Optimized protein linkers and methods of use

Abstract

To provide peptide linkers and fusion proteins comprising linkers designed for optimizing the activity of the proteins comprised therein, and methods for using the same, as well as to provide newly designed Cas12a-based cytosine base editors.SOLUTION: The inventors have designed novel linker sequences and optimized domain architectures for Cas12a-based cytosine base editors, which may allow for targeting new sites and / or expanding the repertoire of site-specific base editing tools, and / or which may be appropriate for commercial use. Also provided are methods of modifying nucleic acids using a fusion protein of the invention and / or a polynucleotide encoding the same. These editors can be used for prokaryotic and / or eukaryotic applications including editing genomes of commercially-related crops.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] [Statement regarding electronic filing of sequence listings] A sequence listing in ASCII text format submitted under 37 CFR § 1.821, entitled 1499-6WO_ST25.txt, created on July 17, 2020, and submitted via EFS-Web, with a size of 727,526 bytes, is provided in lieu of a paper copy. This sequence listing is incorporated herein by reference for its disclosure.

[0002] [PRIORITY STATEMENT] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 62 / 876,275, filed July 19, 2019, the entire contents of which are incorporated herein by reference.

[0003] [Field of the Invention] The present invention relates to peptide linkers and fusion proteins comprising linkers designed to optimize the activity of the proteins contained therein, and methods for using the same. The present invention further relates to a newly designed Cas12a-based cytosine base editor. [Background technology]

[0004] Over the past six years, CRISPR-based gene editing tools, especially those based on Cas9, have become increasingly popular. While early tools relied on the ability of Cas9 to generate blunt-ended double-strand breaks in DNA along with double-strand break repair mechanisms such as homologous recombination and non-homologous end joining, more novel methods have been developed that primarily use engineered versions of nucleases as targeting tools for other covalently linked effector proteins. Notably, the first Cas9-based base editor was developed by linking Cas9 to a deaminase domain (see, e.g., Gaudelli et al. Nature 551:464-471 (2017)). The first cytosine base editor was constructed by linking the rat APOBEC1 domain (apolipoprotein B mRNA editing enzyme), which deaminates cytosine to uracil in both RNA and DNA, to the N-terminus of Cas9 using a previously published (Komor et al. Nature 533(7603):420-424(2016)) linker based on the unstructured XTEN protein. To reduce base excision repair activity, a uracil DNA glycosylase inhibitor (UGI) domain was linked to the C-terminus of Cas9. Later versions of the Cas9 cytosine base editor (CBE) doubled the length of both linkers by adding flexible glycine and serine residues and added an additional UGI domain. Recent versions of this base editor have been optimized for use in human cells by improving the codon optimization and nuclear localization signal, and ancestral reconstruction of the deaminase domain.

[0005] Cas12a, also known as Cpf1, is a more recently discovered CRISPR endonuclease that is increasingly being used as a genome editing tool. Cas12a differs from Cas9 in several ways, including, for example, size, nuclease activity, guide RNA structure, the direction in which the nuclease binds to its guide RNA, and the protospacer adjacent motif (PAM) that it recognizes. Although several variations of cytosine base editors based on Cas12a have been tested, they have low activity compared to the versions based on Cas9. Therefore, there is a need for novel adenosine base editing tools that use Cas12a to overcome the shortcomings in the field. Summary of the Invention [Problem to be solved by the invention]

[0006] The current state of the art CRISPR-based cytosine base editors are mainly based on Cas9, and published versions of Cas12a-based cytosine base editors are relatively inefficient compared to Cas9-based versions. Part of this deficiency may be due to the different structure and binding orientation of Cas12a compared to Cas9. Cas9-based cytosine base editors rely on simple GS linkers or previously designed unstructured sequences, whose length and composition are not designed for optimal placement of deaminase and UGI domains compared to the edited DNA. Furthermore, Cas12a-derived base editors have not reached a suitable activity level for commercial use. The inventors have designed novel linker sequences and optimized domain structures for Cas12a-based cytosine base editors, which may enable new site targeting and / or site-specific expansion of the repertoire of base editing tools and / or may be suitable for commercial use. Also provided are methods of modifying nucleic acids using the fusion proteins of the present invention and / or the polynucleotides encoding them. These editors can be used in prokaryotic and / or eukaryotic applications, including genome editing of commercially relevant crops. [Means for solving the problem]

[0007] One aspect of the present invention provides a polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 24 (L1 to L24).

[0008] A second aspect of the present invention provides a polypeptide comprising a Cas12a domain and any one of the amino acid sequences set forth in SEQ ID NOs: 1 to 24.

[0009] A third aspect provides a fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0010] A fourth aspect provides a V-type Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system comprising: (a) a fusion protein comprising a Cas12a domain, a linker comprising an amino acid sequence of any one of SEQ ID NOs: 1-24, and a polypeptide of interest, wherein the Cas12a domain is linked to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24, or a nucleic acid encoding the fusion protein; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA, gRNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein, and the spacer sequence is capable of hybridizing to the target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, thereby enabling the system to modify or modulate the target nucleic acid.

[0011] A fifth aspect of the present invention provides a fusion protein comprising: (a) a Cas12a domain that specifically binds to a target nucleic acid sequence when combined with a bound guide nucleic acid (e.g., gRNA); (b) a cytidine deaminase domain that deaminates cytosine bases in a single-stranded portion of the target nucleic acid sequence when combined with the Cas12a domain and gRNA; and (c) a uracil glycosylase inhibitor (UGI) domain that inhibits uracil-DNA glycosylase, wherein the Cas12a domain is linked to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0012] A sixth aspect provides a fusion protein comprising: (a) a cytosine deaminase domain; (b) a Cas12a domain; and (c) a uracil DNA glycosylase inhibitor (UGI) domain, wherein the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, and the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain, or the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-9, and the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain.

[0013] A seventh aspect provides a fusion protein comprising: (a) a Cas12a (Cpf1) domain; (b) a uracil DNA glycosylase inhibitor (UGI) domain; and (c) a cytosine deaminase domain, wherein the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 10-12, and the C-terminus of the UGI domain is linked to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, wherein the amino acid sequences of SEQ ID NOs: 10-12 and the amino acid sequences of SEQ ID NOs: 13-16 are independently selected.

[0014] An eighth aspect provides a fusion protein comprising: (a) a uracil DNA glycosylase inhibitor (UGI) domain; (b) a Cas12a (Cpf1) domain, wherein the Cas12a domain comprises a mutation within a nuclease active site; and (c) a cytosine deaminase domain, wherein the C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain, or wherein the C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain, and the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20-24.

[0015] A ninth aspect of the invention provides a method of modifying a target nucleic acid, the method comprising contacting the target nucleic acid with (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid; (b) a complex comprising the fusion protein of the invention and a guide nucleic acid; (c) a composition comprising the fusion protein of the invention and a guide nucleic acid; and / or (d) a system of the invention, thereby modifying the target nucleic acid.

[0016] A tenth aspect of the invention provides a method of modifying a target nucleic acid, the method comprising contacting a cellular or cell-free system comprising a target nucleic acid with (a)(i) a polynucleotide encoding a polypeptide or fusion protein of the invention, or an expression cassette or vector comprising same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising same; and / or (b) a nucleic acid construct encoding a complex comprising the fusion protein of the invention and the guide nucleic acid, or an expression cassette or vector comprising same, under conditions such that when the fusion protein is expressed to form a complex with the guide nucleic acid, the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid.

[0017] An eleventh aspect of the invention provides a method of editing a target nucleic acid, the method comprising contacting the target nucleic acid with (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid; (b) a complex comprising the fusion protein of the invention and a guide nucleic acid; (c)(i) a composition comprising the fusion protein of the invention and (ii) a guide nucleic acid; and / or (d)(i) a system of the invention, wherein a cytosine deaminase domain converts a cytosine (C) in the target nucleic acid to thiamine (T), thereby editing the target nucleic acid to generate a (point) mutation.

[0018] A twelfth aspect of the invention provides a method of editing a target nucleic acid, the method comprising contacting a cellular or cell-free system comprising a target nucleic acid with (a)(i) a polynucleotide encoding a fusion protein of the invention, or an expression cassette or vector comprising same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising same; and / or (b) a nucleic acid construct encoding a complex comprising the fusion protein of the invention and the guide nucleic acid, or an expression cassette or vector comprising same, under conditions such that when the fusion protein is expressed to form a complex with the guide nucleic acid, the complex hybridizes to the target nucleic acid, wherein the cytosine deaminase domain converts a cytosine (C) in the target nucleic acid to thiamine (T), thereby editing the target nucleic acid to generate a (point) mutation.

[0019] The present invention further provides constructs, complexes, compositions, expression cassettes, vectors and cells comprising the polypeptides and / or fusion proteins of the invention, and / or polynucleotides and nucleic acid constructs encoding the fusion proteins and complexes of the invention.

[0020] These and other aspects of the invention are set forth in greater detail in the following description of the invention.

[0021] [Brief description of the sequence] SEQ ID NOs: 1 to 24 are amino acid sequences of the present invention that are useful for linking polypeptides. SEQ ID NOs:25-28 are amino acid sequences for exemplary peptide linkers useful for linking polypeptides. SEQ ID NOs: 29 to 45 are examples of amino acid sequences of Cas12a useful in the present invention. SEQ ID NOs: 46 to 47 and 76 to 82 are examples of amino acid sequences of cytosine deaminases useful in the present invention. SEQ ID NO:48 is an exemplary uracil-DNA glycosylase inhibitor (UGI). SEQ ID NOs: 49-72 and 91-107 are examples of fusion proteins. SEQ ID NOs: 83 to 88 are examples of spacer sequences. SEQ ID NO:89 and SEQ ID NO:90 are examples of intron sequences (human and soybean, respectively). [Brief description of the drawings]

[0022] [Figure 1A-C] We provide exemplary domain arrangements of the Cas12a-based cytosine base editors of the present invention that were selected for experimental screening in mammalian cells. For the constructs in Figure 1A (ACU) and Figure 1C (UCA), each linker for APOBEC1 or UGI was tested independently and paired with a control linker (either an 8-residue GS linker, an XTEN linker, or a GS-XTEN-GS linker). For the constructs in Figure 1B (CUA), all combinations of linkers were tested. [Diagram 2] Two Cas12a cytosine base editor designs used as controls are provided. [Diagram 3] FIG. 14 shows the results of C to T editing with EMX1 spacer 1:TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 4]RUNX1 Spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84) C to T editing results. The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Diagram 5] Figure 1 shows the results of C to T editing with RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. No editing data is available for constructs UCA_L2_1, UCA_L2_1R, UCA_L2_4, CUA control or Shanghai Tech control. [Figure 6] Figure 1 shows the results of C to T editing with DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 7] DNMT1 spacer 2: GCTCAGCAGGCACCTGCCTCAGC (SEQ ID NO: 87) C to T editing results. The Y axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. No editing data is available for construct ACU_L1_1. [Figure 8] FIG. 14 shows the results of C to T editing with EMX1 spacer 1:TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 9] RUNX1 spacer 1: Shows the results of C to T editing using AGCCTCACCCCTCTAGCCCTACA (sequence number 84). [Figure 10]Figure 1 shows the results of C to T editing with DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. No editing data is available for constructs ACU_L1_2, ACU_L2_2R. [Figure 11] Figure 1 shows the results of C to T editing with DNMT1 spacer 2: GCTCAGCAGGCACCTGCCTCAGC (SEQ ID NO: 87). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 12] FIG. 14 shows the results of C to T editing with EMX1 spacer 1:TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 13] RUNX1 Spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84) C to T editing results. The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 14] Figure 1 shows the results of C to T editing with RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. (No editing data available for constructs ACU_L1_1, ACU_L1_2, ACU_L1_3, ACU_L1_3R, ACU_L1_5R, CUA_L1_3_L2_1, UCA_L1_1, UCA_L2_1, UCA_L2_1R, and UCA_L2_4). [Figure 15] FIG. 14 shows the results of C to T editing with AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 16] Figure 1 shows the results of C to T editing with DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 17] FIG. 14 shows the results of C to T editing with EMX1 spacer 1:TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 18] RUNX1 Spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84) C to T editing results. The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 19] FIG. 14 shows the results of C to T editing with AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 20] Figure 1 shows the results of C to T editing with DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. No editing data available for construct ACU_L1_2 (A3A). [Figure 21] FIG. 14 shows the results of C to T editing with EMX1 spacer 1:TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 22] FIG. 14 shows the results of C to T editing with AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 23] RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84) C to T editing results. The Y axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. No editing data is available (ND) for construct UC_L2_1 (A3A+intron) and ACU control. [Figure 24] RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85) C to T editing results. The Y axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. No editing data is available for construct UC_L2_4 (ND). [Diagram 25] Figure 1 shows the results of C to T editing with DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86). The Y-axis indicates the level of C to T editing observed for a given cytosine at the indicated position within the spacer. [Figure 26] 1 shows the results of editing three different nucleic acid targets in soybean (Locus 1, Locus 2, Locus 3) using the editor constructs of the invention described in Example 4. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] The present invention is described below with reference to the accompanying drawings and examples in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented or all the features that may be added to the invention. For example, features illustrated with respect to one embodiment may be incorporated in other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, it is contemplated that the present invention may exclude or omit, in some embodiments of the invention, any feature or combination of features shown herein. Moreover, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of this disclosure and do not depart from the invention. Thus, the following description is intended to illustrate some particular embodiments of the invention, and is not intended to exhaustively specify all permutations, combinations, and variations thereof.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the present invention in this specification is for the purpose of describing specific embodiments only and is not intended to be limiting of the present invention.

