Methods for generating genetically modified animals

Abstract

To provide multiplexed genetically modified animals, such as porcine endogenous retrovirus (PERV)-inactivated pigs, and methods for producing the pigs, and also provide methods of improving the birth rate of multiplexed genetically modified animals.SOLUTION: There are provided generation and utilization of porcine cells in which porcine endogenous retroviral (PERV) elements have been inactivated. Alternatively, the PERV-free or PERV-reduced porcine cells are cloned to produce porcine embryos. Further alternatively, the PERV-free or PERV-reduced embryos may be grown into adult swine from which organs and / or tissues may be extracted and used for such purposes as xenotransplantation into non-porcine animals such as humans.SELECTED DRAWING: Figure 16B

Description

[Technical field]

[0001] Priority claim This application is a continuation of U.S. Provisional Application No. 62 / 487,898, filed April 20, 2017. , U.S. Provisional Application No. 62 / 527,702, filed June 30, 2017, and This application claims priority to U.S. Provisional Application No. 62 / 543,610, filed August 10, 2007, which is hereby incorporated by reference in its entirety. the disclosure of which is incorporated herein by reference in its entirety. [Background technology]

[0002] Background of the disclosure The shortage of human organs and tissues for transplantation represents a significant unmet medical need In the United States and Europe alone, approximately 200,000 patients are waiting for organ transplants, but only a small proportion of these patients Only a small proportion of people receive donor organs (U.S. Department of Health and Human Services, Organ Procurement and Transplantation). Network-2017; European Commission, Journalist workshop on organ donation and transplantation,Receive nt Facts & Figures., 2016) to alleviate the critical shortage of donor organs. To achieve this, human induced pluripotent stem cells In vitro organ development from human induced pluripotent stem cells (hiPSCs), decellularization, and Repositioning cellular organ scaffolds, constructing 3D printed organs, creating chimeric animals containing human organs, and Several strategies are envisioned, including performing cross-species transplants and performing xenografts (i.e., xenotransplants) mating. In particular, xenotransplantation is an attractive solution to the organ donation and transplant shortage. Porcine organs are suitable for xenotransplantation because they are similar in size and function to human organs. is considered a suitable resource. Furthermore, pigs can be bred in large numbers under conditions free of the specified pathogen and can be used for commercial production (Xeno transplantation 2.0, 2016, Nat. Biotechn ol. 34:1).

[0003] Xenotransplantation has the potential to provide an almost unlimited supply of transplant organs to patients with chronic organ failure. However, the clinical use of pig organs is hampered by immunological incompatibility and the potential risk of transmission of porcine endogenous retrovirus (PERV) elements. PERV is a provirus of the pig genome that was first integrated into the germline chromosome during exogenous retroviral infection (Gifford, R. & Tristem, M., 2003, Virus Genes 26, 291 -315). There are three major subtypes of PERV: PERV A, PERV B, and PERV C. Subtypes A and B are ubiquitous and can infect both pigs and humans, while C is present only in some pig strains and can be transmitted between pigs (Pa tience et al., 2001, J. Virol, 75:2771-2 775). PERV is, by definition, not shared with other species and is usually the result of a recent retroviral infection (Gifford and Tristem). Most PERVs accumulate mutations over time and become inactive, but certain intact PERVs have been shown to infect human cells in vitro (Patien

[0004] PERVs have been shown to infect human cells in vitro (Patien ​​​​​​Ce et al., 1997, Nat. Med., 3:282-286; Y ang et al., 2015, Science,350:1101-1104) 。These intact PERVs pose a potential zoonotic risk in porcine-to-human xenotransplantation (Denner et al., 2016, Xenotrans plantation, 23:53-59; Denner J and Tonje s R, 2012, Clin Microbiol Rev, 25:318-34 3). As reported for other retroviruses, mutagenesis from PERV integration may cause tumorigenesis and immunodeficiency (Bendinelli et al ., 1985, Advances in Cancer Research, 45 :125-181), and PERV is considered a major safety concern in the context of clinical xenotransplantation. So far, several groups have attempted to inactivate PERV using transcription activator-like effector nuclease (Dunn et al., 2015, FASEB J, 29:LB761) or Zinc Finger Nuclease (Semaan et al., 20 15, PLoS One, 10), but these attempts have not been successful.

[0005] Genetically modified animals are designed to have intentional modifications in their genomes and have been used for decades for various purposes, including scientific purposes, livestock improvement, and the production of recombinant proteins. Transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), deaminase, and clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) (CRISPR / Cas9) systems have been developed to precisely edit genes in various organisms. short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9)​ Short palindromic repeat (CRISPR)-based systems with spacers, such as CRIS PR-Cas9, etc., of clustered regularly interspaced short palindromic repeat (CRISPR)-based systems have been developed for generating genetically modified animals. Recently, these technologies have been employed to target multiple nucleic acid sequences for multiplex genome editing in vitro. However, the success rate of live birth and / or postnatal survival of genetically engineered animals depends on a number of factors, including the technology used, the genomic region(s) targeted, and the species of the modified animal, and the rate is lower than that of non-genetically modified animals. SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0006] Therefore, there is a need to develop PERV-free pigs as a source of cells, tissues, and / or organs for transplantation into humans, and to improve the birth rate and / or survival rate of genetically modified animals, particularly animals designed to carry multiple genetic modifications. MEANS FOR SOLVING THE PROBLEM

[0007] SUMMARY OF DISCLOSURE In some aspects, the present disclosure provides a swine grown from an embryo, where the embryo comprises porcine cells having at least 75% inactive porcine endogenous retrovirus (PERV) elements.

[0008] In some aspects, the present disclosure is a method for generating a porcine endogenous retrovirus (PERV)-inactivated pig, comprising: : Obtaining nuclear donor cells having nuclei, wherein at least 75% of the PERV elements in the nuclear donor cells are inactive; Transferring the nuclei of the nuclear donor cells to recipient enucleated oocytes to generate nuclear transfer oocytes; Activating the nuclear transfer oocytes; Culturing the nuclear transfer oocytes to generate blastocysts or embryos; Transferring the blastocysts or embryos to a surrogate; and Generating live PERV-inactivated pigs from the blastocysts or embryos. A method comprising the steps above is provided. And Generating live PERV-inactivated pigs from the blastocysts or embryos. A method comprising the steps above is provided.

[0009] In some embodiments, the present disclosure provides a method for generating a porcine endogenous retrovirus (PERV)-inactivated pig, comprising: Using nuclei of nuclear donor cells to generate blastocysts or embryos, wherein at least 75% of the PERV elements in the nuclear donor cells are inactive; and Transferring the blastocysts or embryos to a surrogate to create PERV-inactivated pigs. A method comprising the steps above is provided. In some embodiments, the present disclosure provides a method for improving the birth rate of PERV-inactivated pigs, comprising: Using nuclei derived from nuclear donor cells to generate blastocysts or embryos, wherein at least 75% of the PERV elements in the nuclear donor cells are inactive; and Transferring the blastocysts or embryos to at least one surrogate to generate at least one PERV-inactivated pig,

[0010] wherein the abortion rate is related to cells ​​​​​Compared to the abortion rate of fetuses generated from cells in which more than 25% of the PERV elements inside are active, A method that is decreasing, is provided.

[0011] In some embodiments, the disclosure is a method of creating a genetically modified animal, comprising: Using a nucleus derived from a nuclear donor cell to generate a blastocyst or embryo, wherein a plurality of nucleic acid sequences in the nuclear donor cell are modified, and transferring the blastocyst or embryo to a surrogate to create the genetically modified animal. A method is provided that includes this.

[0012] In some embodiments, the disclosure uses a nucleus derived from a genetically modified nuclear donor cell to generate a blastocyst or embryo, and transferring the blastocyst or embryo to a surrogate to generate at least one viable offspring, is a method for preventing or reducing the risk of pregnancy loss or abortion by somatic cell nuclear transfer (SCNT) of a genetically modified blastocyst or embryo, where the rate of pregnancy loss or abortion is decreased compared to the rate of pregnancy loss or abortion in a control. A method is provided. Here, the rate of pregnancy loss or abortion is decreased compared to the rate of pregnancy loss or abortion in a control. A method is provided.

[0013] Organs or tissues obtained from any of the pigs of the embodiments disclosed and described herein are also provided. Isolated porcine cells generated by any of the methods disclosed and described herein are also provided.

[0014] In some embodiments, about 100% of the PERV elements in the cell are inactive. In some embodiments, 100% of the PERV elements in the cell are inactive.

[0015] In some embodiments, the PERV element comprises one or more mutations or epigenetic changes that result in a decrease or elimination of PERV element activity.

[0016] In some embodiments, the PERV elements of porcine cells are inactivated by a method comprising administering to the cells a genome modifying agent specific for a gene involved in PERV replication and / or assembly. Here, the agent disrupts the transcription and / or translation of the gene. In some embodiments, the agent is a nuclease or nickase or a nucleic acid encoding the nuclease or nickase, for example, the nuclease or nickase is a CRISPR-associated nuclease or nickase. In some embodiments, the agent further comprises: a) a CRISPR guide RNA or tracrRNA, or b) a nucleic acid encoding a CRISPR guide RNA.

[0017] In some embodiments, the CRISPR guide RNA comprises any one nucleotide sequence of SEQ ID NOs: 1-3 or 26-181, any strain-specific genetic variant thereof, or any combination thereof. In some embodiments, the CRISPR guide RNA comprises any one nucleotide sequence of SEQ ID NOs: 1-3 or 26-116, any strain-specific genetic variant thereof, or any combination thereof. In some embodiments, the CRISPR guide RNA comprises SEQ ID NOs: 35, 36, 48, 99, 101 ​​​​​​​​​​​​​One of the nucleotide sequences of 102, 106, 108, 111, 113, or any combination thereof, or comprises. In some embodiments, the agent is a nucleic acid encoding a CRISP R-Cas9 nuclease or nickase, wherein the cell is engineered to stably express the agent, wherein the agent further comprises at least 1 guide RNA, and wherein at least one guide RNA sequence comprises one of the nucleotide sequences of SEQ ID NOs: 1-3 or 26-116.

[0018] In some embodiments, the pig maintains the same or substantially the same level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years post-gestation.

[0019] In some embodiments, the nuclear donor cell is a somatic cell, a fetal cell, a germ cell, a stem cell, or an induced pluripotent stem cell (iPSC). In some embodiments, the nuclear donor cell is a fetal cell. In some embodiments, the nuclear donor cell is isolated from a chimeric PERV-inactivated fetus. In some embodiments, the chimeric PERV-inactivated fetus is about 10 days, about 20 days pregnant, about 30 days, or about 3 months. In some embodiments, the chimeric PERV-inactivated fetus is generated using a genome modifier, such as

[0020] a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, a deaminase, and a CRISPR-associated nuclease or nickase. In some embodiments, the chimeric PERV-inactivated fetus is generated using a genome modifier, such as a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, a deaminase, and a CRISPR-associated nuclease or nickase. is generated.

[0021] In some embodiments, the nuclear donor cells are subjected to fewer than 30, fewer than 20, fewer than 10, fewer than 5, or fewer than 2 population doublings in vitro. In some embodiments, the nuclear donor cells are isolated from a pig. In some embodiments, the nuclear donor cells are isolated from a pig that is less than 10 weeks old, less than 8 weeks old, less than 6 weeks old, less than 5 weeks old, less than 4 weeks old, less than 3 weeks old, less than 2 weeks old, or less than 1 week old. In some embodiments, at least about 80%, at least about 90%, at least about 95%, at least about 99% of the PERV elements in the nuclear donor cells are inactive. In some embodiments, the PERV-inactivated pig maintains the same or a similar level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy. In some embodiments, the method further comprises transferring at least one wild-type blastocyst or embryo to the surrogate. In some embodiments, at least about 80%, at least about 90%, at least about 95%, at least about 99% of the PERV elements in the nuclear donor cells are inactive. In some embodiments, 100% of the PERV elements in the nuclear donor cells are inactive.

[0022] In some embodiments, the PERV-inactivated pig maintains the same or a similar level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy. In some embodiments, the method further comprises transferring at least one wild-type blastocyst or embryo to the surrogate. In some embodiments, 100% of the PERV elements in the nuclear donor cells are inactive.

[0023] In some embodiments, the method further comprises transferring at least one wild-type blastocyst or embryo to the surrogate. In some embodiments, the method further comprises transferring at least one wild-type blastocyst or embryo to the surrogate.

[0024] In some embodiments, at least about 80%, at least about 90%, at least about 95%, at least about 99% of the PERV elements in the nuclear donor cells are inactive. In some embodiments, at least about 80%, at least about 90%, at least about 95%, at least about 99% of the PERV elements in the nuclear donor cells are inactive. In some embodiments, 100% of the PERV elements in the nuclear donor cells are inactive. In some embodiments, the PERV-inactivated pig maintains the same or a similar level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy.

[0025] In some embodiments, the PERV-inactivated pig maintains the same or a similar level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy. maintain the same PERV inactivation over at least 6 months, at least 1 year, at least 5 years, or at least 10 years. In some embodiments, the PE RV-inactivated pig is a pig that does not contain PERV. In some embodiments, the P ERV-inactivated pig has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% inactive PERV elements. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Brief Description of the Drawings

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 1E

Figure 2A

Figure 2B

Figure 2C

Figure 2D

Figure 2E

Figure 3A

Figure 3B

Figure 4A

Figure 4B

Figure 5A

Figure 5B

Figure 5C

Figure 6A

Figure 6B

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11A

Figure 11B

Figure 12

Figure 13

Figure 14

Figure 15A

Figure 15B

Figure 16A

Figure 16B

Figure 17A

Figure 17B

Figure 17C

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31A

Figure 31B

DETAILED DESCRIPTION OF THE INVENTION

[0027] Detailed Description of the Disclosure The present disclosure provides one or more genetically modified porcine cells with reduced intact PERV, or methods for generating these cells. In some embodiments, the one or more porcine cells have no intact PERV, or methods for generating these cells at all. In some embodiments, PERV-reduced or PERV-free porcine cells can be cloned to generate porcine embryos. These can in turn grow into adult pigs. Organs and / or tissues can then be extracted therefrom and used for purposes such as xenotransplantation into humans.

[0028] I. Definitions As used throughout this specification and the claims, the terms "about" and "approximately" in connection with numerical values are well known to those skilled in the art and indicate an interval of acceptable accuracy.

[0029] The numerical ranges disclosed herein include the numbers defining the ranges.

[0030] The terms "a" and "an" include plural referents unless the context clearly dictates otherwise. The term "a" (or "an"), as well as the terms "one or more" and "at least one" can be used interchangeably herein. Further, as used herein, "and / or" shall be construed to mean either a particular disclosure with or without each of two or more specific features or components. Thus, the term "and / or" as used in phrases such as "A and / or B" in this specification shall mean "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, "A and / or B" shall include "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, ​​The term "and / or" as used in phrases such as "A, B, and / or C" is intended to include the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A alone; B alone; C alone; be intended.

[0031] Throughout this specification, the term "comprise" or its variants "comprises" or "comprising" means the inclusion of the specified integers or groups of integers, but is understood not to mean the exclusion of any other integers or groups of integers. When used in this specification, the term "including" also encompasses the use of the narrower terms "consisting of" and "consisting essentially of". include.

[0032] The terms "pig", "swine", and "porcine" are used interchangeably herein and refer to various breeds of domestic pigs, the species Sus scrofa. refer to.

[0033] When the term "biologically active" is used to refer to a fragment or derivative of a protein or polypeptide, the fragment or derivative is meant to retain at least one measurable and / or detectable biological activity of the reference full-length protein or polypeptide. For example, a biologically active fragment or derivative of the CRISPR / Cas9 protein may be able to bind to guide RNA, bind to a target DNA sequence when complexed with guide RNA, and / or have the potential to cleave one or more DNA strands. For example, a biologically active fragment or derivative of the CRISPR / Cas9 protein can bind to guide RNA, bind to the target DNA sequence when forming a complex with guide RNA, and / or may be able to cleave one or more DNA strands.

[0034] The terms "treatment", "treating", "alleviation", etc. When used in the context of a disease, injury or disorder, it is generally used to mean obtaining the desired pharmacological and / or physiological effects. It may also be used to refer to improving, alleviating, and / or reducing the severity of one or more symptoms of the condition being treated. The effect may be preventive in that it delays the onset or recurrence of the disease, condition, or its symptoms, either completely or in part, and / or may be therapeutic in that it effects a partial or complete cure of the disease or condition and / or of the side effects resulting from the disease or condition. As used herein, "treatment" includes any treatment of a disease or condition in a mammal, particularly a human, and includes: (a) preventing a disease or condition from occurring in a subject who may be predisposed to the disease or condition but has not yet been diagnosed as having it; (b) inhibiting a disease or condition (e.g., preventing its onset); or (c) alleviating a disease or condition (e.g., causing regression of the disease or condition and improving one or more symptoms). (a) preventing a disease or condition from occurring in a subject who may be predisposed to the disease or condition but has not yet been diagnosed as having it; (b) inhibiting a disease or condition (e.g., preventing its onset); or (c) alleviating a disease or condition (e.g., causing regression of the disease or condition and improving one or more symptoms).

[0035] II. Porcine cells, tissues, organs In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the mammalian cells are non-human mammalian cells, such as equine, porcine, bovine, ovine, caprine, canine, or feline. In some embodiments, the cells are porcine cells. In some embodiments, the present disclosure provides one or more porcine cells with reduced intact PERV. In some embodiments, the porcine cells are intact P present in the porcine cells.

