(5): e97495), which are characterized by a deletion in the CR2 domain of the E1A gene. They replicate only in tumor cells with a deregulated retinoblastoma-pathway (Rb). Ad-Delta24-RGD further contains an RGD motif in the fiber knob, as shown in XVir-N-31. Note that the oncolytic adenovirus dl922-947 is similar to Delta24, since the deletion in this virus is also located in the E1A-CR2 domain and affects RB binding (retinoblastoma protein). [Diagram 31]Figure 31 shows that the structure of VCN-01, a replication-competent adenovirus specifically engineered to replicate in tumors lacking the RB pathway, displays enhanced infectivity with modified fibers and improved distribution with expression of soluble hyaluronidase (Pascual-Pasto et al. Sci Transl Med. 2019,11 476). The deletion in E1A of VCN-01 is similar to the deletion in delta24 (deletion of the CR2 domain in E1A). Furthermore, expression of this E1A protein is regulated by introducing an E2F binding site into the E1A promoter. In addition, it contains an RGD motif in the fiber knob and expresses soluble hyaluronidase (Martinez-Velez et al. 2016, Clin Cancer Res. 1;22(9):2217-25. The Oncolytic Adenovirus VCN-01 as Therapeutic Approach Against Pediatric Osteosarcoma). [Diagram 32] Figure 32 shows the structures of E1Adl1107 and E1Adl1101, where deletions in these two oncolytic adenoviruses affect binding to p300 (histone acetyltransferase p300, also known as p300 HAT or E1A-associated protein p300) or pRb (retinoblastoma protein) (Howe et al., MOLECULAR THERAPY 2000, 2, 485-495). [Diagram 33] FIG. 33 shows the structure of oncolytic adenovirus CB016 (and one of wild-type adenovirus 5 (WT-Ad5)), where the deletion in the E1A-CR2 domain is similar to that in Ad-delta24. In addition, CB016 contains a deletion in the CR1 domain. In addition, CB016 contains either an RGD motif in the fiber or a fiber from serotype 3 (LaRocca et al., Oral Oncol. 2016, 56, 25-31). [Diagram 34]FIG. 34 shows the structure of adenovirus ORCA-010, which contains the E1AΔ24 deletion in the E1A CR2-domain, a potency-enhancing T1 mutation in the E3 / 19K protein, and an infectivity-enhancing fiber RGD modification (Dong et al., Hum Gene Ther. 2014 Oct 1; 25(10): 897-904).

[0475] Example 1: Materials and Methods cell culture Human bladder cancer cell lines were cultured under subconfluent conditions in RPMI or DMEM medium (Biochrom AG) supplemented with 10% FBS (Biochrom AG) and 1% NEA (Biochrom AG) at 5% or 10% CO2, respectively. Depending on the cell line and experimental conditions, 0.2-1x106, 0.5-1x105, 0.25-0.5x105 and 500-700 cells were seeded per 10 cm in 6-well, 12-well and 96-well formats, respectively.

[0476] cell line HeLaP HeLaP cells (ATCC CCL-2) are epithelial cells derived from cervical adenocarcinoma, named after the patient Henrietta Lacks. This cell line is the most widely distributed and oldest cell line (Rahbari et al., 2009) because it was the first permanent cell line established in 1951 (Gey et al., 1952). The cells were cultured in DMEM (10% FBS, 1% PS) at 37°C and 10% CO2.

[0477] HeLaRDB HeLaRDB is a subline of the HeLaP cell line that is resistant to daunoblastin based on overexpression of glycoprotein P. Resistance was achieved by culturing in medium containing this anthracycline. This cytostatic agent mediates double-stranded DNA sequences and inhibits cellular transcription and replication (Mizuno et al., 1975). As a result of the stress response caused by daunoblastin treatment, the cellular factor YB-1 shows higher nuclear localization compared to the parental cell line (Holm et al., 2004). To maintain resistance to daunoblastin, cells were cultured every 14 days in DMEM (10% FBS, 1% PS) containing 0.25 μg / ml daunoblastin at 37°C under 10% CO2.

[0478] A549 A549 cells (ATCC CCL-185) were isolated from a human alveolar basal adenocarcinoma in 1972 (Giard et al., 1973). Cultures were performed in Dulbecco's MEM (10% FBS and 1% PS) at 37°C and 10% CO2.

[0479] T24 T24 cells (ATCC HTB-4) were derived from a primary human bladder cancer in 1970 (Bubenik, Baresova et al., 1973). A point mutation in the HRAS gene (Reddy et al., 1982) activates the MAPK and PI3K pathways. In addition, this cell line harbors an additional mutation in the tumor suppressor gene p53 locus (Pinto-Leite et al., 2014). Cells were cultured in RPMI containing 10% FCS, 1% PS, and 1% non-essential amino acids at 37°C and 5% CO2.

[0480] HEK293 HEK293 cells (ATCC CRL-1573) are human embryonic kidney cells isolated in 1973. Due to the stable transfection of a 4.5 kb sized portion of the genome of adenovirus serotype 5 containing the entire E1 region (Graham and Smiley, 1977), this cell line is used for the production of E1-deleted adenoviruses and for the determination of viral titers.

[0481] Table 1: Primers Name Forward primer Reverse primer Company name fiber Eurofins AAGCTAGCCCTGCAAACATCA CCCAAGCTACCAGTGGCAGTA Early E2 Invitrogen CCGTCATCTCTACAGCCCAT GGGCTTTGTCAGAGTCTTGC Late E2 Invitrogen CTTCCTAGCGACTTTGTGCC GTCAGAGTGGTAGGCAAGGT E1A12S Metabion CGACGAGGATGAAGTCCTGTGTCTG CTCAGGATAGCAGGCGCCAT E1A12S Short Metabion GAGGATGAAGTCCTGTGT CTCAGGATAGCAGGCGCCAT E1A13S Metabion TGTTTGTCTACAGTCCTGTGTCTG CTCAGGATAGCAGGCGCCAT E1A13S Short Metabion TTGTCTACAGTCCTGTGT CTCAGGATAGCAGGCGCCAT E4orf6 Metabion TCCCTCCCAACACACAGAGT GACAGGAAACCGTGTGGAAT Rb Life Techno. AGCAACCCTCCTAAACCACT TGTTTGAGGTATCCATGCTATCA E2F1 Life Technology ACGCTATGAGACCTCACTGAA TCCTGGGTCAACCCCTCAAG E2F2 Life Technology CGTCCCTGAGTTCCCAACC GCGAAGTGTCATACCGAGTCTT GAPDH MWG TGGCATGGACTGTGGTCATGAG ACTGGCGTCTTCACCACCATGG Actin Eurofins TAAGTAGGTGCACAGTAGGTCTGA AAAGTGCAAAGAACACGGCTAAG L4 33K Eurofins GAACCAGGGCCGCCCATACTG GGGCTTTGTCAGAGTCTTGC L4 22K Eurofins CCGTTAGCCCAAGAGCAAC CGGCCGTGATGGTAGAGAAG L4HexAss Eurofins CTGTGGTACTTCCCAGAGAC CAGGTGAGTTATACCCTGCC

[0482] Virus Characteristics Ad-WT+AdWT-RGD Wild type mastadenovirus, type C, serotype 5 and AdWT with additional RGD fiber motif AdWT-E2Fmut. Mast adenovirus, type C, serotype 5, containing a mutation in both E2F binding sites in the E2 early promoter, an additional RGD fiber motif, and a 2.7 kb deletion in the E3 region (ΔE3). XVir-N-31 Mast adenovirus, type C, serotype 5, with a deletion in the E1B region (1.716-1915, 200 bp), a deletion in the E3 region (28.132-30.813) and a 12-base deletion in the E1A region. Replicates in cancer cells that express only nuclear YB-1 expression. XVir-N-31 / E2FM Mastadenovirus, type C, serotype 5 It has a deletion in the E1B region (1.716-1915, 200 bp), a deletion in the E3 region (28.132-30.813) and a 12-base deletion in the E1A region. It replicates in cancer cells that express only nuclear YB-1 expression. It has a mutation in both E2F binding sites in the E2 early promoter, an additional RGD fiber motif and a 2.7 kb-sized deletion in the E3 region (ΔE3).