[0025] All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety for the teachings relevant to the sentence and / or paragraph in which the reference is set forth.

[0026] Unless the context indicates otherwise, it is expressly intended that the various features of the invention described herein can be used in any combination. Moreover, it is also contemplated that in some embodiments of the invention, any feature or combination of features described herein can be excluded or omitted. For example, if the specification states that a composition comprises components A, B, and C, it is expressly intended that any of A, B, or C, or any combination thereof, can be omitted and negated, either alone or in any combination.

[0027] As used in the description of this invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise.

[0028] Also, as used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0029] The term "about" as used herein, when referring to a measurable value, such as an amount or concentration, means to include the specified value as well as a variation of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified value. For example, "about X", where X is a measurable value, means to include X and a variation of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of X. Ranges provided herein for measurable values ​​may include any other ranges and / or individual values ​​therein.

[0030] As used herein, phrases such as "between X and Y" and "between about X and Y" should be interpreted to include X and Y. As used herein, phrases such as "between about X and Y" mean "between about X and about Y," and phrases such as "from about X to Y" mean "from about X to about Y."

[0031] As used in this specification, the terms "comprise", "comprises" and "comprising" specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0032] The transitional phrase "consisting essentially of" as used herein means that the claim should be construed to include the specified materials or steps recited in the claim and which do not materially affect the basic and novel feature(s) of the claimed invention. Thus, the term "consisting essentially of" when used in the claims of the present invention is not intended to be construed as the equivalent of "comprising."

[0033] As used herein, the terms "increase," "increasing," "increased," "enhance," "enhanced," "enhancing," and "enhancement" (and grammatical variations thereof) describe an increase of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more compared to a control.

[0034] As used herein, the terms "reduce," "reduced," "reducing," "reduction," "diminish," and "decrease" (and grammatical variations thereof) describe a reduction of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%, for example, as compared to a control. In certain embodiments, the reduction results in no or essentially no detectable activity or amount (i.e., an insignificant amount, e.g., less than about 10% or even 5%).

[0035] A "heterologous" or "recombinant" nucleotide sequence is a nucleotide sequence that is not naturally associated with a host cell into which it is introduced and includes non-naturally occurring multiple copies of a naturally occurring nucleotide sequence.

[0036] A "native" or "wild-type" nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence. Thus, for example, a "wild-type mRNA" is an mRNA that occurs naturally in an organism or is endogenous to an organism. A "homologous" nucleic acid sequence is a nucleotide sequence that is naturally associated with a host cell into which it is introduced.

[0037] As used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleotide sequence" and "polynucleotide" refer to RNA or DNA, linear or branched, single or double stranded, or hybrids thereof. The terms also encompass RNA / DNA hybrids. When dsRNA is produced synthetically, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for pairing antisense, dsRNA and ribozymes. For example, polynucleotides containing C-5 propyne analogs of uridine and cytidine have been shown to bind RNA with high affinity and are potent antisense inhibitors of gene expression. Other modifications can also be made, such as modifications to the phosphodiester backbone of RNA or the 2'-hydroxy in the ribose sugar group.

[0038] The term "nucleotide sequence" as used herein refers to a heteropolymer of nucleotides or the sequence of these nucleotides from the 5' to 3' end of a nucleic acid molecule, including DNA or RNA molecules, including cDNA, DNA fragments or portions, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA, mRNA, and antisense RNA, any of which may be single-stranded or double-stranded. The terms "nucleotide sequence," "nucleic acid," "nucleic acid molecule," "oligonucleotide," and "polynucleotide" are also used interchangeably herein to refer to a heteropolymer of nucleotides. Nucleic acid molecules and / or nucleotide sequences provided herein are presented herein in the 5' to 3' direction, from left to right, and are represented using the standard code for representing nucleotide symbols as set forth in the United States Sequence Rules, 37 CFR §§ 1.821-1.825 and World Intellectual Property Organization (WIPO) Standard ST.25. As used herein, the "5' region" can refer to the region of a polynucleotide closest to the 5' end of the polynucleotide. Thus, for example, an element in a 5' region of a polynucleotide can be located anywhere from the first nucleotide located at the 5' end of the polynucleotide to a nucleotide located in the middle of the polynucleotide. As used herein, a "3' region" can refer to the region of a polynucleotide that is closest to the 3' end of the polynucleotide. Thus, for example, an element in a 3' region of a polynucleotide can be located anywhere from the first nucleotide located at the 3' end of the polynucleotide to a nucleotide located in the middle of the polynucleotide.

[0039] The term "gene" as used herein refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, miRNA, anti-microRNA antisense oligodeoxyribonucleotide (AMO), and the like. A gene may or may not be capable of being used to produce a functional protein or gene product. A gene may include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences, and / or 5' and 3' untranslated regions). A gene may be "isolated," thereby meaning a nucleic acid that is substantially or essentially free from components that are normally found associated with the nucleic acid in its natural state. Such components include other cellular materials, culture medium from recombinant production, and / or various chemicals used in the chemical synthesis of the nucleic acid.

[0040] By way of example, introns useful in the constructs of the present invention include, but are not limited to, SEQ ID NO:89 or SEQ ID NO:90.

[0041] The term "mutation" refers to point mutations (e.g., missense, or nonsense, or single base pair insertions or deletions resulting in a frameshift), insertions, deletions, and / or truncations. When a mutation is a substitution of a residue in an amino acid sequence with another residue, or a deletion or insertion of one or more residues in a sequence, the mutation is typically described by specifying the original residue followed by the position of that residue in the sequence and the identity of the newly substituted residue.

[0042] The term "complementary" or "complementarity" as used herein refers to the natural binding of polynucleotides by base pairing under permissive salt and temperature conditions. For example, the sequence "AGT" (5' to 3') binds to the complementary sequence "TCA" (3' to 5'). Complementarity between two single-stranded molecules can be "partial," where only a portion of the nucleotides bind, or "complete," where there is total complementarity between the single-stranded molecules. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

[0043] "Complement," as used herein, can mean 100% complementarity with a comparator nucleotide sequence, or it can mean less than 100% complementarity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc. complementarity).

[0044] A "portion" or "fragment" of a nucleotide sequence of the present invention is understood to mean a nucleotide sequence of reduced length (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides reduced) compared to a reference nucleic acid or nucleotide sequence that comprises, consists essentially of, and / or consists of a nucleotide sequence of contiguous nucleotides that are identical or nearly identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment or portion according to the invention may, where appropriate, be comprised within a larger polynucleotide of which it is a component. As an example, the repeat sequence of a guide nucleic acid of the invention may comprise a portion of a wild-type Cas12 repeat sequence.

[0045] The term "fragment" or "portion" as used herein with respect to a polypeptide may refer to a polypeptide that is reduced in length relative to a reference polypeptide and that comprises, consists essentially of, and / or consists of an amino acid sequence of contiguous amino acids that is identical or nearly identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the corresponding portion of the reference polypeptide. Such a polypeptide fragment may, where appropriate, be contained within a larger polypeptide of which it is a component. In some embodiments, a polypeptide fragment comprises, consists essentially of, or consists of at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 260, 270, 280, 290, or more contiguous amino acid residues of a reference polypeptide.

[0046] Different nucleic acids or proteins with homology are referred to herein as "homologs". The term "homologs" includes homologous sequences from the same and other species and orthologous sequences from the same and other species. "Homology" refers to the level of similarity between two or more nucleic acid and / or amino acid sequences in terms of percentage of positional identity (e.g., sequence similarity or identity). Homology also refers to the concept of similar functional properties between different nucleic acids or proteins. Thus, the compositions and methods of the present invention further include homologs to the nucleotide and polypeptide sequences of the present invention. "Orthologs" as used herein refers to homologous nucleotide and / or amino acid sequences in different species that arose from a common ancestral gene during speciation. Homologs of the nucleotide sequences of the present invention have substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) to the above-mentioned nucleotide sequences of the present invention.

[0047] "Sequence identity," as used herein, refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout the window of alignment of the components (eg, nucleotides or amino acids). "Identity" can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology (Lesk, AM, ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM, and Griffin, HG, eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

[0048] The term "percent sequence identity" or "percent identity" as used herein refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, "percent identity" can refer to the percentage of identical amino acids in an amino acid sequence compared to a reference polypeptide.

[0049] The phrase "substantially identical" or "substantial identity" as used herein in the context of two nucleic acid molecules, nucleotide sequences or protein sequences refers to two or more sequences or subsequences that have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence as measured using one of the following sequence comparison algorithms or by visual inspection. In some embodiments of the invention, the substantial identity exists over a region of contiguous nucleotides of the nucleotide sequences of the invention that is about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 25 nucleotides, about 30 nucleotides to about 40 nucleotides, about 50 nucleotides to about 60 nucleotides, about 70 nucleotides to about 80 nucleotides, about 90 nucleotides to about 100 nucleotides, or more nucleotides in length, and any range therein (up to the full length of the sequence). In some embodiments, the nucleotide sequences can be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides). In some embodiments, the substantially identical nucleotide or protein sequence performs substantially the same function as the nucleotide (or encoded protein sequence) to which it is substantially identical.

[0050] For sequence comparison, typically one sequence serves as a reference sequence, to which test sequences are compared.When using sequence comparison algorithm, test and reference sequences are input into computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated.The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) compared to the reference sequence based on the designated program parameters.

[0051] Optimal sequence alignment for aligning a comparison window is well known to those skilled in the art and may be performed by tools such as the Smith and Waterman local homology algorithm, the Needleman and Wunsch homology alignment algorithm, the Pearson and Lipman similarity search method, or by computerized implementations of algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, CA). The "identity fraction" for an aligned segment of a test sequence and a reference sequence is the number of identical elements shared by the two aligned sequences divided by the total number of elements in the reference sequence segment (e.g., the entire reference sequence or a smaller defined portion of the reference sequence). The percent sequence identity is expressed as the identity fraction multiplied by 100. The comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For purposes of the present invention, "percent identity" may be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.

[0052] Two nucleotide sequences may be considered to be substantially complementary if the two sequences hybridize to each other under stringent conditions. In some exemplary embodiments, two nucleotide sequences that are considered to be substantially complementary hybridize to each other under highly stringent conditions.

[0053] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridization are sequence dependent and will vary under different environmental parameters. A comprehensive guide to nucleic acid hybridization can be found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York (1993). In general, highly stringent hybridization and wash conditions are those that meet the thermal melting point (T m ) is chosen to be approximately 5°C lower than

[0054] T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are the T mAn example of stringent hybridization conditions for hybridization of complementary nucleotide sequences with more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide with 1 mg heparin at 42° C., with overnight hybridization. An example of very stringent washing conditions is 0.15 M NaCl at 72° C. for about 15 minutes. An example of stringent washing conditions is a 0.2×SSC wash at 65° C. for 15 minutes (see Sambrook, below, for a description of SSC buffers). Often, a low stringency wash is performed before a high stringency wash to remove background probe signal. An example of a medium stringency wash, for example for a duplex of more than 100 nucleotides, is 1×SSC at 45° C. for 15 minutes. An example of a low stringency wash, for example for duplexes of more than 100 nucleotides, is 4-6×SSC at 40° C. for 15 minutes. For short probes (e.g., about 10-50 nucleotides), stringent conditions typically include a salt concentration of less than about 1.0 M Na ion, typically about 0.01-1.0 M Na ion (or other salts) (pH 7.0-8.3), and a temperature typically at least about 30° C. Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. In general, a signal-to-noise ratio of 2-fold (or higher) than that observed for an unrelated probe in a particular hybridization assay indicates detection of specific hybridization. Nucleotide sequences that do not hybridize to each other under stringent conditions are substantially identical if the proteins they encode are substantially identical. This can occur, for example, when copies of nucleotide sequences are made using the maximum codon degeneracy permitted by the genetic code.

