Biosensor for measuring glucose

Abstract

To provide a biosensor for measuring glucose having excellent reactivity, thermal stability, and substrate-recognition performance to glucose.SOLUTION: A biosensor for measuring glucose comprises an electrode system and an enzyme reaction layer arranged on the electrode system. The enzyme reaction layer includes FAD-binding glucose dehydrogenase and electron acceptor. The FAD-binding glucose dehydrogenase is protein derived from Aspergillus oryzae strain. Specific activity per protein is 300U / mg or more, and an enzymatic activity value to galactose is 5% or less in the case where enzymatic activity to D-glucose is 100%, and is polypeptide including a specific amino acid sequence.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a flavin adenine dinucleotide (FAD)-binding glucose dehydrogenase. A novel gene (polynucleotide) that encodes the gene, and a transformed cell recombined with the gene. A method for producing the enzyme using the above-mentioned method, a recombinant FAD-linked glucose dehydrogenase, and a method for producing the enzyme A method for measuring glucose, a reagent composition for measuring glucose, and a method for measuring glucose This relates to biosensors for course measurement, etc. [Background technology]

[0002] Blood glucose level is an important marker for diabetes. Diabetes tests are performed in hospital laboratories, etc. In addition to clinical testing, simple tests such as simple tests by medical staff and self-tests by patients themselves are also available. Measurements (Point-of-Care Testing: POCT) are being carried out.

[0003] This simple measurement can be performed using glucose diagnostic kits, biosensors, and other measuring devices (POCT devices). However, glucose oxidase has traditionally been used in these POCT devices. However, glucose oxidase is affected by the concentration of dissolved oxygen, leading to errors in the measured values. Therefore, the use of glucose dehydrogenase, which is not affected by oxygen, is recommended.

[0004] Glucose dehydrogenase is a type of enzyme that converts nicotinamide adenine dinucleotide (NAD) or Coenzyme-free type with coenzyme NADP (coenzyme) Glucose dehydrogenase, pyrroloquinoline quinone (PQQ), and flavin adenine dinucleotide There are coenzyme-bound glucose dehydrogenases that use fatty acid dihydrogenase (FAD) as a coenzyme. Coenzyme-bound glucose dehydrogenase has a higher level of contamination than non-coenzyme-bound glucose dehydrogenase. It is less susceptible to the effects of components, has high measurement sensitivity, and, in principle, can be used to develop POCT devices at low cost. It has the advantage that it is possible to manufacture it.

[0005] However, conventional PQQ-linked glucose dehydrogenases have low stability and Maltose is also a strong stimulant for infusions. It is a sugar that is used to make blood sugar when PQQ-linked glucose dehydrogenase reacts with maltose. POCT devices can display higher than actual blood glucose levels, which can lead to unnecessary incidents. As a result of administering insulin injections, hypoglycemia occurs, leading to loss of consciousness and coma, and serious This has become a major problem.

[0006] In particular, the current uses of blood glucose POCT devices are expanding beyond simply measuring blood glucose. It is becoming increasingly important as a means of self-management and treatment for patients, and is used for this purpose. Self-Monitoring of Blood Glucose (SMBG) devices are becoming more and more popular in homes. Since the trend is toward a steady decline, the demand for measurement accuracy is considered to be extremely high.

[0007] In fact, in February 2005, the Ministry of Health, Labor and Welfare of Japan issued a decree on the use of maltose infusion and Icodeki. For patients receiving dialysis fluid containing sulin, A notice was issued calling attention to the use of blood glucose measuring devices using 7th; Yakushoku and Yasuda Notification No. 0207005, etc.).

[0008] On the other hand, it catalyzes the dehydrogenation of glucose and produces coenzyme-bound glucose with FAD as a coenzyme. As for the dehydrogenase, the one derived from Agrobacterium tumefaciens (J. Biol. Chem. (1967) 242: 3665-3672), derived from Cytophaga marinoflava (Appl. Biochem. Biotechnol. (1996) 56: 301 -310), derived from Halomonas sp. α-15 (Enzyme Microb. Technol. (1998) 22 : 269-274), Agar derived from icus bisporus (Arch. Microbiol. (1997) 167:119-125, Appl. Microbiol. Biotechnol (1999)51:58-64) and Macrolepiota rhacodes (Arch. Microbiol.(2001)176:178-186 ) enzymes have been reported, but these enzymes act on the 2- and / or 3-hydroxyl groups of glucose. Both have high activity against maltose and low selectivity against glucose. In addition, Burkholderia cepacia, which also has a high activity against maltose, A coenzyme-linked glucose dehydrogenase derived from Bacillus subtilis cepacia is also known, but this is not the original The native enzyme is a hetero-oligomeric enzyme consisting of three subunits, α, β, and γ, and is membrane-bound. It is known as a synthetic enzyme. Therefore, a solubilization process was required to obtain the enzyme. Therefore, in order to express sufficient activity by cloning, the necessary subunits must be cloned simultaneously. There were issues such as the need to conduct inspections.

[0009] In response to this, the present inventors have developed a novel soluble, non-membrane-bound enzyme that uses FAD as a coenzyme. We have purified a coenzyme-linked glucose dehydrogenase from Aspergillus terreus. The coenzyme-linked glucose dehydrogenase in Patent Document 1 binds to the 1-position of glucose. It oxidizes the hydroxyl groups of β-glucose, has excellent substrate recognition properties for glucose, is not affected by dissolved oxygen, and Also, the activity against maltose is low (activity against maltose when activity against glucose is 100%). The activity against galactose is also less than 5%. It has a certain nature.

[0010] However, the coenzyme-linked glucose dehydrogenase of Patent Document 1 is derived from a wild microorganism. (e.g., Aspergillus spp. microorganisms, etc.) The amount of enzyme produced was limited. In addition, the amount of enzyme produced was extremely small, and a large amount of sugar was reacting with the enzyme. The enzyme is then bound to a "sugar capsule" that is covered with a different type of sugar than the N- or O-glycans that are normally bound to enzymes. The enzyme is in a form that could be called a "buried enzyme," making its activity difficult to detect ( low enzyme activity), the inability to remove glycans enzymatically or chemically, and as a result, In the experiment, the protein was stained by standard protein staining (e.g., Coomassie Brilliant Blue G-250). It is almost unstained, and the amino terminus and internal amino acids of the enzyme, which are necessary for gene acquisition, are Deciphering the sequence from a normal purified enzyme is difficult, but the enzyme gene was successfully cloned. However, there are no known cases in which the expression of this enzyme activity has been confirmed.

[0011] On the other hand, the coenzyme-linked glucose dehydrogenase from Aspergillus oryzae was Its existence was suggested in 1967 (Non-Patent Document 1), but it was only partially enzymatic. Although only the quality of the enzyme was revealed, and its property of not acting on maltose was suggested, However, after that, the coenzyme-linked glucose dehydrogenase from Aspergillus oryzae was used. Detailed reports on the coenzyme-linked glucose dehydrogenases derived from other microorganisms are also available. However, there is no information on the enzyme that oxidizes the 1-hydroxyl group of glucose, and There were no reports whatsoever regarding the amino acid sequence or gene for glucose dehydrogenase.

[0012] In addition, glucose dehydrogenase EC 1.1.99.10 was used for glucose measurement. The idea of ​​using FAD-linked glucose dehydrogenase has been known (see Patent Document 2). It has never been produced at a practical level, and has not yet been used in sensors for practical use. The reason is that the activity of this enzyme inside the bacterial cell is very weak, and even if it is secreted outside the bacterial cell, The amount is extremely small, and because it is covered with a large amount of sugar, its activity is weak, making it difficult to even detect. It is presumed that this was the reason why the gene could not be cloned.

[0013] [Patent Document 1] International Publication No. 2004 / 058958 Brochure [Patent Document 2] Japanese Patent Application Publication No. 59-25700

[0014] [Non-Patent Document 1] Biochem.Biophys.Acta.,139,277-293,1967 Summary of the Invention [Problem to be solved by the invention]

[0015] There are already many genetic engineering methods for modifying PQQ-binding glucose dehydrogenase. Many techniques are known, but these conventional techniques mainly have the low substrate specificity and stability of the enzyme. In order to improve the shortcomings of conventional PQQ-binding glucose dehydrogenase, such as low activity, PQQ-binding glucose dehydrogenase and a modified gene for its genetic engineering Child materials are provided.

[0016] However, modified PQQ-linked glucose dehydrogenases produced using modified genetic material In the case of hydrogen enzyme, the activity of malt when glucose is taken as 100% is still The activity against maltose is generally higher than 10%, or the reactivity against maltose is reduced. As a result, the reactivity (specific activity) to glucose is also reduced, and the substrate is insufficient. When the activity was measured by electrochemical measurement under certain conditions, the function as a glucose sensor was insufficient. However, the reality is that PQQ-linked glycoproteins have not yet been used in POCT devices. The coenzyme PQQ required for the expression of glucose dehydrogenase activity is widely used as a recombinant host. It is not produced in Escherichia coli, but is limited to host microorganisms that produce PQQ (such as Pseudomonas). There was also the problem of having to create recombinant plants using the same technology.

