Composition for improving intestinal bacterial flora and application thereof

Abstract

To provide a novel composition for improving intestinal microbiota.SOLUTION: To solve the above problem, in one aspect, the present disclosure provides the following invention: a composition for improving intestinal bacterial flora, the composition comprising a culture supernatant of mesenchymal stem cells.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to a composition for improving intestinal flora and its application. Specifically, the present disclosure relates to a composition for improving intestinal flora, use of the composition, a method for producing the composition, use of a culture supernatant, and a method for improving intestinal flora. [Background technology]

[0002] In recent years, it has become clear that the intestinal flora plays a very important role in maintaining homeostasis in the human body. There are many genera of bacteria in the intestinal bacteria that are generally called good bacteria, bad bacteria, opportunistic bacteria, etc. As is clear from this fact, it is thought that bacterial genera with various roles exist in balance and contribute to maintaining homeostasis in the body.

[0003] It has been suggested that there is a relationship between this imbalance of intestinal bacteria (dysbiosis) and various diseases such as inflammatory bowel disease, metabolic syndrome, asthma, and cardiovascular disease (https: / / www.jstage.jst.go.jp / article / jspen / 33 / 5 / 33_1099 / _article / -char / ja / ). Therefore, probiotics (https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 071100015 / and https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 071100016 / ), which involve the intake of bacteria that play an important role in maintaining biological homeostasis, such as beneficial bacteria, and prebiotics (https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 061400010 / and https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 061400011 / ), which involve the intake of food ingredients that promote the proliferation of such bacterial genera, are expected to play an important role in the future from the perspective of treating or preventing diseases.

[0004] Mesenchymal stem cells are one of the stem cells present in adults and have the ability to differentiate into mesoderm-derived tissues (e.g., bone, cartilage, blood vessels, cardiac muscle cells, etc.) Examples of mesenchymal stem cells include bone marrow-derived mesenchymal stem cells and adipose tissue-derived mesenchymal stem cells.

[0005] Patent Document 1 discloses an intestinal flora improving agent containing soy isoflavone as an active ingredient, and discloses that a specific effect of the intestinal flora improving agent is to improve the reduced diversity of the intestinal flora.

[0006] Patent Document 2 discloses the following invention: A composition for improving intestinal environment, which contains at least one selected from broccoli and carrot, and exhibits an effect of improving the intestinal environment by adjusting the balance of the intestinal bacterial flora. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] JP 2023-080372 A [Patent Document 2] JP 2023-059641 A [Non-patent literature]

[0008] [Non-Patent Document 1] https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 071100015 / [Non-Patent Document 2] https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 071100016 / [Non-Patent Document 3] https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 061400010 / [Non-Patent Document 4] https: / / bio.nikkeibp.co.jp / atcl / column / 16 / 031700078 / 061400011 / [Non-Patent Document 5] https: / / www.jstage.jst.go.jp / article / jspen / 33 / 5 / 33_1099 / _article / -char / ja / Summary of the Invention [Problem to be solved by the invention]

[0009] As described above, research has been conducted on foods to improve the intestinal flora. The purpose of the present disclosure is to provide a new composition and method for improving the intestinal flora. [Means for solving the problem]

[0010] In one aspect, the present disclosure includes the following inventions for achieving the above object. (Invention 1) A composition for improving intestinal flora, comprising a culture supernatant of mesenchymal stem cells. (Invention 2) The composition of invention 1, further comprising at least one of vitamin C and vitamin D3. (Invention 3) The composition of invention 2, comprising 0.05 mg / g or more of vitamin C. (Invention 4) The composition of invention 2, comprising 4.16 ng / g or more of vitamin D3. (Invention 5) A composition according to any one of Inventions 1 to 4, which is used for oral administration. (Invention 6) 6. The composition of claim 5, wherein the composition is formulated so that the active ingredient can come into contact with gastric fluids. (Invention 7) 7. The composition according to any one of Inventions 1 to 6, wherein the mesenchymal stem cells are derived from adipose tissue. (Invention 8) 1. Use of a culture supernatant of mesenchymal stem cells for improving intestinal flora, the use being in combination with at least one of vitamin C and vitamin D3. (Invention 9) Use of invention 8 for oral administration. (Invention 10) A method for producing a composition for improving intestinal flora, the method comprising: A step of culturing mesenchymal stem cells in a medium to obtain a culture supernatant; formulating the culture supernatant to obtain a composition suitable for administration; A method comprising: (Invention 11) A method according to claim 10, comprising: further comprising at least one of vitamin C and vitamin D3 to obtain a composition suitable for administration; The method further comprises: (Invention 12) 12. The method of invention 10 or 11, wherein the administration is oral administration. (Invention 13) 1. Use of a culture supernatant for producing a composition for improving intestinal flora, wherein the culture supernatant is obtained by culturing mesenchymal stem cells. (Invention 14) 14. The use of claim 13, which is a combination use with at least one of vitamin C and vitamin D3. (Invention 15) 15. Use of invention 13 or 14 for oral administration. (Invention 16) A method for improving intestinal flora, comprising: The method includes administering to a subject in need of improving intestinal flora an effective amount of a composition, The composition comprises a culture supernatant of mesenchymal stem cells. method. (Invention 17) 17. The method of claim 16, wherein the administering step includes administering at least one of vitamin C and vitamin D3. (Invention 18) 18. The method of claim 16 or 17, wherein the administering step comprises oral administration. (Invention 19) A composition for improving skin, comprising a culture supernatant of mesenchymal stem cells. (Invention 20) 20. The composition of claim 19, further comprising vitamin D3. (Invention 21) An anti-inflammatory composition, comprising a culture supernatant of mesenchymal stem cells. (Invention 22) 22. The composition of claim 21, further comprising vitamin D3. (Invention 23) A composition for improving skin, comprising mesenchymal stem cells. (Invention 24) 24. The composition of claim 23, further comprising vitamin D3. (Invention 25) An anti-inflammatory composition, comprising mesenchymal stem cells. (Invention 26) 26. The composition of claim 25, further comprising vitamin D3. Effect of the Invention