[0055] Any nucleotide sequence, polynucleotide and / or recombinant nucleic acid construct of the present invention can be codon-optimized for expression in any organism of interest. Codon optimization is well known in the art and involves modification of nucleotide sequences for codon usage bias using a species-specific codon usage table. The codon usage table is generated based on sequence analysis of the most highly expressed genes for the organism / species of interest. If the nucleotide sequence is expressed in the nucleus, the codon usage table is generated based on sequence analysis of the most highly expressed nuclear genes for the species of interest. The modification of the nucleotide sequence is determined by comparing the codons present in the native polynucleotide sequence with the species-specific codon usage table. As is understood in the art, codon optimization of a nucleotide sequence results in a nucleotide sequence having less than 100% identity to a native nucleotide sequence (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% and any range or value therein) but encodes a polypeptide having the same function as that encoded by the original, native nucleotide sequence. Thus, in some embodiments of the invention, polynucleotides, nucleic acid constructs, expression cassettes, and / or vectors of the invention (comprising / encoding a polypeptide, fusion protein, complex, e.g., Cas12a, a polypeptide of interest, cytosine deaminase, linker, of the invention) may be codon optimized for expression in a particular species of interest, e.g., a particular plant species, a particular bacterial species, a particular animal species, etc.In some embodiments, codon-optimized polynucleotides, nucleic acid constructs, expression cassettes, and / or vectors of the invention have about 70% to about 99.9% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100%) identity or greater to a polynucleotide, nucleic acid construct, expression cassette, and / or vector of the invention that is not codon-optimized.

[0056] In any of the embodiments described herein, the polynucleotides or nucleic acid constructs of the invention may be operably associated with various promoters and other regulatory elements for expression in an organism of interest and / or cells of an organism of interest. Thus, in some embodiments, an expression cassette or vector comprising a polynucleotide or nucleic acid construct of the invention may further comprise one or more promoters, enhancers, and / or terminators operably linked to one or more of the polynucleotides or nucleic acid constructs.

[0057] By "operably linked" or "operably associated" as used herein, it is meant that the indicated elements are functionally associated with each other, and generally also physically associated. Thus, as used herein, the term "operably linked" or "operably associated" refers to nucleotide sequences on a single nucleic acid molecule that are functionally related. Thus, a first nucleotide sequence operably linked to a second nucleotide sequence refers to a situation in which the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For example, a promoter is operably associated with a nucleotide sequence if the promoter acts to transcribe or express the nucleotide sequence. Those skilled in the art will understand that a control sequence (e.g., a promoter) need not be contiguous with the nucleotide sequence with which it is operably associated, so long as the control sequence functions to direct its expression. Thus, for example, an intervening transcribed but untranslated sequence may be present between the promoter and the nucleotide sequence, and the promoter can still be considered to be "operably linked" to the nucleotide sequence.

[0058] The term "linked" as used herein in reference to a polypeptide refers to the attachment of one polypeptide to another. A polypeptide may be linked to another polypeptide (at the N-terminus or C-terminus) directly (e.g., via a peptide bond) or via a linker.

[0059] The term "linker" is art-recognized and refers to a bond, chemical group, or molecule that links two molecules or moieties, such as two domains of a fusion protein, such as a Cas12a domain and a nucleic acid editing domain (e.g., cytosine deaminase). A linker may consist of a single linking molecule (e.g., an amino acid) or may include more than one linking molecule. In some embodiments, a linker may be an organic molecule, group, polymer, or chemical moiety. In some embodiments, a linker may be an amino acid or peptide linker. In some embodiments, the peptide linker is about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, , 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids in length. In some embodiments, the peptide linker may be a GS linker. In some embodiments, the linker may comprise the amino acid sequence SGGS (SEQ ID NO:25), (GGS)n, or S(GGS)n (one or more repeats of SEQ ID NO:25), where n is 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and any range or value therein). In some embodiments, the linker may comprise the amino acid sequence SGGSGGSGGS (SEQ ID NO:26). In some embodiments, the linker may comprise the amino acid sequence, SGSETPGTSESATPES (SEQ ID NO:27), also referred to as an XTEN linker.In some embodiments, the linker may comprise the amino acid sequence SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO: 28), also referred to as a GS-XTEN-GS linker. In some embodiments, the linker comprises, consists essentially of, or consists of any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0060] A "promoter" is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) that is operably associated with the promoter. The coding sequence controlled or regulated by a promoter may code for a polypeptide and / or a functional RNA. Typically, a "promoter" refers to a nucleotide sequence that contains a binding site for RNA polymerase II and directs the initiation of transcription. Generally, promoters are found 5', or upstream, to the start of the coding region of the corresponding coding sequence. The promoter region may contain other elements that act as regulators of gene expression. These include the TATA box consensus sequence and often the CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50:349). In plants, the CAAT box may be replaced by an AGGA box (Messing et al., (1983) in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227).

[0061] Promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and / or tissue-specific promoters, for example, for use in the preparation of recombinant nucleic acid molecules, such as "synthetic nucleic acid constructs" or "protein-RNA complexes." These various types of promoters are known in the art.

[0062] The choice of promoter may vary depending on the time and space requirements of expression and may vary based on the host cell to be transformed.Promoters for many different organisms are well known in the art.Based on the extensive knowledge existing in the art, suitable promoters can be selected for a specific host organism of interest.Thus, for example, much is known about the upstream promoters of highly constitutively expressed genes in model organisms, and such knowledge can be easily accessed and implemented in other systems as appropriate.

[0063] In some embodiments, the polynucleotides and / or nucleic acid constructs of the invention may be or may be included within an "expression cassette." As used herein, "expression cassette" refers to a recombinant nucleic acid molecule that includes, for example, a nucleic acid construct of the invention (e.g., encoding a complex of the invention (e.g., a fusion protein and a guide nucleic acid of the invention)), where the nucleic acid construct is operably associated with at least a control sequence (e.g., a promoter). Thus, some embodiments of the invention provide expression cassettes designed to express, for example, a nucleic acid construct of the invention.

[0064] An expression cassette containing a nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous to at least one of the other components (e.g., a promoter from a host organism operably linked to a polynucleotide of interest to be expressed in the host organism, where the polynucleotide of interest is from an organism different from the host or is not normally found in association with that promoter). Expression cassettes may also be of natural origin but derived in recombinant form that is useful for heterologous expression.

[0065] The expression cassette may include a transcriptional and / or translational termination region (i.e., a termination region) and / or an enhancer region that is functional in the selected host cell. A variety of transcriptional terminators and / or enhancers are available for use in the expression cassette and are responsible for the termination of transcription and correct mRNA polyadenylation. The termination region and / or enhancer region may be native to the transcriptional initiation region, may be native to the operably linked nucleotide sequence of interest, may be native to the host cell, or may be of another origin (e.g., foreign or heterologous to the promoter, to the nucleotide sequence of interest, to the host, or any combination thereof).

[0066] The expression cassette of the present invention may include a nucleotide sequence encoding a selectable marker that can be used to select transformed host cells. As used herein, a "selectable marker" refers to a nucleotide sequence that, when expressed, confers a distinct phenotype on host cells expressing the marker, such that such transformed cells can be distinguished from those that do not possess the marker. Such a nucleotide sequence may encode either a selectable marker or a screenable marker, depending on whether the marker confers a characteristic that can be selected by chemical means, for example, by using a selection agent (such as an antibiotic), or whether the marker is a simple characteristic that can be identified through observation or testing, for example, by screening (e.g., fluorescence). Many examples of suitable selectable markers are known in the art and can be used in the expression cassettes described herein.

[0067] In addition to expression cassettes, the nucleic acid molecules / constructs and polynucleotide sequences described herein may be used in the context of vectors. The term "vector" refers to a composition for transferring, delivering, or introducing a nucleic acid(s) into a cell. A vector includes a nucleic acid molecule that includes the nucleotide sequence(s) to be transferred, delivered, or introduced. Vectors for use in transforming host organisms are well known in the art. Non-limiting examples of general classes of vectors include, but are not limited to, viral vectors, plasmid vectors, phage vectors, phagemid vectors, cosmid vectors, fosmid vectors, bacteriophages, artificial chromosomes, minicircles, or Agrobacterium binary vectors in double-stranded or single-stranded, linear or circular form, which may or may not be self-transmissible or motile. In some embodiments, viral vectors may include, but are not limited to, retroviral, lentiviral, adenoviral, adeno-associated, or herpes simplex viral vectors. A vector as defined herein can transform a prokaryotic or eukaryotic host by integration into a cell genome or can exist extrachromosomally (e.g., an autonomously replicating plasmid with an origin of replication). Further included is shuttle vector, which means a DNA vehicle capable of replication, naturally or by design, in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotes (e.g., higher plants, mammals, yeast or fungal cells). In some embodiments, the nucleic acid in the vector is under the control of and operably linked to a suitable promoter or other regulatory element for transcription in the host cell. The vector may be a bifunctional expression vector that functions in multiple hosts. In the case of genomic DNA, this may include its own promoter or other regulatory element, and in the case of cDNA, it may be under the control of a suitable promoter or other regulatory element for expression in the host cell. Thus, the polynucleotides and nucleic acid constructs of the present invention, and / or expression cassettes comprising same, may be included in vectors as described herein and known in the art.

[0068] As used herein, "contact," "contacting," "contacted," and grammatical variations thereof refer to placing components of a desired reaction together under appropriate conditions to effect the desired reaction (e.g., transformation, transcriptional regulation, genome editing, nicking, and / or cleavage). Thus, for example, a target nucleic acid can be contacted with a fusion protein of the invention and a guide nucleic acid, thereby modifying the target nucleic acid. In some embodiments, a target DNA can be contacted with a polynucleotide or nucleic acid construct encoding a fusion protein of the invention and a guide nucleic acid under conditions in which the fusion protein is expressed to form a complex with the guide nucleic acid, and the complex hybridizes to the target nucleic acid to modify the target nucleic acid.

[0069] As used herein, "modifying" or "modification" in reference to a target nucleic acid includes editing (e.g., mutating), covalently modifying, exchanging / substituting, deleting, truncating, nicking, and / or transcriptional regulation of the target nucleic acid.

[0070] "Introducing," "introduce," "introduced" (and grammatical variations thereof) in the context of a polynucleotide of interest means presenting a nucleotide sequence of interest (e.g., a polynucleotide, a nucleic acid construct, a complex (e.g., a protein-RNA chimeric complex), and / or a guide nucleic acid) to a host organism or a cell of said organism (e.g., a host cell) in a manner that allows the nucleotide sequence access to the interior of the cell. Thus, for example, a polynucleotide encoding a fusion protein of the invention and a guide nucleic acid can be introduced into a cell of an organism, thereby transforming the cell.

[0071] The term "transformation" as used herein refers to the introduction of heterologous nucleic acid into a cell. The transformation of a cell may be stable or transient. Thus, in some embodiments, the host cell or host organism is stably transformed with a nucleic acid molecule of the present invention. In other embodiments, the host cell or host organism is transiently transformed with a recombinant nucleic acid molecule of the present invention.

[0072] "Transient transformation" in the context of a polynucleotide means that the polynucleotide is introduced into a cell and does not integrate into the genome of the cell.

[0073] By "stably introduce" or "stably introduced" in the context of a polynucleotide introduced into a cell, it is intended that the introduced polynucleotide is stably integrated into the genome of the cell, thus stably transforming the cell with the polynucleotide.

[0074] As used herein, "stable transformation" or "stably transformed" means that a nucleic acid molecule is introduced into a cell and integrated into the genome of the cell. Thus, the integrated nucleic acid molecule can be inherited by its progeny, more specifically, by progeny of multiple successive generations. As used herein, "genome" includes nuclear and plastid genomes, and thus includes, for example, the integration of a nucleic acid into a chloroplast or mitochondrial genome. As used herein, stable transformation can also refer to a transgene that is maintained extrachromosomally, for example, as a minichromosome or plasmid.

[0075] Transient transformation can be detected, for example, by enzyme-linked immunosorbent assay (ELISA) or Western blot, which can detect the presence of peptides or polypeptides encoded by one or more transgenes introduced into the organism. Stable transformation of cells can be detected, for example, by Southern blot hybridization assay of the genomic DNA of the cells with a nucleic acid sequence that specifically hybridizes with the nucleotide sequence of the transgene introduced into the organism (e.g., a plant). Stable transformation of cells can be detected, for example, by Northern blot hybridization assay of the RNA of the cells with a nucleic acid sequence that specifically hybridizes with the nucleotide sequence of the transgene introduced into the host organism. Stable transformation of cells can also be detected by polymerase chain reaction (PCR) or other amplification reactions well known in the art, which result in the amplification of transgene sequences that can be detected according to standard methods, for example, using specific primer sequences that hybridize with the target sequence(s) of the transgene. Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.