[0483] Target gene siRNA construct Manufacturer Control Control (non-sil.) siRNA, 20 μM Qiagen, the Netherlands E2F-1 E2F-1(SASI_Hs01_00162220), 10μM Sigma, Merck, Germany YB-1 YBX1 siRNA FlexiTube, 10μM Qiagen, the Netherlands

[0484] method siRNA transfection Downregulation of specific genes was performed using siRNA transfection. Here, 5 μl of Lipofectamine RNAiMAX (Thermo Fischer) reagent was added to 150 μl of Opti-MEM in one tube and 36 pmol siRNA was combined with 150 μl of Opti-MEM in the other tube. After combining the contents of both tubes and vortexing briefly, the solution was incubated for 5 min at room temperature. Then, 250 μl of siRNA-lipid complexes were added to 250.000–1.000.000 cells seeded the day before in a 6-well plate, without changing the medium, to reach a final concentration of 30 pmol siRNA per well. After 48 h of incubation at 37°C and 10% CO2, infection or lysis occurred.

[0485] RNA quantification in combination with siRNA RNA was also quantified in cells in which virus was combined with siRNA transfection. Here, 125.000 cells were seeded and transfected the next day with 30 pmol of control-, YB-1-, and E2F1-siRNA siRNA constructs. Infection occurred after 48 h of incubation, and lysis occurred 24 h post-infection. Lysates were stored at -20°C.

[0486] RNA isolation Cells were rinsed with PBS, lysed with lysis buffer (mirVana miRNA Isolation Kit, Life Technologies) and transferred to a 1.5 ml reaction tube. 50 μl homogenate additive (mirVana miRNA Isolation Kit, Life Technologies) was added to the lysate, resuspended and incubated on ice for 10 min. 500 μl acid-phenol-chloroform was added, vortexed for approximately 30 s and incubated on ice for 2 min. After centrifugation at 14.000 g for 5 min at room temperature, the aqueous and organic phases were separated. The upper aqueous phase was transferred to a new snap cap, combined with an equal volume of isopropanol and mixed by inversion. After incubation at room temperature for 10 min, the samples were centrifuged at 4°C and 14.000 g for 30 min. The supernatant was then removed and the RNA pellet was washed with 1 ml of 75% ethanol. The samples were briefly centrifuged at 7500 g for 5 min at 4°C. After removing the supernatant, the air-dried pellet was dissolved in 20 μl of nuclease-free water and incubated in a thermomixer at 55° C. and 500 rpm for 10 min. The RNA concentration was then measured spectrophotometrically. To avoid amplification of DNA rut, DNAse digestion was performed. Here, Deoxyribonuclease I, Amplification Grade Kit (Invitrogen, life technologies) was used. To 1 μg RNA, 1 μl of 10×DNAse I reaction buffer and 1 μl of DNAse I were added, filled up to a final volume of 10 μl with DEPC-treated water and incubated at room temperature for exactly 15 min. DNase I was inactivated by adding 1 μl of 25 mM EDTA solution, thereby stopping the progress of DNAse digestion. The sample was incubated at 65° C. for 10 min and then used for reverse transcription.

[0487] Reverse transcription To convert RNA to cDNA, a high-performance cDNA reverse transcription kit (Thermo Scientific) was used. 2 μg DNA digested sample RNA was added to a Mastermix containing transcription buffer, 100 mM dNTPs and RNAse inhibitor in a PCR soft tube. Here, it had to be considered that RNA transcribed via E2 early and E2 late promoters could not be converted by the random primers normally used for reverse transcription, because these random primers would bind to both strands of the double-stranded adenovirus genome. Therefore, RNA to cDNA conversion for samples used for E2 early and E2 late quantification was performed by using specific E2 early reverse primers (Table 1). For actin, a housekeeping gene used to normalize the results, random primers were used.

[0488] DNA replication analysis To investigate the viral replication in infected cells, a DNA replication assay was performed. 125.000 cells were seeded in 6-well plates and infected at 10-20 MOI. Lysis was performed 2, 8, 12, 24, 36 and 48 hours post-infection, respectively. Here, the medium was removed and the adherent cells were washed with 1 ml of PBS. After adding 200 μl of DNA lysis buffer, the adherent cells were scraped off the plate using a cell scraper. The lysate was then transferred to a snap cap. 3 μl of the enzyme proteinase K was added and incubated overnight at 56 °C and 550 rpm in a thermomixer. DNA isolation was performed the next day.

[0489] DNA isolation For DNA purification, 200 μl of phenol-chloroform-isoamyl alcohol was added to the lysate. After vortexing and subsequent incubation on ice for 5 min, phase separation was achieved by centrifugation at 16430 g for 3 min at 4°C. The upper aqueous phase was transferred to a new snap cap containing 200 μl of chloroform in 10 mM TrisCl and 20 μl of cresol red for better visualization of the phases. After vortexing and incubation on ice for 5 min, centrifugation was performed at 16430 g for 3 min at 4°C. Again, the upper aqueous phase was combined with 800 μl of ethanol and 50 μl of 3M sodium acetate solution. To achieve better precipitation, 2 μl of glycogen was added. After brief inversion of the tube, the solution was centrifuged at 16430 g for 30 min at 4°C. The DNA pellet was then covered with 400 μl of 70% ethanol and incubated at room temperature for 10 min. After centrifugation at 4760 g for 7 min at room temperature, the DNA pellet was dried at 37°C for about 5-10 min. The pellet was then dissolved in 100 μl of 0.1×TE buffer and shaken at 40°C and 400 rpm for about 3 h. Once the DNA was completely dissolved, the DNA concentration was measured by a spectrophotometer using 2 μl of the DNA solution to be measured and 0.1×TE buffer as a blank solution. The DNA was then stored at 4°C.

[0490] qPCR For further quantification, real-time quantitative PCR was used. 5 μl of template DNA or cDNA, respectively, was used at a final concentration of 10 ng / μl. qPCR was performed in 96-well plates pipetted in duplicates using 10 μl Mastermix GoTaq PCR (Promega Corporation) (7.5 μl Mastermix, 1.5 μl primers, 1 μl H2O) and 5 μl DNA template. Relative quantification was performed using the comparative CT method with two normalization genes. The plates were closed with foil and centrifuged at 220 g for 2 min at room temperature. The plates were then incubated according to a specific temperature-time program in a thermal cycler. The primers used are listed in Table 1. The reactions were performed in a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories).

[0491] qPCR cycling conditions Fiber: 94°C for 2 min, 94°C for 15 s, 60°C for 15 s and 72°C for 15 s, 45 cycles Other viral genes: 94°C for 1.5 min, 94°C for 15 s, 58°C for 15 s, and 72°C for 15 s, 45 cycles Rb: 94°C for 2 min, 94°C for 15 s, 60°C for 30 s and 72°C for 1 min, 44 cycles E2F: 95°C for 2 min, 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s, 40 cycles

[0492] Protein isolation Cells were lysed using 1% SDS buffer to achieve disruption of the nuclear membrane. The entire process was performed on ice to avoid protein denaturation. After aspirating the medium, cells were washed twice with cold PBS. Adherent cells in one well of a duplicate approach were lysed with 200 μl of 1% SDS buffer and scraped with a cell scraper. The lysate was then transferred to the other well of a duplicate approach and scraped again. The lysates of both wells were then combined and transferred to a snap-cap tube. The lysate was subsequently treated with a syringe to break the viscous DNA and centrifuged at 31000 rpm for 30 min at 4°C. As proteins were present in the supernatant, the supernatant was transferred to a new snap-cap tube and used for further steps.

