Use of ZC3h12b gene or protein and establishment method for liver disease animal model

By knocking out the ZC3H12B gene in medaka fish, a model is established that accurately simulates intrahepatic bile duct cystadenoma and cystadenocarcinoma, addressing the limitations of current models and enabling detailed research into these liver diseases and gender-specific factors.

JP2025114626AInactive Publication Date: 2025-08-05SHANGHAI OCEAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025072725
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-12-30
Filing Date
2025-04-24
Publication Date
2025-08-05
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current animal models for intrahepatic bile duct cystadenoma, cystadenocarcinoma, and related fatty liver diseases do not accurately simulate the clinical development of these conditions, particularly those induced by hepatitis B and C viruses, and lack genetic and protein-based models to study gender-specific differences in incidence and mechanisms.

Method used

The ZC3H12B gene or protein is targeted for knockout in medaka fish using CRISPR/Cas9 editing, creating a model that exhibits liver pathology similar to human intrahepatic bile duct cystadenoma and cystadenocarcinoma, including fused bile duct proliferation, steatosis, and lymphocytic infiltration, providing a platform for studying these conditions and their gender-specific differences.

Benefits of technology

The medaka model effectively mimics human liver diseases, allowing for in-depth research into the molecular mechanisms and gender-specific factors contributing to intrahepatic bile duct cystadenoma and cystadenocarcinoma, offering a more accurate simulation than chemically induced models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025114626000003
    Figure 2025114626000003
  • Figure 2025114626000004
    Figure 2025114626000004
  • Figure 2025114626000005
    Figure 2025114626000005
Patent Text Reader

Abstract

To provide use of Zc3h12b gene or protein and an establishment method for a liver disease animal model.SOLUTION: By using a gene editing technology, a Zc3h12b gene of medaka is targeted and knocked out, and the medaka deficient in a ZC3H12B protein product is established. All of these exhibit liver diseases such as hepatobiliary hyperplasia and fusion, hepatocyte fatty degeneration, and fibrosis, and exhibit fatty liver with increase of months of age, with local cyst necrosis. Obvious lymphocyte infiltration in hepatic sinusoids, and abnormal increase in the number of macrophages are observed. Furthermore, the cells in which human tumor markers GPC3, SMA and CK19 are positive are also detected, indicating that ZC3H12B can be used as a therapeutic target and a biomarker for intrahepatic cystadenoma, intrahepatic cystadenocarcinoma, or fatty liver or liver cancer related thereto. Medaka deficient in Zc3h12b can be used as an animal model to study the pathological process of intrahepatic cystadenoma, intrahepatic cystadenocarcinoma or both.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of biomedical technology, in particular to the establishment of new functions of genes or proteins and related disease animal models, and more particularly to the use of ZC3H12B gene or protein and the method for establishing an animal model simulating liver disease. [Background technology]

[0002] Liver diseases are classified into two types: non-neoplastic and neoplastic liver diseases. In non-neoplastic liver diseases (pathogenic infections such as common hepatitis viruses and parasites, chemical or alcoholic liver damage, cholelithiasis, and genetic developmental abnormalities such as bile duct malformations), the microenvironment in which hepatocytes, biliary epithelial cells, and stem cells reside within the hepatic sinusoids is constantly stimulated by bile secreted by the bile duct epithelium. In addition, due to the influence of cytokines secreted by macrophages (Kupffer cells, KC) specific to the hepatic sinusoids and lymphocytes of the autoimmune system, hepatocytes at the site of local liver damage develop fatty lesions, fibrosis, and further cirrhosis, eventually leading to hepatic neoplastic cancer. According to epidemiological survey data, the incidence rates of hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC) differ between men and women. The incidence ratio of HCC is approximately 2:1 to 4:1, while the incidence rate of ICC is slightly higher in women than in men (3:2). ICC is a bile duct adenocarcinoma derived from hepatic bile duct epithelial cells, hepatocytes, stem cells, and peri-biliary glandular cells. Its incidence rate is second only to hepatocellular carcinoma (HCC) as a primary malignant tumor of the liver.

[0003] ICC pathogenic factors include cholangitis caused by pathogenic infections such as hepatitis viruses and parasites, chemical carcinogens, and genetic factors. However, the pathogenic mechanism and specific etiology remain unknown, and the incidence has been increasing worldwide in recent years. Because ICC does not exhibit obvious clinical symptoms in its early stages, early diagnosis and timely treatment are of particular importance. Regarding the explanation of gender differences in ICC liver cancer, current research has focused primarily on sex hormones and cellular factors. However, in recent years, therapeutic strategies targeting the estrogen-androgen receptor pathway and inflammation have not achieved promising clinical outcomes. Meanwhile, most current research results are derived from chemically induced animal models of liver carcinogenesis, which do not fully simulate the development of clinical ICC caused by HBV and HCV infection, especially genetically induced ICC. Meanwhile, due to differences in cell types, the causes and mechanisms of gender differences in ICC have yet to be fully elucidated. Furthermore, because drug-induced ICC animal models are the norm, detailed genomic studies are lacking. Therefore, genetic and protein ICC animal models have important basic science and clinical application value for genetic research into the mechanisms of liver cancer pathogenesis and sex differences, research and development of rapid diagnostic techniques, and design and screening of targeted drugs.

