Redirection of tropism of AAV capsids

Abstract

To provide compositions or methods for preparing adeno-associated virus capsid protein comprising a target directing peptide insert for enhancing tropism to a target tissue.SOLUTION: A method for generating a variant AAV capsid polypeptides that exhibit at least one of improved transduction or increased cell or tissue specificity relative to a parental AAV capsid polypeptide is disclosed. The method comprises the steps of: generating a library of variant AAV capsid polypeptides comprising a plurality of capsid polypeptides; and generating an AAV vector library by cloning the capsid polypeptides of the library into AAV vectors, where the AAV vectors comprise a first promoter and a second promoter, where the second promoter drives capsid mRNA expression in the absence of helper virus co-infection.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to compositions, methods, and processes for preparing adeno-associated virus capsid proteins, their uses, and / or formulations, where the capsid proteins contain targeting peptide inserts to enhance tropism for target tissues. [Background technology]

[0002] Gene delivery to the adult central nervous system (CNS) remains a major challenge in gene therapy, and engineered AAV capsids with enhanced brain tropism are an attractive solution. Adeno-associated virus (AAV) derived vectors are promising tools for clinical gene transfer due to their non-pathogenic nature, their low immunogenicity profile, low integration rate into the host genome, and long-lasting transgene expression in non-dividing cells. However, the transduction efficiency of AAV natural variants in certain organs is too low to be applied clinically, and capsid neutralization by pre-existing neutralizing antibodies may prevent treatment of most patients. For these reasons, great efforts have been dedicated to obtain novel capsid variants with enhanced properties. Among the many approaches tested so far, the most meaningful progress has come from the directed evolution of AAV capsids using in vitro or in vivo selection of capsid variants generated by capsid sequence randomization using either error-prone PCR, shuffling of various parent serotypes, or insertion of fully randomized short peptides at defined positions.

[0003] To perform directed evolution of AAV capsids, the viral capsid-encoding sequence is itself flanked by inverted terminal repeats (ITRs) so that it can be packaged into its own capsid shell. After infecting cultured cells or animals with a mixed population of capsids, DNA encoding capsid variants that successfully target tissues of interest are recovered by PCR and subjected to further rounds of selection. This approach recovers all viral DNA species present in a given tissue, and does not distinguish between specific cell types or vectors that can perform complete transduction (cell surface binding, endocytosis, transport, nuclear translocation, uncoating, double-stranded synthesis, transcription). For example, in the case of highly complex tissues containing multiple cell types, such as the central nervous system (CNS), it is expected that it would be highly preferable to apply more stringent selective pressure aimed at recovering capsid variants that can transduce neurons and / or astrocytes but not microglia or endothelial cells.

[0004] Attempts to improve the CNS tropism of AAV capsids upon systemic administration have met with limited success. Two previous approaches have been used to address this issue. The first strategy used co-infection of cultured cells (Non-Patent Document 1) or in situ animal tissues (Non-Patent Document 2) with adenovirus to trigger exponential replication of infectious AAV DNA. Another successful approach involved the use of cell-specific CRE transgenic mice (Non-Patent Document 3) to specifically allow viral DNA recombination in astrocytes, followed by recovery of CRE-recombinant capsid variants. Both approaches proved successful and allowed the isolation of several capsid variants with enhanced transduction of target cell populations.

[0005] This finding suggested that cell type-specific library selection could improve the outcome of directed evolution. However, the transgenic CRE system used by Deverman et al. is cumbersome in other animal species, and AAV variants selected by directed evolution in mouse tissues do not show similar properties in larger animals. Therefore, to increase the probability of translatability in human subjects, it is expected that the entire directed evolution process will need to be performed directly in non-human primates. None of the previously described transduction-specific approaches are suitable for large animal studies for the following reasons: 1) many of the tissues of interest (e.g., CNS) are not readily accessible for adenoviral co-infection; 2) specific Ad tropism itself would bias the library distribution; and 3) large animals are typically not amenable to transgenesis and cannot be engineered to express CRE recombinase in defined cell types.

[0006] To address this issue, we developed a broadly applicable functional AAV capsid library screening platform for cell type-specific biopanning in non-transgenic animals. In the TRACER (Tropism Redirection of AAV by Cell type-specific Expression of RNA) platform system, the capsid genes are placed under the control of a cell type-specific promoter to drive capsid mRNA expression in the absence of helper virus co-infection. This RNA-driven screen increases the selection pressure to favor capsid variants that transduce specific cell types.

[0007] The TRACER platform allows the generation of AAV capsid libraries, and specific recovery and subcloning of capsid mRNA expressed in transduced cells is achieved without the need for transgenic animals or helper virus co-infection. Because mRNA transcription is a defining feature of complete transduction, such a method allows the identification of AAV capsid mutants that are fully infectious. In addition to being more stringent, this method allows the identification of capsids with high tropism for specific cell types, using libraries designed to express CAP mRNA under the control of any cell-specific promoter, including, but not limited to, the synapsin-1 promoter (neurons), the GFAP promoter (astrocytes), the TBG promoter (liver), the CAMK promoter (skeletal muscle), and the MYH6 promoter (cardiomyocytes). [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Grimm et al., 2008 [Non-Patent Document 2] Lisowski et al., 2014 [Non-Patent Document 3] Deverman et al., 2016 Summary of the Invention

[0009] The present disclosure provides compositions and methods for engineering and / or redirecting the tropism of AAV capsid.Also provided herein are peptides that can be inserted into AAV capsid sequence to increase the tropism of capsid to specific tissues.In one aspect, these peptides can be used to target capsid to the brain or brain regions or spinal cord.

[0010] The present disclosure provides a method for generating one or more variant AAV capsid polypeptides. In certain embodiments, the variant AAV capsid polypeptides exhibit at least one of improved transduction or increased cell or tissue specificity compared to the parent AAV capsid polypeptide. In certain embodiments, the method includes: (a) generating a library of variant AAV capsid polypeptides, the library comprising: (i) a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids, or (ii) a plurality of capsid polypeptides derived from more than one parent AAV capsid polypeptide; (b) generating an AAV vector library by cloning the capsid polypeptides of library (a)(i) or (a)(ii) into an AAV vector, the AAV vector comprising a first promoter and a second promoter, the second promoter driving capsid mRNA expression in the absence of helper virus co-infection.

[0011] In certain embodiments, the first promoter is AAV2 P40. In certain embodiments, the second promoter is a ubiquitous promoter. In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.

[0012] In certain embodiments, the first promoter is AAV2 P40.In certain embodiments, the second promoter is a cell type specific promoter.In certain embodiments, the first promoter is AAV2 P40 and the second promoter is a cell type specific promoter.

[0013] In certain embodiments, the promoter is selected from any of the promoters listed in Table 3. In certain embodiments, a ubiquitous or cell-specific promoter allows expression of an RNA encoding a capsid polypeptide.

[0014] In certain embodiments, the method comprises recovering RNA encoding the capsid polypeptide. In certain embodiments, the method comprises determining the sequence of the capsid polypeptide. In certain embodiments, the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

[0015] In certain embodiments, the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglial cell, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatic cell, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

[0016] In certain embodiments, the AAV vector comprises a first promoter and a second promoter, the second promoter being located downstream of the capsid gene and driving its antisense RNA expression in the absence of helper virus coinfection.

[0017] In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a ubiquitous promoter.In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a cell-specific promoter.In certain embodiments, the ubiquitous promoter or the cell-specific promoter allows the expression of the gene encoding the capsid polypeptide of variant AAV in antisense direction, resulting in antisense RNA.In certain embodiments, the method includes recovering the antisense RNA that can be converted into the RNA encoding the variant AAV capsid polypeptide, which is used to determine the sequence of the variant AAV capsid polypeptide.

[0018] In certain embodiments, the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. The above and other objects, features and advantages will become apparent from the following description of specific embodiments of the present disclosure, as illustrated in the accompanying drawings, which are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the present disclosure. [Brief description of the drawings]

[0019] [Figure 1A] Diagram showing wild-type AAV capsid gene transcription and a map of the CMV-CAP vector. Figure 1A shows transcription of VP1, VP2, and VP3 AAV from the wild-type AAV genome. The transcription start site of each viral promoter is indicated. SD, splice donor; SA, splice acceptor. The sequence of the start codon of each reading frame is indicated. Translation of AAP and VP3 is carried out by leaky scanning of the major mRNA. [Figure 1B] Diagram showing wild-type AAV capsid gene transcription and CMV-CAP vector map. Figure 1B shows the structure of the CMV-p40 dual promoter vector used to determine the minimal regulatory sequences required for efficient virus production. The pREP2ΔCAP vector shown at the bottom was obtained by deleting most of the CAP reading frame and is used to provide the REP protein in trans. [Figure 2A]Histogram representation of data showing the effect of CMV promoter position on viral yield and CAP mRNA splicing. Figure 2A shows the average yield of AAV9 produced in HEK-293T cells co-transfected with Ad helper vector using the constructs described in Figure 1. Wild-type AAV9 plasmid (pAV9) is used as a positive control. Y-axis values ​​show AAV DNA copy number per ul from each 15 cm plate (approximately 1000ul in total, left panel) or percentage of wtAAV9 (right panel). [Figure 2B] Histogram representation of data showing the effect of CMV promoter position on virus yield and CAP mRNA splicing. Figure 2B shows evidence of expression of CAP transcript in transfected cells. mRNA from transfected 293T cells was subjected to RT-PCR using primers specific for the predominantly spliced ​​CAP transcript. Note the lack of p40-driven transcription in the absence of Ad helper vector (lane 2). [Figure 3A] Figure 3 shows the effect of REP helper plasmid optimization on virus yield. Figure 3A shows the design of the improved pREP helper vector. Deletion of the MscI fragment removes the C-terminal portion of the VP protein required for encapsidation. The asterisk represents a premature stop codon introduced to destroy the possibility that the VP1, VP2, and VP3 reading frames are encoded. [Figure 3B] Figure 3B shows the effect of REP helper plasmid optimization on virus yield. Figure 3B shows the yield of synapsin-p40-CAP9 AAV produced using various REP plasmid architectures. The Y-axis values ​​represent the percentage of VG relative to wild-type AAV9. [Figure 3C]Figure 3C shows the effect of REP helper plasmid optimization on virus yield. Figure 3C shows quantification of recombination and / or illegitimate packaging of full-length REP from pREP plasmid. Produced virus stocks were subjected to qPCR using a Taqman probe located in the N-terminal portion of REP, which is not present in the ITR-containing vector. [Figure 4A] Figure 4. In vivo analysis of second generation vectors is described. Figure 4A shows the design of the Pro9 vector. The architecture of all three vectors is based on the BstEII construct. The AAV9 capsid RNA is placed under the control of the P40 promoter and the CMV, hSyn1, or GFAP promoter, respectively. [Figure 4B] Figure 4B depicts the in vivo analysis of second generation vectors. Figure 4B shows a silver stained SDS-PAGE gel obtained by running 1e10VG of each vector after double iodixanol purification. [Figure 4C] In vivo analysis of second generation vectors is described. Figure 4C shows the biodistribution of viral DNA in mouse brain (cortex), liver, and heart after tail vein injection of 1e12 VG per mouse. AAV9 VP3 DNA was quantified by Taqman PCR and normalized to the mouse transferrin receptor gene. [Figure 4D] In vivo analysis of second generation vectors is described. Figure 4D shows capsid RNA recovery from mouse tissues. Total RNA was reverse transcribed and Taqman PCR was performed using capsid-specific Taqman primers and probes. Values ​​represent VP3c DNA copy numbers normalized to the TBP housekeeping gene. [Figure 5A]In vitro analysis of intronic second generation vectors is described. Figure 5A shows the design of the IntronPro9 vector harboring a hybrid CMV / globin intron. The AAV9 capsid RNA is placed under the control of the P40 promoter and the CBA, hSyn1, or GFAP promoters in a tandem (top) or inverted (bottom) configuration. The inverted promoter vectors have an additional SV40 polyadenylation site (orange) added to the 3' end to allow polyadenylation of the antisense CAP9 transcript. [Figure 5B] In vitro analysis of intronic second generation vectors is described. Figure 5B shows AAV9 CAP cDNA amplification. Triple transfection with pHelper and pREP-3stops was used to produce all vectors shown, and the resulting viruses were used to infect HEK-293T cells at an MOI of 1e4VG per cell. RNA was extracted 48 hours post-infection and subjected to RT-PCR using primers amplifying the complete capsid (top) or the C-terminal fragment (bottom). [Figure 5C] In vitro analysis of intronic second generation vectors is described. Figure 5C shows AAV9 VP3 cDNA from cells infected with intronless or intronic viruses carrying forward tandem promoters was quantified by Taqman PCR and normalized to the GAPDH housekeeping gene. Values ​​indicate the ratio of VP3 to GAPDH cDNA. [Figure 5D] In vitro analysis of intronic second generation vectors is described. Figure 5D shows mapping of capsid RNA recovery from cells infected with tandem or inverted constructs. Total RNA was reverse transcribed and PCR was performed using primers flanking the entire capsid gene. White arrows represent VP3 size variants resulting from aberrant splicing of the antisense CAP mRNA. [Figure 5E]In vitro analysis of intron second generation vectors is described. Figure 5E shows analysis of globin intron splicing. cDNA derived from HEK-293T cells transduced with CAG9 plasmid (left) or CAG9 virus was subjected to PCR with forward primers located in front of (Glo ex1) or within (GloSpliceF4 (SEQ ID NO: 26) and GloSpliceF6 (SEQ ID NO: 13)) the globin inter-exon junction. Primers spanning the junction between exon 1 (not underlined) and exon 2 (underlined) are listed at the bottom. [Figure 6] Figure 1 provides in vitro evidence that the presence of the P40 promoter downstream of the synapsin or Gfabc1D promoter does not derepress either promoter in HEK-293T cells. [Figure 7] A diagram illustrating the basic structure of the TRACER platform. [Figure 8] Diagram illustrating features of the TRACER platform, including the use of tissue-specific promoters and RNA recovery. [Figure 9] FIG. 1 provides one embodiment of a TRACER production architecture. [Figure 10] FIG. 11 provides a comparison between conventional vDNA recovery and second generation vRNA recovery. [Figure 11] FIG. 1 provides an overview of the use of cell-specific RNA expression for targeted evolution. [Figure 12A] FIG. 12 provides a diagram showing capsid gene transcription of native AAV (FIG. 12A) and the TRACER library (FIG. 12B). [Figure 12B] FIG. 12 provides a diagram showing capsid gene transcription of native AAV (FIG. 12A) and the TRACER library (FIG. 12B). [Figure 13] FIG. 1 is a diagram of the AAV6, AAV5, and AAV-DJ capsid peptide display libraries used for in vivo evolution (SEQ ID NOs: 27-32, respectively, in order of appearance). [Figure 14]FIG. 1 is a diagram of the AAV9 capsid peptide display library used for in vivo evolution (SEQ ID NOs: 33-42, respectively, in order of appearance). [Figure 15A] Diagram presenting the method used for library construction. Figure 15A shows the sequences of the insertion sites used to introduce the random library (SEQ ID NOs: 43-46, respectively, in order of appearance). [Figure 15B] Diagram presenting the methodology used for library construction. Figure 15B provides an explanation of the assembly procedure. [Figure 16] FIG. 47 provides a representative diagram of the cloning-free rolling circle procedure used for library amplification (SEQ ID NO: 47; NNK7). [Figure 17] A diagram providing the sequences of codon mutant AAV9 library shuttles designed to minimize wild-type contamination (SEQ ID NOs: 33-34 and 48-52, respectively, in order of appearance). [Figure 18] Diagram providing an illustration of AAV9 peptide library biopanning. [Figure 19] Diagram showing the recovery process with 50% recovery from the initial pool. [Figure 20] Diagram providing examples of cDNA recovery and amplification from GFAP-driven libraries (groups B and F). [Figure 21] Diagram showing the progression of AAV9 peptide library diversity throughout the biopanning process. Figure 21A describes the RNA library evolution. Figure 21B and Figure 21C show the amino acid distribution of NNK machine mix preparations for P0 and P1 viruses. [Figure 22] Diagram providing neuronal (SYN)-AAV9 peptide library composition at P2. [Diagram 23] Diagram providing astrocyte (GFAP)-AAV9 peptide library composition at P2. [Figure 24]FIG. 11 provides an estimate of brain / liver specificity in GFAP-AAV9 peptide library candidates. [Diagram 25] FIG. 11 provides an estimate of brain / liver specificity in GFAP-AAV9 peptide library candidates. [Figure 26] FIG. 1 provides examples of subpopulation selection of variants. [Figure 27] Diagram providing a representative design of the library generation and cloning procedure. [Figure 28] Diagram providing the NNK / NNM codon distribution (covariance of codon mutants) of AAV produced with a synthetic library of 666 sequence variants (GFAP promoter). [Figure 29] Diagram providing the NNK / NNM codon distribution (covariance of codon mutants) of AAV produced with a synthetic library of 666 sequence variants (SYN9 promoter). [Diagram 30] FIG. 13 provides data derived from tissue recovery from brain and liver punches 1 month after injection. [Figure 31A] Figure 31A provides control capsid results from Syn-driven synthetic library NGS analysis. Figure 31A shows enrichment analysis of internal AAV9, PHP.B, and PHP.eB controls (SEQ ID NOs: 53-58 and 53-58, respectively, in order of appearance). [Figure 31B] Figure 31B, Figure 31C, and Figure 31D provide control capsid results from Syn-driven synthetic library NGS analysis. Figure 31B, Figure 31C, and Figure 31D show NNK / NNM codon distribution in mRNA from mouse brain tissue. [Figure 31C] Figure 31B, Figure 31C, and Figure 31D provide control capsid results from Syn-driven synthetic library NGS analysis. Figure 31B, Figure 31C, and Figure 31D show NNK / NNM codon distribution in mRNA from mouse brain tissue. [Figure 31D] Figure 31B, Figure 31C, and Figure 31D provide control capsid results from Syn-driven synthetic library NGS analysis. Figure 31B, Figure 31C, and Figure 31D show NNK / NNM codon distribution in mRNA from mouse brain tissue. [Figure 32A]Figure providing the results of neuronal synthetic library NGS analysis (SEQ ID NOs: 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71, and 70-74, respectively, in order of appearance). [Figure 32B] Figure providing the results of neuronal synthetic library NGS analysis (SEQ ID NOs: 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71, and 70-74, respectively, in order of appearance). [Diagram 33] Figure providing the results of astrocyte synthetic library NGS analysis (SEQ ID NOs: 53-58, 53-58, and 53-58, respectively, in order of appearance). [Figure 34A] Diagram providing astrocyte synthetic library codon mutant covariances. [Figure 34B] Diagram providing astrocyte synthetic library codon mutant covariances. [Diagram 35]Figure providing the results of astrocyte synthetic library NGS analysis (respectively in order of appearance, SEQ ID NOs: 75, 75–78, 76–77, 79–83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88–90, 87, 91, 83, 88, 63, 89–90, 92–93, 91, 94–97, 93, 95, 98, 98, 97, 63, 92, 94, 99–101, 75, 75 ~78, 76~77, 79~83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88~90, 87, 91, 83, 88, 63, 89~90, 92~93, 91, 94~97, 93, 95, 98, 98, 97, 63, 92, 94, 99~102, 99, 103, 103~104, 96, 105~106, 101, 100, 102, 107, 104~105, 108~ 113, 106, 60, 66, 114-117, 109, 113, 72, 108, 110, 67, 118-119, 116, 120, 120, 107, 112, 121-123, 66, 124-125, 115, 118, 126, 121, 127-128, 60, 129, 119, 130-132, 72, 133, 123, 125, 69, 134-139, 62, 124, 67, 111, 114, 126, 140-141, 1 22, 142, 128-129, 143, 138, 144, 134, 62, 136, 145, 141, 146-153, 127, 154, 69, 144, 155, 71, 156, 133, 132, 137, 147, 157-158, 135, 159, 140, 117, 160, 139, 161-162, 130, 163, 143, 164, 152, 151, 165-167, 155, 168, 71, 169, and 146). [Diagram 36] Diagram providing GFAP synthetic library NGS analysis. [Figure 37A]Figure 37A provides the top 38 variants from the synthetic library screening. Figure 37A shows a phylogenetic analysis of the 9-mer peptide sequences, along with the sequences of the peptide variants (SEQ ID NOs: 67, 59, 64, 61, 77, 84, 96, 60, 80, 82, 66, 62, 83, 85, 106, 131, 94, 90, 76, 68-69, 79, 75, 81, 88, 139, 78, 155, 102, 63, 140, 87, 70, 105, 120, 89, 65, and 109, respectively, in order of appearance). Highlighted sequences represent peptides selected for individual transduction assays. [Figure 37B] Figure 37A provides the top 38 variants from the synthetic library screen. Figure 37B shows a graphical representation of the neuronal and astrocyte tropism of each peptide, with both axes showing the inverse ranking in the synapsin and GFAP screens. [Figure 38] A diagram providing the top consensus sequences compared to PHP.N and PHP.B (SEQ ID NOs: 168 and 71, respectively, in order of appearance). [Figure 39] FIG. 1 is a diagram of the Gibson assembly library cloning procedure. [Diagram 40] FIG. 1 provides examples of TRIM / NNK peptide occurrence (SEQ ID NOs: 170-171, respectively, in order of occurrence). [Diagram 41] Figure providing peptide diversity statistics for a study using Illumina adapters with 42 million bacterial transformants, 81 million sequence reads, and 12 million sequence variants (sequence numbers 172-173, 48-49, and 174-175, respectively, in order of appearance). [Diagram 42] FIG. 1 provides a representative diagram of cloning-free DNA amplification by rolling circle amplification. [Diagram 43] FIG. 1 provides a diagram of protelomerase monomer processing (SEQ ID NOs: 176-178, respectively, in order of appearance). [Diagram 44] FIG. 1 provides a diagram comparing conventional and cloning-free methods. [Figure 45A]Figure providing the complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and heart tissues. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The ranking of the internal control capsids PHP.B, PHP.eB, and AAV9 is shown (Figure 45A and Figure 45B). A comparison of the combined Syn-driven and GFAP-driven results is provided (Figure 45C). Two of the six mice showed very different ranking profiles and were considered outliers, so only four animals represented the GFAP-driven library. [Figure 45B] Figure providing the complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and heart tissues. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The ranking of the internal control capsids PHP.B, PHP.eB, and AAV9 is shown (Figure 45A and Figure 45B). A comparison of the combined Syn-driven and GFAP-driven results is provided (Figure 45C). Two of the six mice showed very different ranking profiles and were considered outliers, so only four animals represented the GFAP-driven library. [Figure 45C] Figure providing the complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and heart tissues. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The ranking of the internal control capsids PHP.B, PHP.eB, and AAV9 is shown (Figure 45A and Figure 45B). A comparison of the combined Syn-driven and GFAP-driven results is provided (Figure 45C). Two of the six mice showed very different ranking profiles and were considered outliers, so only four animals represented the GFAP-driven library. [Figure 46A]Figure 46 provides a comparison of the results of neuronal and astrocyte synthetic library NGS analysis. Figure 46A shows the ranking of capsids using the SYN promoter or the GFAP promoter. [Figure 46B] Figure 46A provides a comparison of the results of neuronal and astrocyte synthetic library NGS analysis. Figure 46B shows a scatter plot showing the correlation of Syn-driven libraries versus GFAP-driven libraries. [Figure 47] FIG. 1 illustrates one embodiment of a multi-species (e.g., rodent) study followed by next generation sequencing (NGS). [Figure 48A] Figure 48A provides the results of a multi-strain / species comparison of 333 capsid variants. Figure 48A shows the ranking of 333 capsids by brain RNA enrichment score in C57BL / 6 mice, BALB / C mice, and rats. Capsids are ranked according to Syn-driven brain enrichment score in C57BL / 6 mice. [Figure 48B] Figure 48A provides the results of a multi-strain / species comparison of 333 capsid variants. Figure 48B shows a scatter plot showing the correlation between C57BL / 6 and BALB / C enrichment scores from Syn- and GFAP-driven pools. [Figure 48C] Figure 48A provides the results of a multi-strain / species comparison of 333 capsid variants. Figure 48C shows a Venn diagram showing the crossover and consensus sequences of capsids with >10-fold higher brain enrichment scores than AAV9 (either Syn-driven or GFAP-driven) in C57BL / 6 and BALB / C strains. In rats, no capsids showed >10-fold enrichment scores relative to AAV9. [Figure 49A] A diagram providing transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in Figure 49A (SEQ ID NOs: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. [Figure 49B]A diagram providing transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in Figure 49A (SEQ ID NOs: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. [Figure 49C] Figure 49A provides transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in Figure 49A (SEQ ID NOs: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. Figure 49C shows RNA expression in brain and spinal cord samples. [Figure 49D] Figure 49A provides transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in Figure 49A (SEQ ID NOs: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. Figure 49D shows DNA distribution in brain and spinal cord samples. [Figure 50A] Figure 50 provides the results of testing individual capsids and their mRNA expression in brain, spinal cord, and liver. EGFP mRNA expression results are shown for brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 50B] Figure 50 provides the results of testing individual capsids and their mRNA expression in brain, spinal cord, and liver. EGFP mRNA expression results are shown for brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 50C] Figure 50 provides the results of testing individual capsids and their mRNA expression in brain, spinal cord, and liver. EGFP mRNA expression results are shown for brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 51]FIG. 51 provides the results of NGS screening using the neuronal NeuN marker for both the GFAP and SYN screens. [Figure 52] FIG. 11 provides results of testing individual capsids in whole brain. [Diagram 53] FIG. 11 provides results from testing additional individual capsids in whole brain. [Figure 54] FIG. 11 provides results of testing individual capsids in the cerebellum. [Figure 55] FIG. 11 provides results of testing individual capsids in the cortex. [Figure 56] FIG. 11 provides results of testing individual capsids in the hippocampus. [Figure 57A] A diagram providing transduction data of 10 capsid variants in mouse liver analyzed by EGFP RNA expression (FIG. 57B) and whole tissue fluorescence (FIG. 57A). [Figure 57B] A diagram providing transduction data of 10 capsid variants in mouse liver analyzed by EGFP RNA expression (FIG. 57B) and whole tissue fluorescence (FIG. 57A). [Figure 58A] Figure 58A provides the results of a comparative study of the CNS transduction efficacy of 333 capsid variants on C57BL / 6 mouse BMVEC (Figure 58A) and human BMVEC (Figure 58B). [Figure 58B] Figure 58A provides the results of a comparative study of the CNS transduction efficacy of 333 capsid variants on C57BL / 6 mouse BMVEC (Figure 58A) and human BMVEC (Figure 58B). [Figure 59A] FIG. 59 provides a diagram of external barcoding for NGS analysis and full-length capsid variant recovery. A common barcode pair is shown (FIG. 59C). A complete ITR-to-ITR construct is shown with a barcode pair 5' of the CAP sequence (FIG. 59A) and 3' of the CAP sequence (FIG. 59B). [Figure 59B]FIG. 59 provides a diagram of external barcoding for NGS analysis and full-length capsid variant recovery. A common barcode pair is shown (FIG. 59C). A complete ITR-to-ITR construct is shown with a barcode pair 5' of the CAP sequence (FIG. 59A) and 3' of the CAP sequence (FIG. 59B). [Figure 59C] FIG. 59 provides a diagram of external barcoding for NGS analysis and full-length capsid variant recovery. A common barcode pair is shown (FIG. 59C). A complete ITR-to-ITR construct is shown with a barcode pair 5' of the CAP sequence (FIG. 59A) and 3' of the CAP sequence (FIG. 59B). [Figure 60A] Figure 60 provides a detailed analysis of virus production and RNA splicing using several configurations of the intron barcoding platform. Common ITR-to-ITR constructs are shown in Figure 60A (SEQ ID NOs: 189-193, respectively, in order of appearance), along with intron barcode yields (Figure 60B) and gel columns showing the results of AAV intron splicing and globin intron splicing (Figure 60C). [Figure 60B] Figure 60 provides a detailed analysis of virus production and RNA splicing using several configurations of the intron barcoding platform. Common ITR-to-ITR constructs are shown in Figure 60A (SEQ ID NOs: 189-193, respectively, in order of appearance), along with intron barcode yields (Figure 60B) and gel columns showing the results of AAV intron splicing and globin intron splicing (Figure 60C). [Figure 60C] Figure 60 provides a detailed analysis of virus production and RNA splicing using several configurations of the intron barcoding platform. Common ITR-to-ITR constructs are shown in Figure 60A (SEQ ID NOs: 189-193, respectively, in order of appearance), along with intron barcode yields (Figure 60B) and gel columns showing the results of AAV intron splicing and globin intron splicing (Figure 60C). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The details of one or more embodiments of the present disclosure are set forth in the accompanying description below. Any materials and methods similar or equivalent to those described herein can be used to implement or test the present disclosure, but preferred materials and methods are described herein. Other features, objects, and advantages of the present disclosure will be apparent from the present description. In this description, singular forms include plural forms unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present disclosure belongs. In case of discrepancy, the present description shall prevail.