[0493] Protein quantification To quantify the amount of protein, a bicinchoninic acid (BCA) assay was performed with the Pierce™ BCA Protein Kit, in which 112.5 μl of BCA solution A+B (50:1) and 12.5 μl of sample were added to one well of a 96-well plate and incubated at 37° C. for 30 minutes. Staining of the solution occurred according to the protein concentration. The protein concentration of the samples was determined by photometric measurement at 562 nm in a microplate reader with a standard series with known protein concentrations.

[0494] SDS gel electrophoresis To separate the proteins in the subsequent sodium dodecyl sulfate polyacrylamide gel electrophoresis, the calculated amount of lysate and lysis buffer was mixed with 15 μl of loading buffer-DDT-mixture (6:1). The protein load material was then heated at 100° C. for 5 min. 5 μl of color protein standard and 40 μl of sample were loaded onto the gel. For protein separation for detection of viral proteins, a 10% gel was used. To study the genes downregulated by siRNA, a 12% gel was used. The composition of the separation and stacking gels are listed in the buffers and solutions section. The gel was run in TGS-buffer at 90 V for about 20 min to collect all proteins into one band. The gel was then run in TGS-buffer at 150 V for about 60 min to separate the proteins by size.

[0495] Western blot To transfer the proteins from the gel to the membrane, they were blotted using the Western blot technique. To activate the hydrophobic PVDF membrane, it was incubated in methanol for about 2 minutes. The membrane was then deposited in blotting buffer with the sponge, filter paper and gel. The proteins were transferred to the membrane in blotting buffer by electrophoresis at 4°C and 100V for about 2 hours. To avoid non-specific antibody binding, the membrane was blocked in 10 ml of 5% milk powder in TBST for the analysis of cellular proteins, respectively, and in 5 ml of 5% BSA-TBST for the subsequent use of antibodies to detect viral proteins, respectively, with rotation at room temperature for 1 hour. After washing the membrane five times in TBST for 5 minutes each, the membrane was incubated with the primary antibody solution overnight at 4°C with rotation. For the antibodies GAPDH, E1A, E1B55K, E2A and E4orf6, this step was performed at room temperature for 1 hour. Here, the antibodies were diluted in different factors in 5% BSA in TBST with 0.02% sodium azide. After five further washing steps, the membranes were incubated in a 1:10.000 dilution of the secondary antibodies for 30 minutes at room temperature with rotation. The secondary antibody against the virus antibodies (anti-mouse) was diluted in 5% BSA-TBST, all other antibodies were diluted in 5% milk powder in TBST. These secondary antibodies are conjugated with horseradish peroxidase. After five final washing steps, the membranes were incubated for 5 minutes in Enhanced-Chemi-Luminescence (ECL) solution to visualize the peroxidase signal. For the membranes incubated with the primary antibodies DP-1 and E2F-1, a brighter signal was achieved using Amersham ECL Prime Western Blot detection reagent from GE-Healthcare. For all others, an ECL solution prepared in the laboratory was used. The compositions of ECL A and ECL B, mixed 1:1 just before use, are listed in the buffers and solutions section. Finally, the proteins could be detected by displaying the signal on the film.

[0496] antibody: Checkpoint kinase 1 (sc-377231, Santa Cruz Biotechnology) Total RB (554136, BD Biosciences) Phospho-RB Ser780 (8180, Cell Signaling Technology) E2F1 (sc-251, Santa Cruz Biotechnology) E2F2 (ab138515, abcam) E2F3 (PG37, Thermo Fisher Scientific) E2F4 (WUF10, Thermo Fisher Scientific) E2F5 (sc-999, Santa Cruz Biotechnology) Cyclin D1 (92G2, Cell Signaling Technology) Cyclin E2 (4132, Cell Signaling Technology) CDK2 (78B2, Cell Signaling Technology) GAPDH (14C10, Cell Signaling Technology) Actin (A2066, Sigma-Aldrich Chemie GmbH) E1A (sc-25, Santa Cruz Biotechnology) E1B55k (kindly provided by M. Dobbelstein) E4orf6 (kindly provided by M. Dobbelstein) E2A (DBP, kindly provided by M. Dobbelstein) Hexon (ABIN2686029, Antibodies online)

[0497] Small molecule inhibitor treatment PD-0332991 isethionate (palbociclib, Sigma-Aldrich Chemie GmbH) and LY-2835219 (abemaciclib, Selleck Chemicals) were dissolved in sterile water as 10 mM stock solutions. LEE011 (ribociclib, MedChem Express) and Nutlin-3a (Sigma) were dissolved in DMSO as 10 mM and 5 μM stock solutions, respectively. Working concentrations were prepared fresh for immediate use.

[0498] Viral infection and combination treatments For determination of virus-induced cell death, cells were seeded in 12-well plates. For combination treatment with PD-033299, LY-2835219, and LEE011, cells were pretreated with inhibitors for 24 h. The cells were infected with the indicated viruses at the indicated MOI in 200-400 μl of medium without FBS. Complete medium with or without small molecule inhibitors was added to the cells at 1 hpi.

[0499] Cell viability (SRB assay) Cells were fixed with 10% TCA for 1 h at 4° C. and stained with 0.5% sulforhodamine B (SRB, Sigma-Aldrich Chemie GmbH) in 1% acetic acid for 30 min at RT, followed by washing with 1% acetic acid to remove excess SRB. Dried SRB was dissolved in 10 mM Tris buffer and quantification was performed photometrically at 590 nm.

[0500] Potency Test For the determination of infectious viral particle production, infected cells and supernatants were harvested at 3 dpi using a cell scraper. Virus was released from intact cells by multiple cycles of freeze-thawing followed by centrifugation at 1600rcf. Cell lysate supernatants were tested for viral particle production using Hek293 cells as described in the AdEasy virus titer kit instruction manual (972500). The following reagents were used: goat anti-hexon antibody (1056, Chemicon), rabbit anti-goat antibody (P0449, Dako), DAB solution (Dako).

[0501] Example 2: Effect of the CDK4 / 6 inhibitor PD0332991 on the replication of E1-minus adenovirus E1-deleted adenoviruses have been shown to replicate in cancer cells, albeit with very low potency. T24 cells were infected with 100 MOI E1-minus adenovirus expressing green fluorescent protein (Ad-GFP) and treated with 500 nM PD0332991 one day prior to infection and during the incubation period. Under these conditions, an increase in GFP expression was observed, indicating E1A-independent viral replication and gene expression mediated by activation of the adenovirus E2 early promoter.

[0502] Example 3: Combination of wild-type adenovirus or XVir-N-31 with various CDK4 / 6 inhibitors Based on the results using the E2 early mutant adenoviruses Ad-WT / E2M and Ad-GFP in combination with PD0332991, experiments were performed using various CDK4 / 6 inhibitors in combination with either the wild-type adenovirus Ad-WT or XVir-N-31. Because these drugs arrest cells in the G1 phase, it was surprising to find that all inhibitors were able to support viral replication.

[0503] Furthermore, we investigated whether treatment of cells with three clinically active CDK4 / 6 inhibitors, PD-033299, LY-2835219 and LEE011, could affect infection on cell viability, viral replication and viral titer production.