[0036] ​​​​​​​​The ERV is genetically modified to be inactivated. In some embodiments, the porcine cells have less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, less than 3, less than 2, 1 or zero copies of intact PERV. In some embodiments, the porcine cells have less than 10, less than 5, less than 3, less than 2, 1 or zero copies of intact PERV. In some embodiments, the porcine cells have zero copies of intact PERV. In some embodiments, the porcine cells have from about 60 copies to about 1 copy, from about 50 copies to about 1 copy, from about 40 copies to about 1 copy, from about 30 copies to about 1 copy, from about 20 copies to about 5 copies, from about 15 copies to about 10 copies, or from about 5 copies to about 1 copy of intact PERV. In some embodiments, at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% of the PERVs in the cells are inactive. In some embodiments, about 30% - 100%, about 35% - 100%, about 40% - 100%, about 45% - 100%, about 50% - 100%, about 55% - 100%, about 60% - 100%, about 65% - 100%, about 70% - 100%, about 75% - 100%, about 80% - 100%, about 85% - 100%, about 90% - 100%, about 95% - 100%, about 96% - 100%, about 97% - 100%, about 98% - 100%, or about 99% - 100% of the PERVs in the cells

[0037] In some embodiments, the cells are primary cells, such as porcine primary cells. In some embodiments, the cells are somatic cells. In some embodiments, the cells are postnatal cells In some embodiments, the cells are adult cells (e.g., adult ear fibroblasts). In some embodiments, the cells are fetal / embryonic cells (e.g., blastomeres). In some embodiments, the cells are germline cells. In some embodiments, the cells are oocytes. In some embodiments, the cells are stem cells. In some embodiments, the cells are cells from a primary cell line. In some embodiments the cells are epithelial cells, muscle cells, fibroblasts, endothelial cells, hepatocytes, theca cells, adipocytes. In certain embodiments, the cells are fibroblasts. In some embodiments, the fibroblasts are fetal fibroblasts, such as female fetal fibroblasts. In some embodiments, the cells are cancer cells. In some embodiments, the cells are not cancer cells. In some embodiments, the cells are in vitro. In some embodiments, the cells are in vivo. In some embodiments, the cells are single cells. In some embodiments, the cells are members of a cell colony.

[0038] In some embodiments, the cells are porcine cells. Non-limiting examples of porcine cells are the following porcine breeds: American Landrace, American Yorkshire, Aksai Black Pied, Angeln Saddleback, App alachian English, Arapawa Island, Auckla​ nd Island, Australian Yorkshire, Babi Ka mpung, Ba Xuyen, Bantu, Basque, Bazna, B eijing Black, Belarus Black Pied, Belgia n Landrace, Bengali Brown Shannaj, Benth eim Black Pied, Berkshire, Bisaro, Bangu r, Black Slavonian, Black Canarian, Brei tovo, British Landrace, British Lop, Bri tish Saddleback, Bulgarian White, Cambro ugh, Cantonese, Celtic, Chato Murciano, Chester White, Chiangmai Blackpig, Choct aw Hog, Creole, Czech Improved White, Da nish Landrace, Danish Protest, Dermantsi Pied, Li Yan, Duroc, Dutch Landrace, Ea st Landrace, East Balkan, Essex, Estonia n Bacon, Fengjing, Finnish Landrace, For est Mountain, French Landrace, Gascon, G erman Landrace, Gloucestershire Old Spot s, Gottingen minipig, Grice, Guinea Hog, Hampshire, Hante, Hereford, Hezuo, Hoga n Hog, Huntington Black Hog, Iberian, It alian Landrace, Japanese Landrace, Jeju Black, Jinhua, Kakhetian, Kele, Kemerovo , Korean Native, Krskopolje, Kunekune, L amcombe, Large Black, Large Black-White, Large White, Latvian White, Leicoma, Li thuanian Native, Lithuanian White, Linco lnshire Curly-Coated, Livny, Malhado de Alcobaca, Mangalitsa, Meishan, Middle Wh ite, Minzhu, Minokawa Buta, Mong Cai, Mo ra Romagnola, Moura, Mukota, Mulefoot, M urom, Myrhorod, Nero dei Nebrodi, Neijia ng, New Zealand, Ningxiang, North Caucas ian, North Siberian, Norwegian Landrace, Norwegian Yorkshire, Ossabaw Island, Ox ford Sandy and Black, Pakchong 5, Philip pine Native, Pietrain, Poland China, Red Wattle, Saddleback, Semirechensk, Siber Iberian Black Pied, Small Black, Small White , Spots, Surabaya Babi, Swabian-Hall, Sw edish Landrace, Swallow Belied Mangalitz a, Taihu pig, Tamworth, Thuoc Nhieu, Tib etan, Tokyo-X, Tsivilsk, Turopolje, Ukra inian Spotted Steppe, Ukrainian White St eppe, Urzhum, Vietnamese Potbelly, Welsh , Wessex Saddleback, West French White, Windsnyer, Wuzhishanm, Yanan, Yorkshire and Yorkshire Blue and White、 cells derived from or induced by any of the above.

[0039] In some embodiments, the cells (e.g., donor nuclear cells) are isolated from chimeric / mosaic fetuses. As used herein, the terms "chimeric" and "mosaic" are used interchangeably and refer to a fetus having two or more populations of cells with different genotypes in one fetus developing from a single fertilized egg. In some embodiments, the chimeric fetus is at about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months or more of gestation. In some embodiments, the chimeric fetus is at less than about 5 days, less than about 10 days, less than about 15 days, less than about 20 days, less than about 25 days, less than about 30 days of gestation and are used interchangeably, and refer to a fetus having two or more populations of cells with different genotypes in one fetus developing from a single fertilized egg. In some embodiments, the chimeric fetus is at about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months or more of gestation. In some embodiments, the chimeric fetus is at less than about 5 days, less than about 10 days, less than about 15 days, less than about 20 days, less than about 25 days, less than about 30 days of gestation about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months or more of gestation. In some embodiments, the chimeric fetus is at less than about 5 days, less than about 10 days, less than about 15 days, less than about 20 days, less than about 25 days, less than about 30 days of gestation In some embodiments, the chimeric fetus is at less than about 5 days, less than about 10 days, less than about 15 days, less than about 20 days, less than about 25 days, less than about 30 days of gestation less than about 5 days, less than about 10 days, less than about 15 days, less than about 20 days, less than about 25 days, less than about 30 days of gestation Full, less than about 2 months, less than about 3 months, less than about 4 months, less than about 5 months, less than about 6 months, less than about 7 months, less than about 8 months, or less than about 9 months.

[0040] In some embodiments, the chimeric fetus is generated using a genome modifier, such as a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, a deaminase, and a CRISPR-associated nuclease or nickase. In some embodiments, the chimeric fetus is generated by direct zygote injection. In some embodiments, the nuclear donor cells are isolated from an animal that is less than 10 weeks old, less than 8 weeks old, less than 7 weeks old,

[0041] less than 6 weeks old, less than 5 weeks old, less than 4 weeks old, less than 3 weeks old, less than 2 weeks old, or less than 1 week old.

[0042] In some embodiments, nuclear donor cells, such as cells isolated from a chimeric fetus, are expanded in vitro for a period of time. In some embodiments, the cells expand in vitro with a population doubling of less than about 30, less than about 25, less than about 20, less than about 15, less than about 10, less than about 5, or less than about 2. In some embodiments, the cells expand in vitro with a population doubling of about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 or less.

[0043] In some embodiments, before or after gene modification, the cells are evaluated for cell health and / or It is cultured in the presence of one or more factors that improve survival. In some embodiments the factor is bepp hydrochloride, pifithrin-α, R18 trifluoroacetate, fibroblast growth factor (fgf), large T antigen, BCL, or any combination thereof . In some embodiments, the factor(s) induce RNA-dependent protein kinase apo ptosis, inhibit p53-mediated apoptosis, inhibit 14-3-3 protein , promote proliferation, promote immortalization, anti-apoptosis, or any combination thereof .

[0044] In some embodiments, the factor is a cell cycle checkpoint inhibitor. In some embodiments, the factor is an anti-apoptosis factor. In some embodiments the factor is bcl-2. In some embodiments, the factor is one of the following: c-Myc , Bax, p53, tBid, and BCL, an inhibitor of any one. Those skilled in the art know various small molecules that can be used as anti-apoptosis checkpoint inhibitors or anti-apoptosis factors and possible derivatives of those small molecules. In some embodiments the factor is the SV40 antigen.

[0045] In some embodiments, the factor is a p53 inhibitor. In some embodiments the factor is a pifithrin molecule or a derivative thereof. In some embodiments, the factor is pifithrin alpha and / or pifithrin beta. Pifithrin (PFT) -α has been demonstrated to reversibly inhibit p53-dependent transcriptional activation and apoptosis and PFT-μ reduces the p53 binding affinity for Bcl-xL and Bcl-2 ​It has been demonstrated to inhibit the binding of p53 to mitochondria. In some embodiments, the p53 inhibitor is a cyclic PFT-α p53 inactivator, such as cyclic pifithrin-α hydrobromide, etc. In some embodiments, the p53 inhibitor is a nucleic acid that reduces or eliminates p53 expression in cells. In some aspects, the nucleic acid is an antisense and / or RNAi molecule. In some aspects, the p53 inhibitor is a dominant negative p53 protein, or a nucleic acid encoding a dominant negative p53 inhibitor In some embodiments, the p53 inhibitor is pifithrin -α, pifithrin-beta, pifithrin-α hydrobromide, pifithrin-mu ( mu), ellipticine, 9-hydroxyellipticine, nutlin-3, roscovitine, and SJ 172550, selected from the group consisting of.

[0046] In some aspects, the factor is a growth factor. In some embodiments, the growth factor is of porcine origin. In some embodiments, the growth factor is a growth factor useful for genetically modified cell types. For example, when the genetically modified cell is a fibroblast or a cell of a fibroblast lineage, in some embodiments, the growth factor is fibroblast growth factor In some embodiments, the fibroblast growth factor is basic fibroblast growth factor (bFGF) or fibroblast growth factor-2 (FGF-2). In some embodiments the fibroblast growth factor is basic fibroblast growth factor (bFGF). In some embodiments, the growth factor is epidermal growth factor (EGF), insulin-like growth factor ( IGF), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), and keratinocyte growth factor (KGF). It is selected from the group consisting of

[0047] In some embodiments, both a p53 inhibitor and a growth factor are administered to the cells. In certain embodiments, both bFGF and pifithrin-alpha are administered to the cells .

[0048] In some aspects, the cells of the present disclosure are cultured under conditions of about 1-20% oxygen (O2), about 1-20 % carbon dioxide (CO2), about 50-90% N2, or any combination thereof . In some embodiments, the cells of the present disclosure are cultured under hypoxic conditions (e.g ., in the presence of less than 10% O2). In some embodiments, the cells of the present disclosure are cultured at about 37°C. In some embodiments, the cells of the present disclosure can be cultured with about 5% O2, 5% CO2 and 90% N2. In some embodiments , the cells are cultured in a tri-gas incubator for at least a certain period of time .

[0049] In some embodiments, the cells of the present disclosure, when cultured in vitro, are split and / or frozen when the cells are at a culture density of about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 1 0%, or less. In some embodiments, the cells are split and / or frozen when the cell confluence is less than about 50%.

[0050] III. Genetic Modification The present disclosure provides a method for generating genetically modified cells and animals derived therefrom​​ 。

[0051] In some embodiments, the plurality of endogenous nucleic acid sequences are modified by inactivation, insertion of exogenous nucleic acids, subtraction of endogenous nucleic acids, or any combination thereof to generate genetically modified cells and the animals derived therefrom. In some embodiments, the plurality of nucleic acid sequences in a cell (e.g., a nuclear donor cell) are modified. In some embodiments, at least about 2, at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, or more nucleic acid sequences are modified. In some embodiments, the plurality of genetic modifications are to a single repetitive gene sequence. In other embodiments, at least a portion of the genetic modifications are to different genes.

[0052] In some embodiments, the present disclosure provides one or more cells in which intact viral elements (e.g., PERV) are reduced. In some embodiments, the nuclear donor cells are genetically modified such that intact viral elements present within the cells are inactivated. In some embodiments, the cell has less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, a porcine cell has less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, or more nucleic acid sequences are modified. In some embodiments, the plurality of genetic modifications are to a single repetitive gene sequence. In other embodiments, at least a portion of the genetic modifications are to different genes. In some embodiments, the present disclosure provides one or more cells in which intact viral elements (e.g., PERV) are reduced. In some embodiments, the nuclear donor cells are genetically modified such that intact viral elements present within the cells are inactivated. In some embodiments, the cell has less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, a porcine cell has less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element.

[0053] In some embodiments, the present disclosure provides one or more cells in which intact viral elements (e.g., PERV) are reduced. In some embodiments, the nuclear donor cells are genetically modified such that intact viral elements present within the cells are inactivated. In some embodiments, the nuclear donor cells are genetically modified such that intact viral elements present within the cells are inactivated. In some embodiments, the cell has less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, a porcine cell has less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, the cell has less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, a porcine cell has less than 10, less than 5, less than 3, less than 2, one, or zero copies of an intact viral element. In some embodiments, the cell has less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, less than 3, In some embodiments, the porcine cells have zero intact viral element copies. In some embodiments, the cells have from about 60 to about 1 copy, from about 50 to about 1 copy, from about 40 to about 1 copy, from about 30 to about 1 copy, from about 20 to about 5 copies, from about 15 to about 10 copies, or from about 5 to about 1 copy of an intact viral element. In some embodiments, at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% of the viral elements in said cells are inactive. In some embodiments, about 30% to 100%, about 35% to 100%, about 40% to 100%, about 45% to 100%, about 50% to 100%, about 55% to 100%, about 60% to 100%, about 65% to 100%, about 70% to 100%, about 75% to 100%, about 80% to 100%, about 85% to 100%, about 90% to 100%, about 95% to 100%, about 96% to 100%, about 97% to 100%, about 98% to 100%, or about 99% to 100% of the viral elements in said cells are inactive.

[0054] In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure lack infectious virus (or are engineered to lack an activated strain thereof). In some embodiments, the cells lack endogenous retroviruses. In some embodiments, the cells of the present disclosure are free of herpes virus, porcine lymphotropic herpes virus (PLHV), porcine Porcine circovirus (PCV), hepatitis E virus (HEV), rabies virus, pseudorabies virus, parvovirus, swine vesicular disease virus, swine poliovirus, hemagglutinating encephalomyocarditis virus, swine influenza A, adenovirus, transmissible gastroenteritis virus, vesicular stomatitis virus, feline leukemia virus, mouse mammary tumor virus, murine leukemia virus, simian immunodeficiency virus (SIV), equine infectious anemia, bovine immunodeficiency virus (BIV), etc., lacking any one or more of them (or engineered to lack their activated strains). In some embodiments, the cells, tissues, organs or pigs of the present disclosure lack PERV (or are engineered to lack the activated strains of PERV). Among others, such as those lacking any one or more of the following: porcine circovirus (PCV), hepatitis E virus (HEV), rabies virus, pseudorabies virus, parvovirus, swine vesicular disease virus, swine poliovirus, hemagglutinating encephalomyocarditis virus, swine influenza A, adenovirus, transmissible gastroenteritis virus, vesicular stomatitis virus, feline leukemia virus, mouse mammary tumor virus, murine leukemia virus, simian immunodeficiency virus (SIV), equine infectious anemia, bovine immunodeficiency virus (BIV), etc. (or engineered to lack their activated strains). In some embodiments, the cells, tissues, organs or pigs of the present disclosure lack PERV (or are engineered to lack the activated strains of PERV). In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. For example, porcine circovirus (PCV), hepatitis E virus (HEV), rabies virus, pseudorabies virus, parvovirus, swine vesicular disease virus, swine poliovirus, hemagglutinating encephalomyocarditis virus, swine influenza A, adenovirus, transmissible gastroenteritis virus, vesicular stomatitis virus, feline leukemia virus, mouse mammary tumor virus, murine leukemia virus, simian immunodeficiency virus (SIV), equine infectious anemia, bovine immunodeficiency virus (BIV), etc., lacking any one or more of them (or engineered to lack their activated strains). In some embodiments, the cells, tissues, organs or pigs of the present disclosure lack PERV (or are engineered to lack the activated strains of PERV). In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay.

[0055] In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay. In some embodiments, the cells, tissues, organs or animals (e.g., pigs) of the present disclosure contain one or more inactivating mutations. In some embodiments, the cells, tissues, organs or animals contain one or more mutations or epigenetic changes that result in a decrease or elimination of the activity of a nucleic acid sequence (e.g., a gene or a retroviral element, such as a PERV element, etc.). In some embodiments, one or more nucleic acid sequences (e.g., PERV elements) are inactivated by genetically modifying the nucleic acid(s) present in the cells, tissues, organs or animals. In some embodiments, the inactivation of one or more nucleic acid sequences (e.g., PERV elements) is confirmed by an assay. In some embodiments, the assay is an infectious assay, a reverse transcriptase PCR assay, RNA-seq, real-time PCR, or a junction PCR mapping assay.