[0076] Thus, in some embodiments, the nucleotide sequences, nucleic acid constructs, and / or expression cassettes of the invention may be transiently expressed and / or stably integrated into the genome of a host organism. Thus, in some embodiments, the fusion proteins of the invention or polynucleotides encoding same may be introduced into a cell together with a guide nucleic acid, and thus the DNA is not maintained in the cell.

[0077] The nucleic acid constructs / polynucleotides of the invention can be introduced into cells by any method known to those of skill in the art. In some embodiments of the invention, the transformation of a cell comprises nuclear transformation. In other embodiments, the transformation of a cell comprises plastid transformation (e.g., chloroplast transformation). In further embodiments, the nucleic acid constructs / polynucleotides of the invention can be introduced into cells via conventional breeding techniques.

[0078] Procedures for transforming both eukaryotic and prokaryotic organisms are well known and routine in the art and are described throughout the literature (see, e.g., Jiang et al. 2013. Nat. Biotechnol. 31:233-239; Ran et al. Nature Protocols 8:2281-2308 (2013)).

[0079] Thus, the nucleotide sequence can be introduced into the host organism or its cells by any number of methods well known in the art. The method of the present invention does not depend on a particular method to introduce one or more nucleotide sequences into an organism, only to access the inside of at least one cell of the organism. If more than one nucleotide sequence is introduced, they can be assembled as part of a single nucleic acid construct or as separate nucleic acid constructs, and can be located on the same or different nucleic acid constructs. Thus, the nucleotide sequence can be introduced into the cell of interest in a single transformation event or in separate transformations, or, if relevant, the nucleotide sequence can be incorporated into the plant, for example, as part of a breeding protocol.

[0080] The present invention relates to polypeptides (e.g., SEQ ID NOs: 1-24) that can be used, for example, to link two or more proteins / protein domains. In some embodiments, the polypeptides of the present invention can be about 70%-100% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) identical to any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the present invention provides a polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 1-24 and / or a polynucleotide having 70% to 100% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identity) to a polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, a polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 1-24 may be codon-optimized for expression in an organism.

[0081] The present invention also relates to synthetic fusion proteins comprising these polypeptides. In some embodiments, the present invention provides a polypeptide and a polypeptide of interest comprising any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the polypeptide of interest may be linked at its C-terminus and / or its N-terminus to any one of the amino acid sequences of SEQ ID NOs: 1-24 (which may be C-terminus and / or N-terminus). In some embodiments, the polypeptide of interest may comprise two or more polypeptides of interest (e.g., 2, 3, 4, 5, 6, 7 or more), which may be the same or different, and wherein at least two of the two or more polypeptides of interest may be linked to each other via any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0082] Polypeptides of interest useful according to the present invention include, but are not limited to, deaminase (deamination) activity (e.g., cytosine deaminase, adenine deaminase), nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor (transcription release factor), and the like. The polynucleotide of interest may comprise a polypeptide or protein domain having a nucleotide sequence encoding a polypeptide of interest, a polypeptide or protein domain having a polypeptide sequence encoding a polypeptide of interest, ...

[0083] In some embodiments, the polypeptide of interest is a CRISPR Cas12a polypeptide or Cas12a domain, wherein Cas12a is linked at its C-terminus and / or N-terminus to the C-terminus or N-terminus of any one of the amino acid sequences of SEQ ID NOs: 1-24.

[0084] In some embodiments, a fusion protein is provided that includes Cas12a, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the amino acid sequences of SEQ ID NOs: 1-24 allow for optimal positioning of Cas12a and one or more (e.g., 1, 2, 3, 4, 5, 6, 7 or more) polypeptides of interest (e.g., cytosine deaminase domain, glycosylase inhibitor (e.g., uracil-DNA glycosylase inhibitor (UGI)) with respect to the Cas12a domain. The amino acid sequences of SEQ ID NOs: 1-24 can be used to link Cas12a and the polypeptide(s) of interest in a manner that allows access to single-stranded portions of the non-target strand, e.g., for nucleic acid modification, e.g., base editing.

[0085] In some embodiments, the amino acid sequences of SEQ ID NOs: 1-24 may provide different windows for modification or editing of a nucleic acid when used to link Cas12a to a polypeptide of interest. For example, the amino acid sequences of SEQ ID NOs: 1-24 that link a polypeptide of interest to Cas12a may provide a window for editing or modification of 1 to about 25 nucleotides from the corresponding PAM (protospacer adjacent motif) in a target nucleic acid (e.g., DNA) (e.g., an editing / modification window of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides from the PAM and any range or value therein). In some embodiments, the editing or modification window can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 to about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides from the PAM (e.g., 1-20, 1-15, 1-10, 3-15, 4-10, 5-25, 5-20, 5-15, 5-10, 7-15 nucleotides from the PAM).

[0086] Cas12a is a type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas nuclease. Cas12a differs from the better known type II CRISPR Cas9 nuclease in several ways. For example, Cas9 recognizes a G-rich protospacer-adjacent motif (PAM) (3'-NGG) that is 3' to its guide RNA (gRNA, sgRNA) binding site (protospacer, target nucleic acid, target DNA), whereas Cas12a recognizes a T-rich PAM (5'-ttN, 5'TTTN) that is 5' to the target nucleic acid. In fact, the orientations in which Cas9 and Cas12a bind their guide RNAs are almost opposite with respect to their N- and C-termini. Furthermore, the Cas12a enzyme uses a single guide RNA (gRNA, CRISPR array, crRNA) rather than the dual guide RNAs (sgRNA (e.g., crRNA and tracrRNA)) found in the native Cas9 system, and Cas12a processes its own gRNA. In addition, Cas12a nuclease activity produces protruding DNA double-stranded breaks instead of the blunt ends generated by Cas9 nuclease activity, and Cas12a relies on a single RuvC domain to cleave both DNA strands, whereas Cas9 utilizes the HNH and RuvC domains for cleavage.

[0087] A CRISPR Cas12a polypeptide or CRISPR Cas12a domain useful in the present invention may be any known or later identified Cas12a nuclease (formerly known as Cpf1) (see, e.g., U.S. Patent No. 9,790,490, which is incorporated by reference for the Cpf1 (Cas12a) sequence it discloses). The term "Cas12a", "Cas12a polypeptide" or "Cas12a domain" refers to an RNA-guided nuclease that includes a Cas12a polypeptide, or a fragment thereof, including the guide nucleic acid binding domain of Cas12a and / or an active, inactive, or partially active DNA cleavage domain of Cas12a. In some embodiments, a Cas12a useful in the present invention may include a mutation in the nuclease active site (e.g., the RuvC site of the Cas12a domain). A Cas12a domain or Cas12a polypeptide that has a mutation in its nuclease active site and therefore no longer contains nuclease activity is generally referred to as a deadCas12a (e.g., dCas12a). In some embodiments, a Cas12a domain or Cas12a polypeptide that has a mutation in its nuclease active site may be impaired in activity.

[0088] In some embodiments, the Cas12a domain can include, but is not limited to, the amino acid sequence of any one of SEQ ID NOs: 29-45 (e.g., SEQ ID NOs: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45); or a polynucleotide encoding same. In some embodiments, the fusion protein of the invention can include a Cas12a domain from Lachnospiraceae bacterium ND2006 Cas12a (LbCas12a) (e.g., SEQ ID NO: 29).

[0089] In some embodiments, polynucleotides encoding Cas12a domains may be codon-optimized for expression in an organism. Thus, in some embodiments, the invention provides polynucleotides having at least about 70% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identity) to a polynucleotide encoding an amino acid sequence of any one of SEQ ID NOs: 29-45.

[0090] In some embodiments, a V-type Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) associated (Cas) (CRISPR-Cas) system is provided, the system comprising: (a) a fusion protein comprising a Cas12a domain, a linker comprising any one of the amino acid sequences of SEQ ID NOs: 1-24, and a polypeptide of interest, or a nucleic acid encoding the fusion protein, wherein the Cas12a domain is linked to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein, and the spacer sequence is capable of hybridizing to the target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, thereby enabling the system to modify (e.g., cleave or edit) or modulate (e.g., modulate transcription) the target nucleic acid.

[0091] In some embodiments, a fusion protein is provided comprising Cas12a, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24, wherein the polypeptide of interest is a cytosine deaminase polypeptide or domain.

[0092] In some embodiments, the present invention provides a fusion protein comprising: (a) a Cas12a domain, which specifically binds to a target nucleic acid sequence when combined with a bound guide nucleic acid (e.g., gRNA); (b) a cytidine deaminase domain, which deaminates cytosine bases in a single-stranded portion of the target nucleic acid sequence when combined with the Cas12a domain and gRNA; and (c) a uracil glycosylase inhibitor (UGI) domain, which inhibits uracil-DNA glycosylase, wherein the Cas12a domain is linked to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments, the N-terminus of the Cas12a domain may be linked to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, the C-terminus of the Cas12a domain may be linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-12, the N-terminus of the cytosine deaminase domain may be linked to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, the N-terminus of the Cas12a domain may be linked to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and / or the N-terminus of the cytosine deaminase domain may be linked to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 20-24. In some embodiments, when the N-terminus of the Cas12a domain is linked to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, the C-terminus of the Cas12a domain may be linked to the UGI domain via a GS linker. In some embodiments, when the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-12, the N-terminus of the Cas12a domain may be linked to the cytosine domain via a GS linker. In some embodiments, when the N-terminus of the Cas12a domain is linked to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, the C-terminus of Cas12a may be linked to the cytosine deaminase via a GS linker.In some embodiments, the C-terminus of Cas12a is linked to cytosine deaminase via a GS linker, where the N-terminus of the cytosine deaminase domain is linked to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 20-24. Examples of fusion proteins of the present invention include, but are not limited to, the amino acid sequences of SEQ ID NOs: 49-72.

[0093] In some embodiments, a fusion protein is provided that includes (a) a cytosine deaminase domain; (b) a Cas12a domain; and (c) a uracil DNA glycosylase inhibitor (UGI) domain, wherein the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 1-5, and the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain, or the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6-9, and the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain. In some embodiments, the C-terminus of the Cas12a domain may be linked to the N-terminus of the UGI domain via a GS linker. In some embodiments, the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via a GS linker. In some embodiments, the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via the amino acid sequence of SEQ ID NO: 29. Examples of fusion proteins of the present invention include, but are not limited to, any one of the amino acid sequences of SEQ ID NOs: 64-72.

[0094] In some embodiments, a fusion protein is provided that includes: a) a Cas12a (Cpf1) domain; (b) a uracil DNA glycosylase inhibitor (UGI) domain; and (c) a cytosine deaminase domain, wherein the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 10-12, and the C-terminus of the UGI domain is linked to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 13-16, wherein the amino acid sequences of SEQ ID NOs: 10-12 and 13-16 are independently selected. Exemplary fusion proteins of the present invention include any one of the amino acid sequences of SEQ ID NOs: 58-63.

[0095] In some embodiments, a fusion protein is provided that includes: (a) a uracil DNA glycosylase inhibitor (UGI) domain; (b) a Cas12a (Cpf1) domain, wherein the Cas12a domain comprises a mutation in a nuclease active site; and (c) a cytosine deaminase domain, wherein the C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17-19, and the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20-24. In some embodiments, the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via a GS linker. In some embodiments, the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via the amino acid sequence of SEQ ID NO: 28. In some embodiments, the C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain via a GS linker. Examples of fusion proteins of the present invention include, but are not limited to, any one of the amino acid sequences of SEQ ID NOs: 49-72.

[0096] Cytosine deaminases (or cytidine deaminases) useful according to the present invention may be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Pat. No. 10,167,457 and Thuronyi et al. Nat. Biotechnol. 37:1070-1079 (2019), each of which is incorporated by reference herein for its disclosure of cytosine deaminases). Cytosine deaminases can catalyze the hydrolytic deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. In some embodiments, the deaminase polypeptide or deaminase domain is a cytidine deaminase domain that catalyzes the hydrolytic deamination of cytosine to uracil. In some embodiments, the cytosine deaminase can be a variant of a naturally occurring cytosine deaminase, including but not limited to, primate (eg, human, monkey, chimpanzee, gorilla), dog, cow, rat or mouse. Thus, in some embodiments, cytosine deaminases useful in the present invention may be about 70%-100% identical to a wild-type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a naturally occurring cytosine deaminase, and any range or value therein). In some embodiments, a polynucleotide encoding a cytosine deaminase polypeptide / domain may be codon-optimized for expression in an organism.