[0021] According to the present disclosure, AAV particles with enhanced tropism to target tissue (e.g., CNS) are provided, as well as the related processes for targeting, preparing, formulating, and using them.Targeting peptides and nucleic acid sequences encoding targeting peptides are provided.These targeting peptides can be inserted into AAV capsid protein sequences to change the tropism to specific cell types, tissues, organs, or organisms in vivo, ex vivo, or in vitro.

[0022] As used herein, an "AAV particle" or "AAV vector" comprises a capsid protein and a viral genome, the viral genome comprising at least one payload region and at least one inverted terminal repeat (ITR). The AAV particle and / or its component capsid and viral genome may be genetically engineered to alter tropism for a particular cell type, tissue, organ, or organism.

[0023] As used herein, "viral genome" or "vector genome" refers to a nucleic acid sequence encapsulated in an AAV particle. The viral genome includes a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.

[0024] As used herein, a "payload region" is any nucleic acid molecule that encodes one or more "payloads" of the present disclosure. As a non-limiting example, the payload region may be a nucleic acid sequence that encodes a payload that includes an RNAi agent or a polypeptide.

[0025] As used herein, a "targeting peptide" refers to a peptide of 3-20 amino acids in length. Such targeting peptides can be inserted or attached to a parent amino acid sequence to alter the properties (e.g., tropism) of the parent protein. As a non-limiting example, a targeting peptide can be inserted into an AAV capsid sequence to enhance targeting to a desired cell type, tissue, organ, or organism.

[0026] The AAV particles and payloads of the present disclosure can be delivered to one or more target cells, tissues, organs, or organisms.In preferred embodiments, the AAV particles of the present disclosure demonstrate enhanced tropism for target cell types, tissues, or organs.As a non-limiting example, the AAV particles can show enhanced tropism for cells and tissues of the central nervous system or peripheral nervous system (CNS and PNS, respectively).The AAV particles of the present disclosure can also or alternatively show reduced tropism for undesirable target cell types, tissues, or organs.

[0027] Adeno-associated virus (AAV) is a small non-enveloped icosahedral capsid virus of the Parvoviridae family, characterized by a single-stranded DNA genome. Parvoviridae viruses are composed of two subfamilies: the Parvovirinae subfamily, which infect vertebrates, and the Densovirinae subfamily, which infect invertebrates. The Parvoviridae family includes the Dependovirus genus, which includes AAVs that can replicate in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and ovine species.

[0028] Parvoviruses and other members of the Parvoviridae family are reviewed in Kenneth I. Berns, "The Parvoviridae: The Viruses and Their Replication," Chapter 69 of FIELDS VIROLOGY (3d Ed. 1996), the contents of which are incorporated by reference in their entirety.

[0029] AAVs have proven to be useful as biological tools because of their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integrating into the host genome and replicating, and their relatively benign immunogenicity profile.The genome of the virus can be engineered to contain the minimum components to assemble a functional recombinant virus or virus particle that is loaded with a desired payload or engineered to target and express or deliver a desired payload to a specific tissue.

[0030] The wild-type AAV viral genome is a linear single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) long. Inverted terminal repeats (ITRs) traditionally cap the viral genome at both the 5' and 3' ends and provide the origin of replication of the viral genome. Without wishing to be bound by theory, AAV viral genomes typically contain two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure defined by self-complementary regions (145 nt in wild-type) at the 5' and 3' ends of the ssDNA that form energetically stable double-stranded regions. The double-stranded hairpin structure has multiple functions, including, but not limited to, acting as an origin of DNA replication by serving as a primer for the endogenous DNA polymerase complex of the host viral replicating cell.

[0031] The wild-type AAV viral genome further comprises two open reading frames: one for four nonstructural Rep proteins (Rep78, Rep68, Rep52, Rep40 encoded by the Rep genes) and one for three capsid or structural proteins (VP1, VP2, VP3 encoded by the capsid or Cap genes). The Rep proteins are important for replication and packaging, and the capsid proteins assemble to create the protein coat of AAV, i.e., the AAV capsid. Alternative splicing and alternative initiation codons and promoters result in the production of four different Rep proteins from a single open reading frame, and the production of three capsid proteins from a single open reading frame. Although it varies depending on the AAV serotype, as a non-limiting example, in the case of AAV9 / hu.14 (US Pat. No. 7,906,111, SEQ ID NO: 123, the contents of which are incorporated herein by reference in their entirety), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. In other words, VP1 is the full-length capsid sequence, and VP2 and VP3 are the shorter components of the whole. As a result, although sequence changes in the VP3 region are also changed in VP1 and VP2, the percent difference compared to the parent sequence is greatest in VP3, since it is the shortest sequence of the three. Although described here in terms of amino acid sequences, the nucleic acid sequences encoding these proteins can be described as well. The three capsid proteins assemble together to create the AAV capsid proteins. Without wishing to be bound by theory, AAV capsid proteins typically comprise a molar ratio of VP1:VP2:VP3 of 1:1:10. As used herein, "AAV serotype" is defined primarily by the AAV capsid. In some cases, the ITRs are also specifically described by the AAV serotype (e.g., AAV2 / 9).

[0032] The AAV vector of the present disclosure may be recombinantly produced or may be based on an adeno-associated virus (AAV) parent or reference sequence. As used herein, a "vector" is any molecule or moiety that transports, transduces, or otherwise acts as a carrier for heterologous molecules, such as the nucleic acids described herein.

[0033] In addition to single-stranded AAV viral genomes (e.g., ssAAV), the present disclosure also provides self-complementary AAV (scAAV) viral genomes. scAAV vector genomes contain DNA strands that anneal together to form double-stranded DNA. scAAV allows for rapid expression in transduced cells by skipping second-strand synthesis.

[0034] In one embodiment, the AAV particles of the disclosure are scAAV. In one embodiment, the AAV particles of the disclosure are ssAAV. Methods for producing and / or modifying AAV particles have been disclosed in the art, such as pseudotyped AAV vectors (WO200028004; WO200123001; WO2004112727; WO2005005610, and WO2005072364, the contents of each of which are incorporated herein by reference in their entirety).

[0035] In one embodiment, an AAV particle of the present disclosure comprising a capsid and viral genome with a targeting peptide inserted therein can exhibit enhanced tropism for a cell type or tissue of the human CNS.

[0036] AAV Capsid The AAV particles of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype.AAV serotypes can differ in characteristics such as, but not limited to, packaging, tropism, transduction and immunogenicity profile.Without wishing to be bound by theory, AAV capsid protein is often considered to be what drives AAV particle tropism to specific tissues.

[0037] In one embodiment, the AAV particles may have capsid proteins and ITR sequences derived from the same parent serotype (e.g., AAV2 capsid and AAV2 ITRs). In another embodiment, the AAV particles may be pseudotyped AAV particles, in which the capsid proteins and ITR sequences are derived from different parent serotypes (e.g., AAV9 capsid and AAV2 ITRs; AAV2 / 9).

[0038] The AAV particles of the present disclosure may comprise an AAV capsid protein in which a targeting peptide is inserted into the parent sequence. The parent capsid or serotype may comprise or be derived from any natural or recombinant AAV serotype. As used herein, a "parent" sequence is a nucleotide or amino acid sequence into which a targeting sequence is inserted (i.e., a nucleotide insertion into a nucleic acid sequence or an amino acid sequence insertion into an amino acid sequence).

[0039] In a preferred embodiment, the parent AAV capsid nucleotide sequence is as shown in SEQ ID NO:1. In another embodiment, the parent AAV capsid nucleotide sequence is the K449R variant of SEQ ID NO: 1, in which the codon encoding a lysine (e.g., AAA or AAG) at position 449 of the amino acid sequence (nucleotides 1345-1347) is replaced with one encoding an arginine (CGT, CGC, CGA, CGG, AGA, AGG). The K449R variant has the same functionality as wild-type AAV9.

[0040] In one embodiment, the parent AAV capsid amino acid sequence is as shown in SEQ ID NO:2. In another embodiment, the parent AAV capsid amino acid sequence is as shown in SEQ ID NO:3.

[0041] In one embodiment, the parent AAV capsid sequence is any of those shown in Table 1.

[0042] [Table 1]

[0043] Each of the patents, applications, and / or publications listed in Table 1 is incorporated herein by reference in its entirety. The parent AAV serotype and associated capsid sequence may be any of those known in the art. Non-limiting examples of such AAV serotypes include: AAV9, AAV9 K449R (or K449R AAV9), AAV1, AAVrhlO, AAV-DJ, AAV-DJ8, AAV5, AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP.B2 (PHP.B2), AAVPHP.B3 (PHP.B3), AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT , AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP , AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAV PHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B- TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3(G2A3), AAVG2B4(G2B4), AAVG2B5(G2B5), PHP.S, AAV2, AAV2G9, AAV3, AAV3a, AA V3b, AAV3-3, AAV4, AAV4-4, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9.11, AAV9.13, AAV9.16, AAV9. 24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12、AAV42-1b、AAV42-2、AAV42-3a、AAV42-3b、AAV42-4、AAV42-5a、AAV42-5b、AAV42-6b、AAV42-8、AAV42-10、AAV42-11、AAV42-12、AAV42-13、AAV42-1 5、AAV42-aa、AAV43-1、AAV43-12、AAV43-20、AAV43-21、AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4 AV223.5、AAV223.6、AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / rh.6、AAV3.1 / rh.61 hu.9、AAV3-9 / rh.52、AAV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / rh.7、AAV16.8 / hu.1 0、AAV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu .16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAVF3、AAVF5、AAVH2、AAVrh.72、AAV hu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AA VCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy. 6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu. AVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu. u.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4 0、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu. 47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu. u.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.20、AAVrh. rh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37、AAVrh.37、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh.53、AAVrh. h.54、AAVrh.56、AAVrh.57、AAVrh.58、AAVrh.61、AAVrh.64、AAVrh.64R1、AAVrh.64R2、AAVrh.67、AAVrh.73、AAVrh.74、AAVrh.8R、AAVrh.8R. A586R mutation、AAVrh8R R533A mutation、AAAV、BAAV、ヤギAAV、ウシAAV、AAVhE1.1、AAVhEr1.5、AAVhER1.14、AAVhEr1.8、AAVhEr1.16、AAVhEr1.18、AAVhEr1.35、AAVhEr1.7、AAVhEr1.36、AAV hEr2.29、AAVhEr2.4、AAVhEr2.16、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AAVhER1.23、AAVhEr3.1、AAV2.5T、AAV-PAEC、AAV-LK01、AAV-LK02、AAV-LK03、AAV-LK03 LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK16、AAV-LK17、AAV-LK18 、AAV-LK19、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAV-PAEC11、AAV-PAEC12、AAV-2-pre-miRNA-101、AAV-8h、AAV-8b、AAV-h、AAV-b、AAV SM 10-2、AAVシャッフル(AAV Shuffle)100-1、AAVシャッフル100-3、AAVシャッフル100-7、AAVシャッフル10-6、AAVシャッフル10-8、AAV SM 10-8、AAV SM 100-3、AAV SM 10-8 100-10、BNP61 AAV、BNP62 AAV、BNP63. AAV、AAVrh.50、AAVrh.43、AAVrh.62、AAVrh.48、AAVhu.19、AAVhu.11、AAVhu.53、AAV4-8 / rh.64、AAVLG-9 / hu.39、AAV54.5 / hu.23、AAV AAV(true types AAV)(ttAAV)、UPENN AAV10、ジャパニーズAAV10 serotype、Japanese AAV 10 serotype、AAV CBr-7.1、AAV CBr-7.10、AAV CBr-7.2、AAV CBr-7.3、AAV CBr-7.4、AAV CBr-7.5、AAV CBr-7.7、AAV CBr-7.8、AAV CBr-B7.3、AAV CBr-B7.4、AAV CBr-E1、AAV CBr-E2、AAV CBr-E3、AAV CBr-E4、AAV CBr-E5、AAV CBr-e5、AAV CBr-E6、AAV CBr-E7、AAV CBr-E8、AAV CHt-1、AAV CHt-2、AAV CHt-3、AAV CHt-6.1、AAV CHt-6.10、AAV CHt-6.5、AAV CHt-6.6、AAV CHt-6.7、AAV CHt-6.8、AAV CHt-P1、AAV CHt-P2、AAV CHt-P5、AAV CHt-P6、AAV CHt-P8、AAV CHt-P9、AAV CKd-1、AAV CKd-10、AAV CKd-2、AAV CKd-3、AAV CKd-4、AAV CKd-6、AAV CKd-7、AAV CKd-8、AAV CKd-B1、AAV CKd-B2、AAV CKd-B3、AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAV CKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAV CKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAV CLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV CLv1-10、AAV CLv1-2、AAV CLv12、AAV CLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAV CLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AA V CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1、AAV CLv-K3、AAV CLv-K6、AAV CLv-L4、AAV CLv-L5、AAV CLv-L6、AAV CLv-M1、AAV CLv-M11、AAV CLv-M2、AAV CLv-M5、AAV CLv-M6、AAV CLv-M7、AAV CLv-M8、AAV CLv-M9、AAV CLv-R1、AAV CLv-R2、AAV CLv-R3、AAV CLv-R4、AAV CLv-R5、AAV CLv-R6、AAV CLv-R7、AAV CLv-R8、AAV CLv-R9、AAV CSp-1、AAV CSp-10、AAV CSp-11、AAV CSp-2、AAV CSp-3、AAV CSp-4、AAV CSp-6、AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, and / or AAVF9 / HSC9, and variants thereof.