[0017] Therefore, the present invention solves the above problems and provides a method for the preparation of a soluble ... It has excellent FAD binding properties, including excellent specificity and low activity against maltose. A novel gene (polynucleotide) encoding glucose dehydrogenase, A method for producing the enzyme using a transformed cell recombined with the recombinant enzyme, and a method for producing the enzyme using the resulting enzyme A method for measuring glucose, a reagent composition for measuring glucose, and a method for measuring glucose The present invention aims to provide a biosensor for measuring glucose. [Means for solving the problem]

[0018] As a result of intensive research aimed at solving the above problems, the present inventors have discovered that Aspergillus oryzae In order to significantly express FAD-linked glucose dehydrogenase in the Bacillus oryzae strain, The polypeptide encoded by the gene must contain the amino acid sequence (AGVPWV). Furthermore, it was found that the activity was reduced when at least one of the amino acids was deleted. That is, the present invention has the following features: This is related to the above.

[0019] [Aspect 1] Amino acid sequence: X1-X2-X3-X4-X5-X6 (X1 and X2 are aliphatic amino acids, X3 and X6 are branched amino acids, and X4 and X5 are FAD-linked polypeptides containing heterocyclic or aromatic amino acids A polynucleotide encoding glucose dehydrogenase. [Aspect 2] A polynucleotide encoding a polypeptide of the following (a), (b), or (c): D: (a) a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:1; (b) Amino acid sequence (a) in which one or several amino acids are substituted or deleted or a polypeptide having an FAD-linked glucose dehydrogenase activity. Lipeptide, or (c) an amino acid sequence having 70% or more homology with the amino acid sequence (a); and A polypeptide having FAD-binding glucose dehydrogenase activity. [Aspect 3] A polynucleotide of the following (d), (e) or (f): (d) a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3; (e) a polynucleotide having a base sequence complementary to the polynucleotide having the base sequence (d); Hybridization with the oxidase under stringent conditions and FAD-linked glucose deoxyribonuclease A polynucleotide encoding a polypeptide having hydrogenase activity, or (f) a nucleotide sequence having 70% or more homology to a polynucleotide consisting of the nucleotide sequence (d); and encoding a polypeptide having FAD-linked glucose dehydrogenase activity. Polynucleotide. [Aspect 4] Amino acid sequence: A sense primer and an amino acid sequence encoding AGVPWV FAD-linked glucose dehydrogenase from Aspergillus oryzae a reverse primer consisting of the 3'-terminal nucleotide sequence of the encoding polynucleotide; or , amino acid sequence: antisense primer and aspartate for the base sequence encoding AGVPWV The FAD-linked glucose dehydrogenase from Aspergillus oryzae was A forward primer consisting of the 5'-terminal base sequence of the polynucleotide to be read is used. A FAD-linked glucose deoxyribonuclease having a DNA fragment that can be amplified by PCR using a combination of A polynucleotide encoding a polypeptide having hydrogenase activity. [Aspect 5] Amino acid sequence: A probe consisting of a base sequence encoding AGVPWV and a stringent hybridize under favorable conditions and have FAD-linked glucose dehydrogenase activity A polynucleotide encoding a polypeptide. [Aspect 6] When the enzyme activity value for D-glucose is 100%, the enzyme activity value for maltose is The enzyme activity against D-galactose is 10% or less, and the enzyme activity against D-galactose is 5% or less. Aspergillus oryzae-derived FAD-linked glutamate A polynucleotide encoding cose dehydrogenase. [Aspect 7] Aspergillus oryzae, characterized by having an enzyme activity of 300 U / mg or more. Polypeptide encoding FAD-linked glucose dehydrogenase from Aspergillus oryzae nucleotide. [Aspect 8] A recombinant vector carrying the above polynucleotide. [Aspect 9] A transformed cell produced by using the above-mentioned recombinant vector. [Aspect 10] The above-mentioned transformed cell is cultured, and a glucose dehydrogenation enzyme is extracted from the resulting culture. The present invention relates to a method for producing an FAD-linked glucose dehydrogenase having an activity of A method for producing glucose dehydrogenase. [Embodiment 11] A recombinant FAD-linked glycoprotein encoded by the polynucleotide described above. dehydrogenase. [Aspect 12] A glycoprotein characterized by using the above-mentioned FAD-linked glucose dehydrogenase. How to measure the source. [Aspect 13] A glycoprotein characterized by containing the above-mentioned FAD-linked glucose dehydrogenase. A reagent composition for measuring glucose. [Aspect 14] A glucose dehydrogenase comprising the FAD-linked glucose dehydrogenase Biosensor for measuring glucose. Effect of the Invention

[0020] By using the polynucleotide of the present invention, it is possible to obtain a nucleic acid having superior substrate recognition ability for glucose. Moreover, it has the excellent property of being less effective against maltose. For example, it is now possible to produce homogeneous and large amounts of glucose dehydrogenase using recombinant gene technology. It becomes Noh. In addition, the enzyme produced in this way is problematic in FAD-linked glucose dehydrogenase. Since the amount of sugar added can be controlled according to the purpose, it is possible to prepare an enzyme with a reduced sugar content. This can change the effect on the sugar (glucose, etc.) in the sample when measuring blood glucose, etc. It is also possible. [Brief description of the drawings]

[0021] [Figure 1] 1 shows a calibration curve of glucose concentration using an enzyme-immobilized electrode. [Diagram 2] The results of PCR detection of the target gene are shown below. The symbols in the figure are as follows: M: 200bp DNA ladder marker (Takara Bio) 1: Aspergillus oryzae NBRC4268 2: Aspergillus oryzae NBRC5375 3: Aspergillus oryzae NBRC6215 4: Aspergillus oryzae NBRC4181 5: Aspergillus oryzae NBRC4220 6: Aspergillus oryzae NBRC100959 [Diagram 3] The results of detection of the target gene by Southern hybridization are shown. The symbols in the figure are the same as those in Figure 2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The FAD-linked glucose dehydrogenase of the present invention has the amino acid sequence: X1-X2-X3-X4-X5-X6 (X1 and X2 are the same or different aliphatic amino acids, and X3 and X6 are the same or different X4 and X5 are the same or different heterocyclic amino acids or indicates aromatic amino acids), i.e., polypeptides consisting of six amino acids This is one of the technically important points, and for this reason, the enzyme is significantly expressed in the bacterial cell. The expressed enzyme does not necessarily have to be secreted outside the bacterial cell, and may remain within the bacterial cell. In contrast, as specifically shown in the examples of the present specification, the homology of the entire amino acid sequence Even if the gene encodes an enzyme that is considered to be FAD-linked glucose dehydrogenase, A gene that does not code for a polypeptide consisting of the amino acid sequence is an FAD-linked glycoprotein. The recombinant human β-lactamase does not express a protein having α-aspartate dehydrogenase activity.

[0023] The six amino acid sequences are preferably those of a polypeptide that is an FAD-linked glucose dehydrogenase. At least one of X1 to X6 is located at positions 202 to 207 of the peptide, Alanine (A), X2 is glycine (G), X3 is valine (V), X4 is proline (P), and X5 is tryptophan. X6 is valine (V), or X7 is valine (V). :AGVPWV (SEQ ID NO: 4) can be mentioned.

[0024] In the present invention, the term "FAD-linked glucose dehydrogenase" refers to an enzyme that can convert glucose to glucose in the presence of an electron acceptor. It catalyzes the dehydrogenation (oxidation) of the hydroxyl group at the 1-position of glucose, and acts on glucose. The enzyme is a soluble protein having an activity to maltose of 10% or less. Characterized by nature. 1) Flavin adenine dinucleotide (FAD) is a coenzyme. 2) oxygen is not an electron acceptor, and 3) Its activity on maltose is 10% or less than its activity on glucose.

[0025] Among the FAD-linked glucose dehydrogenases of the present invention, those having the amino acid sequence: AGVPWV In particular, those derived from Aspergillus oryzae are preferred. Representative strains include NBRC5375, NBRC5375, and NBRC5375 shown in Table 1 below. 4079 strain, NBRC4203 strain, NBRC4214 strain, NBRC4268 strain, NBRC 5238, NBRC6215, NBRC30104 and NBRC30113 Amino acid sequence: AGVPWV is an enzyme having the amino acid sequence The 202nd to 207th amino acids of the signal sequence (NBRC5 375 strain) (or in the corresponding position for enzymes derived from other strains) Included.

[0026] For example, Aspergillus oryzae NBRC5375 strain expresses The amino acid sequence of the FAD-linked glucose dehydrogenase is SEQ ID NO:1 (including the signal peptide). The base sequence of the chromosomal DNA encoding it is shown in SEQ ID NO:2, and also in SEQ ID NO:1. The cDNA corresponding to the amino acid sequence is shown in SEQ ID NO: 3. The amino acid sequence: The base sequence encoding AGVPWV is GCTGGGTGTTCCATGGGTT (SEQ ID NO: 5). It is.