[0056] Cells, tissues, organs, or animals can be genetically modified according to any method known to those skilled in the art. In some embodiments, the nucleic acid(s) within the cell are genetically modified such that one or more nucleic acid sequences (e.g., genes or retroviral elements) within the cell are inactivated. In some embodiments, the nucleic acid sequence is genetically modified using any of the genetic modification systems known in the art and / or disclosed herein. In some embodiments, the genetic modification system is a TALEN, zinc finger nuclease, and / or CRISPR-based system. In some embodiments, the genetic modification system is a CRISPR-Cas9 system. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated, and the cell (or tissue or organ cloned / derived from the cell) is further genetically modified such that the expression of one or more genes that would induce an immune response if transplanted into a human is reduced. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated, and the cell (or tissue or organ cloned / derived from the cell) is further genetically modified such that the expression of one or more genes that would suppress an immune response if transplanted into a human is increased. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated, and the cell (or tissue or organ cloned / derived from the cell) is further genetically modified such that the expression of one or more genes that would induce an immune response if transplanted into a human is decreased when the cell is transplanted into a human. In some embodiments, the nucleic acid(s) within the cell are genetically modified such that one or more nucleic acid sequences (e.g., genes or retroviral elements) within the cell are inactivated. In some embodiments, the nucleic acid sequence is genetically modified using any of the genetic modification systems known in the art and / or disclosed herein. In some embodiments, the genetic modification system is a TALEN, zinc finger nuclease, and / or CRISPR-based system. In some embodiments, the genetic modification system is a CRISPR-Cas9 system. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated, and the cell (or tissue or organ cloned / derived from the cell) is further genetically modified such that the expression of one or more genes that would induce an immune response if transplanted into a human is reduced. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated, and the cell (or tissue or organ cloned / derived from the cell) is further genetically modified such that the expression of one or more genes that would suppress an immune response if transplanted into a human is increased. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated, and the cell (or tissue or organ cloned / derived from the cell) is further genetically modified such that the expression of one or more genes that would induce an immune response if transplanted into a human is decreased when the cell is transplanted into a human. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated. And when the cell (or tissue or organ cloned / derived from the cell) is transplanted into a human, the cell is further genetically modified such that the expression of one or more genes that would induce an immune response is reduced. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated. And when the cell (or tissue or organ cloned / derived from the cell) is transplanted into a human, the cell is further genetically modified such that the expression of one or more genes that would suppress an immune response is increased. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated. And when the cell (or tissue or organ cloned / derived from the cell) is transplanted into a human, the cell is further genetically modified such that the expression of one or more genes that would induce an immune response is decreased. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated. And when the cell (or tissue or organ cloned / derived from the cell) is transplanted into a human, the cell is further genetically modified such that the expression of one or more genes that would suppress an immune response is increased. In some embodiments, the cell is genetically modified such that one or more nucleic acid sequences within the cell are inactivated. And when the cell (or tissue or organ cloned / derived from the cell) is transplanted into a human, the cell is further genetically modified such that the expression of one or more genes that would induce an immune response is decreased. And the cell is further genetically modified such that the expression of one or more genes that would induce an immune response is decreased when the cell is transplanted into a human. When the cells (or tissues or organs cloned / derived from the cells) are transplanted into humans, such that the cells increase expression of one or more genes that will suppress an immune response. The cells are further genetically modified.

[0057] In some embodiments, the present disclosure relates to a method for the preparation of a method for the preparation of a cell comprising the steps of: In some embodiments, the blastocyst or embryo is provided with a genetically modified nucleic acid (s). The recombinant vector (or vectors) may be extracted from the genetically modified cells and cloned into different cells. For example, In somatic cell nuclear transfer, recombinant nucleic acid from a genetically modified cell is introduced into an enucleated oocyte. In some embodiments, the oocyte is subjected to partial zona pellucida dissection near the polar body. The nucleus is then enucleated and the cytoplasm can then be pushed out at the incision area. In embodiments, the oocyte is obtained with all or substantially all of the cytoplasm intact. In some embodiments, the oocytes are screened for multiple layers of cumulus cells. In some embodiments, an injection pipette with a sharp beveled tip is used to Inject genetically modified cells into enucleated oocytes arrested in meiosis-2. The oocytes are often referred to as "eggs." In some embodiments, fusion of the oocytes is Fusion and activation produces an embryo. Such an embryo is referred to herein as a "genetically modified embryo." In some embodiments, the genetically modified embryo is a recipient female broth. The eggs are then transferred to the uterus and into the uterus.

[0058] The genetically modified blastocyst or embryo can be cultured according to any of the embodiments disclosed herein. In one embodiment, fetal porcine fibroblasts can be obtained and neo It can be transfected using transfection reagents. Single cells with desired modifications sorted and expanded in vitro, genotyped cells and / or PCR-verified knockout genes for positive clones can be used to counterselect and / or antibody-binding selection of knock-in genes. Subsequently, cell transfer and somatic cell cloning, or any combination thereof, follows. In some embodiments, genetic modification is performed in the zygote using, for example, microinjection instead of in vitro cells. Direct injection into the zygote is thought to cause less stress to the cells. Once the zygote is modified, the embryo is transplanted to obtain a mosaic animal, and cells are isolated from the mosaic fetus used for SCNT cloning. In some embodiments, cells, blastocysts, embryos, etc. generated according to any of the embodiments disclosed herein are tested for quality control. Non-limiting examples of quality control include Miseq and Sanger sequencing to detect gene targeting efficiency, Exome sequencing and / or whole-genome sequencing to detect off-targets, karyotyping to detect chromosomal abnormalities, RT-qPCR to detect target gene expression, RNAseq to detect the normality of the overall gene expression pattern, antibody-binding counterselection of knockout genes (e.g., by bead enrichment), specific gene antibody-binding selection for knock-in genes (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene

[0059] In some embodiments, cells, blastocysts, embryos, etc. generated according to any of the embodiments disclosed herein are tested for quality control. Non-limiting examples of quality control include Miseq and Sanger sequencing to detect gene targeting efficiency, Exome sequencing and / or whole-genome sequencing to detect off-targets, karyotyping to detect chromosomal abnormalities, RT-qPCR to detect target gene expression, RNAseq to detect the normality of the overall gene expression pattern, antibody-binding counterselection of knockout genes (e.g., by bead enrichment), specific gene antibody-binding selection for knock-in genes (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene (e.g., sorting by flow cytometry); specific gene antibody-binding, human serum antibody-binding, complement cytotoxicity, or natural killer detection of the physiological function of the target gene -(NK) cell assay, blastocyst for confirming whether gene editing affects embryonic development including any of blastocyst development rates and combinations thereof.

[0060] IV. Surrogate and / or somatic cell nuclear transfer In some embodiments, the genetically modified blastocyst or embryo is transferred to a surrogate, e.g., the oviduct of the surrogate. In some embodiments, the genetically modified blastocyst or embryo is transferred to the oviduct of the surrogate about 20-24 hours after activation. In some embodiments, more than one blastocyst or embryo is transferred to the surrogate. In some embodiments, between about 1 and about 600, between about 50 and about 500, between about 100 and about 400, or between about 200 and about 300 blastocysts or embryos are transferred. In some embodiments, embryo quality control is confirmed, e.g., by checking cleavage and blastocyst ratio, prior to transplantation. In some embodiments, embryos or blastocysts derived from sample cells are transferred to multiple surrogates, e.g., about 5-20 surrogates / cell line. In some embodiments, at least one wild-type blastocyst or embryo is transferred to the surrogate at the same time as, or substantially at the same time as, the genetically modified blastocyst or embryo. In some embodiments, at least one wild-type blastocyst or embryo is transferred to the surrogate before or after the genetically modified blastocyst or embryo is transferred to the surrogate. In some embodiments, pregnancy is checked about 20-21 days after transplantation of the genetically modified blastocyst or embryo. In some embodiments, prior to transplanting the blastocyst or embryo, the surrogate is checked for certain characteristics. In some embodiments, pregnancy is checked about 20-21 days after transplantation of the genetically modified blastocyst or embryo. In some embodiments, at least one wild-type blastocyst or embryo is transferred to the surrogate before or after the genetically modified blastocyst or embryo is transferred to the surrogate. In some embodiments, pregnancy is checked about 20-21 days after transplantation of the genetically modified blastocyst or embryo. In some embodiments, pregnancy is checked about 20-21 days after transplantation of the genetically modified blastocyst or embryo. checked.

[0061] In some embodiments, prior to transplanting the blastocyst or embryo, the surrogate is checked for certain characteristics. Screen the surrogates. Non-limiting examples of surrogate characteristics are physiological stage, age, fertility, maternal behavior, lactation ability and rearing ability, abortion frequency, disease, or any combination thereof. In some embodiments, the surrogate is selected for having a previous litter size, appropriate age, multiple birth histories, and / or appropriate physiological stage. In some embodiments, blastocyst or embryo transfer is performed in the spring or fall. In some embodiments, blastocyst or embryo transfer is not performed in the summer and / or winter.

[0062] In some embodiments, a larger surrogate is selected. A larger surrogate can be expected to improve pig production as determined by any one of the outcome measurements including, but not limited to, birth rate, litter size, survival rate, and number of pigs awaited per sow, or a combination thereof, compared to a smaller surrogate.

[0063] In some embodiments, the first round of SCNT is performed to generate embryos that are transferred to a surrogate to generate fetuses, and then the cells are isolated from the fetuses. The isolated cells are used in the second round of SCNT and transferred to a surrogate to generate a genetically modified animal. In some embodiments, the fetuses used in the second round of SCNT are sacrificed at about 10 days, about 20 days, about 30 days, about 40 days, about 50 days, about 60 days, about 70 days, about 80 days, about 90 days, about 100 days, or about 100 days of gestation. In some embodiments, the fetuses used in the second round of SCNT are less than about 50 days, about 40 days, about 30 days, about 20 days, or about 10 days of gestation.

[0064] In some embodiments, the genetically modified blastocyst or embryo grows into a postnatal genetically modified animal (e.g., a pig). In some embodiments, the postnatal genetically modified animal is a neonatal genetically modified animal. In some embodiments, the genetically modified animal is a juvenile genetically modified animal. In some embodiments, the genetically recombinant animal is an adult genetically modified animal (e.g., older than 5-6 months). In some embodiments, the genetically recombinant animal is a female genetically recombinant animal. In some embodiments, the animal is a male genetically modified animal. In some embodiments, the genetically recombinant animal is mated with a non-genetically recombinant animal. In some embodiments, the genetically modified animal is mated with another genetically modified animal. In some embodiments, the genetically modified animal is mated with another genetically recombinant animal in which an active retrovirus (e.g., PERV, etc.) is reduced or absent. In some embodiments, the genetically modified animal is mated with a second genetically recombinant animal such that when transplanted into a human, the cells, tissues or organs of the second genetically recombinant animal are less likely to induce an immune response.

[0065] V. Genetically Recombinant Animals The present disclosure provides for using a nucleus from a genetically modified donor cell to generate a blastocyst or embryo, and transferring the blastocyst or embryo to a surrogate to produce at least one viable offspring, including pregnancy loss or by somatic cell nuclear transfer (SCNT) of a genetically modified blastocyst or embryo. also provides a method for preventing or reducing the risk of miscarriage. Here, the rate of pregnancy loss or miscarriage is decreased as compared to the rate of pregnancy loss or miscarriage in the control.

[0066] In some embodiments, the rate of pregnancy loss or miscarriage is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, 50% less than, at least about 60%, at least about 70%, at least about 80%, at least about 90% less than, or more reduced as compared to the rate of pregnancy loss or miscarriage of the genetically modified blastocyst or embryo in the control.

[0067] In some embodiments, the genetically modified animal maintains the same or a similar level of genetic modification over at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy.

[0068] In some embodiments, the genetically modified animal lives for at least 1 month, at least 2 months at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 1 year, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years, at least 10 years, or more.

[0069] In some embodiments, the genetically modified pig is a PERV-inactivated genetically modified pig and, at least 1 month, at least 6 months, at least 1 year, at least 5 years after pregnancy , maintain the same or similar level of PERV inactivation for at least 10 years. Some In some embodiments, the genetically modified pig remains a PERV-inactivated genetically modified pig after delivery from a non-PERV-inactivated surrogate or after being in a facility / space with other non-PERV-inactivated pigs.

[0070] In some embodiments, the disclosure provides cells, tissues or organs obtained from any of the postnatal genetically modified animals ( e.g., pigs) described herein. In some embodiments, the cells, tissues or organs are selected from the group consisting of liver, lung, heart, brain, pancreas, muscle, blood, bone, testis and ovary. In some embodiments, the organ is liver, lung or heart. In some embodiments, cells derived from postnatal genetically modified animals are pancreatic islets, lung epithelial cells, cardiomyocytes, skeletal muscle cells, smooth muscle cells, hepatocytes, non-parenchymal liver cells, gallbladder epithelial cells, gallbladder endothelial cells, bile duct epithelial cells, bile duct endothelial cells, hepatic vascular epithelial cells, hepatic vascular endothelial cells, sinusoidal cells, choroid plexus cells, fibroblasts, Sertoli cells, neurons, stem cells, and adrenal chromaffin cells, selected from the group consisting of. In some embodiments, the genetically modified organs, tissues or cells are separated from their natural environment (i.e., separated from the animal in which they are growing). In some embodiments, separation from the natural environment means physical separation from the natural environment, e.g., removal from the genetically modified donor animal, and a change in the relationship with adjacent cells in direct contact with the genetically modified organ, tissue, or cell, e.g., by dissociation).

[0071] III. Generation of PERV-reduced or PERV-free pig cells​​ The present disclosure provides a method for generating any of the PERV-reduced PERV-free porcine cells disclosed herein. In some embodiments, the present disclosure administers to the cell a genome modifier specific for a gene involved in PERV replication and / or assembly, to inactivate the PERV element in any of the porcine cells disclosed herein, wherein the agent disrupts transcription and / or translation of the gene. In some embodiments, the agent targets the start codon of the gene and inhibits transcription of the gene. In some embodiments, the agent targets an exon of the gene and induces a frameshift mutation in the gene. In some embodiments, the agent introduces an inactivating mutation in the gene. In some embodiments, the agent suppresses transcription of the gene. One of ordinary skill in the art knows a number of assays for determining whether a cell is PERV-free. One method is to expose human cells to genetically modified cells in which PERV is reduced or considered PERV-free and monitor PERV infection of the human cells, i.e., an infectivity assay. See, for example, Examples 1 and 2. Other methods of monitoring PERV activity in genetically engineered cells include, for example, RNAseq, reverse transcriptase PCR, microarray, and / or junction PCR reactions that monitor the expression and / or chromosomal integrity of PERV-related genes (e.g., gag, pol, and / or env).

[0072]

[0073] In some embodiments, any of the agents disclosed herein is a polynu cleotide. In some embodiments, the polynucleotide encodes one or more of the nucleases and / or nickases and / or RNA or DNA molecules described herein. In some embodiments, the polynucleotide agent is introduced into one or more PERV porcine cells. In some embodiments, the polynucleotide is introduced into one or more PERV porcine cells in such a way that the polynucleotide is transiently expressed by one or more cells. In some embodiments, the polynucleotide is introduced into one or more PERV porcine cells such that the polynucleotide is stably expressed by one or more cells. In some embodiments, the polynucleotide is introduced in such a way that it is stably integrated into the porcine cell genome. In some embodiments, the polynu cleotide is introduced with one or more transposon elements. In some embodiments, the transposon element is an polynucleotide sequence encoding a transposase. In some embodiments, the transposon element is a polynucleotide sequence encoding a PiggyBac trans posase. In some embodiments, the transposable element is inducible. In some embodiments, the transposable element is doxycycline-inducible. In some

[0074] In some embodiments, the agent is a nuclease or nickase used to target PERV DNA within the cell. In some embodiments, the agent specifically targets and suppresses the expression of PERV. In some embodiments, the agent comprises a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain is a Krüppel-associated box (KRAB).

[0075] In some embodiments, the agent is any programmable nuclease. In some embodiments, the agent is a native homing meganuclease. In some embodiments, the agent is a TALEN-based agent, a ZFN-based agent, or a CRISPR-based agent, or any biologically active fragment, fusion, derivative, or combination thereof. In some embodiments, the agent is a deaminase or a nucleic acid encoding a deaminase. In some embodiments, the cell is designed to stably and / or transiently express a TALEN-based agent, a ZFN-based agent, and / or a CRISPR-based agent.

[0076] A. TALEN-based agent In some embodiments, the agent is a TALEN-based agent. In some embodiments, the TALEN-based agent is one or more TALEN polypeptides / proteins or biologically active fragments or derivatives thereof, or one or more TALEN polypeptides or fragments or derivatives thereof encoding One or more nucleic acids that perform. Transcription activator-like (TAL) effector sequences are assembled by assembling the repeat variable-diresidues (RVD ) sequences so as to specifically bind to a DNA target can be assembled. A fusion protein of a TAL effector and a nuclease (TALEN) can perform a targeted double-strand break of cellular DNA for performing specific genetic modifications on cells. In some embodiments, the agent is a TALEN polypeptide / protein or a fragment or derivative thereof that targets one or more PERV DNA sequences within the PERV cell. In some embodiments, the repeat variable-diresidues (RVD) portion of the TALEN is designed to target one or more PERV DNA sequences within the PERV cell. In some embodiments, the TALEN-based agent is a nucleic acid encoding one or more TA LEN proteins. In some embodiments, the nucleic acid is within a plasmid. In some embodiments, the nucleic acid is mRNA.

[0077] In some embodiments, the TALEN protein is expressed intracellularly and induces site-specific double-strand DNA breaks in one or multiple PERV genes. In some embodiments, the TALEN protein introduces a donor sequence, where the donor sequence partially or completely replaces the PERV gene, thereby silencing or inactivating the PERV gene. In some embodiments, the TALEN is a left TALEN and further includes a right TALEN that cooperates with the left TALEN to cleave the double strand of the PERV gene. . In another embodiment, the nucleic acid encoding the TALEN and / or the nucleic acid donor sequence is part of a vector or plasmid. In some embodiments, the TALEN comprises a spacer (e.g., the spacer sequence is 12 to 30 nucleotides in length).

[0078] In some embodiments, the TALEN protein comprises a TAL effector DNA binding domain and / or a modified FokI nuclease catalytic domain. In some embodiments the TAL effector DNA binding domain binds to a region within the PERV gene. In some embodiments, the TALEN, from the N-terminus to the C-terminus, (i) a first segment about 50 to about 200 amino acids in length; (ii) a TAL effector DNA binding domain that provides sequence-specific binding to the PERV nucleotide sequence; DNA binding domain; (iii) a second segment about 20 to 100 amino acids in length; (iv) a modified FokI nuclease catalytic domain; including.

[0079] Methods of engineering TALENs to bind to specific nucleic acids are described in Cermak, et al l, Nucl. Acids Res. 1-1 1 (2011). U.S. Patent Application Publication No. 2011 / 0145940 discloses TAL effectors and methods of using them to modify DNA. Miller et al. Nature Biotechnol 29: 143 (2011) describes the generation of TALENs for site-specific nuclease architectures by linking TAL cleavage mutants to the catalytic domain of Fok I nuclease. The general TALEN binding domain The design principles are described, for example, in WO2011 / 072246. Each of these documents is incorporated herein by reference in its entirety.

[0080] In some embodiments, the TALEN-based agent targets the nucleotide sequence of PERV. In some embodiments, the TALEN-based agent targets a nucleotide sequence that is conserved across more than one strain of PERV. In some embodiments, the TALEN-based agent targets the PERVpol, env, and / or gag genes. In some embodiments, the TALEN-based agent targets the PERVpol gene. In some embodiments, the TALEN-based agent targets the sequence encoding the catalytic core of the PERVpol gene.