[0504] Upon treatment, all three inhibitors exhibit similar effects on RB expression and phosphorylation levels, as previously described in numerous publications. After nearly complete dephosphorylation at 24 hours and downregulation of total protein, phosphorylation levels are partially restored over time. CDK2 levels were upregulated and cyclin D2 and E2 levels were downregulated upon treatment.

[0505] Example 4: Synergistic effects produced by the combination of CDK4 / 6 inhibitors and oncolytic adenoviruses The CDK4 / 6 inhibitors PD-033299, LY-2835219 and LEE011 were combined with adenoviral infection of cells, which was performed 24 h after treatment, as downstream effects on target molecules can only be detected between 8 and 24 h after treatment.

[0506] The results are shown in Figure 1.

[0507] CDK4 / 6 inhibitors induced synergistic effects on cell viability, viral replication and viral titer. (a) Cells were pretreated with three CDK4 / 6 inhibitors PD-033299, LY-2835219 and LEE011 for 24 h and infected with XVir-N-31 (Moi60) or wild-type adenovirus (Moi80). Four days post-infection, cell viability was measured by SRB assay. Graphs show the average of at least three independent experiments. (b) Three days post-infection, lysates were prepared from cells and titer tests were performed on HEK293 cells. Viral titers are shown as fold changes relative to control. (c) DNA was extracted from infected cells at 4, 24, 36 and 48 hpi and analyzed for viral replication by using qPCR on fiber cDNA. Values ​​are normalized to GAPDH at 4 hpi. Graphs show representative of at least two independent experiments. Error bars represent standard error.

[0508] As can be seen from FIG. 1, all three CDK4 / 6 inhibitors dramatically supported cell lysis (FIG. 1a), intracellular replication (FIG. 18) and viral particle formation (FIG. 1b).

[0509] Example 5: Effect of the CDK4 / 6 inhibitor palbociclib (PD-033299) on selected viral protein expression levels To analyze these effects in more detail, expression levels of selected viral proteins were determined in treated or untreated cells. For this experiment, the inhibitor palbociclib (PD-033299) was used as a representative CDK4 / 6 inhibitor. Cells were infected at 15 MOI. PD treatment at 500 nM was performed until 24 hours post-infection and protein isolation was performed. After 12, 24 and 36 hours, protein isolation was performed using 1% SDS buffer. Actin was included as a positive control. The loading control shows the same protein levels of cellular actin in all lines, thus ensuring a proper comparison between lines. hpi: hours post-infection.

[0510] The results are shown in Figure 2. Figure 2 shows the results of viral protein expression in Ad-WT and XVir-N-31 infected T24 cells in combination with the CDK4 / 6 inhibitor PD0332991 (PD). All of the viral proteins investigated in this experiment (E1A, E1B-55k, DBP (E2A) and hexon) were expressed at higher levels in cells treated with the CDK4 / 6 inhibitor PD-0332991 compared to the adenovirus wild type virus. This effect could be observed as early as 12 hpi for E1A and 24 hpi for the other proteins.

[0511] Example 6: Specificity of effects mediated by CDK4 / 6 inhibitors The class of CDK4 / 6 inhibitors according to Example 5 requires expression of RB. Therefore, three RB positive and two RB negative bladder cancer derived cell lines were used and these cells were treated with the combination therapy. The cell lines were pretreated with IC50 concentrations of PD-0332991 (T24: 500nM, RT112: 2000nM, 253J: 100nM) for 24 hours and infected with XVir-N-31 (T24 MOI50, 253J MOI25, RT112 MOI450). Values ​​are the average of at least two independent experiments. Error bars indicate standard error. At 4 dpi, cell survival was measured using the SRB assay (a, c). (b, d) Cell lysates were prepared at 3 dpi and titer tests were performed on Hek293 cells. Viral titers are shown as fold changes relative to the control.

[0512] The results are shown in Figure 3.

[0513] As shown in Figure 3, only the RB-positive cell lines showed a significant decrease in cell proliferation and cell survival, respectively (Figure 3a, c), and viral particle formation was increased only in the RB-positive cell lines upon PD-0332991 treatment (Figure 3b, d).

[0514] Example 7: Effect of combined treatment of CDK4 / 6 inhibitor PD-0332991 with XVir-N-31 To investigate the effect of PD-0332991 on viral replication in RB-positive cell lines, relative quantification of fiber DNA copies was performed using qPCR. Bladder cancer cell lines were pretreated for 24 h and infected with XVir-N-31 (T24 MOI40, UMUC3 and 253J MOI20, RT112 MOI400). DNA was extracted 24-48 hpi and analyzed for viral fiber using qPCR. Values ​​are normalized to GAPDH. Data are representative of at least two independent experiments. Error bars SD.

[0515] The results are shown in Figure 4.

[0516] As can be seen in Figure 4, combined treatment with the CDK4 / 6 inhibitor PD-0332991 and XVir-N-31 dramatically increases viral replication.

[0517] Example 8: Time kinetics of CDK4 / 6 inhibitors The time kinetics of CDK4 / 6 inhibitors on dephosphorylation and degradation of RB is about 10 hours after treatment of cells. The results shown above also showed a partial recovery of RB downstream targets over time (Figure 1). This observation implies that the time kinetics of CDK4 / 6 inhibitors and their effect on virus-induced cell death are important parameters of this combination therapy, as illustrated in Example 7. For the application of the combination therapy, different time points for pretreatment of cells were tested. Accordingly, cells were treated either before infection (day / hour before infection, dai / hai) or 1 hour after infection, and cell proliferation was measured using the SRB assay. Error bars represent SE, and values ​​are the average of three independent experiments.

[0518] The results are shown in Figure 5.

[0519] As can be seen from FIG. 5, parallel treatment was already sufficient to increase cell death.

[0520] Example 9: Combination treatment of various adenoviruses with the CDK4 / 6 inhibitor PD0332991 This example was performed to provide experimental evidence that various oncolytic adenoviruses can be used with CDK4 / 6 inhibitors, such as PD0332991, for cell killing, and that the observed increase in viral replication and cell killing was not limited to XVir-N-31. Accordingly, T24 cancer cells with Ad-delta24 and Onyx-015 as follows: T24 bladder cancer cells were infected with the indicated oncolytic adenoviruses at 20 MOI. Treatment with 500 nM CDK4 / 6 inhibitor PD0332991 was performed 1 day before infection and 4 days after infection. Images were taken 4 days after infection. The occurrence of cytopathic effect (CPE) indicates viral replication and cell killing.

[0521] The results are shown in Figure 6.

[0522] As can be seen from Figure 6, the CDK4 / 6 inhibitor PD0332991, as a representative example of a CDK4 / 6 inhibitor that reduces RB phosphorylation, increased cell killing when combined with other oncolytic adenoviruses, such as Ad-delta24 and Onyx-015.

[0523] Example 10: Infection of T24 cells with recombinant E1-deleted adenovirus expressing GFP in combination with palbociclib (Ad-minus / GFP) increases GFP expression 100.000 T24 cells / well were seeded in 6-well plates and grown in RPMI medium containing 10% FCS at 37°C with 5% CO2. T24 cells were treated with 500 nM palbociclib 24 h before infection and again 1 h after infection. Infection with E1-deleted adenovirus expressing GFP (Ad-minus / GFP) was performed in 400 μl serum-free medium. Pictures were taken 48 h after infection using a fluorescent microscope at 10x magnification.

[0524] The results of fluorescence microscopy analysis of GFP expression with and without palbociclib treatment are shown in Figure 7 .

[0525] The results show that treatment of T24 cells with palbociclib strongly enhanced GFP expression mediated by palbociclib-induced viral DNA replication.