[0011] In one aspect, the present invention includes a culture supernatant, which can improve symptoms related to the intestinal flora, skin, and anti-inflammatory properties. [Brief description of the drawings]

[0012] [Figure 1] In one embodiment, changes in the intestinal flora before and after administration of the culture supernatant are shown. [Diagram 2] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. [Diagram 3] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. [Figure 4] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. [Diagram 5] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. [Figure 6] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. [Figure 7] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. [Figure 8] In one embodiment, the changes in gene expression before and after administration of the culture supernatant are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] Hereinafter, specific embodiments for carrying out the present invention will be described. The following description is intended to facilitate understanding of the present invention, and is not intended to limit the scope of the present invention.

[0014] 1.Definition The terms used in this specification are explained below.

[0015] As used herein, the term "intestinal flora" refers to the formation pattern of intestinal bacteria. The formation pattern of intestinal bacteria includes data showing the proportion of each type of bacteria. The data showing the proportion of bacteria is obtained by collecting a portion of stool and analyzing the sample.

[0016] As used herein, the term "effective amount" refers to an amount sufficient to cause an improvement in the intestinal flora. In one embodiment, the improvement of the intestinal flora means at least one of an increase in good bacteria and a decrease in bad bacteria. In another embodiment, the improvement of the intestinal flora means that the expression level of useful genes in intestinal cells (including the large intestine and the small intestine, the same applies below) increases with a statistically significant difference. In yet another embodiment, the improvement of the intestinal flora means that the expression level of harmful genes in intestinal cells decreases with a statistically significant difference.

[0017] As used herein, the term "mesenchymal stem cell" (MSC) refers to one of the stem cells present in an adult body, and is capable of differentiating into mesodermally derived tissues such as bone, cartilage, blood vessels, and cardiomyocytes. Mesenchymal stem cells may be derived from any one or more of the following tissues: adipose tissue, bone marrow, umbilical cord, umbilical cord blood, amniotic membrane, placenta, dental pulp (derived from permanent teeth), dental pulp (derived from milk teeth), and the like.

[0018] As used herein, the term "culture supernatant" refers to a substance obtained directly or indirectly by culturing the above-mentioned mesenchymal stem cells using a liquid medium. An example of a directly obtained substance includes the liquid remaining in the culture vessel immediately after the culture is completed. An example of an indirectly obtained substance refers to a substance obtained by further processing the liquid.

[0019] Examples of further processing may include any one or more of the following: Filtration process Centrifugation to collect exosomes Freeze-drying to convert into powder form After being converted into powder, it is processed into a specific shape (e.g., tablet, pill, etc.) To change into a semi-solid (gel-like) state Add any additional ingredients

[0020] Therefore, the term "culture supernatant" as used herein includes not only liquid but also solid and semi-solid forms.

[0021] The liquid medium is used to obtain the culture supernatant and / or to culture the mesenchymal stem cells. The liquid medium is not particularly limited, and a medium known in the art (e.g., DMEM, F12, RPMI, etc.) can be used. Examples of the liquid medium may include any one or more of the following: mesenchymal stem cell basal medium manufactured by Invitrogen, mesenchymal stem cell basal medium manufactured by Sanko Junyaku, MF medium manufactured by TOYOBO, sf-DOT (registered trademark) manufactured by Biomimetics Sympathies, medium manufactured by Nipro / Cell Science Institute (e.g., product number A2G00P05C+A2G20P1CC), medium manufactured by Kohjin Bio (e.g., product number KBM ADSC-4), etc.

[0022] The liquid medium and the culture supernatant may contain serum and / or may be serum-free. In a preferred embodiment, the liquid medium and the culture supernatant do not contain serum. This makes it possible to avoid the influence of components in serum.

[0023] 2. Composition In one embodiment, the present disclosure relates to a composition for improving intestinal flora, the composition comprising a culture supernatant of mesenchymal stem cells.

[0024] Although the following explanation is not intended to limit the scope of the invention, it is believed that mesenchymal stem cells secrete substances outside the cells, and the effects of these substances lead to improvement of the intestinal flora.

[0025] In another embodiment, the composition may further contain at least one of vitamin C and vitamin D3 in addition to the culture supernatant. For example, at least one of vitamin C and vitamin D3 may be mixed with the culture supernatant (in other words, vitamin D3 is not added to the liquid medium for obtaining the culture supernatant, and / or the concentration of vitamin C is kept below a predetermined concentration). By combining these vitamins with the culture supernatant, the effect of the culture supernatant can be enhanced.