[0081] B. ZFN-Based Agents In some embodiments, the agent is a zinc finger nuclease (ZFN)-based agent. In some embodiments, the ZFN-based agent is one or more ZFN polypeptides or biologically active fragments or derivatives thereof, or one or more nucleic acids encoding one or more ZFN polypeptides or fragments or derivatives thereof. ZFNs are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a nuclease. The zinc finger domain can be designed to target a specific desired DNA sequence, and thereby the zinc finger nuclease can target a unique sequence within a complex genome. The DNA-binding domain of an individual ZFN typically contains 3 to 6 individual zinc finger repeats. ​ can each recognize 9 to 18 base pairs (bp). When a zinc finger domain completely recognizes a DNA sequence of 3 base pairs and generates a 3-finger array, the array can recognize a target site of 9 base pairs. In some embodiments, 1-finger or 2-finger modules are utilized to generate zinc finger arrays comprising 6 or more individual zinc fingers. Since the specificity of individual zinc fingers can overlap and may depend on the context of the surrounding zinc fingers and DNA, ZFNs may not be useful for targeting specific PERVs. When a zinc finger domain completely recognizes a DNA sequence of 3 base pairs and generates a 3-finger array, the array can recognize a target site of 9 base pairs. In some embodiments, 1-finger or 2-finger modules are utilized to generate zinc finger arrays comprising 6 or more individual zinc fingers. Since the specificity of individual zinc fingers can overlap and may depend on the context of the surrounding zinc fingers and DNA, ZFNs may not be useful for targeting specific PERVs. In some embodiments, 1-finger or 2-finger modules are utilized to generate zinc finger arrays comprising 6 or more individual zinc fingers. Since the specificity of individual zinc fingers can overlap and may depend on the context of the surrounding zinc fingers and DNA, ZFNs may not be useful for targeting specific PERVs. In some embodiments, 1-finger or 2-finger modules are utilized to generate zinc finger arrays comprising 6 or more individual zinc fingers. Since the specificity of individual zinc fingers can overlap and may depend on the context of the surrounding zinc fingers and DNA, ZFNs may not be useful for targeting specific PERVs. In some embodiments, 1-finger or 2-finger modules are utilized to generate zinc finger arrays comprising 6 or more individual zinc fingers. Since the specificity of individual zinc fingers can overlap and may depend on the context of the surrounding zinc fingers and DNA, ZFNs may not be useful for targeting specific PERVs.

[0082] To generate zinc finger arrays that can target desired sequences, many selection methods have been developed. In some embodiments, the initial selection effort uses phage display to select proteins that bind to a given DNA target from a large pool of partially randomized zinc finger arrays. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. To generate zinc finger arrays that can target desired sequences, many selection methods have been developed. In some embodiments, the initial selection effort uses phage display to select proteins that bind to a given DNA target from a large pool of partially randomized zinc finger arrays. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. To generate zinc finger arrays that can target desired sequences, many selection methods have been developed. In some embodiments, the initial selection effort uses phage display to select proteins that bind to a given DNA target from a large pool of partially randomized zinc finger arrays. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence. In some embodiments, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems (e.g., the "OPEN" system), and mammalian cells are used to select proteins that bind to a given DNA. In particular, the OPEN system combines a pre-selected pool of individual zinc fingers selected to bind a given triplet, and then uses a second selection to obtain a 3-finger array that can bind the desired 9-bp sequence.

[0083] In some embodiments, the process of editing the PERV gene sequence is within the genome A zinc that can recognize a PERV array and cleave a site in the PERV gene array Introducing into a cell at least one nucleic acid encoding a zinc finger nuclease . In some embodiments, the process is substantially sequence identical to either side of the cleavage site At least one donor polynucleotide comprising an integration sequence flanked by upstream and downstream sequences sharing identity Further comprising introducing. In some embodiments, the pro The cess is substantially identical to a portion of the genomic PERV sequence at the cleavage site and further comprises at least one Introducing at least one exchange polynucleotide comprising a sequence further comprising nucleotide changes . In some embodiments, the zinc finger nuclease Culturing the cells to allow expression of the zinc finger nuclease such that the zinc finger nuclease introduces a double-strand break into the genomic PERV sequence . In some embodiments, the double-strand break is repaired by a non-homologous end-joining repair process, thereby introducing a silencing or inactivating mutation Into the chromosomal sequence. In some embodiments, the double-strand break is repaired by a homology-directed repair Process, whereby the sequence of the donor polynucleotide is integrated into the genomic PERV Sequence, or the sequence of the exchange polynucleotide is exchanged with a portion of the chromosomal sequence .

[0084] In some embodiments, the zinc finger nuclease targets the nucleotide sequence of PERV . In some embodiments, the zinc finger nuclease Targets nucleotide sequences conserved across more than one strain of PERV. In some Embodiments, the zinc finger nuclease is PERV pol, en ​targets the v, and / or gag gene. In some embodiments, the zinc finger nuclease targets the PERV pol gene. In some embodiments , the zinc finger nuclease targets the sequence encoding the catalytic core of the PERV pol gene .

[0085] C. CRISPR-based agents In some embodiments, the agent is a CRISPR-based agent. In some embodiments, the CRISPR-based agent is one or more polynucleotides that are involved in the expression of or indicate the activity of a CRISPR-associated (「Cas」) gene, including but not limited to the sequence encoding the Cas gene, the tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or the active portion trac rRNA), the tracr-mate sequence (「including direct repeats and the portion of direct repeats processed by tracrRNA in the context of the endogenous CRISPR system」), the guide sequence (also referred to as 「spacer」 in the context of the endogenous CRISPR system) , and / or other sequences and transcripts from the CRISPR locus. In some embodiments, the CRISPR-based agent is a polynucleotide encoding at least one CRISPR protein and one or more guide RNAs (gRNAs). In some embodiments, the one or more gRNAs are homologous to the PERV polynucleotide sequence and contain a sequence capable of binding to a protospacer adjacent motif (「PAM」 ). In some embodiments, the PAM includes the sequence NG G or NNGRRT. .​​​​

[0086] In some embodiments, the agent is a CRISPR-based polypeptide or a fragment or derivative thereof that targets one or more PERV DNA sequences in PERV cells. In some embodiments, the CRISPR-based agent is characterized by an element that promotes the formation of the CRISPR complex at a site of a PERV DNA or RNA sequence. In some embodiments, the CRISPR-based agent is one or more CRISPR / Cas endonucleases or biologically active fragments or derivatives thereof, or one or more nucleic acids encoding one or more CRISPR / Cas polypeptides or fragments or derivatives thereof. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is derived from a CRISPR type I system. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is derived from a CRISPR type II system. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is derived from a CRISPR type III system. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is derived from a CRISPR type IV system. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is derived from a CRISPR type V system. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is derived from a CRISPR type VI system. In some embodiments, the CRISPR / Cas endonuclease or derivative thereof is CRISPR IIA, I ​​​​​​​​​​​It is from a type IB or IIC system. In some embodiments, the CRIS PR / Cas endonuclease or a derivative thereof is from a CRISPR IIC type system. In some embodiments, the type II CRISPR / Cas endonuclease is Cas9 or a derivative thereof. In some embodiments, the CRISPR / Ca s endonuclease or a derivative thereof is a type V CRISPR / Cas endonuclease , such as Cpf1, or a derivative thereof. In some embodiments, the site-specific modification polypeptide is a type III-B Cmr complex, such as a type III-B Cmr complex derived from Pyrococcus furiosus, Sulfolobus solfataricus, or Therm us thermophilus. See, for example, Hale, C. R. et al. Genes & Developme nt, 2014, 28:2432-2443, and Makarova K.S. e t al. Nature Reviews Microbiology, 2015,

[0087] In certain embodiments, the CRISPR-based agent utilizes a type II cas9 endonuclease. In some embodiments, the CRISPR-based agent comprises a type II cas9 endonuclease and an additional polynucleotide. In some embodiments, the additional polynucleotide is a tracrRNA, a crRNA (also referred to as a "tra cr mate RNA") and / or a synthetic single guide RNA (sgRNA). See, for example, Jinek, M., et al. (2012) Science, See 337, 816 - 821.

[0088] In some embodiments, the CRISPR - based agent is a Cas protein that lacks the ability to cleave double - stranded DNA. In some embodiments, the Cas protein can cleave only one strand of DNA, i.e., the Cas protein is a "nickase". In some embodiments, the Cas protein cannot cleave either strand of DNA. In some embodiments, the Cas protein is a Cas9 protein that has been mutated to be a nickase or to lack the ability to cleave either strand of DNA. In some embodiments, the Cas9 protein has D10A and / or H840A mutations. In some embodiments, the agent is a polynucleotide encoding a Cas9 protein having D10A and / or H840A mutations. For example, see Cong L., et al. (2013) Science, 339, 819 - 823; Jinek, M., et al. (2012) Science, 337, 816 - 821; Gasiunas, G., et al. (2012) Proc. Natl. Acad. Sci. U S A, 109, E2579 - 2586; and Mali, P., et al. (2013) Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. In some embodiments, the agent contains a gRNA. In some embodiments, the gRNA targets the nucleotide sequence of PERV. For example, see Cong L., et al. (2013) Science, 339, 819 - 823; Jinek, M., et al. (2012) Science, 337, 816 - 821; Gasiunas, G., et al. (2012) Proc. Natl. Acad. Sci. U S A, 109, E2579 - 2586; and Mali, P., et al. (2013) Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. Science, 339, 819 - 823; Jinek, M., et al. (2012) Science, 337, 816 - 821; Gasiunas, G., et al. (2012) Proc. Natl. Acad. Sci. U S A, 109, E2579 - 2586; and Mali, P., et al. (2013) Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. Science, 337, 816 - 821; Gasiunas, G., et al. (2012) Proc. Natl. Acad. Sci. U S A, 109, E2579 - 2586; and Mali, P., et al. (2013) Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. Proc. Natl. Acad. Sci. U S A, 109, E2579 - 2586; and Mali, P., et al. (2013) Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. 109, E2579 - 2586; and Mali, P., et al. (2013) Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. Science, 339, 823 - 826; each of which is incorporated herein by reference in its entirety. Each of these is incorporated herein by reference in its entirety.

[0089] In some embodiments, the CRISPR - based agent contains a gRNA. In some embodiments, the gRNA targets the nucleotide sequence of PERV. In that embodiment, the gRNA targets nucleotide sequences conserved across more than one strain of PERV. In some embodiments, the gRNA targets the PERV pol, env, and / or gag genes. In some embodiments, the gRNA targets the PERV pol gene. In some embodiments, the gRN A targets the sequence encoding the catalytic core of the PERV pol gene. In some embodiments, the gRNA targets the non-catalytic core region of the PERV pol gene. In some embodiments, the non-catalytic core region of the PERV pol gene is upstream of the catalytic core region of the PERV po l gene.

[0090] In some embodiments, the gRNA comprises any one of the nucleotide sequences of SEQ ID NOs: 1-3 or 26-116, fragments thereof, or strain-specific genetic variants thereof. In certain embodiments, the gRNA comprises any one of the nucleotide sequences of SEQ ID NOs: 1-3, fragments thereof, or strain-specific genetic variants thereof. In some embodiments, the g RNA comprises any one of the nucleotide sequences of SEQ ID NOs: 1-3 or 26-181 fragments (e.g., protospacers), combinations thereof, or any strain-specific genetic var iants thereof. It will be well understood by those skilled in the art that the guide RNA cleavage site on the genome is composed of a 20bp protospacer, typically followed by a 3pbPAM sequence (NGG, where N can be any nucleotide), and that the 20bp protospacer pairs with Cas9 and is used as a guide RNA for genome cleavage. Truncation of the first 1-3 bp of the protospacer (e.g., truncated gRNA (“tru-gRNA”)) has also been established to achieve a similar cleavage effect . See, for example, Fu Y., et al. (2014) Nature, 32(3) , 279-284. In the case of tru-gRNA, when the last 17-19 bp of the gRNA are identical and the first 1-3 bp are truncated, the genomic target sequence is considered the same . In some embodiments, the agent comprises at least three guide RNAs , where the three guide RNA sequences comprise the nucleotide sequences of SEQ ID NOs: 1-3. In other embodiments, at least one guide RNA comprises any one of the nucleotide sequences of SEQ ID NOs: 35, 36, 48, 99, , 101, 102, 106, 108, 111, 113, a fragment (e.g., a protospacer), any strain-specific genetic variant, or any combination thereof . The agent comprises at least two guide RNAs, at least three guide RNAs, at least

[0091] four guide RNAs, at least five guide RNAs, at least six guide RNAs, at least seven guide RNAs, at least eight guide RNAs, at least nine guide RNAs, at least ten guide RNAs, at least eleven guide RNAs, at least twelve guide RNAs, at least thirteen guide RNAs, at least fourteen guide RNAs, at least fifteen guide RNAs, at least sixty guide RNAs, at least seventeen guide RNAs, at least eighteen guide RNAs, at least nineteen guide RNAs, at least about twenty guide RNAs, at least about thirty guide RNAs . ​ , at least about 40 guide RNAs, at least about 50 guide RNAs, at least about 60 guide RNAs, at least about 70 guide RNAs, at least about 80 guide RNAs, at least about 90 guide RNAs, at least about 100 guide RNAs , or more, are included.

[0092] In some embodiments, the agent comprises at least two guide RNAs. In some embodiments, when using at least two guide RNAs, at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 6 0%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 9 6%, about 97%, about 98%, about 99% or 100% of the PER in the cell becomes inactive. In some embodiments, when using at least two guide RNAs, at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% of the cells in the cell population are PERVs that are inactivated by at least about 95%, about 96%, about 97%, about 98

[0093] [Table 1]

[0094] In some embodiments, the agent comprises at least three guide RNAs. In some In some embodiments, using at least three guide RNAs results in inactivation of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 6 0%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 9 6%, about 97%, about 98%, about 99% or 100% of PERV in the cell. In some embodiments using at least three guide RNAs results in at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% of the cells in the cell population being PERVs inactivated by at least about 95%, about 96%, about 97%, about 98 %, about 99% or 100%. Non-limiting combinations of guide RNAs include, for example, the combinations listed in the following table.

[0095]

[0096] In some embodiments, the agent comprises at least four guide RNAs. In some embodiments, using at least four guide RNAs results in inactivation of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 6 0%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 9 6%, about 97%, about 98%, about 99% or 100% of PERV in the cell. In some embodiments using at least four guide RNAs results in at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% of the cells in the cell population being PERVs inactivated by at least about 95%, about 96%, about 97%, about 98 About 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% are PERVs that are inactivated by at least about 95%, about 96%, about 97%, about 98 %, about 99% or 100%. Non-limiting combinations of guide RNAs include, for example, the combinations listed in the following table. For example, the combinations listed in the following table are included.

[0097] [Table 3]

[0098] In some embodiments, the agent comprises at least five guide RNAs. In some embodiments, using at least five guide RNAs results in inactivation of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 6 0%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 9 6%, about 97%, about 98%, about 99% or 100% of the PERVs in the cells. In some embodiments using at least five guide RNAs results in at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% of the cells in the cell population being PERVs that are inactivated by at least about 95%, about 96%, about 97%, about 98 %, about 99% or 100%. Non-limiting combinations of guide RNAs include, for example, the combinations listed in the following table. about 98%, about 99% or 100% are PERVs that are inactivated by at least about 95%, about 96%, about 97%, about 98 %, about 99% or 100%. Non-limiting combinations of guide RNAs include, for example, the combinations listed in the following table. For example, the combinations listed in the following table are included.

[0099] [Table 4]

[0100] In some embodiments, at least two guide RNAs in the PERV KO (e.g., 2–10 guide RNAs) would result in deletions in the PERV pol sequence. In some embodiments, the deletion is greater than 1 bp, greater than 2 bp, greater than 3bp, greater than 4bp, greater than 5bp, greater than 6bp, Larger than 7bp, larger than 8bp, larger than 9bp, larger than about 10bp less than about 15 bp, more than about 20 bp, more than about 25 bp, and Greater than 0 bp, greater than about 35 bp, greater than about 40 bp, and less than about 45 bp Larger than about 50 bp, larger than about 55 bp, larger than about 60 bp Less than about 65 bp, more than about 70 bp, more than about 75 bp, more than about 8 Greater than 0 bp, greater than about 85 bp, greater than about 90 bp, and less than about 95 bp greater than about 100 bp, greater than about 125 bp, greater than about 130 bp Larger than about 135 bp, larger than about 140 bp, and larger than about 145 bp Large, greater than about 150 bp, greater than about 200 bp.

[0101] In some embodiments, one or more elements of a CRISPR-based agent has been reported in a specific organism that contains an endogenous CRISPR system, Streptococcus p yogenes, Staphylococcus aureus, Neisseri a meningitidis, Streptococcus thermophil us or Treponema denticola.

[0102] In some embodiments, the CRISPR-based agent is any combination of the CRISPR-based polypeptides / proteins and CRISPR-based polynucleotides disclosed herein. For example, in some embodiments, the CR ISPR-based agent comprises a Cas endonuclease and a guide RNA. In some embodiments, the CRISPR-based agent comprises a CAS endonuclease, a tracrRNA, and a TRACR-mate sequence. In some embodiments the tracrRNA and the tracr-mate sequence are designed to be within the same molecule. In some embodiments, the CRISPR-based agent is one or more polynucleotides encoding any of the foregoing. In some embodiments, the CRISPR-based agent is a chimeric RNA such as CRISPR-Cas system RNA. In some embodiments, the CRISP R-based agent has at least one second guide sequence capable of hybridizing to a nucleic acid molecule for expression of the components of the CRISPR-Cas complex to reduce or eliminate functional expression of the system or complex. Thereby, the system or complex can be self-inactivated. And, the second guide sequence may be capable of hybridizing to a nucleic acid molecule for expression of the CRISPR enzyme. In some embodiments, the present disclosure is based on the CRISPR disclosed herein.