[0044] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12):5887-5911 (2008), US Patent Publication No. 20140359799, and US Patent No. 7,588,772, each of which is incorporated herein by reference in its entirety). The amino acid sequence of AAVDJ8 may include two or more mutations to remove the heparin binding domain (HBD). As a non-limiting example, an AAV-DJ sequence is as set forth in SEQ ID NO:1 of U.S. Pat. No. 7,588,772, the contents of which are incorporated herein by reference in their entirety, and the AAV-DJ8 sequence may contain two mutations: (1) R587Q, in which arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln), and (2) R590T, in which arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, the AAV-DJ8 sequence may contain three mutations: (1) K406R, in which lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q, in which arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln), and (3) R590T, in which arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).

[0045] In one embodiment, the parent AAV capsid sequence comprises an AAV9 sequence. In one embodiment, the parent AAV capsid sequence comprises a K449R AAV9 sequence. In one embodiment, the parent AAV capsid sequence comprises an AAVDJ sequence.

[0046] In one embodiment, the parent AAV capsid sequence comprises an AAVDJ8 sequence. In one embodiment, the parent AAV capsid sequence comprises an AAVrh10 sequence. In one embodiment, the parent AAV capsid sequence comprises an AAV1 sequence.

[0047] In one embodiment, the parent AAV capsid sequence comprises an AAV5 sequence. Without wishing to be bound by theory, it is understood that the parent AAV capsid sequence comprises the VP1 region.In one embodiment, the parent AAV capsid sequence comprises the VP1, VP2 and / or VP3 region, or any combination thereof.The parent VP1 sequence can be considered as synonymous with the parent AAV capsid sequence.

[0048] The present disclosure refers to structural capsid proteins (including VP1, VP2, and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein structural coat (i.e., capsid) of a viral vector, such as AAV. VP capsid proteins synthesized from Cap polynucleotides generally contain a methionine (Met1) as the first amino acid of the peptide sequence, which is associated with the start codon (AUG or ATG) of the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue, or generally any first amino acid (AA1), is generally cleaved by a protein processing enzyme, such as Met-aminopeptidase, after or during polypeptide synthesis. This "Met / AA clipping" process often correlates with the corresponding acetylation of the second amino acid (e.g., alanine, valine, serine, threonine, etc.) of the polypeptide sequence. Met clipping generally occurs in VP1 and VP3 capsid proteins, but may also occur in VP2 capsid proteins.

[0049] Incomplete Met / AA clipping may result in the production of a mixture of one or more (1, 2, or 3) VP capsid proteins that make up the viral capsid, some of which contain the Met1 / AA1 amino acid (Met+ / AA+) and some of which may lack the Met1 / AA1 amino acid as a result of Met / AA clipping (Met- / AA-). For further discussion of Met / AA clipping of capsid proteins, see Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther. Methods. 2017 Oct. 28(5):255-267; Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19.327(5968):973-977, the contents of each of which are incorporated herein by reference in their entirety.

[0050] According to the present disclosure, reference to a capsid protein is not limited to being either clipped (Met- / AA-) or unclipped (Met+ / AA+), but may refer, depending on the context, to an individual capsid protein, a viral capsid comprised of a mixture of capsid proteins, and / or a polynucleotide sequence (or fragment thereof) that encodes, describes, produces, or results in a capsid protein of the present disclosure. Also, a direct reference to a "capsid protein" or "capsid polypeptide" (such as VP1, VP2, or VP2) may include a VP capsid protein that includes the Met1 / AA1 amino acids (Met+ / AA+) as well as a corresponding VP capsid protein that lacks the Met1 / AA1 amino acids as a result of Met / AA clipping (Met- / AA-).

[0051] Furthermore, according to the present disclosure, reference to specific sequence numbers (whether protein or nucleic acid) that each contain or encode one or more capsid proteins (Met+ / AA+) that contain the Met1 / AA1 amino acids should be understood to teach VP capsid proteins that lack the Met1 / AA1 amino acids, and any sequence that merely lacks the first listed amino acid (whether Met1 / AA1 or not) is immediately apparent upon inspection of the sequence.

[0052] As a non-limiting example, reference to a (Met+) VP1 polypeptide sequence that is 736 amino acids in length and includes a "Met1" amino acid encoded by an AUG / ATG start codon can be understood to also teach a (Me-) VP1 polypeptide sequence that is 735 amino acids in length and does not include the "Met1" amino acid of the 736 amino acid Met+ sequence. As a second non-limiting example, reference to a (AA+) VP1 polypeptide sequence that is 736 amino acids in length and includes an "AA1" amino acid encoded by an optional NNN start codon can be understood to also teach a (AA-) VP1 polypeptide sequence that is 735 amino acids in length and does not include the "AA1" amino acid of the 736 amino acid AA+ sequence.

[0053] Reference to a viral capsid formed from a VP capsid protein (such as a reference to a specific AAV capsid serotype) may incorporate a VP capsid protein that includes the Met1 / AA1 amino acids (Met+ / AA1+), a corresponding VP capsid protein that lacks the Met1 / AA1 amino acids as a result of Met / AA1 clipping (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).

[0054] As non-limiting examples, AAV capsid serotypes may include VP1(Met+ / AA1+), VP1(Met- / AA1-), or a combination of VP1(Met+ / AA1+) and VP1(Met- / AA1-), AAV capsid serotypes may also include VP3(Met+ / AA1+), VP3(Met- / AA1-), or a combination of VP3(Met+ / AA1+) and VP3(Met- / AA1-), as well as similar optional combinations of VP2(Met+ / AA1) and VP2(Met- / AA1-).

[0055] In one embodiment, the parent AAV capsid sequence may comprise an amino acid sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of those set forth below.

[0056] In one embodiment, the parent AAV capsid sequence may be encoded by a nucleotide sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of those set forth below.

[0057] In one embodiment, the parent sequence is not an AAV capsid sequence, but instead is a different vector (e.g., a lentivirus, a plasmid, etc.) In another embodiment, the parent sequence is a delivery vehicle (e.g., a nanoparticle) to which the targeting peptide is attached.

[0058] Targeting Peptides Disclosed herein are targeting peptides for enhancing or improving transduction of target tissues (e.g., cells of the CNS or PNS), and related AAV particles comprising capsid proteins having one or more targeting peptide inserts.

[0059] In one embodiment, the targeting peptide can direct AAV particles to cells or tissues of the CNS.CNS cells can be brain supporting cells, such as, but not limited to, neurons (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), glial cells (e.g., microglia, astrocytes, oligodendroglia), and / or immune cells (e.g., T cells).CNS tissues can be, but not limited to, cortex (e.g., frontal, parietal, occipital, temporal), thalamus, hypothalamus, striatum, putamen, caudate, hippocampus, entorhinal cortex, basal ganglia, or deep cerebellar nuclei.

[0060] In one embodiment, the targeting peptide can direct the AAV particle to a cell or tissue of the PNS, which may be, but is not limited to, the dorsal root ganglion (DRG).

[0061] The targeting peptide can direct AAV particles to the CNS (e.g., the cortex) following intravenous administration. The targeting peptide can direct AAV particles to the PNS (e.g., DRG) following intravenous administration.

[0062] The targeting peptide may vary in length. In one embodiment, the targeting peptide is 3-20 amino acids long. As a non-limiting example, the targeting peptide may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 3-5, 3-8, 3-10, 3-12, 3-15, 3-18, 3-20, 5-10, 5-15, 5-20, 10-12, 10-15, 10-20, 12-20, or 15-20 amino acids long.

[0063] The targeting peptides of the present disclosure can be identified and / or designed by any method known in the art. As a non-limiting example, the CREATE system as described in Deverman et al. (Nature Biotechnology 34(2):204-209(2016)), Chan et al. (Nature Neuroscience 20(8):1172-1179)(2017)), and WO2015038958 and WO2017100671 can be used as a means to identify targeting peptides in either mice or other research animals, such as, but not limited to, non-human primates. The contents of each of these documents are incorporated herein by reference in their entirety.

[0064] The targeting peptides and related AAV particles can be identified from a library of AAV capsids containing targeting peptide variants. In one embodiment, the targeting peptides can be sequences of seven amino acids (7-mers). In another embodiment, the targeting peptides can be sequences of nine amino acids (9-mers). The targeting peptides can also differ in the methods for creating or designing them, including, in non-limiting examples, random peptide selection, site-saturation mutagenesis, and / or optimization of specific regions of the peptide (e.g., flanking regions or central core).

[0065] In one embodiment, the targeting peptide library comprises targeting peptides seven amino acids in length (7-mers) randomly generated by PCR. In one embodiment, the targeting peptide library comprises targeting peptides having three mutated amino acids. In one embodiment, the three mutated amino acids are consecutive amino acids. In another embodiment, the three mutated amino acids are non-consecutive amino acids. In one embodiment, the parent targeting peptide is a 7-mer. In another embodiment, the parent peptide is a 9-mer.

[0066] In one embodiment, the targeting peptide library comprises 7-mer targeting peptides, and amino acids of the targeting peptides and / or flanking sequences have been evolved by site-saturation mutagenesis of three consecutive amino acids. In one embodiment, the site-saturation mutant sequences are generated using NNK (N=any base; K=G or T) codons.

[0067] AAV particles are generated that contain capsid protein with targeting peptide insert, and the viral genome that encodes a reporter (e.g., GFP) is encapsulated therein.These AAV particles (or AAV capsid libraries) are then administered to transgenic mice by intravenous delivery to tail vein.These capsid libraries are administered to cre-expressing mice, which results in the expression of the reporter payload in target tissues due to Cre expression.

[0068] AAV particles and / or viral genomes may be recovered from the target tissue to identify enrichment of the targeting peptide and associated AAV particles, which indicates enhanced transduction of the target tissue. Enrichment can be determined using standard methods in the art, including, but not limited to, next generation sequencing (NGS), viral genome quantification, biochemical assays, immunohistochemistry, and / or imaging of the target tissue sample.

[0069] Target tissue may be any cell, tissue or organ of a subject.As a non-limiting example, the sample can be selected from brain, spinal cord, dorsal root ganglion and associated roots, liver, heart, gastrocnemius muscle, soleus muscle, pancreas, kidney, spleen, lung, adrenal gland, stomach, sciatic nerve, saphenous nerve, thyroid gland, eye (with or without optic nerve), pituitary gland, skeletal muscle (rectus femoris muscle), colon, duodenum, ileum, jejunum, leg skin, superior cervical ganglion, bladder, ovary, uterus, prostate, testis, and / or any site identified as having a lesion or site of interest.

[0070] Targeting peptide sequence In one embodiment, the targeting peptide may comprise a sequence as shown in Table 2. In Table 2, "_1" refers to the NNM codon with A or C at the third position, and "_2" refers to the NNK codon with G or T at the third position. In addition, the NNM codons cannot cover the entire repertoire of amino acids, since Met or Trp can only be coded for by the codons ATG and TGG, respectively. Thus, some "NNM" sequences also contain some codons that end with G.

[0071] [Table 2-1]

[0072] [Table 2-2]

[0073] [Table 2-3]

[0074] [Table 2-4]

[0075] [Table 2-5]

[0076] [Table 2-6]

[0077] [Table 2-7]

[0078] In one embodiment, the targeting peptide sequence may comprise an amino acid sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of the sequences shown in Table 2.

[0079] In one embodiment, the targeting peptide may comprise four or more consecutive amino acids of any of the targeting peptides disclosed herein. In one embodiment, the targeting peptide may comprise four consecutive amino acids of any of the sequences as shown in Table 2. In one embodiment, the targeting peptide may comprise five consecutive amino acids of any of the sequences as shown in Table 2. In one embodiment, the targeting peptide may comprise six consecutive amino acids of any of the sequences as shown in Table 2.

[0080] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence as shown in any of Table 2.

[0081] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence comprising at least four consecutive amino acids of any of the sequences as shown in any of Table 2.

[0082] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence substantially comprising any of the sequences as set forth in any of Table 2.

[0083] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid polynucleotide having a targeting nucleic acid insert, the targeting nucleic acid insert having a nucleotide sequence substantially comprising any of those shown as Table 2.

[0084] AAV particles of the present disclosure containing a targeting nucleic acid insert may have a polynucleotide sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the parent capsid sequence.

[0085] AAV particles of the present disclosure comprising a targeting peptide insert may have an amino acid sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identical to the parent capsid sequence.

[0086] In any of the DNA and RNA sequences referenced and / or described herein, the single letter symbols have the following explanations: A is adenine; C is cytosine; G is guanine; T is thymine; U is uracil; W is a weak base such as adenine or thymine; S is a strong nucleotide such as cytosine and guanine; M is an amino nucleotide such as adenine and cytosine; K is a keto nucleotide such as guanine and thymine; R is the purines adenine and guanine; Y is the pyrimidines cytosine and thymine; B is any base that is not A (e.g., cytosine, guanine, and thymine); D is any base that is not C (e.g., adenine, cytosine, and thymine); H is any base that is not G (e.g., adenine, cytosine, and thymine); V is any base that is not T (e.g., adenine, cytosine, and guanine); N is any nucleotide (not a gap); and Z is zero.

[0087] In any of the amino acid sequences referenced and / or described herein, the single letter symbols have the following explanations: G (Gly) is glycine; A (Ala) is alanine; L (Leu) is leucine; M (Met) is methionine; F (Phe) is phenylalanine; W (Trp) is tryptophan; K (Lys) is lysine; Q (Gln) is glutamine; E (Glu) is glutamic acid; S (Ser) is serine; P (Pro) is proline; V (Val) is valine; I (Ile) is isoform. Leucine; C (Cys) is cysteine; Y (Tyr) is tyrosine; H (His) is histidine; R (Arg) is arginine; N (Asn) is asparagine; D (Asp) is aspartic acid; T (Thr) is threonine; B (Asx) is aspartic acid or asparagine; J (Xle) is leucine or isoleucine; O (Pyl) is pyrrolysine; U (Sec) is selenocysteine; X (Xaa) is any amino acid; and Z (Glx) is glutamine or glutamic acid.

[0088] Use of targeting peptides in AAV particles The targeting peptide may be an independent peptide or may be inserted or conjugated to a parent sequence, hi one embodiment, the targeting peptide is inserted into the capsid protein of the AAV particle.

[0089] One or more targeting peptides may be inserted into the parent AAV capsid sequence to generate the AAV particles of the present disclosure. The targeting peptide may be inserted into the parent AAV capsid sequence at any position that results in a complete functional AAV particle. The targeting peptide may be inserted into VP1, VP2, and / or VP3. The exact amino acid position of the targeting peptide insertion may not be important because the numbering of amino acid residues varies across AAV serotypes. As used herein, the amino acid positions of the parent AAV capsid sequence are described using AAV9 (SEQ ID NO:2) as reference.

[0090] In one embodiment, targeting peptide is inserted into the hypervariable region of AAV capsid sequence.Non-limiting examples of such hypervariable regions include loop IV and loop VIII of parent AAV capsid.Without wishing to be bound by theory, these surface-exposed loops are unstructured and poorly conserved, making them ideal regions for inserting targeting peptide.

[0091] In one embodiment, the targeting peptide is inserted into loop IV. In another embodiment, the targeting peptide is used to replace part or all of loop IV. As a non-limiting example, the addition of a targeting peptide to a parent AAV capsid sequence may result in the replacement or mutation of at least one amino acid in the parent AAV capsid.

[0092] In one embodiment, the targeting peptide is inserted into loop VIII. In another embodiment, the targeting peptide is used to replace part or all of loop VIII. As a non-limiting example, the addition of a targeting peptide to a parent AAV capsid sequence may result in the replacement or mutation of at least one amino acid in the parent AAV capsid.

[0093] In one embodiment, more than one targeting peptide is inserted into the parent AAV capsid sequence. As a non-limiting example, a targeting peptide may be inserted into both loop IV and loop VIII of the same parent AAV capsid sequence.

[0094] The targeting peptide may be inserted at any amino acid position in the parent AAV capsid sequence, including, but not limited to, between amino acids 586-592, 588-589, 586-589, 452-458, 262-269, 464-473, 491-495, 546-557, and / or 659-668.

[0095] In a preferred embodiment, the targeting peptide is inserted into the parent AAV capsid sequence between amino acids 588 and 589 (loop VIII). In one embodiment, the parent AAV capsid is AAV9 (SEQ ID NO: 2). In a second embodiment, the parent AAV capsid is K449R AAV9 (SEQ ID NO: 3).

[0096] The targeting peptides described herein can increase the transduction of the AAV particles of the present disclosure into a target tissue, as compared to a parent AAV particle lacking a targeting peptide insert. In one embodiment, the targeting peptide increases the transduction of the AAV particles into a target tissue by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500%, or more, as compared to a parent AAV particle lacking a targeting peptide insert.

[0097] In one embodiment, the targeting peptide increases transduction of the AAV particle into cells or tissues of the CNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to a parent AAV particle lacking the targeting peptide insert.

[0098] In one embodiment, the targeting peptide increases transduction of the AAV particle into cells or tissues of the PNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to a parent AAV particle lacking the targeting peptide insert.

[0099] In one embodiment, the targeting peptide increases transduction of AAV particles into cells or tissues of the DRG by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to a parent AAV particle lacking the targeting peptide insert.

[0100] AAV production The virus production disclosed herein describes processes and methods for producing AAV particles (with enhanced, improved, and / or increased tropism for target tissues) that can be used to contact target cells and deliver a payload.

[0101] The present disclosure provides a method for producing AAV particles that contain targeting peptides.In one embodiment, AAV particles are prepared by viral genome replication in viral replicating cells.Any method known in the art can be used to prepare AAV particles.In one embodiment, AAV particles are produced in mammalian cells (e.g., HEK293).In another embodiment, AAV particles are produced in insect cells (e.g., Sf9).

[0102] Methods for making AAV particles are well known in the art and are described, for example, in U.S. Pat. Nos. 6,204,059, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498, and 7,491,50. 8, 5064764, 6194191, 6566118, 8137948; or WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353, and WO2001023597; Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al. et al., J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al. al.), Vir., 219:37-44 (1996); Zhao et al., Vir. 272:382-93 (2000). The contents of each of these references are incorporated herein by reference in their entirety. In one embodiment, the AAV particles are made using the methods described in WO2015191508, the contents of which are incorporated herein by reference in their entirety.

