Combination therapy including KRAS g12c inhibitor and one or more additional pharmaceutically active agents for treatment of cancers

Abstract

To provide combination therapy including a KRAS G12C inhibitor and one or more additional pharmaceutically active agents for treatment of cancers.SOLUTION: The present invention provides combination therapy that includes a KRASG12C inhibitor, such as the formula in the figure or a pharmaceutically acceptable salt thereof, and one or more additional pharmaceutically active agents, particularly for treatment of cancers. The invention also relates to pharmaceutical compositions that contain a KRASG12C inhibitor and one or more additional pharmaceutically active agents for treatment of cancers.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No. 62 / 865,819, filed June 24, 2019, U.S. Provisional Patent Application No. 62 / 821,376, filed March 20, 2019, and U.S. Provisional Patent Application No. 62 / 769,355, filed November 19, 2018, all of which are incorporated by reference in their entirety for all purposes.

[0002] <Sequence Listing> This application is filed with a sequence listing in electronic format. The sequence listing is provided in a file named A-2326-US-NP_SeqList_102919_ST25.txt (created October 29, 2019) and is 15.4 kb in size. The information in the electronic sequence listing is incorporated herein by reference in its entirety.

[0003] The present invention relates to a method for the treatment of cancer, in particular to a method for the treatment of cancer G12C The present invention also provides combination therapies comprising a KRAS inhibitor and one or more additional pharma- ceutical active agents for the treatment of cancer. G12C The present invention relates to pharmaceutical compositions comprising an inhibitor and one or more additional pharma- ceutical active agents. [Background technology]

[0004] KRAS gene mutations are common in pancreatic, lung adenocarcinoma, colorectal, gallbladder, thyroid, and bile duct cancers. KRAS mutations are also observed in approximately 25% of NSCLC patients, and several studies have shown that KRAS mutations are a negative prognostic factor for NSCLC patients. Recently, V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations have been found to confer resistance to epidermal growth factor receptor (EGFR)-targeted therapy in colorectal cancer, and thus, the mutation status of KRAS can provide important information prior to the prescription of TKI therapy. Taken together, new medical treatments are needed for patients with pancreatic, lung adenocarcinoma, or colorectal cancer, especially those diagnosed with cancers characterized by KRAS mutations, including those who have progressed to post-chemotherapy. Oncogenic KRAS mutations at residues G12, G13, and Q61 represent the most common RAS mutations found in solid malignancies. Recently, we have developed a covalent small molecule inhibitor of KRAS that reacts with a mutant cysteine ​​adjacent to the switch II pocket (SIIP) and locks KRAS in its inactive GDP-bound state. G12C It has been demonstrated that it can be targeted.

[0005] KRAS is the most frequently mutated oncogene in human cancers and encodes a signaling protein important in tumors. G12C The mutants carry a cysteine ​​that has been exploited to design covalent inhibitors with promising preclinical activity. We have optimized a series of inhibitors with novel binding interactions and significantly enhanced potency and selectivity. These efforts have resulted in the first KRAS inhibitor in clinical development. G12CThis led to the discovery of the inhibitor AMG510. Preclinical AMG510 treatment regressed KRAS p.G12C tumors and significantly improved the antitumor efficacy of chemotherapy and targeted agents. In immune-competent mice, treatment with AMG510 resulted in a proinflammatory tumor microenvironment that, in combination with immune checkpoint inhibition, led to durable cures. Cured mice rejected the growth of syngeneic KRAS p.G12D tumors, suggesting adaptive immunity to a shared antigen. AMG510 showed preliminary evidence of clinical antitumor activity in the first dosing cohort and represents a potentially transformative treatment for patients lacking effective therapies.

[0006] The KRAS oncoprotein is a GTPase that is an essential mediator of intracellular signaling pathways involved in tumor cell proliferation and survival. In normal cells, KRAS functions as a molecular switch, alternating between an inactive GDP-bound state and an active GTP-bound state. The transition between these states is facilitated by GTP hydrolysis catalyzed by guanine nucleotide exchange factors (GEFs), which load GTP and activate KRAS, and GTPase-activating proteins (GAPs), which inactivate KRAS. Binding of GTP to KRAS promotes binding of effectors that trigger signaling pathways including RAF-MEK-ERK (MAPK). Somatic activating mutations of KRAS are a hallmark of cancer and prevent GAP association, thereby stabilizing effector binding and enhancing KRAS signaling. Patients with KRAS-mutated tumors have significantly poorer outcomes and worse prognosis. Although there are clinically approved inhibitors of several MAPK pathway proteins (e.g., MEK, BRAF, EGFR) for a subset of tumor types, to date there are no clinical molecules that are selective for KRAS mutant tumors. Furthermore, some MAPK pathway targeted therapies are contraindicated for the treatment of KRAS mutant tumors due to lack of clinical efficacy. Furthermore, non-tumor or non-mutant selective therapies can introduce target toxicity due to inhibition of MAPK signaling in normal cells. This may limit the usefulness of combining such agents with standard treatments or immunotherapy. Thus, there is a significant unmet need for the development of tumor-selective therapies that do not impose liability on normal cells.

[0007] KRAS p.G12C is present in approximately 13% of lung adenocarcinomas, 3% of colorectal cancers, and 2% of other solid tumors. G12C The mutant cysteine ​​in is adjacent to a pocket (P2) that is present in the inactive GDP-bound form of KRAS. The proximity of P2 to the mutant cysteine ​​has led to an extensive search for covalent inhibitors of KRAS. G12CAraxes Pharma's initially reported electrophile screen led to the eventual identification of ARS-1620, which shows in vivo efficacy in a preclinical KRAS p.G12C model. Araxes Pharma's ARS-1620 was a proof-of-concept, mutant-selective KRAS inhibition milestone, but was positioned as a tool compound for preclinical trials. Amgen, Inc. scientists have G12C By exploiting a previously untapped surface groove in , we have identified a series of novel acrylamide-based molecules that substantially increase potency and selectivity. Intensive electrophilic screening and structure-based design have led to the discovery of the first KRAS inhibitor to reach human clinical trials. G12C This has led to the discovery of AMG510, an inhibitor of IL-16 (see www.clinicaltrials.gov NCT03600883). The present invention includes compelling preclinical activity of AMG510, its ability to enhance tumor cell killing as a monotherapy or in combination with other therapies, and a dramatic effect on immune cell infiltration that most impressively sensitizes the tumor microenvironment to immunotherapy. Preliminary evidence of clinical efficacy is also presented herein. Summary of the Invention [Means for solving the problem]

[0008] The present invention relates to

[0009] [ka] The present invention includes pharmaceutical compositions comprising AMG510, or a pharma- ceutically acceptable salt thereof; and one or more therapeutic or pharma- ceutical active agents; and a pharma- ceutically acceptable excipient.

[0010] The present invention further includes methods of treating cancer, such as solid tumors, including but not limited to lung cancer, colon cancer, and pancreatic cancer, with AMG510, or a pharma- ceutically acceptable salt, in combination with at least one therapeutic agent, wherein the therapeutic agent is selected from an anti-PD-1 antibody, a chemotherapeutic agent, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, and an AKT inhibitor.

[0011] The present invention further comprises two KRAS G12C The present invention includes an isolated cell line that contains the allele, the cell line being CT-26 KRAS pG12C.

[0012] The present invention further comprises two KRAS G12C 1. A method of generating a cell line containing an allele, comprising: a) Two KRAS G12C Two KRAS alleles were generated, along with a CRISPR construct that induces nucleotide substitutions in both KRAS alleles. G12D incubating the cell line containing the allele; and b) Two KRAS G12C Isolating cell lines containing the allele; The present invention includes a method comprising the steps of:

[0013] First set of embodiments

[0014] 1. In one embodiment of the present invention, the invention comprises a method of treating pancreatic cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering an inhibitor and at least one chemotherapeutic agent.

[0015] 2. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering an inhibitor and at least one chemotherapeutic agent.

[0016] 3. In another embodiment of the invention, the invention encompasses the method of embodiment 2, wherein the colon cancer has a KRAS p.G12C mutation.

[0017] 4. In another embodiment of the present invention, the present invention comprises a method of treating lung cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C This involves administering an inhibitor and a chemotherapeutic agent.

[0018] In some such embodiments, the lung cancer is non-small cell lung cancer.

[0019] 5. In another embodiment of the invention, the invention encompasses the method of embodiment 1, wherein the pancreatic cancer has a KRAS p.G12C mutation.

[0020] 6. In another embodiment of the invention, the invention encompasses the method of any one of embodiments 1-5, wherein the chemotherapeutic agent is carboplatin.

[0021] 7. In another embodiment of the present invention, the present invention comprises a method of treating pancreatic cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The method includes administering a medicament for treating cancer, comprising administering to the patient a medicament for treatment with a tumour comprising administering to the patient a tumour inhibitor and a MEK inhibitor.

[0022] 8. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering a medicament for treating cancer, comprising administering to the patient a medicament for treatment with a tumour comprising administering to the patient a tumour inhibitor and a MEK inhibitor.

[0023] 9. In another embodiment of the present invention, the present invention comprises a method of treating lung cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering a medicament for treating cancer, comprising administering to the patient a medicament for treatment with a tumour comprising administering to the patient a tumour inhibitor and a MEK inhibitor.

[0024] 10. In another embodiment of the invention, the invention encompasses the method of embodiment 9, wherein the lung cancer has a p.KRAS G12C mutation.

[0025] 11. In another embodiment of the invention, the invention comprises the method of any one of embodiments 7 to 10, wherein the MEK inhibitor is trametinib.

[0026] 12. In another embodiment of the invention, the invention encompasses the method of any one of embodiments 7 to 10, wherein the MEK inhibitor is pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

[0027] 13. In another embodiment of the present invention, the present invention comprises a method of treating pancreatic cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The method includes administering an EGFR inhibitor and an EGFR inhibitor.

[0028] 14. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering an EGFR inhibitor and an EGFR inhibitor.

[0029] 15. In another embodiment of the present invention, the present invention comprises a method of treating lung cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The method includes administering an EGFR inhibitor and an EGFR inhibitor.

[0030] 16. In another embodiment of the invention, the invention comprises the method of any one of embodiments 13 to 15, wherein the EGFR inhibitor is afatinib.

[0031] 17. In another embodiment of the invention, the invention encompasses the method of any one of embodiments 13 and 15, wherein the EGFR inhibitor is erlotinib.

[0032] 18. In another embodiment of the invention, the invention comprises the method of embodiment 15, wherein the EGFR inhibitor is lapatinib.

[0033] 19. In another embodiment of the present invention, the present invention comprises a method of treating pancreatic cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The method includes administering a medicament for treating a pulmonary artery disease comprising administering to the patient a therapeutically effective amount of a pulmonary artery disease (PAH) inhibitor and a SHP2 inhibitor.

[0034] 20. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The method includes administering a medicament for treating a pulmonary artery disease comprising administering to the patient a therapeutically effective amount of a pulmonary artery disease (PAH) inhibitor and a SHP2 inhibitor.

[0035] 21. In another embodiment of the present invention, the present invention comprises a method of treating lung cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The method includes administering a medicament for treating a pulmonary artery disease comprising administering to the patient a therapeutically effective amount of a pulmonary artery disease (PAH) inhibitor and a SHP2 inhibitor.

[0036] 22. In another embodiment of the invention, the invention comprises the method of any one of embodiments 19-21, wherein the SHP2 inhibitor is selected from RMC-4550.

[0037] 23. In another embodiment of the invention, the invention comprises the method of embodiment 22, wherein the SHP2 inhibitor is RMC4550.

[0038] 24. In another embodiment of the present invention, the present invention comprises a method of treating pancreatic cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The present invention includes administering a PI3K inhibitor to a patient having a pulmonary artery disease.

[0039] 25. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The present invention includes administering a PI3K inhibitor to a patient having a pulmonary artery disease.

[0040] 26. In another embodiment of the present invention, the present invention comprises a method of treating lung cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The present invention includes administering a PI3K inhibitor to a patient having a pulmonary artery disease.

[0041] 27. In another embodiment of the invention, the invention comprises the method of any one of embodiments 24-26, wherein the PI3K inhibitor is AMG511.

[0042] 28. In another embodiment of the invention, the invention comprises the method of embodiment 26, wherein the PI3K inhibitor is buparlisib.

[0043] 29. In another embodiment of the present invention, the present invention comprises a method of treating pancreatic cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The present invention includes administering an AKT inhibitor to a patient having a glioma.

[0044] 30. In another embodiment of the present invention, the present invention comprises a method of treating lung cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C The present invention includes administering an AKT inhibitor to a patient having a glioma.

[0045] 31. In another embodiment of the invention, the invention comprises the method of any one of embodiments 29-30, wherein the AKT inhibitor is AZD5363.

[0046] 32. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C This involves administering an inhibitor and an EGFR antibody.

[0047] 33. In another embodiment of the invention, the invention comprises the method of embodiment 32, wherein the EGFR antibody is cetuximab.

[0048] 32. In another embodiment of the present invention, the present invention comprises a method of treating colon cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of KRAS G12C This involves administering an inhibitor and an anti-PD-1 antibody.

[0049] 33. In another embodiment of the invention, the invention encompasses the method of embodiment 32, wherein the anti-PD-1 antibody is selected from AMG404, pembrolizumab, and nivolumab.

[0050] 34. In another embodiment of the invention, the invention comprises the method of embodiment 33, wherein the anti-PD-1 antibody is pembrolizumab.

[0051] 35. In another embodiment of the invention, the invention comprises the method of embodiment 33, wherein the anti-PD-1 antibody is AMG404.

[0052] 36. In another embodiment of the invention, the invention comprises the method of embodiment 33, wherein the anti-PD-1 antibody is nivolumab.

[0053] 37. In another embodiment of the present invention, the present invention

[0054] [ka] or a pharma- ceutically acceptable salt thereof; carboplatin; and a pharma- ceutically acceptable excipient.

[0055] 38. In another embodiment of the present invention, the present invention

[0056] [ka] or a pharma- ceutically acceptable salt thereof; trametinib; and a pharma- ceutically acceptable excipient.

[0057] 39. In another embodiment of the present invention, the present invention

[0058] [ka] or a pharma- ceutically acceptable salt thereof; afatinib; and a pharma- ceutically acceptable excipient.

[0059] 40. In another embodiment of the present invention, the present invention

[0060] [ka] or a pharma- ceutically acceptable salt thereof; erlotinib; and a pharma- ceutically acceptable excipient.

[0061] 41. In another embodiment of the present invention, the present invention provides

[0062] [ka] or a pharma- ceutically acceptable salt thereof; lapatinib; and a pharma- ceutically acceptable excipient.

[0063] 42. In another embodiment of the present invention, the present invention provides

[0064] [ka] or a pharma- ceutically acceptable salt thereof; RMC-4550; and a pharma- ceutically acceptable excipient.

[0065] 43. In another embodiment of the present invention, the present invention provides

[0066] [ka] or a pharma- ceutically acceptable salt thereof; AMG511; and a pharma- ceutically acceptable excipient.

[0067] 44. In another embodiment of the present invention, the present invention

[0068] [ka] or a pharma- ceutically acceptable salt thereof; buparlisib; and a pharma- ceutically acceptable excipient.

[0069] 45. In another embodiment of the present invention, the present invention provides

[0070] [ka] or a pharma- ceutically acceptable salt thereof; AZD5363; and a pharma- ceutically acceptable excipient.

[0071] 46. ​​In another embodiment of the present invention, the present invention

[0072] [ka] or a pharma- ceutically acceptable salt thereof; cetuximab; and a pharma- ceutically acceptable excipient.

[0073] 47. In another embodiment of the present invention, the present invention provides

[0074] [ka] or a pharma- ceutical composition comprising: an anti-PD-1 antibody; or a pharma- ceutical acceptable salt thereof; and a pharma- ceutical composition comprising:

[0075] 48. In another embodiment of the present invention, the present invention provides

[0076] [ka] or a pharma- ceutically acceptable salt thereof; AMG404; and a pharma- ceutically acceptable excipient.

[0077] 49. In another embodiment of the present invention, the present invention provides

[0078] [ka] or a pharma- ceutical acceptable salt thereof; pembrolizumab; and a pharma- ceutical acceptable excipient.

[0079] 50. In another embodiment of the present invention, the present invention

[0080] [ka] or a pharma- ceutical acceptable salt thereof; nivolumab; and a pharma- ceutical acceptable excipient.

[0081] 51. In another embodiment of the present invention, the present invention provides a method for the treatment of KRAS G12C Inhibitors

[0082] [ka] or a pharma- ceutically acceptable salt thereof.

[0083] 52. In another embodiment of the present invention, the present invention provides a method for treating solid tumors using KRAS G12C This includes the combination of a glioma inhibitor with a MEK inhibitor.

[0084] 53. In another embodiment of the present invention, the present invention provides a method for treating lung cancer using KRAS G12C This includes the combination of a glioma inhibitor with a MEK inhibitor.

[0085] 54. In another embodiment of the present invention, the present invention relates to a method for treating colon cancer using KRAS G12C This includes the combination of a glioma inhibitor with a MEK inhibitor.

[0086] 55. In another embodiment of the present invention, the present invention relates to a method for treating pancreatic cancer using KRAS G12C This includes the combination of a glioma inhibitor with a MEK inhibitor.

[0087] 56. In another embodiment of the present invention, the present invention provides a method for treating solid tumors using KRAS G12C This includes the combination of inhibitors with chemotherapy drugs.

[0088] 57. In another embodiment of the present invention, the present invention provides a method for treating lung cancer using KRAS G12C This includes the combination of inhibitors with chemotherapy drugs.

[0089] 58. In another embodiment of the present invention, the present invention relates to a method for treating colon cancer using KRAS G12C This includes the combination of inhibitors with chemotherapy drugs.

[0090] 59. In another embodiment of the present invention, the present invention relates to a method for treating pancreatic cancer using KRAS G12C This includes the combination of inhibitors with chemotherapy drugs.

[0091] 60. In another embodiment of the present invention, the present invention provides a method for treating solid tumors using KRAS G12C This includes the combination of a chemotherapy inhibitor with an EGFR inhibitor.

[0092] 61. In another embodiment of the present invention, the present invention provides a method for treating lung cancer using KRAS G12C This includes the combination of a chemotherapy inhibitor with an EGFR inhibitor.

[0093] 62. In another embodiment of the present invention, the present invention relates to a method for treating colon cancer using KRAS G12C This includes the combination of a chemotherapy inhibitor with an EGFR inhibitor.

[0094] 63. In another embodiment of the present invention, the present invention relates to a method for treating pancreatic cancer using KRAS G12C This includes the combination of a chemotherapy inhibitor with an EGFR inhibitor.

[0095] 64. In another embodiment of the present invention, the present invention provides a method for treating solid tumors using KRAS G12C This includes the combination of inhibitors and anti-PD-1 antibodies.

[0096] 65. In another embodiment of the present invention, the present invention provides a method for treating lung cancer using KRAS G12C This includes the combination of inhibitors and anti-PD-1 antibodies.

[0097] 66. In another embodiment of the present invention, the present invention relates to a method for treating colon cancer using KRAS G12C This includes the combination of inhibitors and anti-PD-1 antibodies.

[0098] 67. In another embodiment of the present invention, the present invention relates to a method for treating pancreatic cancer using KRAS G12C This includes the combination of inhibitors and anti-PD-1 antibodies.

[0099] 68. In another embodiment of the present invention, the present invention provides a method for the manufacture of a medicament for the management or treatment of pancreatic cancer, lung cancer, or colon cancer in a subject, comprising administering to a subject a KRAS inhibitor in combination with a chemotherapeutic agent. G12C This includes the use of inhibitors.

[0100] 69. In another embodiment of the present invention, the present invention provides a method for the treatment of pancreatic cancer, lung cancer, or colon cancer in a subject, comprising administering to the subject a medicament for the treatment of pancreatic cancer, lung cancer, or colon cancer in a subject in combination with a KRAS inhibitor in combination with a MEK inhibitor. G12C This includes the use of inhibitors.

[0101] 70. In another embodiment of the present invention, the present invention provides a method for the treatment of pancreatic cancer, lung cancer, or colon cancer in a subject, comprising administering to the subject a KRAS inhibitor in combination with an EGFR inhibitor for the manufacture of a medicament for the management or treatment of pancreatic cancer, lung cancer, or colon cancer in a subject. G12C This includes the use of inhibitors.

[0102] 71. In another embodiment of the present invention, the present invention provides a KRAS antibody in combination with an anti-PD-1 antibody for the manufacture of a medicament for the management or treatment of pancreatic cancer, lung cancer, or colon cancer in a subject. G12C This includes the use of inhibitors.

[0103] 72. In another embodiment of the present invention, the present invention provides a method for the treatment of cancer by inhibiting the expression of two KRAS G12C and isolated cell lines containing the allele.

[0104] 73. In another embodiment of the invention, the invention comprises the cell line of embodiment 68, wherein the cell line is CT-26 KRAS p.G12C.

[0105] 74. In another embodiment of the present invention, the present invention provides a method for the treatment of cancer by inhibiting the expression of two KRAS G12C 1. A method of generating a cell line containing an allele, comprising: a) Two KRAS G12Cincubating a cell line containing two KRASG12D alleles with a CRISPR construct that induces a nucleotide substitution in both KRAS alleles such that the alleles are generated; and b) Two KRAS G12C isolating a cell line containing the allele; Includes.

[0106] 75. In another embodiment of the present invention, the present invention comprises the method of embodiment 70, wherein the CRISPR construct comprises the sequence CTTGTGATGGTTGGAGCTGA (sequence number 21).

[0107] 76. In another embodiment of the present invention, the present invention comprises a method of treating cancer, the method comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering an inhibitor and at least one additional chemotherapeutic agent.

[0108] 77. In another embodiment of the present invention, the present invention provides a method for treating solid tumors by inhibiting KRAS G12C This includes the combination of inhibitors and anti-PD-1 antibodies.

[0109] 78. In another embodiment of the present invention, the present invention provides a method for the manufacture of a medicament for the management or treatment of pancreatic cancer, lung cancer, or colon cancer in a subject, comprising administering to the subject a KRAS inhibitor in combination with at least one additional chemotherapeutic agent. G12C This includes the use of inhibitors.

[0110] 79. In another embodiment of the present invention, the present invention provides a method for the treatment of KRAS G12C Inhibitors

[0111] [ka] or a pharma- ceutically acceptable salt thereof.

[0112] 80. In another embodiment of the present invention, the present invention provides a method for the treatment of KRAS G12C Inhibitors

[0113] [ka] or a pharma- ceutically acceptable salt thereof.

[0114] 81. In another embodiment of the present invention, the present invention provides a method for the treatment of KRAS G12C Inhibitors

[0115] [ka] or a pharma- ceutically acceptable salt thereof.

[0116] 82. In another embodiment of the invention, the invention encompasses the use according to embodiment 78, wherein the lung cancer is non-small cell lung cancer (NSCLC).

[0117] <Second set of embodiments>

[0118] 1. In another embodiment of the present invention, the present invention relates to a method of treating cancer, comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS G12C The method includes administering an inhibitor and at least one additional pharma- ceutical active agent.

[0119] 2. In a further embodiment, KRAS G12C The inhibitor is

[0120] [ka] or a pharma- ceutically acceptable salt thereof.

[0121] 3. In a further embodiment, the method of embodiment 1, wherein the cancer has a KRAS p.G12C mutation.

[0122] 4. In a further embodiment, the method of embodiment 1, wherein the cancer is pancreatic cancer, colorectal cancer, lung cancer, appendix cancer, endometrial cancer, or small intestine cancer.

[0123] 5. In a further embodiment, the method of embodiment 4, wherein the cancer is pancreatic cancer.

[0124] 6. In a further embodiment, the method of embodiment 4, wherein the cancer is colorectal cancer.

[0125] 7. In a further embodiment, the method of embodiment 4, wherein the cancer is lung cancer.

[0126] 8. In a further embodiment, the lung cancer is non-small cell lung cancer (NSCLC), the method of embodiment 7.

[0127] 9. In a further embodiment, the method of embodiment 4, wherein the cancer is appendiceal cancer.

[0128] 10. In a further embodiment, the method of embodiment 4, wherein the cancer is endometrial cancer.

[0129] 11. In a further embodiment, the method of embodiment 4, wherein the cancer is small intestine cancer.

[0130] 12. In a further embodiment, the method of embodiment 1, wherein the at least one additional pharma- ceutically active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, or an AKT inhibitor.

[0131] 13. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutically active agent is carboplatin.

[0132] 14. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutically active agent is an anti-PD-1 inhibitor.

[0133] 15. In a further embodiment, the method of embodiment 14, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

[0134] 16. In a further embodiment, the method of embodiment 15, wherein the anti-PD-1 inhibitor is pembrolizumab.

[0135] 17. In a further embodiment, the method of embodiment 15, wherein the anti-PD-1 inhibitor is AMG404.

[0136] 18. In a further embodiment, the method of embodiment 15, wherein the anti-PD-1 inhibitor is nivolumab.

[0137] 19. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutical active agent is a MEK inhibitor.

[0138] 20. In a further embodiment, the method of embodiment 19, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

[0139] 21. In a further embodiment, the method of embodiment 20, wherein the MEK inhibitor is trametinib.

[0140] 22. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutically active agent is an EGFR inhibitor.

[0141] 23. In a further embodiment, the method of embodiment 22, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

[0142] 24. In a further embodiment, the method of embodiment 23, wherein the EGFR inhibitor is afatinib.

[0143] 25. In a further embodiment, the method of embodiment 23, wherein the EGFR inhibitor is cetuximab.

[0144] 26. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

[0145] 27. In a further embodiment, the method of embodiment 26, wherein the SHP2 inhibitor is RMC4550.

[0146] 28. In a further embodiment, the method of embodiment 26, wherein the SHP2 inhibitor is RMC4630.

[0147] 29. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutical active agent is a PI3K inhibitor.

[0148] 30. In a further embodiment, the method of embodiment 29, wherein the PI3K inhibitor is AMG511 or buparlisib.

[0149] 31. In a further embodiment, the method of embodiment 30, wherein the PI3K inhibitor is AMG511.

[0150] 32. In a further embodiment, the method of embodiment 30, wherein the PI3K inhibitor is buparlisib.

[0151] 33. In a further embodiment, the method of embodiment 12, wherein the at least one additional pharma- ceutical active agent is an AKT inhibitor.

[0152] 34. In a further embodiment, the method of embodiment 33, wherein the AKT inhibitor is AZD5363.

[0153] 35. In a further embodiment,

[0154] [ka] or a pharma- ceutically acceptable salt thereof; at least one additional pharma- ceutically active agent; and a pharma- ceutically acceptable excipient.

[0155] 36. In a further embodiment, the composition of embodiment 35, wherein the at least one additional pharma- ceutical active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, or an AKT inhibitor.

[0156] 37. In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutically active agent is carboplatin.

[0157] 38. In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutical active agent is an anti-PD-1 inhibitor.

[0158] 39. In a further embodiment, the composition of embodiment 38, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

[0159] 40. In a further embodiment, the composition of embodiment 39, wherein the anti-PD-1 inhibitor is pembrolizumab.

[0160] 41. In a further embodiment, the composition of embodiment 39, wherein the anti-PD-1 inhibitor is AMG404.

[0161] 42. In a further embodiment, the composition of embodiment 39, wherein the anti-PD-1 inhibitor is nivolumab.

[0162] 43. In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutical active agent is a MEK inhibitor.

[0163] 44. In a further embodiment, the composition of embodiment 43, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

[0164] 45. In a further embodiment, the composition of embodiment 44, wherein the MEK inhibitor is trametinib.

[0165] 46. ​​In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutically active agent is an EGFR inhibitor.

[0166] 47. In a further embodiment, the composition of embodiment 46, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

[0167] 48. In a further embodiment, the composition of embodiment 47, wherein the EGFR inhibitor is afatinib.

[0168] 49. In a further embodiment, the composition of embodiment 47, wherein the EGFR inhibitor is cetuximab.

[0169] 50. In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

[0170] 51. In a further embodiment, the composition of embodiment 50, wherein the SHP2 inhibitor is RMC4550.

[0171] 52. In a further embodiment, the composition of embodiment 50, wherein the SHP2 inhibitor is RMC4630.

[0172] 53. In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutically active agent is a PI3K inhibitor.

[0173] 54. In a further embodiment, the composition of embodiment 53, wherein the PI3K inhibitor is AMG511 or buparlisib.

[0174] 55. In a further embodiment, the composition of embodiment 54, wherein the PI3K inhibitor is AMG511.

[0175] 56. In a further embodiment, the composition of embodiment 54, wherein the PI3K inhibitor is buparlisib.

[0176] 57. In a further embodiment, the composition of embodiment 36, wherein the at least one additional pharma- ceutical active agent is an AKT inhibitor.

[0177] 58. In a further embodiment, the composition of embodiment 57, wherein the AKT inhibitor is AZD5363.

[0178] 59. In a further embodiment, a kit, the kit comprising: G12C inhibitor, or a pharma- ceutically acceptable salt thereof; and at least one additional pharma- ceutically active agent.

[0179] 60. In a further embodiment, KRAS G12C Inhibitors

[0180] [ka] or a pharma- ceutically acceptable salt thereof.

[0181] 61. In a further embodiment, the kit according to embodiment 59, wherein the at least one additional pharma- ceutically active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor or an AKT inhibitor.

[0182] 62. In a further embodiment, the kit of embodiment 59, wherein the at least one additional pharma- ceutically active agent is carboplatin.

[0183] 63. In a further embodiment, the kit of embodiment 59, wherein the at least one additional pharma- ceutically active agent is an anti-PD-1 inhibitor.

[0184] 64. In a further embodiment, the kit of embodiment 63, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

[0185] 65.In a further embodiment, the kit according to embodiment 64, wherein the anti-PD-1 inhibitor is pembrolizumab.

[0186] 66. In a further embodiment, the kit according to embodiment 64, wherein the anti-PD-1 inhibitor is AMG404.

[0187] 67.In a further embodiment, the kit of embodiment 64, wherein the anti-PD-1 inhibitor is nivolumab.

[0188] 68. In a further embodiment, the kit of embodiment 61, wherein the at least one additional pharma- ceutically active agent is a MEK inhibitor.

[0189] 69. In a further embodiment, the kit of embodiment 68, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

[0190] 70. In a further embodiment, the kit of embodiment 69, wherein the MEK inhibitor is trametinib.

[0191] 71. In a further embodiment, the kit of embodiment 61, wherein the at least one additional pharma- ceutically active agent is an EGFR inhibitor.

[0192] 72. In a further embodiment, the kit according to embodiment 61, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

[0193] 73. In a further embodiment, the kit according to embodiment 62, wherein the EGFR inhibitor is afatinib.

[0194] 74. In a further embodiment, the kit according to embodiment 62, wherein the EGFR inhibitor is cetuximab.

[0195] 75. In a further embodiment, the kit of embodiment 61, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

[0196] 76. In a further embodiment, the kit according to embodiment 75, wherein the SHP2 inhibitor is RMC4550.

[0197] 77. In a further embodiment, the kit according to embodiment 75, wherein the SHP2 inhibitor is RMC4630.

[0198] 78. In a further embodiment, the kit of embodiment 61, wherein at least one additional pharma- ceutically active agent is a PI3K inhibitor.

[0199] 79. In a further embodiment, the kit according to embodiment 78, wherein the PI3K inhibitor is AMG511 or buparlisib.

[0200] 80. In a further embodiment, the kit of embodiment 79, wherein the PI3K inhibitor is AMG511.

[0201] 81. In a further embodiment, the kit according to embodiment 79, wherein the PI3K inhibitor is buparlisib.

[0202] 82. In a further embodiment, the kit of embodiment 61, wherein at least one additional pharma- ceutically active agent is an AKT inhibitor.

[0203] 83. In a further embodiment, the kit according to embodiment 82, wherein the AKT inhibitor is AZD5363.

[0204] 84. In a further embodiment, the kit according to embodiment 59, wherein the kit is for treating cancer.

[0205] 85. In a further embodiment, the kit of embodiment 84, wherein the cancer has a KRAS p.G12C mutation.

[0206] 86. In a further embodiment, the kit of embodiment 84, wherein the cancer is pancreatic cancer, colorectal cancer, lung cancer, appendix cancer, endometrial cancer, or small intestine cancer.

[0207] 87. In a further embodiment, the kit of embodiment 86, wherein the cancer is pancreatic cancer.

[0208] 88. In a further embodiment, the kit of embodiment 86, wherein the cancer is colorectal cancer.

[0209] 89. In a further embodiment, the kit of embodiment 86, wherein the cancer is lung cancer.

[0210] 90. In a further embodiment, the kit of embodiment 89, wherein the lung cancer is non-small cell lung cancer (NSCLC).

[0211] 91. In a further embodiment, the kit of embodiment 86, wherein the cancer is appendiceal cancer.

[0212] 92. In a further embodiment, the kit of embodiment 86, wherein the cancer is endometrial cancer.

[0213] 93. In a further embodiment, the kit of embodiment 86, wherein the cancer is small intestine cancer.

[0214] 94. In a further embodiment, a KRAS inhibitor is used in combination with at least one additional chemotherapeutic agent for the manufacture of a medicament for the management or treatment of cancer in a subject. G12C Use of inhibitors.

[0215] 95. In a further embodiment, KRASG12C The inhibitor is

[0216] [ka] or a pharma- ceutically acceptable salt thereof.

[0217] 96. In a further embodiment, a KRAS inhibitor is used for the treatment of cancer together with at least one additional pharma- ceutical active agent. G12C A compound that is an inhibitor.

[0218] 97. In a further embodiment, KRAS G12C The inhibitor is

[0219] [ka] or a pharma- ceutically acceptable salt thereof.

[0220] 98. In a further embodiment, the compound of embodiment 96, wherein the cancer has a KRAS p.G12C mutation.

[0221] 99. In a further embodiment, the compound of embodiment 96, wherein the cancer is pancreatic cancer, colorectal cancer, lung cancer, appendix cancer, endometrial cancer, or small intestine cancer.

[0222] 100. In a further embodiment, the compound of embodiment 99, wherein the cancer is pancreatic cancer.

[0223] 101. In a further embodiment, the compound according to embodiment 99, wherein the cancer is colorectal cancer.

[0224] 102. In a further embodiment, the compound according to embodiment 99, wherein the cancer is lung cancer.

[0225] 103. In a further embodiment, the compound according to embodiment 102, wherein the lung cancer is non-small cell lung cancer (NSCLC).

[0226] 104. In a further embodiment, the compound of embodiment 99, wherein the cancer is appendiceal cancer.

[0227] 105. In a further embodiment, the compound according to embodiment 99, wherein the cancer is endometrial cancer.

[0228] 106. In a further embodiment, the compound according to embodiment 99, wherein the cancer is small intestine cancer.

[0229] 107. In a further embodiment, the compound according to embodiment 96, wherein the at least one additional pharma- ceutically active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor or an AKT inhibitor.

[0230] 108. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutically active agent is carboplatin.

[0231] 109. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutical active agent is an anti-PD-1 inhibitor.

[0232] 110. In a further embodiment, the compound of embodiment 109, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

[0233] 111. In a further embodiment, the compound according to embodiment 110, wherein the anti-PD-1 inhibitor is pembrolizumab.