[0027] Thus, the polynucleotide of the present invention is a polypeptide of Aspergillus oryzae In addition to the above, a polypeptide of (a), (b) or (c) below is also provided: Polynucleotide encoding: (a) a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:1; (b) In the amino acid sequence (a), one to several amino acids are substituted, deleted or added. A polypeptide consisting of an amino acid sequence and having FAD-linked glucose dehydrogenase activity, teeth (c) an amino acid sequence having 70% or more homology with the amino acid sequence (a); and A polypeptide having FAD-linked glucose dehydrogenase activity is included.

[0028] Furthermore, the polynucleotide of the present invention includes a polynucleotide selected from the group consisting of (d), (e) and (f) below: Otiddo: (d) a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3; (e) a polynucleotide having a base sequence complementary to the polynucleotide having the base sequence (d); Hybridization with OD under stringent conditions and FAD-bound glucose dehydration a polynucleotide encoding a polypeptide having enzyme activity; or (f) a nucleotide sequence having 70% or more homology to a polynucleotide consisting of the nucleotide sequence (d); and encoding a polypeptide having FAD-linked glucose dehydrogenase activity. Polynucleotides are included.

[0029] In particular, the polypeptide of (b) or (c) above has the amino acid sequence: X1-X2-X3-X4-X5-X 6, or the polynucleotide of (e) or (f) encodes the amino acid sequence. It is preferable that the amino acid sequence of the nucleic acid sequence is AGVPWV. stomach.

[0030] In the present specification, an amino acid sequence or a base sequence having a homology of 70% or more is It is preferable that the sequence has at least 70% identity over the entire length of the reference sequence to be compared. 75% or more, more preferably 80% or more, even more preferably 90% or more, and particularly preferably The percentage of identity of such sequences is is a publicly available or commercially available software that has an algorithm for comparing a reference sequence to a query sequence. For example, BLAST, FASTA, or G ENETYX (Software Development Co., Ltd.) and other software can be used. can be used as a default parameter.

[0031] Furthermore, the polynucleotide of the present invention comprises a base sequence encoding the amino acid sequence: AGVPWV The sense primer and FAD bond derived from Aspergillus oryzae From the 3'-terminal base sequence of the polynucleotide encoding the combined glucose dehydrogenase or an amplicon for the base sequence encoding the amino acid sequence: AGVPWV. Sense primer and FAD conjugate from Aspergillus oryzae The 5'-terminal base sequence of the polynucleotide encoding glucose dehydrogenase A DNA fragment that can be amplified by PCR using a combination of forward primers A polypeptide encoding a polypeptide having FAD-linked glucose dehydrogenase activity is Contains leotide.

[0032] Alternatively, the polynucleotide of the present invention may be a nucleotide sequence encoding the amino acid sequence: AGVPWV. A probe that hybridizes under stringent conditions and is capable of binding to FAD-binding glutamate. The present invention includes a polynucleotide that encodes a polypeptide having cocos dehydrogenase activity.

[0033] Preferably, the base sequence encoding the amino acid sequence AGVPWV is (GCTGGTGTTCCATGGGTT). In addition, various studies on the above PCR and hybridization under stringent conditions have been carried out. The conditions can be appropriately selected by those skilled in the art in accordance with the description of the Examples in this specification.

[0034] Furthermore, the polynucleotide of the present invention has an enzyme activity value for D-glucose of 100%. In this case, the enzyme activity for maltose is 10% or less, preferably 5% or less, and more preferably Preferably, the enzyme activity for D-galactose is 3% or less, and the enzyme activity for D-galactose is 5% or less, and preferably 3% or less, more preferably 2% or less, and even more preferably 1% or less of FAD-bound glucose. A polynucleotide encoding a saccharide dehydrogenase or a protein having a specific activity of 300 U / mg or more, preferably 500U / mg or more, more preferably 1,000U / mg or more The polynucleotide encoding the FAD-linked glucose dehydrogenase having the enzyme activity In addition, the "specific activity per protein" is, for example, the specific activity per protein as described in Example 7 of the present specification. As described in , the culture supernatant was concentrated and confirmed as a single band by SDS-PAGE. The measurements were taken at .

[0035] In the present invention, the term "polynucleotide" refers to a β-N-saccharide unit in which purine or pyrimidine is linked to sugar. Phosphate esters of glycosidically linked nucleosides (ATP (adenosine triphosphate), G TP (guanosine triphosphate), CTP (cytidine triphosphate), UTP (uridine triphosphate) ); or dATP (deoxyadenosine triphosphate), dGTP (deoxyguanosine triphosphate) dCTP (deoxycytidine triphosphate), dTTP (deoxythymidine triphosphate) )) is a molecule that is bound to more than 100 FAD-linked glucose dehydrogenase. Chromosomal DNA that codes for the mRNA, mRNA that is transcribed from the chromosomal DNA, and This includes cDNA and polynucleotides amplified by PCR using them as templates. "Nucleotide" refers to a molecule in which 2-99 nucleotides are linked together. " refers to 30 amino acids linked together by amide bonds (peptide bonds) or non-natural residue linkages. It means a molecule composed of more than one amino acid residue, and furthermore, a sugar chain is added to these. This includes those that have been artificially chemically modified.

[0036] The most specific embodiment of the polynucleotide (gene) of the present invention is SEQ ID NO: 2 or SEQ ID NO: It is a polynucleotide containing the base sequence of SEQ ID NO: 3. The polynucleotide may be, for example, a chromosomal vector derived from Aspergillus oryzae strain NBRC5375. A DNA library was prepared and the FAD gene was isolated from Aspergillus terreus, which is described in Patent Document 1. The amino acids at the N-terminus and internal sequence of bound glucose dehydrogenase were determined by the Edman method. The amino acid sequence obtained by the determination of the nucleotide sequence and the genome sequence of Aspergillus oryzae were analyzed. As a result of this project, DOGAN (Database of the Genomes Analyzed at NITE) was launched in January 2006. Aspergillus niger published on the website http: / / www.bio.nite.go.jp / dogan / Top Multiple oligonucleotides were created based on the genome sequence information of M. oryzae (NBRC100959 strain). The chromosomal DNA library is then subjected to a PCR reaction using a nucleotide probe by a method known to those skilled in the art. It can be obtained by screening.

[0037] The probe can be labeled by any method known to those skilled in the art, for example, by radioisotope (RI). The method can be performed by RI or non-RI method, but it is preferable to use the non-RI method. Examples of the method include fluorescent labeling, biotin labeling, and chemiluminescence. It is preferable to use a fluorescent substance that can bind to the base portion of an oligonucleotide. A suitable dye may be selected and used, but a cyanine dye (e.g., Cy Dye™ series Cy3, Cy5, etc.), Rhodamine 6G reagent, N-acetoxy-N2-acetylglucosamine Aminofluorene (AAF), AAIF (iodine derivative of AAF), etc. can be used. Cut.

[0038] Alternatively, a polynucleotide that is a cDNA, such as that represented by SEQ ID NO:3, can be used, for example, as described herein. As specifically described in the examples of the present document, a cDNA library was used as a template, and the above The oligonucleotide primer (probe) set thus prepared was used to identify each of the nucleic acid sequences known to those skilled in the art. or extracted from Aspergillus oryzae NBRC5375 strain by seed PCR. It can also be obtained by RT-PCR using total RNA or mRNA as a template. When designing a primer, the size (number of bases) of the primer is determined based on the distance between the primer and the template DNA. Considering the satisfaction of specific annealing, 15-40 bases, preferably 15-30 However, when performing LA (long and accurate) PCR, At least 30 bases are effective. The primers are arranged in such a way that the pair of primers (two ends) do not anneal to each other. Avoid complementary sequences between primers. In addition, ensure stable binding to the template DNA. In order to maintain the GC content, the GC content was set to about 50%, and the primers were made GC-rich or AT- The annealing temperature is set to Tm (melting temperature). Therefore, in order to obtain highly specific PCR products, the Tm values ​​should be close to each other, between 55 and 65°C. In addition, the final concentration of the primers used in PCR is about 0.1 It is also necessary to pay attention to adjusting the concentration to about 1 μM. Commercially available software for this purpose, such as OligoTM [National Bioscience Inc. (USA)] (manufactured by Software Development Co., Ltd.), GENETYX (manufactured by Software Development Co., Ltd.), etc. can also be used.

[0039] In addition, such oligonucleotide probes and oligonucleotide primer sets are For example, the cDNA, which is the polynucleotide of the present invention, is digested with an appropriate restriction enzyme to prepare the cDNA. It is also possible.