[0103] Therapeutic Applications The present disclosure provides methods for treating a disease, disorder, and / or condition in a mammalian subject, including a human subject, comprising administering to the subject an AAV particle described herein, including a novel capsid defined by the present disclosure ("TRACER AAV particle"), or any of the compositions described herein, including the pharmaceutical compositions described herein.

[0104] In one embodiment, the TRACER AAV particles of the present disclosure are administered to a subject prophylactically to prevent the onset of a disease. In another embodiment, the TRACER AAV particles of the present disclosure are administered to treat (reduce the effects of) a disease or a symptom thereof. In yet another embodiment, the TRACER AAV particles of the present disclosure are administered to cure (eliminate) a disease. In another embodiment, the TRACER AAV particles of the present disclosure are administered to prevent or slow the progression of a disease. In yet another embodiment, the TRACER AAV particles of the present disclosure are administered to treat (reduce the effects of) a disease or a symptom thereof. The AAV particles are used to reverse the deleterious effects of the disease. Disease state and / or progression can be determined or monitored by standard methods known in the art.

[0105] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating neurological diseases and / or disorders. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating tauopathy.

[0106] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Alzheimer's disease. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Friedreich's ataxia or any disease whose underlying cause is loss or partial loss of the frataxin protein.

[0107] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Parkinson's disease. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating amyotrophic lateral sclerosis.

[0108] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Huntington's disease. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating neuropathic pain.

[0109] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating diseases associated with the central nervous system. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating diseases associated with the peripheral nervous system.

[0110] In one embodiment, the TRACER AAV particles of the present disclosure are administered to a subject having at least one of the diseases or conditions described herein. As used herein, any disease associated with the central or peripheral nervous system and their components (eg, neurons) can be considered a "neurological disease."

[0111] Any neurological disease can be treated with the disclosed TRACER AAV particles or pharmaceutical compositions thereof, including, but not limited to, septum pellucidum defect, acid lipase disease, acid maltase deficiency, acquired epileptiform aphasia, acute disseminated encephalomyelitis, attention deficit hyperactivity disorder (ADHD), Adie pupil, Adie syndrome, adrenoleukodystrophy, agenesis of the corpus callosum, agnosia, Aicardi syndrome, Aicardi-Goutières syndrome disorder, AIDS-neurological complications, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angel's disease, Mann's syndrome, angiomatosis, anoxia, antiphospholipid syndrome, aphasia, apraxia, arachnoid cyst, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, Asperger's syndrome, ataxia, ataxia-telangiectasia, ataxia and cerebellar or spinocerebellar degeneration, atrial fibrillation and stroke, attention deficit hyperactivity disorder, autism spectrum disorder, autonomic dysfunction, back pain, Barth syndrome, Batten disease, Becker's myotonia, Behçet's disease, Bell's palsy, benign idiopathic blepharospasm, benign focal muscular atrophy, benign intracranial hypertension, Bernhard-Roth syndrome, Vince's syndrome, Wanger's disease, blepharospasm, Bloch-Sulzberger syndrome, brachial plexus birth trauma, brachial plexus injury, Bradbury-Eggleston syndrome, cerebrospinal tumor, cerebral aneurysm, brain injury, Brown-Séquard syndrome, bulbar palsy, spinal-bulbar muscular atrophy, cerebral autosomal dominant arteriopathy with subcortical infarction and leukoencephalopathy (CADASIL), Canavan disease, carpal tunnel syndrome, causalgia, cavernoma, cavernous hemangioma, cavernous malformation, central cervical spinal cord syndrome, central spinal cord syndrome, central pain syndrome, central pontine myelinolysis, head injury, ceramidase deficiency, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, Brain atrophy, cerebral beriberi, cerebral cavernous malformation, cerebral gigantism, cerebral hypoxia, cerebral palsy, cerebro-oculo-facial-skeletal syndrome (COFS), Charcot-Marie-Tooth disease, Chiari malformation, cholesterol ester storage disease, chorea, choreoacanthocytosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, Cockayne syndrome type II, Coffin-Lowry syndrome, colpocephaly, coma, complex regional pain syndrome, concentric sclerosis (Barrow's disease), congenital bilateral facial nerve palsy, congenital myasthenia,Congenital myopathy, congenital vascular cavernous malformation, corticobasal degeneration, cranial arteritis, craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob disease, chronic progressive external ophthalmoplegia, cumulative traumatic injury, Cushing's syndrome, cytomegalic inclusion disease, cytomegalovirus infection, dancing eyes-dancing feet syndrome, Dandy-Walker syndrome, Dawson's disease, Domorsia syndrome, Dejerine-Klumpke palsy, dementia, multi-infarct dementia, semantic dementia, subcortical dementia, dementia with Lewy bodies, demyelinating diseases, dentatocerebellar ataxia, dentatorubral atrophy, dermatomyositis, developmental dyspraxia, Devic's syndrome, diabetic neuropathy, diffuse sclerosis, distal hereditary motor neuropathy, Dravet syndrome, autonomic neuropathy, dysgraphia, dyslexia , dysphagia, dyspraxia, myoclonic cerebellar dyssynergia, progressive cerebellar dyssynergia, dystonia, early infantile epileptic encephalopathy, empty sella syndrome, encephalitis, encephalitis lethargica, encephalopathy, encephalopathy (familial infantile type), trigeminal region hemangioma, epilepsy, epileptic hemiplegia, paroxysmal ataxia, Erb's palsy, Erb-Duchenne and Degerines-Klumpke palsy, essential tremor, extrapontine myelinolysis Myelinolysis, Faber's disease, Fahr's syndrome, Familial dysautonomia, Familial hemangioma, Familial idiopathic basal ganglia calcification, Familial periodic paralysis, Familial spastic paralysis, Farber's disease, Febrile convulsions, Fischer syndrome, Hypotonic infantile syndrome, Foot drop, Friedreich's ataxia, Frontotemporal dementia, Gaucher's disease, Systemic gangliosidosis (GM1, GM2), Gerstmann's syndrome, Gerstmann-Sträussler-Scheinker disease, Giant axonal neuropathy, Giant cell arteritis, Giant cell inclusion disease, Globoid cell leukodystrophy, Glossopharyngeal neuralgia, Glycogen storage disease, Guillain-Barré syndrome, Hallervorden-Spatz disease, Head trauma, Headache, Persistent migraine, Hemiface spasm, Alternating hemiplegia Alterans), hereditary neuropathies, hereditary spastic paraplegia, hereditary polyneuropathic ataxia, herpes zoster, herpes zoster oticus, Hirayama syndrome, Holmes-Ardie syndrome, holoprosencephaly,HTLV-1-associated myelopathy, Hughes syndrome, Huntington's disease, Hurler syndrome, hydrocephalus, hydrocephalus, normal pressure hydrocephalus, hydromyelopathy, hypercortisolism, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, infantile hypotonia, infantile neuroaxonal dystrophy, infantile phytanic acid storage disease, infantile Refsum's disease, infantile spasms, inflammatory myopathy, foramen occipitalis, intestinal lipodystrophy, intracranial cyst, increased intracranial pressure, Isaacs syndrome, Joubert's disease Lew syndrome, Kearns-Sayre syndrome, Kennedy's disease, Kinsbourne syndrome, Kleine-Levin syndrome, Klippel-Feil syndrome, Klippel-Trenaunay syndrome (KTS), Klüber-Bucy syndrome, Korsakoff amnesic syndrome, Krabbe disease, Kugelberg-Welander disease, Kuru, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral myelopathy syndrome, learning disability, Leigh's disease, Lennox-Gastaut syndrome, Lesson's disease Nyhan syndrome, leukodystrophies, Levine-Critchley syndrome, Lewy body dementia, Lichtheim disease, lipid storage diseases, lipoid proteinosis, lisencephaly, locked-in syndrome, Lou Gehrig's disease, lupus - neurological sequelae, Lyme disease - neurological complications, lysosomal storage disorders, Machado-Joseph disease, megaencephalopathy, megalencephaly, Melkersson-Rosenthal syndrome, meningitis, meningitis and encephalitis, Menkes disease, paresthesia, metachromatic leukodystrophy, microcephaly, ectopic head Pain, Miller Fisher syndrome, mild stroke, mitochondrial myopathy, mitochondrial DNA depletion syndrome, Moebius syndrome, monolimbic muscular atrophy, Morvan syndrome, motor neuron disease, moyamoya disease, mucolipidosis, mucopolysaccharidoses, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy, multiple system atrophy with orthostatic hypotension, muscular dystrophy, congenital myasthenia, myasthenia gravis, diffuse myelinoclastic sclerosis Diffuse Sclerosis), myelitis, myoclonic encephalopathy of infancy, myoclonus, myoclonic epilepsy, myopathy, congenital myopathy, thyrotoxic myopathy, myotonia, myotonia congenita, narcolepsy, NARP (neuropathy, ataxia, and retinitis pigmentosa), neuroacanthocytosis, neurodegeneration with cerebral iron accumulation,Neurodegenerative diseases, Neurofibromatosis, Neuroleptic malignant syndrome, Neurological complications of AIDS, Neurological complications of Lyme disease, Neurological consequences of cytomegalovirus infection, Neurological findings in Pompe disease, Neurological sequelae of lupus, Neuromyelitis optica, Neuromyotonia, Neuronal ceroid lipofuscinosis, Neuronal migration disorder, Neuropathic pain, Hereditary neuropathies, Neuropathies, Neurosarcoidosis, Neurosyphilis, Neurotoxicity, Cavernous nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, Occipital neuralgia, Ohtahara syndrome, Olivopontocerebellar atrophy, Opsoclonus-myoclonus, Orthostatic hypotension, Overuse syndromes, Chronic pain, Pantothenate kinase-associated neurodegeneration, Paraneoplastic syndromes, Paresthesia, Parkinson's disease, Paroxysmal choreoathetosis, Paroxysmal migraine, Parry-Romberg disease, Pelizaeus-Merzbacher disease, Penner-Shocker II syndrome, Perineural cysts, Peroneal muscular atrophy, Periodic paralysis, Peripheral neuropathy, Periventricular leukomalacia, Persistent vegetative state, Pervasive developmental disorder, Phytanic acid storage disease, Pick's disease, Pinched nerve compression Nerve, Piriformis syndrome, Pituitary tumor, Polymyositis, Pompe disease, Porencephaly, Post-polio syndrome, Post-herpetic neuralgia, Post-infectious encephalomyelitis, Postural hypotension, Postural orthostatic tachycardia syndrome, Postural orthostatic tachycardia syndrome, Primary dentate atrophy, Primary lateral sclerosis, Primary progressive aphasia, Prion disease, Progressive bulbar palsy, Progressive facial hemiatrophy, Progressive gait ataxia, Progressive multifocal leukoencephalopathy, Progressive muscular atrophy, Progressive sclerosing poliodystrophy, Progressive supranuclear palsy, Prosopagnosia, Pseudobulbar palsy, Pseudo-Torch syndrome, Pseudotoxoplasmosis syndrome), pseudotumor cerebri, psychogenic movement disorder, Ramsay Hunt syndrome I, Ramsay Hunt syndrome II, Rasmussen's encephalitis, reflex sympathetic dystrophy syndrome, Refsum's disease, infantile Refsum's disease, repetitive movement disorder, motor repetitive strain injury, restless legs syndrome, retroviral-associated myelopathy, Rett's syndrome, Reie's syndrome, rheumatoid encephalitis, Riley-Day syndrome, sacral root cyst, chorea, salivary gland disease, Sandhoff's disease, Schilder's disease, encephalomyelitis, Seitelberger's disease, seizure disorder, semantic dementia, septo-optic dysplasia,Severe Myoclonic Epilepsy of Infancy (SMEI), Shaken Baby Syndrome, Herpes Zoster, Shy-Drager Syndrome, Sjögren's Syndrome, Sleep Apnea, Sleeping Sickness, Sotos Syndrome, Spasticity, Spina Bifida, Spinal Cord Infarction, Spinal Cord Injury, Spinal Cord Tumor, Spinal Muscular Atrophy, Spinocerebellar Ataxia, Spinocerebellar Atrophy, Spinocerebellar Degeneration, Sporadic Ataxia, Steele-Richardson-Olszewski Syndrome, Stiff Personality Syndrome, Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute Sclerosing Panencephalitis, Subcortical Arteriosclerotic Encephalopathy, Short-lasting, Unilateral, Short-lasting, Unilateral, Neuralgiform headache, dysphagia, Sydenham's chorea, syncope, syphilitic spinal sclerosis, syringomyelia, syringomyelia, systemic lupus erythematosus, spinal fistula, tardive dyskinesia, Tarlov's cyst, Tay-Sachs disease, temporal arteritis, tethered spinal cord syndrome, Thomsen myotonia, thoracic outlet syndrome, thyrotoxic myopathy, painful check, Todd's palsy, Tourette's syndrome, transient ischemic attack, transmissible spongiform encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraparesis, Troyer's syndrome, tuberous sclerosis, vascular erectile tumors Tumors), vasculitis syndromes of the central and peripheral nervous system, vitamin B12 deficiency, von Echonomo disease, von Hippel-Lindau disease (VHL), von Recklinghausen disease, Wallenberg syndrome, Wertnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, whiplash injury, Whipple disease, Williams syndrome, Wilson disease, Wollman disease, X-linked spinal and bulbar muscular atrophy.

[0112] Treatment of Neurological Diseases TRACER AAV particles encoding protein payloads The present disclosure provides a method for introducing the TRACER AAV particles of the present disclosure into a cell, comprising introducing any of the vectors into the cell in an amount sufficient to cause increased production of target mRNA and protein. In some embodiments, the cell may be a neuron, such as, but not limited to, a motor neuron, a hippocampal neuron, an entorhinal neuron, a thalamic neuron, a cortical neuron, a sensory neuron, a sympathetic neuron, or a parasympathetic neuron, and a glial cell, such as an astrocyte, a microglia, and / or an oligodendrocyte.

[0113] The present disclosure discloses a method for treating a neurological disease associated with insufficient function / presence of a target protein (e.g., ApoE, FXN) in a subject in need of treatment. The method optionally comprises administering to the subject a therapeutically effective amount of a composition comprising a TRACER AAV particle of the present disclosure. As a non-limiting example, the TRACER AAV particle can increase target gene expression and increase target protein production, thus reducing one or more symptoms of the neurological disease in the subject, and the subject is therapeutically treated.

[0114] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered to the central nervous system of a subject by systemic administration, hi one embodiment, the systemic administration is intravenous injection. In some embodiments, a composition comprising a TRACER AAV particle of the present disclosure is administered to the central nervous system of a subject, hi other embodiments, a composition comprising a TRACER AAV particle of the present disclosure is administered to a CNS tissue of a subject (e.g., the putamen, thalamus, or cortex of a subject).

[0115] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered to the central nervous system of a subject by intraparenchymal injection, non-limiting examples of which include intraputamen, intracortex, intrathalamus, intrastriatum, intrahippocampus, or intraentorhinal cortex.

[0116] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered into the central nervous system of a subject by intraparenchymal and intravenous injection. In one embodiment, the TRACER AAV particles of the present disclosure can be delivered to specific types of targeted cells, including, but not limited to, thalamic neurons, hippocampal neurons, entorhinal neurons, cortical neurons, motor neurons, sensory neurons, excitatory neurons, inhibitory neurons, sympathetic neurons, or parasympathetic neurons; glial cells, including oligodendrocytes, astrocytes, and microglia; and / or other cells that surround neurons, such as T cells.

[0117] In one embodiment, the TRACER AAV particles of the present disclosure can be delivered to neurons in the putamen, thalamus, and / or cortex. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for neurological diseases.

[0118] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for tauopathy. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Alzheimer's disease.

[0119] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for amyotrophic lateral sclerosis. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Huntington's disease.

[0120] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Parkinson's disease. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Friedreich's ataxia.

[0121] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for chronic or neuropathic pain. In one embodiment, administration of the TRACER AAV particles described herein to a subject can increase target protein levels in the subject, including, but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-20%, 30-3 ...100%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30 By way of non-limiting example, the TRACER AAV particles can increase protein levels of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can increase protein levels of a target protein by at least 40%. As a non-limiting example, a subject can exhibit a 10% increase in target protein. As a non-limiting example, TRACER AAV particles can increase protein levels of a target protein by a factor of two from baseline. In one embodiment, TRACER AAV particles bind 5-6 fold higher levels of a target protein.

[0122] In one embodiment, administration of the TRACER AAV particles described herein to a subject can increase expression of a target protein in the subject, including, but not limited to, expression of the target protein in a subject in the CNS, a region of the CNS, or a particular cell of the CNS of the subject, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase expression of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can increase target protein expression by at least 40%.

[0123] In one embodiment, intravenous administration of the TRACER AAV particles described herein to a subject can increase CNS expression of a target protein in the subject, including, but not limited to, increased expression of the target protein in the subject by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-20%, 30-3 ...100%, 30-20%, 30-30%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase expression of a target protein in the CNS by at least 50%. As a non-limiting example, TRACER AAV particles can increase expression of a target protein in the CNS by at least 40%.

[0124] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target protein expression in astrocytes to treat neurological diseases. Target protein expression in astrocytes can be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ... %, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~ 50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 3 0~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%,50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~85%, 60~ It can be increased by 90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0125] In some embodiments, TRACER AAV particles can be used to increase target proteins in microglia. The increase in target proteins in microglia can be independently greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%. 30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~ 95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0126] In some embodiments, TRACER AAV particles can be used to increase target proteins in cortical neurons. Increases in target proteins in cortical neurons can be greater than or equal to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ... ~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50% , 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~ 95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0127] In some embodiments, TRACER AAV particles can be used to increase target proteins in hippocampal neurons. Increases in target proteins in hippocampal neurons can be greater than or equal to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ... ~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50% , 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~ 95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0128] In some embodiments, TRACER AAV particles can be used to increase target proteins in DRG and / or sympathetic neurons. Increases in target proteins in DRG and / or sympathetic neurons can be greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, or greater than 95%, independently. 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%,45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~ It can be increased by 85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0129] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target proteins in sensory neurons to treat neurological diseases. Target proteins in sensory neurons can be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ... %, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~ 50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 3 0~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%,50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~85%, 60~ It can be increased by 90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0130] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target protein and reduce symptoms of a neurological disease in a subject. The increase in target protein and / or reduction in symptoms of a neurological disease can be independently greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-60%, 15-70%, 15-80%, 15-90%, 15-90%, 15-100%, 15 ...40%, 15-50%, 15-50%, 15-60%, 15-60%, 15-70%, 15-80%, 15-90%, 15-90%, 15-90%, 15-100%, 15-20%, 15-30%, 15 %, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40% , 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80% , 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%,50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~85%, 60~90%, 60~95%, 65~75 %, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% alteration (increasing in the case of target protein production or decreasing in the case of neurological disease symptoms),

[0131] In one embodiment, the TRACER AAV particles of the present disclosure can be used to reduce decline in functional capacity and activities of daily living as measured by standard assessment methods, such as, but not limited to, the total functional capacity (TFC) scale.

[0132] In one embodiment, the TRACER AAV particles of the present disclosure can be used to improve the performance of any assay used to measure symptoms of a neurological disease. Such assessments include, but are not limited to, ADAS-cog (Alzheimer's Disease Assessment Scale-cognition), MMSE (Mini-Mental State Examination), GDS (Geriatric Depression Scale), FAQ (Functional Activities Questionnaire), ADL (Activities of Daily Living), GPCOG (General Practitioner Cognitive Assessment), Mini-Cog, AMTS (Abridged Mental Test Score), Clock Drawing Test, 6-CIT (6-item Cognitive Impairment Inventory), TYM (Test Your Memory), MoCa (Montreal Cognitive Assessment), ACE-R (Addenbrooke's Cognitive Assessment), MIS (Memory Impairment Screening), BADLS (Bristol Activities of Daily Living Scale), Barthel Index, Functional Independence Assessment, Instrumental Activities of Daily Living, IQCODE (Informant Questionnaire on Cognitive Decline in the Elderly), Neuropsychiatric Symptom Assessment, The Cohen-Mansfield Agitation Scale Examples of such tests include the BEHAVE-AD Inventory, BEHAVE-AD, EuroQol, Short Form-36, and / or the MBR Caregiver Strain Instrument, or any of the other tests as described in Sheehan B (Ther Adv Neurol Disord. 5(6):349-358 (2012)), the contents of which are incorporated herein by reference in their entirety.