[0234] 112. In a further embodiment, the compound according to embodiment 110, wherein the anti-PD-1 inhibitor is AMG404.

[0235] 113. In a further embodiment, the compound according to embodiment 110, wherein the anti-PD-1 inhibitor is nivolumab.

[0236] 114. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutically active agent is a MEK inhibitor.

[0237] 115. In a further embodiment, the compound according to embodiment 114, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

[0238] 116. In a further embodiment, the compound according to embodiment 115, wherein the MEK inhibitor is trametinib.

[0239] 117. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutical active agent is an EGFR inhibitor.

[0240] 118. In a further embodiment, the compound according to embodiment 117, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

[0241] 119. In a further embodiment, the compound according to embodiment 118, wherein the EGFR inhibitor is afatinib.

[0242] 120. In a further embodiment, the compound according to embodiment 118, wherein the EGFR inhibitor is cetuximab.

[0243] 121. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

[0244] 122. In a further embodiment, the compound according to embodiment 121, wherein the SHP2 inhibitor is RMC4550.

[0245] 123. In a further embodiment, the compound according to embodiment 121, wherein the SHP2 inhibitor is RMC4630.

[0246] 124. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutically active agent is a PI3K inhibitor.

[0247] 125. In a further embodiment, the compound according to embodiment 124, wherein the PI3K inhibitor is AMG511 or buparlisib.

[0248] 126. In a further embodiment, the compound according to embodiment 125, wherein the PI3K inhibitor is AMG511.

[0249] 127. In a further embodiment, the compound according to embodiment 125, wherein the PI3K inhibitor is buparlisib.

[0250] 128. In a further embodiment, the compound according to embodiment 107, wherein the at least one additional pharma- ceutically active agent is an AKT inhibitor.

[0251] 129. In a further embodiment, the compound according to embodiment 128, wherein the AKT inhibitor is AZD5363.

[0252] 130. In a further embodiment, KRAS G12C 2. The method of embodiment 1, wherein the inhibitor and the at least one additional pharma- ceutically active agent are administered simultaneously.

[0253] 131. In a further embodiment, KRAS G12C 2. The method of embodiment 1, wherein the inhibitor and the at least one additional pharma- ceutical active agent are administered separately.

[0254] Further embodiments of the present invention relate to KRAS G12C Further embodiments of the invention include combinations for the treatment of cancer, comprising an inhibitor of KRAS and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor. G12CIn a further embodiment of the invention, the present invention comprises a combination of a KRAS inhibitor and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor for the treatment of cancer. G12C The present invention also includes combination methods comprising the inhibitor and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor. Further embodiments of the present invention include combinations for the treatment of cancer, the combination comprising a KRAS G12C The combination comprises an inhibitor and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor, and the use includes self-administration of the combination agent.

[0255] Further embodiments of the present invention relate to KRAS G12C The present invention also includes a method of treating cancer comprising administering a combination therapy comprising an inhibitor of KRAS and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor. G12C The present invention also includes a method of treating cancer comprising prescribing to a subject in need thereof a combination therapy further comprising an inhibitor and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor.

[0256] Further embodiments of the present invention relate to KRAS G12C and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor, which methods further include listing the combination drug in a formulary and instructing a patient in need of such cancer treatment.

[0257] Further embodiments of the present invention relate to the use of KRAS inhibitors for the treatment of cancer.G12C and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor, comprising a patient in need of such cancer treatment purchasing the combination drug for self-administration.

[0258] Further embodiments of the present invention relate to KRAS G12C and another therapeutic agent selected from a chemotherapeutic agent, an anti-PD-1 inhibitor, a MEK inhibitor, a Pi3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor.

[0259] Further embodiments of the present invention include the use of the combinations described herein. A] Prescription, B] Sales and advertising for sales purposes; C] Purchase, D] Instructions for self-administration, or E] Administration (provided that the combination has been approved by a regulatory agency for the treatment of cancer in a subject in need thereof).

[0260] Further embodiments of the present invention relate to the treatment of cancer by inhibiting KRAS G12C The present invention also includes a method of supplying a combination drug comprising an inhibitor and another therapeutic agent selected from a chemotherapeutic agent, a PD-1 inhibitor, a MEK inhibitor, a PI3K selective inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, or an AKT inhibitor, the method including reimbursing a physician, a pharmacy, a patient, or an insurance company for the sale of the combination drug.

[0261] For clarity, the term "instructions" is meant to include labeling information approved by a regulatory agency, in addition to its commonly understood definition. [Brief description of the drawings]

[0262] [Figure 1] FIG. 1 shows that AMG510 in combination with carboplatin enhances growth inhibition of NCI-H358, NSCLC tumors. [Diagram 2] FIG. 2 shows that AMG510 in combination with the MEK inhibitor PD-325901 results in enhanced efficacy in the NCI-H358 xenograft model of NSCLC. [Diagram 3] FIG. 3 shows that AMG510 inhibits the growth of CT-26 KRAS p.G12C tumors in vivo. [Figure 4] Figure 4 shows that AMG510 in combination with an anti-PD-1 antibody results in increased survival and durable cures in a mouse model of KRAS p.G12C mutant cancer. [Diagram 5] FIG. 5 shows that treatment with AMG510 results in increased CD8+ and CD4+ T cell infiltration in CT-26 G12C-H10 tumors. [Figure 6] FIG. 6 shows that treatment with AMG510 results in an increase in PD-L1 positive neutrophils in CT-26 G12C-H10 tumors. [Figure 7] FIG. 7 shows that the additivity excess matrix identifies regions of synergistic interactions. [Figure 8] FIG. 8 experimentally demonstrates the additivity of the self-intersection matrix model. [Figure 9] FIG. 9 shows that AMG510 synergizes with both RMC-4550 (a SHP2i) and trametinib (a MEKi) to achieve cell killing in the NCI-H358 cell line. [Figure 10] FIG. 10 shows that the lack of single agent activity of afatinib or RMC-4550 may contribute to the relatively weak synergy in the MIA PaCA-2 cell line. [Figure 11] FIG. 11 shows that combination in 3D culture can reveal increased synergy. [Figure 12] FIG. 12 shows that AMG510×trametinib has synergistic activity in NCI-H358. [Figure 13] FIG. 13 shows the self-crossing of AMG in the NCI-H358 cell line. [Figure 14] FIG. 14 shows the self-crossing of trametinib in the NCI-H358 cell line. [Figure 15] FIG. 15 shows that AMG510×trametinib has weak synergy in the MIA PaCa-2 cell line. [Figure 16] FIG. 16 shows that 3D culture improves AMG510×trametinib synergy in MIA PaCa-2. [Figure 17] FIG. 17 shows AMG510×trametinib (3D) in NCI-H1373 cell line. [Figure 18] FIG. 18 shows that AMG510×trametinib has weak synergy due to the high potency of each single agent in CT-26 KRAS p.G12C. [Figure 19] FIG. 19 shows that AMG510×PD-325901 has weak synergistic effect in MIA PaCa-2. [Figure 20] FIG. 20 shows that AMG510×Afatinib has synergistic effects in NCI-H358 cell lines. [Figure 21] FIG. 21 shows that AMG510×Afatinib has weak synergy in the MIA PaCa-2 cell line. [Figure 22] FIG. 22 shows that 3D culture does not improve AMG510 x afatinib synergy in MIA PaCa-2 cell line. [Diagram 23] FIG. 23 shows AMG510 x Afatinib (3D) in NCI-H1373 cell line. [Figure 24] FIG. 24 shows that AMG510 x afatinib has modest synergy in CT-26 KRAS p.G12C. [Diagram 25] FIG. 25 shows that AMG510×Lapatinib has synergistic effects in NCI-H358 cell lines. [Figure 26]FIG. 26 shows that AMG x erlotinib has modest synergy in the NCI-H358 cell line. [Figure 27] FIG. 27 shows that no AMG510×erlotinib synergy is observed in the MIA PaCa-2 cell line due to the lack of erlotinib activity. [Figure 28] FIG. 28 shows that no AMG510 x cetuximab synergy is observed in SW837 due to the lack of cetuximab activity in vivo. [Figure 29] FIG. 29 shows that AMG510×RMC-4550 has synergistic effects in NCI-H358 cell lines. [Diagram 30] FIG. 30 shows that AMG510×RMC-4550 has weak synergistic activity in the MIA PaCa-2 cell line. [Diagram 31] FIG. 31 shows that AMG510×RMC-4550 has modest synergy in CT-26 KRAS p.G12C. [Diagram 32] FIG. 32 shows that AMG510×AMG511 has modest synergistic activity in the NCI-H358 cell line. [Diagram 33] FIG. 33 shows that AMG510×AMG511 has weak synergistic effect in the MIA PaCa-2 cell line. [Diagram 34] FIG. 34 shows that AMG510×AMG511 has modest synergy in CT-26 KRAS p.G12C. [Diagram 35] FIG. 35 shows that AMG510 x buparlisib (BKM120) has modest synergy in the NCI-H358 cell line. [Diagram 36] FIG. 36 shows that AMG510×AZD5363 has weak synergistic effect in NCI-H358 cell line. [Figure 37] FIG. 37 shows that AMG5120×AZD5363 has weak synergy in MIA PaCa-2. [Figure 38]FIG. 38 shows that AMG510 inhibits KRAS signaling in CT-26 KRAS p.G12C in 2D culture. [Figure 39] Figure 39 shows that mouse CT-26 KRAS p.G12C cells are sensitive to AMG510 in 3D culture. [Figure 40-1] Figure 40(a) shows the X-ray co-crystal structure of KRASG12C / C51S / C80L / C118S bound to GDP and ARS-1620 (PDB ID: 5V9U). Figure 40(b) shows the X-ray co-crystal structure of KRASG12C / C51S / C80L / C118S bound to GDP and AMG510 at 1.65 Å resolution (PDB ID: not yet assigned). Figure 40(c) shows the biochemical activity of AMG510 and ARS-1620 measured in a SOS1-catalyzed nucleotide exchange assay using purified KRASG12C / C118A or KRASC118A proteins (n=4). [Figure 40-2] Figure 40(d) shows the kinetic properties of AMG510 and ARS-1620 as determined by mass spectrometry (n>2). Figure 40(e) shows the cellular activity of AMG510 and ARS-1620 in NCI-H358 and MIA PaCa-2 as measured by inhibition of ERK1 / 2 phosphorylation after 2 hours of treatment (n=2). [Figure 40-3] Figure 40(f) shows inhibition of ERK phosphorylation and KRASG12C occupancy by AMG510 in NCI-H358 and MIA PaCa-2 cells after 2 hours of treatment (n=3). Figure 40(g) shows the cellular activity of AMG510 and ARS-1620 in NCI-H358 and MIA PaCa-2 cells as measured by the effect on cell viability after 72 hours of treatment (n=3). [Figure 40-4] FIG. 40(h) shows the kinetic properties of AMG510 and ARS-1620 as determined by inhibition of ERK phosphorylation (n≧2). [Figure 41-1]Figure 41(a) shows the effect on cell signaling in NCI-H358 or MIA PaCa-2 after 4 or 24 hour treatment along with the dose response of AMG510. Figure 41(b) shows the effect on cell signaling in NCI-H358 or MIA PaCa-2 after treatment with 0.1 μM AMG510 for time points up to 24 hours. [Figure 41-2] Figure 41(c) shows the cellular activity of AMG510 across a panel of KRAS p.G12C and non-KRAS p.G12C mutant cell lines as measured by inhibition of ERK1 / 2 phosphorylation after 2 hours of treatment (n>2). Figure 41(d) shows the cellular activity of AMG510 across a panel of KRAS p.G12C and non-KRAS p.G12C mutant cell lines as measured by effects on cell viability after 72 hours of treatment. [Figure 41-3] Figure 41(e) shows that the viability dose-response curves are representative of at least n=2 experiments. Effect of 72 h treatment with AMG510 on cell viability under adherent monolayer or spheroid culture conditions (n=2). Figure 41(f) shows cysteine ​​proteome analysis of NCI-H358 whole cell lysates after 4 h treatment with 1 μM AMG510 (n=5). [Figure 42-1] Figure 42(a), (b) shows that AMG510 inhibits ERK1 / 2 phosphorylation in KRAS p.G12C mutant tumors in vivo. Mice bearing MIA PaCa-2 T2 (Figure 42(a)) or NCI-H358 (Figure 42(b)) tumors were administered a single dose of either vehicle or AMG510 (all other bars) orally and harvested 2 hours later (Figure 42(a), (b)) and assessed for p-ERK levels measured by MSD immunoassay. Plasma and tumor samples were collected and analyzed for AMG510 concentrations (red triangles, open black circles, respectively). Data are presented as percent of vehicle control. Data represent mean tumor volume ± SEM (n=3 / group). Figure 42(a), (b), ****P<0.0001; *P<0.05 by Dunnett's method. [Figure 42-2]Figure 42(c), (d) shows that AMG510 inhibits ERK1 / 2 phosphorylation in KRAS p.G12C mutant tumors in vivo. Mice bearing MIA PaCa-2 T2 tumors were administered a single dose of either vehicle or AMG510 (all other bars) orally, harvested over time as indicated, and assessed for p-ERK levels measured by MSD immunoassay. Plasma and tumor samples were collected and analyzed for AMG510 concentrations (red triangles, open black circles, respectively). Data are presented as percent of vehicle control. Data represent mean tumor volume ± SEM (n=3 / group). ****P<0.0001; *P<0.05 by Dunnett's method. Figure 42(e) shows the results of AMG510 treatment over a dosing regimen of covalent modification of KRASG12C using mass spectrometry, which correlates with p-ERK inhibition in mice with MIA PaCa-2 T2. Figure 42(f) shows the results of AMG510 treatment over a dosing regimen of covalent modification of KRASG12C using mass spectrometry, which correlates with p-ERK inhibition in mice with NCI-H358. Figure 42(g) shows the results of AMG510 treatment over time of covalent modification of KRASG12C using mass spectrometry, which correlates with p-ERK inhibition in mice with MIA PaCa-2 T2. [Figure 43-1]Figure 43(a) shows mice bearing established MIA PaCa-2 T2 KRAS p.G12C tumors were administered either vehicle or AMG510. AMG510 selectively inhibits the in vivo growth of KRAS p.G12C mutant tumors. Data represent mean tumor volume ± SEM (n=10 / group). ****P<0.0001, *P<0.05 (vehicle vs. treatment group by Dunnett's method), #P<0.05 (paired t-test regression), ****P<0.0001 by RM two-way ANOVA. Figure 43(b) shows mice bearing established NCI-H358 KRAS p.G12C tumors were administered either vehicle or AMG510. AMG510 selectively inhibits the in vivo growth of KRAS p.G12C mutant tumors. Data represent mean tumor volume ± SEM (n=10 / group). ****P<0.0001, *P<0.05 (vehicle vs. treatment groups by Dunnett's method), #P<0.05 (paired t-test regression), ****P<0.0001 by RM two-way ANOVA. [Figure 43-2] Figure 43(c) shows mice bearing established CT-26 KRAS p.G12C tumors were administered either vehicle or AMG510. AMG510 selectively inhibits the in vivo growth of KRAS p.G12C mutant tumors. Data represent mean tumor volume ± SEM (n=10 / group). ****P<0.0001, *P<0.05 (vehicle vs. treatment group by Dunnett's method), #P<0.05 (paired t-test regression), ****P<0.0001 (by RM two-way ANOVA). Figure 43(d) shows the effect on tumor growth in the KRASG12CNSCLC PDX model with mice treated with either vehicle or AMG510. AMG510 selectively inhibits the in vivo growth of KRAS p.G12C mutant tumors. Data represent mean tumor volume ± SEM (n=10 / group). [Figure 43-3]Figure 43(e) shows CT scans from two KRAS p.G12C lung cancer patients treated with AMG510. Representative pre-treatment ("baseline") and post-treatment (Rx) scans. Left: top panel represents the upper left lobe of the lung, bottom panel represents the lower right lobe of the lung. Right: top panel represents the upper left lobe of the lung, bottom panel represents the pleura. AMG510 selectively inhibits the in vivo growth of KRAS p.G12C mutant tumors. Figure 43(f) shows mice bearing CT-26 KRAS p.G12C tumors were administered vehicle or AMG510. Plots of individual CT-26 KRAS p.G12C tumors from AMG510-treated mice (100 mg / kg). Figure 43(g) shows mice bearing CT-26 KRAS p.G12C tumors were administered vehicle or AMG510. Plots of individual CT-26 KRAS p.G12C tumors from AMG510-treated mice (200 mg / kg). Continued treatment with the 100 mg / kg group suggested that regression was not sustained (Fig. 3i), likely due to incomplete inhibition of p-ERK (Extended Data Fig. 2a). Accordingly, a 200 mg / kg dose of AMG510 was evaluated, resulting in near-complete inhibition of p-ERK (Extended Data Fig. 2a) and durable cures in 8 of 10 cases (Fig. 3j), with plasma levels of AMG510 just below the cellular IC90 (Extended Data Fig. 2h). [Figure 44-1] Figure 44(a) shows AMG510 in combination with carboplatin against NCI-H358 tumor xenografts. Data represent mean tumor volume ± SEM (n=10 / group). a***P<0.001 (Dunnett's comparison of combination treatment to each single agent), #P<0.001 (paired t-test regression), c****P<0.001 (Dunnett's comparison of combination treatment to each single agent), #P<0.001 (paired t-test regression). Results from all treatment groups were significant compared to vehicle (****P<0.0001 (Dunnett's)). Figure 44(b) shows the synergy score of AMG510 in combination with targeted agents calculated using the Loewe additive excess algorithm and is presented as a heat map with higher scores (darker red) indicating stronger synergistic interactions. [Figure 44-2]Figure 44(c) depicts AMG510 in combination with MEK inhibitor (PD-0325901) on NCI-H358 tumor xenografts. Data represent mean tumor volume ± SEM (n=10 / group). a***P<0.001 (Dunnett's comparison of combination treatment to each single agent), #P<0.001 (paired t-test regression), c****P<0.001 (Dunnett's comparison of combination treatment to each single agent), #P<0.001 (paired t-test regression). Results from all treatment groups were significant compared to vehicle (****P<0.0001 (Dunnett's)). [Figure 45-1] Figure 45(a) shows the growth of CT-26 KRAS p.G12C tumors in individual mice treated with either vehicle, AMG510, anti-PD-1, or AMG510 in combination with anti-PD-1 (n=10 / group). The line with circles represents tumor-free mice. Figure 45(b) shows Kaplan Meier analysis of surrogate survival endpoint (tumor size >800 mm3). Mantel-Cox ****P<0.001 vs. vehicle control; #P<0.005 vs. AMG510 or combination vs. anti-PD-1 alone. [Figure 45-2] Figure 45(c) shows CT-26 KRAS p.G12C tumors from mice treated with either vehicle, AMG510, anti-PD-1, AMG510 combined with anti-PD-1, or MEKi for 4 days and immunophenotyped by flow cytometry (n=8 / group). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 (by Tukey's method compared to vehicle control); NS=not significant. Figure 45(d) shows RNA was isolated from CT-26 KRAS p.G12C tumors after 2 days of treatment (n=5 / group). Gene expression and scores were calculated by NanoString technology (see Methods). ****P<0.0001, ***P<0.001 (by Tukey's method). [Figure 45-3]Figure 45(e) shows cell surface expression of MHC class I antigen H-2Kd on CT-26 KRAS p.G12C cells after 24 hours of treatment with AMG510 in the presence or absence of interferon gamma ("IFNγ"), as measured by flow cytometry. Levels of secreted IFN-γ were measured by ELISpot assay (n=4-5 / group). Figure 45(f) shows individual tumor growth in mice cured with AMG510+anti-PD-1 treatment and rechallenged with CT-26 KRAS p.G12C, CT-26, or 4T1 cells. [Figure 45-4] Figure 45(g) shows that spleen cells were harvested and challenged with the indicated cells, CT-26, CT-26 KRAS p.G12C or 4T1 cells. *P=0.0269 (unpaired t-test comparison of control vs. combination). Figure 45(h) shows that AMG510 treatment induces a proinflammatory tumor microenvironment. The immunophenotype of CT-26 KRAS p.G12C tumors from mice treated with either vehicle, AMG510, anti-PD-1, AMG510 combined with anti-PD-1, or MEKi for 4 days was determined by immunohistochemistry (n=5 / group), immunohistochemistry for CD3 / Ki67. Ki67 immunopositive staining is blue for nuclei, and CD3 and CD8 immunopositive staining is brown for cytoplasm. Arrows in (h) point to examples of cells with double immunopositivity for CD3 and Ki67. [Figure 45-5] Figure 45(i) shows that treatment with AMG510 induces a proinflammatory tumor microenvironment, and the immunophenotype of CT-26 KRAS p.G12C tumors from mice treated for 4 days with either vehicle, AMG510, anti-PD-1, AMG510 in combination with anti-PD-1, or MEKi was determined by immunohistochemistry (n=5 / group), immunohistochemistry for CD8. Ki67 immunopositive staining is blue for nuclei, and CD3 and CD8 immunopositive staining is brown for cytoplasm. [Figure 46-1]Figure 46(a) shows the biochemical activity of AMG510 and its non-reactive propionamide analogue as measured in a SOS1-catalyzed nucleotide exchange assay using purified KRASG12C / C118A or KRASC118A proteins (n≧2). Data represent the mean ± SD for the number of independent replicates shown. Figure 46(b) shows the calculated maximum reaction velocity and the concentrations of AMG510 and ARS-1620 that achieve half the maximum velocity. Data represent the mean ± SD for the number of independent replicates shown. Figure 46(c) shows the inhibition of ERK phosphorylation by RMC-4550 in NCI-H358 cells with t1 / 2=12.2 min (n=2). Data represent the mean ± SD for the number of independent replicates shown. [Figure 46-2] Figure 46(d) shows the effect of 72 h treatment with AMG510 on cell viability of MIA PaCa-2 and NCI-H1373 in adherent monolayer or spheroid culture conditions (n=2). Data represent the mean ± SD for the number of independent replicates shown. Figure 46(e) shows the determination of the half-life of KRAS in MIA PaCa-2 and NCI-H358 cells by Stable Isotope Labeling by / with Amino acids in Cell culture (SILAC). Data represent the mean ± SD for the number of independent replicates shown. [Figure 47-1]Figure 47(a)-(c) shows that mice bearing CT-26 KRAS p.G12C tumors were treated orally with a single dose of vehicle or with the indicated doses of AMG510 and harvested 2 hours later. Levels of p-ERK were measured by MSD immunoassay. Plasma and tumor samples were harvested and analyzed for AMG510 concentrations (red triangles, open black circles, respectively). Data are presented as percent of control (POC) relative to vehicle. ****P<0.0001, *P<0.05 (Dunnett's comparison to vehicle). Figure 47(d) shows that treatment with AMG510 results in covalent modification of KRASG12C that inversely correlates with p-ERK inhibition. Figure 47(e) shows the effect of AMG510 on tumor growth in the SW480-1AC xenograft model. Treatment was initiated when tumors reached approximately 200 mm3. ****P<0.0001 by RM two-way ANOVA. Figure 47(f) shows the effect of AMG510 treatment on tumor growth in KRASG12CSCLC PDX models. Treatment was initiated when tumors reached approximately 200 mm3. ****P<0.0001 by RM two-way ANOVA. Figure 47(g) shows plasma levels of AMG510 from MIA PaCa-2 T2, NCI-H358 xenografts. Figure 47(h) shows plasma levels of AMG510 from CT-26 KRAS p.G12C xenografts. Figure 47(i) shows individual CT-26 KRAS p.G12C tumor plots of AMG510 treated mice (200 mg / kg) in BALB / c nude mice from day 14 to day 32. [Figure 47-2] Figure 47(j) shows CT scans of two KRAS p.G12C lung cancer patients treated with AMG510. Additional representative pre-treatment ("Baseline") and post-treatment (Rx) scans of the patient previously described in Figure 43d are (top to bottom on the left side): upper left lobe, lower left lobe, lymph node, upper left lobe, upper left lobe. On the right side (top to bottom): lower left lobe, lower left lobe, pleura, and adrenal gland. [Figure 47-3]Figure 47(k) shows AMG510 as a single agent or in combination with carboplatin against NCI-H358 tumor xenografts. ****P<0.001 (Dunnett's comparison to vehicle control), #P<0.001 (paired t-test regression). [Figure 48-1] Figure 48 shows the growth inhibition matrix and Loewe additive excess of AMG510 administered in combination with targeted agents in the indicated cell lines, with darker colors indicating greater cell killing (growth inhibition) and stronger synergistic interactions (Loewe excess). The maximum tested concentration of inhibitor and the dose range covered by the matrix of each combination are noted. Individual heterogeneous combinations (AxB) were evaluated by comparing their respective synergy scores to the synergy scores of their components' self-crossovers (AxA or BxB). Heterogeneous combinations were considered synergistic only if their synergy scores exceeded 3 times the self-crossover synergy scores of either component. [Figure 48-2] Figure 48 shows the growth inhibition matrix and Loewe additive excess of AMG510 administered in combination with targeted agents in the indicated cell lines, with darker colors indicating greater cell killing (growth inhibition) and stronger synergistic interactions (Loewe excess). The maximum tested concentration of inhibitor and the dose range covered by the matrix of each combination are noted. Individual heterogeneous combinations (AxB) were evaluated by comparing their respective synergy scores to the synergy scores of their components' self-crossovers (AxA or BxB). Heterogeneous combinations were considered synergistic only if their synergy scores exceeded 3 times the self-crossover synergy scores of either component. [Figure 48-3]Figure 48 shows the growth inhibition matrix and Loewe additive excess of AMG510 administered in combination with targeted agents in the indicated cell lines, with darker colors indicating greater cell killing (growth inhibition) and stronger synergistic interactions (Loewe excess). The maximum tested concentration of inhibitor and the dose range covered by the matrix of each combination are noted. Individual heterogeneous combinations (AxB) were evaluated by comparing their respective synergy scores to the synergy scores of their components' self-crossovers (AxA or BxB). Heterogeneous combinations were considered synergistic only if their synergy scores exceeded 3 times the self-crossover synergy scores of either component. [Figure 48-4] Figure 48 shows the growth inhibition matrix and Loewe additive excess of AMG510 administered in combination with targeted agents in the indicated cell lines, with darker colors indicating greater cell killing (growth inhibition) and stronger synergistic interactions (Loewe excess). The maximum tested concentration of inhibitor and the dose range covered by the matrix of each combination are noted. Individual heterogeneous combinations (AxB) were evaluated by comparing their respective synergy scores to the synergy scores of their components' self-crossovers (AxA or BxB). Heterogeneous combinations were considered synergistic only if their synergy scores exceeded 3 times the self-crossover synergy scores of either component. [Figure 48-5] Figure 48 shows the growth inhibition matrix and Loewe additive excess of AMG510 administered in combination with targeted agents in the indicated cell lines, with darker colors indicating greater cell killing (growth inhibition) and stronger synergistic interactions (Loewe excess). The maximum tested concentration of inhibitor and the dose range covered by the matrix of each combination are noted. Individual heterogeneous combinations (AxB) were evaluated by comparing their respective synergy scores to the synergy scores of their components' self-crossovers (AxA or BxB). Heterogeneous combinations were considered synergistic only if their synergy scores exceeded 3 times the self-crossover synergy scores of either component. [Figure 48-6]Figure 48 shows the growth inhibition matrix and Loewe additive excess of AMG510 administered in combination with targeted agents in the indicated cell lines, with darker colors indicating greater cell killing (growth inhibition) and stronger synergistic interactions (Loewe excess). The maximum tested concentration of inhibitor and the dose range covered by the matrix of each combination are noted. Individual heterogeneous combinations (AxB) were evaluated by comparing their respective synergy scores to the synergy scores of their components' self-crossovers (AxA or BxB). Heterogeneous combinations were considered synergistic only if their synergy scores exceeded 3 times the self-crossover synergy scores of either component. [Figure 49] Figure 49(a) shows the cellular activity of AMG510 and the MEK inhibitor trametinib in CT-26 KRAS p.G12C and parental CT-26 cell lines as measured by inhibition of ERK1 / 2 phosphorylation after 2 hours of treatment (n≧2). Figure 49(b) shows the cellular activity of AMG510 and the MEK inhibitor trametinib in CT-26 KRAS p.G12C and parental CT-26 cell lines as measured by the effect on cell viability after 72 hours of treatment in spheroid cultures (n=2). [Figure 50-1]Figure 50(a) shows CT-26 KRAS p.G12C tumors in mice treated with either vehicle, AMG510, anti-PD-1, AMG510 in combination with anti-PD-1, or MEKi for 4 days and immunophenotyped by flow cytometry (n=8 / group). *P<0.05 (Tukey's method vs. vehicle control); NS not significant; ***P<0.001 (Dunnett's method vs. vehicle); ****P<0.0001 (Dunnett's method vs. vehicle control). Figure 50(b) shows mice bearing CT-26 KRAS p.G12C tumors were treated with a single oral dose of vehicle (black bars) or oral MEKi (blue bars) at the indicated doses and harvested 2 hours later. p-ERK levels were measured by MSD immunoassay. Plasma and tumor samples were collected and analyzed for MEKi concentration (red triangles, open black circles, respectively). Data are presented as percent of control (POC) of vehicle. *P<0.05 (Tukey's method vs. vehicle control); NS is not significant; ***P<0.001 (Dunnett's method vs. vehicle); ****P<0.0001 (Dunnett's method vs. vehicle control). Figure 50(c) shows the effect of MEKi treatment on tumor growth over time was measured in mice bearing CT-26 KRAS p.G12C tumors. Data represent mean tumor volume ± SEM (n=10 / group). *P<0.05 (Tukey's method vs. vehicle control); NS is not significant; ***P<0.001 (Dunnett's method vs. vehicle); ****P<0.0001 (Dunnett's method vs. vehicle control). [Figure 50-2]Figure 50(d) shows tumor volumes of mice bearing CT-26 KRAS p.G12C tumors treated with either vehicle, AMG510, anti-PD-1, AMG510 + anti-PD-1, or MEKi for 4 days. Data represent mean tumor volume ± SEM (n=8 / group). Figure 50(e) shows RNA was isolated from CT-26 KRAS p.G12C tumors after 2 days of treatment. Gene expression and scores were calculated by NanoString technology (n=5 / group). *P<0.05 (Tukey's method vs. vehicle control); NS is not significant; ***P<0.001 (Dunnett's method vs. vehicle); ****P<0.0001 (Dunnett's method vs. vehicle control). [Figure 50-3] Figure 50(f) shows cell surface expression of MHC class I antigens (H-2Dd and H-2Ld) on CT-26 KRAS p.G12C cells after 24 hours of treatment with AMG510 in the presence or absence of IFNγ, as measured by flow cytometry. Figure 50(g) shows growth curves of Balb / c mice bearing either CT-26 or CT-26 KRAS p.G12C tumors. Figure 50(h) shows quantification of CXCL10 or CXCL11 transcripts and secreted IP-10 protein after 24 hours of treatment of parental CT-26 or CT-26 KRAS p.G12C cells with AMG510 or MEKi. [Figure 50-4] Figure 50(i) shows cell surface expression of MHC class I antigens (HLA, H-2Dd and H-2Kd) on CT-26 KRAS p.G12C cells after 24 hours treatment, together with SW-1573 after 48 hours treatment and MIA PaCA-2 after 48 hours treatment, with AMG510 in the presence or absence of IFNγ, as measured by flow cytometry. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0263] The present invention relates to a method for the treatment of cancer, in particular to a method for the treatment of cancer G12C The present invention also provides combination therapies comprising a KRAS inhibitor and one or more additional pharma- ceutical active agents for the treatment of cancer.G12C The present invention relates to a pharmaceutical composition comprising an inhibitor and one or more additional pharma- ceutical active agents. The compounds disclosed herein all include pharma- ceutical acceptable isotopically labeled compounds (wherein one or more atoms of the compounds disclosed herein are replaced by an atom having the same atomic number but different atomic mass or mass number from the atomic mass or mass number usually found in nature). Examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, chlorine, and iodine, such as 2H, 3H, 11C, 13C, 14C, 13N, 15N, 15O, 17O, 18O, 31P, 32P, 35S, 18F, 36Cl, 123I, and 125I, respectively. These radiolabeled compounds can be useful to help determine or measure the effectiveness of a compound, for example, by characterizing the site or mode of action, or the binding affinity to a pharmacologically important site of action. Certain isotopically labeled compounds of the present disclosure, such as those incorporating a radioactive isotope, are useful in drug and / or substrate tissue distribution studies. The radioactive isotopes tritium, i.e., 3H, and carbon-14, i.e., 14C, are particularly useful for this purpose in view of their ease of incorporation and ready means of detection.

[0264] Substitution with heavier isotopes such as deuterium, ie, 2H, may afford certain therapeutic advantages resulting from greater metabolic stability, such as increased in vivo half-life or reduced dosage requirements, and therefore may be preferred in certain circumstances.

[0265] Substitution with positron emitting isotopes such as 11C, 18F, 15O and 13N can be useful in Positron Emission Topography (PET) studies to examine substrate receptor occupancy. Isotopically labeled compounds of structure (I) can generally be prepared by conventional techniques well known to those skilled in the art, or by processes analogous to those described in the Preparations and Examples below, substituting the appropriate isotopically labeled reagents for the non-labeled reagents previously used.

[0266] Isotopically labeled compounds disclosed herein can generally be prepared by conventional methods well known to those of skill in the art, or by methods analogous to those described in the accompanying Examples and Schemes, substituting appropriate isotopically labeled reagents for previously used non-labeled reagents.

[0267] Some of the compounds disclosed herein may exist as stereoisomers (i.e., isomers that differ only in the spatial arrangement of atoms), including optical isomers and conformers (or conformers). The compounds disclosed herein include all stereoisomers, both as pure individual stereoisomer preparations and enriched preparations, as well as racemic mixtures of such stereoisomers, and as individual diastereomers and enantiomers that can be separated according to methods well known to those skilled in the art. Additionally, the compounds disclosed herein include all tautomeric forms of the compounds.

[0268] Some of the compounds disclosed herein may exist as atropisomers, which are conformational stereoisomers that arise when rotation around a single bond in a molecule is hindered or greatly slowed down as a result of steric interactions with other parts of the molecule. The compounds disclosed herein include all atropisomers, both as pure individual atropisomer preparations and enriched preparations, or as non-specific mixtures of each. If the rotation barrier around a single bond is sufficiently high and the interconversion between conformations is sufficiently slow, separation and isolation of isomeric species may be possible. Separation and isolation of isomeric species is appropriately indicated by the well-known and accepted symbols "M" or "P".

[0269] In another embodiment, these compounds may be used as intermediates in processes to produce the compounds of the present application.

[0270] In another embodiment, these compounds may be in the form of a pharma- ceutically acceptable salt and may be in the form of a pharmaceutical formulation with pharma- ceutically acceptable excipients.

[0271] Also provided herein are pharmaceutical compositions comprising the compounds disclosed herein together with a pharma- ceutically acceptable excipient, such as a diluent or carrier. Compounds and pharmaceutical compositions suitable for use in the present invention include those in which the compound can be administered in an amount effective to achieve its intended purpose. Administration of the compounds is described in more detail below.

[0272] In another embodiment, these compounds may be used as intermediates in processes to produce the compounds of the present application.