[0040] The polynucleotide of the present invention is, for example, the Aspergillus oryzae NBRC5 The FAD-linked glucose dehydrogenase cDNA derived from the 375 strain was It can be prepared by modifying it using the insertion method or the mutagenesis PCR method. From the chromosomal DNA or cDNA libraries of Aspergillus oryzae strains other than the 75 strains, Using oligonucleotides prepared based on the nucleotide sequence information of SEQ ID NO:1 It can be obtained by the probe hybridization method. In the reaction, the stringent conditions are varied to obtain the above polynucleotides. Stringent conditions are used for hybridization and Depending on the salt concentration, organic solvent (formaldehyde, etc.) concentration, temperature conditions, etc. in the cleaning process The method is well known to those skilled in the art, as disclosed in, for example, U.S. Pat. No. 6,100,037. A variety of conditions well known in the art may be employed.

[0041] Further, see the literature (e.g., Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47:411 -418;Adams(1983)J. Am. Chem. Soc. 105:661;Belousov(1997)Nucleic Acid Res. 25:34 40-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemist ry 33:7886-7896; Narang(1979)Meth. Enzymol. 68:90;Brown(1979)Meth. Enzymol. 68:1 09; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Pat. No. 4,458,066). The polynucleotides of the present invention can be synthesized in vitro by well-known chemical synthesis techniques such as It is possible.

[0042] The recombinant vector of the present invention is a cloning vector or an expression vector, An appropriate one is used depending on the type of polynucleotide as a target and the purpose of use. For example, FAD-linked glucose dehydrogenase can be produced by inserting a cDNA or its ORF region. When producing the enzyme, expression vectors for in vitro transcription and E. coli, Bacillus subtilis, etc. are used. Prokaryotic cells, yeast, mold and other filamentous fungi, insect cells, mammalian cells, and other eukaryotic cells A suitable expression vector may also be used.

[0043] The transformed cells of the present invention include, for example, prokaryotic cells such as Escherichia coli and Bacillus subtilis, yeasts, fungi, etc. Eukaryotic cells, such as insect cells and mammalian cells, can be used. The cells were synthesized using a variety of methods, including electroporation, calcium phosphate, liposome, and DEAE-dextran. The preparation can be carried out by introducing a recombinant vector into cells by known methods. As specific examples of recombinant vectors and transformed cells, the recombinant vectors and Examples of the vector include transformed E. coli and transformed fungi.

[0044] The FAD-linked glucose dehydrogenase of the present invention is expressed in a microorganism such as Escherichia coli. For production, an origin, promoter, and ribosome binding site capable of replicating in a microorganism are required. The above-mentioned polynucleotide is inserted into an expression vector having a sequence, a DNA cloning site, a terminator sequence, etc. An expression vector is prepared by recombining nucleotides, and a host cell is transformed with the expression vector. Then, the resulting transformant is cultured to produce FAD-linked glucose dehydrogenase in the microorganism. In this case, the start codon and the stop codon are inserted before and after the arbitrary translation region. By adding and expressing the desired region, a FAD-linked glucose dehydrogenase fragment containing the desired region can be obtained. Alternatively, it can be expressed as a fusion protein with another protein. The desired FAD-linked glutamate can also be obtained by cleaving the fusion protein with an appropriate protease. Cocosyl dehydrogenase can be obtained. Expression vectors for E. coli include pUC series, pBluescriptII, pET expression system, pGEX expression system, pCold Examples include expression systems.

[0045] Alternatively, when FAD-linked glucose dehydrogenase is expressed and produced in eukaryotic cells, The polynucleotide is inserted into a nucleic acid sequence including a promoter, a splicing region, a poly(A) addition site, etc. The recombinant vector is then inserted into a eukaryotic cell. By using the plasmid p53, FAD-linked glucose dehydrogenase can be produced in eukaryotic cells. They can be maintained in the cell in a doped state or integrated into the chromosome. The expression vectors include pKA1, pCDM8, pSVK3, pSVL, and p Examples include BK-CMV, pBK-RSV, EBV vector, pRS, and pYE82. In addition, pIND / V5-His, pFLAG-CMV-2, pEGFP-N1, and pEGFP- By using C1 as an expression vector, various tags such as His tag, FLAG tag, and GFP can be expressed. The FAD-linked glucose dehydrogenase polypeptide is expressed as a fusion protein with a nucleotide sequence. Eukaryotic cells include monkey kidney cells COS-7, Chinese hamster Ovarian cells, CHO and other mammalian cultured cells, budding yeast, fission yeast, mold, silkworm cells, Generally, Xenopus oocytes are used, but Any eukaryotic cell can be used as long as it can express the gene. These include the electroporation method, calcium phosphate method, liposome method, and DEAE dextran method. Methods of knowledge can be used.

[0046] In particular, the FAD-linked glutamate of the present invention derived from Aspergillus oryzae A recombinant vector carrying a polynucleotide encoding cocosyl dehydrogenase, Self-cloning to transform Spergillus oryzae strains is preferred.

[0047] FAD-linked glucose dehydrogenase is expressed in prokaryotic or eukaryotic cells, and then cultured or culture medium or medium composition containing the enzyme secreted outside the cells) For purification, known separation procedures can be combined. For example, urea, etc. Treatment with denaturants or surfactants, heat treatment, pH treatment, ultrasonic treatment, enzyme digestion, salting out or dissolving Solvent precipitation, dialysis, centrifugation, ultrafiltration, gel filtration, SDS-PAGE, isoelectric focusing, Ion exchange chromatography, hydrophobic chromatography, reversed phase chromatography, Affinity chromatography (using tag sequences and FAD-coenzyme-linked glutamate) This includes methods using polyclonal and monoclonal antibodies specific to glucose dehydrogenase. Examples include:

[0048] In addition, the FAD-linked glucose dehydrogenase can be prepared by the polynucleotide (cDNA or The polynucleotides can be obtained by recombinant DNA techniques using the coding region of the polynucleotides. RNA was prepared by in vitro transcription from a vector carrying the nucleotide sequence, and the RNA was used as a template. In vitro translation was performed using the 1H-glycoprotein complex to dehydrate glucose by FAD binding. Alternatively, the polynucleotide can be expressed in a suitable expression vector by a known method. Once recombined into vectors, they can be used in prokaryotic cells such as E. coli and Bacillus subtilis, as well as in yeast, mold, insect cells, and mammalian cells. In a eukaryotic cell, such as a cell line, a polynucleotide encoding FAD-linked glucose dehydrogenase is It is possible to express a large amount of the same amino acid sequence as the host. Polynucleotides with optimized usage may also be introduced. Depending on the need for other peptide modifications, an appropriate host can be selected.

[0049] When FAD-linked glucose dehydrogenase is produced by in vitro expression, The polynucleotide is inserted into a vector having a promoter to which an RNA polymerase can bind. The vector is inserted into the promoter-corresponding RNA In vitro translation of polymerase-containing rabbit reticulocyte lysates and wheat germ extracts When added to a translation system, FAD-linked glucose dehydrogenase can be produced in vitro. The promoters to which RNA polymerase can bind include T3, T7, and SP6. Examples of vectors containing these promoters include pKA1, pCDM8, etc. Examples include pT3 / T718, pT7 / 319, and pBluescriptII.

[0050] The recombinant FAD-linked glucose dehydrogenase of the present invention can be produced by the method described above. Such FAD-linked glucose dehydrogenase can convert glucose into glucose in the presence of an electron acceptor. Since this enzyme catalyzes the dehydrogenation of aldehydes, the changes caused by this reaction can be utilized in many applications. For example, the present invention can be used to measure glucose in a sample containing a biological material. It can be used in the medical and clinical fields as a fixed-use reagent, an eradication reagent, etc. The enzyme can also be used in the production of substances using a bound glucose dehydrogenase.

[0051] The glucose measurement reagent composition of the present invention may be mixed together to form a single reagent, or may be mixed together to form a single reagent. If there are components that interfere with the These may also be prepared as solution or powder reagents, and these may be used for the preparation of the desired compound. The test strips or analytical films are prepared by incorporating the test strips into suitable supports such as filter paper or film. It is also possible to prepare the standard solution containing a deproteinizing agent such as perchloric acid or a glucose quantification agent. Reagents may be included. The amount of enzyme in this composition is about 0.1 to 50 units per sample. The sample for quantifying glucose is, for example, plasma, serum, cerebrospinal fluid, saliva, urine, etc. Examples include:

[0052] The biosensor of the present invention contains the FAD-linked glucose dehydrogenase of the present invention as an enzyme. This is a glucose sensor that is used in the reaction layer to measure the glucose concentration in a sample liquid. For example, A working electrode, a counter electrode, and a reference electrode are printed on an insulating substrate by a method such as screen printing. An electrode system is formed, and a hydrophilic polymer, an oxidoreductase, and an electron acceptor are placed on the electrode system. The biosensor is fabricated by forming an enzyme reaction layer containing When a sample solution containing a substrate is dropped onto the enzyme reaction layer, the enzyme reaction layer dissolves and the enzyme reacts with the substrate. After the enzyme reaction is complete, the reduced electron acceptor is electrochemically The substrate concentration in the sample solution is calculated from the oxidation current value obtained by the biosensor. It is also possible to measure color intensity or pH changes. It is also possible to construct a biosensor that uses this method.