[0026] Vitamin D3 may be active or inactive. Inactive vitamin D3 can typically be converted to active by metabolism. Some forms of administration may reach the intestine without metabolic process. In this case, it is preferable to use active vitamin D3.

[0027] The amount of vitamin C in the composition is not particularly limited. For example, the amount of vitamin C in the composition may be 0.05 mg / g or more (i.e., when the total weight of the composition is 1 g, the composition contains 0.05 mg or more of vitamin C).

[0028] Similarly, the amount of vitamin D3 in the composition is not particularly limited.For example, the amount of vitamin D3 in the composition may be 4.16ng / g (10 picomoles / g) or more (i.e., when the weight of the entire composition is 1g, the composition contains 4.16ng or more (10 picomoles or more) of vitamin D3).Preferably, the amount of vitamin D3 in the composition may be 41.6ng / g or more (100 picomoles / g or more), more preferably 416ng / g or more (1 nanomole / g or more).

[0029] The composition may be an aerosol, liquid, solid, or semi-solid.

[0030] In the case of liquids, they may be in the form of syrups, emulsions, suspensions, etc. In addition, in the case of liquids, they may be stored in vials, drip bags, pre-filled syringes, etc. In the case of solids, they may be in the form of tablets, pills, capsules, powders, granules, suppositories, etc.

[0031] In a preferred embodiment, when the active ingredient is a solid, it may not be covered by a capsule, coating, or the like.

[0032] In another preferred embodiment, or in a more preferred embodiment, the composition may be formulated such that the active ingredient can be contacted with gastric fluids, and the active ingredient of the composition can maintain its efficacy even in the presence of gastric fluids (e.g., gastric acid).

[0033] This offers the advantage of simplifying the composition (eg, no capsules, coatings, etc. to protect against stomach acid are required).

[0034] The composition may include other ingredients. Examples of other ingredients may include any one or more of the following: pH adjuster (e.g., phosphate buffer, Tris buffer, etc.) Inorganic salts (e.g., sodium chloride, potassium chloride, etc.) Sugars (e.g., lactose, sucrose, etc.) Excipients (e.g., water, purified water, alcohol, glycerin, lactose, starch, dextrin, white sugar, precipitated silica, etc.)

[0035] 3. Manufacturing method In one embodiment, the present disclosure relates to a method for producing a composition for improving gut microbiota, the method comprising the steps of: A process of culturing mesenchymal stem cells in a medium to obtain a culture supernatant Formulating the culture supernatant to obtain a composition suitable for administration.

[0036] The culture conditions are not particularly limited and may be any conditions known in the art. For example, the temperature may be 35°C to 40°C, typically 37°C. The incubator may be appropriately controlled so that CO2 is 5%. The culture period is not particularly limited, but it is preferable to culture for at least 24 hours, preferably 48 hours or more. The upper limit is not particularly limited, but is 168 hours or less.

[0037] The type of medium is not particularly limited, and the above-mentioned media can be used appropriately.

[0038] After the culture is completed, the supernatant in the culture vessel may be aspirated and collected. Alternatively, the contents of the culture vessel may be transferred to another vessel and centrifuged, and the supernatant may be aspirated and collected. This supernatant may then be regarded as the culture supernatant.

[0039] The culture supernatant is then mixed to obtain a composition suitable for administration. The procedures required for this purpose are not particularly limited and may be carried out appropriately depending on the final form of the composition.

[0040] For example, the treatment described above in the explanation of the term "culture supernatant" may be carried out.

[0041] In addition to the above-mentioned processes, for example, a process of forming into a specific shape may be carried out.

[0042] In a preferred embodiment, the method may further comprise the step of formulating at least one of Vitamin C and Vitamin D3 to obtain a composition suitable for administration.

[0043] For example, when the culture supernatant is liquid, at least one of vitamin C and vitamin D3 in powder form or liquid form may be mixed with the liquid of the culture supernatant.For example, when the culture supernatant is solid, it may be dissolved in liquid, and then at least one of vitamin C and vitamin D3 in powder form or liquid form may be mixed with the liquid of the culture supernatant.Alternatively, when the culture supernatant is solid, it may be processed into powder form, and at least one of vitamin C and vitamin D3 in powder form may be mixed with the powder of the culture supernatant.

[0044] Other ingredients may be added in a similar manner.

[0045] In another embodiment, the present disclosure relates to use of the culture supernatant for producing a composition for improving intestinal microflora. The production method may be the above-mentioned production method.

[0046] The culture supernatant may also be used in combination with at least one of vitamin C and vitamin D3.

[0047] 4. Method of using the composition In one embodiment, the present disclosure relates to the use of a culture supernatant of mesenchymal stem cells for improving gut microbiota, wherein the use is in combination with at least one of vitamin C and vitamin D3.

[0048] An example of the use of the combination includes administering a composition containing the culture supernatant of mesenchymal stem cells separately from at least one of vitamin C and vitamin D3. The timing of administration may be simultaneous or different. However, if the time difference is too large, the combined effect of the culture supernatant and the vitamin is reduced. Therefore, preferably, the time difference may be within 1 hour, within 30 minutes, or within 15 minutes.

[0049] In another embodiment, the present invention relates to a method for improving intestinal flora, comprising administering to a subject in need of improving intestinal flora an effective amount of a composition, wherein the composition comprises a culture supernatant of mesenchymal stem cells.