[0097] In some embodiments, the cytosine deaminase useful in the present invention may be an apolipoprotein B mRNA editing complex (APOBEC) family deaminase. In some embodiments, the cytosine deaminase may be APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, APOBEC4 deaminase, human activation-induced deaminase (hAID), rAPOBEC1, FERNY, and / or CDA1 (which may be pmCDA1), atCDA1 (e.g., At2g19570), and / or their evolved versions. In some embodiments, the cytosine deaminase may be APOBEC1 deaminase having the amino acid sequence of SEQ ID NO:46. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase having the amino acid sequence of SEQ ID NO: 47. In some embodiments, a cytosine deaminase useful in the invention may be about 70%-100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase.In some embodiments, a cytosine deaminase useful in the invention may be about 70% to 99.5% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47). In some embodiments, a polynucleotide encoding a cytosine deaminase may be codon-optimized for expression in an organism, and the codon-optimized polypeptide may be about 70%-99.5% identical to a reference polynucleotide.

[0098] A "uracil glycosylase inhibitor" useful in the present invention may be any protein capable of inhibiting the uracil-DNA glycosylase base excision repair enzyme. In some embodiments, the UGI domain comprises wild-type UGI or a fragment thereof. In some embodiments, the UGI domain useful in the present invention may be about 70%-100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical and any range or value therein) to the amino acid sequence of a naturally occurring UGI domain. In some embodiments, the UGI domain may comprise the amino acid sequence of SEQ ID NO:48 or a polypeptide having about 70% to 99.5% identity to the amino acid sequence of SEQ ID NO:48 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:48). For example, in some embodiments, the UGI domain may comprise a fragment of the amino acid sequence of SEQ ID NO:48 that is 100% identical to a portion of contiguous nucleotides of the amino acid sequence of SEQ ID NO:48 (e.g., 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 contiguous nucleotides; e.g., about 10, 15, 20, 25, 30, 35, 40, 45, to about 50, 55, 60, 65, 70, 75, 80 contiguous nucleotides). In some embodiments, the UGI domain may be a variant of a known UGI (e.g., SEQ ID NO: 48) having 70% to 99.5% identity to a known UGI (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity, and any range or value therein).In some embodiments, a polynucleotide encoding a UGI may be codon-optimized for expression in an organism, and the codon-optimized polypeptide may be about 70%-99.5% identical to a reference polynucleotide.

[0099] The fusion protein of the present invention comprising a Cas12a domain linked to a polypeptide of interest as described herein can be used in combination with a guide RNA (gRNA, CRISPR array, CRISPR RNA, crRNA) designed to function with the Cas12a domain to modify a target nucleic acid. The guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) useful in the present invention comprises a spacer sequence and a repeat sequence. The guide nucleic acid can form a complex with the Cas12a domain of the fusion protein, and the spacer sequence can hybridize to the target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, where the target nucleic acid is modified (e.g., cleaved or edited) or regulated (e.g., transcriptionally regulated) by the polypeptide of interest of the fusion protein. As an example, a fusion protein comprising a Cas12a domain linked to a cytosine deaminase domain described herein can be used in combination with a Cas12a guide nucleic acid to modify a target nucleic acid, where the cytosine deaminase domain of the fusion protein deaminates cytosine bases in the target nucleic acid, thereby editing the target nucleic acid.

[0100] As used herein, "guide nucleic acid", "guide RNA", "gRNA", "CRISPR RNA / DNA", "crRNA" or "crDNA" refers to a nucleic acid comprising at least one spacer sequence that is complementary to (and hybridizes with) a target DNA (e.g., a protospacer) and at least one repeat sequence (e.g., a repeat of a V-type Cas12a CRISPR-Cas system, or a fragment or portion thereof), where the repeat sequence is linked to the 5' end of the spacer sequence. The design of the gRNA of the present invention is based on the V-type Cas12a CRISPR-Cas system. In some embodiments, the gRNA for Cas12a may comprise, from 5' to 3', a repeat sequence (full length or a portion thereof ("handle"); e.g., a pseudoknot-like structure) and a spacer sequence. In some embodiments, a guide nucleic acid may include more than one repeat sequence-spacer sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more repeat-spacer sequences) (e.g., repeat-spacer-repeat; e.g., repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer, etc.). Guide nucleic acids of the invention may be synthetic, human-made, not found in nature. gRNAs can be quite long and used as aptamers (e.g., in MS2 recruitment strategies) or other RNA structures hanging off the spacer.

[0101] "Repeat sequence" as used herein refers to, for example, any repeat sequence of a wild-type CRISPR Cas12a locus or a repeat sequence of a synthetic crRNA. The repeat sequence useful in the present invention can be any known or later identified repeat sequence of a CRISPR Cas12a locus (V-type), or can be a synthetic repeat designed to function in a V-type CRISPR-Cas system. The repeat sequence may include a hairpin structure and / or a stem-loop structure. In some embodiments, the repeat sequence may form a pseudoknot-like structure at its 5' end (i.e., a "handle"). Thus, in some embodiments, the repeat sequence can be identical or substantially identical (e.g., at least 70% identical) to a repeat sequence from a wild-type V-type CRISPR locus. Repeat sequences from wild-type Cas12a (V-type) CRISPR loci can be determined through validated algorithms, for example using CRISPRfinder provided through CRISPRdb (see Grissa et al. Nucleic Acids Res. 35 (Web Server issue): W52-7). In some embodiments, the repeat sequence or a portion thereof is linked to the 5' end of a spacer sequence, thereby forming a repeat-spacer sequence (e.g., guide RNA, crRNA).

[0102] In some embodiments, the repeat sequence comprises, consists essentially of, or consists of at least 10 nucleotides (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50-100 or more nucleotides, or any range or value therein), depending on the particular repeat and whether or not the guide RNA comprising the repeat is processed. In some embodiments, the repeat sequence comprises, consists essentially of, or consists of about 10 to about 20, about 10 to about 30, about 10 to about 45, about 10 to about 50, about 15 to about 30, about 15 to about 40, about 15 to about 45, about 15 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 40 to about 80, about 50 to about 100, or more nucleotides.

[0103] The repeat sequence linked to the 5' end of the spacer sequence can comprise a portion of the repeat sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more consecutive nucleotides of the wild-type repeat sequence). In some embodiments, the portion of the repeat sequence linked to the 5' end of the spacer sequence can be about 5 to about 10 contiguous nucleotides in length (e.g., about 5, 6, 7, 8, 9, 10 nucleotides) and has at least 90% identity (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the same region (e.g., the 5' end) of the wild-type Cas12a repeat nucleotide sequence. In some embodiments, the portion of the repeat sequence comprises a pseudoknot-like structure (e.g., a "handle") at its 5' end.

[0104] A "spacer sequence" as used herein is a nucleotide sequence that is complementary to a target nucleic acid (e.g., a target DNA) (e.g., a protospacer). A spacer sequence can be fully complementary or substantially complementary to a target nucleic acid (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher)). Thus, in some embodiments, a spacer sequence can have 1, 2, 3, 4, or 5 mismatches compared to a target nucleic acid, and the mismatches can be contiguous or non-contiguous. In some embodiments, the spacer sequence can have 70% complementarity to the target nucleic acid. In other embodiments, the spacer nucleotide sequence can have 80% complementarity to the target nucleic acid. In still other embodiments, the spacer nucleotide sequence can have 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% complementarity, etc., to the target nucleic acid (protospacer). In some embodiments, the spacer sequence is 100% complementary to the target nucleic acid. The spacer sequence can have a length of about 15 nucleotides to about 30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or any range or value therein). Thus, in some embodiments, the spacer sequence may have perfect complementarity or substantial complementarity over a region of the target nucleic acid (e.g., a protospacer) that is at least about 15 nucleotides to about 30 nucleotides in length. In some embodiments, the spacer is about 20 nucleotides in length. In some embodiments, the spacer is about 23 nucleotides in length.

[0105] In some embodiments, the 5' region of the spacer sequence of the guide RNA may be identical to the target DNA, and the 3' region of the spacer may be substantially identical to the target DNA, and thus the overall complementarity of the spacer sequence to the target DNA may be less than 100%. Thus, for example, the first 1, 2, 3, 4, 5, 6, 7, 8, etc. nucleotides in the 5' region of a 20 nucleotide spacer sequence (i.e., the seed region) may be 100% complementary to the target DNA, and the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary (e.g., at least about 70% complementary) to the target DNA. In some embodiments, the first 1 to 8 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8 nucleotides, and any range therein) at the 5' end of the spacer sequence can be 100% complementary to the target DNA, and the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 50% complementary (e.g., 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more)). In some embodiments, the seed region of the spacer may be about 5-6 nucleotides in length. In some embodiments, the seed region of the spacer is 5 nucleotides in length. In some embodiments, the seed region of the spacer is 6 nucleotides in length.

[0106] As used herein, "target nucleic acid", "target DNA", "target nucleotide sequence", "target region" or "target region in genome" refers to a region of an organism's genome that is fully complementary (100% complementary) or substantially complementary (e.g., at least 70% complementary (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher)) to the spacer sequence in the guide RNA of the present invention. Target regions that are useful for the CRISPR-Cas12a system are located immediately 3' to the PAM sequence in the organism's genome. The target region can be selected from any of at least 15 contiguous nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides, etc.) located immediately adjacent to the PAM sequence.

[0107] "Protospacer sequence" refers to a target double-stranded DNA, and in particular to a portion of the target DNA (e.g., or a target region in a genome) that is fully or substantially complementary to (and hybridizes with) the spacer sequence of a CRISPR repeat-spacer sequence (e.g., guide RNA, CRISPR array, crRNA). In the case of the V-type CRISPR-Cas Cas12a system, the protospacer sequence is flanked (immediately adjacent) by a protospacer adjacent motif (PAM). The PAM is located at the 5' end on the non-target strand and at the 3' end of the target strand (see below for an example). JPEG2025020231000002.jpg34166

[0108] Canonical Cas12a PAMs are T-rich. In some embodiments, the canonical Cas12a PAM sequence can be 5'-TTN, 5'-TTTN, or 5'-TTTV. In some embodiments, non-canonical PAMs can be used but may be inefficient.

[0109] Additional PAM sequences can be determined by those skilled in the art through proven experimental and computational methods. Thus, for example, experimental methods include targeting sequences flanked by all possible nucleotide sequences and identifying sequence members that are not subject to targeting, such as through transformation of target plasmid DNA (Esvelt et al. 2013. Nat. Methods 10:1116-1121; Jiang et al. 2013. Nat. Biotechnol. 31:233-239). In some aspects, computational methods can include performing a BLAST search of natural spacers to identify the original target DNA sequence in a bacteriophage or plasmid and aligning these sequences to determine the conserved sequences adjacent to the target sequence (Briner and Barrangou. 2014. Appl. Environ. Microbiol. 80:994-1001; Mojica et al. 2009. Microbiology 155:733-740).

[0110] In some embodiments, complexes and compositions are provided comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or more) fusion proteins of the invention and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or more) guide nucleic acids (e.g., CRISPR RNA / DNA, e.g., crRNA / crDNA). In some embodiments, polynucleotides or nucleic acid constructs are provided that encode the polypeptides, fusion proteins, guide nucleic acids, and / or complexes of the invention. In some embodiments, nucleic acid constructs, expression cassettes and / or vectors are provided that comprise the polynucleotides and / or one or more guide nucleic acids of the invention. In some embodiments, the polynucleotides encoding the fusion proteins of the invention may be encoded on the same or separate polynucleotides, nucleic acid constructs, expression cassettes or vectors that comprise the guide nucleic acids. If the fusion protein is encoded on a polynucleotide, nucleic acid construct, expression cassette or vector separate from that which comprises the guide nucleic acid, the polynucleotide, nucleic acid construct, expression cassette or vector encoding the fusion protein of the invention may be provided (e.g. contacted with the target nucleic acid) before, simultaneously with, or after the guide nucleic acid is provided (e.g. contacted with the target nucleic acid).

[0111] In some embodiments, the polynucleotides, nucleic acid constructs, expression cassettes and / or vectors of the invention may be codon-optimized for expression in an organism. In some embodiments, the optimized polynucleotides, nucleic acid constructs, or expression cassettes of the invention may be about 70%-100% (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) identical to the polynucleotides, nucleic acid constructs or expression cassettes encoding the polypeptides, fusion proteins and complexes of the invention.

[0112] In some embodiments, a cell is provided that comprises one or more polynucleotides, guide nucleic acids, nucleic acid constructs, expression cassettes or vectors of the invention.

[0113] The polypeptides, fusion proteins, guide RNAs, complexes and compositions of the present invention, as well as the polynucleotides / nucleic acid constructs / expression cassettes / vectors encoding same, may be used to modify target nucleic acids and / or their expression.

[0114] In some embodiments, the fusion protein of the invention is a cytosine base editor (ABE) for use in base editing of a target nucleic acid, wherein the fusion protein comprises a Cas12a domain linked to a cytosine deaminase domain.