[0526] Example 11: E1A-independent viral replication in UMUC cells treated with various cell cycle inhibitors A DNA replication assay was performed to investigate the difference in replication of dl703 (Mantwill et al. 2013, Journal of Translational Medicine, 11, 216) under different treatment conditions. 100.000 UMUC cells were seeded in 6-well plates and grown in DMEM medium containing 10% FCS at 37°C under 5% CO2. 24 hours after seeding, cells were treated with 10 μM Lee (ribociclib), 1 μM CI-1040, 10 μM Nutlin-3a and 10 μM Roscovitine for 24 hours, and after infection, appropriate amounts of inhibitors were added back to the medium. Infection with 50 MOI dl703 (Mastadenovirus, type C, serotype 5, with a 3.2 kb deletion in the E1 region) was performed 24 hours after treatment. At 4 and 48 h postinfection, DNA was isolated and qPCR was performed using primers specific for the viral fiber gene: fiber fwd.5'-AAGCTAGCCCTGCAAACATCA-3'; fiber rev.5'-CCCAAGCTACCAGTGGCAGTA-3'.

[0527] The results are shown in Figure 8.

[0528] As can be seen from Figure 8, treatment of UMUC cells with the CDK4 / 6 inhibitor LEE011 (ribociclib) dramatically increased (almost 100-fold) viral DNA replication of E1-minus adenovirus dl703. This increase strongly suggests that the specific induced G1 arrest by ribociclib in combination with suppression of E2F-1 expression promotes E1-independent adenovirus replication. As a result, not only viruses with specific deletions in the E1A gene show increased adenovirus DNA replication under CDK4 / 6 treatment, but even adenoviruses with complete deletions of the E1A gene show increased viral DNA replication.

[0529] The Mek inhibitor GI-1040 showed similar properties in terms of E2F-1 expression inhibition and G1 arrest, but the replication was much lower compared to ribociclib-treated cells. This may be due to the fact that other important cell cycle-related pathways required for viral replication, such as MEK / ERK, are simultaneously inhibited. In addition, inhibition of the MEK / ERK pathway was shown to reduce particle formation by more than 100-fold, making it unsuitable in a clinical setting for combination therapy with oncolytic adenovirus replication (Schumann and Doppelstein 2016, Cancer Research, 66, 1282-1288).

[0530] Example 12: Western blot analysis of UMUC cells treated with the indicated cell cycle inhibitors Western blot analysis of UMUC cells treated with the indicated concentrations of CI-1040, roscovitine, Nutlin-3a and LEE011 (ribociclib). 1x106 cells were seeded in 10 cm dishes. 24 hours after treatment, proteins were isolated using 1% SDS buffer to achieve nuclear membrane disruption. All samples were aspirated into a syringe several times to disrupt DNA, followed by centrifugation at 30000 rpm for 30 min at 4°C. Supernatants were transferred to new reaction tubes and used directly for further steps or stored at -80°C. Sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed to separate proteins. 40 μg total protein was loaded and probed against the indicated specific antibodies, with electrophoresis at 100 V at 4°C for approximately 2 h.

[0531] The results are shown in Figures 9A, 9B and 9C.

[0532] As can be seen from FIG. 9, roscovitine and Nutlin-3a had no significant effect on Rb, phRB and E2F-1 expression, whereas LEE-011 (ribociclib) at 10 μM and MI-1040 at 1 μM induced inhibition of E2F-1 as well as Rb and phRb expression.

[0533] Example 13: Analysis of CDK4 / 6 inhibitors on viral DNA replication of E1-deleted replication-deficient adenovirus dl703 For cell cycle analysis, cells were seeded in 6-well plates (2.5x10E4c / well). 8 hours prior to infection with dl703, cells were treated with the indicated concentrations of cell cycle inhibitors. After infection with 10 MOI dl703, cells were treated again for 48 hours. Untreated cells and cells infected only with dl703 served as controls. 48 hours post-infection, cells were harvested by trypsinization and fixed with 80% ethanol while vortexing. To investigate cell cycle status, fixed cells were centrifuged for 5 min at RT and 300g and ethanol was aspirated. Cells were resuspended, washed with 1% BSA-PBS (bovine serum albumin) and centrifuged again. Cells were stained with EDU and cell cycle analysis was performed using the Click-iT™ Plus EdU Flow Cytometry Assay Kit from Thermo Fischer, Cat. No. C10632. In addition, after washing three times with 1% BSA / PBS cells were stained with PI (propidium iodide, 50 μg / ml). Measurements were performed directly after staining on a FACScalibur flow cytometry system. Data were analyzed with FlowJo software.

[0534] Features of CDK4 / 6 inhibitors CI1040: MAP kinase kinase (MEK), a dual specificity threonine / tyrosine kinase, is a key component of the RAS / RAF / MEK / ERK signaling pathway that is frequently activated in human tumors. CI-1040 is a benzhydroxamate compound that potently inhibits MEK (Allen et al. 2003, Semin Oncol. (5 Suppl 16):105-16) and induces G1 arrest.

[0535] Nutlin-3a: Nutlin-3, a small molecule antagonist of MDM2, effectively restores p53 function in both normal MDM2-expressing cell lines as well as MDM2-overexpressing cell lines with wild-type p53, leading to cell cycle arrest and apoptosis (Wang et al 2012, Acta Biochimica et Biophysica Sinica, Volume 44, Issue 8, 1 August 2012, Pages 685-691).

[0536] Roscovitine (seliciclib or CYC202) is an experimental drug candidate in the family of pharmacological cyclin-dependent kinase (CDK) inhibitors that preferentially inhibits multiple enzymatic targets, including CDK2, CDK7, and CDK9, resulting in altered proliferation phase or state within the cell cycle of treated cells (Whitaker et al. 2004, Cancer Research 64, 262-272).

[0537] LEE011 (ribociclib; Kisqali) is an inhibitor of cyclin D1 / CDK4 and CDK6 and is used to treat certain types of breast cancer. Inhibition of CDK4 / 6 arrests the cell cycle at G1 and inhibits E2F-1 expression (Kim S. et al, Oncotarget. 2018 Oct 16;9(81):35226-35240;Yang C et al., Oncogene (2017)36,2255-2264).

[0538] The results are shown in Figure 10.

[0539] The CDK4 / 6 inhibitors LEE011 (ribociclib) and CI-1040 induced a clear G1 arrest. Treatment with roscovitine showed a slight increase in G2 / m arrested cells. Nutlin-3a had little or no effect on the cell cycle at the concentrations used. Infection of UMUC cells with recombinant E1 deleted (lacking E1A protein) adenovirus dl703 did not significantly alter cell cycle distribution.

[0540] Example 14: Palbociclib Increases In Vitro Adenovirus Hexon Staining Following Treatment Bladder cell lines RT112, T24 and UMUC were seeded in 6-well plates (2x105 cells / well). One day after seeding, cells were treated with 500nM palbociclib 24h pre-infection and again 1h post-infection. Infection with the indicated MOI of AD-WT was performed in 400μl serum-free DMEM medium. Hexon staining was performed 2 days after infection using the Adeasy virus titer kit from Agilent (cat:972500) according to the manufacturer's instructions.

[0541] The results are shown in Figure 11.

[0542] As shown in Figure 11, palbociclib (500nM) treatment as an exemplary CDK4 / 6 inhibitor significantly increased hexon-positive cells in palbociclib-treated cells 48 hours after infection, as indicated by brown / red color. It was concluded that under palbociclib treatment, cells can produce more virus particles, indicating increased viral DNA replication. Because adenovirus hexon expression is due to the exclusive initiation of viral replication.