[0133] In some embodiments, the compositions are administered as a monotherapy or combination therapy to treat a neurological disease. The TRACER AAV particles encoding the target protein may be used in combination with one or more other therapeutic agents. "In combination with" does not imply that the agents must be administered at the same time and / or formulated to be delivered together, although such delivery methods are within the scope of this disclosure. The composition may be administered simultaneously with, prior to, or following one or more other desired therapeutic agents or medical procedures. In general, each agent will be administered at a dose and / or time schedule determined for that agent.

[0134] Therapeutic agents that can be used in combination with the TRACER AAV particles of the present disclosure may be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, antiglutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation. As a non-limiting example, the combination therapy may be a combination with one or more neuroprotective agents, such as small molecule compounds, growth factors, and hormones, that have been tested for their neuroprotective effects against motor neuron degeneration.

[0135] Compounds that have been tested to treat neurological diseases that can be used in combination with the TRACER AAV particles described herein include, but are not limited to, the following: cholinesterase inhibitors (donepezil, rivastigmine, galantamine); NMDA receptor antagonists such as memantine; antipsychotics; antidepressants; anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus); secretase inhibitors; amyloid aggregation inhibitors; copper or zinc modulators; BACE inhibitors; methylene blue, phenothiazines, and the like. inhibitors of tau aggregation, such as azines, anthraquinones, n-phenylamines, or rhodamines; microtubule stabilizers, such as NAP, taxol, or paclitaxel; kinase or phosphatase inhibitors, such as those targeting GSK3β (lithium) or PP2A; immunization with Aβ peptides or tau phosphoepitopes; anti-tau or anti-amyloid antibodies; dopamine depleting agents (e.g., tetrabenazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, stiffness, and / or spasticity), muscular relaxants (e.g., baclofen, tizanidine for stiffness and / or spasticity); inhibitors of acetylcholine release at the neuromuscular junction that cause muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia); atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or irritability; risperidone, sulpiride, and haloperidol for psychosis, chorea, and / or irritability; treatment resistance clozapine for sexual psychosis, aripiprazole for psychosis with prominent negative symptoms; selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, obsessive-compulsive behavior, and / or irritability); hypnotics (e.g., xopiclone and / or zolpidem for alterations in the sleep-wake cycle); anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania);as well as mood stabilizers (e.g., lithium for mania or hypomania);

[0136] Neurotrophic factors can be used in combination therapy with the TRACER AAV particles of the present disclosure to treat neurological diseases. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation, and / or maturation of neurons, or stimulate increased activity of neurons. In some embodiments, the method further comprises delivering one or more trophic factors to the subject in need of treatment. Trophic factors can include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, colivelin, xaliproden, thyrotropin releasing hormone, and ADNF, and variants thereof.

[0137] In one embodiment, the TRACER AAV particles described herein are capable of expressing AAV-IGF-I (see, e.g., Vincent et al., Neuromolecular Medicine, 2004, 6, 79-85; the contents of which are incorporated herein by reference in their entirety) and AAV-GDNF (see, e.g., Wang et al. The antibodies can be co-administered with TRACER AAV particles expressing neurotrophic factors, such as ...

[0138] In one embodiment, administration of TRACER AAV particles to a subject will increase expression of a target protein in the subject, and increased expression of the target protein will reduce the effects and / or symptoms of a neurological disease in the subject.

[0139] As a non-limiting example, the target protein may be an antibody or a fragment thereof. TRACER AAV particles containing RNAi agents or regulatory polynucleotides The present disclosure provides a method for introducing into a cell a TRACER AAV particle of the present disclosure, comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, comprising introducing into the cell any of the vectors in an amount sufficient to cause degradation of target mRNA, thereby activating target-specific RNAi in the cell. In some embodiments, the cell may be a neuron, such as, but not limited to, a motor neuron, a hippocampal neuron, an entorhinal neuron, a thalamic neuron, a cortical neuron, a sensory neuron, a sympathetic neuron, or a parasympathetic neuron, as well as a glial cell, such as an astrocyte, a microglia, and / or an oligodendrocyte.

[0140] The present disclosure discloses a method for treating a neurological disease associated with the dysfunction of a target protein in a subject in need of treatment.The method optionally comprises administering to the subject a therapeutically effective amount of a composition comprising a TRACER AAV particle comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules.As a non-limiting example, the siRNA molecule can silence target gene expression, inhibit target protein production, and reduce one or more symptoms of the neurological disease of the subject, and the subject is therapeutically treated.

[0141] In some embodiments, compositions comprising the TRACER AAV particles of the present disclosure, which contain a viral genome encoding one or more siRNA molecules, comprise an AAV capsid that allows for enhanced transduction of CNS and / or PNS cells following intravenous administration.

[0142] In some embodiments, a composition comprising a TRACER AAV particle of the present disclosure having a viral genome encoding at least one siRNA molecule is administered to the central nervous system of a subject. In other embodiments, a composition comprising a TRACER AAV particle of the present disclosure is administered to a tissue of a subject (e.g., the putamen, thalamus, or cortex of a subject).

[0143] In one embodiment, a composition comprising a TRACER AAV particle of the present disclosure, comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, is administered to the central nervous system of a subject by systemic administration. In one embodiment, the systemic administration is an intravenous injection.

[0144] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure, which comprises a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, is administered to the central nervous system of a subject by intraparenchymal injection, non-limiting examples of which include intraputamen, intracortex, intrathalamus, intrastriatum, intrahippocampus, or intraentorhinal cortex.

[0145] In one embodiment, a composition comprising TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, is administered into the central nervous system of a subject by intraparenchymal and intravenous injection.

[0146] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be delivered to specific types or targeted cells, including, but not limited to, thalamic neurons, hippocampal neurons, entorhinal neurons, cortical neurons, motor neurons, sensory neurons, excitatory neurons, inhibitory neurons, sympathetic neurons, or parasympathetic neurons; glial cells, including oligodendrocytes, astrocytes, and microglia; and / or other cells that surround neurons, such as T cells.

[0147] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be delivered to neurons in the putamen, thalamus, and / or cortex.

[0148] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for neurological diseases.

[0149] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for tauopathy.

[0150] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Alzheimer's disease.

[0151] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for amyotrophic lateral sclerosis.

[0152] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Huntington's disease.

[0153] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Parkinson's disease.

[0154] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Friedreich's ataxia.

[0155] In one embodiment, administration of TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules to a subject can reduce target protein levels in the subject, including but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-25%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-10 ...100%, 30-25%, 30-30%, 30- By way of non-limiting example, the TRACER AAV particles can reduce protein levels of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can reduce protein levels of a target protein by at least 40%.

[0156] In one embodiment, administration of TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules to a subject can reduce expression of a target protein in the subject, including, but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-25%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-10 ...100%, 30-25%, 30-30%, By way of non-limiting example, the TRACER AAV particles can reduce expression of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can reduce expression of a target protein by at least 40%.

[0157] In one embodiment, administration of TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules to a subject can reduce expression of a target protein in the CNS of the subject, including, but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-25%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-10 ...100%, 30-25%, 30- By way of non-limiting example, the TRACER AAV particles can reduce expression of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can reduce expression of a target protein by at least 40%.

[0158] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit target proteins in astrocytes to treat neurological diseases. Target proteins in astrocytes can be inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or by greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ...15%, 10-20%, 10-30%, 10-40%, 10-50%, 10-20%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10- %, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~ 40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 3 0~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. Target protein in astrocytes was significantly reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%. %, 5~75%, 5~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~ 40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%,35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80% , 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. ,

[0159] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit target proteins in microglia. Inhibition of target proteins in microglia can be independently determined to be greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 15-30%, 15-40%, 15-50%, 15-60%, 15-60%, 15-70%, 15-80%, 15-90%, 15-90%, 15-100%, 15-100%, 15-20%, 15-30%, 15-40%, 15-50%, 15-50%, 15-60%, 15-60%, 15-70%, 15-80%, 15-90%, 15-100%, 15-100%, 15-20%, 15-30%, 15-30%, 15-40%, 15-40%, 15-50%, 15-50%, 15-60%, 15-60%, 15-70%, 15-80%, 15-90%, 15-100%, 0~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~ 40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75 %, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%,45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80% , 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, and may be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-90%, 5-100%, 5-110%, 5-120%, 5-130%, 5-140%, 5-150%, 5-155%, 5-160%, 5-170%, 5-180%, 5-190%, 5-200%, 5-250%, 5-300%, 5-350%, 5-400%, 5-450%, 5-500%, 5-550%, 5-600%, 5-650%, 5-700%, 5-750%, 5-800%, 5-190%, 5-190%, 5-200%, 5-200%, 5-300%, 5-350%, 5-400%, 5-400%, 5-500%, 5-550%, 5-600%, 5-650%, 5-700%, 5-750%, 5-800%, 5-190%, 5-2000%, 5-2000%, 5-3000%, 5-400%, 5-400%, 5-500%, 5-550%, 0%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55 %, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25 ~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%,35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85 %, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0160] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit target proteins in cortical neurons. Inhibition of target proteins in cortical neurons can be independently 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20 ...30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5- , 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35% , 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70% , 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, and may be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 5-100%, 5-105%, 5-106%, 5-107%, 5-108%, 5-109%, 5-200%, 5-201%, 5-202%, 5-203%, 5-204%, 5-205%, 5-306, 5-357, 5-408, 5-409, 5-501, 5-552, 5-601, 5-652, 5-701, 5-753, 5-109, 5-109, 5-110, 5-111, 5-112, 5-113, 5-114, 5-115, 5-115, 5-116, 5-117, 5-118, 5-119, 5-201, 5-202, 5-203, 5-204, 5-205, 5-306, 5-357, 5-408, 5-409, 5-501, 5-55 ~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 1 5~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~4 5%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%,35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 5 It may be 0 to 85%, 50 to 90%, 50 to 95%, 55 to 65%, 55 to 70%, 55 to 75%, 55 to 80%, 55 to 85%, 55 to 90%, 55 to 95%, 60 to 70%, 60 to 75%, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95%.

[0161] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to suppress target proteins in hippocampal neurons. The suppression of target proteins in hippocampal neurons can be independently 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20 ...30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55 , 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35% , 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70% , 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, and may be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 5-100%, 5-105%, 5-106%, 5-107%, 5-108%, 5-109%, 5-200%, 5-201%, 5-202%, 5-203%, 5-204%, 5-205%, 5-306, 5-357, 5-408, 5-409, 5-501, 5-552, 5-601, 5-652, 5-701, 5-753, 5-109, 5-109, 5-110, 5-111, 5-112, 5-113, 5-114, 5-115, 5-115, 5-116, 5-117, 5-118, 5-119, 5-201, 5-202, 5-203, 5-204, 5-205, 5-306, 5-357, 5-408, 5-409, 5-501, 5-55 ~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 1 5~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~4 5%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%,35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 5 It may be 0 to 85%, 50 to 90%, 50 to 95%, 55 to 65%, 55 to 70%, 55 to 75%, 55 to 80%, 55 to 85%, 55 to 90%, 55 to 95%, 60 to 70%, 60 to 75%, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95%.

[0162] In one embodiment, TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit target proteins in DRGs and / or sympathetic neurons. Inhibition of target proteins in DRGs and / or sympathetic neurons can be, independently, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-100%, 5-150 ... %, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-9 5%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30 ~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%,45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70% , 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, and may be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5- 75%, 5~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45 %, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25 ~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%,35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75 %, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0163] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit target proteins in sensory neurons to treat neurological diseases. Target proteins in sensory neurons can be inhibited by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ...15%, 10-20%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20%, 10-30%, 10-40%, 10-50%, 10-20 %, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~ 40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 3 0~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. Target proteins in sensory neurons are significantly less abundant than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%. %, 5~75%, 5~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~ 40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%,35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80% , 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~85%, 60~90%, 60~95%, 65~75%, 65~80%, 65~85%, 65~90%, 65~95%, 70~80%, 70~85%, 70~90%, 70~95%, 75~85%, 75~90%, 75~95%, 80~90%, 80~95%, or 90~95% can be suppressed. ,

[0164] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to silence target proteins and reduce symptoms of a neurological disease in a subject. The silence of the target protein and / or the reduction of symptoms of a neurological disease can be independently greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-100%, 5-120%, 5-140%, 5-160%, 5-180%, 5-190%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-300%, 5-350%, 5-400%, 5-450%, 5-550%, 5-600%, 5-650%, 5-700%, 5-750%, 5-800%, 5-850%, 5-900%, 5-1000%, 5-1200%, 5-1400%, 5-1600%, 5-1800%, 5-1900%, 5-2100%, 5-2100%, 5-2100%, 5-2100%, 5-2100%, 5-2100%, 5-2100%, 95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20 ~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 3 0~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%,45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75 %, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% can be reduced or inhibited.

[0165] In one embodiment, TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, can be used to reduce decline in functional capacity and activities of daily living as measured by standard assessment methods, such as, but not limited to, the Total Functional Capacity (TFC) scale.

[0166] In some embodiments, the compositions are administered as a monotherapy or combination therapy to treat a neurological disease. TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used in combination with one or more other therapeutic agents. "In combination with" does not imply that the agents must be administered at the same time and / or formulated to be delivered together, although such delivery methods are within the scope of this disclosure. The composition can be administered simultaneously with, prior to, or after one or more other desired therapeutic agents or medical procedures. In general, each agent will be administered at a dose and / or time schedule determined for that agent.

[0167] Therapeutic agents that can be used in combination with TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules may be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation.

[0168] Compounds that have been tested to treat neurological diseases that can be used in combination with TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, include, but are not limited to, the following: cholinesterase inhibitors (donepezil, rivastigmine, galantamine); NMDA receptor antagonists such as memantine; antipsychotics; antidepressants; anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus); secretase inhibitors; amyloid aggregation inhibitors; copper or zinc modulators; BACE inhibitors. inhibitors of tau aggregation such as methylene blue, phenothiazines, anthraquinones, n-phenylamines, or rhodamines; microtubule stabilizing agents such as NAP, taxol, or paclitaxel; kinase or phosphatase inhibitors such as those targeting GSK3β (lithium) or PP2A; immunization with Aβ peptides or tau phosphoepitopes; anti-tau or anti-amyloid antibodies; dopamine depleting agents (e.g., tetrabenazine for chorea); benzodiazepines (e.g., for myoclonus, chorea, diabetic retinopathy, and rhodamine); amino acid precursors of dopamine (e.g., levodopa for stiffness); skeletal muscle relaxants (e.g., baclofen, tizanidine for stiffness and / or spasticity); inhibitors of acetylcholine release at the neuromuscular junction causing muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia); atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or irritability, and acetaminophen for psychosis, chorea, and risperidone, sulpiride, and haloperidol for depression, anxiety, delusional and / or irritability, clozapine for treatment-resistant psychosis, and aripiprazole for psychosis with prominent negative symptoms; selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, delusional and / or irritability); hypnotics (e.g., xopiclone and / or zolpidem for alteration of the sleep-wake cycle);Anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania); and mood stabilizers (e.g., lithium for mania or hypomania).

[0169] Neurotrophic factors can be used in combination therapy with TRACER AAV particles that contain a viral genome with a nucleic acid sequence that encodes one or more siRNA molecules for treating neurological diseases. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation, and / or maturation of neurons, or stimulate increased activity of neurons. In some embodiments, the method further comprises delivering one or more trophic factors to the subject in need of treatment. Trophic factors can include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, colivelin, xaliproden, thyrotropin releasing hormone, and ADNF, and variants thereof.

[0170] In one embodiment, TRACER AAV particles encoding the nucleic acid sequence of at least one siRNA duplex targeting a gene of interest can be co-administered with TRACER AAV particles expressing neurotrophic factors such as AAV-IGF-I (see, e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the contents of which are incorporated herein by reference in their entirety) and AAV-GDNF (see, e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the contents of which are incorporated herein by reference in their entirety).

[0171] In one embodiment, administration of TRACER AAV particles to a subject will reduce expression of a target protein in the subject, and reducing expression of the target protein will reduce the effects and / or symptoms of a neurological disease in the subject.

[0172] definition Adeno-associated virus: As used herein, the term "adeno-associated virus" or "AAV" refers to any member of the Dependovirus genus, including any particle, sequence, gene, protein, or component derived therefrom.

[0173] AAV particle: As used herein, an "AAV particle" is a virus that includes a capsid and a viral genome having at least one payload region and at least one ITR. As used herein, an "AAV particle of the present disclosure" is an AAV particle that includes a parent capsid sequence with at least one targeting peptide insert. The AAV particle of the present disclosure may be recombinantly produced and may be based on an adeno-associated virus (AAV) parent or reference sequence. The AAV particle may be derived from any serotype described herein or known in the art, including combinations of serotypes (i.e., "pseudotyped" AAV), or may be derived from a variety of genomes (e.g., single-stranded or self-complementary). In addition, the AAV particle may be replication-deficient and / or targeted. In one embodiment, the AAV particle may have a targeting peptide inserted into the capsid to enhance tropism for a desired target tissue. Reference to the AAV particle of the present disclosure should be understood to include pharmaceutical compositions thereof, even if not expressly stated.

[0174] Administer: As used herein, the term "administer" refers to providing a pharmaceutical agent or composition to a subject. Amelioration: As used herein, the term "amelioration" or "ameliorating" refers to reducing the severity of at least one indicator of a condition or disease. For example, in the context of a neurodegenerative disorder, amelioration includes reducing neuronal loss.

[0175] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and nematodes. In some embodiments, the animal is a transgenic animal, a genetically modified animal, or a clone.

[0176] Antisense strand: As used herein, the term "antisense strand" or "first strand" or "guide strand" of an siRNA molecule refers to a strand that is substantially complementary to a section of about 10-50 nucleotides, e.g., about 15-30, 16-25, 18-23, or 19-22 nucleotides, of the mRNA of a gene that is targeted for silencing. The antisense strand or first strand has a sequence that is sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., sufficient complementarity to trigger the destruction of the desired target mRNA by an RNAi mechanism or process.

[0177] Approximately: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of a percent of the stated reference value in either direction (greater or smaller), unless otherwise specified or otherwise evident from the context (except where such number would exceed 100% of possible values).

[0178] Capsid: As used herein, the term "capsid" refers to the protein coat of a virus particle. Complementary and Substantially Complementary: As used herein, the term "complementary" refers to the ability of polynucleotides to base pair with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows the formation of a duplex. As those skilled in the art will recognize, when RNA is used rather than DNA, uracil, rather than thymine, is the base that is considered complementary to adenine. However, when U is explicitly stated in the context of this disclosure, the ability to substitute for T is implied unless otherwise stated. Perfect complementarity or 100% complementarity refers to a situation in which each nucleotide unit of one polynucleotide strand can form hydrogen bonds with a nucleotide unit of a second polynucleotide strand. Less than perfect complementarity refers to a situation in which some, but not all, nucleotide units of two strands can form hydrogen bonds with each other. For example, in two 20-mers, if only two base pairs of each strand can form hydrogen bonds with each other, this polynucleotide strand exhibits 10% complementarity.In the same example, if 18 base pairs of each strand can form hydrogen bonds with each other, this polynucleotide strand exhibits 90% complementarity.As used herein, the term "substantially complementary" means that siRNA has sufficient sequence (e.g., in antisense strand) to bind to desired target mRNA and trigger RNA silencing of target mRNA.

[0179] Control element: As used herein, "control element", "regulatory control element" or "regulatory sequence" refers to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like. These provide for the replication, transcription, and translation of coding sequences in recipient cells. Not all of these control elements need always be present, so long as the selected coding sequence is capable of being replicated, transcribed, and / or translated in an appropriate host cell.

[0180] Delivery: As used herein, "delivery" refers to the act or manner of delivering an AAV particle, compound, substance, entity, moiety, cargo, or payload. Element: As used herein, the term "element" refers to a distinct portion of an entity. In some embodiments, an element may be a polynucleotide sequence that has a specific purpose that is incorporated into a longer polynucleotide sequence.

[0181] Encapsulate: As used herein, the term "encapsulate" means to enclose, surround, or encase. As an example, capsid proteins encapsulate the viral genome.