[0115] In some embodiments, a method of modifying a target nucleic acid is provided, the method comprising contacting the target nucleic acid with (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA); (b) a complex comprising the fusion protein of the invention and a guide nucleic acid; (c) a composition comprising the fusion protein of the invention and a guide nucleic acid; and / or (d) a system of the invention, thereby modifying the target nucleic acid. The target nucleic acid may be contacted with the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0116] In some embodiments, a method of modifying a target nucleic acid is provided, the method comprising contacting the target nucleic acid with a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 and a guide nucleic acid. The target nucleic acid may be contacted with the fusion protein of the invention before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0117] In some embodiments, a method of modifying a target nucleic acid is provided, the method comprising contacting a cellular or cell-free system comprising a target nucleic acid with (a)(i) a polynucleotide encoding a polypeptide of the invention or a fusion protein of the invention, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, and / or an expression cassette or vector comprising the same; and / or (b) a nucleic acid construct encoding a complex comprising the fusion protein of the invention and the guide nucleic acid, and / or an expression cassette or vector comprising the same, under conditions in which the fusion protein is expressed to form a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid. If provided on a separate construct, the target nucleic acid may be contacted with the polynucleotide, nucleic acid construct, expression cassette or vector encoding the fusion protein before, simultaneously with, or after contacting the guide nucleic acid with the target nucleic acid.

[0118] In some embodiments, a method for modifying a target nucleic acid is provided, the method comprising contacting a cellular or cell-free system containing the target nucleic acid with a polynucleotide encoding a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 50-78 or an expression cassette or vector comprising the same, and a guide nucleic acid or an expression cassette or vector comprising the same under conditions in which the fusion protein is expressed to form a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid. If provided on a separate construct, the target nucleic acid may be contacted with the polynucleotide, nucleic acid construct, expression cassette or vector encoding the fusion protein before, simultaneously with, or after contacting the guide nucleic acid with the target nucleic acid.

[0119] In some embodiments, the invention provides a method of editing a target nucleic acid, the method comprising contacting the target nucleic acid with (a)(i) a fusion protein of the invention, and (a)(ii) a guide nucleic acid; (b) a complex comprising the fusion protein of the invention and a guide nucleic acid; (c)(i) a composition comprising the fusion protein of the invention and (ii) a guide nucleic acid; and / or (d)(i) a CRISPR-Cas system of the invention, wherein a cytosine deaminase domain converts a cytosine (C) in the target nucleic acid to a thiamine (T), thereby editing the target nucleic acid to generate a (point) mutation. The target nucleic acid may be contacted with the fusion protein of the invention before, simultaneously with, or after contacting the target nucleic acid with the guide nucleic acid.

[0120] In some embodiments, a method of editing a target nucleic acid is provided, the method comprising contacting the target nucleic acid with a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 and a guide nucleic acid, thereby editing the target nucleic acid. The target nucleic acid may be contacted with the fusion protein of the invention before, simultaneously with, or after contacting the guide nucleic acid with the target nucleic acid.

[0121] In some embodiments, a method of editing a target nucleic acid is provided, comprising contacting a cellular or cell-free system comprising the target nucleic acid with (a)(i) a polynucleotide encoding a fusion protein of the invention, and / or an expression cassette or vector comprising same, and (a)(ii) a guide nucleic acid, and / or an expression cassette or vector comprising (a)(i) and / or (a)(ii); and / or (b) a nucleic acid construct encoding a complex comprising the fusion protein of the invention and the guide nucleic acid, or an expression cassette or vector comprising same, under conditions in which the fusion protein is expressed and forms a complex with the guide nucleic acid, and the complex hybridizes to the target nucleic acid, where the cytosine deaminase domain converts a cytosine (C) in the target nucleic acid to a thiamine (T), thereby editing the target nucleic acid to generate a (point) mutation. If provided on a separate construct, the target nucleic acid may be contacted with the fusion protein before, simultaneously with, or after contacting the guide nucleic acid with the target nucleic acid.

[0122] In some embodiments, a method for editing a target nucleic acid is provided, the method comprising contacting a cellular or cell-free system containing the target nucleic acid with a polynucleotide encoding a fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 or an expression cassette or vector comprising the same, and a guide nucleic acid or an expression cassette or vector comprising the same, under conditions in which the fusion protein is expressed to form a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby editing the target nucleic acid. The polynucleotide encoding the fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 may be present on the same expression cassette or vector as the one comprising the guide nucleic acid. If the polynucleotide encoding the fusion protein comprising any one of the amino acid sequences of SEQ ID NOs: 49-72 is present on a separate expression cassette or vector from the one comprising the guide nucleic acid, the target nucleic acid may be contacted with the expression cassette / vector comprising the fusion protein before, simultaneously with, or after contacting the target nucleic acid with the expression cassette / vector comprising the guide nucleic acid.

[0123] In some embodiments, the present invention provides a method for editing a target domain / polypeptide useful for base editing and can be used in the present invention. As used herein, "cytosine deaminase" and "cytidine deaminase" refer to a polypeptide or a domain thereof that catalyzes or can catalyze cytosine deamination, in that the polypeptide or domain catalyzes or can catalyze the removal of an amine group from a cytosine base. Thus, cytosine deaminase can convert cystosine to thymidine (through a uracil intermediate), resulting in a C to T conversion, or a G to A conversion in the complementary strand in the genome. Thus, in some embodiments, the cytosine deaminase encoded by the polynucleotide of the present invention causes a C to T conversion in the sense (e.g., "+"; template) strand of the target nucleic acid, or a G to A conversion in the antisense (e.g., "-", complementary) strand of the target nucleic acid. In some embodiments, the cytosine deaminase encoded by the polynucleotide of the present invention effects the conversion of a C to a T, G, or A in a complementary strand in a genome.

[0124] Cytosine deaminases useful in the present invention may be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Pat. No. 10,167,457 and Thuronyi et al. Nat. Biotechnol. 37:1070-1079 (2019), each of which is incorporated by reference herein for its disclosure of cytosine deaminases). Cytosine deaminases can catalyze the hydrolytic deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. Thus, in some embodiments, deaminases or deaminase domains useful in the present invention may be cytidine deaminase domains that catalyze the hydrolytic deamination of cytosine to uracil. In some embodiments, the cytosine deaminase can be a variant of a naturally occurring cytosine deaminase, including but not limited to, primate (eg, human, monkey, chimpanzee, gorilla), dog, cow, rat or mouse. Thus, in some embodiments, cytosine deaminases useful in the present invention may be about 70% to about 100% identical to a wild-type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a naturally occurring cytosine deaminase, and any range or value therein).

[0125] In some embodiments, the cytosine deaminase useful in the present invention may be apolipoprotein B mRNA editing complex (APOBEC) family deaminase.In some embodiments, the cytosine deaminase may be APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, APOBEC4 deaminase, human activation-induced deaminase (hAID), rAPOBEC1, FERNY, and / or CDA1 (may be pmCDA1), atCDA1 (e.g., At2g19570), and their evolved versions.In some embodiments, the cytosine deaminase may be APOBEC1 deaminase, and may have the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:79. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase and may have the amino acid sequence of SEQ ID NO: 47. In some embodiments, the cytosine deaminase may be a CDA1 deaminase and may be CDA1 having the amino acid sequence of SEQ ID NO: 76. In some embodiments, the cytosine deaminase may be a FERNY deaminase and may be FERNY having the amino acid sequence of SEQ ID NO: 77 or SEQ ID NO: 80. In some embodiments, the cytosine deaminase may be a hAID deaminase and may be hAID having the amino acid sequence of SEQ ID NO: 81 or SEQ ID NO: 82. In some embodiments, cytosine deaminases useful in the invention can be about 70% to about 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., an "evolved deaminase") (see, e.g., SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:82).In some embodiments, a cytosine deaminase useful in the invention is about 70% to about 99.5% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 162%, 163%, 164%, 165%, 166%, 167%, 168%, 169%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, or SEQ ID NO:82). In some embodiments, the polynucleotide encoding the cytosine deaminase may be codon-optimized for expression in plants, and the codon-optimized polypeptide may be about 70% to 99.5% identical to the reference polynucleotide.

[0126] The fusion proteins and polypeptides of the invention and nucleic acid constructs encoding same, in combination with a guide nucleic acid, can be used to modify a target nucleic acid, including but not limited to, generating a C→T or G→A mutation in a target nucleic acid (including but not limited to a plasmid sequence); generating a C→T or G→A mutation in a coding sequence that changes the amino acid identity; generating a C→T or G→A mutation in a coding sequence that creates a stop codon; generating a C→T or G→A mutation in a coding sequence that disrupts the start codon; generating a point mutation in genomic DNA that disrupts transcription factor binding; generating a point mutation in genomic DNA that disrupts splice sites; and / or other nucleic acid modifications caused by a fusion protein comprising a Cas12a domain fused to another domain (a polypeptide of interest) via any one of the amino acid sequences: SEQ ID NOs: 1-24 (e.g., a peptide linker).

[0127] The fusion proteins and polypeptides of the invention and nucleic acid constructs encoding same may be useful for modifying target nucleic acids in any organism, including, but not limited to, animals, plants, fungi, archaea, or bacteria. Animals may include, but are not limited to, mammals, insects, fish, birds, etc.

[0128] Exemplary mammals in which the present invention may be useful include, but are not limited to, primates (human and non-human, e.g., chimpanzees, baboons, monkeys, gorillas, etc.), cats, dogs, mice, rats, ferrets, gerbils, hamsters, cows, pigs, horses, goats, donkeys, or sheep.

[0129] The target nucleic acid of any plant or plant part can be modified with the fusion proteins and polypeptides of the present invention and the nucleic acid constructs encoding same. Any plant (or grouping of plants into, for example, genera or higher classifications) can be used in the practice of the present invention, including angiosperms, gymnosperms, monocotyledons, dicotyledons, C3, C4, CAM plants, bryophytes, ferns and / or fern ally, microalgae, and / or macroalgae. Plants and / or plant parts useful in the present invention can be plants and / or plant parts of any plant species / variety / cultivar. The term "plant part" as used herein includes, but is not limited to, embryos, pollen, ovules, seeds, leaves, stems, buds, flowers, branches, fruits, grains, ears, cobs, husks, petioles, roots, root tips, anthers, plant cells (including intact plant cells in plants and / or plant parts, plant protoplasts, plant tissues, plant cell tissue cultures, plant calli, plant clumps, etc.). As used herein, "shoot" refers to the part above ground, including leaves and stems. Additionally, as used herein, "plant cell" refers to the structural and physiological unit of a plant, including the cell wall, and may also refer to a protoplast. A plant cell can be in the form of an isolated single cell, or can be a cultured cell, or can be part of a higher organized unit, such as a plant tissue or plant organ.

[0130] The fusion proteins and polypeptides of the invention and nucleic acid constructs encoding same can be used to modify (e.g., base edit, cleave, nick, etc.) target nucleic acids in any plant or plant part. Non-limiting examples of plants useful in the invention include turfgrass (e.g., bluegrass, bentgrass, ryegrass, fescue), feather reed grass, tufted hair grass, miscanthus, arundo, switchgrass, vegetable crops including artichoke, kohlrabi, arugula, leek, asparagus, lettuce (e.g., head, leaf, romaine), malanga, melons (e.g., muskmelon, watermelon, cranberry, honeydew, cantaloupe), brassica crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, collards, kale, Chinese cabbage, bok choy), cardoni, carrot, napa, okra, and the like. , onion, celery, parsley, chickpeas, parsnips, chicory, peppers, potatoes, cucurbits (e.g., cucumbers, zucchini, toadflax, pumpkins, honeydew melons, watermelons, cantaloupes), radishes, dry bulb onions, rutabagas, eggplant, burdock, endive, shallots, endive, garlic, spinach, leeks, toadflax, leafy vegetables, beets (sugar beet and fodder beet), sweet potatoes, chard, horseradish, tomatoes, turnips, and spices;Fruit crops, such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, figs, nuts (e.g. chestnuts, pecans, pistachios, hazelnuts, pistachios, peanuts, walnuts, macadamia nuts, almonds, etc.), citrus fruits (e.g. clementines, kumquats, oranges, grapefruit, tangerines, mandarins, lemons, limes, etc.), blueberries, black raspberries, boysenberries, cranberries, currants, gooseberries, loganberries, raspberries, strawberries, blackberries, grapes (wine and table), avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papayas, and lychees, crop plants such as clover, alfalfa, timothy grass, evening primrose, meadowfoam, corn / maize (field, sweet, popcorn), hops, jojoba, buckwheat, safflower, quinoa, wheat, rice, barley, rye, millet, sorghum, oats, lyco, sorghum, tobacco, kapok, legumes (beans (e.g., green and dry), lentils, peas, soybeans), oil plants (rapeseed, canola, mustard, poppy, olives, sunflowers, coconuts, castor oil plants, cocoa beans, peanuts, oil palm), duckweed, Arabidopsis, fiber plants (cotton, flax, hemp, jute), hemp (e.g., Cannabis sativa, sativa, Cannabis indica, and Cannabis ruderalis), Lauraceae (cinnamon, camphor), or plants, such as coffee, sugar cane, tea, and rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants (e.g. roses, tulips, violets), and trees, such as forest trees (broad-leaved and evergreen trees, e.g. conifers;For example, elm, ash, oak, maple, fir, spruce, cedar, pine, birch, cypress, eucalyptus, willow), as well as shrubs and other seedlings. In some embodiments, the fusion proteins and polypeptides of the invention and nucleic acid constructs encoding same may be used to modify corn, soybean, wheat, canola, rice, tomato, pepper, sunflower, raspberry, blackberry, black raspberry, and / or cherry.