[0053] As the electron acceptor of the biosensor, chemical substances with excellent electron donating and accepting capabilities can be used. Chemical substances with excellent electron transfer ability are generally called "electron carriers" or "mediators." These are chemical substances called "oxidation-reduction mediators" and the following chemical substances are included: For example, electron carriers and redox mediators listed in JP2002-526759 are Specifically, an osmium compound, a quinone compound, a ferricyanide compound, etc. may be used. etc.

[0054] In measuring the activity of FAD-linked glucose dehydrogenase, the enzyme is preferably added at a final concentration of The enzyme is diluted appropriately to 0.1 to 1.0 unit / mL. A catalytic unit is the enzyme activity that oxidizes 1 μmol of glucose per minute. The enzyme activity of the FAD-linked glucose dehydrogenase can be measured by the following method.

[0055] [Enzyme activity measurement method] 0.1M potassium phosphate buffer (pH 7.0) 1.0mL, 1.0M D-glucose 1.0mL, 3mM 2,6-dichlorophenol indophenol (hereafter referred to as DCIP) c) 0.14 mL, 3 mM 1-methoxy-5-methylphenazinium methyl sulfate Add 0.2 mL of ethanol and 0.61 mL of water to a 3 mL quartz cell (optical path length 1 cm) and place in a thermostatic cell holder. After incubating at 37°C for 5 minutes in a spectrophotometer equipped with a chromatograph, 0.05 ml of enzyme solution was added. After adding L, measure the change in absorbance of DCIP at 600 nm (ΔABS / min). The molar extinction coefficient of DCIP at pH 7.0 is 16.3 x 10 3 cm -1 M -1 And then, 1 minute The enzyme activity that reduces 1 μmol of DCIP during this time is essentially equivalent to 1 unit of the enzyme activity. Therefore, the enzyme activity was calculated from the change in absorbance according to the following formula:

[0056]

number

[0057] In measuring the protein concentration of the present enzyme, the enzyme is preferably added at a final concentration of 0.2 to 0.9. The protein concentration in this invention is determined by the method described in the Japanese National Institute of Standards and Technology (JST). Bio-Rad Protein Concentration Kit is available from Bio-Rad. The antibody assay was performed using bovine serum albumin (BSA, Wako The value is calculated by converting from a calibration curve prepared using a standard substance (manufactured by Junyaku Kogyo Co., Ltd., for biochemistry). can be done.

[0058] It should be noted that the various techniques used to implement the present invention are not limited to those specifically cited. A person skilled in the art can easily and reliably carry out the above-mentioned method based on known literature. For example, For genetic engineering and molecular biology techniques, see Sambrook and Maniatis, in Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel, FM et al., Current Protocols in Molecular Biology, John Wiley & Sons, New Yo rk, NY, 1995, or the methods described in the literature cited therein, or methods similar thereto It can be carried out based on substantially the same method or a modified method. Basically, it is based on the IUPAC-IUB Commission on Biochemical Nomenclature. The meanings of the terms are based on the commonly used meanings in the art.

[0059] The present invention will be described in more detail below with reference to examples. The present invention is not limited in any way by the description of the above. The contents of the above mentioned technical data are incorporated herein by reference as part of the disclosure of this specification. EXAMPLES

[0060] (Presumed FAD-linked glucose dehydrogenase from Aspergillus oryzae NBRC5375 strain) Cloning of genes into E. coli (1) Bacterial cell culture Glucose (Nacalai) 1% (W / V), defatted soybeans (Showa Sangyo) 2% (W / V ), corn steep liquor (Sanei Toka Co., Ltd.) 0.5% (W / V), magnesium sulfate A liquid medium consisting of 0.1% (w / v) sorbitol heptahydrate (Nacalai) and water was adjusted to pH 6.0. Prepare the solution, add 100 mL to a 500 mL Sakaguchi flask, and autoclave at 121°C for 20 minutes. In the cooled liquid medium, Aspergillus oryzae was added. The NBRC5375 strain was inoculated and cultured at 28°C for 48 hours with shaking, and then centrifuged. As a result, 15.5 g of wet cells was recovered. (2) FAD-linked glucose dehydrogenase activity of Aspergillus oryzae NBRC5375 gender confirmation The cells obtained in (1) were suspended in 50 mM potassium phosphate buffer (pH 7.5) and mixed with sea sand. The cells were ground using PBS B (Nacalai), centrifuged, and the supernatant was collected to obtain a cell-free extract. . The FAD-linked glucose dehydrogenase activity of the cell-free extract was measured according to the enzyme activity measurement method described above. The results showed that the FAD-linked glucose dehydrogenase activity was 0.0043 U / mL per cell-free extract. Hydrogen enzyme activity was confirmed. (3) Isolation of total RNA 0.31 g of wet cells from the cells obtained in (1) was frozen in liquid nitrogen and then crushed. Total RNA was extracted using ISOGEN (Nippon Gene). (4)RT-PCR RT was performed using the TaKaRa RNA LA PCR Kit (AMV) Ver.1.1 (Takara Bio) under the following conditions: - PCR was performed to identify a gene for approximately 1.8 kbp that was assumed to be FAD-linked glucose dehydrogenase. A PCR product containing the following was obtained. Template: Total RNA extracted in (3) Primer: Primer 1: 5'-tgggatcctatgctcttctcactggcat-3' (SEQ ID NO: 6) Primer 2: 5'-gccaagcttctaagcactcttcgcatcctccttaatcaagtc-3' (SEQ ID NO: 7) Primers 1 and 2 were obtained from the above DOGAN (Database of the Genomes Analyzed at NIT E) Aspergillus oryzae, which is published on the website http: / / www.bio.nite.go.jp / dogan / Top Genetic analysis of R. oryzae NBRC100959 strain AO090005000449 It was synthesized based on the base sequence of (presumed to be "choline dehydrogenase"). The reason is that the FAD-linked glutamate of Aspergillus terreus discovered by the present inventors Based on the base sequence information of the cosyl dehydrogenase gene, the above AO090005000449 was identified as The FAD-linked glucose dehydrogenase gene, but not the phosphorus dehydrogenase gene, of Aspergillus oryzae This is because it was speculated to be an enzyme gene. Reaction conditions: Reverse transcription reaction at 42°C for 30 minutes (1 cycle) Denaturation 99℃, 5 min (1 cycle) Cool at 5℃ for 5 minutes (1 cycle) Denaturation 94℃, 2 min (1 cycle) Denaturation 94℃, 30 seconds, annealing 45℃, 30 seconds, extension reaction 72℃, 1 minute 30 seconds (25 cycle) Extension reaction: 72℃, 5 minutes (1 cycle) (5) Preparation of a plasmid containing a gene encoding a putative FAD-linked glucose dehydrogenase The PCR amplified fragment obtained in (4) was digested with the restriction enzymes BamHI and HindIII. The pUC18 vector (Takara Bio) was treated with restriction enzymes and ligated with DNA Ligation Kit Ver.2.1. (Takara Bio) was used to ligate the enzyme, which is believed to be FAD-linked glucose dehydrogenase. A plasmid containing the gene to be determined was prepared. (6) Preparation of transformants The plasmid obtained in (5) was transformed into E. coli JM109 Competent Cell l (Takara Bio) was transformed with ampicillin sodium (Wako Pure Chemical Industries, Ltd.). After overnight incubation at 37°C on an LB plate containing 100% ethanol, the growth was confirmed by direct PCR. One colony contained a plasmid containing a gene for putative FAD-linked glucose dehydrogenase. Confirm that the gene has been introduced and then transform the plasmid on an LB plate containing sodium ampicillin. A substitute was obtained. EXAMPLES