[0103] In some embodiments, the CRISPR-based agent is a chimeric RNA such as CRISPR-Cas system RNA. In some embodiments, the CRISP R-based agent has at least one second guide sequence capable of hybridizing to a nucleic acid molecule for expression of the components of the CRISPR-Cas complex to reduce or eliminate functional expression of the system or complex. Thereby, the system or complex can be self-inactivated. And, the second guide sequence may be capable of hybridizing to a nucleic acid molecule for expression of the CRISPR enzyme. In some embodiments, the CRISPR-based agent is a chimeric RNA such as CRISPR-Cas system RNA. In some embodiments, the CRISP R-based agent has at least one second guide sequence capable of hybridizing to a nucleic acid molecule for expression of the components of the CRISPR-Cas complex to reduce or eliminate functional expression of the system or complex. Thereby, the system or complex can be self-inactivated. And, the second guide sequence may be capable of hybridizing to a nucleic acid molecule for expression of the CRISPR enzyme. In some embodiments, the CRISPR-based agent is a chimeric RNA such as CRISPR-Cas system RNA. In some embodiments, the CRISP R-based agent has at least one second guide sequence capable of hybridizing to a nucleic acid molecule for expression of the components of the CRISPR-Cas complex to reduce or eliminate functional expression of the system or complex. Thereby, the system or complex can be self-inactivated. And,

[0104] In some embodiments, the present disclosure is based on the CRISPR disclosed herein. Provided is a method of using any of the effector substances. In some embodiments, the present disclosure provides an effective means for modifying the PERV polynucleotide sequence by utilizing any of the CRISPR-based effector substances disclosed herein. The CRISPR complex of the present invention has a variety of utilities, including modifying (e.g., deleting, inactivating) the PERV polynucleotide sequence in different types of cells from various tissues and organs. As such, the CRISPR complex of the present invention has broad applications, for example, in gene or genome editing. In some embodiments, the present disclosure provides an amount of one or more vectors encoding at least one CRISPR protein and one or more guide RNAs ( gRNAs) respectively, and administering the one or more vectors to a mammal, thereby providing an in vivo method of genome editing. Here, the in vivo expression of the one or more vectors involves the binding of the CRISPR protein to the PERV locus homologous to the gRNA and the generation of double-strand breaks (DSBs) in vivo in a mammalian cell population.

[0105] Here, the in vivo homologous recombination (HR) of the DSBs results in the editing of the genome of the mammalian cell population. In some embodiments, the CRISPR protein is cas9, and the one or more gRNAs include sequences capable of binding to a protospacer adjacent motif (''PAM''). In some embodiments, HR introduces missense or nonsense of the protein expressed at the PERV locus, resulting in non-homologous end joining (N ). ). ). ). ). ). ). ). ). ). ). ). includes HEJ).

[0106] In some embodiments, the CRISPR-based agent further comprises a portion that regulates PERV expression In some embodiments, the CRISPR-based agent is a fusion protein comprising a transcriptional repressor domain In some embodiments, the transcriptional repressor domain is a Krüppel-associated box (KRAB).

[0107] D. Improvement in the health / survival of genetically modified cells In some aspects, the health and / or survival of any of the genetically modified porcine cells described herein may be impaired as a result of the genetic modification process (e.g., multiple DNA damage effects). In these situations, it may be advantageous to treat the genetically modified cell(s) with one or more factors that improve the health and / or survival of the genetically modified cell(s).

[0108] In some aspects, both a p53 inhibitor and a growth factor are administered to one or more genetically modified cells In certain embodiments, both bFGF and pifithrin-alpha are administered to one or more genetically modified cells

[0109] IV. Methods of treatment In some embodiments, any of the genetically modified porcine cells, tissues, or organs disclosed herein can be used to treat a non-porcine subject. In some embodiments, the disclosure provides a method of transplanting any of the genetically modified cells, tissues, or organs described herein into a non-porcine subject in need thereof. In some embodiments, the non-porcine subject is a human. In some embodiments, the subject is a non-human primate ​​​​​​​​​

[0110] In some embodiments, for use in any of the methods disclosed herein Genetically modified organs for this purpose include the heart, lungs, brain, liver, basal ganglia, and brain from genetically modified pigs. Stem medulla, midbrain, pons, cerebellum, cerebral cortex, hypothalamus, eyes, pituitary gland, thyroid gland, parathyroid gland, esophagus , thymus, adrenal glands, appendix, bladder, gallbladder, small intestine, large intestine, small intestine, kidneys, pancreas, spleen, stomach, skin, The tissue may be selected from the prostate, testis, ovary, and / or uterus. In accordance with the present invention, a genetically modified tissue for use in any of the methods disclosed herein comprises a gene Modified porcine cartilage (e.g., esophageal cartilage, knee cartilage, ear cartilage, nasal cartilage), smooth muscle, and heart Muscles (including but not limited to), tendons, ligaments, bones (e.g., bone marrow), such as (heart valves, etc.) In some embodiments, the tissue may be selected from the group consisting of the cornea, the middle ear, and the vein. The genetically modified cells for use in any of the methods disclosed herein may be blood cells, skin follicles, hair follicles, Any part of an organ or tissue (e.g., the eye, such as the cornea) may be used. The composition of the present invention can also be administered to the cerebral cortex (part of the cerebral cortex).

[0111] In some embodiments, the present disclosure provides a method for treating damage, loss or deficiency of organ, tissue or cell function. The present invention provides for treating a subject having a disease, disorder, or injury that results in the In embodiments, the subject is treated with a wound that results in damage to one or more cells, tissues, or organs of the subject. In some embodiments, the subject has suffered injury or trauma (e.g., a car accident). In some embodiments, the subject has received a fire or acid burn. In some embodiments, the subject has a disease or disorder that results in an impairment, loss, or lack of function. Moreover, the subject suffers from an autoimmune disease. In some embodiments, the disease is a heart disease such as (for example) atherosclerosis, dilated cardiomyopathy, severe coronary artery disease, scarred heart tissue, congenital heart abnormalities, type I or type II diabetes, hepatitis, cystic fibrosis, cirrhosis, renal failure, lupus, scleroderma, IgA nephropathy, polycystic kidney disease, myocardial infarction, emphysema, chronic bronchitis, obstructive bronchiolitis, pulmonary hypertension, congenital diaphragmatic hernia, congenital surfactant protein B deficiency, and congenital cystic emphysema, primary biliary cholangitis, sclerosing cholangitis, biliary atresia, alcohol dependence, Wilson's disease, hemochromatosis, and / or alpha-1 antitrypsin deficiency, and is

[0112] selected from the group consisting of. In some embodiments, any of the genetically modified cells, tissues, and / or organs of the present disclosure are isolated from a genetically modified donor pig and administered to a non-pig subject host. As used in this context, "administering" or "administration" includes introducing, applying, injecting, implanting, grafting, suturing, and transplanting, but is not limited thereto. According to the present disclosure, the genetically modified cells, tissues, and / or organs can be administered by a method or route that results in the localization of the organs, tissues, cells, or compositions of the present invention at a desired site. The organs, tissues, cells, or compositions of the present invention can be administered to a subject by any suitable route that results in the delivery of cells to a desired location in the subject such that at least a portion of the cells 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100 % (administered separately, or as part of a tissue or organ) remains viable after administration to a subject. The method of administering the organ, tissue, cell or composition of the present invention is well known in the art. In some embodiments, the cell, tissue and / or organ is transplanted into the host. In some embodiments, the cell is injected into the host. In some embodiments, the cell, tissue and / or organ is grafted onto the surface of the host (e.g., bone or skin). In some embodiments, it is necessary to protect the genetically modified cell(s), tissue(s) or

[0113] organ(s) from the immune system of the host to which the genetically modified cell(s), tissue(s) or organ(s) is administered. For example, in some embodiments the genetically modified cell(s), tissue(s) or organ(s) is administered together with a matrix or coating (e.g., gelatin) to protect the genetically modified cell(s), tissue(s) or organ(s) from the immune response of the host. In some embodiments, the matrix or coating is a biodegradable matrix or coating. In some embodiments, the matrix or coating is natural. In other embodiments, the matrix or coating is synthetic. In some embodiments, the genetically modified cell(s), tissue(s) or organ(s) is administered together with a matrix or coating (e.g., gelatin) to protect the genetically modified cell(s), tissue(s) or organ(s) from the immune response of the host. In some embodiments, the matrix or coating is a biodegradable matrix

[0114] In some embodiments, the genetically modified cell(s), tissue(s) or The organ(s) is / are administered together with an immunosuppressive compound. In some embodiments, the immunosuppressive compound is a small molecule, a peptide, an antibody, and / or a nucleic acid (e.g., an antisense or a siRNA molecule). In some embodiments, the immunosuppressive compound is a small molecule . In some embodiments, the small molecule is a steroid, an mTOR inhibitor, a calcineurin inhibitor, an anti-proliferative agent, or an IMDH inhibitor. In some embodiments, the small molecule is a corticosteroid (e.g., prednisone, budesonide, prednisolone), a calcineurin inhibitor (e.g., cyclosporine, tacrolimus), an mTOR inhibitor (e.g everolimus), an IMDH inhibitor (azathioprine, leflunomide, mycophenolate), an antibiotic (e.g., dactinomycin, anthracycline, macromycin C, bleomycin, mitomycin), and methotrexate, or a salt or derivative thereof selected from the group consisting of. In some embodiments, the immunosuppressive compound is a polypeptide selected from the group consisting of CTLA4, an anti-b7 antibody, abatacept, adalimumab, anakinra, certolizumab , etanercept, golimumab, infliximab, ixekizumab, natalizumab, rituximab, secukinumab, tocilizumab, tocilizumab, ustekinumab, vedolizumab , basiliximab, daclizumab, and muromonab.

[0115] In some embodiments, the gene-modified cell(s), tissue(s), or organ(s) administered to the subject is / are further gene-modified such that their potential to induce an immune response in the subject is low. In some embodiments, genetically modified The resulting cell(s), tissue(s), or organ(s) are further genetically modified to not express functional immune stimulatory molecules.

Examples

[0116] Examples The present disclosure is now generally described. By referring to the following examples, it will be more readily understood that these are included only for the purpose of exemplifying specific aspects and embodiments of the present disclosure, and are not intended to limit the present disclosure. For example, the specific constructs and experimental designs disclosed in this specification represent exemplary tools and methods for verifying appropriate functions. Thus, it will be readily apparent that any of the specific constructs and experimental plans disclosed can be replaced within the scope of the present disclosure. The specific constructs and experimental designs disclosed in this specification represent exemplary tools and methods for verifying appropriate functions. Thus, it will be readily apparent that any of the specific constructs and experimental plans disclosed can be replaced within the scope of the present disclosure.

[0117] Example 1. PERV Infects, Replicates, and Propagates in Human Cells Clinicians have feared that PERV present in porcine donor organs or tissues may infect human host cells. To determine whether PERV maintains activity and propagates in human cells after infection, the PERV copy number was monitored for over 4 months in both a population and a clone of PERV-infected HEK293 T-GFP cells (i-HEK293T-GFP). The PERV copy number increased over time as determined by droplet digital PCR (ddPCR) (Figure 1A). There are three major subtypes of PERV: PERV-A, PERV-B, and P ERV-C. Subtypes A and B are ubiquitous and have been reported to be able to infect from pigs to humans, whereas subtype C is present only in some porcine strains and can only be transmitted between pigs (Patience et al to humans, whereas subtype C is present only in some porcine strains and can only be transmitted between pigs (Patience et al ). , 2001, J. Virol., 75, 2771-5). Consistent with previous reports , PERV-A and PERV-B were detected in infected human cells (data not shown) , and it was confirmed that they are human-directed. However, PERV-C was not detected in either PK15 or i- HEK293T-GFP cells (data not shown). PER To determine whether V is integrated into the human genome or remains episomal in infected human cells , junction capture sequencing was performed on infected clone i-HEK293T-GFP cells . Novel PERV junctions were detected in the human genome. These PERV junctions are overrepresented in the gene internal region (15 out of 22 detected junctions) (Figure 1B). Furthermore, the PERV insertion sites have significantly higher transcription levels, DNase sensitivity, and H3K27 acetylation than randomly selected genomic positions (Figure 4B), suggesting that PERV tends to integrate into transcriptionally active regions .

[0118] To determine whether the increase in the copy number of PERV in i-HEK293T-GFP clones is due to intracellular PERV replication or intercellular PERV transmission between human cells, clone i-HEK293T-GFP cells were co-cultured with WT HEK293T cells for 2 weeks . Subsequently, the PERV elements of the co-cultured WT clones were evaluated by PCR (Figure 1C and 1D ). The presence of the PERV pol, env, and gag genes was detected in WT HEK293 cells without a history of contact with porcine cells . The percentage of infected WT HEK293T cells varied from 18 % to 97%, and the low P of the parental i-HEK293T-GFP clone in co-culture Having low and high ratios corresponding to the ERV copy number and the high PERV copy number, respectively (Figure 1E). These results indicate that infected human cells can transmit PERV to a fresh human cell population . Therefore, there is a risk of PERV transmission to the human host in the context of xenotransplantation, and it is necessary to eliminate this risk by producing PERV-free pigs .

[0119] Example 2. Primary cells of PERV-free pigs The production of PERV-free pigs involves the production of primary porcine cells lacking PERV activity, which can be cloned via somatic cell nuclear transfer (SCNT) to produce porcine embryos . The porcine fetal fibroblast cell line (FFF3) was selected and modified to generate primary porcine cells without PERV . First, the mapping and characterization of PERV present in the FFF3 genome were performed . The copy number of functional PERV was estimated to be approximately 25 as determined by ddPCR of the reverse transcriptase (pol) gene (data not shown) . The estimated PERV copy number was close to a total of 10 copies of the PERV-A env gene, 14 copies of the PERV-B env gene, and 0 copies of the PERV-C env gene identified in the genome (data not shown) . Using whole-genome sequencing, one truncated copy of PERV-B was detected . This truncated PERV-B could not be detected previously by ddPCR (data not shown) . PacBio long-read genome sequencing (N50 = 2,439 bp) was performed after PERV-specific hybridization capture . The results showed 21 copies of PERV .

[0120] pies ​​Pigs were mapped to non-repetitive regions of the genome (Figure 2A). Two additional copies were mapped to repetitive regions and two could not be mapped to the current pig genome assembly (11% g aps, Sus scrofa build 10.2) (Groenen et a l., 2012, Nature, 491:393-8). To target these PERVs for inactivation, three CRISPR guide RNAs (gRNAs) specific to the catalytic core of the PERV pol gene having the sequences of SEQ ID NOs: 1-3, respectively, were designed. A population of FR IS cells was treated with CRISPR-Cas9 and the three gRNAs for 12 days, after which 37% of the PERV pol loci had acquired inactivating mutations. Interestingly, the results showed a bimodal distribution of targeting efficiency among single cells. Approximately 34% (8 out of 23 ) of the single cells had high editing efficiency (>90%) and 60% (14 out of 23) of the single cells had low editing efficiency (<20%). This is probably the result of genetic conversion of repetitive sequence targeting (Yang et al., 2015, Science, 80 :350). Surprisingly, despite the presence of highly modified cells in the population, no high-efficiency single-cell FFF3 clones were obtained by the above procedure (Figure 2B) ). To determine whether simultaneous DNA cleavage by Cas9 at multiple sites in the FFF3 genome can cause senescence or apoptosis induced by DNA damage inhibition of the senescence and / or apoptosis pathways was examined to see if the targeting efficiency of the FFF3 population could be increased and whether the survival rate of highly modified clones could be increased .

[0121] ​​​​​​It was determined whether it was possible. During gene modification, a cocktail containing a p53 inhibitor, pifithrin-alpha (PF Tα), and the growth factor bFGF was applied, and the average targeting efficiency of the resulting FFF3 population was significantly improved (Figure 5A (ANOVA, p = 0.00002 ), Figure 5B). Furthermore, when the SV40 large T antigen , an inhibitor of both the p53 and Rb pathways, was transiently overexpressed, the average targeting efficiency was improved (Figure 6A, one-sided Wilcoxon signed rank test, p = 0.05). On the contrary, overexpression of Bcl-2, an apoptosis inhibitor , did not increase the average targeting efficiency (Figure 5C, ANOVA, p = 0.565). The PFTα and bFGF cocktail was used because it was highly efficient, had low cytotoxicity, and was easy to control. Using this optimized cocktail, 100% PERV-inactivated FFF3 cells were isolated from the population treated with CRISPR-Ca s9 (Figure 2C, 2D). 2D).

[0122] RNA-seq (Figure 7) was performed on 100% PERV-inactivated FFF3 clones. As a result, it was confirmed that all pol transcripts were mutated. Furthermore, the effects of genome-wide disruption of PERV pol and its role in the in vitro production of PERV from FFF3 were investigated. No reverse transcriptase (RT) activity of PERV was detected in the cell culture supernatant of 100% PERV-inactivated FFF3 (Figure 2E). Furthermore, strong RT activity was observed in WT FFF3, suggesting that the modified cells produced few or no PERV particles . . . .

[0123] The off-target effect of CRISPR-Cas9 in 100% PERV-inactivated cells To examine this, karyotype analysis was performed. The results of the karyotype analysis showed a normal chromosome structure ( data not shown). To examine the integrity of the chromosomes at a higher resolution, junction PCR reactions were performed to check the integrity of all PERV genomic junctions on one side that would be lost in the PERV-PERV deletion. All junctions tested remained intact, indicating that no PERV-PERV deletions were detected in these regions. The primers used in the junction PCR reactions are shown in Figure 8. Thus, in FFF3 inactivated with 100% PERV, no detection of off-target effects or on-target genomic damage caused by CRISPR-Cas9 was found.

[0124] Example 3. PERV-free embryos After obtaining FFF3 cells with 100% eradication of PERV activity, somatic cell nuclear transfer (SCNT) was used to generate P ERV-free embryos. Handmade pig cloning (Du et al., 2007, Theriogenology, 68:1104-10) was used, and pig embryos with an efficiency of 50-78% were successfully cloned. These embryos grew in culture for 7 days and reached the blastocyst stage. A normal blastocyst structure was observed. Furthermore, on day 7, the pluripotency of the inner cell mass (SOX2+) was verified (Figure 3A).