[0273] In another embodiment, these compounds may be in the form of a pharma- ceutically acceptable salt and may be in a pharmaceutical dosage form with pharma- ceutically acceptable excipients.

[0274] Also provided herein are pharmaceutical compositions comprising the compounds disclosed herein together with a pharma- ceutically acceptable excipient, such as a diluent or carrier. Compounds and pharmaceutical compositions suitable for use in the present invention include those in which the compound can be administered in an amount effective to achieve its intended purpose. Administration of the compounds is described in more detail below.

[0275] Those skilled in the art can determine the appropriate pharmaceutical dosage form depending on the administration route and the desired dose. For example, see Remington's Pharmaceutical Sciences, 1435-712 (18th ed., Mack Publishing Co, Easton, Pennsylvania, 1990). The dosage form can affect the physical state, stability, in vivo release rate, and in vivo elimination rate of the administered drug. Depending on the administration route, the appropriate dose can be calculated according to body weight, body surface area, or organ size. Further refinement of the calculation required to determine the appropriate therapeutic dose can be made by those skilled in the art without undue experimentation as a routine, especially in light of the dosage information and analysis disclosed herein, and pharmacokinetic data obtained through animal or human clinical trials.

[0276] The phrases "pharmacologically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans. As used herein, "pharmacologically acceptable" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such excipients for pharma-ceutically active substances is well known in the art. Insofar as any conventional media or agent is not incompatible with the therapeutic composition, its use in the therapeutic composition is contemplated. Supplementary active ingredients can also be incorporated into the composition. In an exemplary embodiment, the formulation comprises corn syrup solids, high oleic safflower oil, coconut oil, soybean oil, L-leucine, tricalcium phosphate, L-tyrosine, L-proline, L-lysine acetate, DATEM (emulsifier), L-glutamine, L-valine, dipotassium phosphate, L-isoleucine, L-arginine, L-alanine, glycine, L-asparagine monohydrate, L-serine, potassium citrate, L-threonine, sodium citrate, magnesium chloride, L-histidine, L-methionine, ascorbic acid, calcium carbonate, L-glutamic acid, L-cystine dihydrochloride, May include L-tryptophan, L-aspartic acid, choline chloride, taurine, m-inositol, ferrous sulfate, ascorbyl palmitate, zinc sulfate, L-carnitine, alpha-tocopheryl acetate, sodium chloride, niacinamide, tocopherol mixture, calcium pantothenate, copper sulfate, thiamine chloride hydrochloride, vitamin A palmitate, manganese sulfate, riboflavin, pyridoxine hydrochloride, folic acid, beta-carotene, potassium iodide, phylloquinone biotin, sodium selenate, chromium chloride, sodium molybdate, vitamin D3, and cyanocobalamin.

[0277] The compounds may be present in the pharmaceutical composition as pharma- ceutically acceptable salts. As used herein, "pharmaceutically acceptable salts" includes, for example, base addition salts and acid addition salts.

[0278] Pharmaceutically acceptable base addition salts can be formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Pharmaceutically acceptable salts of compounds can also be prepared with pharma- ceutically acceptable cations. Suitable pharma-ceutically acceptable cations are well known to those skilled in the art and include alkali, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or bicarbonates are also possible. Examples of metals used as cations include sodium, potassium, magnesium, ammonium, calcium, or ferric. Examples of suitable amines include isopropylamine, trimethylamine, histidine, N,N'-dibenzylethylenediamine, procaine chloride, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine.

[0279] Pharmaceutically acceptable acid addition salts include inorganic or organic acid salts. Examples of suitable acid salts include hydrochloride, formate, acetate, citrate, salicylate, nitrate, and phosphate. Other suitable pharma-ceutically acceptable salts are well known to those skilled in the art, and include, for example, formic acid, acetic acid, citric acid, oxalic acid, tartaric acid, or mandelic acid, hydrochloric acid, hydrobromic acid, sulfuric acid, or phosphoric acid; organic carboxylic acid, sulfonic acid, sulfoacid, or phosphoacid, or N-substituted sulfamic acid, such as acetic acid, trifluoroacetic acid (TFA), propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, dihydrogen benzoic acid, nitric ... those with cotinic acid or isonicotinic acid; and those with the 20 alpha amino acids involved in the synthesis of natural proteins, such as glutamic acid or aspartic acid, and also those with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane 1,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfonic acid, naphthalene 2-sulfonic acid, naphthalene 1,5-disulfonic acid, 2- or 3-phosphoglyceric acid, glucose 6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamate), or other acidic organic compounds such as ascorbic acid.

[0280] Pharmaceutical compositions containing the compounds disclosed herein can be manufactured in a conventional manner, for example, by conventional mixing, dissolving, granulating, dragee-making, pulverizing, emulsifying, encapsulating, entrapping, or lyophilizing processes. The appropriate dosage form depends on the route of administration chosen.

[0281] For oral administration, suitable compositions can be easily formulated by combining the compounds disclosed herein with pharma- ceutically acceptable excipients, such as carriers well known in the art. Such excipients and carriers allow the compounds of the present invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by the patient to be treated. Pharmaceutical preparations for oral use can be obtained by adding solid excipients to the compounds disclosed herein, optionally grinding the resulting mixture, adding suitable auxiliary agents as necessary, and then processing the mixture of granules to obtain tablets or dragee cores. Suitable excipients include, for example, fillers and cellulose preparations. Disintegrants can be added as necessary. Pharmaceutically acceptable ingredients are well known for various types of formulations, and can be, for example, binders (e.g., natural or synthetic polymers), lubricants, surfactants, sweeteners and flavors, coating materials, preservatives, dyes, thickeners, adjuvants, antibacterial agents, antioxidants, and carriers for various formulation types.

[0282] When a therapeutically effective amount of a compound disclosed herein is administered orally, the composition will typically be in the form of a solid (e.g., a tablet, capsule, pill, powder, or lozenge) or a liquid preparation (e.g., an aqueous suspension, solution, elixir, or syrup).

[0283] When administered in tablet form, the composition may further contain a functional solid and / or solid carrier, such as gelatin or an adjuvant. The tablet, capsule, and powder may contain about 1 to about 95% of the compound, preferably about 15 to about 90% of the compound.

[0284] When administered in liquid or suspension form, functional liquids and / or liquid carriers, such as water, petroleum, or oils of animal or plant origin, can be added. Liquid forms of the composition can further contain saline, sugar alcohol solutions, dextrose or other sugar solutions, or glycols. When administered in liquid or suspension form, the composition can contain about 0.5 to about 90% by weight of the compounds disclosed herein, preferably about 1 to about 50% of the compounds disclosed herein. In one contemplated embodiment, the liquid carrier is non-aqueous or substantially non-aqueous. For administration in liquid form, the composition can be supplied as a rapidly dissolving solid formulation for dissolution or suspension immediately prior to administration.

[0285] When a therapeutically effective amount of the compounds disclosed herein is administered by intravenous, cutaneous, or subcutaneous injection, the composition is in the form of a pyrogen-free, parenterally acceptable aqueous solution. It is within the skill of the art to prepare such parenterally acceptable solutions, taking into due consideration pH, isotonicity, stability, and the like. A preferred composition for intravenous, cutaneous, or subcutaneous injection usually contains an isotonic vehicle in addition to the compounds disclosed herein. Such compositions can be prepared to be administered as a solution of a free base or a pharmacologically acceptable salt in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations can optionally contain a preservative to prevent the growth of microorganisms.

[0286] Injectable compositions can include sterile aqueous solutions, suspensions, or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions, suspensions, or dispersions. In all embodiments, the form must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must resist the contaminating action of microorganisms, such as bacteria and fungi, optionally by including preservatives. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. In one possible embodiment, the carrier is non-aqueous or substantially non-aqueous. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size of the compound in dispersion embodiments, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many embodiments, it is preferable to include an isotonic agent, for example, sugar or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0287] Sterile injection solution is prepared by incorporating the required amount of active compound in a suitable solvent together with various other ingredients as listed above if necessary, followed by filtration sterilization.Generally, dispersion is prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium as listed above and other necessary ingredients.In the embodiment of sterile powder for preparing sterile injection solution, the preferred preparation method is vacuum drying and freeze-drying technique, which obtains the powder of active ingredient and any additional desired ingredient from their solution that has been previously sterilized and filtered.

[0288] Slow release or sustained release formulations can also be prepared to achieve controlled release of active compound upon contact with body fluids in the digestive tract and provide a substantially constant and effective plasma concentration of active compound. For example, release can be controlled by one or more of dissolution, diffusion, and ion exchange. In addition, sustained release approaches can enhance absorption through saturable or restricted pathways in the GI tract. For example, the compound can be embedded in a matrix of biodegradable polymers, water-soluble polymers, or a mixture of both, and optionally a suitable surfactant for this purpose. Embedding in this context means incorporating microparticles into a polymer matrix. Controlled release formulations can also be obtained by encapsulation of dispersed microparticles or emulsified microdroplets by well-known dispersion or emulsion coating techniques.

[0289] For administration by inhalation, the compounds of the present invention are conveniently delivered in the form of an aerosol spray dispensed from a pressurized container or nebulizer using a suitable propellant. In pressurized aerosol embodiments, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges, for example of gelatin, for use in an inhaler or insufflator can be formulated to contain a powder mix of the compound and a suitable powder base, such as lactose or starch.

[0290] The compounds disclosed herein can be formulated for parenteral administration by injection (e.g., bolus injection or continuous infusion). The injection preparation can be provided in unit dosage form (e.g., in ampoules or multi-dose containers) with added preservatives. The composition can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing, and / or dispersing agents.

[0291] Pharmaceutical preparations for parenteral administration include aqueous solutions of the compound in water-soluble form. Additionally, suspensions of the compound can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils or synthetic fatty acid esters. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension. Optionally, the suspension can also contain suitable stabilizers or agents that increase the solubility of the compound, allowing for the preparation of highly concentrated solutions. Alternatively, the composition can be in powder form for constitution with a suitable vehicle (e.g., sterile pyrogen-free water) before use.

[0292] The compounds disclosed herein can also be formulated into rectal compositions such as suppositories or retention enemas (e.g., containing conventional suppository bases). In addition to the formulations described above, the compounds can also be formulated as depot preparations. Such long-acting preparations can be administered by implantation (e.g., subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil), or ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt.

[0293] In particular, the compounds disclosed herein can be administered orally, bucally, or sublingually in the form of tablets containing excipients such as starch or lactose, or in the form of capsules or ovoids, alone or in mixtures with excipients, or in the form of elixirs or suspensions containing flavorings or colorings. Such liquid preparations can be prepared with pharma- ceutically acceptable additives, such as suspending agents. The compounds can also be injected parenterally, for example, intravenously, intramuscularly, subcutaneously, or intracoronarily. For parenteral administration, the compounds are most often used in the form of a sterile aqueous solution, which may contain other substances, such as salts, or sugar alcohols, such as mannitol, or glucose, to make the solution isotonic with blood.

[0294] For veterinary use, the compounds disclosed herein are administered in an appropriately acceptable formulation, in accordance with normal veterinary practice, and a veterinarian can readily determine the most appropriate dosing regimen and route of administration for a particular animal.

[0295] In some embodiments, all components required for the treatment of KRAS-related disorders, using the compounds disclosed herein alone or in combination with another drug or intervention traditionally used for the treatment of such diseases, can be packaged into a kit.Specifically, the present invention provides a kit for use in disease intervention, comprising a compound disclosed herein, and a packaged drug set comprising a buffer and other components for preparing said drug into a deliverable form, and / or a device for delivering such drug, and / or any drug used in combination therapy with the compounds disclosed herein, and / or instructions for treating the disease packaged with the drug.The instructions can be fixed on any tangible medium, such as printed paper, or computer-readable magnetic or optical media, or the instructions can refer to a remote computer data source, such as a World Wide Web page accessible by the Internet.

[0296] "Therapeutically effective amount" refers to an amount effective to treat, inhibit progression, or alleviate the current symptoms of the subject being treated. Determining an effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein. In general, "therapeutically effective amount" refers to an amount of a compound that results in the achievement of a desired effect. For example, in a preferred embodiment, a therapeutically effective amount of a compound disclosed herein reduces KRAS activity by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to a control.

[0297] The amount of compound administered may depend on the subject being treated, the subject's age, health condition, sex and weight, type of concurrent treatment (if any), severity of the affliction, the nature of the desired effect, the method and frequency of treatment, and the judgment of the prescribing physician.Frequency of administration may also depend on the pharmacodynamic effect on arterial oxygen pressure.However, the most preferred dose can be determined for each individual subject without undue experimentation, as understood and determined by those skilled in the art.This usually involves adjusting the standard dose (e.g., reducing the dose when the patient is lighter).

[0298] While individual needs vary, determining optimal ranges for effective amounts of the compounds is within the skill of the art. For administration to humans in the curative or prophylactic treatment of conditions and disorders identified herein, for example, a typical dose of the compounds of the invention can be from about 0.05 mg / kg / day to about 50 mg / kg / day, for example, at least 0.05 mg / kg, at least 0.08 mg / kg, at least 0.1 mg / kg, at least 0.2 mg / kg, at least 0.3 mg / kg, at least 0.4 mg / kg, or at least 0.5 mg / kg, and preferably 50 mg / kg or less, 40 mg / kg or less, 30 mg / kg or less, 20 mg / kg or less, or 10 mg / kg or less, which can be, for example, about 2.5 mg / day (0.5 mg / kg x 5 kg) to about 5000 mg / day (50 mg / kg x 100 kg). For example, the dose of the compound may be from about 0.1 mg / kg / day to about 50 mg / kg / day, from about 0.05 mg / kg / day to about 10 mg / kg / day, from about 0.05 mg / kg / day to about 5 mg / kg / day, from about 0.05 mg / kg / day to about 3 mg / kg / day, from about 0.07 mg / kg / day to about 3 mg / kg / day, from about 0.09 mg / kg / day to about 3 mg / kg / day, from about 0.05 mg / kg / day to about 0.1 mg / kg / day, from about 0.1 mg / kg / day to about 1 mg / kg / day, The dose may be about 1 mg / kg / day to about 10 mg / kg / day, about 1 mg / kg / day to about 5 mg / kg / day, about 1 mg / kg / day to about 3 mg / kg / day, about 1 mg / kg / day to about 1000 mg / day, about 20 mg / day to about 750 mg / day, about 3 mg / day to about 500 mg / day, about 5 mg / day to about 250 mg / day, about 10 mg / day to about 100 mg / day, about 3 mg / day to about 10 mg / day, or about 100 mg / day to about 250 mg / day. Such doses may be administered in a single dose or may be divided into multiple doses.

[0299] <KRAS G12C How to use inhibitors > The present disclosure provides a method for inhibiting RAS-mediated cell signaling, comprising contacting a cell with an effective amount of one or more compounds disclosed herein. Inhibition of RAS-mediated signaling can be assessed and demonstrated by a wide variety of methods well known in the art. Non-limiting examples include: (a) showing a decrease in the GTPase activity of RAS; (b) a decrease in GTP binding affinity or an increase in GDP binding affinity; (c) an increase in the Koff of GTP or a decrease in the Koff of GDP; (d) a decrease in the level of downstream signaling molecules of the RAS pathway, such as a decrease in pMEK, pERK, or pAKT levels; and / or (e) a decrease in the binding of the RAS complex to downstream signaling molecules, including but not limited to Raf. Kits and commercially available assays can be utilized to determine one or more of the above.

[0300] The present disclosure also provides methods of using the compounds or pharmaceutical compositions of the present disclosure to treat disease conditions, including, but not limited to, conditions associated with G12C KRAS, HRAS or NRAS mutations (e.g., cancer).

[0301] In some embodiments, a method for the treatment of cancer is provided, comprising administering to a subject in need thereof an effective amount of any of the aforementioned pharmaceutical compositions comprising a compound disclosed herein. In some embodiments, the cancer is mediated by a G12C mutation in KRAS, HRAS, or NRAS. In various embodiments, the cancer is pancreatic cancer, colorectal cancer, or lung cancer. In some embodiments, the cancer is gallbladder cancer, thyroid cancer, and cholangiocarcinoma.

[0302] In some embodiments, the disclosure provides a method of treating a disorder in a subject in need of treatment, comprising determining whether the subject has a G12C mutation in KRAS, HRAS or NRAS, and, if the subject is determined to have a G12C mutation in KRAS, HRAS or NRAS, administering to the subject a therapeutically effective amount of at least one compound disclosed herein, or a pharma- ceutically acceptable salt thereof.

[0303] The disclosed compounds inhibit anchorage-independent cell growth and therefore have the potential to inhibit tumor metastasis. Thus, in another embodiment, the present disclosure provides a method for inhibiting tumor metastasis, the method comprising administering an effective amount of a compound disclosed herein.

[0304] G12C mutations in KRAS, HRAS, or NRAS have also been identified in hematological malignancies (e.g., cancers affecting the blood, bone marrow, and / or lymph nodes). Accordingly, certain embodiments relate to the administration of the disclosed compounds (e.g., in the form of a pharmaceutical composition) to patients in need of treatment for hematological malignancies. Such malignancies include, but are not limited to, leukemias and lymphomas. For example, the disclosed compounds can be used to treat diseases such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), chronic myelogenous leukemia (CML), acute monocytic leukemia (AMoL), and / or other leukemias. In another embodiment, the compounds are useful for treating all subtypes of lymphomas, e.g., Hodgkin's lymphoma or non-Hodgkin's lymphoma. In various embodiments, the compounds are useful in the treatment of plasma cell malignancies such as multiple myeloma, mantle cell lymphoma, and Waldenstrom's macroglobulinemia.

[0305] Determining whether a tumor or cancer contains a G12C KRAS, HRAS or NRAS mutation can be performed by evaluating the nucleotide sequence encoding the KRAS, HRAS or NRAS protein, by evaluating the amino acid sequence of the KRAS, HRAS or NRAS protein, or by evaluating the characteristics of a putative KRAS, HRAS or NRAS mutant protein. The sequence of wild-type human KRAS, HRAS or NRAS is well known in the art (e.g., Accession No. NP203524).

[0306] Methods for detecting mutations in KRAS, HRAS or NRAS nucleotide sequences are well known to those skilled in the art. These methods include, but are not limited to, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) assay, real-time PCR assay, PCR sequencing, mutant allele-specific PCR amplification (MASA) assay, direct sequencing, primer extension reaction, electrophoresis, oligonucleotide ligation assay, hybridization assay, TaqMan assay, SNP genotyping assay, high-resolution melting assay and microarray analysis. In some embodiments, samples are assessed for G12C KRAS, HRAS or NRAS mutations by real-time PCR. In real-time PCR, a fluorescent probe specific for the G12C mutation in KRAS, HRAS or NRAS is used. If a mutation is present, the probe binds and fluorescence is detected. In some embodiments, the KRAS, HRAS, or NRAS G12C mutation is identified using direct sequencing of specific regions in the KRAS, HRAS, or NRAS gene (e.g., exon 2 and / or exon 3). This technique identifies all possible mutations in the sequenced region.

[0307] Methods for detecting mutations in KRAS, HRAS or NRAS proteins are well known to those skilled in the art. These methods include, but are not limited to, detection of KRAS, HRAS or NRAS mutations using binding agents (e.g., antibodies) specific for mutant proteins, protein electrophoresis and Western blotting, and direct peptide sequencing.

[0308] A variety of samples can be used in the method of determining whether a tumor or cancer contains a G12C KRAS, HRAS or NRAS mutation. In some embodiments, the sample is taken from a subject with a tumor or cancer. In some embodiments, the sample is a fresh tumor / cancer sample. In some embodiments, the sample is a frozen tumor / cancer sample. In some embodiments, the sample is a formalin-fixed paraffin-embedded sample. In some embodiments, the sample is a circulating tumor cell (CTC) sample. In some embodiments, the sample is processed into a cell lysate. In some embodiments, the sample is processed into DNA or RNA.

[0309] The present disclosure also relates to a method of treating a hyperproliferative disorder in a mammal, comprising administering to said mammal a therapeutically effective amount of a compound disclosed herein, or a pharma- ceutically acceptable salt thereof.In some embodiments, the method is directed to treating acute myeloid leukemia, adolescent cancer, childhood adrenocortical carcinoma, AIDS-related cancers (e.g., lymphoma and Kaposi's sarcoma), anal cancer, appendix cancer, astrocytoma, atypical teratoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain stem glioma, brain tumor, breast cancer, bronchial tumor, Burkitt's lymphoma, carcinoid tumor, atypical teratoma, embryonal tumor, germ cell tumor, primary lymphoma, cervical cancer, childhood cancer, chordoma, cardiac tumor, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative disorders, colon cancer. , colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, extrahepatic ductal carcinoma in situ (DCIS), germinoma, CNS cancer, endometrial cancer, ependymoma, esophageal cancer, nasal neuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, fibrous histiocytoma of bone, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, gestational trophoblastic tumor, hairy cell leukemia, head and neck cancer, cardiac cancer, liver cancer, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell tumor, pancreatic neuroendocrine tumor, kidney cancer, laryngeal cancer, lip and Oral cavity cancer, Liver cancer, Lobular carcinoma in situ (LCIS), Lung cancer, Lymphoma, Recurrent metastatic squamous cell carcinoma of the neck of unknown primary, Midline carcinoma, Oral cavity cancer, Multiple endocrine neoplasia syndrome, Multiple myeloma / plasma cell neoplasm, Mycosis fungoides, Myelodysplastic syndrome, Myelodysplastic / myeloproliferative neoplasm, Multiple myeloma, Merkel cell carcinoma, Malignant mesothelioma, Malignant fibrous histiocytoma and osteosarcoma of bone, Nasal cavity and paranasal sinus cancer, Nasopharyngeal cancer, Neuroblastoma, Non-Hodgkin's lymphoma, Non-small cell lung cancer (NSCLC), Oral cavity cancer, Lip and oral cavity cancer, Oropharyngeal cancer, Ovarian cancer, Pancreatic cancer, Nipple cancer for the treatment of subjects suffering from cancer such as idiopathic melanoma, paraganglioma, paranasal sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pleuropulmonary blastoma, primary central nervous system (CNS) lymphoma, prostate cancer, rectal cancer, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, skin cancer, gastric (stomach) cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, T-cell lymphoma, testicular cancer, pharyngeal cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, trophoblastic tumor, childhood anomalies, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, or virus-induced cancer.In some embodiments, the methods relate to the treatment of non-cancerous hyperproliferative disorders such as benign hyperplasia of the skin (eg, psoriasis), restenosis, or prostate (eg, benign prostatic hyperplasia (BPH)).

[0310] In some embodiments, the method of treatment relates to the treatment of lung cancer, the method comprising administering an effective amount of any of the above compounds (or pharmaceutical compositions comprising same) to a subject in need thereof. In certain embodiments, the lung cancer is non-small cell lung cancer (NSCLC), such as adenocarcinoma, squamous cell lung cancer, or large cell lung cancer. In some embodiments, the lung cancer is small cell lung cancer. Other lung cancers treatable with the disclosed compounds include, but are not limited to, adenocarcinoma, carcinoid tumor, and anaplastic carcinoma.

[0311] The present disclosure further provides a method of modulating G12C mutant KRAS, HRAS or NRAS protein activity by contacting the protein with an effective amount of a compound of the present disclosure. Modulation can be inhibiting or activating the activity of the protein. In some embodiments, the present disclosure provides a method of inhibiting protein activity by contacting a G12C mutant KRAS, HRAS or NRAS protein with an effective amount of a compound of the present disclosure in solution. In some embodiments, the present disclosure provides a method of inhibiting G12C mutant KRAS, HRAS or NRAS protein activity by contacting a cell, tissue or organ expressing the protein of interest. In some embodiments, the present disclosure provides a method of inhibiting the activity of the protein in a subject, including but not limited to rodents and mammals (e.g., humans), by administering to the subject an effective amount of a compound of the present disclosure. In some embodiments, the percentage of modulation is greater than 25%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In some embodiments, the percentage of inhibition is greater than 25%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0312] In some embodiments, the present disclosure provides a method for inhibiting the G12C activity of KRAS, HRAS or NRAS in a cell by contacting the cell with a compound of the present disclosure in an amount sufficient to inhibit the G12C activity of KRAS, HRAS or NRAS in the cell. In some embodiments, the present disclosure provides a method for inhibiting the G12C activity of KRAS, HRAS or NRAS in a tissue by contacting the tissue with a compound of the present disclosure in an amount sufficient to inhibit the G12C activity of KRAS, HRAS or NRAS in the tissue. In some embodiments, the present disclosure provides a method for inhibiting the G12C activity of KRAS, HRAS or NRAS in an organism by contacting the organism with a compound of the present disclosure in an amount sufficient to inhibit the G12C activity of KRAS, HRAS or NRAS in the organism. In some embodiments, the present disclosure provides a method for inhibiting the G12C activity of KRAS, HRAS, or NRAS in an animal by contacting the animal with a compound of the present disclosure in an amount sufficient to inhibit the G12C activity of KRAS, HRAS, or NRAS in the animal. In some embodiments, the present disclosure provides a method for inhibiting the G12C activity of KRAS, HRAS, or NRAS in a mammal by contacting the mammal with a compound of the present disclosure in an amount sufficient to inhibit the G12C activity of KRAS, HRAS, or NRAS in the mammal. In some embodiments, the present disclosure provides a method for inhibiting the G12C activity of KRAS, HRAS, or NRAS in a human by contacting the human with a compound of the present disclosure in an amount sufficient to inhibit the G12C activity of KRAS, HRAS, or NRAS in the human. The present disclosure provides a method for treating a disease mediated by the G12C activity of KRAS, HRAS, or NRAS, wherein the method is for treating a subject in need of such treatment.

[0313] <Combination therapy> The present disclosure also provides a method of combination therapy in which agents known to regulate other pathways or regulate other components of the same pathway, or sets of overlapping target enzymes, are used in combination with the compounds of the present disclosure, or pharma- ceutically acceptable salts thereof. In one embodiment, such therapy includes, but is not limited to, the combination of one or more compounds of the present disclosure with chemotherapeutic agents, therapeutic antibodies, and radiation therapy to provide synergistic or additive therapeutic effects.

[0314] Currently, many chemotherapeutic agents are known in the art and can be used in combination with the compounds of the present disclosure. The compounds or pharmaceutical compositions of the present disclosure can be used in combination with at least one or more chemotherapeutic agents. In some embodiments, the chemotherapeutic agent is selected from the group consisting of mitotic inhibitors, alkylating agents, antimetabolites, intercalating antibiotics, growth factor inhibitors, cell cycle inhibitors, enzymes, topoisomerase inhibitors, biological response modifiers, antihormones, angiogenesis inhibitors, and antiandrogens. Non-limiting examples are chemotherapeutic agents, cytotoxic agents, and non-peptide small molecules such as Gleevec® (imatinib mesylate), Kyprolis® (carfilzomib), Velcade® (bortezomib), Casodex (bicalutamide), Iressa® (gefitinib), Venclexta™ (venetoclax) and Adriamycin™ (doxorubicin), as well as a host of chemotherapeutic agents. Non-limiting examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide (Cytoxan™); alkylsulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines, including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylolomelanin; nitrogen mustards such as chlorambucil, chlornaphazine, chlorocyclophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembicine, phenesterine, prednimustine, trofosfamide, and uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimustine;Aclacinomycin, Actinomycin, Ausramycin (Anthramycin), Azaserine, Bleomycin, Cactinomycin, Calicheamicin, Carabicin, Carminomycin, Carzinophilin, Casodex™, Chromomycin, Dactinomycin, Daunorubicin, Detorubicin, 6-Diazo-5-oxo-L-norleucine, Doxorubicin, Epirubicin, Esorubicin, Idarubicin, Marcellomycin, Mitomycin, Mycophenolic acid, Nogalamycin, Olivomycin, Peplomycin, Potrophiloma Antibiotics such as isin, puromycin, keramycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; metabolic antagonists such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, and trimetrexate; purine analogues such as fludarabine, 6-mercaptopurine, thiamiprine, and thioguanine; ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxorubicin, and cyclohexyl 1-phosphate dehydrogenase; Androgens such as cifluridine, enocitabine, floxuridine, calsterone, dromostanolone propionate, epithiostanol, mepitiostane, and testolactone; antiadrenals such as aminoglutethimide, mitotane, and trilostane; folic acid supplements such as floric acid; aceglatone; aldophosphamide glycosides; aminolevulinic acid; amsacrine; bestravcil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomitine; elliptinium acetate; etoglucide; gallium nitrate; hydroxyl Urea;Lentinan;Lonidamine;Mitoguazone;Mitoxantrone;Mopidamol;Nitracrine;Pentostatin;Phenamet;Pirarubicin;Podophyllic acid;2-Ethylhydrazide;Procarbazine;PSK;Razoxane;Sizofiran;Spirogermanium;Tenuazonic acid;Triaziquone;2,2',2''-Trichlorotriethylamine;Urethane;Vindesine;Dacarbazine;Mannomustine;Mitobronitol;Mitolactol;Pipobroman;Gacytosine;Arabinoside ("Ara-C");Cyclophosphamide;Thiotepa;Taxanes, such as paclitaxel and docetaxel; retinoic acid; esperamycin; capecitabine; and pharma- ceutically acceptable salts, acids, or derivatives of any of the above.

[0315] Suitable chemotherapy cell conditioners include, for example, antiestrogens including tamoxifen (Nolvadex™), raloxifene, aromatase-inhibiting 4(5)imidazole, 4-hydroxytamoxifen, trioxyphene, ketoxifene, LY117018, onapristone, and toremifene (Fareston); antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; chlorambucil; Also included are anti-hormonal agents that modulate or inhibit hormone action on tumors, such as mucitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogues such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; camptothecin-11 (CPT-11); the topoisomerase inhibitor RFS 2000; and difluoromethylornithine (DMFO).

[0316] If desired, the compounds or pharmaceutical compositions of the present disclosure may be used in combination with other drugs such as Herceptin®, Avastin®, Erbitux®, Rituxan®, Taxol®, Arimidex®, Taxotere®, ABVD, AVICINE, abagovomab, acridine carboxamide, adecatumumab, 17-N-allylamino-17-demethoxygeldanamycin, alpharazine, albocarb, cefotaxime ... Sidibu, 3-aminopyridine-2-carboxaldehyde thiosemicarbazone, amonafide, anthracenedione, anti-CD22 immunotoxin, antineoplastic drugs, antitumorigenic herbs, apaziquone, atiprimod, azathioprine, bendamustine, BIBW2992, biricoderl, brostallicin, bryostatin, buthionine sulfoximine, CBV (chemotherapy), calyculin, cell cycle nonspecific antineoplastic agents, dichloroacetic acid, discodermolide, elsamitre. Synth, enocitabine, epothilone, eribulin, everolimus, exatecan, exisulind, ferruginol, forodesine, fosfestrol, ICE chemotherapy regimen, IT-101, imexon, imiquimod, indolocarbazole, irofulven, laniquidar, larotaxel, lurtotecan, mafosfamide, mitozolomide, nafoxidine, nedaplatin, olaparib, ortaxel, PAC-1, pawpaw, pixantrone, protea It may be used in combination with commonly prescribed anticancer drugs such as serosome inhibitors, rebeccamycin, resiquimod, rubitecan, SN-38, salinosporamide A, sapacitabine, Stanford V, swainsonine, talaporfin, tariquidar, tegafur-uracil, temodar, tesetaxel, triplatin tetranitrate, tris(2-chloroethyl)amine, troxacitabine, uramustine, vadimezan, vinflunine, ZD6126, or zosuquidar.

[0317] The present disclosure further relates to a method of combining the compounds or pharmaceutical compositions provided herein with radiation therapy to inhibit abnormal cell proliferation or treat hyperproliferative disorders in a mammal. Techniques for administering radiation therapy are well known in the art, and these techniques can be used in the combination therapy described herein. The administration of the compounds of the present disclosure in this combination therapy can be determined as described herein.

[0318] Radiation therapy can be administered by one of several methods, or a combination of methods, including, but not limited to, external beam therapy, internal radiation therapy, interstitial irradiation, stereotactic radiosurgery, total body radiation therapy, radiotherapy, and permanent or temporary interstitial brachytherapy. As used herein, the term "brachytherapy" refers to radiation therapy delivered by a spatially confined radioactive material inserted into the body at or near the site of a tumor or other proliferative tissue disease. The term is intended to include, but is not limited to, exposure to radioisotopes (e.g., At-211, I-131, I-125, Y-90, Re-186, Re-188, Sm-153, Bi-212, P-32, and Lu radioisotopes). Suitable radiation sources for use as cell conditioners of the present disclosure include both solid and liquid sources. As non-limiting examples, the radiation source can be a radionuclide such as I-125, I-131, Yb-169, Ir-192, I-125 as a solid source, or other radionuclides that emit photons, beta particles, gamma rays, or other therapeutic rays. The radioactive material can also be any solution of the radionuclide, for example a fluid produced from a solution of I-125 or I-131, or the radioactive fluid can be produced using a slurry of a suitable fluid containing microparticles of a solid radionuclide such as Au-198, Y-90, etc. Additionally, the radionuclide can be embodied in the form of a gel or radioactive microspheres.

[0319] The compounds or pharmaceutical compositions of the present disclosure can be used in combination with an amount of one or more substances selected from a chemotherapeutic agent, an anti-angiogenic agent, a signal transduction inhibitor, an anti-proliferative agent, a glycolysis inhibitor, or an autophagy inhibitor.

[0320] Antiangiogenic agents such as MMP-2 (matrix metalloproteinase 2) inhibitors, MMP-9 (matrix metalloproteinase 9) inhibitors, and COX-11 (cyclooxygenase 11) inhibitors can be used in combination with the compounds of the present disclosure and the pharmaceutical compositions described herein. Antiangiogenic agents include, for example, rapamycin, temsirolimus (CCI-779), everolimus (RAD001), sorafenib, sunitinib, and bevacizumab. Examples of useful COX-II inhibitors include alecoxib, valdecoxib, and rofecoxib. Examples of useful matrix metalloproteinase inhibitors are described in WO 96 / 33172, WO 96 / 27583, EP 0818442, EP 1004578, WO 98 / 07697, WO 98 / 03516, WO 98 / 34918, WO 98 / 34915, WO 98 / 33768, WO 98 / 30566, EP 0606046, EP 0931788, and the like. No. 5,863,949, U.S. Pat. No. 5,861,510, and EP 0,780,386, all of which are incorporated herein by reference in their entirety. Preferred MMP-2 and MMP-9 inhibitors are those that have little or no activity inhibiting MMP-1. More preferably, they selectively inhibit MMP-2 and / or MMP-9 relative to other matrix metalloproteinases (i.e., MAP-1, MMP-3, MMP-4, MMP-5, MMP-6, MMP7, MMP8, MMP-10, MMP-11, MMP-12, and MMP-13).Some specific examples of MMP inhibitors useful in the present disclosure are AG-3340, RO32-3555, and RS13-0830.