[0182] Engineered: As used herein, embodiments of the present disclosure are "engineered" if they are designed to have characteristics or properties, whether structural or chemical, that are altered from the starting, wild-type, or naturally occurring molecule.

[0183] Effective amount: As used herein, the term "effective amount" of an agent is an amount sufficient to achieve a beneficial or desired result, e.g., a clinical result, and thus the "effective amount" depends on the context in which it is applied. For example, in the context of administering an agent to treat cancer, an effective amount of the agent is an amount sufficient to achieve cancer treatment as defined herein, e.g., compared to the response obtained without administration of the agent.

[0184] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0185] Feature: As used herein, a "feature" refers to a quality, characteristic, or distinctive element. Formulation: As used herein, a "formulation" comprises at least one AAV particle (active ingredient) and excipients and / or inactive ingredients.

[0186] Fragment: "Fragment" as used herein refers to a portion. For example, an antibody fragment may include a CDR, or a heavy chain variable region, or an scFv, etc. Functional: As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0187] Gene expression: The term "gene expression" refers to the process by which a nucleic acid sequence is successfully transcribed and, in most cases, translated to produce a protein or peptide. For clarity, when reference is made to measuring "gene expression", this should be understood to mean that the measurement may be of a nucleic acid transcription product, such as RNA or mRNA, or of an amino acid translation product, such as a polypeptide or peptide. Methods for measuring the amount or level of RNA, mRNA, polypeptides, and peptides are well known in the art.

[0188] Homology: As used herein, the term "homology" refers to the overall relatedness between polymer molecules, such as between polynucleotide molecules (e.g., DNA and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar. The term "homology" necessarily refers to a comparison between at least two sequences (polynucleotide sequences or polypeptide sequences). According to the present disclosure, two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% identical for at least a stretch of at least about 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by their ability to encode a stretch of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by their ability to encode a stretch of at least 4-5 uniquely specified amino acids. According to the present disclosure, two protein sequences are considered to be homologous if the proteins are at least about 50%, 60%, 70%, 80%, or 90% identical over at least one stretch of at least about 20 amino acids.

[0189] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, such as between polynucleotide molecules (e.g., DNA and / or RNA molecules) and / or between polypeptide molecules. For example, the calculation of percent identity of two polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., for optimal alignment, gaps may be introduced in one or both of the first and second nucleic acid sequences, and non-identical sequences may be ignored for comparison purposes). In certain embodiments, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the methods described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Comput ... The sequence of the sequence of the nucleic acid sequence can be determined using methods such as those described in Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991, all of which are incorporated herein by reference in their entireties. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 1989, 4:11-17) incorporated into the ALIGN program (version 2.0), with a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package, with a NWSgapdna.CMP matrix. Commonly used methods for determining percent identity between sequences include, but are not limited to, those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988), which is incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs.Representative computer software for determining homology between two sequences includes, but is not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J. Molec. Biol., 215, 403 (1990)).

[0190] Inhibit expression of a gene: As used herein, the phrase "inhibit expression of a gene" means causing a reduction in the amount of an expression product of a gene. The expression product may be an RNA molecule (e.g., mRNA) transcribed from a gene, or may be a polypeptide translated from an mRNA transcribed from a gene. Typically, a reduction in the level of an mRNA results in a reduction in the level of the polypeptide translated from it. The level of expression can be determined using standard techniques for measuring mRNA or protein.

[0191] Insert: As used herein, the term "insert" can refer to the addition of a targeting peptide sequence to a parent AAV capsid sequence. An "insertion" may result in the replacement of one or more amino acids of the parent AAV capsid sequence. Alternatively, an insertion may not result in any change to the parent AAV capsid sequence, except for the addition of the targeting peptide sequence.

[0192] Inverted terminal repeat: As used herein, the term "inverted terminal repeat" or "ITR" refers to a cis-regulatory element for packaging a polynucleotide sequence into a viral capsid.

[0193] Library: As used herein, the term "library" refers to a diverse collection of linear polypeptides, polynucleotides, viral particles, or viral vectors. By way of example, the library may be a DNA library or an AAV capsid library.

[0194] Neurological disease: As used herein, a "neurological disease" is any disease associated with the central or peripheral nervous system and their components (eg, neurons).

[0195] Naturally-occurring: As used herein, "naturally-occurring" or "wild-type" means occurring in nature, without artificial assistance or the hand of man. Open reading frame: As used herein, "open reading frame" or "ORF" refers to a sequence that does not contain a stop codon in a given reading frame.

[0196] Parent sequence: As used herein, "parent sequence" refers to the nucleic acid sequence or amino acid sequence from which a variant is derived. In one embodiment, the parent sequence is the sequence into which the heterologous sequence is inserted. In other words, the parent sequence can be considered as an acceptor sequence or a recipient sequence. In one embodiment, the parent sequence is the AAV capsid sequence into which the targeting sequence is inserted.

[0197] Particle: As used herein, a "particle" is a virus that is made up of at least two components: a protein capsid and a polynucleotide sequence that is enclosed within the capsid.

[0198] Patient: As used herein, "patient" refers to a subject who may seek or need treatment, who needs treatment, who is receiving treatment, who will be receiving treatment, or who is receiving care for a particular disease or condition by a skilled professional.

[0199] Payload region: As used herein, a "payload region" is any nucleic acid sequence (e.g., in a viral genome) that encodes one or more "payloads" of the present disclosure. As a non-limiting example, the payload region may be a nucleic acid sequence in the viral genome of an AAV particle that encodes a payload, the payload being an RNAi agent or a polypeptide. The payload of the present disclosure may be, but is not limited to, a peptide, a polypeptide, a protein, an antibody, an RNAi agent, and the like.

[0200] Peptide: As used herein, a "peptide" is 50 amino acids or less in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0201] Pharmaceutically acceptable: The phrase "pharmacologically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with the tissues of human beings and animals, within the scope of sound medical judgment, without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable risk-to-benefit ratio.

[0202] Prevent: As used herein, the term "prevent" or "prevention" refers to partially or completely delaying the onset of an infection, disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or clinical manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying the progression from an infection, a particular disease, disorder, and / or condition; and / or reducing the risk of developing a pathology associated with an infection, disease, disorder, and / or condition.

[0203] Prophylactic: As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the spread of disease. Prevention: As used herein, "prevention" refers to measures taken to maintain health and prevent the spread of disease.

[0204] Region: As used herein, the term "region" refers to a band or general area. In some embodiments, when reference is made to a protein or protein module, a region may include a linear sequence of amino acids along the protein or protein module, or may include a three-dimensional area, epitope, and / or cluster of epitopes. In some embodiments, a region includes a terminal region. As used herein, the term "terminal region" refers to a region located at the end or terminus of a given agent. When reference is made to a protein, a terminal region may include the N-terminus and / or C-terminus.

[0205] In some embodiments, when a polynucleotide is referred to, a region may include a linear sequence of nucleic acids along the polynucleotide, or may include a three-dimensional region, secondary structure, or tertiary structure. In some embodiments, a region includes a terminal region. As used herein, the term "terminal region" refers to a region located at the end or terminus of a given agent. When a polynucleotide is referred to, a terminal region may include the 5' end and / or the 3' end.

[0206] RNA or RNA molecule: As used herein, the term "RNA" or "RNA molecule" or "ribonucleic acid molecule" refers to a polymer of ribonucleotides, and the term "DNA" or "DNA molecule" or "deoxyribonucleic acid molecule" refers to a polymer of deoxyribonucleotides. DNA and RNA may be naturally synthesized, for example, by DNA replication and transcription of DNA, respectively, or may be chemically synthesized. DNA and RNA may be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). The term "mRNA" or "messenger RNA" as used herein refers to a single-stranded RNA that codes for the amino acid sequence of one or more polypeptide chains.

[0207] RNA interference or RNAi: As used herein, the term "RNA interference" or "RNAi" refers to a sequence-specific regulatory mechanism mediated by RNA molecules that results in the inhibition or interference or "silencing" of the expression of corresponding protein-coding genes. RNAi has been observed in many types of organisms, including plants, animals, and fungi. RNAi occurs naturally in cells to remove foreign RNA (e.g., viral RNA). Natural RNAi proceeds through fragments that are cleaved from free dsRNA and direct the degradation mechanism to other similar RNA sequences. RNAi is controlled by the RNA-induced silencing complex (RISC) and is initiated in the cytoplasm by short / small dsRNA molecules that interact with the catalytic RISC component Argonaute. dsRNA molecules can be exogenously introduced into cells. Exogenous dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds to and cleaves the dsRNA to produce 21-25 base pair double-stranded fragments with a small number of unpaired overhanging bases at each end. These short double-stranded fragments are called small interfering RNAs (siRNAs).

[0208] RNAi agent: As used herein, the term "RNAi agent" refers to an RNA molecule or derivative thereof that can inhibit, interfere with, or induce "silencing" of the expression of a target gene and / or its protein product. An RNAi agent can knock out (effectively eliminate or eliminate) or knock down (alleviate or reduce) expression. An RNAi agent can be, but is not limited to, dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA.

[0209] Sample: As used herein, the term "sample" or "biological sample" refers to a subset of tissues, cells, or component parts thereof (e.g., bodily fluids, including, but not limited to, blood, serum, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, intra-amniotic cord blood, urine, vaginal fluid, and semen). Samples may further include homogenates, lysates, or extracts prepared from a whole organism, or a subset of its tissues, cells, or component parts, including, but not limited to, for example, plasma, serum, cerebrospinal fluid, lymphatic fluid, outer compartment of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, or fractions or portions thereof. Additionally, a sample refers to a medium, such as a nutrient broth or gel, that may contain cellular components, such as proteins or nucleic acid molecules.

[0210] Self-complementary viral particle: As used herein, a "self-complementary viral particle" is a particle that is composed of at least two components: a protein capsid and a self-complementary viral genome enclosed within the capsid.

[0211] Sense strand: As used herein, the term "sense strand" or "second strand" or "passenger strand" of an siRNA molecule refers to the strand that is complementary to the antisense strand or the first strand. The antisense and sense strands of an siRNA molecule hybridize to form a duplex structure. As used herein, an "siRNA duplex" includes an siRNA strand that has sufficient complementarity to a section of about 10-50 nucleotides of the mRNA of a gene that is targeted for silencing, and an siRNA strand that has sufficient complementarity to form a duplex with the other siRNA strand.

[0212] Similarity: As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, such as between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent similarity of polymer molecules relative to each other can be performed in the same manner as calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as understood in the art.

[0213] Short interfering RNA or siRNA: As used herein, the term "short interfering RNA", "small interfering RNA", or "siRNA" refers to an RNA molecule (or RNA analog) containing about 5-60 nucleotides (or nucleotide analogs) capable of directing or mediating RNAi. Preferably, the siRNA molecule contains about 15-30 nucleotides or nucleotide analogs, such as about 16-25 nucleotides (or nucleotide analogs), about 18-23 nucleotides (or nucleotide analogs), about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs), about 19-25 nucleotides (or nucleotide analogs), and about 19-24 nucleotides (or nucleotide analogs). The term "short" siRNA refers to an siRNA containing 5-23 nucleotides, preferably 21 nucleotides (or nucleotide analogs), such as 19, 20, 21, or 22 nucleotides. The term "long" siRNA refers to siRNA that comprises 24-60 nucleotides, preferably about 24-25 nucleotides, for example, 23, 24, 25, or 26 nucleotides. Short siRNAs may in some cases comprise less than 19 nucleotides, for example, 16, 17, or 18 nucleotides, or may comprise as few as 5 nucleotides. Provided that such shorter siRNAs retain the ability to mediate RNAi. Similarly, long siRNAs may in some cases comprise more than 26 nucleotides, for example, 27, 28, 29, 30, 35, 40, 45, 50, 55, or even 60 nucleotides. Provided that such longer siRNAs retain the ability to mediate RNAi or translational inhibition, and are free of further processing, for example enzymatic processing, to short siRNAs. siRNA may be a single-stranded RNA molecule (ss-siRNA) or a double-stranded RNA molecule (ds-siRNA) comprising a sense strand and an antisense strand that hybridize to form a double-stranded structure called an siRNA duplex.

[0214] Subject: As used herein, the term "subject" or "patient" refers to any organism to which a composition according to the present disclosure can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

[0215] Substantially: As used herein, the term "substantially" refers to a qualitative state of exhibiting the full or nearly full extent or degree of a desired characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go completely to completion and / or proceed to completion, or achieve or avoid an absolute result. Thus, the term "substantially" is used herein to imply that there is an inherent lack of completeness in many biological and chemical phenomena.

[0216] Targeting peptide: As used herein, "targeting peptide" refers to a peptide of 3-20 amino acids in length. Such targeting peptides can be inserted or attached to a parent amino acid sequence to modify the characteristics (e.g., tropism) of the parent protein. As a non-limiting example, a targeting peptide can be inserted into an AAV capsid sequence to enhance targeting to a desired cell type, tissue, organ, or organism. It should be understood that a targeting peptide is encoded by a targeting polynucleotide, which can also be inserted into a parent polynucleotide sequence. Thus, a "targeting sequence" refers to a peptide sequence or polynucleotide sequence for insertion into a suitable parent sequence (amino acid or polynucleotide, respectively).

[0217] Target cell: As used herein, "target cell" or "target tissue" refers to any one or more cells of interest. The cells can be found in vitro, in vivo, in situ, or in a tissue or organ of an organism. The organism can be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[0218] Therapeutic Agent: The term "therapeutic agent" refers to any agent that exerts a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject.

[0219] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a nucleic acid, a drug, a therapeutic agent, a diagnostic agent, a prophylactic agent, etc.) to be delivered that, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, is sufficient to treat, ameliorate the symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is provided in a single dose.

[0220] Therapeutically Effective Outcome: As used herein, the term "therapeutically effective outcome" means an outcome sufficient to treat, ameliorate the symptoms of, diagnose, prevent, and / or delay the onset of an infection, disease, disorder, and / or condition in a subject suffering from or susceptible to the infection, disease, disorder, and / or condition.

[0221] Treat: As used herein, the term "treat" refers to the partial or complete alleviation, amelioration, enhancement, reduction, delay in onset, inhibition of progression, reduction in severity, and / or reduction in incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. For example, "treating" cancer can refer to inhibiting tumor survival, growth, and / or spread. Treatment can be administered to subjects who do not exhibit symptoms of the disease, disorder, and / or condition and / or to subjects who exhibit only early signs of the disease, disorder, and / or condition, with the purpose of reducing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0222] Vector: As used herein, the term "vector" refers to any molecule or moiety that transports, transduces, or otherwise acts as a carrier for a heterologous molecule. In some embodiments, a vector may be a plasmid. In some embodiments, a vector may be a virus. An AAV particle is an example of a vector. The vectors of the present disclosure may be recombinantly produced and may be based on and / or include an adeno-associated virus (AAV) parent or reference sequence. A heterologous molecule may be a polynucleotide and / or a polypeptide.

[0223] Viral genome: As used herein, the term "viral genome" or "vector genome" refers to a nucleic acid sequence encapsulated in an AAV particle. The viral genome includes a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.

[0224] Equivalents and Scope Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments according to the present disclosure described herein. The scope of the present disclosure is not intended to be limited to the above description, but rather is as set forth in the appended claims.

[0225] In the claims, articles such as "a," "an," and "the" can mean one or more than one, unless indicated to the contrary or otherwise evident from the context. A claim or description containing "or" between one or more members of a group is deemed to be satisfied if one, more than one, or all of the group members are present in, used in, or otherwise relevant to a given product or process, unless indicated to the contrary or otherwise evident from the context. The present disclosure includes embodiments in which exactly one member of the group is present in, used in, or otherwise relevant to a given product or process. The present disclosure includes embodiments in which more than one or all of the group members are present in, used in, or otherwise relevant to a given product or process.

[0226] It should also be noted that the term "comprising" is intended to be open-ended, allowing for, but not requiring, the inclusion of additional elements or steps. Thus, when the term "comprising" is used herein, the term "consisting of" is also included and disclosed.

[0227] When ranges are stated, the endpoints are included. Moreover, unless otherwise indicated or apparent from the context and the understanding of one of ordinary skill in the art, it should be understood that values ​​expressed as ranges can assume any specific value or subrange within the ranges set forth in various embodiments of the present disclosure, down to the tenth of the unit of the lower limit of that range, unless the context clearly dictates otherwise.

[0228] In addition, it should be understood that any particular embodiment of the present disclosure that falls within the prior art can be expressly excluded from any one or more of the claims. Such embodiments are considered to be known to those skilled in the art, and therefore can be excluded even if the exclusion is not expressly set forth herein. Any particular embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic agent, or active ingredient; any method of production; any method of use, etc.) may be excluded from any one or more of the claims for any reason, whether or not related to the existence of prior art.

[0229] It is to be understood that the words which have been used are words of description rather than of limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the present disclosure in its broader aspects.

[0230] While the present disclosure has been described in some detail and with a certain degree of specificity with respect to certain described embodiments, it is not intended that the present disclosure should be limited to any such examples or embodiments or to any particular embodiment, but rather should be construed with reference to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art, thus effectively encompassing the intended scope of the present disclosure. (Additional Note) The technical ideas that can be understood from the above-described embodiment and modified examples will be described. [Item 1] 1. A method for producing a variant AAV capsid polypeptide, wherein the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell or tissue specificity compared to a parent AAV capsid polypeptide; (a) generating a library of variant AAV capsid polypeptides, said library comprising: (i) a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids; or (ii) a plurality of capsid polypeptides derived from more than one parent AAV capsid polypeptide; and (b) generating an AAV vector library by cloning the capsid polypeptides of library (i) or (ii) into an AAV vector, wherein the AAV vector comprises a first promoter and a second promoter, and the second promoter drives capsid mRNA expression in the absence of helper virus co-infection. [Item 2] 2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. [Item 3] 2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a cell type specific promoter. [Item 4] 4. The method of claim 2 or claim 3, wherein the promoter is selected from any of those listed in Table 3. [Item 5] The method of claim 4, wherein the ubiquitous promoter or the cell-specific promoter enables expression of an RNA encoding the capsid polypeptide. [Item 6] 6. The method of claim 5, further comprising recovering the RNA encoding the capsid polypeptide and sequencing the capsid polypeptide. [Item 7] The method of claim 6, wherein the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. [Item 8] 8. The method of claim 7, wherein the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglial cell, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatic cell, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte. [Item 9] The method of claim 1, wherein the AAV vector comprises a first promoter and a second promoter, the second promoter being located downstream of a capsid gene and driving its antisense RNA expression in the absence of helper virus co-infection. [Item 10] 10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. [Item 11] 10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter. [Item 12] 12. The method of claim 10 or claim 11, wherein the ubiquitous promoter or the cell-specific promoter allows expression of a gene encoding a capsid polypeptide of a variant AAV in an antisense orientation, resulting in an antisense RNA. [Item 13] 13. The method of claim 12, further comprising recovering the antisense RNA, which can be converted into RNA encoding the variant AAV capsid polypeptide, which is used to sequence the variant AAV capsid polypeptide. [Item 14] The method of claim 13, wherein the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. [Item 15] 15. The method of claim 14, wherein the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglial cell, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatic cell, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

[0231] The present disclosure is further illustrated by the following non-limiting examples. EXAMPLES

[0232] Example 1. TRACER Proof of Concept: Promoter Selection Proof-of-concept experiments were performed by placing genes encoding an AAV9 peptide display capsid library under the control of either the neuron-specific synapsin promoter (SYN) or the astrocyte-specific GFAP promoter. After intravenous administration to C57BL / 6 mice, RNA was collected from brain tissue and used for further library evolution. Next-generation sequencing (NGS) showed sequence convergence between animals after only two rounds of selection. Interestingly, several variants highly similar to the PHP.eB capsid were recovered, suggesting that our method enabled rapid selection of high-performing capsids. A subset of capsids with peptide sequences showing high CNS enrichment were selected for further studies. It is understood that any promoter can be selected depending on the desired tropism. Examples of such promoters are found in Table 3.