[0125] Using the PERV-free FFF3 cell line, additional rounds of pig cloning via somatic cell nuclear transfer were performed and transferred to surrogate mothers (250 transplanted embryos). On day 49 after embryo transfer, the fetuses were collected from one breeding sow by cesarean section. Four live fetuses were isolated from the breeding sow. The inactivation level of PERV and the copy number of PERV were determined by ddPCR ​​ was checked by. The results showed that there was no reinfection of PE RV in the fetuses produced from the PERV-free cell line (Figure 3B). The fetuses had the same PERV inactivation efficiency (100%, Figure 3B) and PERV copy number (data not shown) as the original PERV-free cell line . A second round of porcine cloning was performed using cell lines derived from PERV-free fetuses .

[0126] Example 4. Piglets without PERV

[0127] PERV-free embryos generated by SCNT from FFF3 with 100% extinguished PERV activity were transplanted into surrogate mothers (250 embryo transplants / female breeding pigs). Fetal genomic DNA was used to measure the PERV inactivation efficiency. Similar to the original PERV-free cell line, P ERV-KO fetuses also showed a ~100% PERV inactivation efficiency. This suggests that there was no reinfection from surrogate breeding female pigs during pregnancy (Figure 16A and 16B ). Surprisingly, even when multiple gene edits were performed, piglets were born completely PERV-free after 3 months, 3 weeks, and 3 days (Figures 9 and 10). 16 PERV-free piglets were produced, 3 of which were born by cesarean section, 13 of which were born naturally , and 2 of the 13 died during natural childbirth. DNA was isolated from mRNA from various tissues of all piglets and dead piglets, and reinfection of PERV was confirmed by deep sequencing for both piglets born by cesarean section and naturally . The results showed that all piglets showed 100% PERV eradication at both the genomic DNA and mRNA levels . DNA was isolated from mRNA from various tissues of all piglets and dead piglets, and reinfection of PERV was confirmed by deep sequencing for both piglets born by cesarean section and naturally born. The results showed that all piglets showed 100% PERV eradication at both the genomic DNA and mRNA levels . was shown. Also, piglets maintained in facilities with WT did not show any reinfection (Figure 17). All PERV-free pigs showed PERV copy numbers similar to WT FFF3 cells (Figure 19) and normal karyotypes (Figure 20).

[0128] In summary, this data clearly establishes that porcine cells can transmit PERV to primary human cells in vitro. A notable observation from this study was that PERV-infected human cells robustly passed PERV to fresh human cells with no history of contact with porcine cells. Therefore, it is thought that it may be necessary to eliminate the risk of PERV infection before human trials of xenotransplantation. These studies demonstrate the complete eradication of PERV activity in clonable primary porcine fibroblasts. Furthermore, the production of PERV-inactivated porcine embryos, fetuses, and piglets using modified fibroblasts, and the absence of reinfection by surrogate breeding sows have also been demonstrated. PERV-free pigs are the first mammals lacking an active endogenous retrovirus, providing insight into the biological functions of these host-related elements. Most importantly, PERV-free pigs may serve as a safe source of organs and tissues for xenotransplantation from pigs to humans. The severe shortage of organs for transplantation is a major challenge for the medical treatment of organ failure, so this would be a very important and much-awaited biomedical advance.

[0129] Method CRISPR-cas9 gRNA design Using the R library DECIPHER, specific gRNAs with amino acid sequences of SEQ ID NOs: 1-3 were designed. ​​​​​​​​​

[0130] Cell culture Porcine PK15 and human HEK293T cells were maintained in Dulbecco's Modified Eagle Medium (DMEM , Invitrogen) high glucose supplemented with 10% fetal bovine serum (Invitrog en) and 1% penicillin / streptomycin (Pen / Strep, Invitro gen) containing sodium pyruvate. All cells were maintained in a humidified incubator at 37°C and 5% CO 2.

[0131] Porcine fetal fibroblast FFF3 was maintained in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen) high glucose supplemented with 15% fetal bovine serum (Invitrogen), 1% penicillin / streptomycin (Pen / Strep, Invitrogen) and 1 % HEPES (Thermo Fisher Scientific) containing sodium pyru vate. All cells were maintained in a humidified tri-gas incubator at 38°C, 5% CO2, 90% N2, and 5% O2.

[0132] Construction of PiggyBac-Cas9 / 2gRNAs and establishment of cell lines As previously described by Yang et al, 2015, Science, 80:350, a DNA fragment encoding U6-gRNA1-U6-gRNA2 (Genewiz) was synthesized and incorporated into the previously constructed PiggyBac- cas9 plasmid. To establish the FFF3 cell line with PiggyBac-Cas9 / 2gRNAs inte gration, a commercially available kit (Thermo Fish er Scientific) was used. For the establishment of the FFF3 cell line with PiggyBac-Cas9 / 2gRNAs integration, a commercially available kit (Thermo Fisher Scientific) was used. According to the instructions of Neon Transfection System (Thermo Scientific), 5×10 FFF3 cells were transfected with 16 μg of PiggyBac-Cas9 / 2gRNAs plasmid and 4 μg of Super PiggyBac Transposase plasmid (System Biosciences). To select cells carrying the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. 5 cells were transfected with 16 μg of PiggyBac-Cas9 / 2gRNAs plasmid and 4 μg of Super PiggyBac Transposase plasmid (System Biosciences). To select cells carrying the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. NAs plasmid and 4 μg of Super PiggyBac Transposase plasmid (System Biosciences). To select cells carrying the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. plasmid. To select cells carrying the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. To select cells carrying the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. Based on the negative control of applying puromycin to wild-type FFF3 cells, it was determined that the selection of puromycin was completed in 4 days. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. The FFF3-PiggyBac cell line was subsequently maintained with 2 μg / mL puromycin and 2 μg / mL doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line. cell line.

[0133] To avoid consistent Cas9 expression in the FFF3 cell line, 5×10 cells were transfected with 3 μg of PiggyBac Excision-Only Transposase vector using Lipofectamine 2000 reagent to perform PiggyBac-Cas9 / 2gRNAs excision from the FFF3 genome. Next, the FFF3 cells with PiggyBac-Cas9 / 2gRNAs excised were single-cell sorted into 96-well plates for clonal growth and genotyping. cells were transfected with 3 μg of PiggyBac Excision-Only Transposase vector using Lipofectamine 2000 reagent to perform PiggyBac-Cas9 / 2gRNAs excision from the FFF3 genome. Next, the FFF3 cells with PiggyBac-Cas9 / 2gRNAs excised were single-cell sorted into 96-well plates for clonal growth and genotyping. 5 cells were transfected with 3 μg of PiggyBac Excision-Only Transposase vector using Lipofectamine 2000 reagent to perform PiggyBac-Cas9 / 2gRNAs excision from the FFF3 genome. Next, the FFF3 cells with PiggyBac-Cas9 / 2gRNAs excised were single-cell sorted into 96-well plates for clonal growth and genotyping. To perform PiggyBac-Cas9 / 2gRNAs excision from the FFF3 genome, 5×10 cells were transfected with 3 μg of PiggyBac Excision-Only Transposase vector using Lipofectamine 2000 reagent. Next, the FFF3 cells with PiggyBac-Cas9 / 2gRNAs excised were single-cell sorted into 96-well plates for clonal growth and genotyping. Next, the FFF3 cells with PiggyBac-Cas9 / 2gRNAs excised were single-cell sorted into 96-well plates for clonal growth and genotyping.

[0134] Genotyping of single-cell clones First, puromycin selection followed by PiggyBac excision was performed in FFF3 Pig Performed with the gyBac-Cas9 / 2gRNA cell line. Next, the cells were single-cell sorted and divided into both a 96-well PCR plate for direct genotyping and a 96-well cell culture plate for colony growth.

[0135] To determine the genotype of single FF cells without clonal expansion, the PERV locus from the sorted single cells was directly amplified according to a previously reported single-cell genotyping protocol. Briefly, single cells were sorted into a 96-well PCR plate. Each well had 5 μL of lysis mix, which consisted of 0.5 μL of 10X KAPA Express Extract buffer (KAPA Biosystems), 0.1 μL of 1 U / μL KAPA Express Extract enzyme, and 4.6 μL of water. The lysis reaction was incubated at 75 °C for 15 minutes, after which the reaction was inactivated at 95 °C for 5 minutes. Then all reaction mixtures were added to 20 μL of PCR reaction mixture containing 1x KAPA 2G fast (KAPA Biosystems s) and 0.2 μM PERV Illumina primer (Method Table 2). After incubating the reaction at 95 °C for 3 minutes, 25 cycles of 95 °C, 20 seconds, 59 °C, 20 seconds, and 72 °C, 10 seconds followed. To add the Illumina sequence adapter, 3 μL of the reaction product was added to 20 μL of PCR mix containing 1x KAPA 2G fast (KAPA Biosystems) and 0.3 μM primer containing the Illumina sequence adapter. After incubating the reaction at 95 °C for 3 minutes, 10 cycles of 95 °C, 10 seconds, 59 °C, 20 seconds, and 72 °C, 10 seconds followed. The PCR products were checked on a 2% EX gel (Invitrogen) Hooked, and subsequently, products of 300 - 400 bp were recovered from the gel. Next, these products were mixed in approximately the same amount and purified (QIAquick Gel Extraction Kit ) and sequenced using the MiSeq Personal Sequencer (Illumina). Deep sequencing data were analyzed, and the PERV editing efficiency using CRISPR - GA was determined (Denner et al., 2016, Viruses, 8 :215).

[0136] Primers used in PERVpol genotype analysis Illumina_PERV_pol forward: 5’ - ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGA CTGCCCCAAGGGTTCAA - 3’ (SEQ ID NO: 4) Illumina_PERV_pol reverse: 5’ - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTC TCTCCTGCAAATCTGGGCC - 3’ (SEQ ID NO: 5)

[0137] PERV infectivity test of PK15 WT to GFP - HEK293T and GFP - HEK293T to WT HEK293T 1) PERV infectivity test of PK15 WT to GFP - HEK293T The procedure was the same as the previously described procedure by Yang et al., 2015, Science, 80:350. Briefly, 1x10 cells of Lent 5 i - GFP - HEK293T and 1×10 cells of PK15 WT were co - cultured in a 10 cm dish 5 and grown for one week. High - purity GFP - positive GFP - HEK293T cells were ​​​​ To obtain, continuous cell sorting was performed via flow cytometry. GFP-H EK293T cells were sorted as a bulk and cultured for 125 days. At different time points (d76, d80, and d125), genomic DNA was isolated from the cells, and whether the PERV copy number increased over time was detected via ddPCR. Single cell sorting from bulk cells was performed at different time points. After single cells grew into clones, PERV infection of several clones was first examined by PCR, and then the PERV copy number of PERV-infected clones was quantified via ddPCR.

[0138] 2) PERV Infectivity Test from GFP-HEK293T to WT HEK293T To test whether PERV can be transmitted from humans to human cells, 1×10 cells of PERV-infected HEK293T-GFP (I-HEK293T-GFP) clones 5 were co-cultured with 1×10 5 cells of WT HEK293T for two weeks, and then GFP negative single cells were sorted by flow cytometry. After single cells grew into clones PCR was used to examine PERV infection to detect the infection rates of different i-HEK293T-GFP clones. In particular, the PERV copy number of GFP-negative clones co-cultured with i-HEK293T-GFP clone 10 was quantified by qPCR using the copy number detected by ddPCR of i-HEK293T-GFP clone 10 as a standard marker.

[0139] Reverse Transcriptase (RT) Assay The RT assay was performed as described in Yang et al., 2015, Science, 80: ​​​​​​​It is the same as the protocol previously described by 350. Briefly, to test the RT activity of FFF3 wild type cells and 100% modified FFF3 clones, 5×10 5 cells were seeded in a 10 cm Petri dish, and the supernatant was collected after the cells reached 80% confluence. The medium was first centrifuged at 400 g for 4 minutes to remove cells and debris, and then filtered through a 0.45 μM Millex-HV syringe filter (EMD Millipore Corpora tion). The filtered supernatant was concentrated at 4000 g for 10 minutes using an Amicon Ultra-15 Centrifugal F ilter Unit (EMD Millipore Corporation). Next, the concentrated supernatant was ultracentrifuged at 50,0 00 rpm for 60 minutes. The supernatant was carefully removed, and the virus pellet was completely resuspended and lysed with 20 μL of 10% NP40 at 37° for 60 minutes. The RT reaction was performed using an O mniscript RT Kit (Qiagen). The total volume of the reaction was 20 μL, which contained 1×RT buffer, 0.5 mM dNTP, 0.5 μM inf luenza reverse primer (5‘ CTGCATGACCAGGGTTTATG 3’ )(SEQ ID NO: 6), 100 units of RnaseOUT (Life Technolog y, Invitrogen), 100 units of SuperRnase Inhibitor (Life Technologies), 5 μL of sample lysate, and 40 ng of ID T synthetic influenza RNA template (which was resistant to Rnas e at both the 5‘ and 3’ ends). The RNA template sequence was 5’ rA*rA*rC*rA*rU*rGrGrArArCrCrUrUrUrGr ​GrCrCrCrUrGrUrUrCrArUrUrUrUrArGrArArArUr CrArArGrUrCrArArGrArUrArCrGrCrArGrArArG rArGrUrArGrArCrArUrArArArCrCrCrUrGrG rUr CrArUrGrCrArGrArCrCrU*rC*rA*rG*rU*rG 3’ (* Phosphodiester bond) (SEQ ID NO: 7) It was. After the RT reaction was completed, the RT product was subjected to influenza forward (5’ AC CTTTGGCCCTGTTCATTT 3’) (SEQ ID NO: 8) and influenza reverse - primer (the above sequence) by PCR. The expected size of the amplicon was 72 bp.

[0140] Quantification of PERV copy number As previously described in Yang et al., 2015, Science, 80:350 As described above, Droplet Digital PCR (registered trademark) (ddPCR (registered trademark )) was used to quantify the copy number of PERV according to the manufacturer's instructions (BioRad) Briefly, genomic DNA was extracted from cultured cells (DNeasy Blood&T issue Kit, Qiagen), and 50 ng of genomic DNA was digested with MseI (10 U) at 37 °C for 3 hours, followed by inactivation at 65 °C for 10 minutes. Then ddP CR reaction was prepared. The reaction mixture contained 1x ddPCR Master mix, 1 μL of 18 μM target primer and 5 μM target probe (VIC), 1 μL of 1 8 μM reference primer and 5 μM reference probe (FAM), 5 ng of digested DNA, and water to a total volume of 20 μL. The primer sequences and probe information are It is described in the extended data table 1.

[0141] After generating droplets with the QX100 Droplet Generator, the droplets were carefully transferred to a 96-well PCR plate and then thermal cycling was carried out as follows using a Biorad PCR machine: 95 °C for 10 minutes for enzyme activation, then 94 °C for 30 seconds for denaturation, 60 °C for 1 minute (ramp rate 2 °C / second) for annealing / extension and 98 °C for 10 minutes for enzyme inactivation, for 40 cycles.

[0142] After thermal cycling, the 96-well plate was placed in a Biorad Droplet R eader and the experiment was read by setting up an experimental plan using QunataSoft Software. After the program ended, the results were analyzed by gating according to the manufacturer's instructions (BioRad). Primers used in the method table 1-ddPCR assay

[0143]

Table 5

[0144] Calculation of targeting efficiency As previously described by Yang et al. (6), a custom pipeline was constructed to estimate the efficiency of PERV inactivation. Briefly, the pol gene was amplified and sequenced by Illumina Next Gen eration Sequencing using PE250 or PE300. First, two overlapping reads using PEAR (1 5) were combined and mapped to the reference region using BLAT. Clustering was performed. After mapping, reads were grouped into sets containing specific combinations of haplotype and indel type. Reads sets with less than 0.5% of the total number of mapped reads with such representation were discarded. Finally, as described by Gueellet al(16), the mapping output was parsed to call various insertions and deletions.