[0321] In addition, the compound is not limited to acemannan, aclarubicin, aldesleukin, alemtuzumab, alitretinoin, altretamine, amifostine, aminolevulinic acid, amrubicin, amsacrine, anagrelide, anastrozole, ANCER, ancestim, ARGLABIN, arsenic trioxide, BAM002 (Novelos), bexarotene, bicalutamide, broxuridine, capecitabine, celmoleukin, cetrole. Rix, cladribine, clotrimazole, cytarabine ocfosfate, DA3030 (Dong-A), dacilizumab, denileukin diftitox, deslorelin, dexrazoxane, dilazep, docetaxel, docosanol, doxercalciferol, doxifluridine, doxorubicin, bromocriptine, carmustine, cytarabine, fluorouracil, HIT diclofenac, interferon alpha, daunorubicin Rubicin, doxorubicin, tretinoin, edelfosine, edrecolomab, eflornithine, emitefur, epirubicin, epoetin beta, etoposide phosphate, exemestane, exisulind, fadrozole, filgrastim, finasteride, fludarabine phosphate, formestane, fotemustine, gallium nitrate, gemcitabine, gemtuzumab ozogamicin, gimeracil / oteracil / tegafur combination drug, glycopine, goserelin, heptaplatin, human chorionic gonadotropin, human fetal alpha-fetoprotein, ibandronate, idarubicin, (imiquimod, interferon alpha, interferon alpha, natural type, interferon alpha-2, interferon alpha-2a, interferon alpha-2b, interferon alpha-N1, interferon alpha- n3, interferon alfacon-1, interferon alpha, natural type, interferon beta, interferon beta-1a, interferon beta-1b, interferon gamma, natural type interferon gamma-1a, interferon gamma-1b, interleukin-1 beta, iobenguane, irinotecan, irsogladine, lanreotide, LC9018 (Yakult), leflunomide, lenograstim, lentinan sulfate, letrozole, leukocyte alpha interferon, leuprorelin, levamisole + fluorouracil Sil, liarozole, lobaplatin, lonidamine, lovastatin, masoprocol, melarsoprol, metoclopramide, mifepristone, miltefosine, millimostim, mismatched double-stranded RNA, mitoguazone, mitolactol, mitoxantrone, molgramostim, nafarelin, naloxone + pentazocine, nartograstim, nedaplatin, nilutamide, noscapine, novel erythropoiesis-stimulating protein preparation, NSC631570, octreotide, oprelvekin, osaterone, oxaliplatin, paclitaxel, pamidronate, pegaspar Gauze, peginterferon alpha-2b, pentosan polysulfate sodium, pentostatin, picibanil, pirarubicin, rabbit antithymocyte polyclonal antibody, polyethylene glycol interferon alpha-2a, porfimer sodium, raloxifene, raltitrexed, rasburiembodiment, rhenium etidronate Re186, RII retinamide, rituximab, romurtide, samarium (153Sm) lexidronam, sargramostim, sizofiran, sobuzoxane, sonet Lumin, strontium 89 chloride, suramin, tasonermin, tazarotene, tegafur, temoporfin, temozolomide, teniposide, tetrachlorodecaoxide, thalidomide, thymalfasin, thyrotropin alpha, topotecan, toremifene, tositumomab-iodine 131, trastuzumab, threosulfan, tretinoin, trilostane, trimetrexate, triptorelin, tumor necrosis factor alpha, natural type, ubenimex, bladder cancer vaccine, Maruyama vaccine, melanoma lysate vaccine, valrubicin, verteporfin, vinorelbine,VIRULIZIN, zinostatin stimalamer, or zoledronic acid; abarelix; AE941 (Aeterna), ambamustine, antisense oligonucleotide, bcl-2 (Genta), APC8015 (Dendreon), cetuximab, decitabine, dexaminoglutethimide, diaziquone, EL532 (Elan), EM800 (Endorecherche), eniluracil, etanidazole, fenretinide, filg Rustim SD01 (Amgen), fulvestrant, galocitabine, gastrin 17 immunogen, HLA-B7 gene therapy drug (Vical), granulocyte-macrophage colony-stimulating factor, histamine dihydrochloride, ibritumomab tiuxetan, ilomastat, IM862 (Cytran), interleukin 2, iproxifen, LDI200 (Milkhaus), religistim, lintuzumab, CA125MAb (Biomira), cancer MAb (Japan Pharmaceutical Development), HER-2 and FcMAb (Medarex), idiotype 105AD7 MAb (CRC Technology), idiotype CEA MAb (Trilex), LYM-1-iodine 131 MAb (Techniclone), polymorphic epithelial mucin-yttrium 90 MAb (Antisoma), marimastat, menogaril, mitumomab, motexafingadolinium, MX6 (Galderma), nelarabine, nolatrexed, P30 protein, pegvisomant, pemetrexed, porfiromycin, prinomastat, RL0903 (Shire), rubitecan, satraplatin, sodium phenylacetate, sparfosic acid, SRL172 (SRPharma), SU5416 (SUGEN), TA077 (Tanabe), tetrathiomolybdate, thaliblastine, thrombopoietin, tin ethyl etiopurpurin, tirapazamine, cancer vaccine (Biomira), melanoma vaccine (New York University), melanoma vaccine (Sloan Kettering Institute), melanoma oncolytic vaccine (New York Medical College),It may also be used in combination with other antitumor drugs, such as viral melanoma lysate vaccine (Royal Newcastle Hospital), or valspodar.

[0322] The compounds of the present invention may further be used with VEGFR inhibitors. In the combination therapy, other compounds described in the following patents and patent applications may be used: U.S. Pat. No. 6,258,812, U.S. Pat. Appl. Pub. No. 2003 / 0105091, WO 01 / 37820, U.S. Pat. No. 6,235,764, WO 01 / 32651, U.S. Pat. No. 6,630,500, U.S. Pat. No. 6,515,004, U.S. Pat. No. 6,713,485, U.S. Pat. No. 5,521,184, U.S. Pat. No. 5,770,599, U.S. Pat. No. 5,747,498, WO 02 / 68406, WO 02 / 66470, and the like. FRET, WO 02 / 55501, WO 04 / 05279, WO 04 / 07481, WO 04 / 07458, WO 04 / 09784, WO 02 / 59110, WO 99 / 45009, WO 00 / 59509, WO 99 / 61422, U.S. Pat. No. 5,990,141, WO 00 / 12089, and WO 00 / 02871.

[0323] In some embodiments, the combination comprises a composition of the present invention in combination with at least one antiangiogenic agent.Agents include, but are not limited to, in vitro synthetically prepared chemical compositions, antibodies, antigen-binding regions, radionuclides, and combinations and conjugates thereof.Agents may be agonists, antagonists, allosteric regulators, toxins, or more generally, they may act to inhibit or stimulate their targets (e.g., activating or inhibiting receptors or enzymes), thereby promoting cell death or preventing cell proliferation.

[0324] Collectively, antibodies form a family of plasma proteins known as immunoglobulins and contain immunoglobulin domains. (Janeway et al., Immunobiology: The Immune System in Health and Disease, 4 th ed., Elsevier Science Ltd. / Garland Publishing, 1999. As used herein, the term "antibody" refers to a protein having a conventional immunoglobulin format, including heavy and light chains, and including variable and constant regions. For example, an antibody may be an IgG, which is a "Y-shaped" structure of two identical pairs of polypeptide chains, each pair having one "light" chain (typically having a molecular weight of about 25 kDa) and one "heavy" chain (typically having a molecular weight of about 50-70 kDa). An antibody has a variable region and a constant region. In the IgG format, the variable region generally has about 100-110 or more amino acids, includes three complementarity determining regions (CDRs), is primarily responsible for antigen recognition, and varies considerably among other antibodies that bind to different antigens. The constant region enables the antibody to recruit cells and molecules of the immune system. The variable region is made from the N-terminal regions of the light and heavy chains, respectively, and the constant region is made from the C-terminal portions of the heavy and light chains, respectively. (Janeway et al., “Structure of the Antibody Molecule and the Immunoglobulin Genes”, Immunobiology: The Immune System in Health and Disease, 4 th ed.Elsevier Science Ltd. / Garland Publishing, (1999)).

[0325] The general structure and characteristics of antibody CDRs have been described in the art. Briefly, CDRs are embedded in the framework of heavy and light chain variable regions in an antibody scaffold and constitute the regions that are largely involved in antigen binding and antigen recognition. A variable region usually comprises at least three heavy or light chain CDRs within a framework region (designated framework regions 1-4, FR1, FR2, FR3 and FR4, according to Kabat et al., 1991; see also Chothia and Lesk, 1987, supra) (Kabat et al., 1991, Sequences of Proteins of Immunological Interest, Public Health Service NIH, Bethesda, Md.; Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917; see also Chothia et al., 1989, Nature 342:877-883).

[0326] An antibody can include any constant region known in the art. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, defining the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. IgG has several subclasses, including but not limited to IgG1, IgG2, IgG3, and IgG4. IgM has subclasses, including but not limited to IgM1 and IgM2. The embodiments of the present disclosure include all such classes or isotypes of antibodies. The light chain constant region can be, for example, a kappa- or lambda-type light chain constant region, for example, a human kappa- or lambda-type light chain constant region. The heavy chain constant region can be, for example, an alpha, delta, epsilon, gamma, or mu-type heavy chain constant region, for example, a human alpha, delta, epsilon, gamma, or mu-type heavy chain constant region. Thus, in exemplary embodiments, the antibody is of the isotype IgA, IgD, IgE, IgG or IgM, including any one of IgG1, IgG2, IgG3 or IgG4.

[0327] The antibody may be a monoclonal or polyclonal antibody. In some embodiments, the antibody comprises a sequence substantially similar to a natural antibody produced by a mammal, such as a mouse, rabbit, goat, horse, chicken, hamster, human, etc. In this respect, the antibody may be considered a mammalian antibody, such as a mouse antibody, a rabbit antibody, a goat antibody, a horse antibody, a chicken antibody, a hamster antibody, a human antibody, etc. In certain aspects, the antibody is a human antibody. In certain aspects, the antibody is a chimeric antibody or a humanized antibody. The term "chimeric antibody" refers to an antibody that comprises domains from two or more different antibodies. A chimeric antibody may, for example, comprise a constant domain from one species and a variable domain from a second species, but more commonly comprises stretches of amino acid sequences from at least two species. A chimeric antibody may also comprise domains from two or more different antibodies within the same species. The term "humanized", when used in reference to an antibody, refers to an antibody with at least the CDR regions from a non-human source that have been engineered to have a structure and immune function more similar to a true human antibody than the original source antibody. For example, humanization can include the transplantation of CDRs from a non-human antibody, such as a murine antibody, into a human antibody. Humanization can also include selected amino acid substitutions to make the non-human sequence more similar to a human sequence.

[0328] Antibodies can be cleaved into fragments, for example, by enzymes such as papain and pepsin. Papain cleaves antibodies to produce two Fab fragments and a single Fc fragment. Pepsin cleaves antibodies to produce F(ab')2 and pFc' fragments. As used herein, the term "antigen-binding antibody fragment" refers to a portion of an antibody molecule capable of binding to an antigen, also known as an "antigen-binding fragment" or "antigen-binding portion." In an illustrative example, the antigen-binding antibody fragment is a Fab fragment or a F(ab')2 fragment.

[0329] The structure of antibodies has been exploited to create a wide range of alternative formats, spanning a molecular weight range of at least about 12-150 kDa, from monomers (n=1) to dimers (n=2), trimers (n=3), tetramers (n=4), and potentially higher valency (n) ranges, such alternative formats being referred to herein as "antibody protein products." Antibody protein products include those based on the complete antibody structure and those that mimic antibody fragments that retain complete antigen-binding capacity, such as scFv, Fab, and VHH / VH (discussed below). The smallest antigen-binding antibody fragment that retains an intact antigen-binding site is the Fv fragment, consisting exclusively of the variable (V) region. Soluble, flexible amino acid peptide linkers are attached to the V region to the scFv (single chain fragment variable) fragment to stabilize the molecule, or constant (C) domains are added to the V region to generate Fab fragments [fragment, antigen binding]. Both scFv and Fab fragments can be easily produced in host cells, e.g., prokaryotic host cells. Alternative antibody protein products include dimeric and multimeric antibody formats such as dia-, tria- and tetrabodies, or minibodies (miniAbs), which include disulfide bond stabilized scFv (ds-scFv), single chain Fab (scFab), and different formats consisting of scFv linked to oligomerization domains. The smallest fragments are the VHH / VH of camelid heavy chain Abs and single domain Abs (sdAbs). The building blocks most frequently used to generate novel antibody formats are single chain variable (V)-domain antibody fragments (scFv), which contain the V domains from heavy and light chains (VH and VL domains) linked by a peptide linker of about 15 amino acid residues. Peptibodies or peptide-Fc fusions are yet another antibody protein product. The structure of a peptibody consists of a biologically active peptide grafted onto the Fc domain. Peptibodies are well described in the art, see, e.g., Shimamoto et al., mAbs 4(5):586-591 (2012).

[0330] Other antibody protein products include single chain antibodies (SCAs); diabodies; triabodies; tetrabodies; bispecific or trispecific antibodies, etc. Bispecific antibodies can be divided into five major classes: BsIgG, adducted IgG, BsAb fragments, bispecific fusion proteins, and BsAb conjugates. See, e.g., Spiess et al., Molecular Immunology 67(2)Part A:97-106(2015).

[0331] Exemplary anti-angiogenic agents include ERBITUX™ (IMC-C225), KDR (kinase domain receptor) inhibitors (e.g., antibodies and antigen binding regions that specifically bind to kinase domain receptors), anti-VEGF agents (e.g., antibodies or antigen binding regions that specifically bind to VEGF or a soluble VEGF receptor or its ligand binding region) such as AVASTIN™ or VEGF-TRAP™, and anti-VEGF receptor agents (e.g., antibodies or antigen binding regions that specifically bind thereto), EGFR inhibitors (e.g., antibodies or antigen binding regions that specifically bind thereto) such as Vectibix (panitumumab), IRESSA™ (gefitinib), TARCEVA™ (erlotinib), anti-Ang1 and anti-Ang2 agents (e.g., antibodies or antigen binding regions that specifically bind thereto) and anti-Tie2 kinase inhibitors (e.g., antibodies or antigen binding regions that specifically bind thereto). Pharmaceutical compositions of the invention can also include one or more agents (e.g., antibodies, antigen-binding regions, or soluble receptors) that specifically bind to and inhibit the activity of the growth factor, such as antagonists of hepatocyte growth factor (HGF, also known as scatter factor), and antibodies or antigen-binding regions that specifically bind to its receptor, "c-met."

[0332] Other antiangiogenic agents include Campath, IL-8, B-FGF, Tek antagonists (Ceretti et al., U.S. Patent Application Publication No. 2003 / 0162712; U.S. Patent No. 6,413,932), anti-TWEAK agents (e.g., specifically binding antibodies or antigen binding regions; or soluble TWEAK receptor antagonists; Wiley, U.S. Patent No. 6,727,225), ADAM disintegrin domains that antagonize the binding of integrins to their ligands (Fanslow et al., U.S. Patent Application Publication No. 2002 / 0042368), specifically binding anti-ephrine These include receptor antibodies and / or anti-ephrin antibodies or antigen binding regions (see U.S. Pat. Nos. 5,981,245; 5,728,813; 5,969,110; 6,596,852; 6,232,447; 6,057,124 and members of that patent family), and anti-PDGF-BB antagonists (e.g., antibodies or antigen binding regions that specifically bind) as well as antibodies or antigen binding regions that specifically bind to a PDGF-BB ligand, and PDGFR kinase inhibitors (e.g., antibodies or antigen binding regions that specifically bind thereto).

[0333] Further antiangiogenic / antitumor agents include: SD-7784 (Pfizer, USA); cilengitide (Merck KGaA, Germany, EP 770622); pegaptanib octasodium, (Gilead Sciences, USA); alphastatin, (BioActa, UK); M-PGA, (Celgene, USA, U.S. Pat. No. 5,712,291); ilomastat, (Arriva, USA, U.S. Pat. No. 5,892,112); emaxanib, (Pfizer, USA, U.S. Pat. No. 5,792,783); vatalanib, (Novartis, Switzerland); 2-methoxyestradiol, (EntreMed, USA); TLC ELL-12, (Elan, Ireland); Anecortave acetate, (Alcon, USA); Alpha-D148 Mab, (Amgen, USA); CEP-7055, (Cephalon, USA); anti-Vn Mab, (Crucell, Netherlands) DAC: Antiangiogenic, (ConjuChem, Canada); Angiocidin, (InKine Pharmaceutical, USA); KM-2550, (Kyowa Hakko, Japan); SU-0879, (Pfizer, USA); CGP-79787, (Novartis, Switzerland, EP 970070); ARGENT technology, (Ariad, USA); YIGSR-Stealth, (Johnson&Johnson, USA); Fibrinogen-E fragment, (BioActa, UK); Angiogenesis inhibitor, (Trigen, UK); TBC-1635, (Encysive Pharmaceuticals, USA);SC-236, (Pfizer, USA);ABT-567, (Abbott, USA);metastatin, (EntreMed, USA);angiogenesis inhibitor, (Tripep, Sweden);maspin, (Sosei Group Corporation, Japan);2-methoxyestradiol, (Oncology Sciences Corporation, USA);ER-68203-00, (IVAX, USA);Benefin, (Lane Labs, USA);Tz-93, (Tsumura Corporation, Japan);TAN-1120, (Takeda Pharmaceutical Co., Ltd., Japan); FR-111142, (Fujisawa Pharmaceutical Co., Ltd.), Japan, JP 02-233610 A); Platelet factor 4, (RepliGen, USA, EP 407122); Vascular endothelial growth factor antagonist, (Borean, Denmark); Bevacizumab (pINN), (Genentech, USA); Angiogenesis inhibitor, (SUGEN, USA); XL 784, (Exelixis, USA); XL 647, (Exelixis, USA); MAb, alpha 5 beta 3 integrin, 2nd generation, (Applied Molecular Evolution, USA and MedImmune, USA); Gene therapy, retinopathy, (Oxford BioMedica, UK); Enzastaurin hydrochloride (USAN), (Lilly, USA); CEP 7055, (Cephalon, USA and Sanofi-Synthelabo, France);BC 1, (Genoa Institute of Cancer Research, Italy);angiogenesis inhibitor, (Alchemia, Australia);VEGF antagonist, (Regeneron, USA);rBPI 21 and BPI-derived antiangiogenic drugs, (XOMA, USA);PI 88, (Progen, Australia);Cilengitide (pINN), (Merck KGaA, German;Munich Technical University, Germany, Scripps Clinic and Research Foundation, USA);Cetuximab (INN), (Aventis, France);AVE 8062, (Ajinomoto Co., Japan);AS 1404, (Cancer Research Laboratory, New Zealand);SG 292, (Telios, USA);Endostatin, (Boston Children's Hospital, USA);ATN 161, (Attenuon, USA);ANGIOSTATIN, (Boston Children's Hospital, USA);2-Methoxyestradiol, (Boston Children's Hospital, USA);ZD 6474, (AstraZeneca, UK);ZD 6126, (Angiogene Pharmaceuticals, UK); PPI 2458, (Praecis, USA); AZD 9935, (AstraZeneca, UK); AZD 2171, (AstraZeneca, UK); vatalanib (pINN), (Novartis, Switzerland and Schering AG, Germany); tissue factor pathway inhibitor, (EntreMed, USA); pegaptanib (Pinn), (Gilead Sciences, USA); xanthrizol, (Yonsei University, South Korea); vaccine, gene-based, VEGF-2, (Scripps Clinic and Research Foundation, USA); SPV5.2, (Supratek, Canada); SDX 103, (University of California at San Diego, USA); PX 478, (ProlX, USA); METASTATIN, (EntreMed, USA); troponin I, (Harvard University, USA);SU 6668, (SUGEN, USA);OXI 4503, (OXiGENE, USA);o-guanidine, (Dimensional Pharmaceuticals, USA);motuporamine C, (British Columbia University, Canada);CDP 791, (Celltech Group, UK);atiprimod (pINN), (GlaxoSmithKline, UK);E 7820, Eisai Co., Ltd., Japan);CYC 381, (Harvard University, USA);AE 941, (Aeterna, Canada);vaccine, angiogenesis agent, (EntreMed, USA);urokinase-type plasminogen activator inhibitor, (Dendreon, USA);oglufanide (pINN), (Melmotte, USA);HIF-1 alpha inhibitor, (Xenova, UK);CEP 5214, (Cephalon, USA);BAY RES 2622, (Bayer, Germany);angiocidin, (InKine, USA);A6, (Angstrom, USA);KR31372, (Korea Research Institute of Chemical Technology, South Korea); GW 2286, (GlaxoSmithKline, UK); EHT 0101, (ExonHit, France); CP 868596, (Pfizer, USA); CP 564959, (OSI, USA); CP 547632, (Pfizer, USA); 786034, (GlaxoSmithKline, UK); KRN 633, (Kirin Brewery Co., Ltd., Japan); Drug delivery system, intraocular medication, 2-methoxyestradiol, (EntreMed, USA); Anginex, (Maastricht University, Netherlands, and Minnesota University, USA); ABT 510, (Abbott, USA); AAL 993, (Novartis, Switzerland);VEGI, (ProteomTech, USA);Tumor necrosis factor-alpha inhibitor, (National Institute on Aging, USA);SU 11248, (Pfizer, USA and SUGEN USA);ABT 518, (Abbott, USA);YH16, (Yantai Rongchang, China);S-3APG, (Boston Children's Hospital, USA and EntreMed, USA);MAb, KDR, (ImClone Systems, USA);MAb, alpha5beta1, (Protein Design, USA);KDR kinase inhibitor, (Celltech Group, UK and Johnson&Johnson, USA);GFB 116, (University of South Florida, USA and Yale University, USA);CS 706, (Sankyo Co., Ltd., Japan);Combretastatin A4 prodrug, (Arizona State University, USA); chondroitinase AC, (IBEX, Canada); BAY RES 2690, (Bayer, Germany); AGM 1470, (Harvard University, USA, Takeda Pharmaceutical Co., Ltd., Japan, and TAP, USA);AG 13925, (Agouron, USA);Tetrathiomolybdate, (University of Michigan, USA);GCS 100, (Wayne State University, USA)CV 247, (Ivy Medical, UK);CKD 732, (Chong Kun Dang, South Korea);MAb, Vascular Endothelial Growth Factor, (Xenova, UK);Irsoglandin (INN), (Nippon Shinyaku Co., Ltd., Japan);RG 13577, (Aventis, France);WX 360, (Wilex, Germany);Squalamine (pINN), (Genaera, USA);RPI 4610, (Sirna, USA);Cancer treatment, (Marinova, Australia);Heparanase inhibitor, (InSight, Israel);KL 3106, (Kolon, South Korea);Honokiol, (Emory University, USA);ZK CDK, (Schering AG, Germany); ZK Angio, (Schering AG, Germany); ZK 229561, (Novartis, Switzerland, and Schering AG, Germany); XMP 300, (XOMA, USA); VGA 1102, (Taisho Pharmaceutical Co., Ltd., Japan); VEGF receptor modulator, (Pharmacopeia, USA); VE-cadherin-2 antagonist, (ImClone Systems, USA); Vasostatin, (National Institutes of Health, USA); Vaccine, Flk-1, (ImClone Systems, USA); TZ 93, (Tsumura & Co., Japan); Tumstatin, (Beth Israel Hospital, USA); Truncated soluble FLT 1 (vascular endothelial growth factor receptor 1), (Merck&Co, USA); Tie-2 ligand, (Regeneron, USA); and thrombospondin 1 inhibitor, (Allegheny Health, Education and Research Foundation, USA).

[0334] Autophagy inhibitors include, but are not limited to, chloroquine, 3-methyladenine, hydroxychloroquine (Plaquenil™), bafilomycin A1, 5-amino-4 imidazolecarboxamide riboside (AICAR), okadaic acid, autophagy-inhibiting algal toxins that inhibit type 2A or type 1 protein phosphatases, analogs of cAMP, and agents that increase cAMP levels, such as adenosine, LY204002, N6-mercaptopurine riboside, and vinblastine. Additionally, antisense or siRNA that inhibit the expression of proteins, including, but not limited to, ATG5 (involved in autophagy), may also be used.

[0335] Additional pharma- ceutically active compounds / agents that may be used in the treatment of cancer and that may be used in combination with one or more compounds of the present invention include epoetin alfa, darbepoetin alfa, panitumumab, pegfilgrastim, palifermin, filgrastim, denosumab, ancestim, AMG102, AMG176, AMG386, AMG479, AMG655, AMG745, AMG951, AMG706, or a pharma- ceutically acceptable salt thereof.

[0336] In certain embodiments, the compositions provided herein are administered in combination with a chemotherapeutic agent. Suitable chemotherapeutic agents include vinca alkaloids (e.g., vinblastine, vincristine, and vinorelbine), paclitaxel, epidipodophyllotoxins (e.g., etoposide and teniposide), antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin, doxorubicin, and idarubicin), anthracyclines, mitoxantrone, bleomycin, plicamycin (mithramycin), mitomycin, enzymes (e.g., steroids that have the ability to metabolize L-asparagine systemically and synthesize their own asparagine), and steroids that have the ability to metabolize L-asparagine systemically and synthesize their own asparagine). L-asparaginase, which deprives cells of IL-1 receptors that do not have IL-1 receptors; antiplatelet agents; antiproliferative / antimitotic alkylating agents such as nitrogen mustards (e.g., mechlorethamine, cyclophosphamide and analogs, melphalan, and chlorambucil); ethylenimines and methylmelamines (e.g., hexamethylmelamine and thiotepa); CDK inhibitors (e.g., seliciclib, UCN-01, P1446A-05, PD-0332991, dinaciclib, P27-00, AT-7519, RGB286638, and SCH727965); alkylsulphonamides (e.g., cyclophosphamide, methylsulphonamide, and methylsulphonamide); Antiproliferative / antimitotic antimetabolites such as folates (e.g., busulfan), nitrosoureas (e.g., carmustine (BCNU) and analogs, and streptozocin), trazene-dacarbazine (DTIC), folic acid analogs (e.g., methotrexate), pyrimidine analogs (e.g., fluorouracil, floxuridine, and cytarabine), purine analogs and related inhibitors (e.g., mercaptopurine, thioguanine, pentostatin, 2-chlorodeoxyadenosine), aromatase inhibitors (e.g., anastrozole, exeterin), mestan, letrozole) and platinum coordination complexes (e.g., cisplatin and carboplatin), procarbazine, hydroxyurea, mitotane, aminoglutethimide, histone deacetylase (HDAC) inhibitors (e.g., trichostatin, sodium butyrate, apicidan, suberoylanilide hydroxamic acid, vorinostat, LBH589, romidepsin, ACY-1215, and panobinostat), mTor inhibitors (e.g., temsirolimus, everolimus, ridaforolimus, and sirolimus), KSP (Eg5) inhibitors (e.g.,Array520), DNA binders (e.g., Zalypsis), PI3K delta inhibitors (e.g., GS-1101 and TGR-1202), PI3K delta and gamma inhibitors (e.g., CAL-130), multikinase inhibitors (e.g., TG02 and sorafenib), hormones (e.g., estrogen), and leutinizing hormone releasing hormone (LHRH) agonists (e.g., goserelin, leuprolide, and triptorelin). Hormonal agonists, BAFF neutralizing antibodies (e.g., LY2127399), IKK inhibitors, p38MAPK inhibitors, anti-IL-6 (e.g., CNTO328), telomerase inhibitors (e.g., GRN163L), Aurora kinase inhibitors (e.g., MLN8237), cell surface monoclonal antibodies (e.g., anti-CD38 (HUMAX-CD38), anti-CS1 (e.g., elotuzumab), HSP90 inhibitors (e.g., 17AAG and KOS95 3), P13K / Akt inhibitors (e.g., Perifosine), Akt inhibitors (e.g., GSK-2141795), PKC inhibitors (e.g., Enzastaurin), FTIs (e.g., Zarnestra™), anti-CD138 (e.g., BT062), Torc1 / 2 specific kinase inhibitors (e.g., INK128), kinase inhibitors (e.g., GS-1101), ER / UPR targeting agents (e.g., MKC-3946), cFMS inhibitors ( For example, natural products such as ARRY-382, JAK1 / 2 inhibitors (e.g., CYT387), PARP inhibitors (e.g., olaparib and veliparib (ABT-888)), BCL-2 antagonists, etc. Other chemotherapeutic agents may include mechlorethamine, camptothecin, ifosfamide, tamoxifen, raloxifene, gemcitabine, navelbine, sorafenib, or analogs or derived variants of any of the above.

[0337] The compounds of the present invention may also be used in combination with radiation therapy, hormone therapy, surgery and immunotherapy, which are well known to those skilled in the art.

[0338] In certain embodiments, the pharmaceutical compositions provided herein are administered with a steroid. Suitable steroids include 21-acetoxypregnenolone, alclometasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difluprednate, enoxolone, fluazacort, flucloronide, flumethasone, flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluorometholone, fluperolone acetate, fluprednidene acetate, fluprednisolone, flurane, These include, but are not limited to, drenolide, fluticasone propionate, formocortal, halcinonide, halobetasol propionate, halometasone, hydrocortisone, loteprednol etabonate, mazipredone, medrysone, meprednisone, methylprednisolone, mometasone furoate, paramethasone, prednicarbate, prednisolone, prednisolone 25-diethylaminoacetate, prednisolone sodium phosphate, prednisone, prednival, prednylidene, rimexolone, tixocortol, triamcinolone, triamcinolone acetonide, triamcinolone benetonide, triamcinolone hexacetonide, and / or salts and derivatives thereof. In certain embodiments, the compounds of the present invention may also be used in combination with additional pharmacologic active agents that treat nausea. Examples of drugs that can be used to treat nausea include dronabinol; granisetron; metoclopramide; ondansetron; and prochlorperazine; or a pharma- ceutically acceptable salt thereof.

[0339] The KRAS gene of the present invention G12CThe inhibitors can be used in combination with Aurora kinase inhibitors, such as those found in WO 2011 / 031842. A specific compound is AMG900 (Example 1 of WO 2011 / 031842, incorporated herein by reference for all purposes).

[0340] The KRAS gene of the present invention G12C The inhibitors can be used in combination with MAP kinase pathway inhibitors. Proteins in the MAP kinase pathway that can be inhibited, and KRAS G12C Examples of such protein inhibitors used in combination with inhibitors include BRAF inhibitors, Pan-RAF inhibitors, and MEK inhibitors. There are three major RAF isoforms: ARAF, BRAF, and CRAF. Pan-RAF inhibitors show inhibitory activity against more than one RAF isoform. In contrast, BRAF inhibitors show greater inhibitory activity (or selectivity) against BRAF than against other RAF proteins.

[0341] The compounds of the present invention may also be combined with an additional pharmacologic active compound that disrupts or inhibits the RAS-RAF-ERK or PI3K-AKT-TOR signaling pathway. In other such combinations, the additional pharmacologic active compound is a PD-1 and PD-L1 antagonist. The compounds or pharmaceutical compositions of the present disclosure may also be combined with an amount of one or more substances selected from EGFR inhibitors, MEK inhibitors, PI3K inhibitors, AKT inhibitors, TOR inhibitors, Mcl-1 inhibitors, BCL-2 inhibitors, SHP2 inhibitors, proteasome inhibitors, and immunotherapeutic agents, including, for example, monoclonal antibodies, immunomodulatory drugs (IMiDs), anti-PD-1 (or alternatively PD-1 inhibitors), anti-PDL-1, anti-CTLA4, anti-LAG1 and anti-OX40 agents, GITR agonists, CAR-T cells, and BiTEs.

[0342] EGFR inhibitors include, but are not limited to, small molecule antagonists, antibody inhibitors, or specific antisense nucleotides or siRNAs.EGFR inhibitors that can be used in the combinations of the present invention include, but are not limited to, afatinib (trade name: Gilotrif®, available from Boehringer Ingelheim), erlotinib (trade name: Tarceva®, available from Genetech / Astellas), and lapatinib (trade name: Tykerb®, available from Novartis).KRAS G12C Inhibitors can also be used in combination with EGFR antibodies in the present invention. EGFR antibodies that can be used in the combinations of the present invention include, but are not limited to, cetuximab (trade name: Erbitux® (Lilly). Useful antibody inhibitors of EGFR include panitumumab (Vectibix), zalutumumab, nimotuzumab, and matuzumab.

[0343] Non-limiting examples of small molecule EGFR inhibitors include any of the EGFR inhibitors described in the following patent publications, as well as all of the pharma- ceutically acceptable salts and solvates of said EGFR inhibitors: European Patent Application Publication No. 520722, published December 30, 1992; European Patent Application Publication No. 566226, published October 20, 1993; International Patent Application Publication No. WO 96 / 33980, published October 31, 1996; U.S. Patent No. 5,747,498, published May 5, 1998; U.S. Patent No. 5,747,498, published October 3, 1996; WO 96 / 30347 published on;European Patent Application Publication No. 787772 published on August 6, 1997;WO 97 / 30034 published on August 21, 1997;WO 97 / 30044 published on August 21, 1997;WO 97 / 38994 published on October 23, 1997;WO 97 / 49688 published on December 31, 1997;European Patent Application Publication No. 837063 published on April 22, 1998 WO 98 / 02434 published January 22, 1998; WO 97 / 38983 published October 23, 1997; WO 95 / 19774 published July 27, 1995; WO 95 / 19970 published July 27, 1995; WO 97 / 13771 published April 17, 1997; WO 98 / 02437 published January 22, 1998; WO 97 / 38983 published October 23, 1997; WO 98 / 02438; WO 97 / 32881 published September 12, 1997; German Patent Application Publication No. 19629652 published January 29, 1998; WO 98 / 33798 published August 6, 1998; WO 97 / 32880 published September 12, 1997; WO 97 / 32880 published September 12, 1997; European Patent Application Publication No. 682027 published November 15, 1995;WO 97 / 02266, published January 23, 1997; WO 97 / 27199, published July 31, 1997; WO 98 / 07726, published February 26, 1998; WO 97 / 34895, published September 25, 1997; WO 96 / 31510, published October 10, 1996; WO 98 / 14449, published April 9, 1998; WO 98 / 14450, published April 9, 1998; WO 98 / 14451, published April 9, 1998; WO 95 / 09847, published April 13, 1995 No. 5,650,415, published July 22, 1997; U.S. Patent No. 5,656,643, issued August 12, 1997; WO 99 / 35146, published July 15, 1999; WO 99 / 35132, published July 15, 1999; WO 99 / 07701, published February 18, 1999; and WO 92 / 20642, published November 26, 1992. Further non-limiting examples of small molecule EGFR inhibitors include all of the EGFR inhibitors described in Traxler, P., 1998, Exp. Opin. Ther. Patents 8(12):1599-1625.

[0344] Antibody-based EGFR inhibitors include any anti-EGFR antibody or antibody fragment that can partially or completely block EGFR activation by its natural ligand.Non-limiting examples of antibody-based EGFR inhibitors include those described in Modjtahedi, H., et al., 1993, Br. J. Cancer 67:247-253;Teramoto, T., et al., 1996, Cancer 77:639-645;Goldstein et al., 1995, Clin. Cancer Res. 1:1311-1318;Huang, SM, et al., 1999, Cancer Res. 15:59(8):1935-40;and Yang, X., et al., 1999, Cancer Res. 59:1236-1243. Thus, the EGFR inhibitor can be the monoclonal antibody Mab E7.6.3 (Yang, 1999, supra), or Mab C225 (ATCC Accession No. HB-8508), or an antibody or antibody fragment having the binding specificity thereof.