[0061] (Presumed FAD-linked glucose dehydrogenase from Aspergillus oryzae NBRC5375 strain) Cloning of the gene into Aspergillus oryzae (1) Extraction of chromosomal DNA 0.25 g of the wet cells obtained in Example 1(1) was frozen in liquid nitrogen and then powdered. The cells were crushed and chromosomal DNA was extracted by standard methods. (2) Cloning of a putative FAD-linked glucose dehydrogenase gene The host used was the Aspergillus oryzae NS4 strain. As mentioned in reference 1 (Biosci. Biotech. Biochem., 61(8), 1367-1369, 1997), It was developed at the Brewing Research Institute in 1999 and is being used to analyze transcription factors and breed strains that produce high amounts of various enzymes. The material has been published and is available for sale. For this strain, the publicly known literature 2 (Heterologous gene expression system of the Aspergillus genus, Toshiki Minetoki, Chemistry and Biology Amylase derived from Aspergillus oryzae described in (J. Biotech., 38, 12, pp. 831-838, 2000) The improved promoter of the system was used, and the chromosomal DNA obtained in (1) was used as a template downstream of it. , DOGAN (Database of the Genomes Analyzed at NITE) (Website AO090005000449, published at http: / / www.bio.nite.go.jp / dogan / Top The following primers were synthesized based on the base sequence: 1. gene1F: 5'-(acgcgtcgac) tgaccaattccgcagctcgtcaaa atgctcttctcactggcattcctga-3' (SEQ ID NO:8 ) 2. gene1R: 5'-(gtg)ctaagca ctcttcgcat cctccttaat caagtcgg-3' (SEQ ID NO: 9) (F is the 5' side, R is the 3' side, in parentheses: restriction enzyme cleavage site, underlined: enoA 5'-UTR, others: ORF ) The gene for putative FAD-linked glucose dehydrogenase was amplified using Thus, a vector capable of expressing this gene was prepared. Transformation was basically performed according to the method described in the prior art 2 and 3 (Gene manipulation technology of sake koji mold, Transformants were obtained by carrying out the method described in (Aji Katsuya, Jyokyo, pp. 494-502, 2000). Comparative Example

[0062] (Presumed FAD-linked glucose dehydrogenase from Aspergillus oryzae NBRC100959 strain) Cloning of the gene (AO090005000449) into Aspergillus oryzae (1) Bacterial cell culture Glucose 1% (W / V), defatted soybeans 2% (W / V), corn steep liquor 0.5 % (W / V), magnesium sulfate heptahydrate 0.1% (W / V), and water. The pH was adjusted to 6.0, and 100 mL was placed in a 500 mL Sakaguchi flask and heated at 121°C for 20 The liquid medium was then autoclaved for 1 min. After cooling, Aspergillus oryzae NBRC The 100959 strain was inoculated and cultured at 28°C for 48 hours with shaking. A total of 10.5 g of the body was recovered. (2) Extraction of chromosomal DNA 0.31 g of wet cells from the cells obtained in (1) was frozen in liquid nitrogen and then crushed. Chromosomal DNA was extracted by standard methods. (3) A putative FAD-linked glucose dehydrogenase gene (AO09000500044 Cloning of 9 genes The host used was the Aspergillus oryzae NS4 strain. As described in Reference 1, it was developed at the Brewing Research Institute in 1997, and the analysis of transcription factors and various It is used for breeding high-yielding enzyme strains, and is available for sale. For this strain, the amylase derived from Aspergillus oryzae, which is described in the public literature 2, The improved promoter of the system was used, and the chromosomal DNA obtained in (2) was used as a template below it. The FAD bond amplified using the primers (SEQ ID NO: 8 and SEQ ID NO: 9) used in Example 2 was The gene (AO090005000449 gene) predicted to be a combined glucose dehydrogenase By ligating the two genes, a vector capable of expressing the gene was prepared. Transformation should be carried out essentially according to the methods described in the prior art 2 and 3. Transformants were obtained. EXAMPLES

[0063] (Verification of gene sequence) (1) FAD-linked glutamate from Aspergillus oryzae NBRC5375 in recombinant E. coli Sequence of the putative cocos dehydrogenase gene Aspergillus oryzae NBRC5375 strain in the recombinant E. coli obtained in Example 1 The results of sequencing the gene putatively encoding FAD-linked glucose dehydrogenase are shown in SEQ ID NO: The sequence of SEQ ID NO: 3 and the FAD-linked glucose dehydrogenase in the comparative example are shown in FIG. The cD sequence of the gene (AO090005000449) excluding introns When comparing the NA sequences, when the initiation base A of AO090005000449 was set as the first base, The sequence from 604 to 606 ATG of Aspergillus oryzae NBRC The gene for the putative FAD-linked glucose dehydrogenase derived from the 5375 strain is shown in SEQ ID NO:5. The sequence identified was GCTGGTGTCCATGGGTT, and the other sequences were a perfect match. The translated amino acid sequence is shown in SEQ ID NO:1. The 202nd M in 05000449, which is the first amino acid, is Aspergillus A putative FAD-linked glucose dehydrogenase gene from S. oryzae NBRC5375 The amino acid sequence encoded by this is the sequence AGVPWV shown in SEQ ID NO: 4. The columns matched perfectly. (2) FAD-linked glycoprotein derived from Aspergillus oryzae NBRC5375 strain in recombinant fungus Sequence of the putative glucose dehydrogenase gene The recombinant fungus Aspergillus oryzae NBRC5375 strain F obtained in Example 2 The sequence of the gene putatively encoding AD-linked glucose dehydrogenase was determined and the result is shown in SEQ ID NO:2. The sequence of SEQ ID NO: 2 and the sequence of the presumed FAD-linked glucose dehydrogenase in the comparative example are shown in FIG. When comparing the base sequence of the gene (AO090005000449) When the starting base A of 5000449 is counted as the first base, the 656th to 658th bases are ATG. The sequence is that of Aspergillus oryzae NBRC5375 FAD-linked glucose dehydrogenase. The putative gene had the sequence GCTGGGTGTTCCATGGGTT shown in sequence number 5. The translated amino acid sequence is shown in SEQ ID NO:1. 20 when the starting amino acid M of 05000449 (presumed choline dehydrogenase) is taken as the first amino acid The second M is a FAD-linked glucose dehydrogenase derived from Aspergillus oryzae NBRC5375. The amino acid sequence encoded by the putative hydrogenase gene is AGVPWV shown in SEQ ID NO:4. The other sequences were identical.

[0064] (Gene sequence comparison) From the above results, the strains of Examples 1 and 2 and the strain of the Comparative Example were found to be capable of FAD-linked glucose dehydrogenation. The genes that are presumed to be enzymes have similar gene sequences, but the A in Examples 1 and 2 The gene sequence derived from the Spergillus oryzae NBRC5375 strain was derived from the comparative strain. Compared with the upcoming gene sequence of AO090005000449, the 656th to 658th positions The ATG sequence is GCTGGTGTCCATGGGTT as shown in SEQ ID NO:5. In addition, the amino acid sequence was compared, and the amino acid M at the 202nd position was found to be identical to that of AGVPWV shown in SEQ ID NO:4. It was found that this was the case. EXAMPLES

[0065] (Comparison with genetic level analysis) (1) Confirmation by Southern blotting DNA was extracted from the wet cells cultured based on the strains obtained in Example 2 and Comparative Example by a standard method. A part of the gene assumed to be FAD-linked glucose dehydrogenase was used as a probe to detect the Detection was by Xanthium blotting. As a result, the amylase system derived from Aspergillus oryzae was improved in both strains. DNA containing a gene for a putative FAD-linked glucose dehydrogenase gene bound to a good promoter The fragments were found to be present in comparable copy numbers. In other words, the strains obtained in Example 2 and Comparative Example had similar levels of It was found to contain a number of copies of the gene. (2) Confirmation by Northern blotting RNA was extracted from the wet cells cultured based on the strains obtained in Example 2 and Comparative Example by a standard method. The gene for this FAD-linked glucose dehydrogenase was used as a probe to detect the Detection was performed by immunoblotting. As a result, in the transformed strains, the FAD-linked glycoproteins coupled to improved promoters of amylase from Aspergillus oryzae An mRNA fragment presumed to be that of the glucose dehydrogenase gene was detected. The strains obtained in 2 and the comparative example have the gene presumed to be the FAD-linked glucose dehydrogenase. It was determined that the offspring were transcribed into RNA to the same extent. EXAMPLES

[0066] (Confirmation of FAD-linked glucose dehydrogenase activity in transformed strains) For the bacteria of Example 1, 50 μg / mL sodium ampicillin and 0.1 mM Isopropyl-β-D-1-thiogalactopyranoside (Sigma-Aldrich Japan) The bacteria were cultured at 37°C for 17 hours with shaking in LB liquid medium containing 50 mM LiCl. The cells were suspended in potassium phosphate buffer (pH 7.0), disrupted using an ultrasonic disrupter, and then centrifuged. The supernatant was collected by centrifugation to obtain a cell-free extract. When the cell-free extract was subjected to SDS-PAGE, an enzyme protein with a molecular weight of approximately 63 kDa was confirmed. The FAD-linked glucose dehydrogenase activity was 0.014 U / mL in the cell-free extract. This activity was not observed in the host Escherichia coli. The cells of Example 2 and the Comparative Example were incubated in a broth containing 1% peptone, 2% sucrose, and dipotassium hydrogen phosphate. The bacteria were cultured at 28°C for 3 days with shaking in a culture medium containing 0.5% sodium chloride and 0.05% magnesium sulfate. After completion of the incubation, the cells and the culture supernatant were collected by centrifugation, and the cells were then soaked in 50 mM potassium phosphate buffer (pH 7.0), disrupt the cells using a tip-type ultrasonic disrupter, then centrifuge and collect the supernatant. This was used to prepare a cell-free extract. When the culture supernatant and the cell-free extract were subjected to SDS-PAGE, the cells of Example 2 In the case of the comparative example, an enzyme protein with a molecular weight of about 86 kDa was confirmed in the culture supernatant. was not detected in the culture supernatant or cell-free extract. In addition, according to the enzyme activity measurement method described above, FAD-linked glucose in the culture supernatant and cell-free extract was When the enzyme dehydrogenase activity was confirmed, the culture supernatant of the bacteria of Example 2 had 53 U / ml The FAD-linked glucose dehydrogenase activity of L was confirmed, but in the comparative bacterial cells, No activity was detected in the supernatant or cell-free extract. (summary) To summarize the findings of Examples 3 to 5, Example 2 and Comparative Example show that the The copy number and transcription level were the same, but the FAD-linked glucose in the transformed The gene sequence of the enzyme dehydrogenase is slightly different from that of the enzyme. It can be concluded that it has a significant effect on the expression of enzyme activity. EXAMPLES