[0543] From the results of the subject of Examples 10-14, it is clear that only CDK4 / 6 inhibitors, but not other cell cycle inhibitors, are able to increase the replication and gene expression of replication-deficient adenovirus (dl703 lacking the E1 gene) and Ad-GFP. Furthermore, to bring about such an increase in viral replication and gene expression, CDK4 / 6 inhibitors must arrest (infected) cells in G1 and inhibit F2F1 expression.

[0544] Example 15: Treatment of T24 cells using a triple combination therapy including XVir-N-31, palbociclib and a PARP inhibitor An efficacy assay was performed to demonstrate the efficacy of triple therapy in T24 cells using a triple combination therapy including XVir-N-31, palboclib and a PARP inhibitor (BMN673 (Talazolarib)).

[0545] T24 cells were seeded at 12.500 cells per well in 12-well plates and grown overnight at 37°C in RPMI medium containing 10% FCS. Cells were treated with inhibitors 24 h after cell seeding and again 1 h after infection by adding the indicated concentrations to the medium. Cells were infected 24 h after inhibitor treatment in 250 μl serum-free medium. Fixation and SRB staining were performed 4 days after infection. PD, palbociclib; PARPi: BMN673.

[0546] For SRB staining, the medium was removed by aspiration. Cells were fixed with 1 ml (per well) of 10% cold TCA for 1 h at 4°C. TCA was removed by aspiration and the cell layer was washed 4 times with tap water. Cells were stained with 1 ml (per well) of 0.5% SRB (sulforhodamine B) in 1% acetic acid for 30 min. Unbound SRB was removed with 1 ml / well of 1% acetic acid in 5 washing steps. After each washing step, acetic acid was removed by aspiration. Plates were air-dried for 2 h. To solubilize SRB-stained cells, 200 μl of 10 mM Tris base was added to each well. Then, 20 μl of each was dispensed into the wells of a 96-well plate. The 96-well plate was loaded into an Elisa plate reader and the absorbance of the samples was measured at 560 nm. Mock-treated cells were set to 100% cell viability.

[0547] The results are shown in Figure 12.

[0548] The results shown in Figure 12 clearly demonstrate that the triple combination therapy consisting of palbociclib, BMN673 and XVir-N-31 showed superior performance in terms of cell killing compared to single agents or combination therapy. Nearly 90% cell killing could be achieved using 10MOI XVir-N-31 in combination with the PARP inhibitor PARPi (BMN673) and the CDK4 / 6 inhibitor palbociclib (PD). The combination of PARPi and palbociclib without XVir-N-31 only killed 65% of the cells. T24 and UMUC cells are sensitive to CDK4 / 6 inhibitors (providing G1 arrest by E2F-1 downregulation).

[0549] Example 16: Kinetics of triple combination therapy including XVir-N-31, palbociclib and a PARP inhibitor To demonstrate the kinetics of triple therapy of T24 cells using a triple combination therapy including XVir-N-31, palboclib and a PARP inhibitor (BMN673 (Talazolarib)), efficacy assays were performed and efficacy was assessed at various time points.

[0550] 3.000 T24 cells per well were seeded in 12-well plates and grown overnight at 37°C in RPMI medium containing 10% FCS. Cells were treated with inhibitors 24 h after cell seeding and again 1 h after infection by adding the indicated concentrations to the medium. Cells were infected 24 h after inhibitor treatment in 250 μl serum-free medium. Fixation and SRB staining were performed 1-5 days post-infection (dpi). 15 nM PARPi corresponds to the IC80 value for T24 cells.

[0551] The results are shown in Figure 13.

[0552] As can be seen from Figure 13, the triple combination therapy using XVir-N-31, CDK4 / 6 inhibitor (palbociclib (PD)) and PARP inhibitor PARPI (BMN673) is much more effective from the kinetics point of view than the monotherapy using XVir-N-31 alone or the combination therapy using XVir-N-31 with either PARP inhibitor or CDK4 / 6 inhibitor. Importantly, tumor cell regrowth was significantly reduced at days 4 and 5 (dpi) in the CDK4 / 6 sensitive cell lines UMUC and T24.

[0553] Example 17: Kinetics of triple combination therapy including XVir-N-31, palbociclib and a PARP inhibitor To demonstrate the kinetics of triple therapy of UMUC cells using a triple combination therapy including XVir-N-31, palboclib and a PARP inhibitor (BMN673 (Talazolarib)), efficacy assays were performed and efficacy was assessed at various time points.

[0554] UMUC-3 seeding: 3.000 cells per well. Cells were seeded in 12-well plates and grown overnight at 37°C in DMEM medium containing 10% FCS. Cells were treated with inhibitors 24 h after cell seeding and again 1 h after infection by adding the indicated concentrations to the medium. Cells were infected 24 h after inhibitor treatment. Fixation and SRB staining were performed 1-6 days post-infection (dpi). 160 nM PARPi corresponds to the IC80 value for UMUC3 cells.

[0555] The results are shown in Figure 14.

[0556] The results shown in Figure 14 clearly demonstrate that the triple combination of palbociclib, BMN673 and XVir-N-31 showed superior performance over single agent or combination therapy. Importantly, tumor cell regrowth was significantly reduced at days 4 and 5 (dpi) in the CDK4 / 6 sensitive cell lines UMUC and T24.

[0557] Example 18: Triple therapy including XVir-N-31, a CDK4 / 6 inhibitor and a bromodomain inhibitor 5000 T24 cells were seeded in 12-well plates and grown in 1 ml RPMI medium containing 10% FCS. The next day, cells were treated with 500 nM palbociclib and 300 nM JQ-1. 24 h after treatment, cells were infected with the indicated MOI of XVir-N-31 in 200 μl RPMI medium without FCS. One hour later, 800 μl RPMI medium containing 10% FCS was added to each well. In addition, 500 nM palbociclib and 300 nM JQ-1 were added to the medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell viability.

[0558] The results are shown in Figure 15.

[0559] As can be seen from Figure 15, the bromodomain inhibitor JQ1 enhanced the cell killing ability of XVir-N-31 in combination with the CDK4 / 6 inhibitor palbociclib at low MOI. Light microscopy analysis at 48 hours post-infection shows already massive cell death in JQ1 / palbociclib / XVir-N-31 treated cells. It was concluded that JQ-1 increased viral replication by increasing viral transcription in palbociclib treated cells. Monotherapy with 300 nM JQ1 alone did not increase the cell killing of XVir-N-31 at 10 and 20 MOI.

[0560] The prerequisite for the enhancement of JQ-1 observed in adenovirus-infected cancer cells is the ability of palbociclib to induce G1 arrest. In cells that are resistant to palbociclib (see Example 18, identical treatment procedure), no increase in cell killing was observed. This observation is in stark contrast to Baojie Lv et al 2018, Scientific reports, 8, 11554, where cells were treated with a concentration of JQ1 that did not induce G1 arrest and was not combined with palbociclib.

[0561] Example 19: Triple therapy including XVir-N-31, a CDK4 / 6 inhibitor and a bromodomain inhibitor 100.000 SK-N-MC cells / well were seeded in 12-well plates and grown in RPMI medium containing 10% FCS at 37°C with 5% CO2. Cells were treated with 200 nM Abemaciclib + 500 nM JQ1 24 h before infection and again 1 h after infection by adding the appropriate volume to the medium. XVir-N-31 infection was performed in 500 μl serum-free RPMI medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell viability.

[0562] The results are shown in Figure 16.

[0563] It has been established that SK-N-MC cells are resistant to CDK4 / 6 inhibitors, which do not cause G1 arrest. Addition of JQ1 did not increase cell killing in CDK4 / 6 (abemaciclib)-resistant SK-N-MC cells, indicating that CDK4 / 6-mediated G1 arrest is a prerequisite for JQ1-mediated effects on cell killing.