[0345] The KRAS gene of the present invention G12C The inhibitors can be used in combination with MEK inhibitors, such as those found in WO 2002 / 006213. A specific compound is N-((((2R)-2,3-dihydroxypropyl)oxy)-3,4-difluoro-2-((2-fluoro-4-iodophenyl)amino)benzamide, also known as AMG 1009089 or 1009089 (Example 39).

[0346] The KRAS gene of the present invention G12C The inhibitor can be combined with BRAF inhibitors, such as those found in WO 2008 / 153,947.A specific compound is AMG2112819 (also known as 2112819) (Example 56).Another specific BRAF inhibitor that can be used in the combination of the present invention is dabrafenib.Another BRAF inhibitor that can be used in the combination of the present invention is vemurafenib.

[0347] The combination of this invention inhibits both Pan-RAF and KRAS G12C In one embodiment, the inhibitors include Pan-Raf 265 and MLN-2480.

[0348] The KRAS gene of the present invention G12C The inhibitors can be combined with MEK inhibitors. Specific MEK inhibitors that can be used in the combinations of the present invention include PD-325901, trametinib, pimasertib, MEK162 (also known as binimetinib), TAK-733, GDC-0973, and AZD8330. The combinations of the present invention can be used to inhibit KRAS G12C A specific MEK inhibitor that can be used together with the inhibitor is trametinib (trade name: Mekinist®, commercially available from Novartis Pharmaceuticals Corp.). Another specific MEK inhibitor is N-(((2R)-2,3-dihydroxypropyl)oxy)-3,4-difluoro-2-((2-fluoro-4-iodophenyl)amino)benzamide, also known as AMG1009089, 1009089 or PD-325901. Another specific MEK inhibitor that can be used in the combination of the present invention includes cobimetinib.

[0349] MEK inhibitors include, but are not limited to, CI-1040, AZD6244, PD318088, PD98059, PD334581, RDEA119, ARRY-142886, and ARRY-438162.

[0350] In another aspect, the present invention relates to the use of the compounds of the present invention in combination with one or more agents that are protein inhibitors in the phosphatidylinositol 3-kinase (PI3K) pathway. Examples of proteins in the PI3K pathway include PI3K, mTOR, and PKB (also known as Akt or AKT). PI3K proteins exist in several isoforms, including αβ, δ, or γ. It is intended that the PI3K inhibitors that may be used in the present invention may be selective for one or more isoforms. By selective, it is meant that the compound inhibits one or more isoforms over other isoforms. Selectivity is a concept well known to those skilled in the art and can be measured using well-known in vitro or cell-based activity assays. Preferred selectivity includes selectivity for one or more isoforms that is greater than 2-fold, preferably 10-fold, or more preferably 100-fold greater, for one or more isoforms over other isoforms. In one aspect, the PI3K inhibitors that may be used in combination with the compounds of the present invention are PI3Kα selective inhibitors. In another aspect, the compounds are PI3Kδ selective inhibitors. In yet another embodiment, the compound is a PI3Kβ selective inhibitor.

[0351] Examples of PI3K inhibitors that can be used in combination with one or more compounds of the invention include those disclosed in: WO 2010 / 151791; WO 2010 / 151737; WO 2010 / 151735; WO 2010151740; WO 2008 / 118455; WO 2008 / 118454; WO 2008 / 118468; U.S. Patent Application Publication No. 2010033129 No. 3; U.S. Patent Application Publication No. 20100331306; U.S. Patent Application Publication No. 20090023761; U.S. Patent Application Publication No. 20090030002; U.S. Patent Application Publication No. 20090137581; U.S. Patent Application Publication No. 2009 / 0054405; U.S. Patent Application Publication No. 2009 / 0163489; U.S. Patent Application Publication No. 2010 / 0273764; U.S. Patent Application Publication No. 2011 / 0092504; or WO 2010 / 108074. PI3K inhibitors include wortmannin, 17-hydroxywortmannin analogs, 4-[2-(1H-indazol-4-yl)-6-[[4-(methylsulfonyl)piperazin-1-yl]methyl]thieno[3,2-d]pyrimidin-4-yl]morpholine (GDC), which are described in WO 06 / 044453. 0941, described in WO 09 / 036,082 and WO 09 / 055,730), 2-methyl-2-[4-[3-methyl-2-oxo-8-(quinolin-3-yl)-2,3-dihydroimidazo[4,5-c]quinolin-1-yl]phenyl]propionitrile (also known as BEZ235 or NVP-BEZ235, described in WO 06 / 122806), (S)-1-(4-((2-(2-aminopyrimidin-5-yl)-7-methyl-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl)piperazin-1-yl)-2-hydroxypropan-1-one (as described in WO 2008 / 070740), LY294002 (2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one, available from Axon Medchem), PI103 hydrochloride (3-[4-(4-morpholinylpyrido-[3',2':4,5]furo[3,2-d]pyrimidin-2-yl]phenol hydrochloride, available from Axon Medchem), PIK 75 (N'-[(1E)-(6-bromoimidazo[1,2-a]pyridin-3-yl)methylene]-N,2-dimethyl-5-nitrobenzenesulfono-hydrazide hydrochloride, available from Axon Medchem), Medchem), PIK90 (N-(7,8-dimethoxy-2,3-dihydro-imidazo[1,2-c]quinazolin-5-yl)-nicotinamide, available from Axon Medchem), GDC-0941 bismesylate (2-(1H-indazol-4-yl)-6-(4-methanesulfonyl-piperazin-1-ylmethyl)-4-morpholin-4-yl-thieno[3,2-d]pyrimidine bismesylate, available from Axon Medchem), AS-252424 (5-[1-[5-(4-fluoro-2-hydroxy-phenyl)-furan-2-yl]-meth-(Z)-ylidene]-thiazolidine-2,4-dione, available from Axon Medchem). Medchem), and TGX-221 (7-methyl-2-(4-morpholinyl)-9-[1-(phenylamino)ethyl]-4H-pyrido-[1,2-a]pyrimidin-4-one, available from Axon Medchem), XL-765 and XL-147. Other PI3K inhibitors include demethoxyviridin, perifosine, CAL101, PX-866, BEZ235, SF1126, INK1117, IPI-145, BKM120, XL147, XL765, Palomid529, GSK1059615, ZSTK474, PWT33597, IC87114, TG100-115, CAL263, PI-103, GNE-477, CUDC-907 and AEZS-136.

[0352] Preferred PI3K inhibitors for use in combination with the compounds of the invention include: Also known as buparlisib, is an investigational small molecule from Novartis Pharmaceuticals:

[0353] [ka] ,

[0354] [ka] or a pharma- ceutically acceptable salt thereof.

[0355] Also preferred is a compound of formula IIa, or a pharma- ceutically acceptable salt thereof:

[0356] [ka] In the formula, X 1 is fluorine or hydrogen, Y 1 is hydrogen or methyl; Z 1 is hydrogen or methyl. A specific PI3K inhibitor that can be used in the combination of the present invention is AMG511 (also known as AMG2539965 or 2539965), which is Example 148 of WO 2010 / 126895.

[0357] The combination of the present invention inhibits KRAS G12C Other PI3K inhibitors that can be used in combination with the inhibitor include Pan-PI3K inhibitors, such as BKM120 and GDC-0941; PI3K alpha selective inhibitors, such as BYL719; and PI3K beta selective inhibitors, such as GSK-2636771.

[0358] Compounds that inhibit both PI3K and mTOR (dual inhibitors) are known. In yet another aspect, the present invention relates to a compound that inhibits KRAS G12CThe present invention provides the use of a dual inhibitor of PI3K and mTOR in combination with an inhibitor. A specific example of a dual inhibitor is GDC-0980.

[0359] KRAS G12C Inhibitors can also be used in combination with SHP2 inhibitors in the present invention. SHP2 inhibitors that can be used in the combinations of the present invention include, but are not limited to, SHP099, and RMC-4550 or RMC-4630 from Revolutions Medicines, Inc. of Redwood City, CA.

[0360] mTOR is a protein in the PI3K pathway. G12C mTOR inhibitors are used in combination with the compounds of the present invention. mTOR inhibitors that can be used in combination with the compounds of the present invention include those disclosed in the following documents: WO 2010 / 132598 and WO 2010 / 096314. The combination of the present invention inhibits KRAS G12C mTOR inhibitors that can be used in combination with the inhibitor include AZD2014 and MLN0128.

[0361] TOR inhibitors include, but are not limited to, AP-23573, CCI-779, everolimus, RAD-001, rapamycin, temsirolimus, ATP-competitive TORC1 / TORC2 inhibitors (including PI-103, PP242, PP30, and Torin1). Other TOR inhibitors include FKBP12 enhancers; rapamycin and its derivatives (including: CCI-779 (temsirolimus), RAD001 (everolimus); WO 9409010) and AP23573; e.g., rapalogs disclosed in WO 98 / 02441 and WO 01 / 14387, e.g., AP23573, AP23464, or AP23841; 40-(2-hydroxyethyl)rapamycin; rapamycin, 40-[3-hydroxy(hydroxymethyl)methylpropanoate]-rapamycin (also known as CC1779), 40-epi-(tetrazolyl)-rapamycin (also known as ABT578), 32-deoxorapamycin, 16-pentynyloxy-32(S)-dihydrorapamycin, and other derivatives disclosed in WO 05005434; U.S. Pat. No. 5,258,389; WO 94 / 090101; Brochure, International Publication No. WO 92 / 05179 Brochure, U.S. Patent No. 5,118,677, U.S. Patent No. 5,118,678, U.S. Patent No. 5,100,883, U.S. Patent No. 5,151,413, U.S. Patent No. 5,120,842, International Publication No. WO 93 / 111130 Brochure, International Publication No. WO 94 / 02136 Brochure, International Publication No. WO 94 / 02485 Brochure, International Publication No. WO 95 / 14023 Brochure , derivatives disclosed in WO 94 / 02136, WO 95 / 16691, WO 96 / 41807, WO 96 / 41807 and U.S. Pat. No. 5,256,790; phosphorus-containing rapamycin derivatives (e.g., WO 05016252); 4H-1-benzopyran-4-one derivatives (e.g., U.S. Provisional Patent Application No. 60 / 528,340).

[0362] PKB (AKT) is also a protein in the PI3K pathway. In another embodiment of the invention, an AKT inhibitor is used to inhibit KRAS G12C In combination with the compounds of the present invention, AKT inhibitors can be used in combination with the compounds of the present invention, including those disclosed in U.S. Patent No. 7,354,944, U.S. Patent No. 7,700,636, U.S. Patent No. 7,919,514, U.S. Patent No. 7,514,566, U.S. Patent Application Publication No. 2009 / 0270445A1, U.S. Patent No. 7,919,504, U.S. Patent No. 7,897,619, or WO 2010 / 083246A1. G12C Specific AKT inhibitors that can be used in combination with the inhibitor include MK-2206, GDC-0068 and AZD5363.

[0363] AKT inhibitors include Akt-1-1 (inhibits Akt1) (Barnett et al. (2005) Biochem. J., 385(Pt. 2), 399-408); Akt-1-1,2 (inhibits Akt1 and 2) (Barnett et al. (2005) Biochem. J. 385(Pt. 2), 399-408); API-59CJ-Ome (eg, Jin et al. (2004) Br. J. Cancer 91, 1808-12); 1-H-imidazo[4,5-c]pyridinyl compounds (e.g., WO 05011700); indole-3-carbinol and its derivatives (e.g., U.S. Pat. No. 6,656,963; Sarkar and Li (2004) J Nutr. 134(12) Suppl), 3493S-3498S); perifosine (e.g., which interferes with membrane localization of Akt; Dasmahapatra et al. (2004) Clin. Cancer Res. 10(15), 5242-52, 2004); phosphatidylinositol ether lipid analogs (e.g., Gills and Dennis (2004) Expert. Opin. Investig. Drugs 13, 787-97); and triciribine (TCN or API-2 or NCI Identification Number: NSC154020; Yang et al. (2004) Cancer Res. 64:4394-9).

[0364] MCl-1 inhibitors include, but are not limited to, AMG-176, MIK665, and S63845.Myeloid cell leukemia-1 (MCL-1) protein is one of the important anti-apoptotic members of the B-cell lymphoma-2 (BCL-2) protein family.Overexpression of MCL-1 has been closely related to tumor progression and resistance to targeted therapy, including traditional chemotherapy as well as BCL-2 inhibitors such as ABT-263.

[0365] Proteasome inhibitors include, but are not limited to, Kyprolis® (carfilzomib), Velcade® (bortezomib), and oprozomib.

[0366] Immunotherapies include, but are not limited to, anti-PD-1 agents, anti-PDL-1 agents, anti-CTLA-4 agents, anti-LAG1 agents, and anti-OX40 agents.

[0367] Monoclonal antibodies include, but are not limited to, Darzalex® (daratumumab), Herceptin® (trastuzumab), Avastin® (bevacizumab), Rituxan® (rituximab), Lucentis® (ranibizumab), and Eylea® (aflibercept).

[0368] Immunomodulatory agents (IMiDs) are a class of immunomodulatory drugs (drugs that modulate the immune response) that contain an imide group. The IMiD class includes thalidomide and its analogs (lenalidomide, pomalidomide, and apremilast).

[0369] Anti-PD-1 inhibitors, including but not limited to antibodies, include, but are not limited to, pembrolizumab (Keytruda®) and nivolumab (Opdivo®). Exemplary anti-PD-1 antibodies and methods of their use are described in Goldberg et al., Blood 110(1):186-192 (2007), Thompson et al., Clin. Cancer Res. 13(6):1757-1761 (2007), and Korman et al., International Application No. PCT / JP2006 / 309606 (WO 2006 / 121168 A1), each of which is expressly incorporated herein by reference. Includes: Yervoy™ (ipilimumab) or tremelimumab (to CTLA-4), galiximab (to B7.1), BMS-936558 (to PD-1), MK-3475 (to PD-1), AMP224 (to B7DC), BMS-936559 (to B7-H1), MPDL3280A (to B7-H1), MEDI-570 (to ICOS), AMG557 (to B7H2), MGA271 (to B7H3), IMP321 (to LAG-3), BMS-663513 (to CD137), PF-05082566 (to CD137), CDX-1127 (to CD27), anti-OX40 (Providence Health Services), huMAbOX40L (to OX40L), atacicept (to TACI), CP-870893 (to CD40), lucatumumab (to CD40), dacetuzumab (to CD40), muromonab-CD3 (to CD3), ipilimumab (to CTLA-4). Immunotherapies also include engineered T cells (e.g., CAR-T cells) and bispecific antibodies (e.g., BiTEs).

[0370] In certain embodiments, the compounds of the invention are used in combination with an anti-PD-1 antibody, such as AMG404. In certain embodiments, the anti-PD-1 antibody (or antigen-binding antibody fragment thereof) comprises one, two, three, four, five, or all six of the CDR amino acid sequences of SEQ ID NOs: 1-6 (representing, in order, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3). In certain embodiments, the anti-PD-1 antibody (or antigen-binding antibody fragment thereof) comprises all six of the CDR amino acid sequences of SEQ ID NOs: 1-6. In other embodiments, the anti-PD-1 antibody (or antigen-binding antibody fragment thereof) comprises (a) a heavy chain variable region amino acid sequence of SEQ ID NO: 7, or a variant sequence thereof that differs by only one or two amino acids or has at least or about 70% sequence identity, or (b) a light chain variable region amino acid sequence of SEQ ID NO: 8, or a variant sequence thereof that differs by only one or two amino acids or has at least or about 70% sequence identity. In an exemplary embodiment, the anti-PD-1 antibody (or antigen-binding antibody fragment thereof) comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 7, and a light chain variable region amino acid sequence of SEQ ID NO: 8. In other embodiments, the anti-PD-1 antibody (or antigen-binding antibody fragment thereof) comprises (a) a heavy chain amino acid sequence of SEQ ID NO: 9, or a variant sequence thereof that differs by only one or two amino acids or has at least or about 70% sequence identity, or (b) a light chain amino acid sequence of SEQ ID NO: 10, or a variant sequence thereof that differs by only one or two amino acids or has at least or about 70% sequence identity. In an exemplary embodiment, the anti-PD-1 antibody (or antigen-binding antibody fragment thereof) comprises a heavy chain amino acid sequence of SEQ ID NO: 9, and a light chain amino acid sequence of SEQ ID NO: 10.

[0371] The disclosure further provides nucleic acid sequences encoding anti-PD-1 antibodies (or antigen-binding portions thereof). In exemplary embodiments, the antibodies comprise one, two, three, four, five, or all six CDRs encoded by the nucleic acids of SEQ ID NOs:11-16 (representing, in order, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3). In another exemplary embodiment, the antibodies comprise all six CDRs encoded by the nucleic acids of SEQ ID NOs:11-16. In some embodiments, the anti-PD-1 antibody (or antigen-binding portion thereof) comprises (a) a heavy chain variable region encoded by SEQ ID NO: 17, or a variant sequence thereof that differs in only 1, 2, 3, 4, 5, or 6 nucleic acids or has at least or about 70%, 85%, 90%, or 95% sequence identity, or (b) a light chain variable region encoded by SEQ ID NO: 18, or a variant sequence thereof that differs in only 1, 2, 3, 4, 5, or 6 nucleic acids or has at least or about 70%, 85%, 90%, or 95% sequence identity. In exemplary embodiments, the anti-PD-1 antibody (or antigen-binding portion thereof) comprises a heavy chain variable region encoded by SEQ ID NO: 17, and a light chain variable region encoded by SEQ ID NO: 18. In another embodiment, the anti-PD-1 antibody (or antigen-binding portion thereof) comprises (a) a heavy chain encoded by SEQ ID NO: 19, or a variant sequence thereof that differs in only 1, 2, 3, 4, 5, or 6 nucleic acids or has at least or about 70%, 85%, 90%, or 95% sequence identity, or (b) a light chain encoded by SEQ ID NO: 20, or a variant sequence thereof that differs in only 1, 2, 3, 4, 5, or 6 nucleic acids or has at least or about 70%, 85%, 90%, or 95% sequence identity. In an exemplary embodiment, the anti-PD-1 antibody (or antigen-binding portion thereof) comprises a heavy chain encoded by SEQ ID NO: 19, and a light chain encoded by SEQ ID NO:20. Using CRISPR technology, CT-26 KRAS p.G12C cells were generated from the murine T-26 colorectal line (ATCC) and both alleles of KRAS p.G12D were replaced with p.G12C (ThermoFisher Scientific), encoded by SEQ ID NO:21.

[0372] [Table 1] TIFF2025061478000030.tif171170TIFF2025061478000031.tif193170TIFF2025061478000032.tif186170TIFF2025061478000033.tif94170

[0373] GITR agonists include GITR fusion proteins as described in U.S. Pat. No. 6,111,090box.c, EP 090505B1, U.S. Pat. No. 8,586,023, WO 2010 / 003118 and WO 2011 / 090754, or GITR fusion proteins as described, for example, in U.S. Pat. No. 7,025,962, EP 1947183B1, U.S. Pat. No. 7,812,135, U.S. Pat. No. 8,388,967, U.S. Pat. No. 8,591,886, EP 1866339, WO 2011 / 028683, WO 2013 / 039954, and the like. and anti-GITR antibodies (e.g., bivalent anti-GITR antibodies), such as those described in WO 2005 / 007190, WO 2007 / 133822, WO 2005 / 055808, WO 99 / 40196, WO 2001 / 03720, WO 99 / 20758, WO 2006 / 083289, WO 2005 / 115451, U.S. Pat. No. 7,618,632, and WO 2011 / 051726.

[0374] In the present invention, KRAS G12CThe inhibitors may also be used in combination with CDK4 and / or 6 inhibitors. CDK4 and / or 6 inhibitors that may be used in the combinations of the present invention include, but are not limited to, those disclosed in the following documents: WO 2009 / 085185, or U.S. Patent Application Publication No. 2011 / 0097305.

[0375] The combination of the present invention inhibits KRAS G12C Other compounds that can be used in combination with the inhibitor include compounds that inhibit certain proteins in the intrinsic apoptosis pathway. Examples of such compounds include, but are not limited to, Bcl2 / BclxL inhibitors such as navitoclax and Bcl2 inhibitors such as ABT-199.

[0376] The combination of the present invention inhibits KRAS G12C Other compounds that can be used in combination with the inhibitor include, but are not limited to, BCR-ABL inhibitors such as dasatinib, and HDAC inhibitors such as panobinostat.

[0377] The combination of the present invention inhibits KRAS G12C Other compounds that can be used in combination with the inhibitors include platinums, such as cisplatin, carboplatin, and oxaliplatin; topoisomerase II inhibitors, typically those of the anthracycline class, such as doxorubicin, daunorubicin, idarubicin, epirubicin, pegylated liposomal doxorubicin hydrochloride, myocet, and etoposide; topoisomerase I inhibitors, such as irinotecan (CPT-11); DNA alkylating agents, such as temozolomide; and nucleoside analogs, such as cytarabine and decitabine.

[0378] The combination of the present invention inhibits KRAS G12C Other compounds that can be used in combination with the inhibitor include receptor and non-receptor kinase inhibitors, including tyrosine kinase inhibitors. Examples of such compounds include imatinib, dasatinib, ponatinib, bosutinib, nilotinib, quizartinib, midostaurin, erlotinib, and lapatinib.

[0379] The compounds described herein can be used in combination with the agents disclosed herein or other suitable agents, depending on the condition being treated. Thus, in some embodiments, one or more compounds of the disclosure will be co-administered with one of the other agents described above. When used in combination therapy, the compounds described herein are administered either simultaneously with or separately from the second agent. Such co-administration can include simultaneous administration of the two agents in the same dosage form, simultaneous administration of the two agents in different dosage forms, and separate administrations. That is, either the compounds described herein and any of the agents described above can be formulated together in the same dosage form and administered simultaneously. Alternatively, either the compounds of the disclosure and any of the agents described above can be administered simultaneously, where both agents are present in separate dosage forms. In another alternative, the compounds of the disclosure can be administered either immediately before or immediately after any of the agents described above. In some embodiments of the separate administration protocol, either the compounds of the disclosure or any of the agents described above are administered separated by minutes, or hours, or days.

[0380] One aspect of the invention is directed to the treatment of a disease / condition with a combination of pharmaceutically active compounds that can be administered separately, so the invention further relates to combining separate pharmaceutical compositions in kit form. The kit includes two separate pharmaceutical compositions: a compound of the invention, and a second pharmaceutical compound. The kit includes a container for holding the separate compositions, such as a divided bottle or a divided foil packet. Further examples of containers include syringes, boxes, and bags. In some embodiments, the kit includes instructions for use of the separate components. The kit form is particularly advantageous preferably when the separate components are to be administered in different dosage forms (e.g., oral and parenteral), at different dosing intervals, or when the prescribing medical professional desires to set the dosages of the individual components of the combination.

[0381] <Synthesis of AMG510>

[0382] KRAS of the present invention G12CInhibitors include those disclosed in WO 2018 / 119183.

[0383] [ka] The synthesis of AMG510, having the structure:

[0384] 6-Fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(4-methyl-2-(2-propanyl)-3-pyridinyl)-4-((2S)-2-methyl-4-(2-propenoyl)-1-piperazinyl)pyrido[2,3-d]pyrimidin-2(1H)-one was prepared using the following process to separate the final product and isolate the M-atropisomer.

[0385] [ka]

[0386] Step 1: 2,6-Dichloro-5-fluoronicotinamide (Intermediate S) To a mixture of 2,6-dichloro-5-fluoro-nicotinic acid (4.0 g, 19.1 mmol, AstaTech Inc, Bristol, PA) in dichloromethane (48 mL) was added oxalyl chloride (2M solution in DCM, 11.9 mL, 23.8 mmol), followed by a catalytic amount of DMF (0.05 mL). The reaction was stirred at room temperature overnight and then concentrated. The residue was dissolved in 1,4-dioxane (48 mL) and cooled to 0° C. Ammonium hydroxide solution (28.0-30% NH3 based, 3.6 mL, 28.6 mmol) was added slowly via syringe. The resulting mixture was stirred at 0° C. for 30 min and then concentrated. The residue was diluted with a 1:1 mixture of EtOAc / heptane and stirred for 5 min and then filtered. The filtered solid was discarded and the remaining mother liquor was partially concentrated to half its volume and filtered. The filtered solid was washed with heptane and dried in a vacuum oven (45° C.) overnight to give 2,6-dichloro-5-fluoronicotinamide. 1 H NMR(400MHz,DMSO-d6)δ ppm 8.23(d,J=7.9Hz,1H)8.09(br s,1H)7.93(br s,1H).m / z(ESI,+ve ion):210.9(M+H).

[0387] Step 2: 2,6-dichloro-5-fluoro-N-((2-isopropyl-4-methylpyridin-3-yl)carbamoyl)nicotinamide To an ice-cold slurry of 2,6-dichloro-5-fluoronicotinamide (Intermediate S, 5.0 g, 23.9 mmol) in THF (20 mL) was added oxalyl chloride (2 M solution in DCM, 14.4 mL, 28.8 mmol) slowly via syringe. The resulting mixture was heated at 75° C. for 1 h, after which the heating was stopped and the reaction was concentrated to half the volume. After cooling to 0° C., THF (20 mL) was added followed by a solution of 2-isopropyl-4-methylpyridin-3-amine (Intermediate R, 3.59 g, 23.92 mmol) in THF (10 mL) dropwise via cannula. The resulting mixture was stirred at 0° C. for 1 h, after which the reaction was quenched with a 1:1 mixture of brine and saturated aqueous ammonium chloride. The mixture was extracted with EtOAc (3x) and the combined organic layers were dried over anhydrous sodium sulfate and concentrated to give 2,6-dichloro-5-fluoro-N-((2-isopropyl-4-methylpyridin-3-yl)carbamoyl)nicotinamide. This material was used in the next step without further purification. m / z (ESI, +ve ion): 385.1 (M+H). + .

[0388] Step 3: 7-Chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidine-2,4(1H,3H)-dione To an ice-cold solution of 2,6-dichloro-5-fluoro-N-((2-isopropyl-4-methylpyridin-3-yl)carbamoyl)nicotinamide (9.2 g, 24.0 mmol) in THF (40 mL) was added KHMDS (1 M in THF, 50.2 mL, 50.2 mmol) slowly via syringe. The ice bath was removed and the resulting mixture was stirred at room temperature for 40 minutes. The reaction was quenched with saturated aqueous ammonium chloride and extracted with EtOAc (3x). The combined organic layers were dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel chromatography (eluent: 0-50% 3:1 EtOAc-EtOH / heptane) to give 7-chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidine-2,4(1H,3H)-dione. 1 H NMR(400MHz,DMSO-d6)δ ppm 12.27(br s,1H),8.48-8.55(m,2H),7.29(d,J=4.8Hz,1H),2.87(quintet,J=6.6Hz,1H),1.99-2.06(m,3H),1.09(d,J=6.6Hz,3H),1.01(d,J=6.6Hz,3H). 19 F NMR(376MHz,DMSO-d6)δ:-126.90(s,1 F).m / z(ESI,+ve ion):349.1(M+H) + .

[0389] <Step 4: 4,7-dichloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidin-2(1H)-one> 7-chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidin-2,4(1H,3H)-dione (4.7 g, 13.5 mmol) and DIPEA (3.5 mL, 20.2 mmol) in acetonitrile (20 mL) was added dropwise from a syringe to phosphorus oxychloride (1.63 mL, 17.5 mmol). The resulting mixture was heated at 80° C. for 1 hour, then cooled to room temperature and concentrated to obtain 4,7-dichloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidin-2(1H)-one. This material was used in the next step without further purification. m / z (ESI, +ve ion): 367.1 (M+H). + .

[0390] Step 5: (S)-tert-butyl 4-(7-chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate To an ice-cold solution of 4,7-dichloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidin-2(1H)-one (13.5 mmol) in acetonitrile (20 mL) was added DIPEA (7.1 mL, 40.3 mmol) followed by (S)-4-N-Boc-2-methylpiperazine (3.23 g, 16.1 mmol, Combi-Blocks, Inc., San Diego, CA, USA). The resulting mixture was allowed to warm to room temperature and stirred for 1 h, then diluted with cold saturated aqueous sodium bicarbonate (200 mL) and EtOAc (300 mL). The mixture was stirred for an additional 5 min, the layers were separated, and the aqueous layer was extracted with additional EtOAc (1×). The combined organic layers were dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel chromatography (eluent: 0-50% EtOAc / heptane) to give (S)-tert-butyl 4-(7-chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate. m / z (ESI, +ve ion): 531.2 (M+H). + .

[0391] Step 6: (3S)-tert-butyl 4-(6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(2-isopropyl-4-methylpyridin-3-yl)-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate (S)-tert-butyl 4-(7-chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate in 1,4-dioxane (80 mL). A mixture of hydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate (4.3 g, 8.1 mmol), potassium trifluoro(2-fluoro-6-hydroxyphenyl)borate (Intermediate Q, 2.9 g, 10.5 mmol), potassium acetate (3.2 g, 32.4 mmol) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II), dichloromethane complex (661 mg, 0.81 mmol) was degassed with nitrogen for 1 min. Deoxygenated water (14 mL) was added and the resulting mixture was heated at 90 °C for 1 h. The reaction was cooled to room temperature, quenched with half-saturated aqueous sodium bicarbonate and extracted with EtOAc (2x) and DCM (1x). The combined organic layers were dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel chromatography (eluent: 0-60% 3:1 EtOAc-EtOH / heptane) to give (3S)-tert-butyl 4-(6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(2-isopropyl-4-methylpyridin-3-yl)-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate. 1H NMR(400MHz,DMSO-d6)δ ppm 10.19(br s,1H),8.38(d,J=5.0Hz,1H),8.26(dd,J=12.5,9.2Hz,1H),7.23-7.28(m,1H),7.18(d,J=5.0Hz,1H),6.72(d,J=8.0Hz,1H),6.68(t,J=8.9Hz,1H),4.77-4.98(m,1H),4.24(br t,J=14.2Hz,1H),3.93-4.08(m,1H),3.84(br d,J=12.9Hz,1H),3.52-3.75(m,1H),3.07-3.28(m,1H),2.62-2.74(m,1H),1.86-1.93(m,3H),1.43-1.48(m,9H),1.35(dd,J=10.8,6.8Hz,3H),1.26-1.32(m,1H),1.07(dd,J=6.6,1.7Hz,3H),0.93(dd,J=6.6,2.1Hz,3H). 19 F NMR(376MHz,DMSO-d6)δ:-115.65(s,1 F),-128.62(s,1 F).m / z(ESI,+ve イオン):607.3(M+H).

[0392] Step 7: 6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(4-methyl-2-(2-propanyl)-3-pyridinyl)-4-((2S)-2-methyl-4-(2-propenoyl)-1-piperazinyl)pyrido[2,3-d]pyrimidin-2(1H)-one> Trifluoroacetic acid (25 mL, 324 mmol) was added to a solution of (3S)-tert-butyl 4-(6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(2-isopropyl-4-methylpyridin-3-yl)-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl)-3-methylpiperazine-1-carboxylate (6.3 g, 10.4 mmol) in DCM (30 mL). The resulting mixture was stirred at room temperature for 1 hour and then concentrated. The residue was dissolved in DCM (30 mL), cooled to 0 °C, and treated sequentially with solutions of DIPEA (7.3 mL, 41.7 mmol) and acryloyl chloride (0.849 mL, 10.4 mmol) in DCM (3 mL; dropwise from a syringe). The reaction was stirred at 0 °C for 10 min, then quenched with half-saturated aqueous sodium bicarbonate and extracted with DCM (2x). The combined organic layers were dried over anhydrous sodium sulfate and concentrated. Chromatographic purification of the residue (silica gel; eluent: 0-100% EtOAc-EtOH (3:1) / heptane) followed by chiral separation using supercritical fluid chromatography (Chiralpak IC, 30 x 250 mm, 5 μm, 55% MeOH / CO2, 120 mL / min, 102 bar; first eluting peak collected) afforded AMG510 (2.25 g, 43% yield). 6-Fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(4-methyl-2-(2-propanyl)-3-pyridinyl)-4-((2S)-2-methyl-4-(2-propenoyl)-1-piperazinyl)pyrido[2,3-d]pyrimidin-2(1H)-one. 1H NMR(400MHz,DMSO-d6)δ ppm 10.20(s,1H),8.39(d,J=4.8Hz,1H),8.24-8.34(m,1H),7.23-7.32(m,1H),7.19(d,J=5.0H z,1H),6.87(td,J=16.3,11.0Hz,1H),6.74(d,J=8.6Hz,1H),6.69(t,J=8.6Hz,1H),6.21(br d,J=16.2Hz,1H),5.74-5.80(m,1H),4.91(br s,1H),4.23-4.45(m,2H),3.97-4.21(m,1H),3.44-3.79(m,2H),3.11-3.31(m,1H),2.67-2. 77(m,1H),1.91(s,3H),1.35(d,J=6.8Hz,3H),1.08(d,J=6.6Hz,3H),0.94(d,J=6.8Hz,3H). 19 F NMR(376MHz,DMSO-d6)δ ppm -115.64(s,1 F), -128.63(s,1 F).m / z(ESI,+ve ion):561.2(M+H) + .

[0393] As used herein, AMG510 refers to

[0394] [ka] or a pharmaceutically acceptable salt thereof.

[0395] <Synthesis of intermediates>

[0396] [ka] 2-Isopropyl-4-methylpyridin-3-amine (R) [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II), dichloromethane complex (79 mg, 0.10 mmol) was added to a slurry of 3-amino-2-bromo-4-picoline (3; 360 mg, 1.9 mmol, Combi-Blocks, San Diego, CA) in THF (4 mL) and the mixture was sparged with argon for 2 min. 2-Propylzinc bromide (0.5 M in THF, 5.40 mL, 2.7 mmol) was added and the solution was heated at 60° C. for 17 h and then cooled to room temperature. Water (10 mL) and 1N aqueous NaOH (20 mL) were added and the mixture was extracted with EtOAc (2×). The combined organic layers were dried over anhydrous sodium sulfate and concentrated in vacuo. Chromatographic purification of the residue (silica gel; eluent: 0-15% MeOH / DCM) afforded R (284 mg, 98% yield). 1 H-NMR (400MHz, DMSO-d6): δ 7.66 ppm(d,J=4.6Hz,1H),6.78(d,J=4.8Hz,1H),4.72(br s,2H),3.14-3.25(m,1H),2.08(s,3H),1.14(d,J = 6.8Hz,6H);m / z(ESI,+ve ion):151.1(M+H) + . [ka]

[0397] <Potassium (2-fluoro-6-hydroxyphenyl)trifluoroborate (Q)>A solution of potassium fluoride (44.7 g, 770 mmol) in water (75 mL) was added to a suspension of (2-fluoro-6-hydroxyphenyl)boronic acid (9; 30 g, 192 mmol, Combi-Blocks, San Diego, CA) in acetonitrile (750 mL). After stirring for 2 minutes, a solution of L-(+)-tartaric acid (72.2 g, 481 mmol) in THF (375 mL) was added over 10 minutes. The resulting mixture was stirred mechanically for 1 hour. The suspended solid was removed by filtration and washed with a small amount of THF. Then, the combined filtrates were partially concentrated in vacuo until a solid began to precipitate. The filtrate was cooled to -20 ℃ and stirred for 16 hours, then warmed slowly to ambient temperature. 2-Propanol (20 mL) was added and the precipitated solid was collected by filtration and washed with 2-propanol to give 27.5 g of solid. The filtrate was again partially concentrated (until precipitation was observed), cooled to -20 ℃ and stirred for 20 minutes. Further 2-propanol was added and the precipitated solid was collected by filtration and washed with 2-propanol. Two batches of solid were combined to give Q (34.6 g, 82% yield). 1 1H-NMR (400 MHz, DMSO-d6): δ 8.07 ppm (q, J = 14.7 Hz, 1H), 6.93 (q, J = 7.5 Hz, 1H), 6.30 - 6.38 (m, 2H).