[0004] The ZC3H12 protein family is a type of CCCH zinc finger protein that regulates immune and inflammatory responses. It is characterized by one CCCH zinc finger domain (involved in DNA or RNA binding), one PIN ZC3H12 functional domain, one RNA enzymatic activity domain, and one highly conserved ubiquitin-associated domain (UBA) among the independent ZC3H12 family members (see Figure 2-3). The ZC3H12 protein family contains four members: ZC3H12A, ZC3H12B, ZC3H12C, and ZC3H12D. These four proteins share high amino acid sequence homology but exhibit significant differences in tissue distribution. The function of the ZC3H12 protein family has not yet been fully elucidated. Regarding Zc3h12b, Wawro M. et al. (Wawro M., Wawro K., Kochan J., Solecka A., Sowinska W. Lichawska-Ciesla A., et al., Zc3h12b / MCPIP2, a new active member of the ZC3H12 family. RNA. 25 (2019) 840-856.) published human and mammalian Zc3h12b, which binds to proinflammatory interleukin-6 (IL-6) mRNA and exists in the cytoplasm, forming granule-like structures that control mRNA transcription and translation into protein, and have the function of arresting the cell cycle at the G2 phase. However, the relationship between Zc3h12b and liver disease, particularly ICC and ICC-related fatty liver and liver cancer, has not been reported as of the filing date of this patent application, and there have been no reports of animal models of liver disease in which Zc3h12b has been knocked out in mice or other animals. Summary of the Invention

[0005] Contents of the invention The object of the present invention is to provide a use of ZC3H12B gene or protein in response to the shortcomings of the prior art, and to provide a method for establishing an animal model of liver disease based thereon.

[0006] In a first aspect of the present invention, the ZC3H12B gene or protein, or an upregulator thereof, is used in the preparation of a drug for treating intrahepatic biliary cystadenoma (BCA), intrahepatic biliary cystadenocarcinoma (BCAC), or associated fatty liver or liver cancer.

[0007] In a preferred embodiment of the invention, said upregulator is selected from small molecule compounds or biopolymers.

[0008] In a second aspect of the present invention, there is provided a pharmaceutical composition for treating intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith, the pharmaceutical composition comprising an upregulator of the ZC3H12B gene or protein and a pharmaceutically acceptable carrier.

[0009] In a third aspect, the present invention provides an application of the ZC3H12B gene or protein as a diagnostic marker in the preparation of a diagnostic reagent or kit for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

[0010] In a fourth aspect of the present invention, a reagent for detecting the amount of ZC3H12B gene or protein finds application in the preparation of a diagnostic reagent or diagnostic kit for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

[0011] In a fifth aspect of the present invention, there is provided a method for screening a drug for treating intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith, by targeting the ZC3H12B gene or protein, the method comprising: treating a ZC3H12B gene or protein expression system with a candidate substance; detecting expression of the ZC3H12B gene or protein in said system; If the candidate substance can increase the expression of the ZC3H12B gene or protein, then the candidate substance is indicated as a potential desired substance; vice versa, the candidate substance is indicated as a potential disliked substance.

[0012] In a sixth aspect of the present invention, there is provided a method for establishing an animal model of liver disease, said method comprising the step of knocking down Zc3h12b gene or protein expression in an animal. In a preferred embodiment of the present invention, the liver disease is selected from intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith. In another preferred embodiment of the present invention, the animal is selected from lower to higher vertebrates other than humans.

[0013] In a seventh aspect of the present invention, there is provided a use of an animal model of liver disease established according to any one of the above methods, said use comprising: a) Study of the molecular mechanisms involved in the regulation of macrophage-mediated fatty liver development and liver cancer-like changes by ZC3H12B in humans and / or animals; b) Research into the molecular pathogenesis of intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or related fatty liver or liver cancer in humans and / or animals; c) Research into the mechanisms of atrophy and necrosis of the liver parenchyma and fibrocarcinoma in intrahepatic bile duct cystadenoma or intrahepatic bile duct cystadenocarcinoma, and the mechanisms of their pathogenesis. d) Screening for effects on the differentiation or development of male and female livers in humans and animals, and the effects on the incidence of intrahepatic bile duct cystadenoma or intrahepatic bile duct cystadenocarcinoma, which are regulated by intrinsic sex differences or exogenous environmental factors.