[0233] [Table 3-1]

[0234] [Table 3-2]

[0235] [Table 3-3]

[0236] Capsid pools were injected into three rodent species, followed by RNA enrichment analysis to characterize transduction efficiency and cross-species performance in neurons or astrocytes. The top-ranked capsids were then tested individually, with several variants demonstrating similar or even better CNS transduction than the PHP.eB benchmark. These results suggest that the TRACER platform enables rapid in vivo evolution of AAV capsids in non-transgenic animals with a high degree of tropism enhancement. The following examples illustrate these findings in more detail.

[0237] Example 2. Generation of AAV vectors capable of capsid mRNA expression in the absence of helper virus To perform cell-type-restricted and transduction-restricted in vivo evolution of AAV capsid libraries, we engineered a capsid library system in which capsid mutant genes can be transcribed in the absence of helper virus in specific cell types. In wild-type AAV virus, the mRNAs encoding the capsid proteins VP1, VP2, and VP3, as well as the AAP accessory proteins, are expressed by the P40 promoter (Berns et al., 1996), located in the 3' region of the REP gene, which is active only in the presence of REP protein and helper virus functions (Figure 1A). To allow expression of capsid mRNA in animal tissues or cultured cells, another promoter must be inserted upstream or downstream of the CAP gene. Because the packaging capacity of AAV capsids is limited, parts of the REP gene must be deleted to accommodate additional promoter insertions, and the REP gene must be provided in trans by another plasmid to allow virus production. By introducing the CMV promoter at various positions upstream of the CAP gene of AAV9, the minimal viral sequence required for high-titer AAV production was determined (Figure 1B). The REP protein was provided in trans by the pREP2 plasmid, which was obtained by deleting the CAP gene from the REP2-CAP2 packaging vector using EcoNI and ClaI (SEQ ID NO: 4). In a small-scale virus production test, HEK-293T cells grown in DMEM supplemented with 5% FBS and 1x pen / strep were co-transfected with 15ug of pHelper(pFdelta6) plasmid, 10ug of pREP2 plasmid, and 1ug of ITR-CMV-CAP plasmid using calcium phosphate transfection and plated in 15cm dishes. After 72 hours, the cells were harvested by scraping, pelleted by brief centrifugation, and suspended in 1ml of buffer containing 10mM Tris and 2mM MgCl2. The cells were lysed by adding Triton X-100 to a final concentration of 0.1%, and treated with 50 U of benzonase for 1 hour.Virus from the supernatant was precipitated with 8% polyethylene glycol and 0.5M NaCl, suspended in 1 ml of 10 mM TRIS-2 mM MgCl2, and combined with the cell lysate. The pooled virus was adjusted to 0.5M NaCl, clarified by centrifugation at 4,000×g for 15 min, and fractionated at 40,000 prm for 3 h in a stepwise iodixanol gradient of 15%, 25%, 40%, and 60% (Zolotukhin et al., 1999). The 40% fraction containing purified AAV particles was collected, and virus titers were measured by real-time PCR using a Taqman primer / probe mix specific for the 3′ end of the REP shared by all constructs. Although the viral yield was significantly lower (1.7%-8.8%) than the complete wild-type ITR-REP2-CAP9-ITR used as a reference, the CMV-BstEII construct allowed the highest yield of all three CMV constructs. See Figure 2. The CMV-HindIII construct, in which most of the P40 promoter sequence is deleted, gave the lowest yield (1.7% of wtAAV9). This indicates that even the strong CMV promoter cannot replace the P40 promoter without causing a severe drop in viral yield. Following these observations, the BstEII architecture (SEQ ID NO: 5), in which the minimal P40 sequence and the CAP mRNA splice donor are preserved, was used in all further experiments.

[0238] The REP expression plasmid was then improved by preserving the AAP reading frame together with most of the capsid gene from the REP2-CAP9 helper vector, which may contain sequences necessary for regulating CAP transcription and / or splicing. To eliminate the capsid-encoding potential of the vector, the C-terminal fragment of the capsid gene was deleted by triple digestion with MscI restriction enzyme, followed by self-ligation to obtain the pREP-AAP plasmid (Figure 3A, SEQ ID NO: 6).

[0239] The repeat portion of this construct was engineered by introducing premature stop codons immediately after the initiation codons of VP1, VP2, and VP3 without disrupting the amino acid sequence of the AAP reading frame on the same strand (Figure 3A). This construct was named pREP-3stop (SEQ ID NO: 7). The neuron-specific syn-CAP9 vector (SEQ ID NO: 8) was derived from the CMV9-BstEII plasmid by replacing the CMV promoter with the neuron-specific human synapsin 1 promoter.

[0240] The production efficiency of this Syn-CAP9 was tested as described above using pREP, pREP-AAP, or pREP-3stop plasmids to supply REP in trans. As shown in Figure 3B, the REP plasmid harboring a longer capsid sequence as well as AAP increased the virus yield by approximately 3-fold compared to the pREP plasmid. The virus titers obtained with the pREP-AAP or pREP-3stop vectors reached approximately 30% of wild-type AAV9. An important concern with plasmids harboring long homology regions is the possibility of undesired recombination with the ITR-CAP vector, which would reconstitute the wild-type ITR-REP-CAP vector and contaminate the combinatorial library.

[0241] To assess the risk of wild-type virus reconstitution, the virus preparations obtained in Fig. 3B were subjected to real-time PCR with a Taqman probe located at the N-terminus of REP. The percentage of capsids containing detectable full-length REP was less than 0.03% of wild-type virus (Fig. 3C), which was even lower than the routinely detected 0.1% illegitimate REP-CAP packaging that occurred in most recombinant AAV preparations obtained from 293T cell transfection (Fig. 3C, our unpublished observations). Because the premature stop codon in the pREP-3stop vector provided an additional layer of safety against the possibility of wild-type capsid reconstitution and prevented translation of truncated capsid proteins, the 3stop plasmid was used for all subsequent studies.

[0242] Following this, the AAV9 capsid gene was driven by the CMV promoter, synapsin promoter, or subsequently referred to as the GFAP promoter (Brenner et al., 2008). We tested the feasibility of RNA-driven biopanning in C57BL / 6 mice using AAV9 packaging vectors driven by the astrocyte-specific GFabc1D promoter (SEQ ID NO: 9) (Figure 4A). The three vectors were produced in HEK-293T cells as previously described and analyzed by PAGE-silver staining. As shown in Figure 4B, all vectors displayed VP1, VP2, and VP3 capsid proteins in normal ratios, indicating that this particular promoter architecture does not disrupt the balance of capsid protein expression. Six-week-old male C57BL / 6 mice were intravenously injected with 1e12 VG per mouse and sacrificed 28 days later. DNA biodistribution and capsid mRNA expression were examined in brain, liver, and heart tissues.

[0243] Total DNA was extracted from brain, liver, and heart tissues using Qiagen DNeasy blood and tissue columns, and viral DNA was quantified by real-time PCR using a Taqman probe located in the VP3 N-terminal region. DNA abundance was normalized using a predesigned probe detecting the single-copy transferrin receptor gene (Life Technologies ref. 4458366). Viral DNA was highly abundant in liver, but to a lesser extent in heart. DNA distribution did not show any notable differences among the three vectors (Fig. 4C). RNA was extracted with Qiagen RNeasy plus universal kit according to the manufacturer's instructions, treated with ezDNAse (Qiagen) to remove residual DNA, and purified using Superscript Reverse transcription was performed using IV (Life technologies).

[0244] RNA expression was assessed using the same VP3 probe used to quantify viral DNA and normalized using TBP as a reference RNA (Life technologies Mm01277042_m1). In the brain, the GFAP promoter allowed the strongest expression levels, while the synapsin promoter allowed expression comparable to the strong CMV promoter. In the liver, all promoters yielded similar expression levels. This was likely a result of leaky expression being at very high copy number (Figure 4D). In the heart, cell type specificity of the Syn and GFAP promoters was evident as they allowed only approximately 3% and 10% of CMV expression, respectively, despite their similar DNA biodistribution.

[0245] Overall, this experiment demonstrated that mRNA derived from transduction-competent capsids could be recovered from a variety of animal organs, including poorly transduced tissues such as the brain. Example 3. AAV Vector Construction To increase RNA expression and maximize library recovery, various vector configurations were explored. The CMV promoter was replaced with a hybrid CMV enhancer / chicken beta-actin promoter sequence (Niwa et al., 1991), and a strong cytomegalovirus beta-globin hybrid intron from the AAV-MCS cloning vector (Stratagene) was inserted between the promoter sequence and the capsid gene, since introns have been shown to increase mRNA processing and stability (Powell et al., 2015). This resulted in the constructs CAG9 (SEQ ID NO: 10), SYNG9 (SEQ ID NO: 11), and GFAPG (SEQ ID NO: 12).

[0246] To avoid possible interference with the P40 promoter, we also tested an inverted vector arrangement in which a helper-independent promoter was placed in reverse orientation downstream of the capsid gene (Figure 5A). This configuration allows expression of antisense capsid transcripts in animal tissues. Since most polyadenylation signals (AATAAA) are orientation-dependent, we hypothesized that the native AAV capsid polyA, when placed in reverse orientation, would not prematurely terminate transcription. All constructs were co-transfected with pHelper and pREP-3stop plasmids to generate AAV9 packaged virions, which were used to transduce HEK-293T cells at an MOI of 1e4VG per cell. RNA was extracted 48 h after transfection and reverse transcribed using the Quantitect kit (Qiagen).

[0247] PCR was performed with primers that allowed the amplification of the full-length capsid or partial sequences localized near the C-terminus (Figure 5B). Overall, the presence of an intron had little effect on expression from the low activity promoters Syn and GFAP, indicating that mRNA splicing did not relieve promoter repression in non-permissive cells. The combination of the CMV enhancer with the chicken beta-actin promoter and hybrid intron allowed significantly higher (>10-fold) mRNA expression compared to the CMV promoter alone (Figure 5B,C).

[0248] Comparing end-point PCR amplification of the forward and inverted intron vectors, it was clear that there was a mismatch between the full-length and partial capsid amplicons (Figure 5B, right lane), raising doubts about the integrity of the capsid RNA. When primers flanking the full-length capsid were used to amplify cDNA derived from the inverted iCAG9 genome, multiple low molecular weight bands were detected, whereas the forward vector allowed the amplification of a single product with the expected length (Figure 5D). Sanger sequencing of the low molecular weight amplicons showed that each band corresponded to an illegitimate splicing product from the antisense capsid RNA.

[0249] In light of these results, the forward tandem promoter became the architecture for subsequent experiments. To avoid the amplification of residual DNA present in the RNA preparation, splice-specific PCR amplification was tested. Two candidate PCR primers overlapping the CMV / globin inter-exon junction were designed and tested for amplification of cDNA (spliced) or plasmid DNA (still containing intron sequences). As shown in Figure 5E, the GloSpliceF6 primer (SEQ ID NO: 13) allowed completely specific amplification from cDNA without producing detectable amplicons from the plasmid DNA sequence. This primer was used in subsequent assays to confirm the absence of amplification from contaminating DNA.

[0250] The tandem constructs were then tested for the possibility that the P40 promoter might interfere with a cell-specific promoter that was placed upstream. To this end, two sets of AAV genomes were tested for transgene mRNA expression in HEK-293T cells. A set of transgenes in which the GFP gene was placed immediately downstream of the CAG, SYNG, or GFAPG promoter and did not have the P40 sequence were tested and compared to a library construct in which the AAV9 capsid was placed downstream of the P40 promoter (Figure 6A). All genomes were packaged into AAV9 capsids. They were used to infect HEK-293T at an MOI of 1e4VG per cell. 48 hours after infection, RNA was extracted and transgene RNA was quantified by using a Taqman primer / probe mix specific to the spliced ​​globin inter-exon junction. As shown in Figure 6B, expression from the CAG promoter was similar for the GFP and P40-CAP9 constructs (2-fold lower for p40-CAP9, but within the tolerance of AAV titration). Expression from the synapsin promoter was dramatically lower for both constructs, and even lower for the GFAP-driven mRNA (Figure 6B). This was expected, since HEK-293T cells are not permissive for synapsin or GFAP promoter expression. Overall, this experiment confirmed that the presence of the P40 sequence does not alter the cell type specificity of the synapsin or GFAP promoters.

[0251] This novel platform has been named TRACER (Tropism Redirection of AAV by Cell type-specific Expression of RNA). The TRACER platform solves the problems of standard methods, including transduction and cell type restriction. (Figure 7). Use of the TRACER system is well suited for capsid discovery, where targeting peptide libraries are used. Screening of such libraries can be performed as outlined in Figure 8.

[0252] While several variants of AAV vectors that encode capsids as payloads are taught herein, one canonical design is shown in FIG. 9B and FIGS. 12A and 12B.

[0253] Further advantages of the TRACER platform relate to the nature of the viral pool and the recovery of RNA only from fully transduced cells (Figure 10). Consequently, capsid discovery can be accelerated to provide cell- and / or tissue-specific tropism (Figure 11).

[0254] Example 4. Generation and cloning-free amplification of peptide display libraries Several peptide display capsid libraries were generated by inserting seven consecutive randomized amino acids into the surface-exposed hypervariable loop VIII region of AAV5, AAV6, or AAV-DJ8 capsids (Figures 13 and 39) and AAV9 (Figure 14). In the case of the AAV9 library, two additional libraries were modified at the -2, -1, and +1 residues of the insert to match the flanking sequences of the highly neurotrophic PHP.eB vector (Chan et al., 2018). To facilitate the insertion of various loops and prevent contamination with wild-type capsids, a deletion shuttle vector was generated in which the C-terminal region of the capsid gene contained between loop VIII and the stop codon was deleted and replaced with a unique BsrGI restriction site (Figures 15A,B). Degenerate primers containing randomized NNK (K=T or G) sequences capable of encoding all amino acids were synthesized by IDT and used to amplify the missing capsid fragments using gBlock (IDT) double-stranded linear DNA as template (SEQ ID NO: 14, 15, 16, 17). Linear PCR templates were preferred over plasmids to completely prevent possible plasmid carryover contamination in the PCR reaction. Amplicons containing random library sequences (500ng) were inserted into shuttle plasmids linearized with BsrGI (2ug) using 100ul of NEBuilder HiFi DNA Assembly Master Mix (NEB) at 50°C for 30 minutes. 5ul of T5 exonuclease was added to the reaction and digested at 37°C for 30 minutes to eliminate unassembled linear templates. The entire reaction was purified with DNA Clean and Concentrator-5 and quantified with nanodrop to estimate the efficiency of assembly. This method routinely allows for the recovery of 0.5-1 ug of assembly material.

[0255] The gBlock template was engineered by introducing silent mutations to remove unique restriction sites, allowing selective loss of wild-type viral contaminants from the library by restriction enzyme digestion. As an example, the AAV9 gBlock was engineered to remove the BamHI and AfeI sites present in the parent sequence (SEQ ID NO: 17).

[0256] Example 5. Cloning-free amplification Transformation of assembled library DNA into competent bacteria represents a major bottleneck in library diversity, since even highly competent strains rarely yield more than 1e7-1e8 colonies per transformation. In comparison, 100 nanograms of a 6 kilobase plasmid contains 1.5e10 DNA molecules. Thus, bacterial transformation randomly eliminates more than 99% of DNA species in a given pool. We therefore created a cloning-free method that allows for >100-fold amplification of Gibson assembled DNA while circumventing the bottleneck of bacterial transformation (Figure 16). We optimized a protocol based on rolling circle amplification, which allows unbiased exponential amplification of circular DNA templates with extremely low error rates (Hutchinson et al., 2005). One problem with rolling circle amplification is the production of very large (average ~70 kilobases), heavily branched concatemers that must be cleaved into monomers for efficient cell transfection. This process can be accomplished by several methods, for example, by generating open-ended linear templates using restriction enzymes (Hutchinson et al., 2005; Huovinen, 2012) or by generating self-ligated circular templates using CRE-Lox recombination (Huovinen et al., 2011). However, open-ended DNA is susceptible to degradation by cytoplasmic exonucleases, and the CRE recombination method showed relatively low efficiency (our unpublished observations). Therefore, we focused on the use of TelN protelomerase (Rybchin et al., 2002), an enzyme that catalyzes the formation of closed-ended linear "dogbone" DNA monomers (Heinrich et al., 2002) that are highly suitable for mammalian cell transfection. An alternative monomer resolution method based on the use of (K. et al., 1999) was chosen.

[0257] Therefore, to obtain the following plasmid, the protelomerase recognition sequence TATCAGCACACAATTGCCCATTATACGC * GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 176) was introduced outside of both ITRs of all BsrGI shuttle vectors used for capsid library insertion (asterisks depict the position where the two complementary strands are covalently linked to each other): TelN-Syn9-BsrGI (SEQ ID NO: 18), TelN-GFAP9-BsrGI (SEQ ID NO: 19), TelN-Syn5-BsrGI (SEQ ID NO: 20), TelN-GFAP5-BsrGI (SEQ ID NO: 21), TelN-Syn6-BsrGI (SEQ ID NO: 22), TelN-GFAP6-BsrGI (SEQ ID NO: 23), TelN-SynDJ8-BsrGI (SEQ ID NO: 24), TelN-GFAPDJ8-BsrGI (SEQ ID NO: 25). Several methods for rolling circle amplification were tested, with the best results (high yields and low non-specific amplification) being obtained with the TruePrime technology (Expedeon), which relies on primer-free amplification (Picher et al., 2016).

[0258] Briefly, the entire column purified assembly reaction was used in a 900ul TruePrime reaction according to the manufacturer's instructions and incubated overnight at 30°C. The next day, the rolling circle reaction product was incubated at 65°C for 10 minutes to inactivate the enzyme and diluted 5-fold into a 4.5ml reaction with 1x thermoPol buffer with 50ul of protelomerase (NEB). After 1 hour at 30°C, the reaction was heat treated at 70°C for 10 minutes to inactivate the protelomerase and a 4.5ul aliquot was run on an agarose gel. The entire reaction was then purified on multiple (10-12) Qiagen QiaPrep2.0 columns according to the manufacturer's instructions. Typical yields obtained with this method were 160-180ug of DNA. This represents a >100-fold amplification of the starting material (typically 0.5-1ug) and provides enough DNA for the transfection of 200 cell culture dishes (Figure 16).

[0259] The composition of all libraries was tested by next-generation sequencing using the Illumina NextSeq sequencing platform to estimate the number of variants and the final contamination with wild-type virus. Amplicons were generated by PCR with Q5 polymerase (NEB) using primers containing Illumina TruSeq adapters and index barcodes. Amplicons were obtained by low-cycle PCR amplification (15 cycles). They were run on a 3% agarose gel and purified using Zymo gel extraction reagent. Libraries were quantified using Nanodrop, pooled into an equimolar mix, and requantified using the KAPA Library Quantification Kit according to the manufacturer's instructions. Libraries were mixed with 20-40% PhiX control library to increase sequence diversity.

[0260] All DNA libraries generated by rolling circles showed high sequence diversity (typically >1e8 unique variants, which exceeds the limit of NextSeq sequencing). In comparison, plasmid libraries generated by bacterial transformation rarely exceeded 1-2e7 variants.

[0261] Example 6. Prevention and / or reduction of contamination In another embodiment, we created a primer / vector system that aims to completely prevent AAV9 library contamination by wild-type virus that may be recovered from environmental contaminants or naturally infected primate tissues. This is achieved by introducing a maximum number of silent mutations into the sequence surrounding the library insertion site and the sequence immediately preceding the CAP stop codon used in PCR amplification (Figure 17). These libraries show extremely low wild-type AAV9 detection by NGS (<2 AAV9 reads per 5e7 total reads). This suggests that changing the codons surrounding the library amplification and cloning sites is a very efficient way to preserve libraries from environmental or experimental contaminants.

[0262] Libraries were produced as previously described by calcium phosphate transfection of HEK-293T cells, double iodixanol gradient fractionation, and membrane ultrafiltration using a 100,000 Da MWCO Amicon-15 membrane (Millipore), quantified by real-time PCR, and aliquots were used for NGS amplicon generation and NextSeq sequencing. The diversity of the viral libraries was significantly lower than that of the DNA libraries (typically about 1-2e7 unique variants) and showed very strong counterselection of variants containing stop codons (from 20% in the DNA libraries to about 1% in the viral libraries). This clearly indicated a very high percentage of cis packaging, as observed in a previous study (Nonnenmacher et al., 2014).