[0564] Thus, Figure 16 (and Figure 15) shows that bromodomain inhibitors targeting BRD2, BRD3, and BRD4 further enhance the cell killing effect of XVir-N-3, provided that CDK4 / 6 inhibitors induce G1 arrest in treated cells.

[0565] Example 20: Western blot analysis of SK-N-MC cells treated with the CDK4 / 6 inhibitor LY-2835219 (abemaciclib) and the Wee inhibitor MK-1775 (adavosertib) 1×10 6Cells were seeded in 10 cm dishes. 24 hours after treatment, proteins were isolated using 1% SDS buffer to achieve nuclear membrane disruption. All samples were aspirated into a syringe several times to disrupt DNA, followed by centrifugation at 30000 rpm for 30 min at 4°C. The supernatant was transferred to a new reaction tube and used directly for further steps or stored at -80°C. Sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed to separate proteins. 40 μg total protein was loaded and probed against the indicated specific antibodies, followed by electrophoresis at 100 V at 4°C for approximately 2 h.

[0566] The results are shown in Figure 17.

[0567] SK-N-MC cells are known to be resistant to Abemaciclib treatment (Dowless M et al.,2018, Clin Cancer Res: 24, 6028-6039). Wee1 is a key component of G2 / M cell cycle checkpoint control and mediates cell cycle arrest by regulating CDC2 phosphorylation. Inhibition of Wee1 by MK1775 has been reported to enhance the cytotoxic effects of DNA damaging agents in different types of carcinomas. Several studies have demonstrated that pharmacological inhibition of Wee1 by the small molecule kinase inhibitor MK-1775 ablate CDC2 phosphorylation at Tyr15 in tumor cells (Kreahling et al 2013, PLoS One. 8(3), e 57523). A strong G1 arrest is observed with combined treatment, but no changes in Rb and E2F-1 expression are observed.

[0568] Example 21: Triple therapy including XVir-N-31, CDK4 / 6 inhibitor abemaciclib and adavosertib (Wee inhibitor MK-1775) 100.000 SK-N-MC cells / well were seeded in 12-well plates and grown in RPMI medium containing 10% FCS at 37°C with 5% CO2. Cells were treated with 200 nM Abemaciclib 24 h before infection and again 1 h after infection by adding the appropriate volume to the medium. Infection with XVir-N-31 was performed in 500 μl of serum-free RPMI medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell viability.

[0569] The results are shown in Figure 18.

[0570] Figure 17 (and Figure 18) demonstrates that the combination of CDK4 / 6 inhibitor Abemaciclib and Wee inhibitor MK-1775 induces G1 arrest without inhibiting E2F-1. The potency assay in Figure 18 shows that this combination does not enhance the cell killing effect of oncolytic adenovirus XVir-N-31. These results clearly demonstrate that the G1 arrest induced by the combination of CDK4 / 6 inhibitor Abemaciclib and Wee inhibitor MK-1775 does not promote the cell killing ability of XVir-N-31. Thus, inhibition of E2F-1 expression is an additional prerequisite for enhancing viral oncolysis.

[0571] Example 22: G1 arrest in combination with E2F-1 inhibition is a prerequisite for enhanced cell killing of XVir-N-31 in combination with CDK4 / 6 inhibitors 48 hours after treatment, cells were washed twice with PBS (containing RNase A, 100U / ml). Cells were trypsinized and centrifuged at 1500 rpm, 4°C for 5 min. Cells were fixed by slowly adding 1 ml of ice-cold 80% ethanol dropwise to the pellet and incubating overnight. Staining was performed by adding 1 ml of staining solution (propidium iodide, 50 μg / ml) to the cells and incubating for 30-60 min at RT with gentle rocking. MK: MK-1775; LY: LY-2835219.

[0572] The results are shown in Figure 19.

[0573] As can be seen in Figure 19, treatment of SK-M-NC cells with LY (abemaciclib) had no effect on the cell cycle. MK-1775 treatment alone increased cells in G2 / M at 500 nM. The combination of the two caused a strong G1 arrest.

[0574] Example 23: Role of E2F-1 expression on viral DNA replication I. 2 x 10 per well 5 T24, A549 and HeLa cells were seeded in 6-well plates and grown in 1.5 ml of RPMI1640 medium (or DMEM medium) containing 10% FBS, penicillin / streptomycin and non-essential amino acids. The next day, 30 pmol siRNA-either negative control siRNA (Qiagen #1022076) or siE2F1 (Sigma #NM_005225, siRNA ID SASI_Hs01_00162220) was diluted in 150 μL of Opti-MEM medium and 9 μl of Lipofectamine RNAiMAX was prepared in 150 μL of Opti-MEM. The siRNA solution and Lipofectamine RNAiMAX solution were mixed and incubated for 5 minutes. The mixture was added dropwise to the cells. After 48 hours, RNA was isolated and RT-qPCR was performed.

[0575] The results are shown in Figure 20. As is clear from Figure 20, E2-early expression is reduced.

[0576] II 2 x 10 for each well of a 6-well plate 5T24 cells were seeded in 1.5 ml of RPMI1640 medium containing 10% FBS, penicillin / streptomycin and non-essential amino acids. The next day, 30 pmol siRNA-either negative control siRNA (Qiagen #1022076) or siE2F1 (Sigma #NM_005225, siRNA ID SASI_Hs01_00162220) was diluted in 150 μL of Opti-MEM medium and 9 μl of Lipofectamine RNAiMAX was prepared in 150 μL of Opti-MEM. The siRNA and Lipofectamine RNAiMAX solutions were mixed and incubated for 5 min. This mixture was added dropwise to the T24 cells. Infection was performed 48 h later by incubating the cells with 10 MOI ADWTRGD in 400 μl of serum-free medium, rocking the plate every 10-15 min. After 1 h, 1.6 ml of complete medium was added. RNA isolation was performed 24 h postinfection.

[0577] The results are shown in Figure 21.

[0578] III Cells were rinsed with cold PBS, disrupted by adding 500 μl of lysis buffer from the MirVana kit (Thermo Fisher catalogue no. AM1560), and the lysate was collected with a spatula and pipetted into a 1.5 ml tube. For organic extraction, 50 μl of homogenate additive was added, the sample was incubated on ice for 10 min, 500 μl of acid-phenol:chloroform was added, the sample was vortexed for 60 s and incubated on ice for 2 min. The sample was centrifuged at 14000×g for 5 min at room temperature to separate the aqueous and organic phases. The upper phase was carefully transferred to a new tube and an equal volume of isopropanol was added. After a 10 min incubation at room temperature, the RNA was precipitated (14000×g, 4°C, 30 min) and washed twice with 1 mL of 75% ethanol (centrifugation 7500×g, 4°C, 5 min). RNA was air-dried for 5-10 min, resuspended in 20-50 μl RNase-free water, dissolved by shaking at 500 rpm, 55°C for 10 min, and measured on a Nanodrop. After DNA digestion (Deoxyribonuclease I, Invitrogen Cat.No. 18068-015), 1 μg RNA sample was combined with 1 μl 10× DNAse I reaction buffer, nuclease-free water, 1 μl DNase I (1 U / μl) to a volume of 9 μl and incubated at room temperature for 15 min. DNAse I was inactivated by adding 1 μl 25 mM EDTA solution and heating at 65°C for 10 min. Reverse transcription was performed using a high performance cDNA reverse transcription kit (Thermo Fisher / Applied Biosystems™ Cat. No.: 4368814). Random hexamers were used for transcription of fiber and actin PCR, and E2 early primers were used for transcription of E2 early PCR.