[0398] <Synthesis of AMG510 Propionamide>

[0399]

Chemical Structure

[0400] (M)-6-Fluoro-7-(2-fluoro-6-hydroxyphenyl)-1-(4-methyl-2-(2-propanyl)-3-pyridinyl)-4-((2S)-2-methyl-4-propanoyl-1-piperazinyl)pyrido[2,3-d]pyrimidin-2(1H)-one (AMG510 propionamide): Trifluoroacetic acid (4.0 mL, 51.9 mmol) was added to a solution of (M)-11 (0.196 g, 0.323 mmol) in DCM (5 mL) and the resulting mixture was stirred at room temperature for 20 min. The mixture was then concentrated in vacuo and the residue was taken up in DCM (10 mL), cooled to 0° C. and treated sequentially with DIPEA (0.169 mL, 0.969 mmol) and propionyl chloride (0.016 mL, 0.194 mmol). The resulting mixture was stirred at 0° C. for 10 min, then diluted with saturated aqueous sodium bicarbonate and extracted with DCM (2×). The combined extracts were dried over anhydrous sodium sulfate and concentrated in vacuo. Chromatographic purification of the residue (silica gel; eluent: 0-70% EtOAc-EtOH (3:1) / heptane) afforded AMG510 propionamide (0.180 g, 99% yield). 1H-NMR(400MHz,DMSO-d6):δ 10.20 ppm(s,1H),8.40(d,J=5.0Hz,1H),8.27(br dd,J=15.1,9.3Hz,1H),7.27(m,1H),7.21(br d,J=4.8Hz,1H),6.73(d,J=8.3Hz,1H),6.69(t,J=8.9Hz,1H),4.87(br s,1H),4.31(m,1.5H),4.21(br d,J=13.5Hz,0.5H),3.94(br d,J=12.2Hz,0.5H),3.82(br d,J=13.3Hz,0.5H),3.62-3.76(m,1H),3.52-3.62(m,0.5H),3.43-3.51(m,0.5H),3.18(br dd,J=13.3,3.3Hz,0.5H),3.06(br t,J=10.7Hz,0.5H),2.73(br m / z(ESI,+ve ion):563.2(M+H) + .

[0401] AMG510 was synthesized by an alternative method, and the relevant intermediates were described in U.S. Provisional Patent Application No. 62 / 768,802, filed November 16, 2018. The alternative method includes the following steps, where separation of the rac-dione in steps 4 and 5 facilitates successful separation of the atropisomers:

[0402] [ka]

[0403] <Process Description>

[0404] <Step 1>:

[0405] [ka]

[0406] [Table 2]

[0407] To a solution of 2,6-dichloro-5-fluoro-3-pyridine carboxylic acid (compound 1) (25 kg; 119.1 mol) in dichloromethane (167 kg) and DMF (592 g) was added oxalyl chloride (18.9 kg; 148.9 mol) while maintaining the internal temperature between 15-20° C. Additional dichloromethane (33 kg) was added as a rinse and the reaction mixture was stirred for 2 hours. The reaction mixture was cooled and then quenched with ammonium hydroxide (40.2 L; 595.5 mol) while maintaining the internal temperature at 0±10° C. The resulting slurry was stirred for 90 minutes before collecting the product by filtration. The filtered solid was washed with DI water (3×87 L) and dried to give 2,6-dichloro-5-fluoronicotinamide (compound 2).

[0408] <Step 2>:

[0409] [ka]

[0410] [Table 3]

[0411] In reactor A, oxalyl chloride (11.9 kg; 93.8 mol) was added to a solution of 2,6-dichloro-5-fluoronicotinamide (compound 2) (16.27 kg; 77.8 mol) in dichloromethane (359.5 kg) while maintaining the temperature at ≦25° C. for 75 minutes. The resulting solution was then heated to 40° C.±3° C. and aged for 3 hours. Using vacuum, the solution was distilled to remove dichloromethane until the solution was under the stirrer. Dichloromethane (300 kg) was then added and the mixture was cooled to 0±5° C. To a clean, dry reactor (reactor B) was added 2-isopropyl-4-methylpyridin-3-amine (ANILINE) (12.9 kg; 85.9 mol) followed by dichloromethane (102.6 kg). The ANILINE solution was azeotropically dried by vacuum distillation, replacing with additional dichloromethane until the solution was dry by KF analysis (limit ≦0.05%), while maintaining the internal temperature between 20-25°C. The volume of the solution was adjusted to approximately 23 L volume with dichloromethane. The dried ANILINE solution was then added to reactor A (while maintaining an internal temperature of 0±5°C). The mixture was then heated to 23°C and aged for 1 hour. The solution was polish filtered into a clean reactor to give 2,6-dichloro-5-fluoro-N-((2-isopropyl-4-methylpyridin-3-yl)carbamoyl)nicotinamide (compound 3) as a solution in DCM, which was used directly in the next step.

[0412] <Step 3>:

[0413] [ka]

[0414] [Table 4]

[0415] A solution of 2,6-dichloro-5-fluoro-N-{[4-methyl-2-(propan-2-yl)pyridin-3-yl]carbamoyl}pyridine-3-carboxamide (uric acid (compound 3)) (containing 15 kg; 38.9 mol) in dichloromethane was solvent exchanged into 2-MeTHF using vacuum distillation while maintaining an internal temperature of 20-25 °C. The reactor volume was adjusted to 40 L and then additional 2-MeTHF (105.4 kg) was added. Sodium t-butoxide (9.4 kg; 97.8 mol) was added while maintaining the temperature at 5-10 °C. The contents were warmed to 23 °C and stirred for 3 hours. The contents were then cooled to 0-5 °C and ammonium chloride (23.0 kg; 430 mol) was added as a solution in 60 L of DI water. The mixture was warmed to 20 °C, DI water (15 L) was added, and the mixture was aged for an additional 30 minutes. The stirring was stopped and the layers were separated. The aqueous layer was removed and DI water (81.7 L) was added to the organic layer. A mixture of concentrated HCl (1.5 kg) and water (9 L) was prepared and then slowly added to the reactor until the pH was measured between 4-5. The layers were separated and the aqueous layer was back extracted with 2-MeTHF (42.2 kg). The two organic layers were combined and washed with 10% citric acid solution (75 kg), followed by a mixture of water (81.7 L) and saturated NaCl (19.8 kg). The organic layer was then washed with saturated sodium bicarbonate (75 kg), and the washes were repeated if necessary to achieve the aqueous target pH > 7.0. The organic layer was washed again with brine (54.7 kg) and then dried over magnesium sulfate (5 kg). The mixture was filtered to remove magnesium sulfate and the filter layer was rinsed with 2-MeTHF (49.2 kg). The combined filtrate and washes were vacuum distilled to a volume of 40 L. The concentrated solution was heated to 55°C and heptane (10-12 kg) was added slowly to the cloud point. The solution was cooled to 23°C over 2 hours, after which heptane (27.3 kg) was added over 2 hours. The product slurry was aged at 20-25°C for 3 hours, then filtered and washed with a mixture of 2-MeTHF (2.8 kg) and heptane (9 kg). The product was dried using nitrogen and vacuum to give a solid, 7-chloro-6-fluoro-1-(2-isopropyl-4-methylpyridin-3-yl)pyrido[2,3-d]pyrimidine-2,4(1H,3H)-dione (rac-DIONE (compound 4)).

[0416] <Step 4>:

[0417] [ka]

[0418] [Table 5]

[0419] A stirred suspension of compound 4 (1.0 equiv.) in 2-methylterahydrofuran (7.0 L / kg) was added to the vessel along with (+)-2,3-dibenzoyl-D-tartaric acid (2.0 equiv.) under nitrogen atmosphere. 2-MeTHF is chiral but used as a racemic mixture. The different enantiomers of 2-MeTHF are randomly incorporated into the co-crystal. The resulting suspension was warmed to 75° C. and aged at 75° C. until complete dissolution was observed (≦30 min). The resulting solution was polish filtered into a second vessel at 75° C. n-heptane (2.0 L / kg) was added to the polish filtered solution at a rate that maintained the internal temperature above 65° C. The solution was then cooled to 60° C., seed crystals (0.01 kg / kg) were added, and aged for 30 min. The resulting suspension was cooled to 20° C. over 4 h and then sampled for chiral purity analysis by HPLC. The suspension was added with n-heptane (3.0 L / kg) and then aged under nitrogen at 20° C. for 4 hours. The suspension was filtered and the isolated solid was washed twice with (2:1) n-heptane:2-methyltetrahydrofuran (3.0 L / kg). The material was dried under nitrogen and vacuum to give M-dione:DBTA:Me-THF complex (compound 4a).

[0420] <Step 5>:

[0421] [ka]

[0422] [Table 6]

[0423] To vessel A, a suspension of disodium hydrogen phosphate (21.1 kg, 2.0 equiv.) in DI water (296.8 L, 6.3 L / kg) was stirred until dissolution was observed (≧30 min). To vessel B, a suspension of M-dione:DBTA:Me-THF complex (composition 4a) [46.9 kg (25.9 kg corrected for M-dione, 1.0 equiv.)] in methyl tert-butyl ether (517.8 L, 11.0 L / kg) was stirred for 15-30 min. The solution obtained from vessel A was added to vessel B, after which the mixture was stirred for >3 h. Stirring was stopped and the biphasic mixture was left for >30 min for separation. The lower aqueous phase was removed and then back extracted with methyl tert-butyl ether (77.7 L, 1.7 L / kg). The organic phases were combined in vessel B and dried over magnesium sulfate (24.8 kg, 0.529 kg / kg). The suspension obtained from vessel B was stirred for >3 hours and then filtered into vessel C. A methyl tert-butyl ether (46.9 L, 1.0 L / kg) rinse was added to vessel B and then filtered into vessel C. The contents of vessel C were cooled to 10°C and then distilled under vacuum with slow warming to 35°C. Distillation was continued until 320-350 kg (6.8-7.5 kg / kg) of methyl tert-butyl ether was collected. The contents of vessel C were cooled to 20°C, after which n-heptane (278.7 L, 5.9 L / kg) was added over 1 hour and then vacuum distilled with slow warming to 35°C. Distillation was continued until 190-200 kg (4.1-4.3 kg / kg) of methyl tert-butyl ether and n-heptane mixture was collected. The contents of vessel C were cooled to 20°C, then a second portion of n-heptane (278.7 L, 5.9 L / kg) was added over 1 hour, followed by vacuum distillation with slow warming to 35°C. Distillation was continued until 190-200 kg (4.1-4.3 kg / kg) of methyl tert-butyl ether and n-heptane mixture was collected. The contents of vessel C were cooled to 20°C, then a third portion of n-heptane (195.9 L, 4.2 L / kg) was added over 1 hour, followed by sampling for solvent composition analysis by GC. The suspension in vessel C was left stirring for >1 hour. The suspension was filtered and then washed with n-heptane (68.6 L, 1.5 L / kg) rinse from vessel C.The isolated solid was dried at 50° C. and a sample was submitted for storage suitability. Compound 5M of 7-chloro-6-fluoro-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]pyrido[2,3-d]pyrimidine-2,4(1H,3H)-dione (M-DIONE) was obtained.

[0424] The first generation process highlighted above was scalable to 200+ kg of rac-dione starting material (compound 5). In this process, seeding the crystallization with the thermodynamically stable rac-dione crystal form (which exhibits low solubility) would cause batch failure. Based on our subsequent work, we found that increasing the DBTA equivalents and decreasing the seed addition temperature by adjusting the heptane addition schedule improved the robustness of the process. The improved method is tolerant to the presence of the thermodynamically stable rac-dione crystal form, facilitating successful atropisomer separation. Subsequent batches will incorporate the improved process for large-scale production.

[0425] <Step 6>:

[0426] [ka]

[0427] [Table 7]

[0428] 7-Chloro-6-fluoro-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]pyrido[2,3-d]pyrimidine-2,4(1H,3H)-dione (M-DIONE) (3.7 kg; 9.8 mol) was combined with 10.5 kg of toluene in a reactor (A) and distilled to remove water until an oil was obtained, while maintaining the set point at 45 °C. Toluene (21 kg) was added to the residue and the mixture was stirred at 40-45 °C for 30 minutes. The contents were cooled to 22 °C, after which phosphoryl chloride (1.8 kg; 11.7 mol) was added. The mixture was cooled to 0-5 °C, after which N,N-diisopropylethylamine (2.5 kg; 19.34 mol) was added, while maintaining the temperature below 5 °C. The solution was aged at 22 °C for 3 hours. In a separate reactor (B), (s)-1-boc-3-methylpiperazine (2.21 kg; 10.8 mol) and N,N-diisopropylethylamine (1.26 kg; 9.75 mol) were combined in toluene (6 kg) and added to reactor (A) while maintaining the temperature at <25° C. The reaction mixture was aged at 22° C. for 15 minutes and then quenched with sodium bicarbonate (973 g) in water (12.9 L) while maintaining the temperature at <25° C. The mixture was stirred for 30 minutes and then DCM (36.8 kg) was added while continuing to stir for 1 hour. The layers were allowed to separate and the lower organic layer was drained into reactor (C). The aqueous layer in reactor (A) was back extracted with DCM (18.4 kg) and the combined organic layers were washed with a brine solution (6.0 kg NaCl; 16.5 kg DI water). The organic layer was distilled at atmospheric pressure while maintaining the internal temperature between 45-55°C. DCM was exchanged during the distillation to azeotropically dry the solution. After distillation, the solution volume was adjusted to 19 L with DCM. The solution was cooled to 30°C and polish filtered. Ethyl acetate (8.5 kg) was added to the filtrate and then distilled at atmospheric pressure until 11-13 kg was collected in the receiver. The solution was seeded with 30 g of authentic product and aged at 25-30°C for 1 hour and then further distilled at atmospheric pressure at an internal temperature of 45-55°C until 8.2 kg of distillate was collected. The slurry was cooled to 22°C and aged overnight before being further cooled to 0-5°C. The product was collected by filtration and washed twice with ethyl acetate (4.2 kg each).The cake was dried under nitrogen and vacuum to give tert-butyl (3S)-4-{7-chloro-6-fluoro-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl}-3-methylpiperazine-1-carboxylate (compound 6, PIPAZOLINE).

[0429] <Step 7>:

[0430] [ka]

[0431] [Table 8]

[0432] To the reactor was added degassed dioxane (74.2 kg), tert-butyl (3S)-4-{7-chloro-6-fluoro-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl}-3-methylpiperazine-1-carboxylate (compound 6, pipezoline) (24.0 kg, 45.2 mol), potassium acetate (22.2 kg, 45.2 mol), and (dppf)PdCl2 (0.74 kg, 1.01 mol). The reactor was inerted with nitrogen gas. The solution was sparged with nitrogen gas until the oxygen content was <500 mg / L. The reaction was heated to 87.5°C. A solution of potassium trifluoro(2-fluoro-6-hydroxyphenyl)borate (12.6 kg, 54.3 mol) in degassed dioxane (49.4 kg) and degassed water (14.4 kg) with an oxygen content of <500 mg / L was transferred to the reaction mass while maintaining an internal temperature of 82.5° C.±7.5° C. The reaction mass was adjusted to 87.5° C.±1.5° C. and stirred for 75 minutes±15 minutes. A 1.0 M EDTA solution (47.3 kg) was added to the reaction mass while maintaining an internal temperature of 85° C.±5° C., followed by water (40.1 kg). The reaction mass was cooled to 20° C.±3° C. over >2 hours and stirred for >16 hours. The reaction mass was filtered and the crude solid was rinsed with water (3×120 kg). The solid was rinsed with a mixture of heptane (28.8 kg) and 2-propanol (33.1 kg) and then dried at <50° C. for >10 hours. To a clean reactor was added the crude solid and dichloromethane (240 kg). The contents were stirred at 20° C.±5° C. for >30 minutes. To the reactor was added Si-thiol (144 kg) and dichloromethane (14.9 kg). The reaction was stirred at 20° C.±5° C. for 18 hours. The reaction was filtered and rinsed with dichloromethane (84 kg). The solution was distilled and the solvent exchanged for 2-propanol. The reaction was heated to 60° C.±3° C. and heptane (108 kg) was added while maintaining the reaction temperature at 60° C.±3° C. The reaction was stirred for 45 minutes, then cooled and stirred at 20° C.±5° C. for 2.5 hours. The reaction was filtered and rinsed with 50% v / v heptane / 2-propanol (61.9 kg).The isolated solid was dried at <50° C. for 12 h to give tert-butyl (3S)-4-{6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl}-3-methylpiperazine-1-carboxylate (compound 7, biaryl).

[0433] <Step 8>:

[0434] [ka]

[0435] [Table 9]

[0436] To the reactor was added tert-butyl (3S)-4-{6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-2-oxo-1,2-dihydropyrido[2,3-d]pyrimidin-4-yl}-3-methylpiperazine-1-carboxylate (compound 7, biaryl) (2.75 kg, 5.27 mol), DCM (13.7 L) and TFA (5.67 kg, 49.7 mol). The reaction was stirred at 20±5° C. for 8-16 hours. To a second reactor was added potassium carbonate (11.24 kg), water (54.8 L) and methanol (13.7 L) to produce a homogenous solution. The reaction mixture was added to the potassium carbonate solution over 2 hours. The mixture was stirred at 20±5° C. for an additional 12 hours. The resulting slurry was filtered and rinsed with water (2 x 27.5 L). The wet cake was dried for 24 hours to give 6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-4-[(2S)-2-methylpiperazin-1-yl]-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]pyrido[2,3-d]pyrimidin-2(1H)-one (compound 8, DESBOC).

[0437] <Step 9>:

[0438] [ka]

[0439] [Table 10]

[0440] 6-Fluoro-7-(2-fluoro-6-hydroxyphenyl)-4-[(2S)-2-methylpiperazin-1-yl]-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]pyrido[2,3-d]pyrimidin-2(1H)-one (compound 8, DESBOC) (156.25 g) was added with N-methylpyrrolidinone (625 mL) and stirred at ambient temperature. Acryloyl chloride (36.29 g; 401.0 mmol) was added to the resulting solution while maintaining an internal temperature of <30° C. The contents were stirred at 25° C. for 2 hours. In a separate reactor, a solution of disodium phosphate (175.1 g; 1234 mmol) in DI water (3.1 L) was prepared. The crude product solution was then transferred to the reactor containing the disodium phosphate solution at 25° C. for >2 hours. The slurry was heated to 45° C. midway through the addition and aged at the same temperature for 2 hours after complete addition. The mixture was cooled to 25° C. and aged for 4 hours before collecting the solid by vacuum filtration. The solid was washed twice with water (1.5 L each) and the product was dried under nitrogen and vacuum to give the product 6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-4-[(2S)-2-methyl-4-(prop-2-enoyl)piperazin-1-yl]pyrido[2,3-d]pyrimidin-2(1H)-one (crude compound 9). 4 Results for this lead lot: isolated mass 154.06 g, 93 wt%, corrected yield 82.9%, NMP 18,000 ppm

[0441] <Step 10>:

[0442] [ka]

[0443] [Table 11]

[0444] To 6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-4-[(2S)-2-methyl-4-(prop-2-enoyl)piperazin-1-yl]pyrido[2,3-d]pyrimidin-2(1H)-one (crude compound 9) (142.33 g; 253.9 mmol) was added ethanol (996 mL) and water (270 mL). Acetic acid (21.8 ml; 380.8 mmol) was added and the mixture was heated to 75° C. to produce a solution which was polish filtered into a clean reactor. The solution was cooled to 45° C., after which water (1067 mL) was added while maintaining an internal temperature >40° C. Seeds of authentic compound 9 were added to the solution and the resulting mixture was aged for 30 minutes. Water (1138 mL) was then added over 2 hours. The mixture was cooled to 25° C. and aged for 8 hours, after which the solid was collected by vacuum filtration and washed with a mixture of ethanol (355.8 mL) and water (711.6 mL). The solid was dried using vacuum and nitrogen to give 6-fluoro-7-(2-fluoro-6-hydroxyphenyl)-(1M)-1-[4-methyl-2-(propan-2-yl)pyridin-3-yl]-4-[(2S)-2-methyl-4-(prop-2-enoyl)piperazin-1-yl]pyrido[2,3-d]pyrimidin-2(1H)-one (compound 9).

[0445] <Step A1: Reaction scheme and preparation table>

[0446] [ka]

[0447] [Table 12]

[0448] To reactor A was added THF (6 vol) and diisopropylamine (1.4 eq). The resulting solution was cooled to -70°C and n-BuLi (2.5M in hexanes, 1.5 eq) was added slowly. After addition was complete, a solution of 3-fluoroanisole (1.0 eq) in THF (6 vol) was added slowly and held at -70°C for 5 min. B(EtO)3 (2.0 eq) was added slowly and held at -70°C for 10 min. The reaction mixture was quenched with 2N HCl. The quenched reaction mixture was extracted with MTBE (3 x 4 vol). The combined organic phase was concentrated to a total volume of 1.5-3. Heptane (7-9 vol) was added dropwise and the mixture was cooled to 0-10°C and stirred for 3 h. The mixture was filtered and rinsed with heptane (1.5 vol). The solid was dried under nitrogen at <30° C. to give (2-fluoro-6-methoxyphenyl)boronic acid.

[0449] <Step A2: Reaction scheme and preparation table>

[0450] [ka]

[0451] [Table 13]

[0452] To reactor A was added dichloromethane (4 vol) and 2-fluoro-6-methoxy-4-methylphenylboronic acid (1 eq). The reaction mixture was cooled to -30°C and 1.5BBr3 (1.5 eq) was added dropwise. Once the addition was complete, the mixture was warmed to 25°C and stirred for 2 hours. The reaction mixture was quenched into ice-cold (0-5°C) water (10 vol). MTBE (10 vol) was added and the mixture was warmed to 25°C and stirred for 1-2 hours or until all solids were dissolved. The aqueous phase was separated and extracted with MTBE (3 vol). The combined organic extracts were washed with water (3 vol) and then concentrated to 1 volume overall. Heptane (10 vol) was added to the mixture and stirred for 2 hours. The resulting product was isolated by filtration and dried at <30°C to give (2-fluoro-6-hydroxyphenyl)boronic acid.

[0453] <Step A3: Reaction scheme and preparation table>

[0454] [ka]

[0455] [Table 14]

[0456] <Process A3>

[0457] In a reactor (Reactor A), water (28 L) was added to potassium fluoride (21.0 kg; 20.87 mol), and the contents were stirred for 30 minutes. In another reactor (Reactor B), (2-fluoro-6-hydroxyphenyl)boronic acid (14.00 kg, 89.79 mol) was added, followed by acetonitrile (206.1 kg) and citric acid (30.94 kg; 147.26 mol) at 25 °C. The contents of Reactor A were added to Reactor B at 25 °C, and the mixture was stirred at that temperature for 10 hours. The reaction mixture was filtered through a Celite bed (7.0 kg) and washed with acetonitrile (42 kg). Isopropanol (56 kg) was added to the filtrate, and then the mixture was distilled under vacuum at a temperature of <35 °C. The distillation volume in the reactor was replaced with isopropanol and repeated as necessary to complete the solvent exchange from acetonitrile to isopropanol. The slurry was cooled to 15 °C, aged for 1 hour, filtered, and washed with 28 kg of isopropanol. The cake was dried using vacuum and nitrogen and packaged to obtain Compound A3.

[0458] <Separation of M-dione Compound 5>

[0459] <Separation of M-dione Intermediate by Chromatography>

[0460] To isolate M-dione from Compound 4, a number of chiral chromatography techniques and methods were used. The techniques and stationary phases are well-known in the art and are outlined in Table 1.

[0461]

Chemical Structure

[0462]

Table 15

[0463] SFC, HPLC, and SMB techniques are well-known in the art, and Chiralpak® stationary phases are commercially available from sources such as Fisher Scientific and Daicel Corporation.

[0464] However, it is desirable to develop a more efficient method for isolating M-dione (compound 5).

[0465] <Classical separation>

[0466] The present invention relates to the development of a viable classical separation method for the M / P-dione racemate (compound 4).

[0467] A total of 100 cocrystal screening experiments were performed to identify three potential cocrystals of diones. Based on the highest area ratio of M / P-dione in the residual solid and the lowest area ratio in the supernatant, (+)-2,3-dibenzoyl-D-tartaric acid (DBTA) was selected as the chiral reagent for separation.

[0468] According to the results from 100 cocrystal screening experiments and more than 20 solvent screenings, 2-MeTHF / n-heptane was found to provide better separation results than other solvent systems. Based on the solubility results of M-dione cocrystals and P-dione cocrystals in different ratios of 2-MeTHF and n-heptane, 2-MeTHF / n-heptane (1.4:1, v / v) was selected as the optimal solvent composition for separation.

[0469] To find possible morphological transformation to dione racemate or M / P-dione during the crystallization process of chiral resolution, the solubility of M-dione cocrystal, P-dione cocrystal, M+P-dione cocrystal mixture (1:1, wt / wt), dione racemate and DBTA in 2-MeTHF / n-heptane (1.4:1, vol / vol) was determined at different temperatures. No morphological change was observed for M-dione cocrystal and P-dione cocrystal at different temperatures for 7 days. However, dione racemate form C was obtained after stirring the mixture of M+P-dione cocrystal mixture (1:1, wt / wt) at different temperatures for 7 days. Dione racemate form D (20 and 30 °C) or dione racemate form C (40, 50, 60 and 65 °C) were observed after stirring the dione racemate at the corresponding temperatures for 7 days. At all temperatures, the solubility of DBTA was observed to be approximately 100 mg / mL.

[0470] To further optimize the separation process, a ternary phase diagram for M / P-dione cocrystal was drawn based on the equilibrium solubility results, but no eutectic point was obtained, presumably because racemic Form C can crystallize in the presence of both M-dione and P-dione cocrystals. Another ternary phase diagram for M / P-Dione was drawn based on the equilibrium solubility results, but no eutectic point was obtained, presumably because dione racemic Form C or D can crystallize in the presence of both M-dione and P-dione.

[0471] In summary, a chiral reagent (DBTA) and solvent system (2-MeTHF / n-heptane (1.4:1, vol / vol)) were identified for the separation of the dione racemate. A small-scale crystallization process using this separation reagent and solvent system was able to achieve a yield of 39% and an ee purity of 99% for M-dione. Furthermore, polymorphism of the dione racemate was observed and investigated during screening experiments.

[0472] The compounds of the present invention can also be used in combination with pharma- ceutically active agents that treat nausea. Examples of agents that can be used to treat nausea include dronabinol, granisetron, metoclopramide, ondansetron, and prochlorperazine, or a pharma- ceutically acceptable salt thereof.

[0473] The compounds of the present invention may also be used in combination with radiation therapy, hormone therapy, surgery and immunotherapy, which are well known to those skilled in the art.

[0474] Since one aspect of the present invention contemplates the treatment of a disease / condition with a combination of pharma- ceutically active compounds that can be administered separately, the present invention further relates to combining separate pharmaceutical compositions into a kit form. The kit comprises two separate pharmaceutical compositions: a compound of the present invention, and a second pharmaceutical compound. The kit comprises a container that holds the separate compositions, such as a divided bottle or a divided foil packet. Further examples of containers include syringes, boxes, and bags. Typically, the kit includes instructions for the use of the separate components. The kit form is particularly advantageous when the separate components are preferably administered in different dosage forms (e.g., oral and parenteral), administered at different dosage intervals, or when the prescribing physician or veterinarian desires to titrate the individual components of the combination.

[0475] An example of such a kit is the so-called blister pack. Blister packs are well known in the packaging industry and are widely used for packaging pharmaceutical unit dosage forms (tablets, capsules, etc.). Blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material. During the packaging process, recesses are formed in the plastic foil. The recesses have the size and shape of the tablets or capsules to be packed. The tablets or capsules are then placed in the recesses and the sheet of relatively stiff material seals the plastic foil with the face of the foil opposite to the direction in which the recesses were formed. As a result, the tablets or capsules are sealed in the recesses between the plastic foil and the sheet. Preferably, the strength of the sheet is such that manual pressure can be applied to the recesses, whereby openings are formed in the sheet at the positions of the recesses, allowing the tablets or capsules to be removed from the blister pack. The tablets or capsules can then be removed from said openings.

[0476] It is desirable to provide a memory aid on the kit, for example next to the tablets or capsules, in the form of numbers (the numbers corresponding to the days of the regimen in which the tablets or capsules so designated should be taken). Another example of such a memory aid is a calendar printed on a card, for example: "Week 1, Monday, Tuesday, etc., etc., etc., etc., as follows: "Week 2, Monday, Tuesday, etc." Other variations of memory aids will be readily apparent. A "daily dose" can be a single tablet or capsule, or multiple pills or capsules to be taken on a given day. Also, a daily dose of a compound of the invention can consist of one tablet or capsule, while a daily dose of a second compound can consist of multiple tablets or capsules, or vice versa. The memory aid should reflect this and aid in the correct administration of the active agents.

[0477] In another specific embodiment of the present invention, a dispenser is provided that is designed to dispense daily doses one at a time in the order of their intended use.Preferably, the dispenser is equipped with a memory aid to further facilitate compliance with the regimen.An example of such a memory aid is a mechanical counter that indicates the number of daily doses dispensed.Another example of such a memory aid is a battery-powered microchip memory, for example, coupled with a liquid crystal readout or an audible reminder signal that reads the date of the last daily dose taken and / or reminds when the next dose should be taken.

[0478] The compounds of the present invention and other pharma- ceutically active compounds can be administered to a patient, as appropriate, either orally, rectally, parenterally (e.g., intravenously, intramuscularly, or subcutaneously), intracisternally, intravaginally, intraperitoneally, intravesically, topically (e.g., powders, ointments, or drops), or by oral or nasal spray. All methods used by those skilled in the art to administer pharma-ceutically active agents are contemplated.

[0479] Compositions suitable for parenteral injection may include physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (such as propylene glycol, polyethylene glycol, glycerol, etc.), suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Proper fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by using surfactants.

[0480] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Microbial contamination can be prevented by the addition of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, etc. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, etc. Prolonged absorption of injectable pharmaceutical compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0481] Solid dosage forms for oral administration include capsules, tablets, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert conventional excipient (or carrier) (e.g., sodium citrate or dicalcium phosphate) or with (a) fillers or extenders (e.g., starch, lactose, sucrose, mannitol, and silicic acid); (b) binders (e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia); (c) humectants (e.g., glycerol); (d) disintegrants (e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate); (e) solution retarders (e.g., paraffin); (f) absorption enhancers (e.g., quaternary ammonium compounds); (g) wetting agents (e.g., cetyl alcohol and glycerol monostearate); (h) adsorbents (e.g., kaolin and bentonite); and (i) lubricants (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), or mixtures thereof. In the case of capsules and tablets, the dosage form may also contain buffering agents.

[0482] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar, as well as high molecular weight polyethylene glycols and the like.

[0483] Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and others known in the art.They can also contain opacifying agents, and can be of such composition that they release active compound in a certain part of the intestinal tract in a delayed manner.Examples of embedding compositions that can be used are polymeric substances and waxes.Active compound can also be in microencapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0484] Liquid dosage forms for oral administration include pharma- ceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs.In addition to the active compound, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers (e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils, especially cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan), or mixtures of these substances.

[0485] In addition to such inert diluents, compositions can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. In addition to the active compounds, suspensions can contain suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, or mixtures of these substances.

[0486] Compositions for rectal administration are preferably suppositories which can be prepared by mixing the compound of the present invention with a suitable non-irritating excipient or carrier such as cocoa butter, polyethylene glycol or a suppository wax, which is solid at normal room temperature, but liquid at body temperature and therefore will melt in the rectum or vaginal cavity and release the active ingredient.

[0487] The dosage form for topical administration of the compound of the present invention includes ointments, powders, sprays and inhalants.The active compound is mixed under sterile conditions with a physiologically acceptable carrier and any necessary preservatives, buffers or propellants.Ophthalmic preparations, eye ointments, powders and solutions are also considered to be within the scope of the present invention.

[0488] The compounds of the present invention can be administered to a patient at dosage levels ranging from about 0.1 to about 3,000 mg per day. For a normal adult having a body weight of about 70 kg, a dosage ranging from about 0.01 to about 100 mg per kilogram of body weight is usually sufficient. The specific dosage and dosage range that can be used will depend on many factors, including the requirements of the patient, the severity of the condition or disease being treated, and the pharmacological activity of the compound being administered. The specific dosage of the compounds of the present invention is the FDA approved dosage, if the compound is approved.

[0489] The compounds of the present invention can be administered as pharma- ceutically acceptable salts, esters, amides, or prodrugs. The term "salt" refers to inorganic and organic salts of the compounds of the present invention. These salts can be prepared in situ during the final isolation and purification of the compounds, or by separately reacting the purified compounds in free base or acid form with a suitable organic or inorganic acid and isolating the salt thus formed. Representative salts include hydrobromide, hydrochloride, sulfate, hydrogen sulfate, nitrate, acetate, oxalate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and laurylsulfonate. Salts may include cations based on alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc. See, e.g., S. M. Berge, et al., "Pharmaceutical Salts," J. Pharm Sci, 66:1-19 (1977).

[0490] Examples of pharma- ceutically acceptable esters of the compounds of the invention include C1-C8 alkyl esters. Acceptable esters also include C5-C7 cycloalkyl esters and arylalkyl esters such as benzyl. C1-C4 alkyl esters are commonly used. Esters of the compounds of the invention may be prepared according to methods well known in the art.

[0491] Examples of pharma- ceutically acceptable amides of the compounds of the present invention include amides derived from ammonia, primary C1-C8 alkylamines, and secondary C1-C8 dialkylamines. In the case of secondary amines, the amines may also be in the form of 5- or 6-membered heterocycloalkyl groups containing at least one nitrogen atom. Amides derived from ammonia, C1-C3 primary alkylamines, and C1-C2 dialkyl secondary amines are commonly used. Amides of the compounds of the present invention may be prepared according to methods well known to those skilled in the art.