[0067] (Comparison with other strains of Aspergillus oryzae) For several other strains of Aspergillus oryzae, the same procedure was used as in Example 1-(2). FAD-linked glucose dehydrogenase activity in culture supernatant and cell-free extract (CFE) of In addition, chromosomal DNA was extracted from these strains in the same manner as in Example 2-(1). The sequence of the approximately 1.9 kbp fragment amplified using the primers shown in SEQ ID NOs: 6 and 7 is The sequence of SEQ ID NO:2 and the chromosomal DNA sequence of AO090005000449 were determined. The translated amino acid sequence was compared with the sequence shown in SEQ ID NO: 1, as well as the sequence shown in SEQ ID NO: 1. The results are shown in Examples 1 to 3 and 4. The results are shown in Table 1 below together with the results of the comparative example. The presence or absence of the amino acid sequence VPWV is shown in Table 1.

[0068] [Table 1]

[0069] Aspergillus oryzae NBRC4079, 4214, 4268, 5238, 621 The chromosomal DNA sequences derived from 30113 and 305113 were completely identical to the sequence of SEQ ID NO:2. was. The chromosomal DNA sequence derived from Aspergillus oryzae NBRC4203 is shown in SEQ ID NO:2. The sequence differed in four bases (135C→A, 437G→A, 532G→A, 1263C→T). Amino acid sequence translated from the chromosomal DNA sequence derived from Pergillus oryzae NBRC4203 differed from the sequence of SEQ ID NO:1 by two amino acids (129V→I, 386A→V). In addition, the chromosomal DNA sequence derived from Aspergillus oryzae NBRC30104 is SEQ ID NO: The sequence of No. 2 differed from the other sequence by four bases (135C→A, 413C→A, 437G→A, 532G→A). Amino acid sequence translated from chromosomal DNA sequence derived from Aspergillus oryzae NBRC30104 The sequence differed from that of SEQ ID NO:1 by two amino acids (121R→S, 129V→I). Differences in amino acid sequence do not directly affect the expression of FAD-linked glucose dehydrogenase It was presumed that. In addition, the chromosomal DNA sequences of Aspergillus oryzae NBRC4181 and 4220 are , all of which were completely identical to the chromosomal DNA sequence of AO090005000449.

[0070] From the results of Examples 1 to 5 and Comparative Example, it was found that the Aspergillus oryzae NBRC5375 strain The putative FAD-linked glucose dehydrogenase gene is a gene encoding the active FAD-linked glucose It was concluded that the gene was encoding a dehydrogenase. The putative FAD-linked glucose dehydrogenase gene from RC100959 strain (AO0900 The 05000449 gene is a gene encoding an active form of FAD-linked glucose dehydrogenase. The AO090005000449 gene was not a FA gene derived from the NBRC5375 strain. It encodes an amino acid sequence highly similar to that of D-linked glucose dehydrogenase. Therefore, in light of the common general knowledge in the technical field, it is believed that they have similar enzyme activity. However, unexpectedly, the present inventors have actually found that As such, the AO090005000449 gene, the NBRC4181 gene, and the 4220 gene It was found for the first time that the enzyme was not expressed in the sequence of The expression or non-expression of FAD-linked glucose dehydrogenase is determined solely by the difference in the sequence of Although it is only a hypothesis, FAD-binding Amino acid sequence contained in glucose dehydrogenase: AGVPWV is an FAD-linked glucose dehydrogenase This sequence is thought to be important for the formation of the original higher-order structure, and the absence of AGVPWV leads to endoplasmic reticulum stress, etc. It is presumed that this causes degradation of the expressed protein and / or suppression of expression. When the amino acid M is the first amino acid, the amino acid sequence AGVPWV exists near the 202nd position. It is currently unclear which amino acids in this sequence are essential for the expression of activity. Research is currently underway, but some activity is maintained even if some amino acids are deleted, substituted, or added. It is possible. In addition, the amino acid sequence: AGVPWV is not related to Aspergillus oryzae. Genetic analysis of Aspergillus oryzae NBRC4203 and Aspergillus oryzae NBRC 30104 Several amino acid substitutions revealed by the analysis affect the expression of FAD-linked glucose dehydrogenase. Did not give it. EXAMPLES

[0071] (Property test of FAD-linked glucose dehydrogenase) The culture supernatant of the bacterial cells of Example 2 obtained in Example 5 was subjected to a centrifugation using Bivacel 2 (Bivacel) with a molecular weight cutoff of 10,000. After concentration with a 100% ethanol solution (manufactured by Biosciences), the solution was replaced with distilled water, and the specific activity per protein was 323 U / The purified enzyme was obtained in an amount of 100 mg. The enzymes from the two enzymes were also purified in the same manner. A single band of approximately 86 kDa was confirmed. The isomerism and coenzymes were examined. The enzyme activity was measured according to the enzyme activity measurement method described above. Ta. 1) Effect The purified enzyme was reacted with 500 mM D-glucose in the presence of 8.66 mM DCIP. The reaction products were quantified using a D-gluconic acid / D-glucono-δ-lactone quantification kit. As a result, the production of D-gluconic acid was confirmed, and from this, it was confirmed that the FAD-linked glucose dehydrogenase of the present invention It was revealed that oxidizing the 1-hydroxyl group of D-glucose is an enzyme that catalyzes the reaction. It became. 2) Substrate specificity The substrates for the reaction solution for measuring the enzyme activity in the above-mentioned enzyme activity measurement method were D-glucose, maltose, The enzyme activity of the purified enzyme was measured using glucose and D-galactose according to the enzyme activity measurement method. When the activity of the enzyme for D-glucose was taken as 100%, the activity for maltose was The enzyme activity for D-galactose was 0.99%. Ta. 3) Coenzymes When D-glucose was added to the purified enzyme and absorbance analysis was performed, the The absorption maximum at 100 nm disappeared upon addition of this compound, indicating that the coenzyme was FAD. It became clear. EXAMPLES

[0072] (Measurement of glucose using an enzyme-immobilized electrode) Using the purified enzyme described in Example 7, D-glucose was measured using an enzyme immobilized electrode. Using a glassy carbon (GC) electrode immobilized with 1.5 U of this enzyme, glucose The response current value was measured against the concentration. pH 6.0) 1.8 ml and 1M potassium hexacyanoferrate (III) (ferricyanide 0.2 ml of an aqueous solution of potassium chloride was added. The GC electrode was connected to a potentiostat BAS100 Connect to B / W (manufactured by BAS), stir the solution at 37°C, and adjust the temperature to +50 against the silver-silver chloride reference electrode. 1M D-glucose solution was added to these systems at final concentrations of 5, 10, 20, The concentration was 30, 40, and 50 mM, and the steady-state current was measured after each addition. The current was plotted against known glucose concentrations (5, 10, 20, 30, 40, 50 mM). As a result, a calibration curve was created (Figure 1). It was demonstrated that glucose can be quantified using an enzyme-immobilized electrode that uses a dehydrogenase. EXAMPLES

[0073] (Confirmation of FAD-linked glucose dehydrogenase gene by PCR) (1) Bacterial cell culture Glucose (Nacalai) 1% (W / V), defatted soybeans (Showa Sangyo) 2% (W / V ), corn steep liquor (Sanei Toka Co., Ltd.) 0.5% (W / V), magnesium sulfate A liquid medium consisting of 0.1% (w / v) sorbitol heptahydrate (Nacalai) and water was adjusted to pH 6.0. After adjusting the concentration, 10 mL was placed in a wide test tube and autoclaved at 121°C for 20 minutes. In this liquid medium, glucose dehydrogenase activity was added to the culture medium as shown in Example 4. Aspergillus oryzae strains NBRC4268, NBRC5375, and NBRC6215 have been confirmed to possess strain, and Aspergillus oryzae strain NBRC4181 and NBRC42, in which this enzyme activity was not detected in the culture medium. The 20 strains and NBRC100959 strain were inoculated into each test tube, and cultured at 30°C for 43 hours with shaking. The wet cells were collected using a separator.