[0131] The present invention further includes a kit or kits for carrying out the methods of the present invention. The kits of the present invention may include reagents, buffers, and instruments for mixing, measuring, selecting, labeling, etc., as well as instructions suitable for modifying the target nucleic acid, etc.

[0132] In some embodiments, the present invention provides kits comprising one or more polypeptides of the invention, one or more fusion proteins of the invention, one or more polynucleotides encoding one or more fusion proteins of the invention, the CRISPR-Cas system of the invention, and / or an expression cassette or vector comprising same, together with optional instructions for their use. In some embodiments, the kit may further comprise a Cas12a guide nucleic acid and / or an expression cassette or vector comprising same. In some embodiments, the guide nucleic acid may be provided on the same expression cassette or vector as the polynucleotide encoding the fusion protein of the invention.

[0133] Thus, in some embodiments, a kit is provided that comprises a nucleic acid construct comprising (a) a polynucleotide encoding a fusion protein provided herein and (b) a promoter driving expression of the polynucleotide of (a). In some embodiments, the kit may further comprise a nucleic acid construct encoding a guide nucleic acid, where the construct comprises a cloning site for cloning a nucleic acid sequence identical or complementary to a target nucleic acid sequence into the backbone of the guide nucleic acid.

[0134] In some embodiments, the kit polypeptide may further comprise one or more nuclear localization signals fused to the fusion protein, or polynucleotides encoding same. In some embodiments, the kit polynucleotide may further encode one or more selectable markers useful for identifying transformants (e.g., nucleic acids encoding antibiotic resistance genes, herbicide resistance genes, etc.). In some embodiments, the polynucleotide may be an mRNA, which may encode one or more introns within the encoded fusion protein.

[0135] The present invention will now be described with reference to the following examples. It should be understood that these examples are not intended to limit the scope of the claimed invention, but rather are intended to be illustrative of specific embodiments. Any variations in the exemplified methods that occur to those skilled in the art are intended to be included within the scope of the present invention. EXAMPLES

[0136] [Example 1.] Several variations of Cas12a-based cytosine base editors have been tested, but they have low activity compared to Cas9-based versions.All tested variants use the same linker set used in Cas9-based cytosine base editors (GS linker, XTEN linker, and GS-XTEN-GS linker), and none of them have been rationally or computationally optimized using structure-based techniques.Therefore, we aim to develop an optimized Cas12a-based cytosine base editor by designing the optimal linker length and sequence for various domain structures based on the ideal arrangement of rAPOBEC1 and UGI domains.

[0137] Initial fusion protein designs were made with Lachnospiraceae bacteria ND2006 Cas12a (LbCas12a) (e.g., SEQ ID NO: 29) due to its lower temperature sensitivity and proven activity in plant cells, however, due to the high level of structural similarity between different Cas12a endonucleases, these designs should extend to Cas12a enzymes from other species (e.g., Acidaminococcus species Cpf1 (AsCpf1), Francisella novicida Cpf1 (FnCpf1) and others, see e.g., SEQ ID NOs: 30-45).

[0138] Using a structure-based approach, we developed several linker sequences designed to allow optimal positioning of the cytosine deaminase domain relative to Cas12a so that it can access the single-stranded portion of the non-target strand for base editing. We also designed linker sequences to ensure that the UGI domain is positioned so that it can bind to uracil DNA glycosylase without interfering with other components of the base editor. Due to the positioning of the ends of Cas12a and the orientation of its guide RNA, the ideal linkers for these positions are significantly different from the current state-of-the-art linkers used in Cas9 CBE and the published version of the CBE based on Cas12a. These linkers were designed to accommodate several possible base editor domain structures, linking the deaminase domain to either end of Cas12a. Exemplary designed linkers are provided in Table 1.

[0139] JPEG2025020231000003.jpg202166

[0140] To test the effectiveness (including length, flexibility, and susceptibility to proteases) of each designed linker sequence, constructs were produced containing each linker sequence for specific configurations in vectors for expression in mammalian cells. The domain arrangements of Cas12a-based cytosine base editors selected for experimental screening are provided in Figures 1A-C, and exemplary sequences produced for testing include SEQ ID NOs: 49-72).

[0141] In the case of constructs with the domain arrangement described in Figure 1A and Figure 1C, the linkers for APOBEC1 and UGI are independent of each other with respect to Cas12a; therefore, they were placed in separate constructs and paired with length-matched control linkers (8 residues of GS, XTEN, or GS-XTEN-GS). For the domain arrangement described in Figure 1C, all combinations of designed linkers are tested, since both linkers potentially affect the position of the deaminase. Two previously tested Cas12a cytosine base editor designs were used as controls (Figure 2).

[0142] After screening in mammalian cells, the most effective linkers for each construct are selected for testing in stable plant transformation (eg, soybean).

[0143] [Example 2.] [Testing HEK293T cells] HEK293T cells (human cell line) were plated in 48-well collagen-coated plates (Corning) in the absence of antibiotics using DMEM medium (Dulbecco's Modified Eagle Medium). At 70-80% confluency, cells were transfected with 1.5 μL of Lipofectamine 3000 (ThermoFisher Scientific) according to the manufacturer's protocol with 750 ng of base editor plasmid and 250 ng of guide RNA plasmid. After 3 days, cells were lysed and DNA was extracted using the MagMax™ DNA extraction kit (Applied Biosystems).

[0144] All constructs listed in Table 1 were tested in a total of four experiments in HEK293T cells as described above. Results for each of the four experiments are provided below in Tables 2-5 and Figures 3-20. The percentages in Tables 2-5 indicate the maximum amount of C to T editing observed at any one base within the indicated spacer.

[0145] In Figures 3-20, constructs are listed on the X-axis, and each bar for a given construct represents editing at a single cytosine within the editing window as described in the figure legend. The Y-axis indicates the level of editing observed for each cytosine within the window. Error bars represent the standard deviation across multiple experiments for the same construct and guide. Where no error bars are shown, only one set of measurements was obtained. Editing efficiency was not determined for certain constructs and spacers noted in the tables as ND = no data.

[0146] The designed linkers (especially the ACU construct) show improved editing efficiency compared to the control construct.

[0147] The spacer sequences are as follows: EMX1 spacer 1: TCATCTGTGCCCCTCCCTCCCTG (SEQ ID NO: 83) RUNX1 spacer 1: AGCCTCACCCCTCTAGCCCTACA (SEQ ID NO: 84) RUNX1 spacer 2: TTCTCCCCTCTGCTGGATACCTC (SEQ ID NO: 85) DNMT1 spacer 1: CCTCACTCCTGCTCGGTGAATTT (SEQ ID NO: 86) DNMT1 spacer 2: GCTCAGCAGGCACCTGCCTCAGC (SEQ ID NO: 87) AAVS1 spacer 1: TCTGTCCCCTCCACCCCACAGTG (SEQ ID NO: 88)

[0148] JPEG2025020231000004.jpg125166

[0149] JPEG2025020231000005.jpg137166

[0150] JPEG2025020231000006.jpg195166

[0151] JPEG2025020231000007.jpg219166

[0152] [Example 3] A subset of designs, along with three control constructs, were further tested as fusions to human A3A, a highly active deaminase previously shown to be capable of efficient cytosine base editing. To stabilize these constructs, an intron was included within the sequence of A3A. Two additional constructs, UCA_L2_2R and UCA_L2_4, were too unstable to be purified as intronless Apobec1 fusions and are therefore shown as fusions with Apobec1 containing an intron within the coding region. For Figures 21-25, the Y-axis indicates the C to T editing efficiency achieved at each of the cytosines indicated by the figure legend, with the constructs listed on the X-axis and each cytosine within the spacer described by a different bar. Where "ND" is indicated, it represents that no data was recovered for the indicated sample and spacer.

[0153] Results for this example are provided below in Table 6 and in Figures 21-25. The percentages in Table 6 indicate the maximum amount of C to T editing observed at any one base in the indicated spacer.

[0154] JPEG2025020231000008.jpg133166

[0155] Example Editor Constructs ACU_L1_5RA3A (HCF version): SEQ ID NO: 91, 93 ACU_L1_5RA3A (soybean version): SEQ ID NO: 92, 94 ACU_L1_2A3A (HCF version): SEQ ID NO: 95, 96 ACU_L1_3RA3A (HCF version): SEQ ID NO: 97, 98 UCA_L2_1A3A (HCF version): SEQ ID NO: 99, 100 CUA control: sequence number 101 ACU control: sequence number 102 Shanghai Tech control: SEQ ID NO: 103 ACU Control A3A (HCF version): SEQ ID NO: 104, 105 UCA_L2_2R (Apobec1+intron): SEQ ID NO: 106 UCA_L2_4 (Apobec1+intron): SEQ ID NO: 107

[0156] [Example 4.] R-SODA Protocol For the rapid stable soybean assay (R-SODA), rehydrated dry soybean explants were infiltrated with Agrobacterium tumefaciens containing a plasmid encoding the appropriate construct and guide cassette within its T-DNA using sonication. The explants were co-cultivated with A. tumefaciens for 4 days and transferred to selection medium. They were cultured on selection medium for 4 weeks and shoots were harvested for screening. Editing in each sampled shoot was assessed using next generation sequencing.

[0157] Three different nucleic acid targets in soybean (Locus 1, Locus 2, Locus 3) were edited using the editor constructs of the invention (ACU_L1_5R (A3A), ACU_L1_5R, ACU_L1_2). The results are shown in FIG.

[0158] The foregoing is illustrative of the present invention and is not to be construed as limiting thereof. The present invention is defined by the following claims, equivalents of which are included herein.

Claims

1. A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 24.

2. The polypeptide of claim 1, further comprising a polypeptide of interest and any one of the amino acid sequences of SEQ ID NOs: 1-24.

3. A polypeptide comprising a Cas12a domain and any one of the amino acid sequences of SEQ ID NOs: 1-24.

4. A fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24.

5. The polypeptide of claim 3 or the fusion protein of claim 4, wherein the Cas12a domain comprises a mutation within a nuclease active site.

6. The fusion protein of claim 4 or 5, wherein the Cas12a domain is linked at its C-terminus and / or its N-terminus to any one of the amino acid sequences of SEQ ID NOs: 1-24.

7. The fusion protein of any one of claims 4 to 6, wherein the C-terminus of the Cas12a domain is linked to the N-terminus of any one of the amino acid sequences of SEQ ID NOs: 1 to 24, and the C-terminus of any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is linked to the N-terminus of the polypeptide of interest.

8. The fusion protein of any one of claims 4 to 6, wherein the N-terminus of the Cas12a domain is linked to the C-terminus of any one of the amino acid sequences of SEQ ID NOs: 1 to 24, and the N-terminus of any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is linked to the C-terminus of the polypeptide of interest.

9. The polypeptide of interest exhibits a deaminase (deamination) activity, a nickase activity, a recombinase activity, a transposase activity, a methylase activity, a glycosylase (DNA glycosylase) activity, a glycosylase inhibitor activity (eg, uracil-DNA glycosylase inhibitor (UGI)).

9. The polypeptide of claim 2 or the fusion protein of any one of claims 4 to 8, comprising at least one polypeptide or protein domain having demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or photolyase activity.

10. 9. The polypeptide of claim 2 or 3 or the fusion protein of any one of claims 4 to 8, wherein the polypeptide of interest comprises a cytosine deaminase domain.

11. 11. The polypeptide of any one of claims 2, 3 or 10, or the fusion protein of any one of claims 4 to 10, wherein the polypeptide of interest comprises a uracil-DNA glycosylase inhibitor (UGI).

12. 12. The polypeptide of claim 10 or 11, or the fusion protein of claim 10 or 11, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

13. A polynucleotide encoding a polypeptide of any one of claims 1 to 3, 5, or 9 to 12, or a fusion protein of any one of claims 4 to 12.