[0492] The term "prodrug" refers to a compound that is converted in vivo to produce a compound of the invention. The conversion can occur by various mechanisms, such as by hydrolysis in blood. The use of prodrugs is discussed in T. Higuchi and W. Stella, "Prodrugs as Novel Delivery Systems," Vol. 14 of the ACS Symposium Series and Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

[0493] For example, since the compounds of the present invention contain a carboxylic acid functional group, the prodrug may be modified by replacing the hydrogen atom of the acid group with a (C1-C8 alkyl, (C2-C12))alkanoyloxymethyl, 1-(alkanoyloxy)ethyl having 4 to 9 carbon atoms, 1-methyl-1-(alkanoyloxy)ethyl having 5 to 10 carbon atoms, alkoxycarbonyloxymethyl having 3 to 6 carbon atoms, 1-(alkoxycarbonyloxy)ethyl having 4 to 7 carbon atoms, 1-methyl-1-(alkoxycarbonyloxy)ethyl having 5 to 8 carbon atoms, N-(alkoxycarbonyl)amino having 3 to 9 carbon atoms, or the like. can include esters formed by substituting with groups such as 1-(N-(alkoxycarbonyl)aminomethyl, 3-phthalidyl, 4-crotonolactonyl, gamma-butyrolactone-4-yl, di-N,N-(C1-C2)alkylamino(C2-C3)alkyl (such as β-dimethylaminoethyl), carbamoyl-(C1-C2)alkyl, N,N-di(C1-C2)alkylcarbamoyl-(C1-C2)alkyl, and piperidino-, pyrrolidino-, or morpholino-(C2-C3)alkyl.

[0494] The compounds of the present invention may have asymmetric or chiral centers, and therefore may exist in different stereoisomeric forms.All stereoisomeric forms of the compounds and their mixtures, including racemic mixtures, are intended to form part of the present invention.Furthermore, the present invention contemplates all geometric and positional isomers.For example, if a compound contains a double bond, both the cis and trans forms (represented by Z and E, respectively) and mixtures are intended.

[0495] Mixtures of stereoisomers, such as diastereomeric mixtures, can be separated into their individual stereochemical components on the basis of their physical chemical differences by well-known methods, such as chromatography and / or fractional crystallization. Enantiomers can also be separated by converting the enantiomeric mixture to a diastereomeric mixture by reaction with a suitable optically active compound (e.g., alcohol), separating the diastereomers, and converting the individual diastereomers into the corresponding pure enantiomers (e.g., hydrolysis). Some compounds may also be atropisomers (e.g., substituted biaryls).

[0496] The compounds of the present invention can exist in unsolvated as well as solvated forms with pharma- ceutically acceptable solvents such as water (hydrates), ethanol, etc. The present invention contemplates and encompasses both the solvated and unsolvated forms.

[0497] It is also possible that the compounds of the present invention exist in different tautomeric forms. All tautomeric forms of the compounds of the present invention are contemplated. For example, all tautomeric forms of the tetrazole moiety are included in the present invention. Also, for example, all keto-enol or imine-enamine forms of the compounds are included in the present invention.

[0498] One of ordinary skill in the art will recognize that the compound names and structures contained herein may be based on a particular tautomer of a compound. Although the name or structure of only a particular tautomer may be used, it is intended that all tautomers are encompassed in the present invention unless otherwise specified.

[0499] The present invention is also intended to encompass compounds that are synthesized in vitro using laboratory techniques as are well known to the synthetic chemist, or that are synthesized using in vivo techniques by metabolism, fermentation, digestion, etc. It is also intended that the compounds of the present invention be synthesized by a combination of in vivo and in vitro techniques.

[0500] The present invention also includes isotopically labeled compounds, which are identical to those enumerated herein except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into the compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, e.g., 2 H, 3 H, 13 C. 14 C. 15 N, 16 O. 17 O. 18 O. 31 P, 32 P, 35 S, 18 F, and 36 In one aspect, the present invention provides a method for preparing a cycloalkyl 1,1-dihydrogen ... 2 H) atom.

[0501] Compounds of the present invention that contain the aforementioned isotopes and / or other isotopes of other atoms are within the scope of the present invention. Certain isotopically labeled compounds of the present invention, e.g., 3 H and 14 Those incorporating radioactive isotopes such as C are useful for drug and / or substrate tissue distribution assays. Tritiated isotopes, i.e. 3 H isotope and carbon-14 isotope, i.e. 14 C isotopes are particularly preferred for their ease of preparation and detectability. Deuterium, i.e. 2 Substitution with heavier isotopes such as H can provide certain therapeutic advantages resulting from greater metabolic stability, such as increased in vivo half-life or reduced dosage requirements, and therefore may be preferred. Isotopically labeled compounds of the invention can generally be prepared by substituting a readily available isotopically labeled reagent for a non-isotopically labeled reagent.

[0502] The compounds of the present invention may exist in various solid states, including crystalline and amorphous states. The different crystalline states (also called polymorphs) and amorphous states of the compounds of the present invention are contemplated as part of the present invention.

[0503] In the synthesis of the compounds of the present invention, the use of certain leaving groups may be desirable. The term "leaving group" ("LG") generally refers to a group that can be displaced by a nucleophile. Such leaving groups are well known in the art. Examples of leaving groups include, but are not limited to, halides (e.g., I, Br, F, Cl), sulfonates (e.g., mesylates, tosylates), sulfides (e.g., SCH3), N-hydroxysuccinimide, N-hydroxybenzotriazole, and the like. Examples of nucleophiles include, but are not limited to, amines, thiols, alcohols, Grignard reagents, anionic species (e.g., alkoxides, amides, carbanions), and the like.

[0504] All patents, patent applications, and other publications cited herein are incorporated by reference in their entirety.

[0505] The following examples illustrate specific embodiments of the present invention, and are meant to be representative and are not intended to limit the scope of the claims in any way. EXAMPLES

[0506] AMG510 inhibits KRAS with potent biochemical and cellular activities and robust in vivo efficacy. G12C AMG510 was developed as an orally bioavailable covalent inhibitor of KRAS. Cysteine ​​proteomic analysis of NCI-H358 cells treated with AMG510 showed that only the G12C-containing peptide of KRAS was covalently modified. AMG510 inhibited the expression of recombinant mutant KRAS G12C / C118A inhibited SOS-catalyzed nucleotide exchange of KRAS, but not wild-type KRAS at position 12. C118AIn cell assays, AMG510 inhibited KRAS G12C covalently modified KRAS p.G12C-mutant cell lines tested, as measured by phosphorylation of ERK1 / 2. G12C AMG510 inhibited KRAS signaling but did not inhibit ERK1 / 2 phosphorylation in cell lines harboring various other KRAS mutations. AMG510 also selectively impaired viability of KRASp.G12C mutant cell lines but did not affect cell lines harboring other KRAS mutations. In vivo pharmacodynamic assays demonstrated that AMG510 selectively inhibited KRAS, as measured by phosphorylation of ERK1 / 2 (p-ERK) in human pancreatic (MIA PaCa-2 T2) and NSCLC (NCI-H358) tumor xenografts. G12C AMG510 inhibited KRAS signaling in a dose- and time-dependent manner. G12C Covalent modification of KRAS was measured by mass spectrometry and correlated with tumor p-ERK inhibition. A time course study in tumor-bearing mice showed that plasma exposure of AMG510 peaked 0.5 hours after dosing, followed closely by inhibition of tumor p-ERK. AMG510 significantly inhibited the growth of MIA PaCa-2 T2 and NCI-H358 xenografts, and at higher doses, caused tumor regression. G12C Treatment of KRAS p.G12C lines with inhibitors increased HLA expression. Combination treatment of AMG510 with inhibitors of other cell signaling pathways showed evidence of synergistic effects on cell viability. Combination treatment of AMG510 with standard of care carboplatin showed enhanced NCI-H358 tumor growth inhibition compared to each agent alone. Similarly, AMG510 in combination with MEK inhibitors resulted in enhanced antitumor efficacy compared to each agent alone.

[0507] KRAS for immune surveillance in vivo G12CTo test the impact of inhibition, we generated novel syngeneic tumor cell lines suitable for testing AMG510 in combination with checkpoint inhibitor therapy and thus characterized in vitro. In a newly developed model of KRAS-G12C mutant cancer, treatment with AMG510 significantly inhibited tumor growth and caused regression. Surprisingly, the combination of AMG510 with immune checkpoint inhibitors resulted in a marked improvement in overall survival, leading to durable cure. Immunophenotyping of mouse KRAS p.G12C tumors revealed that there was a significant increase in T cell infiltration after treatment, suggesting that AMG510 may induce a tumor microenvironment more sensitive to immune checkpoint inhibition.

[0508] A novel syngeneic CT-26 KRAS p.G12C tumor model

[0509] Murine CT26 (colon tumor #26) cells were developed in 1975 by exposing BALB / c mice to N-nitroso-N-methylurethane (NMU), resulting in a rapidly growing grade IV carcinoma that is easily engrafted and metastasizes readily. Used in over 500 published studies, CT26 colon carcinoma is one of the most commonly used cell lines in drug development. A large number of cytotoxic drugs targeting specific signaling pathways as well as therapeutic agents have been studied with these cells. In addition, the CT26 model in BALB / c mice is frequently used for the development and testing of immunotherapy concepts, as it provides a syngeneic in vivo test system. BMC Genomics.2014 Mar 13;15:190.doi:10.1186 / 1471-2164-15-190.Immunomic,genomic and transcriptomic characterization of CT26 colorectal carcinoma.

[0510] The syngeneic CT-26 KRAS p.G12C tumor model was developed to enable cell line and immunotherapy combination studies as outlined in Table A and Figures 3, 4, 5, 6, 18, 24, 31, 34, 38, and 39. The CT-26 syngeneic tumor cell line was selected based on harboring the KRAS-G12D mutation present in the parental line. The presence of the KRAS-G12D mutation suggested that the proliferation and survival of the cell line was driven by constitutive KRAS signaling (G12D) and was potentially sensitive to KRAS inhibition. The CT-26 KRAS p.G12C cells were generated from the CT-26 murine colorectal tumor cell line. CRISPR technology has been described in the prior art by Liang et al. (Journal of Biotechnology 241 (2017) 136-146) and was utilized to replace both alleles of KRAS p.G12D with KRAS p.G12C using the sequence CTTGTGATGGTTGGAGCTGA (SEQ ID NO: 21). Clone 10 was determined to be homozygous for the KRAS p.G12C allele by next generation sequencing (NGS) and identified as CT-26 KRAS G12C-H10. This newly isolated syngeneic tumor cell line, CT-26 KRAS p.G12C, in which KRAS signaling is inhibited by AMG510, was used for all CT-26 G12C in vivo (see Figures 3, 4, 5, and 6) and in vitro studies (see Figures 18, 24, 31, 34, 38, and 39).

[0511] The present invention is a method for identifying two KRAS G12C The present invention includes a novel isolated cell line containing two KRAS alleles. G12C 1. A method of generating a cell line containing an allele, comprising: a) Two KRAS G12C Two KRAS alleles were generated, along with a CRISPR construct that induces substitutions of both nucleotides in the two KRAS alleles. G12D incubating the cell line containing the allele; and b) Two KRAS G12C Isolating cell lines containing the allele; The present invention encompasses a method comprising the steps of:

[0512] Next-generation sequencing (NGS), also known as high-throughput sequencing, is Illumina (Solexa) sequencing Roche 454 sequencing ·Ion torrent: Proton / PGM sequencing SOLiD™ Sequencing Sequencing is an umbrella term used to describe many different modern sequencing technologies, including:

[0513] In the present invention, we used the Ion Torrent™ Personal Genome Machine™ platform, available from Thermo-Fisher Scientific. These modern technologies allow scientists to sequence DNA and RNA much faster and cheaper than the previously used Sanger sequencing.

[0514] <In vitro cell-based combination studies>

[0515] Cell lines were purchased from the American Type Culture Collection (ATCC), the German Collection of Microorganisms and Cell Cultures (DSMZ), and the JCRB Cell Bank (JCRB). Each line was cultured in its recommended growth medium.

[0516] For binary combinations of compounds, the initial density was in the range of 500 to 2500 cells per well, and cells were seeded in either a 96-well or 384-well cell culture plate. After 16 to 24 hours, the compounds were added to the culture plate in a matrix format, with one agent titrated along the x-axis and the second agent titrated along the y-axis. For all combinations tested for any given cell line, the starting high concentration and dilution factor of each compound were selected such that they could adequately define the gradient within the dose range selected in the maximum curve, minimum curve, and combination screening format. The CellTiter-Glo® Luminescent Cell Viability (Promega) assay kit was used to determine the number of viable cells.

[0517] Luminescence was measured by an EnVision® Multilabel Reader (Perkin Elmer) at time zero (V0) before compound addition and 72 hours after compound treatment for each cell line. Growth inhibition (GI) was calculated on a 200-point scale according to the following formula (where V72 is the luminescence of the DMSO control at 72 hours and T72 is the luminescence of the sample treated with the compound): When T72 > V0, GI = 100 × (1 - ((T72 - V0) / (V72 - V0))); when T72 < V0, GI = 100 × (1 - ((T72 - V0) / V0)). GI values of 0, 100, and 200 represented no inhibition of cell growth (i.e., DMSO control), cell stasis, and complete cell kill, respectively. Using a four-parameter logistic model, sigmoidal dose-response curves were plotted. The data were analyzed for synergistic interactions using Chalice™ Analyzer software (Zalicus), which generates a synergy score based on the Loewe additivity model.

[0518] Growth inhibition was calculated for each well of the matrix as previously described, and data were analyzed for synergistic interactions using Chalice™ Analyzer software (Zalicus; Cambridge, Mass.), which generates a synergy score based on the Loewe additivity model (Lehar, J., et al. (2009). "Synergistic drug combinations tend to improve therapeutically relevant selectivity." Nat Biotech 27(7):659-666) and Rickles, et al. (2012) "Adenosine A2A and Beta-2 Adrenergic Receptor Agonists: Novel Selective and Synergistic Multiple Myeloma Targets Discovered through Systematic Combination Screening" Mol Cancer Therapeutics 11(7):1432).

[0519] The Loewe ADD (additive) model (shown in Figures 7-37) quantifies the effect of combinations. The combinations are initially expressed as ADD Volume = ΣC X ,C Y (I data -I Loewe The additive excess volume (I ) is defined as Loewe (C X ,C Y ) is (C X / EC X )+(C Y / EC Y ) = 1, and EC X,Y is the I for the single drug curve Loewe (Effective concentration at 1000 mg / kg / day). A "synergy score" is also used, where synergy score S=log f X log f Y ΣI data (I data -I Loewe ) is the sum over all non-single drug concentration pairs and log fX,Y is the natural logarithm of the dilution factor used for each single agent. This effectively calculates the volume between the additive response surface measurements and the Loewe value, weighting towards high inhibition and correcting for varying dilution factors. I data Based on the measured error for the value and standard error propagation, an uncertainty σ S was calculated.

[0520] In the examples shown, the Growth Inhibition (%) matrix contains consensus growth inhibition values ​​calculated from the luminescence data using the formula above, the Growth Inhibition (%) matrix of the ADD model contains predicted growth inhibition values ​​based on the Loewe additivity model derived from the modeled single agent growth inhibition curves; the ADD Excess Growth Inhibition (%) matrix contains growth inhibition values ​​above the additive model. The additivity model serves as the "null hypothesis" and assumes that there is no synergistic interaction between the two drugs. The activity observed after subtracting the ADD model (=ADD Excess Growth Inhibition) from the growth inhibition dose response matrix is ​​an indication of synergy.

[0521] Table A below lists the KRAS G12C Specific in vitro combinations of inhibitors with one or more additional pharma- ceutically active agents are shown. The data obtained, summarized in Figures 7-39, show that the combinations shown in Table A exhibit enhanced anti-cancer activity over the activity expected when each individual member of the combination therapy is used alone. It is noted that the magnitude of therapeutic synergy observed may vary depending on the type of cancer being treated and the agent being used.

[0522] [Table 16]

[0523] <In vivo tumor xenograft combination study>

[0524] In vivo tumor xenograft studies were performed following these general procedures: Tumor cells were cultured, harvested, and implanted subcutaneously into the right flank of female athymic nude mice. Tumors grew to approximately 200 mm 3 When the tumor reached 10 days after tumor grafting, mice were randomized into treatment groups (n=10 / group) and treatment was initiated (on the days indicated on the graph). Tumor size and body weight were measured 2-3 times weekly. Tumor volume was measured by digital calipers and calculated as L×W×H and expressed in mm 3 The statistical significance of differences observed between growth curves was assessed by repeated measures analysis of covariance (RMANOVA) of log-transformed tumor volume data, comparing control groups to treatment groups using Dunnett's adjusted multiple comparisons. For combination studies, RMANOVA was performed with the combination groups compared 1:1 with each single-agent treatment group.

[0525] BD Matrigel™ Basement Membrane Matrix is ​​a solubilized basement membrane preparation extracted from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma (BD Biosciences, San Jose, Calif.).

[0526] All tests were performed in a blinded fashion.

[0527] In Figures 3, 4, 5 and 6, anti-mouse PD-1 (clone 29F.1A12) antibody is commercially available from Bio X Cell, West Lebanon, New Hampshire.

[0528] Figures 1, 2, 3, 4, 5, and 6 show KRAS G12C Illustrate specific in vivo combinations of inhibitors with one or more additional pharmacologic active agents for specific cancer types. The data obtained and summarized in the figures show that the combinations shown in the figures show enhanced anti-cancer activity over the activity expected when each member of the combination therapy is used alone. It is noted that the magnitude of therapeutic synergy observed may vary depending on the type of cancer being treated and the agent being used.

[0529] In Figure 4, the combination therapy of AMG510 and anti-PD1 antibody (clone 29F.1A12) in the CT26-KRASG12C syngeneic tumor model resulted in significantly improved survival compared to either monotherapy, leading to durable cures. Monotherapy with AMG510 or anti-PD1 led to a delay in tumor growth compared to the control group. Each monotherapy treatment resulted in a complete remission in 1 / 10. The combination therapy of AMG510 + anti-PD1 resulted in a complete remission in 9 / 10. These were considered durable cures, and these 9 mice remained tumor-free from the end of treatment (day 43) until the end of the study on day 57 after treatment was stopped.

[0530] <Enhancement of the Binding Affinity and Potency of AMG510>

[0531] ARS-1620 verified a direct inhibition approach of KRAS G12C However, it has been demonstrated that it is difficult to identify improved inhibitors suitable for clinical trials. The inventors believe that the major challenge is that ARS-1620 has suboptimal potency due to the small size of the allosteric pocket it occupies, which provides limited means for additional protein-ligand interactions. This is shown by the X-ray crystal structure of the KRAS G12C / ARS-1620 covalent complex (Figure 40(a)), which is notably characterized by a hydrogen bond between ARS-1620 and histidine 95 (H95) (dashed line). The inventors' breakthrough was the discovery that the surface groove created by the alternative orientation of H95 is occupied by a substituted aromatic ring, which enables enhanced interaction with KRAS G12C . AMG510 emerged as a top candidate from a binding molecule optimization campaign for the H95 groove due to the convergence of improved potency and favorable development characteristics. Covalent AMG510-KRAS G12CThe X-ray co-crystal structure of the complex (Figure 40(b)) highlights the binding of AMG510 at the P2 pocket of KRAS. The isopropyl-methylpyridine substituent occupies the groove between Y96, H95, and Q99 and participates in a continuous network of 25 ligand-protein van der Waals contacts that stretch from the backbone of helix 2 (H95, Y96) to the backbone of the flexible switch II loop (E62, E63).

[0532] To assess the effect of the enhanced interaction on the potency of AMG510, we cloned recombinant GDP-bound KRAS with an additional cysteine ​​to alanine substitution at residue 118 to avoid reactivity with non-C12 cysteines. C118A or KRAS G12C / C118A Two assays using AMG510 and ARS-1620 were used. The enzymatic nucleotide exchange assay utilized SOS1-catalyzed GDP / GTP exchange to promote binding of the RAS-binding domain (RBD) of c-RAF to both versions of KRAS. In a 40-minute reaction, AMG510 showed approximately 10-fold greater potency (mean IC 50 = 0.09 μM) (Figure 40(c)). AMG510 inhibited KRAS C118A (Figure 40(c)), and a non-reactive analog of AMG510 had minimal activity in these assays (Figure 46(a)). G12C / C118A The reaction rate between was measured by mass spectrometry (MS). A nonlinear fit of the concentration-rate data (Figure 40(d)) gave the maximum rate of the reaction, k inact =0.85±0.08s -1 and the concentration K of AMG510 at half the maximum speed I = 8.6E-05 ± 1.4E-05M is obtained, and k inact / K I The ratio is 9.8E+03±1.8E+03M -1 s -1 AMG510 and KRAS G12C / C118A The reaction rate between AMG510 and cysteine-targeted kinase inhibitors was significantly improved compared to ARS-1620. Compared to clinical cysteine-targeted kinase inhibitors, AMG510 showed a significantly greater kinact This is consistent with the previously described KRAS-inducing catalytic mechanism for ARS-1620. The nonspecific reactivity of AMG510 with 5 mM glutathione was relatively slow (AMG510t 1 / 2 = 196 min), which was within the range of clinical covalent acrylamide.

[0533] <Inhibition of tumor cell signaling and proliferation>

[0534] By measuring basal phosphorylation of ERK1 / 2 (p-ERK) and by MS, we were able to confirm that AMG510 inhibited KRAS G12C The cellular activity of AMG510 was assessed by detecting covalent binding (i.e., occupancy) with p-ERK (IC 50 AMG510 potently inhibited KRAS activation by AMG510 (approximately 0.02 and 0.03 μM, respectively) to nearly undetectable levels, which was 20-fold more potent than ARS-1620 (Figure 40(e)). G12C The occupancy of AMG510 was closely followed, with near-maximal levels achieved at approximately 0.2 μM in both assays (Figure 40(f)). AMG510 also potently impaired cell viability in both lines (IC 50 are approximately 0.006 μM and 0.009 μM, approximately 40-fold more potent than ARS-1620) (FIG. 40(g)).

[0535] KRAS by AMG510 G12C The time- and concentration-dependence of inhibition of p-ERK, reflecting occupancy of p-ERK, was used to determine the cellular kinetics of AMG510 in two KRAS p.G12C cell lines. The rate of p-ERK inhibition increased with AMG510 concentration, saturating at concentrations above 3 μM. Fitting of the concentration-rate curves for AMG510 and ARS-1620 (Figure 40(h) and Figure 46(b)) demonstrated that AMG510 inhibited the KRAS G12C The cellular kinetic efficiency of AMG510 for inhibition of ERK phosphorylation was approximately 23-fold greater than that of ARS-1620. The maximum inhibition rate of ERK phosphorylation by AMG510 (8.9E-04s -1) is the rate-limiting GTP-KRAS pathway proposed in recent kinetic models. G12C Hydrolysis rate (estimated rate from EGFR inhibition = 4.2E-04s -1 ;t 1 / 2 = 27.4 minutes), which is about twice as long as KRAS. G12C To obtain another estimate of the rate of GTP hydrolysis by KRAS, an SHP2 inhibitor was used to eliminate all upstream signaling to KRAS. This experiment yielded a cellular GTP hydrolysis rate of 9.4E-04s. -1 (t 1 / 2 = 12.2 min; Figure 46(c)) was obtained, consistent with the rate observed for AMG510.

[0536] KRAS G12C To more broadly assess the signaling impact of inhibition, we treated the two cell lines with multiple doses of AMG510 for 4 and 24 hours and performed Western blots to assess multiple signaling nodes (Figure 41(a)). G12C Formation of a covalent adduct of AMG510 by AMG510 was detected by a shift in the mobility of the slower migrating KRAS band (upper arrow). This shifted species accumulated with time and increasing dose, consistent with downstream inhibition of the MAPK pathway (i.e., p-MEK1 / 2 and p-ERK1 / 2) in both cell lines (Figure 41(a), (b)). KRAS inhibition by AMG510 also led to accumulation of active EGFR (p-EGFR Y1068). Inhibition of AKT phosphorylation (p-AKT) was evident in one line, whereas a decrease in phosphorylation of ribosomal protein S6 (p-S6) was observed in both lines at 24 hours. Cleavage of caspase-3 was also observed at 24 hours, suggesting apoptosis induction. Over a wider range of time periods, AMG510 treatment at 0.1 μM (Figure 41(b)) induced rapid (<2 h) and sustained (>24 h) effects on MAPK and EGFR, whereas p-S6 and caspase cleavage appeared after 8-16 h of treatment in both lines.

[0537] To assess activity and selectivity, AMG510 was profiled in 22 cell lines harboring either heterozygous or homozygous KRAS p.G12C or non-p.G12C KRAS mutants, as well as wild-type (WT) KRAS lines. A 2-hour treatment with AMG510 inhibited basal p-ERK in all KRAS p.G12C cell lines, with IC 50 The IC values ​​ranged from 0.010 μM to 0.123 μM (Figure 41(c) and Supplementary Table 1). AMG510 did not inhibit p-ERK in any of the non-KRAS p.G12C lines (IC 50 >10 μM; Figure 41(c) and Supplementary Table 1).

[0538] In cell viability assays, AMG510 impaired the proliferation of all homozygous and heterozygous KRAS p.G12C cell lines except SW1573, and was associated with IC 50 Values ​​ranged from 0.004 μM to 0.032 μM (Figure 41(d) and Supplementary Table 1). All KRAS p.G12C lines showed similar maximal inhibition of p-ERK, but the maximal effect on cell viability varied. Cell lines with KRAS mutations other than p.G12C or mutations in genes other than KRAS were not sensitive to AMG510 (IC 50 >7.5 μM; Figure 41(d) and Supplementary Table 1). A subset of KRAS p.G12C cell lines were selected to assess viability under low-attachment conditions to induce spheroid formation. G12C As reported for inhibitors, these conditions enhanced the susceptibility of all tested strains to AMG510, resulting in an increase in potency of up to 20-fold and an increase in maximum inhibition of 2.5-fold (Figure 41(e), Figure 46(d), and Supplementary Table 1). SW1573 remained minimally sensitive, likely due to a co-occurring driver mutation, PIK3CA p.K111E.

[0539] AMG510 and KRAS G12CTo further determine the selectivity of the covalent binding interaction and identify other potential "off-target" cysteine-containing proteins in cells, cysteine-proteome profiling by MS was performed as described. Cells were treated with DMSO or 1 μM of AMG510 (>30-fold p-ERK IC 50 ) for 4 hours, after which the cysteine proteome was enriched and peptides were identified. Among 6451 unique cysteine-containing peptides, the Cys12 peptide derived from KRAS G12C was the only identified peptide that met the criteria for covalent target engagement (Figure 41(f)).

[0540] <AMG510 inhibits KRAS signaling in vivo>

[0541] KRAS G12C The effect of oral treatment with AMG510 on KRAS signaling was evaluated in a pharmacodynamics (PD) assay measuring p-ERK. In human tumors with KRAS p.G12C, AMG510 inhibited p-ERK in a dose-dependent manner 2 hours after treatment (Figures 42(a), (b)). The inhibition of p-ERK after AMG510 treatment (100 mg / kg) decreased in the range of 69% (MIA PaCa-2 T2) to 83% (NCI-H358) compared to the control. A similar effect of AMG510 on p-ERK levels was observed in a mouse tumor model using the syngeneic CT-26 KRAS p.G12C strain generated using CRISPR technology (Figure 47(a)). The time-course PD assay showed that the exposure of AMG510 to plasma and tumors reached a peak 0.5 hour after a single dose (10 mg / kg), resulting in a maximum inhibition of p-ERK at 2 - 4 hours after treatment and a sustained and significant inhibition at 48 hours (Figures 42(c), (d)). This is consistent with the relatively long 20 - 24 hour half-life of the KRAS G12C protein (Figure 46(e)).

[0542] Furthermore, in parallel experiments, the effect of AMG510 on KRAS G12COccupancy of AMG510 was measured by MS and approached 100% at the highest dose (100 mg / kg), correlating with maximal inhibition of p-ERK (Figure 42(e) and (f)). A time course study showed that partial occupancy by AMG510 was detectable after 0.5 h, with approximately 100% occupancy observed after 2 h (Figure 42(g)).

[0543] Mutant-selective tumor inhibition in vivo

[0544] AMG510 was evaluated for its ability to inhibit the growth of human KRAS p.G12C and KRAS p.G12V (SW480-1AC) tumor xenografts in mice. AMG510 significantly inhibited the growth of MIA PaCa-2 T2 and NCI-H358 tumors at all dose levels, with tumor regression observed at higher doses (Figure 43(a), (b)). In contrast, AMG510 treatment did not affect the growth of KRAS p.G12V tumors (Figure 47(b)). Plasma levels of AMG510 were consistent across all models (data not shown). In a murine CT-26 KRAS p.G12C tumor model grown in immune-competent mice, AMG510 caused tumor growth inhibition and regression at the highest dose (Figure 43(c)). Two of ten mice (100 mg / kg group) had no detectable tumors when the study was terminated on day 29. AMG510 also significantly inhibited the growth of human KRAS p.G12C mutant patient-derived xenografts (PDXs) in mice (Figure 43(d) and Figure 47(c)).

[0545] Evidence of clinical activity

[0546] The enhanced potency, robust efficacy, and favorable pharmaceutical profile of AMG510 make it the first KRAS inhibitor to enter clinical trials. G12CThis prompted the selection of AMG510 as a potential inhibitor (clinicaltrials.gov NCT03600883). Notably, in the first two cohorts of patients, treatment with AMG510 resulted in objective partial responses (by RECIST 1.1) in two patients with KRAS p.G12 CNSCLC (Figure 43(e) and Figure 47(d)). Both patients had documented disease progression that had progressed to multiple systemic therapies including carboplatin, pemetrexed, and nivolumab. The first patient showed a 34% tumor reduction after six weeks of AMG510 treatment. The second responder showed a 67% tumor reduction after only two weeks of AMG510 treatment. These patients are still on AMG510 treatment after six and two months, respectively (as of the filing date of this U.S. provisional patent application). No adverse events were reported. These patients became the first to respond to a mutant-specific KRAS inhibitor, representing a milestone for cancer patients with KRAS p.G12C mutant tumors.

[0547] <Increased efficacy when used in combination>

[0548] Given the high prevalence of KRAS p.G12C in lung adenocarcinoma, combination treatment of AMG510 with carboplatin, a standard chemotherapy drug for lung cancer, was investigated in the NCI-H358 model. Treatment with either single agent (AMG510 or carboplatin) resulted in significant tumor growth inhibition (Figure 44(a)). However, combination treatment at various doses resulted in significantly improved antitumor efficacy (Figure 44(a) and Figure 47(e)). To our knowledge, this is the first demonstration of enhanced efficacy by combining a mutant-selective KRAS inhibitor with a chemotherapy drug, providing a rationale for this approach in the clinic.

[0549] A clinically validated strategy of combining BRAF and MEK inhibitors has been shown to enhance tumor cell killing and reduce resistance, while AMG510 and other inhibitors of the MAPK (and AKT) signaling pathways have been shown to enhance tumor cell killing and reduce resistance. 26This suggests that AMG510 may be able to overcome the HER kinase, EGFR, SHP2, PI3K, AKT and MEK inhibitors. Therefore, in vitro combination experiments of several KRAS p.G12C cell lines were performed with AMG510 and a matrix of HER kinase, EGFR, SHP2, PI3K, AKT and MEK inhibitors (Figure 48). As suggested by the induction of p-EGFR by AMG510 (Figure 41(a)), combination of AMG510 with multiple agents resulted in synergistic tumor cell killing in NCI-H358 (Figure 44(b) and Figure 48). While synergy was more limited in other lines, combination with MEKi was synergistic in multiple settings and was enhanced under spheroid growth conditions (Figure 44(b)). Significantly enhanced antitumor activity was also observed in vivo using the minimum effective dose of AMG510 in combination with MEKi when compared to either single agent alone (Figure 44(c)). Together, these data suggest an interesting clinical approach to combine AMG510 with agents that target other nodes in the MAPK pathway to eliminate residual or bypass signaling that may limit efficacy or induce resistance.

[0550] <Inflammatory Tumor Microenvironment>

[0551] Blockade of the immune checkpoint, programmed cell death 1 / programmed death ligand 1 (PD-1 / PD-L1) axis, has been clinically validated and approved for certain cancer patients. The activity of AMG510 in combination with anti-PD-1 therapy was evaluated in the CT-26 KRAS p.G12C model in an immune-competent setting. This line was sensitive to AMG510 (Fig. 43(c) and Fig. 47(a)) depending on the KRAS p.G12C allele (Fig. 49(a), (b)). As shown previously (Fig. 43(c)), AMG510 caused tumor regression as a single agent (Fig. 45(a)). However, over time, only 1 in 10 tumors remained in complete regression (Fig. 45(a)). Anti-PD-1 monotherapy delayed tumor growth, with only 1 in 10 tumors showing complete regression. Strikingly, the combination treatment resulted in 9 complete responses out of 10 mice (Figure 45(a)). Treatment was stopped after 43 days and mice continued to be monitored for an additional 112 days. All complete responders from the combination treatment remained free of detectable tumors, indicating that the combination of AMG510 and the anti-PD-1 antibody resulted in durable cures. Surrogate survival endpoints (tumor volume >800 mm3) were significantly higher in mice than in controls. 3 ), combination treatment resulted in a significant increase in survival compared to monotherapy (Figure 45(b)).

[0552] To understand the effect of treatment on immune cell composition in the tumor, we determined the immunophenotype of CT-26 KRAS p.G12C tumors after treatment. After 4 days of treatment, AMG510 led to a significantly increased infiltration of T cells, mainly CD8+ T cells (Figure 45(c) and Figure 50(a)). An increase in CD8+ T cell infiltration was also observed in the combination group, which was mainly driven by AMG510, as it did not occur after anti-PD-1 monotherapy. As an additional comparison, a MEK inhibitor (MEKi), which blocks MAPK signaling downstream of RAS (Figure 50(b)) and led to similar CT-26 KRAS p.G12C tumor growth inhibition as AMG510 (Figure 50(c), (d)), did not affect the number of infiltrating CD8+ T cells (Figure 45(c)). AMG510 treatment also resulted in increased infiltration of macrophages and dendritic cells, which was not observed with MEKi (Figure 45(c)). PD-1 expression on CD8+ T cells was modestly increased by both AMG510 and MEKi (Figure 44(a)). Total tumor RNA was purified after treatment and the transcriptional profile of a panel of immune genes was assessed. After only 2 days of treatment, AMG510 downregulated KRAS G12CInhibition of AMG510 induced a proinflammatory microenvironment characterized by increased interferon signaling, antigen processing, cytotoxicity and NK cell activity, and significantly higher innate immune stimulatory markers compared to the effects induced by MEK inhibition (Figure 45(d) and Figure 44(e)). AMG510 also induced expression of MHC-I protein on CT-26 KRAS p.G12C tumor cells (Figure 45(e) and Figure 50(f)). These data suggested that the therapeutic effect of AMG510 on tumor cells may result in increased T cell priming and antigen recognition. To test this, cured mice from combination treatment (Figure 45(a)) were re-examined in CT-26 KRAS p.G12C and parental CT-26 (KRAS p.G12D), or CT-26 KRAS p.G12C bilateral tumors as well as an unrelated mouse breast tumor model 4T1. All 4T1 tumors (4 / 4) grew, but none of the CT-26 KRAS p.G12C tumors (0 / 8) grew (Figure 45(f)). Notably, all mice receiving CT-26 parental tumors were tumor-free after 40 days (Figure 45(f)). In a separate control group of naive mice, 15 out of 15 mice (100% engraftment rate) grew parental CT-26 and CT-26 KRAS p.G12C tumors (Figure 50(g)). Spleen cells harvested from cured mice were stimulated with CT-26, CT-26 KRAS p.G12C or 4T1 tumor cells, and the levels of secreted IFN-γ were measured as a marker of tumor-specific T cell priming and activity. CT-26 KRAS p.G12C cells and parental CT-26 cells caused an approximately three-fold increase in IFN-γ, which was not induced in 4T1 cells (Figure 45(g)).