[0050] In a preferred embodiment, the step of administering includes administering at least one of vitamin C and vitamin D3. In this case, the above-mentioned mesenchymal stem cell culture supernatant and at least one of vitamin C and vitamin D3 may be contained in the same composition. Alternatively, both may be contained in separate compositions.

[0051] The subject to which the composition is administered is not particularly limited, and may be a human or an animal (e.g., a mammal other than a human). Typically, the subject to which the composition is administered is a human. The subject to which the composition is administered may be healthy or may be suffering from a disease. Preferably, the subject to which the composition is administered is one whose intestinal flora has room for improvement (e.g., a certain proportion of bad bacteria is present).

[0052] The amount of vitamin C administered is not particularly limited. For example, the daily dosage may be 0.1 g / kg or more (i.e., 0.1 g is administered per kg of body weight), and preferably 0.2 g / kg or more. The upper limit is not particularly limited. However, for example, the daily dosage may be 1.0 g / kg or less. On the other hand, the daily dosage of vitamin D3 must be 100 μg or less.

[0053] The above-mentioned dosage refers to the total dosage per day. Therefore, the number of times of administration per day may be one or may be divided into several times. For example, the number of times of administration per day may be two, three, four or more.

[0054] The administration period is not particularly limited. The administration period may be within a range defined by two selected from 1 day, 3 days, 7 days, 30 days, 90 days, 120 days, 180 days, 200 days, and 365 days (for example, 1 day to 90 days, 90 days to 180 days, etc.).

[0055] The administration form is not particularly limited, and may be systemic administration or local administration. The administration route is not particularly limited, and may be, for example, any one or more of the following routes: oral administration, inhalation administration, anal administration, subcutaneous injection, intravenous injection, intramuscular injection, drip infusion, application to the skin, spraying to the skin, etc. In a preferred embodiment, the administration route is preferably oral administration. This is because no special equipment or facilities are required for administration.

[0056] 5. Other uses of the composition, etc. The aspects of the invention including the above-mentioned embodiments are all inventions with the purpose related to the improvement of the intestinal flora. However, in another aspect, the present disclosure also includes inventions other than the invention with the purpose related to the improvement of the intestinal flora. For example, in one embodiment, the present disclosure also includes inventions with the purpose related to anti-inflammation. In another embodiment, the present disclosure also includes inventions with the purpose related to the improvement of the skin condition. Therefore, in another aspect, the object of the present disclosure is to provide a new composition and method for suppressing anti-inflammation and / or improving the skin condition. In yet another aspect, the object of the present disclosure is to provide a new use of the combination of the culture supernatant of mesenchymal stem cells and vitamin D3. The contents of "1. Definition" to "4. Method of using the composition, etc." described above are also applicable to inventions with the purpose related to anti-inflammation and inventions with the purpose related to the improvement of the skin condition.

[0057] Thus, in one embodiment, the present disclosure relates to a composition for improving skin, use of the composition, a method for producing the composition, use of the culture supernatant and / or mesenchymal stem cells for producing the composition, and a method for improving skin using the composition. In another embodiment, the present disclosure relates to a composition for anti-inflammation, use of the composition, a method for producing the composition, use of the culture supernatant and / or mesenchymal stem cells for producing the composition, and a method for anti-inflammation using the composition.

[0058] In addition, unlike the above-mentioned inventions aimed at improving the intestinal flora, the inventions aimed at anti-inflammation and the inventions aimed at improving the skin condition include not only culture supernatants but also mesenchymal stem cell inventions. As described above, the fact that an effect can be obtained by administering a culture supernatant means that a similar effect can be expected by administering mesenchymal stem cells. In the inventions aimed at anti-inflammation and the inventions aimed at improving the skin condition, cells can be administered to the target tissue by means of direct administration of cells to the skin, administration of cells via a catheter, etc.

[0059] In another aspect, the present disclosure relates to a composition for enhancing expression of a specific gene in a specific tissue or cell, use of the composition, a method for producing the composition, use of a culture supernatant and / or mesenchymal stem cells for producing the composition, and a method for enhancing expression of a gene using the composition. Examples of specific tissues or cells include intestines (including, for example, small intestine, large intestine, etc.), skin, macrophages, etc. Examples of genes to be enhanced in expression include any one or more of the following: CAMP, DEFB1, LCN2, LYZ, Filaggrin, and IL-10. EXAMPLES

[0060] In order to facilitate understanding of the above-described embodiment, further specific examples are described below. As with the above-described embodiment, the following examples are not intended to limit the scope of the invention.

[0061] Example 1. Preparation of culture supernatant First, we prepared mesenchymal stem cells. Specifically, we used adipose tissue-derived mesenchymal stem cells (AD-CM) and umbilical cord tissue-derived mesenchymal stem cells (UC-CM).

[0062] Example 1-1. Preparation of mesenchymal stem cells derived from adipose tissue Subcutaneous adipose tissue was isolated from patients who were scheduled to undergo regenerative medicine using adipose tissue-derived mesenchymal stem cells. The subcutaneous adipose tissue was used as the raw material for the preparation of cells for administration. The remaining portion of the subcutaneous adipose tissue was used for primary culture. In addition, consent for research use was obtained from the patients in advance.