14. 14. The polynucleotide of claim 13, which is codon-optimized for expression in an organism.

15. The polynucleotide of claim 14, wherein the organism is an animal, a plant, a fungus, an archaea, or a bacterium.

16. A complex comprising the fusion protein of any one of claims 4 to 9 and a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA).

17. A complex comprising the fusion protein of any one of claims 10 to 12 and a guide nucleic acid.

18. A nucleic acid construct encoding the complex of claim 16 or 17.

19. A composition comprising a polypeptide of any one of claims 1 to 3, 5 or 9 to 12, or a fusion protein of any one of claims 4 to 12, and a guide nucleic acid.

20. 19. An expression cassette or vector comprising the polynucleotide of any one of claims 13 to 15 or the nucleic acid construct of claim 18.

21. A V-shaped Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system, comprising: (a) a fusion protein comprising a Cas12a domain, a linker comprising any one of the amino acid sequences of SEQ ID NOs: 1-24, and a polypeptide of interest, wherein the Cas12a domain is linked to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24, or a nucleic acid encoding the fusion protein; and (b) a guide nucleic acid comprising a spacer sequence and a repeat sequence; Including, The guide nucleic acid is capable of forming a complex with the Cas12a domain of the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the Cas12a domain and the polypeptide of interest to the target nucleic acid, thereby enabling the system to modify (e.g., cleave or edit) or modulate (e.g., modulate transcription) the target nucleic acid.

22. The system of claim 21 , wherein the Cas12a domain comprises a mutation within a nuclease active site.

23. The system of claim 21 or 22, wherein the Cas12a domain is linked at its C-terminus and / or its N-terminus to any one of the amino acid sequences of SEQ ID NOs: 1-24.

24. 24. The system of any one of claims 21 to 23, wherein the Cas12a domain is linked by its C-terminus to the N-terminus of the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24.

25. 24. The system of any one of claims 21 to 23, wherein the Cas12a domain is linked by its N-terminus to the C-terminus of the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1-24.

26. 26. The system of any one of claims 21 to 25, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)). demethylase activity, transcription activator activity, transcription repressor activity, transcription terminator activity, histone modifying activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or photolyase activity.

27. 27. The system of any one of claims 21 to 26, wherein the target polypeptide comprises a cytosine deaminase domain.

28. 28. The system of any one of claims 21 to 27, The system further comprising a second polypeptide of interest, said second polypeptide of interest being a uracil-DNA glycosylase inhibitor (UGI).

29. 29. The system of claim 27 or 28, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

30. 30. The system of any one of claims 21 to 29, wherein (a) and (b) are contained within one or more expression cassettes and / or vectors.

31. 31. A cell comprising a polynucleotide of any one of claims 13 to 15, a nucleic acid construct of claim 16, an expression cassette or vector of claim 20, or a system of any one of claims 21 to 30.

32. 1. A method for modifying a target nucleic acid, comprising: The target nucleic acid (a)(i) a fusion protein of any one of claims 4 to 12, and (a)(ii) a guide nucleic acid; (b) the complex of claim 16 or 17, and a guide nucleic acid; (c) a composition comprising a fusion protein according to any one of claims 4 to 12 and a guide nucleic acid; and / or (d) a system according to any one of claims 21 to 29 contacting the target nucleic acid with method.

33. 1. A method for modifying a target nucleic acid, comprising: A cell line or a cell-free system containing the target nucleic acid, (a)(i) a polynucleotide encoding a polypeptide of claim 3 or 5 or a fusion protein of any one of claims 4 to 12, or an expression cassette or vector comprising same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising same; and / or (b) a nucleic acid construct encoding the complex of claim 16 or 17, or an expression cassette or vector containing the same. and contacting the guide nucleic acid under conditions in which the fusion protein is expressed to form a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid. method.

34. 1. A method for editing a target nucleic acid, comprising: The target nucleic acid (a)(i) a fusion protein of any one of claims 10 to 12, and (a)(ii) a guide nucleic acid; (b) the conjugate of claim 17; (c) a composition comprising a fusion protein according to any one of claims 10 to 12 and a guide nucleic acid; and / or (d) the system of any one of claims 27 to 29; contacting the wherein the cytosine deaminase domain converts cytosine (C) to thiamine (T) in the target nucleic acid, thereby editing the target nucleic acid to generate a mutation (e.g., a point mutation). method.

35. 1. A method for editing a target nucleic acid, comprising: A cell line or a cell-free system containing the target nucleic acid, (a)(i) a polynucleotide encoding the fusion protein of any one of claims 10 to 12, or an expression cassette or vector comprising same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising same; (b) a nucleic acid construct encoding the complex of claim 17, or an expression cassette or vector comprising same; and / or (c) The system of claim 30. under conditions in which the fusion protein is expressed and forms a complex with the guide nucleic acid, and the complex hybridizes to the target nucleic acid; wherein the cytosine deaminase domain converts cytosine (C) to thiamine (T) in the target nucleic acid, thereby editing the target nucleic acid. method.

36. 36. The method of claim 34 or 35, wherein the point mutation is a C→T transversion in the sense (e.g., "+"; template) strand of the target nucleic acid or a G→A transversion in the antisense (e.g., "-", complementary) strand of the target nucleic acid.

37. (a) a Cas12a domain that specifically binds to a target nucleic acid sequence when combined with an attached guide nucleic acid (e.g., gRNA); (b) a cytidine deaminase domain that, when combined with the Cas12a domain and the gRNA, deaminates cytosine bases in the single-stranded portion of the target nucleic acid sequence; and (c) a uracil glycosylase inhibitor (UGI) domain, which inhibits uracil-DNA glycosylase; A fusion protein comprising: The Cas12a domain is linked to the cytosine deaminase domain or the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 1 to 24; Fusion proteins.

38. 38. The fusion protein of claim 37, The N-terminus of the Cas12a domain is linked to the C-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 1 to 5; The C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6 to 12; The N-terminus of the cytosine deaminase domain is linked to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 13 to 16; The N-terminus of the Cas12a domain is linked to the C-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 17 to 19, and / or The N-terminus of the cytosine deaminase domain is linked to the C-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 20 to 24; Fusion proteins.

39. (a) a cytosine deaminase domain; (b) a Cas12a domain; and (c) a uracil DNA glycosylase inhibitor (UGI) domain; A fusion protein comprising: The C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 1 to 5, and the C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain, or The C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 6 to 9, and the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain. Fusion proteins.

40. (a) Cas12a (Cpf1) domain; (b) a uracil DNA glycosylase inhibitor (UGI) domain; and (c) a cytosine deaminase domain; A fusion protein comprising: The C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via any one of the amino acid sequences of SEQ ID NOs: 10 to 12, and the C-terminus of the UGI domain is linked to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 13 to 16. Fusion proteins.

41. (a) uracil DNA glycosylase inhibitor (UGI) domain; (b) a Cas12a (Cpf1) domain containing a mutation within the nuclease active site; and (c) a cytosine deaminase domain; A fusion protein comprising: The C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain via any one of the amino acid sequences of SEQ ID NOs: 17 to 19, and the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain, or The C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain, and the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via any one of the amino acid sequences of SEQ ID NOs: 20 to 24; Fusion proteins.

42. 42. The fusion protein of any one of claims 37 to 41, wherein the Cas12a domain comprises a mutation within a nuclease active site.

43. 43. The fusion protein of any one of claims 37 to 42, wherein the cytosine deaminase domain is an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.

44. 44. The fusion protein of claim 43, the APOBEC domain is a rat or human APOBEC domain; wherein the rat APOBEC domain may be the amino acid sequence of SEQ ID NO: 46, and / or the APOBEC domain may be the amino acid sequence of SEQ ID NO: 47; Fusion proteins.

45. 45. The fusion protein of any one of claims 39 or 42 to 44, The C-terminus of the Cas12a domain is linked to the N-terminus of the UGI domain via a GS linker, and / or the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via a GS linker; Fusion proteins.

46. 45. The fusion protein of any one of claims 41 to 44, The C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via a GS linker, and / or the C-terminus of the UGI domain is linked to the N-terminus of the Cas12a domain via a GS linker. Fusion proteins.

47. 47. The fusion protein of claim 45 or 46, wherein the GS linker is (GSS)n, S(GGS)n (SEQ ID NO:25), SGGS (SEQ ID NO:25), SGGSGGSGGS (SEQ ID NO:26), SGSETPGTSESATPES (SEQ ID NO:27), and / or SGGSGGSSGSETPGTSESATPESSGGSSGGGS (SEQ ID NO:28).

48. 48. The fusion protein of any one of claims 39, 42-44, or 47, wherein the C-terminus of the cytosine deaminase domain is linked to the N-terminus of the Cas12a domain via the amino acid sequence of SGGSSGGSSGSETPGTSESATPESSGGSSGGS (SEQ ID NO: 28).

49. 48. The fusion protein of any one of claims 41 to 44, or 47, wherein the C-terminus of the Cas12a domain is linked to the N-terminus of the cytosine deaminase domain via the amino acid sequence SGSETPGTSESATPES (SEQ ID NO: 27).

50. A polynucleotide encoding the fusion protein of any one of claims 37 to 49.

51. 51. The polynucleotide of claim 50, which is codon-optimized for expression in an organism.

52. 50. A complex comprising the fusion protein of any one of claims 37 to 49 and a guide nucleic acid.

53. A nucleic acid construct encoding the complex of claim 52.

54. 50. An expression cassette or vector comprising the polynucleotide of claim 48 or 49, or the nucleic acid construct of claim 31.

55. 54. A cell comprising the polynucleotide of claim 50 or 51, or the nucleic acid construct of claim 53, or the expression cassette or vector of claim 54.

56. A composition comprising the fusion protein of any one of claims 37 to 49 and a guide RNA.

57. 1. A method for editing a target nucleic acid, comprising: The target nucleic acid (a)(i) a fusion protein of any one of claims 37 to 49, and (a)(ii) a guide nucleic acid; (b) the complex of claim 2; and / or (c) the composition of claim 56 and contacting the wherein the cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thiamine (T), thereby editing the target nucleic acid to generate a (point) mutation. method.

58. 1. A method for editing a target nucleic acid, comprising: A cell line or a cell-free system containing the target nucleic acid, (a)(i) the polynucleotide of claim 50 or 51 and (a)(ii) a guide nucleic acid, and / or an expression cassette or vector comprising (a)(i) and / or (a)(ii); and / or (b) a nucleic acid construct according to claim 53, or an expression cassette or vector comprising same. under conditions in which the fusion protein is expressed and forms a complex with the guide nucleic acid, and the complex hybridizes to the target nucleic acid; wherein the cytosine deaminase domain converts cytosine (C) in the target nucleic acid to thiamine (T), thereby editing the target nucleic acid to generate a (point) mutation. method.

59. 59. The method of claim 57 or 58, the point mutation is a C→T transversion in the sense (e.g., "+"; template) strand of the target nucleic acid, or a G→A transversion in the antisense (e.g., "-"; complementary) strand of the target nucleic acid; method.

60. 60. The method of claim 58 or 59, wherein the guide nucleic acid comprises a repeat sequence and a spacer sequence 5' to 3', the spacer sequence being 70% to 100% complementary to the target nucleic acid (protospacer).

61. 61. The method of claims 58 to 60, wherein the target nucleic acid is flanked by protospacer adjacent motifs (PAMs).

62. 62. The method of claim 61, wherein the PAM comprises the nucleotide sequence 5'-TTN, 5'-TTTV, or 5'-TTTN.

63. A kit comprising a polypeptide of any one of claims 1 to 3 or a fusion protein of any one of claims 4 to 12 or claims 37 to 49, Optionally, it may include instructions for its use, kit.

64. 52. A kit comprising the polynucleotide of any one of claims 13 to 15, 50 or 51 and / or an expression cassette or vector comprising same, Optionally, it may include instructions for its use, kit.

65. 65. The kit of claim 63 or 64, Further comprising a Cas12a guide nucleic acid and / or an expression cassette or vector containing the same; kit.

66. 66. The kit of claim 65, The guide nucleic acid comprises a cloning site for cloning a nucleic acid sequence identical or complementary to a target nucleic acid sequence into the backbone of the guide nucleic acid. kit.

67. 67. The kit of claims 63 to 66, the polypeptide further comprises one or more nuclear localization signals fused to the fusion protein, or polynucleotides encoding same; kit.

68. 68. The kit of claims 63 to 67, the polynucleotide further encodes one or more selectable markers; kit.

69. 69. The kit of claims 63 to 68, the polynucleotide is an mRNA and encodes one or more introns within the encoded fusion protein; kit.

Images