[0014] The advantages of the present invention are as follows: This study was the first to utilize gene editing technology to target and knock out the zc3h12b gene in medaka fish, establishing zc3h12b-deficient medaka. We then generated a series of frameshift mutants, as well as heterozygotes and homozygotes lacking Zc3h12b protein production. These heterozygotes and homozygotes exhibited varying degrees of liver pathology. With increasing age, focal hepatic steatosis and fibrosis with bile duct proliferation developed. Six-month-old medaka exhibited severe hepatic steatosis with localized cysts and necrosis. Compared to normal controls, zc3h12b knockout medaka exhibited significant lymphocytic infiltration into the hepatic sinusoids, an abnormal increase in the number of macrophages, fused hepatic bile duct proliferation, and hepatocellular fatty lesions. Immunohistochemical analysis revealed not only smooth muscle actin (SMA)-positive cells, but also cells positive for human liver and bile duct tumor cell markers such as GPC3, SMA, and CK19. The number of MMP9-positive macrophages was significantly increased, and the tumors were accompanied by human liver cancer-like symptoms such as iron particle deposition. 1. The zc3h12b-deficient medaka fish can serve as an animal model for studying intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, and their pathological processes. It can provide a platform for in-vivo animal research to deeply investigate the control of macrophage inflammatory response activation by the CCC3H zinc finger protein Zc3h12b, and the molecular mechanisms underlying lipopolysaccharide metabolism and macrophage immune responses specific to tissues other than the liver (such as the gonads and brain). Because "liver cancer" is referred to as "obesity" disease in traditional Chinese medicine (TCM), the zc3h12b-knockout medaka was named "obesity medaka." Compared with the prior art chemically induced liver cancer animal models, the animal model of the present invention can better simulate the clinical developmental process of intrahepatic bile duct cystadenoma or intrahepatic bile duct cystadenocarcinoma, and is more useful for in-depth exploration of genetic-level sex differences in intrahepatic bile duct cystadenoma and intrahepatic bile duct cystadenocarcinoma, and the single gene knockout method is simple and easy to operate. 2. The ZC3H12B gene or protein can be a therapeutic target for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or the associated fatty liver or liver cancer. 3. The ZC3H12B gene or protein can be used as a diagnostic marker for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith. 4. The ZC3H12B gene or protein can be targeted to screen for drugs to treat intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or related fatty liver or liver cancer. [Brief explanation of the drawings]

[0015] DESCRIPTION OF THE DRAWINGS Figure 1: ZC3H12B knockout "hypertensive medaka": fusion of hepatic bile duct proliferation, balloon-like fatty degeneration of hepatocytes (***); lymphocytic infiltration into the hepatic sinusoids

[0016] Figure 2-3: The functional regions in the molecular structure of the medaka Zc3h12b protein are highly evolutionarily conserved. Figure 2. The amino acid sequence of the medaka Zc3h12b protein shows high homology with the functional structural regions of Zc3h12b in birds, mammals, mice, and humans (first box in green: ubiquitin-associated domain UBA; second box in red: PIN Zc3h12 domain; third box in orange: CCCH-type zinc finger domain; fourth box in blue: RNase activity domain). Figure 3. Using multiple sequence alignment in the MUSCLE software of MEGAX and a phylogenetic tree created using the MEGAX Neighbor-joining tree, we concluded that the medaka Zc3h12b protein belongs to the Zc3h12 family. Phylogenetic tree analysis shows the four major Zc3h12 family members, Zc3h12A, -B, -C, and -D.

[0017] Figures 4-7: Using the CRISPR / CAS9 editing system to knock out the gene target in medaka Zc3h12b, we obtained five Zc3h12b mutants with partial or complete deletions. Figure 4. Sequence number and structure of the medaka zc3h12b gene. The yellow highlights in the figure indicate the gRNA sequences for two target sites in exon 1 of medaka zc3h12b. Figure 5. Genotyping of wild-type and knockout mice by PCR. Figure 6. DNA sequencing confirmation of the genomic PCR products of wild-type and knockout mice. Figure 7. Western blot (immunoblot) analysis of liver Zc3h12b protein for wild-type and knockout mice using an antibody raised against the N-terminal polypeptide. Western blot analysis revealed bands for wild-type Zc3h12b (OlaX-201, 845 aa, predicted 94.57 kDa; OlaX-202, 833 aa, predicted 93.37 kDa), whereas knockout livers showed reduced (Mut 3) or no (Mut 1) expression, confirming partial or complete loss of Zc3h12b protein after knockout. None of the five mutants expressed intact Zc3h2b protein.