[0063] The subcutaneous adipose tissue was subjected to centrifugation (400×g for 5 minutes) and separated into three layers. Specifically, the tissue was separated into three layers, namely, a lipid fraction, an adipose tissue fraction, and an aqueous fraction, from the top. The middle layer of the adipose tissue fraction was left, and the top and bottom layers were discarded. A 0.15% collagenase enzyme solution was added to the remaining adipose tissue fraction in an amount of 4 times the tissue weight. The tissue was permeated at 37°C for 1 hour and subjected to enzyme treatment. After the adipose tissue was dispersed by the enzyme treatment, the adipose tissue was subjected to centrifugation (400×g for 5 minutes). The precipitated fraction was suspended in 30 mL of PBS(-) solution as a stromal vascular cell fraction containing mesenchymal stem cells. The suspension was then passed through a cell strainer (mesh size 70 μm diameter), and tissue residues captured by the cell strainer were discarded. The flow-through fraction was then centrifuged again (400×g for 5 min), and the precipitated fraction was suspended in 6 mL of serum-free culture medium sf-DOT (Biomimetics Sympathies, Inc.). The entire cell suspension was seeded in a T25 flask (CellBIND; Corning, 3289) and placed in an incubator (37°C, 5% CO2) to initiate primary culture.

[0064] The medium was replaced once every three days. The supernatant was discarded, and the cells growing on the bottom of the flask were selectively grown. 2 mL of enzyme solution (TrypLE Express; Thermo Fisher Scientific, 12604021) was added to the cells in the T-25 flask that had grown to semi-confluence, and the cells were detached from the bottom of the flask (37°C, left to stand for 5 minutes). The cells were diluted with PBS(-) and centrifuged (400×g for 5 minutes). The precipitated cells were suspended in sf-DOT culture medium, and a portion was taken and the cell count was measured using the trypan blue staining method. The cells suspended in sf-DOT were seeded in a new T75 flask (CellBIND; Corning, 3290) and left to stand in an incubator (37°C, 5% CO2) for subculture (P0→P1). Subculture was then performed using the same procedure to obtain the required number of cells (P1→P2).

[0065] Example 1-2. Preparation of mesenchymal stem cells derived from umbilical cord tissue First, consent for research use of the umbilical cord was obtained from the expectant mother in advance. After delivery, the umbilical cord was washed with PBS(-) and cut into pieces of about 3 mm with a scalpel. A 0.15% collagenase enzyme solution was added in an amount four times the tissue weight. The tissue was permeated at 37°C for 2 hours and enzyme treatment was performed. After the umbilical cord tissue was dispersed by enzyme treatment, the tissue was subjected to centrifugation (400×g for 5 minutes). The precipitated fraction was suspended in 30 mL of PBS(-) solution as the interstitial vascular cell fraction containing mesenchymal stem cells. The suspension was then passed through a cell strainer (mesh size 70 μm diameter), and tissue residues captured by the cell strainer were discarded. The passed fraction was then subjected to centrifugation again (400×g for 5 minutes), and the precipitated fraction was suspended in 12 mL of serum-free culture medium sf-DOT (Biomimetics Sympathies, Inc.). The entire cell suspension was seeded into a T75 flask (CellBIND; Corning, 3290) and placed in an incubator (37° C., 5% CO 2 ) to initiate primary culture.

[0066] The medium was replaced once every three days. The supernatant was discarded, and the cells growing on the bottom of the flask were selectively grown. 2 mL of enzyme solution (TrypLE Express; Thermo Fisher Scientific, 12604021) was added to the cells in the T-25 flask that had grown to semi-confluence, and the cells were detached from the bottom of the flask (37°C, left to stand for 5 minutes). The cells were diluted with PBS(-) and centrifuged (400×g for 5 minutes). The precipitated cells were suspended in sf-DOT culture medium, and a portion was taken and the cell count was measured using the trypan blue staining method. The cells suspended in sf-DOT were seeded in a new T75 flask (CellBIND; Corning, 3290) and left to stand in an incubator (37°C, 5% CO2) for subculture (P0→P1). Subculture was then performed using the same procedure to obtain the required number of cells (P1→P2).

[0067] Example 1-3. Preparation of culture supernatant First, adipose tissue- or umbilical cord tissue-derived mesenchymal stem cells were cultured in sf-DOT as described above. Adipose tissue- or umbilical cord tissue-derived mesenchymal stem cells were cultured in the same medium at 6000 cells / cm per T75 flask. 2 On the fourth day, the culture supernatant was collected.

[0068] The collected culture supernatant was filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan). The filtered culture supernatant was frozen and stored at -20°C or below until use in analysis.

[0069] Example 2. Improvement of intestinal flora by oral intake On the first day, feces were collected from an adult male. The adult male administered the culture supernatant under the following conditions: Culture supernatant to be administered: Culture supernatant of mesenchymal stem cells derived from adipose tissue Amount to take: 10mL When to take: Before bedtime Number of times to take: 4 times (first day, 2 days later, 4 days later, and 6 days later)

[0070] Seven days later, stool samples were collected from the adult males and sent to a laboratory for bacterial flora testing.

[0071] The results are shown in Figure 1. There was a significant change in the abundance of at least three types of bacteria. The first type is the Ruminococcus genus. If this type of bacteria increases, it may cause heart disease, diabetes, cerebral infarction, etc. After taking the culture supernatant, a decrease in the Ruminococcus genus bacteria was observed.