[0579] Primers and siRNAs used E2 initial fw: CCGTCATCTCTACAGCCCAT E2 initial rev:GGGCTTTGTCAGAGTCTTGC Fiber fw: AAGCTAGCCCTGCAAACATCA Fiber rev:CCCAAGCTACCAGTGGCAGTA Actin fw:TCACCCACACTGTGCCCATCTACG Actin rev: CAGCGGAACCGCTCATTGCCAATGG E2F1fw:CATCCCAGGAGGTCACTTCTG E2F1rev:GACAACAGCGGTTCTTGCTC Control siRNA Sense:UUCUCCGAACGUGUCACGUdTdT Antisense:ACGUGACACGUUCGGAGAAdTdT E2F-1 siRNA CUGAGGAGUUCAUCAGCCU[dT][dT] AGGCUGAUGAACUCCUCAG[dT][dT]

[0580] To prove the role of E2 early expression by RT-qPCR, it is absolutely necessary to select appropriate primers. The position of the primers should be between the E2 early promoter and the E2 late promoter. Otherwise, the E2 late promoter will strongly affect the results. The positions of the primers are shown in Figure 22.

[0581] As is evident from Figures 20 and 21, downregulation of E2F1 by siRNA increases E2-early expression. This could only be explained by the repressive role of E2F1 in E2-early expression. If E2F-1 were an activator, the result would be a decrease in E2-early expression. In addition, siRNA against E2F-1 mimics the effect of CDK4 / 6 inhibitors, which also inhibits E2F-1 expression (Yang C et al., Oncogene 2017, 36,2255-2264).

[0582] Example 24: Recombinant adenoviruses with mutations in two E2F binding sites in the adenovirus E2 early promoter show increased E2 early expression Mutant adenoviruses were generated that have mutations in the two E2F binding sites of the adenovirus E2 early promoter. Both the wild-type and mutant E2 early promoters are shown in FIG.

[0583] RNA-expression analysis was performed in AdWT-RGD and AdE2Fm (also containing RGD motif) infected T24 cells, obtained by RT-qPCR at 24 hours after infection. AD-WT gene expression was set to 100%. The method was the same as that described in Section III of Example 23.

[0584] The results are shown in Figure 24.

[0585] As can be seen from Figure 24, the expression of E2 early gene expression was higher in AdE2Fm-infected cells compared to Ad-WT-infected cells. Therefore, we must conclude that E2F-1 plays a repressive role in E2 early promoter activation. This is in clear contrast to the current understanding that E2F-1 is assumed to be an activator (DeCaprio JA, Virology. 2009 Feb 20;384(2):274-84).

[0586] It is known that the structure of E2 region in all currently known oncolytic adenoviruses is constructed as shown in Figure 22. Therefore, the mechanism of action of E2F-1 is the same as that described here. As a result, all of them, i.e., all oncolytic adenoviruses (including ColoAd1 and Delta24-RGD) can be used in combination with CDK4 / 6 inhibitors.

[0587] ColoAd1 can be characterized as follows.

[0588] Enadenotucirev (formerly ColoAd1) is a tumor-selective chimeric adenovirus with demonstrated preclinical activity. The capsid of ColoAd1 is derived from Ad11p, a serotype with limited seroprevalence in humans. EnAd infects cells by binding to both CD46 and / or desmoglein 2,6, which are widely expressed on many cancer cells. Most of the EnAd genome is derived from Ad11p, which has a large deletion in E3 and a smaller deletion in E4. In addition, the E2B region consists of a chimera of sequences from Ad11p and Ad3. The E4 deletion in EnAd is in E4ORF4, whereas Ad5 encodes a protein that inactivates protein phosphatase 2A, thereby activating the protein translation machinery and regulating the activity of the E1A protein in a feedback inhibitory loop. These deletions, presumably in combination with the chimeric E2B region, likely contribute to the remarkable cancer-selective replication of EnAd (Deyer et al., Mol Ther Oncolytics. 2017, 16; 5: 62-74).

[0589] Delta 24-RGD (DNX-2401) can be characterized as follows.

[0590] Delta24-RGD (DNX-2401) is a conditionally replicative oncolytic virus engineered to preferentially replicate and lyse in tumor cells with p16 / RB / E2F pathway abnormalities. Fueyo et al., Oncogene. 2000 Jan 6;19(1):2-12. Mutant oncolytic adenovirus targeting the Rb pathway produces antiglioma effects in vivo. Dai B. et al. Mol Cancer Therapy. 2017 Apr;16(4):662-670.

[0591] The features of the invention disclosed in the foregoing specification, in the claims and in the drawings can be important for the realization of the invention in its various embodiments, both individually and in any combination.

Claims

1. A combination comprising an adenovirus and a CDK4 / inhibitor.

2. The combination of claim 1 , wherein the combination further comprises a PARP inhibitor.

3. 3. The combination according to claim 1 or 2, wherein the combination further comprises a bromodomain inhibitor.

4. A combination according to any one of claims 1 to 3 for use in a method for the treatment of tumors or cancer.

5. 1. An adenovirus for use in a method for treating a tumor or cancer in a subject, comprising: The method includes administering to a subject an adenovirus and a CDK4 / 6 inhibitor. Adenovirus.

6. 1. A CDK4 / 6 inhibitor for use in a method for the treatment of a tumor or cancer in a subject, comprising: The method includes administering to a subject an adenovirus and a CDK4 / 6 inhibitor. CDK4 / 6 inhibitors.

7. The combination according to claim 1, the combination for use according to claim 4, the adenovirus for use according to claim 5 and the CDK4 / 6 inhibitor for use according to claim 6, wherein the adenovirus is an oncolytic adenovirus.

8. The combination according to any one of claims 1 and 7, the combination for use according to any one of claims 4 and 7, the adenovirus for use according to any one of claims 5 and 7 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

9. The combination according to any one of claims 1 and 7 to 8, the combination for use according to any one of claims 4 and 7 to 8, the adenovirus for use according to any one of claims 5 and 7 and 8 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 8, wherein the adenovirus is XVir-N-31.

10. The combination according to any one of claims 1 and 7 to 9, the combination for use according to any one of claims 4 and 7 to 9, the adenovirus for use according to any one of claims 5 and 7 to 9 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 9, wherein the CDK4 / 6 inhibitor is a CDK4 / 6 inhibitor which arrests cells in the G1 phase and inhibits E2F1.

11. The combination according to any one of claims 1 and 7 to 10, the combination for use according to any one of claims 4 and 7 to 10, the adenovirus for use according to any one of claims 5 and 7 to 10 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 10, wherein the CDK4 / 6 inhibitor is selected from the group comprising palbociclib, also known as PD0332991, abemaciclib, also known as LY-2835219, ribociclib, also known as LEE011, trilaciclib, also known as G1T28, and dinaciclib.

12. The combination for use according to any one of claims 4 and 7 to 11, the adenovirus for use according to any one of claims 5 and 7 to 11 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 11, wherein the pathological tumor or cancer expresses Rb or is Rb positive.

13. The combination for use according to any one of claims 4 and 7 to 12, the adenovirus for use according to any one of claims 5 and 7 to 12 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 12, wherein the cells of the tumor cells are resistant or insensitive to one or more pharma- ceutically active agents and / or radiation.

14. A combination for use according to any one of claims 4 and 7 to 13, an adenovirus for use according to any one of claims 5 and 7 to 13 and a CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 13, wherein the tumor or cancer contains YB-1 in the cell nucleus independent of the cell cycle.

15. The combination for use according to any one of claims 4 and 7 to 14, the adenovirus for use according to any one of claims 5 and 7 to 14 and the CDK4 / 6 inhibitor for use according to any one of claims 6 and 7 to 14, wherein the disease is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer and leukemia.

Images