[0145] PERV - Human Junction Capture PERV insertion sites in highly infected i - HEK293 - GFP clones were determined by a standard inverse PCR protocol. Genomic DNA of these clones was fragmented by Sau3AI digestion and self - ligated at low DNA concentration using T4 DNA ligase (NEB). Next, fragments containing the PERV - human junction were amplified by PCR using primers on the PERV LTR shown below. The PCR products were subcloned using the PCR Blunt TOPO kit (Thermo Fisher) and Sanger sequenced. The sequence immediately adjacent to the PERV LTR was aligned to the human genome using the UCSC Genome Browser. Some of the hits in the human gene were verified using junction PCR and Sanger sequencing. Some of the hits in the human gene were verified using junction PCR and Sanger sequencing. SEQ ID NO: 24 - PERV_LTR_F: ATGCCCCCGAATTCCAGA SEQ ID NO: 25 - PERV_LTR_R: GGTTAGGTTGCATTTTCATC CTT

[0146] Handmade Cloning for Producing SCNT Porcine Embryos Unless otherwise specified, all chemicals were purchased from Sigma - Aldrich. Handmade cloning (HMC) is based on the procedure described in Du et al., Theriogeno logy, 68: 1104 - 10. Briefly, Porcine ovaries were obtained from the abattoir, and cumulus-oocyte complexes (COCs) were collected from large follicles. Next, in-vitro maturation of porcine oocytes was carried out in 4-well dishes (Nunc, Thermo Fisher Scientific) containing 400 μL of bicarbonate-buffered M199 medium (Gibco, Thermo Fisher Scientific). 4-well dishes (Nunc, Thermo Fisher Scientific) supplemented with 10% porcine follicular fluid, 10% fetal bovine serum (FBS) (Gibco, Therm mo Fisher Scientific), 10 IU / mL pregnant mare serum gonadotropin (PMSG) and 5 IU / mL human chorionic gonadotropin (hCG) were overlaid with mineral oil and incubated for 42 - 43 hours in humidified air at 38.5 °C, 5% CO2, 5% O2, and 90% N2. After maturation, the cumulus cells of the COCs were removed by repeated pipetting in HEPES-buffered M199 containing 1 mg / mL hyaluronidase, followed by washing the oocytes in a droplet of T2 (HEPES-buffered M199 containing 2 % FBS). From this point on, all manipulations were performed on a heated stage adjusted to 39 °C. The droplets of the solution ( 20 μL / droplet) were made on the lid of a 60 mm Petri dish (Corning, Thermo Fish er Scientific) and covered with mineral oil. The transfer of oocytes was performed using a finely drawn and fire-polished glass pipette. The oocytes were placed in a pronase droplet (3 .3 mg / mL), digested for about 1 minute until the shape of the oocytes changed, and then T2 and After that, the oocytes were washed in a droplet of T2 (HEPES-buffered M199 containing 2% FBS). From this point on, all manipulations were performed on a heated stage adjusted to 39 °C. The droplets of the solution (20 μL / droplet) were made on the lid of a 60 mm Petri dish (Corning, Thermo Fisher Scientific) and covered with mineral oil. The transfer of oocytes was performed using a finely drawn and fire-polished glass pipette. The oocytes were placed in a pronase droplet (3.3 mg / mL), digested for about 1 minute until the shape of the oocytes changed, and then T2 and covered with mineral oil. The transfer of oocytes was performed using a finely drawn and fire-polished glass pipette. The oocytes were placed in a pronase droplet (3.3 mg / mL), digested for about 1 minute until the shape of the oocytes changed, and then T2 and After that, the oocytes were washed in a droplet of T2 (HEPES-buffered M199 containing 2% FBS). From this point on, all manipulations were performed on a heated stage adjusted to 39 °C. The droplets of the solution (20 μL / droplet) were made on the lid of a 60 mm Petri dish (Corning, Thermo Fisher Scientific) and covered with mineral oil. The transfer of oocytes was performed using a finely drawn and fire-polished glass pipette. The oocytes were placed in a pronase droplet (3.3 mg / mL), digested for about 1 minute until the shape of the oocytes changed, and then T2 and .3 mg / mL) for about 1 minute until the shape of the oocytes changed, and then washed in T2 and Continuous washing with droplets of T20 (M199 buffered with HEPES containing 20% FBS) was continued, and the zona pellucida of the oocytes was removed during washing. Next, the zona-free oocytes were arranged in droplets of T20 containing 2.5 μg / mL of cytochalasin B (CB). Enucleation of the oocytes was indicated by the position of the polar body and was manually performed under a stereomicroscope using Ultra Sharp Splitting Blad es (Shearer Precision Products LLC, Pullma n, WA) to remove one-third of the cytoplasm of the oocytes, and the enucleated oocytes were placed in T2 droplets for the next step of fusion. To perform the fusion of oocytes and somatic cells, 100% PER V-KOFFF3 fibroblasts were detached using 0.25% Trypsin, neutralized with T10 (HEPES buffer -M199 containing 10% FBS), filtered, and single cells separated were obtained. On the other hand, small droplets of the fusion solution were prepared on the lid of a 35 mm Petri dish (Corning, Thermo Fisher Scien tific), and enucleated oocytes called cytoplasts and 1 - 5 μL of somatic cells were placed in different T10 droplets. The cytoplasts were individually transferred to 0.4 mg / mL of phytohemagglutinin (PHA-P) for 2 - 3 seconds (s) and quickly dropped onto the single cells that had settled at the bottom of the T10 droplets. After attachment, the pairs of cytoplasts and cells were picked up and equilibrated in droplets of a fusion medium (pFM) containing 0.3 M mannitol and 5 μm poly(vinyl alcohol) (PVA), and then transferred to a fusion chamber covered with 500 μL of pFM solution. The fusion chamber contained parallel platinum wires with a diameter of 0.5 mm and a spacing of 0.8 mm. After attachment, the pairs of cytoplasts and cells were picked up and equilibrated in droplets of a fusion medium (pFM) containing 0.3 M mannitol and 5 μm poly(vinyl alcohol) (PVA), and then transferred to a fusion chamber covered with 500 μL of pFM solution. The fusion chamber contained parallel platinum wires with a diameter of 0.5 mm and a spacing of 0.8 mm. and then transferred to a fusion chamber covered with 500 μL of pFM solution. The fusion chamber contained parallel platinum wires with a diameter of 0.5 mm and a spacing of 0.8 mm. The fusion chamber contained parallel platinum wires with a diameter of 0.5 mm and a spacing of 0.8 mm. were included.

[0147] Using 2V alternating current (AC) (CELLFUSION: BLS CF-150 / B S P , BLS Ltd., Hungary), the somatic cell farthest from the wire was paired with the negative wire and then fused with a single 100V direct current (DC) pulse for 9 μs. Next, the pairs were carefully removed and incubated for 1 hour in T10 to completely fuse the somatic cells into cytoplasts . And the same procedure was repeated for more fusions between cytoplasts and somatic cells .

[0148] Next, the above fusion pairs were fused with another unfused cytoplast. Similarly, unfused cytoplasts were transferred to a fusion chamber covered with 500 μL of bovine fusion medium (bFM) containing 0.3M mannitol, 5 μm PVA, 1 mM MgSO4 and 0.5 mM CaCl2. Using the same AC 2V, the unfused cytoplasts were attached to the negative wire, and then the fusion pairs were placed on the opposite side of the cytoplasts, with the pair in the state farthest from the negative wire. A single pulse of 43V DC was applied for 8 0 μs to fuse the cytoplast pair triplets . Next, the triplets, i.e., the constructed embryos, were placed in a T10 droplet for about 10 minutes to allow complete fusion of the cytoplasts . Chemical activation was performed after the second fusion. The constructed embryos were incubated for 4 hours in 400 μL of PZM3 solution supplemented with 5 μg / ml CB and 10 μg / mL cycloheximide (CX) and covered with mineral oil (Guell et al. , 2014, Bioinformatics, 30:2968 - 2970). Then , the embryos were washed with PZM3 and placed on the bottom of a 4-well dish with an agglutination needle DN-09 / B (BLS Ltd., Transferred to the wells of a well (WOW) system containing small U-bottom holes made in Hungary The embryos constructed with the WOW system were then placed in a humidified trigas incubator containing 5% CO2, 5% O2, and 90% N2 and incubated at 38.5 °C for 7 days to allow for the formation of blastocysts, and the blastocysts per reconstructed embryo development rate were evaluated.

[0149] Immunostaining On day 7, porcine blastocysts were fixed and stained using a pluripotent stem cell 4-marker immunocytochemistry kit (Molecular Probes A24881) according to the manufacturer's instructions. However, the antibodies provided by the kit were replaced with goat anti-pig anti-SOX2 (sc-17320 ) conjugated to Alexa Fluor 647 (Invitrogen A-21446) and a rabbit anti-goat IgG secondary antibody. NucBlue® Live ReadyProbes® Reagent (Molecular Probes R 37605) and phalloidin (A22282) were applied 5 minutes before imaging. The final concentrations of the antibodies used for embryo staining were 1:100 for anti-SOX2, 1:200 for rabbit anti-goat IgG, 1:40 for phalloidin, and 1:100 for NucBlue.

[0150] Confocal microscopy The blastocysts were transferred to the wells of a 4-well microinsert in a 35 mm microdish (Ibidi 80406) and imaged using a Leica TCS SP5 confocal laser scanning microscope equipped with a 10x water objective. The images were trimmed, segmented, and contrast-enhanced using a combination of Imaris and Fiji software. .

[0151] Example 5. Single-cell clones with desirable genotypes for SCNT After CRISPR / cas9 gene editing, the cell population was sorted into single cells in 96-well plates. The results were: 4.5g / L D-glucose, 110mg / L sodium pyruvate, Glu DMEM supplemented with taMax and 5ng / mL basic fibroblast growth factor (bFG F) (13256029, Thermo Fisher Scientific) and 1 0 ng / mL cyclic pifithrin-α hydrobromide (cPFT-α) (P4236, Sig ma), a P53 inhibitor, for ~14 days. Genomic DNA was isolated and genotyping was performed. Desired clones were then expanded and The cells were cultured under the culture conditions described above. This strategy produces clones of the desired genotype, but Cell viability may be suboptimal due to excessive cell doubling time. Addition of bFGF and cPFT-α to the culture medium significantly improved cell viability.

[0152] Example 6. Bulk cell modification for SCNT After gene editing, the modified cells are enriched by antibody binding or bead selection, and the enriched cell population is The group was directly used in SCNT without going through a single-cell sorting procedure. , shortening cell culture time and avoiding cells becoming too old and generally losing viability .

[0153] Example 7: In vivo modification For in vitro gene editing, cell damage can occur, especially in multiplex editing. This can be difficult to avoid during cell culture and transfection procedures. To achieve mosaic fetuses, an in vivo microinjection method for the delivery of CRISPR / cas9 to porcine zygotes was developed. Figure 25. Fetuses at 30 days of age were collected and cells were extracted. Next, single cells were sorted and the gene type was identified as single cell clones. The clones of interest were expanded and used for SCNT. By this strategy, in vitro transfection procedures were avoided and the cells maintained sufficient viability. As shown in Figure 30, recloning significantly increased the litter size and also showed an increase in viability, although not a significant one. Example 8: Collection and in-vitro maturation (IVM) of oocytes To isolate cumulus-oocyte complexes (COCs), ovaries from sexually mature young female pigs or breeding female pigs were used. Oocyte collection and IVM culture were performed as described in R. Tomii et al., J. Reprod. Dev. 55, 121-7 (2009). Oocytes surrounded by multiple layers (at least 3 layers) of cumulus cells were collected to be in-vitro matured in IVM medium at 38.5 °C in an atmosphere of 5% CO2, 5% O2 and 90% N2 with saturated humidity for about 42 - 44 hours. Example 9: Somatic cell nuclear transfer (SCNT) SCNT was performed as previously described by H. Wei et al., PLoS One. 8, e57728 (2013). Cumulus cells were removed from cultured COCs by treatment with 0.1% (w / v) hyaluronidase. The first polar body contained in the cytoplasm adjacent to the oocyte was gently aspirated using a tilted pipette of TLH-PVA.

[0154]

[0155] Enucleated. Donor cells derived from GTKO / hCD55 / hCD59-positive fibroblast cell lines were inserted into the perivitelline space of enucleated oocytes. The reconstructed embryos were placed in a fusion medium (0.25 M D-sor bitol alcohol, 0.05 mM Mg(C2H3O2)2, 20 mg / mL BSA, and 0.5 mM HEPES [without acid]) and fused using an Electro Cell Fusion Generator (LF201, NEPA GENE Co., Ltd., Japan) with a single direct current pulse of 200 V / mm for 20 μs. Next, the embryos were cultured in PZ M-3 for 0.5 - 1 hour and activated with a single pulse of 150 V / mm for 100 ms in an activation medium containing 0.25 M D-sorbitol alcohol, 0.01 mM Ca(C2H3O2)2, 0.05 mM Mg(C2H3O2)2, and 0.1 mg / mL BSA. The embryos were equilibrated in PZM-3 supplemented with 5 μg / mL cytochalasin B in a humidified atmosphere of 5% CO2, 5% O2, 90% N2 at 38.5 °C for 2 hours (APM-30D, AS TEC, Japan) and then cultured in PZM-3 medium under the same culture conditions as above until embryo transfer.

[0156] Example 10: Embryo Transfer For embryo transfer, at least one reproductive female pig with a history of parturition and a good litter size was selected as a surrogate mother. The SCNT embryos were surgically transferred into the oviducts of the recipients. Pregnancy was confirmed approximately 23 days after surgical transfer using an ultrasonic scanner (HS-101 V, Honda Electronics Co., Ltd ., Yamazuka, Japan). The selection of the surrogate was determined to be important for the results of pig cloning. For example, compared to a small surrogate (e.g., Diannan), a surrogate mother (e.g., Sanyuan) ​​​​The larger the value, the higher the measured results of the production rate, litter size, survival rate, and the expected number of pigs per breeding female. The determined value improves. Figure 29.

[0157] Example 11: Analysis of Fetus and Pig To test whether there was reinfection of PERV into fetuses from surrogate breeding females and pigs cloned from PERV-free cells WT and PERV knockout fetuses were collected from surrogate sows by cesarean section (c-section). Genomic DNA and total RNA were isolated from different tissues of cloned pigs at different time points. Subsequently, both genomic DNA and RNA of the PERV genotype were checked by deep sequencing. Fetal and pig PERV knockouts showed ~100% PERV inactivation efficiency in both genomic and tissue transcripts. The copy number of PERV was confirmed to be similar to the cell line from which they were cloned. No reinfection of PERV was observed in either the fetuses or pigs generated by these methods.

[0158] Example 12: Increase in KO Efficiency with an Increase in the Number of Guide RNAs Used To examine the effect of different numbers of guide RNAs on the efficiency of PERV knockout (KO), experiments were conducted using combinations of 2, 3, and 4 guide RNAs. Briefly stated, PERV KO was performed on fetal fibroblasts of Yucatan mini pigs containing approximately 50 - 60 copies of PERV. The PERV KO efficiency was measured using the results determined by bulk fragment analysis and chromatography. It was observed that the KO efficiency increased as the number of gRNAs increased. Figure 27. When using two guide RNAs ​, 12.52% of the cells in the population with a deletion in the PERV pol sequence were obtained, and when using three guide RNAs, 22.19% of the cells in the population with a deletion in the PERV pol sequence were obtained. When using four guide RNAs, the KO efficiency increased to 52.47%. Importantly, when using at least four guide RNAs, deletions exceeding 100 bp were observed in a significant number of cells. Figure 27, lower right panel. Unlike small indels, the large deletions generated using more than two guide RNAs are thought to be unable to revert by spontaneous mutations because they completely remove the catalytic domain of PERV pol.

[0159] In addition to avoiding spontaneous mutations, it was demonstrated that the inactivation of PERV pol cannot be complemented by the activity of human ERV pol. Figure 28. Briefly, PK15 WT cells (「PK15-WT+mCherry」), PERV KO cells (「PK15-#15) 」, and PERV KO cells expressing recombinant human ERV pol (「PK15-#15+ recombinant ERV Pol」) were co-cultured with human 293-GFP cells. After two weeks, 293 -GFP cells were FACS sorted at the indicated numbers. And PERV infection measured at the pol and env levels was determined using PCR. Using GGTA as a negative control, instead of 293-GFP cells contaminated with PK15, it was shown that pol / env expression was due to PERV infection. As shown in Figure 28, PK15-WT cells expressed both pol and env, but neither PERV KO expressing recombinant human ERV pol nor PERV KO showed expression of pol or env. This data indicates that PE ​​​PERVs in RV-inactivated porcine organs are not reactivated even when exposed to human ERVs is shown.

[0160] Para A. A pig grown from an embryo, wherein the embryo comprises porcine cells having at least 75% inactive porcine endogenous retrovirus (PERV) elements.

[0161] Para B. The pig of Para A, wherein the porcine cells are porcine fetal fibroblast cells (PFFF3) cells.

[0162] Para C. The pig of Para A or Para B, wherein approximately 100% of the intracellular PE RV elements are inactive.

[0163] Para D. The pig of any one of Para A to C, wherein the PER V elements comprise one or more mutations or epigenetic changes that result in a decrease or elimination of PERV element activity including.

[0164] Para E. The pig of any one of Para A to D, wherein the PERV elements of the porcine cells are inactivated by a method comprising administering to the cells a sequence-specific genomic modifier that disrupts PERV replication and / or assembly wherein the agent disrupts transcription and / or translation of the gene. Here, the agent disrupts transcription and / or translation of the gene.

[0165] Para F. The pig of Para E, wherein the agent is a nuclease or nickase, or a nucleic acid encoding a nuclease or nickase.

[0166] Para G. The pig of Para F, wherein the nuclease or nickase Ze is a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, and is selected from the group consisting of a CRISPR-associated nuclease or nickase and is selected from the group consisting of a CRISPR-associated nuclease or nickase

[0167] Para H. A pig of Para G, wherein the nuclease or nickase Ze is a CRISPR-associated nuclease or nickase

[0168] Para I. A pig of Para H, wherein the CRISPR-associated nuclease or nickase is a CRISPR-Cas9 nuclease or nickase, a CRIS PR-Cpf1 nuclease or nickase, or a biologically active fragment thereof or derivative

[0169] Para J. A pig of any one of Para E to I, wherein the agent further comprises a) a CRISPR guide RNA or tracrRNA, or b) a nucleic acid encoding a CRISPR guide RNA the agent further comprises a) a CRISPR guide RNA or tracrRNA, or b) a nucleic acid encoding a CRISPR guide RNA

[0170] Para K. A pig of Para J, wherein the CRISPR guide RNA comprises any one nucleotide sequence of SEQ ID NOs: 1 to 3 or 26 to 181, any strain-specific genetic variant thereof, or any combination thereof comprises any one nucleotide sequence of SEQ ID NOs: 1 to 3 or 26 to 181, any strain-specific genetic variant thereof, or any combination thereof

[0171] Para L. A pig of Para J, wherein the CRISPR guide RNA comprises any one nucleotide sequence of SEQ ID NOs: 1 to 3 or 26 to 116, its strain-specific gene variant, or any combination thereof comprises any one nucleotide sequence of SEQ ID NOs: 1 to 3 or 26 to 116, its strain-specific gene variant, or any combination thereof

[0172] Para M. A pig of Para J, wherein the CRISPR guide RNA comprises any one nucleotide sequence of SEQ ID NO: 35, 36, 48, 99, 101, 102, 106, 108, 111, 11 3, or any combination thereof.

[0173] Para N. A pig of any one of PARA E-J, wherein the agent is a nucleic acid encoding the CRISPR-Cas9 nuclease or nickase , wherein the cell is engineered to stably express the agent, wherein the agent further comprises at least one guide RNA, and wherein at least one guide RNA sequence comprises any one of the nucleotide sequences of SEQ ID NO: 1-3 or 26-116 .

[0174] Para O. A pig of Para N, wherein the agent comprises at least three guide RNAs, and wherein the three guide RNA sequences comprise the nucleotide sequences of SEQ ID NO: 1-3 .