[0072] The second type of bacteria is the Bifidobacterium genus, which is known as a good bacteria and contributes to anti-inflammatory properties.

[0073] The third type of bacteria is the Bacteroides genus. This type of bacteria is one of the bacteria that cause opportunistic infections. The increase or decrease in its population does not have a significant impact on health.

[0074] The results in Figure 1 show that bad bacteria (Ruminococcus bacteria) decreased and good bacteria (Bacteroides bacteria) increased.

[0075] Example 3. Induction of antimicrobial peptide expression by culture supernatant Example 3-1. Treatment of cell lines with culture supernatant and cell recovery A rectal cancer cell line, HT-29, was prepared. The cell line was obtained from ATCC (ATCC number HTB-38, https: / / www.atcc.org / products / htb-38). 1.0 × 10 5 cells / cm 2 The medium used was McCoy's 5A (Merck Sigma: Catalog No. M4892) + FBS (10%) (Merck Sigma: Catalog No. F7524). The cells were placed in an incubator (37°C, 5% CO2) for subculture.

[0076] The medium was replaced 24 hours after seeding. After replacement, the HT-29 line was incubated with the culture supernatant (culture supernatant of adipose tissue-derived mesenchymal stem cells and culture supernatant of umbilical cord tissue-derived mesenchymal stem cells). As a control, the medium (sf-DOT) used for culturing adipose tissue- and umbilical cord tissue-derived mesenchymal stem cells was used. Therefore, there is nothing special in the medium for mesenchymal stem cells, and it is possible to discuss only the importance of factors secreted from stem cells. After 24 hours of culture, total RNA was extracted from HT-29 using the ReliaPrep RNA Miniprep system (Promega, Z6012).

[0077] Example 3-2. Expression analysis method After RNA extraction, cDNA synthesis (PrimeScript RT Master Mix; Takara, RR036A) was performed using 500 ng of RNA, followed by quantitative PCR (Thunderbird Sybr qPCR Mix; TOYOBO, QPS-201X5).

[0078] A mixture for cDNA synthesis was prepared according to the following composition. 5xPrimeScript RT Master Mix 2μl (1x final concentration) Total RNA 500ng RNase free H2O Adjust to 10μl in total

[0079] The above mixture was treated under the following conditions using a Veriti 96 well Thermal Cycler from Applied Biosystems. 37℃ 15 minutes ↓ 85℃ 5 seconds ↓ 4℃∞

[0080] The synthesized cDNA (10 μl) was diluted 10-fold with 90 μl of TE (10 mM Tris-HCl pH 8.0 + 1 mM EDTA pH 8.0), and the diluted solution was subjected to quantitative PCR.

[0081] More specifically, the dilutions were mixed under the following conditions: 2×THUNDERBIRD Probe qPCR Mix 10μl 5mM Forward Primer 0.4μl 5mM Reverse Primer 0.4μl H2O 8.2μl cDNA (10x dilution) 1μl

[0082] The PCR cycle conditions were as follows: 1. 95℃ 1 minute (initial denaturation) 2.95℃ 15 seconds (denaturation) 3.60℃ 30 seconds (extension) (Steps 2 and 3 were repeated 40 times, and a fluorescent signal was detected each time step 3 was completed.) 4. The temperature was increased from 65℃ to 95℃ in 0.5℃ increments, and the temperature was held for 5 seconds each time before detecting the fluorescent signal.

[0083] Using the above cycles, PCR products were detected, and the uniformity of the PCR products was confirmed by a melting curve.

[0084] As an internal control (a housekeeping gene with equal expression in all cells and conditions), GAPDH ( G Lycer a ldehyde 3- p Phosphate d e h ydrogenase) was used. The primer sequences for detecting each gene were as follows: GAPDH Forward primer: 5' - AGCCACATCGCTCAGACAC - 3' GAPDH Reverse primer: 5' - GCCTAATACGACCAAATCC - 3' CAMP Forward primer: 5' - TGGTGAAGCGGTGTATGG - 3' CAMP Reverse primer: 5' - GCAGGGCAAATCTCTTGTTATC - 3' DEFB1 Forward primer: 5' - CTTCCTACCTTCTGCTGTTTACTC - 3' DEFB1 Reverse primer: 5' - CACTGCTGACGCAATTGTAATG - 3' LCN2 Forward primer: 5' - GGAGCTGACTTCGGAACTAAAG - 3' LCN2 Reverse primer: 5' - CGTCGATACACTGGTCGATTG - 3' LYZ Forward primer: 5' - AATAGCCGCTACTGGTGTAATG - 3' LYZ Reverse primer: 5' - ATCACGGACAACCCTCTTTG - 3' Filaggrin Forward Primer: 5' - TCAGACTCTAGTACCGCTAAGG - 3' Filaggrin Reverse Primer: 3' - ACTGCCACGTGACTGTATTC - 3' IL-10 Forward Primer: 5' - TACGGCGCTGTCATCGATTT - 3' IL-10 Reverse Primer: 3' - TAGAGTCGCCACCCTGATGT - 3'

[0085] The abbreviations for some of the genes given above stand for the following: CAMP: Cathelicidin Antimicrobial Peptide, LL37 DEFB1: Defensin Beta 1 LCN2: Lipocalin 2 LYZ: Lysozyme

[0086] All primers were purchased from FASMAC Co., Ltd. (reverse-phase column purification grade). The expression level of each gene is shown by standardizing the expression level of each gene obtained by quantitative PCR by dividing it by the expression level of GAPDH. Furthermore, the expression level under control conditions in which the supernatant was not treated was standardized to "1". The melting curve confirmed that all PCR products amplified using the above primers were single (i.e., multiple types of sequences were not amplified with the same primers).