[0074] (2) Extraction of chromosomal DNA The wet cells obtained in (1) were frozen in liquid nitrogen, pulverized, and chromosomal DNA was extracted by the usual method. I put it out.

[0075] (3) Amplification of the full-length FAD-linked glucose dehydrogenase gene (2) Each DNA extracted in step (2) was used as a template, and a primer synthesized based on the sequence of SEQ ID NO:2 was used. Using 3 and 4, PCR was performed under the following conditions to obtain a fragment of approximately 1.9 kbp FAD-linked glucose dehydrogenase A PCR product containing the gene was obtained. Template: DNA extracted in (2) Primer: Primer 3: 5'-ttatgctcttctcactggcattcctgagtgccctgt-3' (SEQ ID NO: 10) Primer 4: 5'-gctaagcactcttcgcatcctccttaatcaagtcgg-3' (SEQ ID NO: 11) Reaction conditions: Denaturation 94℃, 1 minute (1 cycle) Denaturation 94℃, 30 seconds, annealing 45℃, 30 seconds, extension reaction 72℃, 1 minute 30 seconds (30 cycles) Extension reaction: 72℃, 10 minutes (1 cycle)

[0076] (4) Amplification of the FAD-linked glucose dehydrogenase gene that expresses activity Using each PCR product obtained in (1) as a template, primer 3 and the amino acid sequence: AGVPWV Using primer 5 synthesized based on the above, PCR was carried out under the following conditions. Template: PCR product obtained in (3) Primer: Primer 3: 5'-ttatgctcttctcactggcattcctgagtgccctgt-3' (SEQ ID NO: 10) Primer 5: 5'-aacccatggaacaccagc-3' (SEQ ID NO: 12) Reaction conditions: Denaturation 94℃, 1 minute (1 cycle) Denaturation 94℃, 30 seconds, annealing 65℃, 30 seconds, extension reaction 72℃, 1 minute (30 cycles) Extension reaction: 72°C, 5 min (1 cycle).

[0077] The results of detection of the target gene by PCR are shown in Figure 2. A gene encoding FAD-linked glucose dehydrogenase from Aspergillus oryzae with high activity Only the polynucleotides that were found to be identical in size to the expected polynucleotides were amplified by PCR. Even if the obtained DNA is used directly as a template for PCR, the same results will be obtained if glucose is not present in the culture medium. FAD-linked glucose dehydrogenase from Aspergillus oryzae with dehydrogenase activity Only the polynucleotide encoding the above was amplified by PCR at the expected size. EXAMPLES

[0078] (Confirmation of FAD-linked glucose dehydrogenase gene by Southern hybridization) 100 ng of each PCR product obtained in Example 9(1) was subjected to agarose gel electrophoresis and then The cells were then blotted onto membrane (Hybond-N+, GE Healthcare) and fixed at 80°C for 71 hours. After prehybridization, the 5' end was fused with fluorescein isothiocyanate (FI A probe fluorescently labeled with TC was synthesized based on the amino acid sequence AGVPWV, and incubated at 37°C for 24 hours. The membrane was incubated at 4°C in 6×SSC and at 50°C in tetramethylammonium chloride. After washing with tetramethylammonium chloride solution, the SDS from the tetramethylammonium chloride solution was washed away with 25 mM TBS. Fluorescence detection was performed using an image analyzer (Typhoon 9400, GE Healthcare). The compositions of the buffers and the sequences of the probes used are described in. Hybridization Buffer: 6 x SSC 5x Denhardt's solution 0.5% skim milk 20×SSC: 3M Sodium Chloride 0.3M Trisodium Citrate Tetramethylammonium chloride solution: 3M Tetramethylammonium chloride 50 mM Tris-HCl (pH 8.0) 2mM EDTA 0.1% SDS Probe: 5'(FITC)-gctggtgttccatgggtt-3' (sequence number 5).

[0079] The results of detection of the target gene by Southern hybridization are shown in Figure 3. Aspergillus oryzae, which has glucose dehydrogenase in the cytosol, is a type of FAD-linked glucose dehydrogenase. Only the polynucleotides encoding hydrogenases were detectable by Southern hybridization. It can be seen that the confirmation by Southern hybridization was carried out in the same manner as in Example 9 (3). The PCR product obtained in step 2 was immobilized on a nylon membrane (Hybond-N+, GE Healthcare). can be performed with similar results. EXAMPLES

[0080] (Cloning and Cloning of the Gene Confirmed to be the FAD-linked Glucose Dehydrogenase Gene) Secretory production in cultured strains Glucose dehydrogenase is secreted into the culture medium by the method shown in Example 9 and / or Example 10. A gene encoding FAD-linked glucose dehydrogenase from Aspergillus oryzae was The gene that was confirmed to be a nucleotide was inserted into a vector according to the method described in Example 2. The cloned strain was cultured and a large amount of the active enzyme was secreted into the culture supernatant. I was able to make it happen. EXAMPLES

[0081] (Affects the activity expression of FAD-linked glucose dehydrogenase from Aspergillus oryzae Confirmation of amino acids Six amino acids of FAD-linked glucose dehydrogenase from Aspergillus oryzae NBRC5375 ( Among the AGVPWV (amino acids 202 to 207), several mutations were made by deleting one amino acid. A mutant enzyme gene that lacks all six amino acids, and We created a mutant enzyme gene that has a base that codes for Met instead of an amino acid, and The mutant gene was introduced into the R. oryzae NS4 strain and the effect on the expression of the activity was confirmed. Using the TRATAGEN Quik Change Site Directed Muntagenesis Kit, Aspergillus Gene introduction into M. oryzae was carried out according to the method described in Example 2. The average activity value (3 strains) per medium was calculated for each organism (estimated to be a single copy). The results are shown in Table 2. From these results, the FAD-linked glucose dehydrogenase of Aspergillus oryzae These six amino acids, especially the 205th to 207th amino acids, are important for the activity of the enzyme. This is strongly suggested.

[0082] [Table 2] [Industrial Applicability]

[0083] The FAD-linked glucose dehydrogenase encoded by the polynucleotide of the present invention is capable of inhibiting blood glucose Since it has virtually no effect on maltose during measurement, it is suitable for more accurate self-measurement of blood glucose (S It can also be used in MBG devices, which will be of great help to diabetic patients in their self-management and treatment.

[0084] JPEG2025072485000005.jpg242162JPEG2025072485000006.jpg242154JPEG20250724850 00007.jpg242152JPEG2025072485000008.jpg242153JPEG2025072485000009.jpg100153

Claims

1. A biosensor for measuring glucose, comprising: An electrode system and an enzyme reaction layer disposed on the electrode system, the enzyme reaction layer contains FAD-bound glucose dehydrogenase and an electron acceptor; the FAD-linked glucose dehydrogenase is a protein derived from an Aspergillus oryzae strain, has a specific activity per protein of 300 U / mg or more, and has an enzyme activity value for galactose of 5% or less when the enzyme activity for D-glucose is taken as 100%, The FAD-linked glucose dehydrogenase is a polypeptide comprising an amino acid sequence AGVPWV and is a polypeptide represented by the following (a) or (b): (a) a polypeptide having an FAD-binding glucose dehydrogenase activity, which consists of an amino acid sequence in which one to several amino acids are substituted, deleted or added in the amino acid sequence shown in SEQ ID NO: 1; or (b) a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO:1 and having FAD-binding glucose dehydrogenase activity.

2. The biosensor according to claim 1, wherein the polypeptide (b) consists of an amino acid sequence having 95% or more identity to the amino acid sequence shown in SEQ ID NO: 1 and is a polypeptide having FAD-linked glucose dehydrogenase activity.

3. The biosensor of claim 1, wherein the polypeptide (a) or (b) comprises a substitution of valine (V) corresponding to the 129th position of SEQ ID NO: 1 with isoleucine (I), and a substitution of alanine (A) corresponding to the 386th position of SEQ ID NO: 1 with valine (V).

4. The biosensor of claim 1, wherein the polypeptide (a) or (b) comprises a substitution of arginine (R) corresponding to the 121st position of SEQ ID NO: 1 with serine (S) and a substitution of valine (V) corresponding to the 129th position of SEQ ID NO: 1 with isoleucine (I).

5. 2. The biosensor according to claim 1, wherein the polypeptide (a) or (b) comprises the amino acid sequence AGVPWV at positions corresponding to bases 202 to 207 of SEQ ID NO:

1.

6. 6. The biosensor according to claim 1, wherein the enzyme reaction layer contains 0.1 to 50 units of FAD-linked glucose dehydrogenase.

7. The biosensor according to any one of claims 1 to 6, wherein the enzyme reaction layer further contains a hydrophilic polymer.

8. 8. The biosensor according to claim 1, wherein the electron acceptor is a compound selected from the group consisting of osmium compounds, quinone compounds, and ferricyanide compounds.

Images