[0263] Example 7. In vivo selection of AAV9 libraries for mouse brain transduction Then, RNA-driven library selection was developed to increase brain transduction in mouse models. The AAV9 library generated as described above was injected intravenously into male C57BL / 6 mice at a dose of 2e12VG per mouse. Two groups of mice were injected with a single SYN-driven or GFAP-driven library derived from wild-type AAV9 flanking sequences, while two other groups received a pooled library containing wild-type and PHP.eB-derived flanking sequences (Figure 18). One month later, RNA was extracted from 200mg of brain tissue corresponding to a whole hemisphere using the RNeasy Universal Plus procedure (Qiagen). To minimize the possibility of RNA under sampling, the entire RNA preparation (~200ug) was subjected to mRNA enrichment using Oligotex beads (Qiagen) as recommended by the manufacturer. The entire preparation of enriched mRNA (~5ug, representing 2% of total RNA) was then subjected to mRNA enrichment using the following sequences:

[0264] [ka]

[0265] The entire pool of cDNA was then amplified in a 500 ul PCR reaction with 30 cycles of 55° C. annealing temperature and 2 min extension, using Q5 master mix, GloSpliceF6 forward primer, and CAP9 specific reverse primer:

[0266] [ka]

[0267] (The CAP stop codon is underlined.) This method allowed the recovery of large amounts of amplicons from all brain samples (Figure 20). The full-length capsid amplicons were then used as templates for NGS library generation as well as cloned into P1 DNA libraries using the exact same assembly and cloning-free procedures for the next round of biopanning. NGS analysis performed on the PCR amplicons showed that the library diversity was reduced by approximately 25-fold (from 1e7 to 4e5) after the first round of biopanning for both Syn- and GFAP-driven libraries (Figure 21). The number of first passage variants (P1) recovered was too high to show any significant sequence convergence at this point, and there was little overlap between the composition of pools recovered from individual animals. Therefore, a second round of selection was performed. After the second biopanning (P2), the total number of unique variants was further reduced by 4-5-fold to <1e5 peptides. Importantly, some libraries recovered after the first round of biopanning displayed significant counts of wild-type AAV9 and AAV-PHP.eB sequences, likely derived from environmental contaminants, which later served as useful benchmarks for second-round enrichment.

[0268] After RNA was harvested and PCR amplified, a systematic enrichment analysis by NGS was performed by calculating the ratio of P2 / P1 reads and comparing it to the P2 / P1 ratio of AAV9 or PHPeB. As shown in Figure 22, Table 4, Figure 23, and Table 5, several capsids showed higher enrichment ratios than the benchmark PHP.eB in both Syn- and GFAP-driven libraries, and sequence convergence was evident as demonstrated by consensus sequence generation.

[0269] [Table 4-1]

[0270] [Table 4-2]

[0271] [Table 5-1]

[0272] [Table 5-2]

[0273] [Table 5-3]

[0274] Importantly, there was strong sequence convergence between different animals, suggesting that selection was efficient after only two passages. Figures 24 and 25 provide an estimate of brain / liver specificity in the GFAP-AAV9 peptide library candidates.

[0275] Example 8. Multiplexed Selection A subpopulation of variants with promising properties (including but not limited to enrichment factor in more than one mouse, liver detargeting, high counts, etc.) can be selected as shown in FIG. 26 for final multiplexed in vivo screening by pooling individual variants into an equimolar library, and then an equimolar primer pool encoding all 7-mers can be synthesized (microchip solid-phase synthesis, up to 3,800 primers per chip). A limited diversity library can be produced that includes an internal control, such as but not limited to PHP.N, PHP.B, wild-type AAV9 (wtAAV9), and / or any other serotype, including those taught herein. Mice are injected and RNA enrichment is then compared to the internal control in a manner similar to the barcoding studies known in the art and described herein.

[0276] Example 9. Codon optimization Codon variants can be used to improve data strength when using synthetic libraries. A list of NNK codons, NNM codons, and most preferred NNM codons in mammals for various amino acids is provided in Table 6. In Table 6, * means that the NNM codon is not available, ** means "avoid homopolymeric extensions if possible."

[0277] [Table 6]

[0278] To have a balanced library, it is recommended to establish a list of potential candidates and then use Table 6 to establish a pooled primer library containing all peptide variants coded by NNK codons (original from the library) and non-NNK codons (maximum variability). If similar behavior is found between two variants of the same peptide, this will strengthen the analysis of that peptide. In addition, it is recommended to select the most favorable NNM codon (M=A or C).

[0279] Example 10. Library Generation We selected the top 330 peptide variants from the SYN- and GFAP-driven libraries that showed enhanced performance compared to the parental AAV9. De novo libraries with pooled primer synthesis were generated for all 330 peptide sequences plus AAV9, AAV-PHP.B, and AAV-PHP.eB controls (Table 7). To eliminate potential artifacts due to DNA sequence and increase the robustness of the assay, each peptide variant was encoded by two different DNA sequences, one with NNK codons for all amino acids (same as the original library) and one with NNM codons whenever possible (M=C or A, Table 6).

[0280] [Table 7-1]

[0281] [Table 7-2]

[0282] [Table 7-3]

[0283] [Table 7-4]

[0284]

Table 7-5

[0285]

Table 7-6

[0286]

Table 7-7

[0287]

Table 7-8

[0288]

Table 7-9

[0289]

Table 7-10

[0290]

Table 7-11

[0291]

Table 7-12

[0292]

Table 7-13

[0293]

Table 7-14

[0294]

Table 7-15

[0295]

Table 7-16

[0296]

Table 7-17

[0297]

Table 7-18

[0298]

Table 7-19

[0299]

Table 7-20

[0300]

Table 7-21

[0301]

Table 7-22

[0302]

Table 7-23

[0303] Primer pools were produced by Twist biosciences using solid-phase synthesis. They were used to generate a balanced library of 666 nucleotide variants by PCR amplification of the CAP C-terminus and Gibson assembly as described in Figure 27. The 666 primers were provided at 1 fmole each, for a total of 0.6 pmole (regular PCR requires approximately 25 pmoles of primers). Primer-free amplification on the capsid gBlock template was performed for 10 cycles. Forward and reverse primers were added, followed by an additional 10, 15, or 20 PCR cycles. The constructs were then cloned into the AAV9 backbone plasmid by Gibson / RCA (as for regular libraries).

[0304] NGS analysis of SYN- and GFAP-driven AAV libraries produced with pooled DNA showed good correlation between the codon variants of each peptide, suggesting that the DNA sequence itself had little effect on virus production (Figure 28 and Figure 29). Pooled synthetic libraries were injected intravenously into C57BL / 6 mice (5e11VG per mouse, N=9), BALB / C mice (5e11VG per mouse, N=6), and rats (5e12VG per rat, N=6), and after one month of survival, RNA was extracted from brain and spinal cord, and DNA was extracted from liver and heart tissue samples for biodistribution analysis (Figure 30). DNA instead of RNA was analyzed in peripheral organs, since the synapsin and GFAP promoters are not sufficiently active in non-CNS tissues. C57BL / 6 mouse analysis was the initial focus, as this was the mouse strain in which library evolution was performed.

[0305] The enrichment score of each capsid was determined by NGS analysis and defined as the ratio of reads per million (RPM) in the target tissue to the RPM in the inoculum. An example of an analysis performed on a control capsid is shown in Figure 31A. As expected from published data, PHP.B and PHP.eB (aka PHP.N) capsids enabled significantly higher RNA expression in neurons compared to the AAV9 parental capsid (8-fold and 25-fold, respectively). There was a very high correlation between the codon variants of each peptide species in each animal (r = 0.92, 0.93, and 0.95), confirming the robustness of the NGS assay (Figures 31B-D).

[0306] Examples of enrichment analysis are presented in Figures 32A-36. The 333 capsid variants were ranked by the average brain enrichment score across all animals, and individual enrichment values ​​are shown on a color scale. As indicated by the position of the reference capsid, the group of novel variants showed higher enrichment scores than the PHP.eB benchmark capsid in both neurons (Syn-driven) and astrocytes (GFAP-driven). Interestingly, many variants showed different enrichment scores in neurons and astrocytes, as indicated by the moderate level of correlation between Syn-driven and GFAP-driven RNA. This suggests that certain capsids display enhanced tropism for neurons and other capsids display enhanced tropism for astrocytes (Figure 33).

[0307] A group of 38 capsids displayed potentially interesting properties based on their tropism for neurons, astrocytes, or both (Tables 8A and 8B) (Figure 38) and showed strong consensus peptide sequence similarity, which differed between neuronal and astrocyte-targeted variants (Figures 45-C and 46A-B).

[0308] [Table 8]

[0309] [Table 9-1]

[0310] [Table 9-2]

[0311] [Table 9-3]

[0312] Example 11. Phylogenetic grouping Phylogenetic grouping of peptide sequences showed a clear correlation between sequence homology clusters and capsid phenotypes (Figure 37). For example, 9-mer variants with sequence DGTxxxPFK / R (SEQ ID NO: 1181) displayed similar behavior to PHP.eB capsids (high transduction of both neurons and astrocytes), while variants harboring sequence DGTxxxYDS / A (SEQ ID NO: 1182) showed preference for neuronal transduction. In contrast, peptides with consensus DGTxxxxGW (SEQ ID NO: 1183) or CGTxxxPPR / K (SEQ ID NO: 1184) displayed higher tropism for astrocytes.

[0313] Example 12. Capsid Assay Capsid variants representing distinct sequence clusters (highlighted in Figure 37B) were selected for individual transduction analysis in C57BL / 6 mice. Each capsid was produced as a recombinant AAV packaging a self-complementary EGFP transgene driven by a ubiquitous promoter (Figure 49A,B). Groups of mice (N=3) were intravenously injected with 6e10VG and transduction efficiency was assessed one month later by quantifying EGFP mRNA in brain, spinal cord, and liver tissues. EGFP mRNA expression was normalized using mouse TBP as a housekeeping gene, and DNA biodistribution was normalized to the single copy mouse TfR gene (Figure 50A-C). Reverse transcription was performed using the Quantitect kit and included a DNA removal treatment. All capsid variants showed significant enhancement of brain and spinal cord mRNA expression compared to the parental AAV9 capsid, and three of the seven variants (9P16, 9P31, and 9P35) showed similar or higher transduction than the PHP.eB benchmark capsid (Figure 49C, Table 10). Viral DNA biodistribution showed very strong tropism of 9P31 and 9P35 for the brain and spinal cord, while all variants showed a 40- to 260-fold increase in biodistribution compared to AAV9 (Figure 49D, Table 10).

[0314] The expected cell tropism by labeling the neuronal NeuN marker was tested using NGS screening (Figure 51). Within the cortex, the top capsids in the GFAP screen showed predominantly GFP expression in NeuN-negative cells with glial morphology. Conversely, the top capsids in the SYN screen showed very high transduction of NeuN-positive cells, and the bispecific capsids 9P08 and 9P16, which ranked highly in both assays, showed mixed cell preference with multiple NeuN+ and glial cells.

[0315] Cell tropism was also tested using mouse brain microvascular EC (mBMVEC) binding to AAV9, and the results are shown in Table 9.

[0316] [Table 10]

[0317] Fluorescent EGFP expression in whole brain, cerebellum, cortex, and hippocampus tissues revealed transduction patterns across the spectrum, demonstrating tissue-specific capsid discrimination (Figures 52-56).

[0318] Liver transduction, measured by mRNA expression and by total tissue GFP expression, showed that some variants outperformed AAV9, which was unexpected in light of the NGS results. Some variants, such as 9P08 or 9P23, showed relative liver detargeting compared to AAV9 (Figure 57A-B).

[0319] [Table 11]

[0320] Example 13. Multi-rodent study (cross-species) The CNS transduction efficacy of the 333 capsid variants was tested in other rodent strains or species (Figure 47). Side-by-side comparison of neuronal and astrocyte transduction in C57BL / 6 mice, BALB / C mice, and rats showed that there were large differences in the enrichment scores of multiple variants between the two mouse strains, and even more pronounced differences between mice and rats (Figure 48A-C). Surprisingly, the most efficient capsid for rat brain transduction was the parental AAV9. This suggests that directed evolution "bottleneck" capsid variants perform better in one given species, in contrast to the versatility of wild-type AAV capsids.

[0321] Correlation analysis showed that some capsids shared high CNS transduction between C57BL / 6 and BALB / C mice, whereas other capsids were restricted to only one strain (Figure 48B).

[0322] Interestingly, PHP.B and PHP.eB capsids showed poor brain transduction in BALB / C mice, consistent with a recent publication (Hordeaux et al., 2018). Focusing on capsids that showed a >10-fold increase in brain transduction, 62 variants showed improvement only in C57BL / 6 mice, 28 variants showed improvement only in BALB / C mice, and 30 variants showed improved brain transduction in both strains (Table 11). Consensus sequence analysis showed a "C57BL / 6 signature" closely similar to the PHP.eB peptide (DGTxxxPFR (SEQ ID NO: 1185)), whereas the BALB / C signature showed a different consensus (DGTxxxxGW (SEQ ID NO: 1183)). This suggests that different cellular receptors were used (Figure 48C).

[0323] [Table 12-1]

[0324] [Table 12-2]

[0325] [Table 12-3]

[0326] [Table 12-4]

[0327] [Table 12-5]

[0328] The CNS transduction efficacy of 333 capsid variants was also compared in C57BL / 6 mouse BMVECs and human BMVECs (Figures 58A and 58B). Example 14. Engineering an NGS-driven selection system for full-length capsid variants The barcode system was engineered to enable enrichment studies with full capsid length modifications. The TRACER platform described here was initially developed to use peptide display libraries, and although the randomized peptide sequences themselves can be used for Illumina NGS analysis due to their short size, Illumina sequencing techniques typically do not allow for sequencing of more than 300 consecutive bases, and therefore our platform cannot be used for NGS analysis of full-length capsid variants, such as those generated by DNA shuffling techniques or error-prone PCR.

[0329] We designed an alternative RNA-driven platform for full-length capsid libraries in which unique molecular identified (UMI) are located outside the capsid gene and can be used for NGS enrichment analysis (Figure 59A-C). Once variants with the desired properties are identified by UMI enrichment analysis of animal tissues, the UMI sequence should allow highly specific recovery of full-length capsids from the starting material with minimal error rates. To be effective, this system should have one or more of the following properties: 1) the UMI should be transcribed under the control of a cell type-specific promoter; 2) the UMI should not interfere with capsid expression or splicing during virus production; 3) the UMI should be short enough for Illumina NGS sequencing (typically less than 60 nt for standard single-end 75 nt sequencing); and 4) the UMI should allow sequence-specific recovery of the desired full-length capsid from the starting DNA / virus library with minimal error rates.

[0330] To address these properties, 1) UMIs were placed in the transcribed region of the capsid library (i.e., anywhere between the transcription start site and the polyadenylation signal), 2) UMIs were placed either at various positions in the AAV introns (which are rarely spliced ​​in the absence of helper functions) or between the capsid stop codon and the polyadenylation signal, 3) UMI cassettes consisted of two randomized 21 nt sequences separated by a 15 nt spacer, with a total length of 57 nt, allowing for an additional 18 nucleotides for primer annealing, and 4) UMI randomized sequences were formed with NSW triplets (N=A, T, G, C; S=G, C; W=A, T) to prevent large variability in annealing temperatures with the amplification primers, avoid homopolymeric extension, and prevent the formation of a premature polyA signal (AATAAA).

[0331] Importantly, the UMI cassette contained two random sequences in tandem. The first sequence (outermost) is used to design matching capsid recovery primers, and the second sequence (innermost) is used to confirm the identity of the capsid amplicon after cloning. This method should be able to eliminate all clones containing non-specific amplification products. In an alternative embodiment, the innermost sequence can also be used to design nested PCR primers to increase the specificity of the amplification (Figure 59A-C).

[0332] Several insertion sites for tandem barcodes were explored to test the effect on virus viability and titer. A series of constructs were engineered to insert barcodes into the AAV intron of the CAG9 plasmid (Figure 60A). Since the AAV intron is spliced ​​out during virus production, the presence of the barcode should have minimal effect on yield. Conversely, since AAV splicing is highly ineffective in the absence of helper functions (Mouw et al., 2000), the barcode sequence will be preserved in the RNA recovered from animal tissues. All intronic barcode constructs were tested for their ability to produce high titer AAV progeny by co-transfecting them with pHelper and pREP3stop plasmids. All constructs enabled high titer AAV production ranging from 50% to 80% of non-barcoded CAG9 virus (Figure 60B).

[0333] RNA splicing analysis of transfected cells showed that the rate of AAV intron splicing varied slightly between constructs and was more efficient when the intron barcode was inserted after the conserved intervening sequence downstream of the splice donor (Figure 58C, top panel).

[0334] Globin intron splicing was 100% efficient in all conditions tested (Figure 60C, bottom panel). As expected, in the absence of helper function, AAV intron splicing was nearly undetectable.

[0335] An alternative platform was tested in which tandem barcodes were placed between the capsid stop codon and the polyadenylation signal (Figure 59B). Titers generated by the 3' barcoded construct were identical to the non-barcoded CAG9 construct.

[0336] Overall, external barcoding of full-length capsids enables highly efficient AAV production, and the novel tandem barcoding platform enables reliable NGS-driven sequence-specific recovery from library preparations.

[0337] [Table 13-1]

[0338] [Table 13-2]

[0339] [Table 13-3]

[0340] [Table 13-4]

[0341] [Table 13-5]

[0342] [Table 13-6]

[0343] [Table 13-7]

[0344] [Table 13-8]

[0345] [Table 13-9]

[0346]

Table 13-10

[0347]

Table 13-11

[0348]

Table 13-12

[0349]

Table 13-13

[0350]

Table 13-14

[0351]

Table 13-15

[0352]

Table 13-16

[0353]

Table 13-17

[0354]

Table 13-18

[0355]

Table 13-19

[0356]

Table 13-20

[0357]

Table 13-21

[0358]

Table 13-22

[0359]

Table 13-23

[0360]

Table 13-24

[0361]

Table 13-25

[0362]

Table 13-26

[0363]

Table 13-27

[0364]

Table 13-28

[0365] Citations

[0366]

Table 14-1

[0367]

Table 14-2

Claims

1. 1. A method for producing a variant AAV capsid polypeptide, wherein the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell or tissue specificity compared to a parent AAV capsid polypeptide; (a) generating a library of variant AAV capsid polypeptides, said library comprising: (i) a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids; or (ii) multiple capsid polypeptides derived from more than one parent AAV capsid polypeptide. and (b) generating an AAV vector library by cloning the capsid polypeptides of library (i) or (ii) into an AAV vector, wherein the AAV vector comprises a first promoter and a second promoter, and the second promoter drives capsid mRNA expression in the absence of helper virus coinfection.

2. 2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.

3. 2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a cell type specific promoter.

4. 4. The method of claim 2 or claim 3, wherein the promoter is selected from any of those listed in Table 3.

5. The method of claim 4, wherein the ubiquitous promoter or the cell-specific promoter enables expression of an RNA encoding the capsid polypeptide.

6. 6. The method of claim 5, further comprising recovering the RNA encoding the capsid polypeptide and sequencing the capsid polypeptide.

7. The method of claim 6, wherein the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

8. 8. The method of claim 7, wherein the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglial cell, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatic cell, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

9. 2. The method of claim 1, wherein the AAV vector comprises a first promoter and a second promoter, the second promoter being located downstream of a capsid gene and driving its antisense RNA expression in the absence of helper virus coinfection.

10. 10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter.

11. 10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter.

12. The method of claim 10 or claim 11, wherein the ubiquitous promoter or the cell-specific promoter allows expression of a gene encoding a capsid polypeptide of a variant AAV in an antisense orientation, resulting in an antisense RNA.

13. 13. The method of claim 12, further comprising recovering the antisense RNA, which can be converted into RNA encoding the variant AAV capsid polypeptide, which is used to sequence the variant AAV capsid polypeptide.

14. The method of claim 13, wherein the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

15. 15. The method of claim 14, wherein the target cell is a neuron, a neural stem cell, an astrocyte, an oligodendrocyte, a microglial cell, a retinal cell, a tumor cell, a hematopoietic stem cell, an insulin-producing beta cell, a lung epithelial cell, an endothelial cell, a hepatic cell, a skeletal muscle cell, a muscle stem cell, a muscle satellite cell, or a cardiomyocyte.

Images