[0087] Example 3-3. Expression analysis results The results are shown in Figure 2. Compared to samples not treated with culture supernatant (samples shown as Control in Figure 2), significant increases in the expression of various genes were confirmed in samples treated with culture supernatant. In particular, expression was markedly increased in the culture supernatant of mesenchymal stem cells derived from adipose tissue.

[0088] Example 4. Induction of antimicrobial peptide expression by culture supernatant and vitamin D3 The same experiment as in Example 3 was carried out. However, when treating with the culture supernatant, active vitamin D3 was added (addition amount was 100 nM or 1 μM in final concentration). The results are shown in Figure 3. Co-administration of active vitamin D3 with the culture supernatant was able to induce an increase in the expression of CAMP, DEFB1, and LCN2.

[0089] Example 5. Induction of antimicrobial peptide expression by culture supernatant and vitamin C An experiment similar to that in Example 3 was carried out. However, when treating with the culture supernatant, either vitamin C or vitamin E was added (final concentrations of vitamin C: 50 μg / mL, vitamin E: 1 μg / mL). The results are shown in FIG. 4. Looking at the results of the control sample, the addition of vitamin C and vitamin E alone was unable to induce an increase in the expression of Defensin Beta 1 (DEFB1). However, co-administration of vitamin C with the culture supernatant was able to induce an increase in the expression of DEFB1. Furthermore, it was shown that the effect of increasing the expression of DEFB1 by the culture supernatant was enhanced by the addition of vitamin C.

[0090] Example 6. Effects of protein degradation and denaturation treatments and induction of antimicrobial peptide expression In the above Examples 3 to 5, the effect of administering the culture supernatant to the cell line was verified. However, when actually taking an oral drug, the drug passes through the stomach and then reaches the intestine. Therefore, the drug may be affected by gastric acid.

[0091] To investigate the above possibility, some of the conditions of the experiment performed in Example 3 were changed. Specifically, the culture supernatant was pretreated. The following two types of pretreatment were performed.

[0092] Pretreatment 1 (digestion with trypsin) Trypsin was added to the control medium (sf-DOT) and the culture supernatant to a final concentration of 200 μg / mL, and the culture supernatant was then incubated at 37° C. After 1 hour, trypsin inhibitor was added to a final concentration of 400 μg / mL, and the culture supernatant was further treated at 37° C. for 30 minutes. The culture supernatant was then transferred to ice to cool.

[0093] Pretreatment 2 (Heat denaturation) The control medium (sf-DOT) and the culture supernatant were incubated at 100°C for 2 hours, then transferred to ice and cooled for 15 minutes, and centrifuged (20,000 x g for 15 minutes) to collect the supernatant.

[0094] The results of pretreatment 1 are shown in Figure 5. No decrease in the expression level of the CAMP and LCN2 genes was observed by trypsin treatment. Instead, an increase in the expression level of CAMP was observed by trypsin treatment.

[0095] The results of pretreatment 2 are shown in Figure 6. No decrease in the expression level of the LCN2 gene was observed due to heat denaturation treatment.

[0096] Example 7. Induction of antimicrobial peptide expression by culture supernatant and vitamin D3 (inflammation) The cell line THP-1 was prepared. The cell line was obtained from the JCRB Cell Bank (cell number JCRB0112, https: / / cellbank.nibiohn.go.jp / ~cellbank / cgi-bin / search_res_det.cgi?ID=281). 7.5 × 10 4 cells / cm 2 The medium used was RPMI1640 (Fujifilm Wako Pure Chemical Industries, Ltd.: Catalog No. 189-02025) + FBS (10%) (Merck Sigma: Catalog No. F7524). The cells were placed in an incubator (37°C, 5% CO2) for subculture.

[0097] At the time of seeding, PMA (phorbol myristate acetate) was added to a final concentration of 100 nM. After 24 hours, half of the medium was removed. After removal, culture supernatant (culture supernatant of mesenchymal stem cells derived from adipose tissue and culture supernatant of mesenchymal stem cells derived from umbilical cord tissue) was added to the half of the removed amount, and the cells were incubated. Activated vitamin D3 was added to the culture supernatant (final concentrations: 10 pM, 100 pM, 1 nM, 10 nM, and 100 nM). After 24 hours, total RNA was extracted from THP-1 using the ReliaPrep RNA Miniprep system (Promega, Z6012). Thereafter, gene expression analysis was performed by RT-PCR using the same method as in Example 3.

[0098] The results are shown in Figure 7. The bar graph is divided into two groups (Control, culture supernatant of adipose tissue-derived mesenchymal stem cells). As a control, the medium (sf-DOT) used for culturing adipose tissue-derived mesenchymal stem cells was used. Therefore, there is nothing special in the medium for mesenchymal stem cells, and it is possible to discuss only the importance of factors secreted from stem cells. Comparing the leftmost bars of each group, it was shown that the culture supernatant itself can increase the expression of IL-10, an anti-inflammatory cytokine. It was also shown that active vitamin D3 itself can increase the expression of IL-10, an anti-inflammatory cytokine. Furthermore, it was shown that co-administration of both can significantly increase the expression of IL-10, an anti-inflammatory cytokine.