[0553] <Consideration>

[0554] KRAS G12C Discovery of a novel interaction with the H95 groove of KRAS is a breakthrough oral KRAS inhibitor with evidence of clinical activity in patients G12CThis study enabled the identification and significantly increased efficacy of the selective KRAS p.G12C tumor inhibitor, AMG510. AMG510 selectively targets KRAS p.G12C tumors and, in combination with cytotoxic targeted agents, synergistically kills tumor cells. AMG510-induced tumor cell death resulted in an inflammatory tumor microenvironment that responded exquisitely to immune checkpoint inhibition. Combination treatment with anti-PD-1 and MEKi has shown compelling preclinical efficacy in several reports, which was associated with increased T cell infiltration. In this study, we demonstrated that selective KRAS G12C Immune cell infiltration following inhibition was significantly more robust than that induced by MEKi. In contrast to the reported effects of non-tumor-selective MEKi, which interfere with T cell proliferation and priming, AMG510-induced KRAS inhibition G12C Selective inhibition of p.G12C resulted in increased T cell priming. These data support a model of enhanced antigen recognition and T cell memory, whereby AMG510-induced tumor cell death, in combination with anti-PD-1 therapy, generates an adaptive immune response such that non-p.G12C tumors are recognized and eradicated. There is ample evidence that intratumoral KRAS mutation status can be heterogeneous both within the same tumor and between primary and metastatic sites. Taken together, our data suggest that KRAS G12C These results suggest that AMG510 may be an effective antitumor agent even in settings where expression is heterogeneous.

[0555] <Method>

[0556] <Recombinant Protein> Recombinant His-tagged human KRAS G12C / C118A (1-169), GST-human c-RAF(1-149), and His-tagged human KRAS C118A(1-169) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Recombinant His-tagged human SOS1 (564-1049, insect codon optimized) was expressed in Trichoplusia ni and purified using affinity chromatography; after removal of the His-tag, it was further purified by size-exclusion chromatography. Ostrem et al. 15 Based on the work of , we used a cysteine ​​light mutant construct for co-crystallization studies. Recombinant His-tagged human KRAS G12C / C51S / C80L / C118S (1-169) was expressed in E. coli and purified using affinity, ion exchange, and size exclusion chromatography to remove the His tag for crystallization.

[0557] <Compounds and antibodies> ARS-1620, PD-0325901, trametinib, afatinib, erlotinib, RMC-4550, and AZD5363 were obtained commercially. AMG511 was synthesized in-house. The synthesis of AMG510 and its non-reactive propionamide is described herein. Stocks of AMG510 and all other inhibitors used in in vitro experiments were prepared as 10 mM solutions in 100% dimethyl sulfoxide (DMSO). For in vivo studies, AMG510 and MEKi (PD-0325901) were formulated in 2% HPMC, 1% Tween 80 and administered orally at 10 mL / kg daily by gavage. Carboplatin stock solutions at 10 mg / mL were further diluted to 5 mg / mL or 3 mg / mL in 1% PBS and administered by intraperitoneal injection (IP) once a week. The rat anti-mouse PD1 clone 29F.1A12 was chimerized to contain a mouse IgG1 backbone. In addition, the Fc receptor silencing mutation N297G was introduced into the IgG heavy chain region to reduce effector function. The anti-PD-1 antibody, 29F.1A12, was diluted to a concentration of 500 μg / mL in 1× PBS and administered by IP once every 3 days for a total of 3 injections. All antibodies used in Western blotting were purchased from Cell Signaling, except for anti-RAS (Abcam), anti-phospho-ERK1 / 2 (ThermoFisher Scientific), and anti-beta-actin-HRP (Sigma).

[0558] <Cell line> All cell lines except KM12 and NCI-H3122 obtained from the National Cancer Institute were purchased from the American Type Culture Collection (ATCC). Cell lines were authenticated by short tandem repeat (STR) profiling. To improve the in vivo growth response rate, MIA PaCa-2 T2 and SW480-1AC cells were generated by passaging MIA PaCa-2 and SW480 cells in mice, respectively. CT-26 KRAS p.G12C cells were generated from the mouse CT-26 colorectal cell line using CRISPR technology, and both alleles of KRAS p.G12D were replaced with p.G12C (ThermoFisher Scientific). Clone H10 was determined to be homozygous for the KRAS p.G12C allele, identified as CT-26 KRAS p.G12C-H10, and referred to as CT-26 KRAS p.G12C. All cell lines were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1× penicillin / streptomycin / L-glutamine at 37 °C, 5% CO2 in a humidified incubator.

[0559] <X-ray crystallography> Purified unlabeled KRAS in 20 mM HEPES (pH 7.5, 150 mM NaCl) G12C / C51S / C80L / C118S (“KRAS”) was concentrated to 40 mg / mL and added to a 2-fold molar excess of solid AMG510 compound dissolved in DMSO. The protein-complex sample was placed on an orbital shaker at RT for 16 h and subsequently spin-filtered. Cocrystallization was performed using the sitting-drop vapor diffusion method. The “KRAS”-AMG510 protein-complex sample and the crystallization buffer (1 mM MgCl2, 0.1 M MES pH 6.5, 30% weight / volume polyethylene glycol 4000) were mixed. Flat rod-shaped crystals appeared at 20 °C in 1 day.

[0560] Crystals were equilibrated in crystallization buffer as cryoprotectant before freezing in liquid nitrogen. Data sets were collected on a Pilatus6M silicon pixel detector at Advanced Light Source Beamline 5.0.1 at a wavelength of 0.97741 Å and a temperature of 100 K. Data were integrated and scaled using HKL2000. The crystals belong to the orthorhombic space group P212121 with unit cell dimensions of a=40.9 Å, b=58.4 Å, c=65.9 Å, α=90°, β=90°, γ=90° (see Supplementary Table 2). The structure was solved by molecular replacement using MolRep with the apo-KRAS structure as the search model. There is one protein molecule in the asymmetric unit. The structure was refined using Refmac5 and model building was performed using the graphics program Coot. Ligands were generated using PRODRG. KRAS bound to GDP and AMG510 G12C / C51S / C80L / C118S The structure has an R factor of 18.1% and R free 21.5% were refined to 1.65 Å. Ramachandran statistics were 98.2% in favored regions, 1.8% in allowed regions, and none in disallowed regions. Amino acid residues 105-107 were unresolved in the crystal structure. Atomic coordinates and structure factors will be deposited in the Protein Data Bank (PDB ID code: not yet assigned).

[0561] Coupled Nucleotide Exchange Assay KRAS G12C / C118A or KRAS C118A Inhibition of SOS1-catalyzed nucleotide exchange activity was measured using the Alpha (Amplified Luminescent Proximity Homogeneous Assay) technique. 20 nM GDP-bound human KRAS was incubated with 2-fold serial dilutions of AMG510 or DMSO in reaction buffer (25 mM HEPES, pH 7.4; 10 mM MgCl2; 0.01% Triton X-100) for 5 min at room temperature (RT). G12C / C118A or KRAS C118AThe protein was incubated. In all subsequent steps, DTT was added to the reaction buffer at a final concentration of 1 mM. Next, GTP and SOS-1 were added to the DTT reaction buffer at final concentrations of 1.25 mM or 500 nM, respectively, and incubated at RT for 30 minutes. Finally, c-RAF RBD (final 50 nM), α-glutathione donor beads (PerkinElmer; final 20 μg / mL), and AlphaLISA® nickel chelate acceptor beads (PerkinElmer; final 20 μg / mL) (all diluted in DTT reaction buffer) were added. The reaction mixture was incubated at RT for 5 minutes, and then the plate was read on an EnVision® Multilabel Reader using the AlphaScreen protocol. After excitation at 680 nm for 180 ms, the luminescence signal was measured at 570 nm. The signal intensity corresponded to the association of c-RAF RBD with GTP-bound KRAS G12c / C118A or KRAS C118A and was normalized to the DMSO control.

[0562] <ERK1 / 2 Phosphorylation Assay> For the cell assay, 2.5E+04 cells per well were seeded in a 96-well plate and incubated overnight at 37 °C, 5% CO2. The next day, the compound or DMSO was added to the cells at 3-fold serial dilutions, and the plate was incubated at 5% CO2, 37 °C for 2 hours. After treatment, the cells were washed with ice-cold PBS and lysed in RIPA lysis buffer (50 mM Tris-HCl, pH 7.5; 1% Igepal; 0.5% sodium deoxycholate; 150 mM NaCl; 0.1% sodium dodecyl sulfate) containing protease and phosphatase inhibitors. The basal ERK1 / 2 phosphorylation level was measured in the treated cell lysates using a phospho-ERK1 / 2 total cell lysate kit (Meso Scale Discovery) according to the manufacturer's protocol. The signal intensity corresponded to the phospho-ERK1 / 2 level and was normalized to the DMSO control.

[0563] For tumor cell lysates from the in vivo pharmacodynamic assay, 50 μg of total protein per sample was analyzed using the phospho-ERK1 / 2 and total ERK1 / 2 whole cell lysate kit (Meso Scale Discovery) according to the manufacturer's protocol. For a given sample, the phospho-ERK1 / 2 signal was normalized to the total ERK1 / 2 signal, and the % inhibition of ERK phosphorylation was calculated relative to the vehicle group.

[0564] <Cell viability assay> For adhesion viability assays, 0.5-1.0E+03 cells per well were plated in 384-well plates (or 2.5-4.0E+04 cells per well in 96-well plates) and incubated overnight at 37°C with 5% CO2. The next day, serially diluted compounds or DMSO were added to the cells and plates were incubated for 72 hours at 37°C with 5% CO2. Cell viability was measured using the CellTiter-Glo® Luminescent Cell Viability Assay kit (Promega) according to the manufacturer's protocol. Luminescent signals of treated samples were normalized to DMSO control.

[0565] For spheroid viability assay, 2.5–4.0E+04 cells per well were plated in 96-well spheroid microplates (Corning) and incubated for 24 h at 37 °C and 5% CO. The same procedure as above was followed, except that viability was measured using the CellTiter-Glo® 3D Cell Viability Assay kit (Promega) according to the manufacturer's protocol.

[0566] <Synergistic combination study> Combination experiments to evaluate the synergistic interactions of AMG510 with other inhibitors in vitro were performed as previously described (Saiki, AY et al. MDM2 antagonists synergize broadly and robustly with compounds targeting fundamental oncogenic signaling pathways. Oncotarget 5, 2030-2043, doi:10.18632 / oncotarget.1918(2014)).

[0567] <Kinetic analysis> Covalent inhibitors-KRAS G12C The formation of the adduct was measured using MS as previously described. 44 Prism (GraphPad Software) was used to fit the relative % binding values ​​for the various inhibitor concentrations at various incubation times with an exponential equation to obtain the k for each concentration tested. obs The resulting k obs The values ​​are then re-plotted against the inhibitor concentration to obtain k inact and K i Generated a value.

[0568] Covalent inhibitors of KRAS in cells G12C To determine the kinetics of adduct formation, basal ERK1 / 2 phosphorylation levels were measured after treatment with various inhibitor concentrations for different incubation times, exactly as described above, and % activity values ​​were used for kinetic calculations.

[0569] <Cysteine ​​proteome analysis> Human non-small cell lung cancer NCI-H358 cells were seeded at 2.0E+06 cells / 10 cm plate and incubated overnight at 37°C, 5% CO2. The next day, cells were treated with 1 μM AMG 510 or DMSO (n=5) and incubated for 4 hours at 37°C, 5% CO2. After treatment, cells were washed with ice-cold PBS containing protease inhibitors and then removed from the plate. Snap-frozen cell pellets were processed by mass spectrometry (MS) at IQ Proteomics, LLC, following their protocol described by Patricelli et al. Briefly, cell pellets were lysed and treated with 100 μM desthiobiotin iodoacetamide to label remaining unreacted cysteines exposed to the solvent. After trypsin digestion, peptide mixtures generated from each sample were labeled with ™T-10plex (Tandem Mass Tag) isobaric labeling reagent (ThermoFisher Scientific). After labeling, samples were mixed and then desthiobiotinylated peptides were enriched using high-capacity streptavidin agarose. Enriched peptides were analyzed by nanoLC-MS using a 3-h gradient and MS3 method based on synchronous precursor selection (SPS) on an Orbitrap Lumos mass spectrometer (ThermoFisher Scientific). Desthiobiotinylated peptides were identified by database searching with a custom informatics pipeline developed in the Gygi Lab at Harvard Medical School using SEQUEST. Mutant KRAS G12CAll spectra were searched against the Human Uniprot (2018) protein sequence database, with protein sequences and common contaminants attached. Peptides and proteins were filtered to a false discovery rate (FDR) of 1%, and only peptides meeting the criteria of a minimum signal-to-noise ratio of 200 and isolation purity of >50% were used for quantitative analysis. All data processing for statistical analysis was performed with Microsoft Excel using normalized peak abundances of cysteine-containing peptides. Log2-fold changes were calculated between the DMSO control and AMG510-treated sample groups. For each peptide, a two-tailed t-test assuming equal variance was performed to assess the statistical significance of the differences between the treated and DMSO control sample groups. For each desthiobiotinylated cysteine-containing peptide, a negative log 10 Volcano plots showing p-values ​​were plotted against log2 fold change. Peptides showing a log2 fold decrease of >2 and a p-value <0.0001 were designated as covalent targets of AMG510 (n=5 biological replicates).

[0570] <Animal testing> All animal procedures were performed in accordance with the guidelines of the Ammgen Animal Care and Use Committee and the standards of the Association for Assessment and Accreditation of Laboratory Animal Care. All studies used female athymic nude or female Balb / c mice (Charles River Laboratories) aged 4 to 7 weeks. Athymic nude mice were housed 5 per cage with a filter cap in sterile housing, and Balb / c mice were housed 5 per cage with a filter cap in nonsterile housing in an environmentally controlled room (temperature 23 ± 2 °C, relative humidity 50 ± 20%) with a 12-h light / dark cycle. Mice were fed a commercial rodent diet.

[0571] <Gene expression analysis> Total RNA was purified from CT-26 KRAS p.G12C tumors treated with vehicle orally, AMG510 orally (100 mg / kg QD) or MEKi orally (PD-0325901, 10 mg / kg QD) for 2 days (n=5 / group) using RNeasy Mini kit (QIAGEN). RNA was quantified by DropSense 96 (PerkinElmer Inc.). 300 ng of RNA was analyzed by nCounter™ (NanoString Technologies) using a mouse pan-cancer immune profiling panel including 750 target genes, 20 housekeeping genes, 8 internal negative controls, and 6 internal positive controls. Raw data was quality cleaned, normalized, and analyzed using nSolver software. ( Analysis was performed using nSolver Advanced Analysis (NanoString Technologies). Raw data were log2 transformed and statistical analysis was performed. Pathway scores (interferon score, antigen processing score, MHC score, TLR score, and T cell function score) and cell profiling scores (NK cell score, cytotoxicity cell score, and CD45 score) were generated using nSolver Advanced Analysis (NanoString Technologies).

[0572] For a detailed list of genes included in each score, as well as the p-values ​​used to calculate the pathway and cell profiling scores, see Supplementary Tables 3A, 3B, 3C, 3D, and 3E.

[0573] Tumor Pharmacodynamic Assays The effect of AMG510 on ERK1 / 2 phosphorylation was evaluated in mice bearing MIA PaCa-2 T2, NCI-H358, and CT-26 KRAS p.G12C tumors. MIA PaCa-2 T2 or NCI-H358 tumor cells (5.0E+06 cells) were injected subcutaneously into the flank of female athymic nude mice at a 2:1 ratio of cells to Matrigel (BD Bioscience, San Jose, CA). The mean tumor size was approximately 300–600 mm. 3When the tumor reached 100 mg / kg (n=3 / group), mice were given a single oral dose of either vehicle or AMG510 (0.3, 1, 3, 10, 30 and 100 mg / kg) and harvested 2 hours later. For time course studies, a single oral dose (10 mg / kg) of AMG510 was used. Female Balb / c mice were injected subcutaneously with CT-26 KRAS p.G12C tumor cells (3.0E+05 cells). Tumor volumes averaged 486 mm 3 At 1 h after immunization, mice were randomized into groups (n=3 / group) and administered a single oral dose of either vehicle or AMG510 (3, 10, 30, or 100 mg / kg), or MEKi (PD-0325901, 10 mg / kg), and harvested 2 h later. In all studies, plasma and tumors were analyzed to determine test item concentrations. Tumor samples were also collected at the indicated times, flash frozen in liquid nitrogen, and processed for bioanalysis or pulverized using a cryoPREP® Dry Impactor (Covaris). Pulverized samples were resuspended and homogenized in RIPA lysis buffer containing protease and phosphatase inhibitors. Clarified lysates were then analyzed for ERK1 / 2 phosphorylation levels as described above, and KRAS phosphorylation by MS. G12C The covalent modification of was analyzed.

[0574] <Xenotransplant and syngeneic studies> MIA PaCa-2 T2, NCI-H358, or SW480-1AC cells (5.0E+06 cells at a 2:1 ratio with Matrigel) were injected subcutaneously into the flank of female athymic nude mice (n=10 / group). Treatment was continued until tumors were established and grew to approximately 170 mm in the MIA PaCa-2 T2 and NCI-H358 studies. 3 , SW480-1AC model is about 200mm 3Treatment was started at 0.05 mg / kg QD. In dose response studies, mice received either vehicle orally (QD) or AMG510 orally (3, 10, 30, and 100 mg / kg QD). In NCI-H358 combination studies with AMG510 and carboplatin, mice were randomized into 8 groups (n=10 / group) and administered either vehicle orally (QD) + PBS i.p. (1x / week), AMG510 orally (10 or 30 mg / kg QD) + PBS i.p. (1x / week), vehicle orally (QD) + carboplatin (50 or 100 mg / kg) i.p. (1x / week), or AMG510 orally (10 or 30 mg / kg QD) + carboplatin (50 or 100 mg / kg) i.p. (1x / week). For AMG510 and MEKi combination studies, mice were randomized into 4 groups, n=10 / group, and received either vehicle orally (QD); AMG510 orally (10 mg / kg QD); MEKi orally (1 mg / kg QD); or AMG510 orally (10 mg / kg QD) + MEKi orally (1 mg / kg QD). In syngeneic studies, CT-26 KRAS p.G12C cells (3.0E+05 cells) were injected subcutaneously into the flank of female Balb / c mice. Treatment was initiated once tumors were established and reached approximately 170 mm in dose-response studies. 3 , and in combined tests, about 130 mm 3Initially, n=10 / group was used for the initial study, but n=8 / group for the MEKi dose-response study. In the dose-response study, mice received either vehicle orally (QD), AMG510 orally (3, 10, 30, and 100 mg / kg QD), or MEKi (PD-0325901) orally (1, 3, or 10 mg / kg QD). For the combination study, mice were randomized into 4 groups, n=10 / group, and were treated from days 15 to 43 with either vehicle orally (QD) + PBS intraperitoneally (Q3D×3); AMG510 orally (100 mg / kg QD) + PBS intraperitoneally (Q3D×3); vehicle orally (QD) + anti-PD-1 antibody (29F.1A12; 100 μg / dose, Q3D×3) intraperitoneally; or AMG510 orally (100 mg / kg QD) + anti-PD-1 antibody (29F.1A12; 100 μg / dose, Q3D×3) intraperitoneally. The combination treatment study was performed in a blinded fashion. Tumor size was assessed twice weekly using Pro-Max electronic digital calipers (Japan Micrometer Mfg.Co.LTD), and tumor volume was calculated using the formula length × width × height, mm 3 In the KRAS p.G12C lung PDX model, tumor masses of approximately 70 mg in size were implanted subcutaneously into mice. 3 When the mice reached the age of 18, they were randomized and given either vehicle or AMG510 orally (100 mg / kg QD) the day after randomization. 2 Collect tumor size twice weekly using the formula: x length x 0.52 mm 3 Data are expressed as mean ± SEM.

[0575] <AMG510-KRAS G12C Detection of Complexes Anti-human RAS (anti-RAS) antibody was purchased from Abcam and biotinylated with EZ-Link NHS-PEG4-biotin (ThermoFisher Scientific) using the protocol described by the vendor. Residual biotin was removed and the resulting biotin-anti-RAS was added to Dynabeads® MyOne™ Streptavidin C1 beads (ThermoFisher Scientific) in a 1:1 ratio for 1 h at RT with shaking. Lysates of in vitro treated cells or in vivo treated tumor cells as previously described were incubated with biotinylated anti-RAS beads for 3 h at RT with shaking. Using a magnet, the beads were washed with PBST (3×), followed by PBS (1×), and then water (1×). Samples were eluted from the beads using 2% formic acid in water / 10% acetonitrile in water, followed by incubation at RT for 10 min with shaking. Supernatants were transferred to 96-well plates and dried. Samples were resuspended in denaturing buffer (10 mM TCEP, 8 M urea) and incubated at 65 °C for 15 min with shaking. Iodoacetamide (40 mM) was added and incubated at 37 °C for 30 min, protected from light. 50 mM NH4HCO3 and trypsin (0.01 μg / μL) were added and samples were digested overnight at 37 °C for approximately 16-20 h, and finally the reaction was quenched with formic acid to give a final concentration of 1% (vol:vol). Samples were then analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS) with multiple reaction monitoring (MRM) in positive ion electrospray mode using a 6500QTRAP (AB SCIEX) coupled to an Acquity UPLC (Waters). Samples were injected onto an Acquity UPLC BEH C8 1.7 μm, 2.1 × 100 mm column (Waters). The mobile phase consisted of mobile phase A (water + 0.1% formic acid) and mobile phase B (acetonitrile + 0.1% formic acid). The LC gradient was 5-50% B in 5 min, 50-95% B in 0.5 min, and 95% B in 1 min. The following peptides were analyzed: KRAS G12C LVVVGAC(CAM)GVGK(529.8→846.3) and AMG510 modified-KRAS G12CAMG510-LVVVGAC(CAM)GVGK (521.4→675.2) was monitored. Occupancy was measured for unmodified and modified-KRAS G12C AMG510-modified-KRAS, normalized to the sum of peptides G12C Calculated as a percentage of peptide.

[0576] <Flow cytometry> To analyze the effect of AMG510 on MHC class I antigen expression in vitro, CT-26 KRAS p.G12C cells (5.0E+04 cells / well) were seeded in 96-well plates and treated with 3-fold serial dilutions of AMG510 in the absence or presence of IFNγ at final concentrations of 25 or 250 pg / mL. Plates were incubated at 37°C, 5% CO2 for 24 hours. Cells were non-enzymatically detached from the wells, washed with staining buffer (PBS / 0.5% BSA) and then stained with PE-conjugated H-2D. d , H-2K d , or H-2L d Cells were incubated with antibodies (BioLegend) for 30 min on ice. After washing, cells were resuspended in staining buffer containing SYTOX Blue Dead Cell Stain (Life Technologies) and then analyzed by flow cytometry. Acquisition and analysis were performed on a BD LSRFortessa flow cytometer using BD FACSDiva software.

[0577] For in vivo studies, CT-26 KRAS p.G12C cells were implanted into Balb / c female mice at approximately 6 weeks of age. Twenty-two days after implantation, mice were randomized into 5 4-day treatment cohorts, n=8 / group, to receive either vehicle orally (QD) + PBS intraperitoneally (Q3D x 2); AMG510 orally (100 mg / kg QD) + PBS intrap...

Claims

1. A method of treating cancer comprising administering to a patient in need thereof a therapeutically effective amount of a KRAS inhibitor. Ｇ１２Ｃ The method comprises administering an inhibitor and at least one additional pharma- ceutically active ingredient.

2. The KRAS Ｇ１２Ｃ The inhibitor is 【Chemistry 1】 or a pharma- ceutically acceptable salt thereof.

3. 2. The method of claim 1, wherein the cancer has a KRAS p.G12C mutation.

4. 10. The method of claim 1, wherein the cancer is pancreatic cancer, colorectal cancer, lung cancer, appendix cancer, endometrial cancer, or small intestine cancer.

5. 5. The method of claim 4, wherein the cancer is pancreatic cancer.

6. 5. The method of claim 4, wherein the cancer is colorectal cancer.

7. The method of claim 4, wherein the cancer is lung cancer.

8. 8. The method of claim 7, wherein the lung cancer is non-small cell lung cancer (NSCLC).

9. The method of claim 4 , wherein the cancer is appendiceal cancer.

10. The method of claim 4, wherein the cancer is endometrial cancer.

11. 5. The method of claim 4, wherein the cancer is small intestine cancer.

12. 2. The method of claim 1, wherein the at least one additional pharma- ceutical active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, or an AKT inhibitor.

13. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is carboplatin.

14. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is an anti-PD-1 inhibitor.

15. 15. The method of claim 14, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

16. 16. The method of claim 15, wherein the anti-PD-1 inhibitor is pembrolizumab.

17. 16. The method of claim 15, wherein the anti-PD-1 inhibitor is AMG404.

18. 16. The method of claim 15, wherein the anti-PD-1 inhibitor is nivolumab.

19. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is a MEK inhibitor.

20. 20. The method of claim 19, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

21. 21. The method of claim 20, wherein the MEK inhibitor is trametinib.

22. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is an EGFR inhibitor.

23. 23. The method of claim 22, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

24. 24. The method of claim 23, wherein the EGFR inhibitor is afatinib.

25. 24. The method of claim 23, wherein the EGFR inhibitor is cetuximab.

26. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

27. 27. The method of claim 26, wherein the SHP2 inhibitor is RMC4550.

28. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is a TOR inhibitor.

29. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is a PI3K inhibitor.

30. 30. The method of claim 29, wherein the PI3K inhibitor is AMG511 or buparlisib.

31. 31. The method of claim 30, wherein the PI3K inhibitor is AMG511.

32. 31. The method of claim 30, wherein the PI3K inhibitor is buparlisib.

33. 13. The method of claim 12, wherein the at least one additional pharma- ceutical active agent is an AKT inhibitor.

34. 34. The method of claim 33, wherein the AKT inhibitor is AZD5363.

35. 【Chemical 2】 or a pharma- ceutically acceptable salt thereof, at least one additional pharma- ceutically active agent, and a pharma- ceutically acceptable excipient.

36. 36. The composition of claim 35, wherein the at least one additional pharma- ceutical active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, or an AKT inhibitor.

37. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is carboplatin.

38. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is an anti-PD-1 inhibitor.

39. 39. The composition of claim 38, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

40. 40. The composition of claim 39, wherein the anti-PD-1 inhibitor is pembrolizumab.

41. 40. The composition of claim 39, wherein the anti-PD-1 inhibitor is AMG404.

42. 40. The composition of claim 39, wherein the anti-PD-1 inhibitor is nivolumab.

43. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is a MEK inhibitor.

44. 44. The composition of claim 43, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

45. 45. The composition of claim 44, wherein the MEK inhibitor is trametinib.

46. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is an EGFR inhibitor.

47. 47. The composition of claim 46, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib or cetuximab.

48. 48. The composition of claim 47, wherein the EGFR inhibitor is afatinib.

49. 48. The composition of claim 47, wherein the EGFR inhibitor is cetuximab.

50. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

51. 51. The composition of claim 50, wherein the SHP2 inhibitor is RMC4550.

52. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is a TOR inhibitor.

53. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is a PI3K inhibitor.

54. 54. The composition of claim 53, wherein the PI3K inhibitor is AMG511 or buparlisib.

55. 55. The composition of claim 54, wherein the PI3K inhibitor is AMG511.

56. 55. The composition of claim 54, wherein the PI3K inhibitor is buparlisib.

57. 37. The composition of claim 36, wherein the at least one additional pharma- ceutical active agent is an AKT inhibitor.

58. 58. The composition of claim 57, wherein the AKT inhibitor is AZD5363.

59. KRAS Ｇ１２Ｃ A kit comprising an inhibitor or a pharma- ceutically acceptable salt thereof, and at least one additional pharma- ceutically active agent.

60. The KRAS Ｇ１２Ｃ Inhibitors 【Chemistry 3】 or a pharma- ceutically acceptable salt thereof.

61. 60. The kit of claim 59, wherein the at least one additional pharma- ceutical active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, or an AKT inhibitor.

62. 60. The kit of claim 59, wherein the at least one additional pharma- ceutically active agent is carboplatin.

63. 60. The kit of claim 59, wherein the at least one additional pharma- ceutical active agent is an anti-PD-1 inhibitor.

64. 64. The kit of claim 63, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

65. The kit of claim 64, wherein the anti-PD-1 inhibitor is pembrolizumab.

66. The kit of claim 64, wherein the anti-PD-1 inhibitor is AMG404.

67. The kit of claim 64, wherein the anti-PD-1 inhibitor is nivolumab.

68. 62. The kit of claim 61, wherein the at least one additional pharma- ceutical active agent is a MEK inhibitor.

69. 69. The kit of claim 68, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

70. 70. The kit of claim 69, wherein the MEK inhibitor is trametinib.

71. 62. The kit of claim 61, wherein the at least one additional pharma- ceutical active agent is an EGFR inhibitor.

72. 62. The kit of claim 61, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

73. 63. The kit of claim 62, wherein the EGFR inhibitor is afatinib.

74. 63. The kit of claim 62, wherein the EGFR inhibitor is cetuximab.

75. 62. The kit of claim 61, wherein the at least one additional pharma- ceutical active agent is an SHP2 inhibitor.

76. 76. The kit of claim 75, wherein the SHP2 inhibitor is RMC4550.

77. 62. The kit of claim 61, wherein the at least one additional pharma- ceutical active agent is a TOR inhibitor.

78. 62. The kit of claim 61, wherein the at least one additional pharma- ceutical active agent is a PI3K inhibitor.

79. 79. The kit of claim 78, wherein the PI3K inhibitor is AMG511 or buparlisib.

80. 80. The kit of claim 79, wherein the PI3K inhibitor is AMG511.

81. 80. The kit of claim 79, wherein the PI3K inhibitor is buparlisib.

82. 62. The kit of claim 61, wherein the at least one additional pharma- ceutical active agent is an AKT inhibitor.

83. 83. The kit of claim 82, wherein the AKT inhibitor is AZD5363.

84. 60. The kit of claim 59, wherein the kit is for treating cancer.

85. 85. The kit of claim 84, wherein the cancer has a KRAS p.G12C mutation.

86. 85. The kit of claim 84, wherein the cancer is pancreatic cancer, colorectal cancer, lung cancer, appendix cancer, endometrial cancer, or small intestine cancer.

87. 87. The kit of claim 86, wherein the cancer is pancreatic cancer.

88. 87. The kit of claim 86, wherein the cancer is colorectal cancer.

89. 87. The kit of claim 86, wherein the cancer is lung cancer.

90. 90. The kit of claim 89, wherein the lung cancer is non-small cell lung cancer (NSCLC).

91. 87. The kit of claim 86, wherein the cancer is appendiceal cancer.

92. 87. The kit of claim 86, wherein the cancer is endometrial cancer.

93. 87. The kit of claim 86, wherein the cancer is small intestine cancer.

94. A method for the manufacture of a medicament for the management or treatment of cancer in a subject, comprising administering to a subject a therapeutically effective amount of a KRAS inhibitor in combination with at least one additional chemotherapeutic agent. Ｇ１２Ｃ Use of inhibitors.

95. The KRAS Ｇ１２Ｃ The inhibitor is 【Chemistry 4】 or a pharma- ceutically acceptable salt thereof.

96. KRAS inhibitors for use in the treatment of cancer together with at least one additional pharma- ceutical active agent Ｇ１２Ｃ A compound that is an inhibitor.

97. The KRAS Ｇ１２Ｃ Inhibitors 【Chemistry 5】 or a pharma- ceutically acceptable salt thereof.

98. 97. The compound of claim 96, wherein the cancer has a KRAS p.G12C mutation.

99. 97. The compound of claim 96, wherein the cancer is pancreatic cancer, colorectal cancer, lung cancer, appendix cancer, endometrial cancer, or small intestine cancer.

100. 100. The compound of claim 99, wherein the cancer is pancreatic cancer.

101. 100. The compound of claim 99, wherein the cancer is colorectal cancer.

102. 100. The compound of claim 99, wherein the cancer is lung cancer.

103. The compound of claim 102, wherein the lung cancer is non-small cell lung cancer (NSCLC).

104. 100. The compound of claim 99, wherein the cancer is appendiceal cancer.

105. 100. The compound of claim 99, wherein the cancer is endometrial cancer.

106. 100. The compound of claim 99, wherein the cancer is small intestine cancer.

107. 97. The compound of claim 96, wherein the at least one additional pharma- ceutically active agent is carboplatin, an anti-PD-1 inhibitor, a MEK inhibitor, an EGFR inhibitor, a TOR inhibitor, a SHP2 inhibitor, a PI3K inhibitor, or an AKT inhibitor.

108. 108. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is carboplatin.

109. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is an anti-PD-1 inhibitor.

110. The compound of claim 109, wherein the anti-PD-1 inhibitor is selected from AMG404, pembrolizumab, and nivolumab.

111. The compound of claim 110, wherein the anti-PD-1 inhibitor is pembrolizumab.

112. The compound of claim 110, wherein the anti-PD-1 inhibitor is AMG404.

113. The compound of claim 110, wherein the anti-PD-1 inhibitor is nivolumab.

114. 108. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is a MEK inhibitor.

115. The compound of claim 114, wherein the MEK inhibitor is trametinib, pimasertib, PD-325901, MEK162, TAK-733, GDC-0973 or AZD8330.

116. The compound of claim 115, wherein the MEK inhibitor is trametinib.

117. 108. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is an EGFR inhibitor.

118. 118. The compound of claim 117, wherein the EGFR inhibitor is afatinib, erlotinib, lapatinib, or cetuximab.

119. The compound of claim 118, wherein the EGFR inhibitor is afatinib.

120. The compound of claim 118, wherein the EGFR inhibitor is cetuximab.

121. 108. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is an SHP2 inhibitor.

122. 122. The compound of claim 121, wherein the SHP2 inhibitor is RMC4550.

123. 108. The compound of claim 107, wherein the at least one additional pharma- ceutical active agent is a TOR inhibitor.

124. 108. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is a PI3K inhibitor.

125. The compound of claim 124, wherein the PI3K inhibitor is AMG511 or buparlisib.

126. The compound of claim 125, wherein the PI3K inhibitor is AMG511.

127. 126. The compound of claim 125, wherein the PI3K inhibitor is buparlisib.

128. 108. The compound of claim 107, wherein the at least one additional pharma- ceutically active agent is an AKT inhibitor.

129. The compound of claim 128, wherein the AKT inhibitor is AZD5363.

130. The KRAS Ｇ１２Ｃ The method of claim 1 , wherein the inhibitor and the at least one additional pharma- ceutical active agent are administered simultaneously.

131. The KRAS Ｇ１２Ｃ The method of claim 1 , wherein the inhibitor and the at least one additional pharma- ceutically active agent are administered separately.

Images