[0175] Para P. A pig of any one of Para A-O, wherein the pig maintains the same or substantially the same level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy.

[0176] Para Q. An organ or tissue obtained from a pig of any one of Para A-P.

[0177] Para R. A method of transplanting an organ or tissue of Para Q into a subject, comprising the step of transplanting the organ into the subject .

[0178] Para S. The method of Para R, wherein the subject is a human.

[0179] Para T. The method of Para R, wherein the subject is a non-human primate. .

[0180] Para U. A method for producing porcine endogenous retrovirus (PERV) inactivated pigs. That is, the method is Obtaining a nuclear donor cell having a nucleus, comprising: be at least 75% inactive; To generate a nuclear transfer oocyte, the nucleus of the nuclear donor cell is transferred to a recipient enucleated oocyte. Transferring to cells; subjecting said nuclear transfer oocyte to activation; Culturing the nuclear transfer oocyte to produce a blastocyst or embryo; transferring said blastocyst or embryo into a surrogate; and generating a live PERV-inactivated pig from said blastocyst or embryo; Includes.

[0181] A method for generating Para V. porcine endogenous retrovirus (PERV) inactivated pigs. The method comprises: Using a nucleus from a nuclear donor cell to generate a blastocyst or embryo, said nuclear donor - at least 75% of the PERV elements in the cell are inactive; and The blastocysts or embryos are transferred to surrogates to generate PERV-inactivated pigs. -To do; Includes.

[0182] The method of Para W. Para U or Para V, wherein the nuclear donor The cell is a fetal cell.

[0183] Method of Para X, Para U or Para V, wherein the nuclear donor cells are isolated from a chimeric PERV-inactivated fetus.

[0184] Para Y. Method of Para X, wherein the chimeric PERV-inactivated fetus is pregnant for about 10 days, about 20 days, about 30 days, or about 3 months.

[0185] Para Z. Method of Para X, wherein the chimeric PERV-inactivated fetus is generated using a genome modifier.

[0186] Para AA. Method of Para Z, wherein the chimeric PERV-inactivated fetus is generated by zygote injection.

[0187] Para AB. Method of Para Z, wherein the genome modifier is selected from the group consisting of zinc finger nucleases or nickases, TAL effector nucleases or nickases, deaminases, and CRISPR-associated nucleases or nickases. selected.

[0188] Para AC. Method of Para U or Para V, wherein the nuclear donor cells are in vitro propagated.

[0189] Para AD. Method of Para AC, wherein the nuclear donor cells undergo less than 30, less than 20, less than 10, less than 5, or less than 2 population doublings in vitro.

[0190] Para AE. Method of Para U or Para V, wherein the nuclear donor cells are somatic cells.

[0191] The method of Para AF, Para U or Para V, wherein the nuclear donor cell is , fetal muscle cells, fibroblasts, endothelial cells, and liver cells.

[0192] The method of Para AG, Para U or Para V, wherein the nuclear donor cell is It is isolated from pigs.

[0193] Para AH. The method of Para AG, wherein the pig is less than 10 weeks of age, less than 8 weeks of age, Fully aged, less than 6 weeks, less than 5 weeks, less than 4 weeks, less than 3 weeks, less than 2 weeks, or less than 1 week be.

[0194] The method of Para AI, Para U or Para V, At least about 80%, at least about 90%, at least about 95%, or at least At least about 99% of the protein is inactive.

[0195] The method of Para AJ, Para U or Para V, 100% of the PERV elements are inactive.

[0196] The method of Para AK, Para U or Para V, Pigs should be kept for at least one month, at least six months, at least one year, or at least five years after gestation. , maintaining the same or similar levels of PERV inactivation for at least 10 years.

[0197] The method of Para AL, Para U or Para V, The pigs are PERV-free pigs.

[0198] The method of Para AM, Para U or Para V, The pig has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of inactive PERV elements.

[0199] A method of Para AN, Para U or Para V, further comprising a deacetylase inhibitor agent.

[0200] A method of Para AO, Para U or Para V, further comprising transferring at least one wild type blastocyst or embryo to the surrogate.

[0201] Isolated pig cells produced by any one of the methods of Para AP, Para U to AO .

[0202] Organs or tissues obtained from cells produced by any one of the methods of Para AQ, Paras U to AO .

[0203] A method for improving the birth rate of PERV-inactivated pigs, the method comprising: Using a nucleus from a nuclear donor cell to generate a blastocyst or embryo, wherein at least 75% of the PERV elements in the nuclear donor cells are inactive, and Transferring the blastocyst or embryo to at least one surrogate to generate at least one PERV-inactivated pig, wherein the abortion rate is reduced compared to the abortion rate of fetuses generated from cells in which more than 25% of the PERV elements in the cells are active. See, wherein the abortion rate is reduced compared to the abortion rate of fetuses generated from cells in which more than 25% of the PERV elements in the cells are active.

[0204] A method for creating a genetically modified animal, comprising: Using a nucleus from a nuclear donor cell to generate a blastocyst or embryo, wherein the Multiple nucleic acid sequences in the nuclear donor cells are modified, and To create the genetically modified animal, the blastocyst or embryo is transfected into a surrogate for that purpose, including.

[0205] A method of Para AT, Para AR or AS, wherein the nuclear donor cell is a fetal cell is.

[0206] A method of Para AU, Para AR or AS, wherein the nuclear donor cell is isolated from a chimeric fetus.

[0207] A method of Para AV, Para AR or AS, wherein the chimeric fetus is about 10 days, about 20 days, about 30 days, or about 3 months of gestation.

[0208] A method of Para AW, Para AV, wherein the chimeric fetus is generated using a genome modifier is.

[0209] A method of Para AX, Para AU, wherein the chimeric fetus is generated by zygote injection The method according to claim 32, wherein

[0210] A method of Para AY, Para AQ, wherein the genome modifier is a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, a deaminase, and a CRISPR-associated nuclease or nickase selected from the group consisting of is.

[0211] A method of Para AZ, Para AR or AS, wherein the nuclear donor cell proliferates in vitro.

[0212] Para BA. A method of Para AZ, wherein the nuclear donor cells receive a population doubling of less than 30, less than 2 less than 20, less than 10, less than 5, or less than 2.

[0213] Para BB. A method of Para AR or AS, wherein the nuclear donor cells are somatic cells thereof.

[0214] Para BC. A method of Para AR or AS, wherein the nuclear donor cells are selected from the group consisting of fetal muscle cells, fibroblasts, endothelial cells, and hepatocytes.

[0215] Para BD. A method of Para AR or AS, wherein the nuclear donor cells are isolated from an animal that is less than 10 weeks old, less than 8 weeks old, less than 6 weeks old, less than 5 weeks old, less than 4 weeks old, less than 3 weeks old, less than 2 weeks old , or less than 1 week old.

[0216] Para BE. A method of Para AR or AS, wherein the plurality of nucleic acid sequences are inactivated , insertion of exogenous nucleic acids, subtraction of endogenous nucleic acids, or any combination thereof modified.

[0217] Para BF. A method of Para AR or AS, wherein at least about 2, at least at least about 5, at least about 10, at least about 20, at least about 30, at least about 4 0, at least about 50, at least about 60, at least about 70, at least about 80, at least at least about 90, at least about 100, or more nucleic acid sequences are modified.

[0218] Para BG. A method for preventing or reducing the risk of pregnancy loss or miscarriage by somatic cell nuclear transfer (SCNT) of genetically modified blastocysts or embryos, the method comprising: : Using nuclei from genetically modified nuclear donor cells to generate blastocysts or embryos and and converting the blastocyst or embryo into a surrogate to produce at least one viable offspring. To transfer, where the rate of pregnancy loss or miscarriage is equal to the rate of pregnancy loss or miscarriage in a control. is decreasing in comparison.

[0219] Para BH. The method of Para BG, comprising: The cells have multiple genetic modifications.

[0220] Para BI. The method of Para BH, wherein the plurality of genetic modifications comprises at least at least about 2, at least about 3, at least about 4, at least about 5, at least about 10, At least about 15, at least about 20, at least about 30, at least about 40, at least about 5 0, at least about 60, at least about 70, at least about 80, at least about 90, or It contains at least about 100 genetic modifications.

[0221] Para BJ. The method of Para BG, wherein the multiple genetic modifications are This is for multiple gene sequences.

[0222] Para BK. The method of Para BG, wherein at least some of the genetic modifications are for different genes.

[0223] The method of Para BL. Para BG, comprising: The vesicles are capable of expressing zinc finger nucleases or nickases, TAL effector nucleases, and or from nickases, deaminases, and CRISPR-associated nucleases or nickases It is modified using a genome modifier selected from the group consisting of.

[0224] Incorporation by reference All publications and patents mentioned in this specification are incorporated by reference in their entirety as if each individual publication or patent were specifically and individually indicated to be incorporated by reference. Incorporated.

[0225] Although specific embodiments of the present disclosure have been discussed, the above specification is illustrative and not restrictive. By considering this specification and the following claims, many variations of the disclosure will become apparent to those skilled in the art. The full scope of the present disclosure should be determined by reference to the claims, the full scope of equivalents, and the specification, as well as such variations.​​

Claims

1. A pig developed from an embryo, said embryo comprising pig cells having at least 75% inactivated porcine endogenous retrovirus (PERV) elements.

2. The pig of claim 1, wherein about 100% of the PERV elements in the cells are inactive.

3. The pig of claim 1 or claim 2, wherein the PERV element comprises one or more mutations or epigenetic changes that result in reduced or eliminated activity of the PERV element.

4. The pig according to any one of claims 1 to 3, wherein the PERV elements of the pig cells have been inactivated by a method comprising administering to the cells a genome modifying agent specific for a gene involved in PERV replication and / or assembly, wherein the agent disrupts transcription and / or translation of the gene.

5. The pig of claim 4 , wherein the agent is a nuclease or nickase or a nucleic acid encoding the nuclease or nickase.

6. The pig of claim 4, wherein the nuclease or nickase is a CRISPR-associated nuclease or nickase.

7. The agent is: a) CRISPR guide RNA or tracrRNA, or b) a nucleic acid encoding a CRISPR guide RNA; The pig according to any one of claims 4 to 6, further comprising:

8. 8. The pig of claim 7, wherein the CRISPR guide RNA comprises the nucleotide sequence of any one of SEQ ID NOs: 1-3 or 26-181, any strain-specific genetic variant thereof, or any combination thereof.

9. 8. The pig of claim 7, wherein the CRISPR guide RNA comprises the nucleotide sequence of any one of SEQ ID NOs: 1-3 or 26-116, any strain-specific genetic variant thereof, or any combination thereof.

10. 8. The pig of claim 7, wherein the CRISPR guide RNA comprises the nucleotide sequence of any one of SEQ ID NOs: 35, 36, 48, 99, 101, 102, 106, 108, 111, 113, or any combination thereof.

11. 8. The pig of any one of claims 4-7, wherein the agent is a nucleic acid encoding a CRISPR-Cas9 nuclease or nickase, wherein the cells are engineered to stably express the agent, wherein the agent further comprises at least one guide RNA, and wherein the at least one guide RNA sequence comprises a nucleotide sequence of any one of SEQ ID NOs: 1-3 or 26-116.

12. 2. The pig of any one of the preceding claims, wherein the pig maintains the same or substantially the same level of PERV inactivation for at least one month, at least six months, at least one year, at least five years, at least ten years after gestation.

13. Organs or tissues obtained from a pig according to any one of the preceding claims.

14. 1. A method for producing a porcine endogenous retrovirus (PERV) inactivated pig, comprising: i. Obtaining a nuclear donor cell having a nucleus, wherein at least 75% of the PERV elements in said nuclear donor cell are inactive; ii. transferring the nucleus of the nuclear donor cell into a recipient enucleated oocyte to generate a nuclear transfer oocyte; iii. subjecting the nuclear transfer oocyte to activation; iv. culturing the nuclear transfer oocyte to produce a blastocyst or embryo; v. transferring the blastocyst or embryo into a surrogate; and vi. Producing live PERV-inactivated pigs from said blastocysts or embryos; The method includes:

15. 1. A method for producing a porcine endogenous retrovirus (PERV) inactivated pig, comprising: i. using a nucleus of a nuclear donor cell to generate a blastocyst or embryo, wherein at least 75% of the PERV elements in the nuclear donor cell are inactive; and ii. transferring the blastocyst or embryo into a surrogate to generate a PERV-inactivated pig; The method includes:

16. 16. The method of claim 14 or 15, wherein the nuclear donor cell is a fetal cell.

17. The method of claim 14 or 15, wherein the nuclear donor cell is isolated from a chimeric PERV-inactivated fetus.

18. The method of claim 17, wherein the chimeric PERV-inactivated fetus is about 10 days, about 20 days, about 30 days, or about 3 months pregnant.

19. The method of claim 17, wherein the chimeric PERV-inactivated fetus is generated using a genome modifying agent.

20. 20. The method of claim 19, wherein the genome modifying agent is selected from the group consisting of a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, a deaminase, and a CRISPR-associated nuclease or nickase.

21. 16. The method of claim 14 or 15, wherein the nuclear donor cell undergoes less than 30, less than 20, less than 10, less than 5, or less than 2 population doublings in vitro.

22. The method of claim 14 or 15, wherein the nuclear donor cells are isolated from a pig.

23. 23. The method of claim 22, wherein the pig is less than 10 weeks old, less than 8 weeks old, less than 6 weeks old, less than 5 weeks old, less than 4 weeks old, less than 3 weeks old, less than 2 weeks old, or less than 1 week old.

24. The method of claim 14 or 15, wherein at least about 80%, at least about 90%, at least about 95%, or at least about 99% of the PERV elements in the nuclear donor cell are inactive.

25. The method of claim 14 or 15, wherein the PERV-inactivated pig maintains the same or substantially the same level of PERV inactivation for at least one month, at least six months, at least one year, at least five years, or at least ten years after gestation.

26. 16. The method of claim 14 or 15, further comprising transferring at least one wild-type blastocyst or embryo into said surrogate.

27. 27. An isolated porcine cell produced by the method of any one of claims 14 to 26.

28. 27. An organ or tissue obtained from cells produced by the method of any one of claims 14 to 26.

29. i. using a nucleus from a nuclear donor cell to generate a blastocyst or embryo, wherein at least 75% of the PERV elements in the nuclear donor cell are inactive; and ii. transferring said blastocyst or embryo to at least one surrogate to generate at least one PERV-inactivated pig; 1. A method for improving the birth rate of a PERV-inactivated pig, comprising: wherein the miscarriage rate is reduced compared to the miscarriage rate of fetuses produced from cells in which more than 25% of the PERV elements in the cells are active.

30. 1. A method for producing a genetically modified animal comprising: i. using a nucleus from a nuclear donor cell to generate a blastocyst or embryo, wherein a plurality of nucleic acid sequences within the nuclear donor cell are modified; and ii. transferring said blastocyst or embryo into a surrogate to generate said transgenic animal; The method includes:

31. 31. The method of claim 29 or 30, wherein the nuclear donor cell is a fetal cell.

32. The method of claim 29 or 30, wherein the nuclear donor cell is isolated from a chimeric PERV-inactivated fetus.

33. 33. The method of claim 32, wherein the chimeric PERV-inactivated fetus is about 10 days, about 20 days, about 30 days, or about 3 months pregnant.

34. The method of claim 32, wherein the chimeric PERV-inactivated fetus is generated using a genome modifying agent.

35. 33. The method of claim 32, wherein the chimeric PERV-inactivated fetus is generated by zygote injection.

36. 35. The method of claim 34, wherein the genome modifying agent is selected from the group consisting of a zinc finger nuclease or nickase, a TAL effector nuclease or nickase, a deaminase, and a CRISPR-associated nuclease or nickase.

37. 31. The method of claim 29 or 30, wherein the nuclear donor cell undergoes less than 30, less than 20, less than 10, less than 5, or less than 2 population doublings in vitro.

38. 32. The method of claim 31 , wherein the pig is less than 10 weeks old, less than 8 weeks old, less than 6 weeks old, less than 5 weeks old, less than 4 weeks old, less than 3 weeks old, less than 2 weeks old, or less than 1 week old.

39. The method of claim 29 or 30, wherein at least about 80%, at least about 90%, at least about 95%, or at least about 99% of the PERV elements in the nuclear donor cell are inactive.

40. The method of claim 29 or 30, wherein 100% of the PERV elements in the nuclear donor cell are inactive.

41. The method of claim 29 or 30, wherein the PERV-inactivated pig maintains the same or similar level of PERV inactivation for at least 1 month, at least 6 months, at least 1 year, at least 5 years, or at least 10 years after gestation.

42. The method of claim 29 or 30, wherein the PERV-inactivated pig is a PERV-free pig.

43. 31. The method of claim 29 or 30, wherein the PERV inactivated pig has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% inactive PERV components.

44. 31. The method of claim 29 or 30, further comprising transferring at least one wild-type blastocyst or embryo into said surrogate.

45. i. using a nucleus from a genetically modified nuclear donor cell to generate a blastocyst or embryo; and ii. transferring the blastocyst or embryo to a surrogate to produce at least one viable offspring; 1. A method for preventing or reducing the risk of pregnancy loss or miscarriage by somatic cell nuclear transfer (SCNT) of a genetically modified blastocyst or embryo, comprising: wherein the rate of pregnancy loss or miscarriage is reduced as compared to the rate of pregnancy loss or miscarriage in a control.

46. 46. ​​The method of claim 45, wherein the genetically modified nuclear donor cell comprises multiple genetic modifications.

47. 47. The method of claim 46, wherein the plurality of genetic modifications comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 10, at least about 15, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 genetic modifications.

48. 46. ​​The method of claim 45, wherein the multiple genetic modifications are to a single repeated genetic sequence.

49. 46. ​​The method of claim 45, wherein at least some of the genetic modifications are to different genes.

50. 46. ​​The method of claim 45, wherein the genetically modified nuclear donor cell has been modified with a genome modifying agent selected from the group consisting of zinc finger nucleases or nickases, TAL effector nucleases or nickases, deaminases, and CRISPR-associated nucleases or nickases.

Images