[0099] Example 8. Induction of antimicrobial peptide expression by culture supernatant and vitamin D3 (skin) The cell line PSVK1 (immortalized epidermal keratinocyte) was prepared. The cell line was obtained from the JCRB Cell Bank (cell number JCRB1093, https: / / cellbank.nibiohn.go.jp / ~cellbank / cgi-bin / search_res_det.cgi?ID=3306). 1 × 10 5 cells / cm 2The medium used was Keratinocyte-SFM (ThermoFisher: Catalog No. 17005042) (serum-free culture). The cells were placed in an incubator (37°C, 5% CO2) for subculture.

[0100] 24 hours after seeding, the medium was replaced. After replacement, the PSVK1 strain was incubated with the culture supernatant (culture supernatant of mesenchymal stem cells derived from adipose tissue and culture supernatant of mesenchymal stem cells derived from umbilical cord tissue). Activated vitamin D3 was added to the culture supernatant (final concentrations: 10 nM, 100 nM, and 1 μM). After 48 hours, total RNA was extracted from PSVK1 using the ReliaPrep RNA Miniprep system (Promega, Z6012). Thereafter, gene expression analysis was performed by RT-PCR using the same method as in Example 3.

[0101] The results are shown in Figure 8. The bar graph is divided into three groups (Control, culture supernatant of mesenchymal stem cells derived from adipose tissue, and culture supernatant of mesenchymal stem cells derived from umbilical cord tissue). As a control, the medium (sf-DOT) used for culturing mesenchymal stem cells derived from adipose tissue and umbilical cord tissue was used. Therefore, there is nothing special in the medium for mesenchymal stem cells, and it is possible to discuss only the importance of factors secreted from stem cells. Comparing the leftmost bars of each group, it was shown that the culture supernatant itself can increase the expression of Filaggrin, which is involved in skin moisturization. On the other hand, active vitamin D3 was unable to increase the expression of Filaggrin. However, it was shown that co-administration of both can significantly increase the expression of Filaggrin.

[0102] It was shown that the culture supernatant itself can increase CAMP expression. It was also shown that active vitamin D3 itself can increase CAMP expression. Furthermore, it was shown that coadministration of the two can significantly increase CAMP expression.

[0103] Above, specific embodiments of the invention have been described. The above embodiments are merely examples, and the present invention is not limited to the above embodiments. For example, a technical feature disclosed in one of the above embodiments can be applied to other embodiments. In addition, unless otherwise specified, for a particular method, some steps can be replaced with other steps, and additional steps can be added between two specific steps. The scope of the present invention is defined by the claims.

Claims

1. A composition for improving intestinal flora, comprising a culture supernatant of mesenchymal stem cells.

2. 10. The composition of claim 1, further comprising at least one of vitamin C and vitamin D3.

3. 3. The composition of claim 2, comprising at least 0.05 mg / g of vitamin C.

4. The composition of claim 2, comprising 4.16 ng / g or more of vitamin D3.

5. The composition of claim 1, which is adapted for oral administration.

6. 6. The composition of claim 5, wherein the composition is formulated so that the active ingredient is available for contact with gastric fluids.

7. The composition according to any one of claims 1 to 6, wherein the mesenchymal stem cells are derived from adipose tissue.

8. 1. Use of a culture supernatant of mesenchymal stem cells for improving intestinal flora, the use being in combination with at least one of vitamin C and vitamin D3.

9. The use according to claim 8 for oral administration.

10. A method for producing a composition for improving intestinal flora, the method comprising: A step of culturing mesenchymal stem cells in a medium to obtain a culture supernatant; formulating the culture supernatant to obtain a composition suitable for administration; A method comprising:

11. 11. The method of claim 10, further comprising: further comprising at least one of vitamin C and vitamin D3 to obtain a composition suitable for administration; The method further comprises:

12. 12. The method of claim 10 or 11, wherein the administration is oral administration.

13. 1. Use of a culture supernatant for producing a composition for improving intestinal flora, wherein the culture supernatant is obtained by culturing mesenchymal stem cells.

14. 14. The use of claim 13 in combination with at least one of vitamin C and vitamin D3.

15. 15. Use according to claim 13 or 14 for oral administration.

16. A method for improving intestinal flora, comprising: The method includes administering to a subject in need of improving intestinal flora an effective amount of a composition, The composition comprises a culture supernatant of mesenchymal stem cells. method.

17. 17. The method of claim 16, wherein the administering step includes administering at least one of vitamin C and vitamin D3.

18. 18. The method of claim 16 or 17, wherein the administering step comprises oral administration.

19. A composition for improving skin, comprising a culture supernatant of mesenchymal stem cells.

20. 20. The composition of claim 19, further comprising vitamin D3.

21. An anti-inflammatory composition, comprising a culture supernatant of mesenchymal stem cells.

22. 22. The composition of claim 21, further comprising vitamin D3.

23. A composition for improving skin, comprising mesenchymal stem cells.

24. 24. The composition of claim 23, further comprising vitamin D3.

25. An anti-inflammatory composition, comprising mesenchymal stem cells.

26. 26. The composition of claim 25, further comprising vitamin D3.

Images