[0018] Figure 8: Comparison of liver morphology between wild-type and knockout mice, and analysis of histological sections. Normal livers from males and females (ab) were deep red or brown, with a soft texture. Livers from knockout homozygotes (cd) were pale yellow to milky white, with thick, nodular tissue. In sections (e-e') of normal female liver, the hepatic sinusoids were regular and spread out without gaps. In sections (f-f') of knockout liver, there was abundant proliferation and fusion of bile ducts, as well as bile stasis, consistent with the marked shrinkage of the gallbladder in the intact liver. (ef) was observed at low magnification, and (e'-f') at high magnification.

[0019] Figure 9: Immunohistochemical analysis of anti-human SMA autoimmune antibodies. Low and high magnification images show the results of anti-SMA immunohistochemistry in sections of normal female (AA'), male (BB'), and knockout (C-C') livers. In the knockout livers, SMA-positive cells surrounded the abundant bile duct proliferation. This phenotype is similar to that observed in a bile acid-feeding-induced liver cancer mouse model, where SMA-positive cells surround and proliferate numerous bile ducts (P Fickert et al., American Journal of Pathology 2006).

[0020] Figure 10: Immunohistochemical analysis using anti-human cytokeratin 19 (CK19) antibody. Immunohistochemical reaction using anti-human CK19 antibody in liver sections from normal females, knockout females, and knockout males (low magnification A, B, C; high magnification A', B', C'). In normal livers, CK19-positive cells are present in small numbers and are almost undetectable, but in knockout livers, large numbers of CK19-positive cells are observed, accumulating in the proliferating bile ducts and surrounding tissues. In the negative control (B" NC) without anti-human CK19, no brown signal is observed. This is similar to the symptom of CK19-positive cells surrounding and proliferating bile ducts in a bile acid-induced liver cancer model mouse (P Fickert et al., American Journal of Pathology 2006).

[0021] Figure 11: Multiplex immunofluorescence staining using liver cancer marker antibodies. In normal male livers, anti-GPC3 and anti-MMP9 reactions were weak and difficult to detect. However, in the livers of zc3h12b-knockout medaka, many cells were positive for anti-human GPC3, anti-human MMP9, anti-human CK19, and anti-human SMA, suggesting the possibility that these cells may have become cancerous. Negative staining was observed with anti-GPC3 (green, arrow), anti-MMP9, anti-CK19, and anti-SMA (red, arrowhead), as well as 4',6-diamidino-2-phenylindole (DAPI) for cell nuclei.

[0022] Figure 12: Abnormal activation of macrophages in the liver of zc3h12b knockout medaka. Prussian blue staining and negative eosin staining revealed that small numbers of hepatic sinusoidal macrophages (Kupffer cells, KCs) containing iron particles were present in the hepatic sinusoids of normal males (low magnification A, high magnification A') and females (low magnification B, high magnification B'), and that these KCs were abnormally proliferating in the livers of zc3h12b knockout medaka (low magnification C, high magnification C'). DETAILED DESCRIPTION OF THE INVENTION

[0023] Specific Embodiments Zc3h12b Zc3h12b is a member of the Zc3h12 protein family, which is a CCCH-type zinc finger protein that plays a role in immune and inflammatory responses. In the present invention, the Zc3h12b protein used may be naturally occurring. For example, it may be isolated or purified from lower to higher vertebrates. Alternatively, the Zc3h12b protein that can be isolated or purified may be artificially prepared using conventional genetic engineering techniques to produce recombinant Zc3h12b protein.

[0024] Any suitable Zc3h12b protein may be used in the present invention, including a full-length Zc3h12b protein or a biologically active fragment thereof.

[0025] The present invention also encompasses amino acid sequences of Zc3h12b proteins formed through the substitution, deletion, or addition of one or more amino acid residues. Zc3h12b proteins or biologically active fragments thereof contain a sequence of conservative amino acids, which do not affect or retain a portion of the activity of the sequence. Appropriate amino acid substitutions are well known to those skilled in the art, are easily performed, and can be guaranteed not to alter the biological activity of the resulting molecule. These techniques have generally led those skilled in the art to recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity. See Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub. Co., p. 244.

[0026] Any biologically active fragment of Zc3h12b protein is applicable to the present invention. Here, a biologically active fragment of Zc3h12b protein means that, as a single polypeptide, it can still retain all or part of the function of the full-length Zc3h12b protein. Preferably, the biologically active fragment retains at least 50% of the activity of the full-length Zc3h12b protein. More preferably, the active fragment retains 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length Zc3h12b protein.

[0027] The present invention may also employ modified or improved Zc3h12b proteins to enhance their half-life, potency, metabolism, and / or protein effectiveness. The modified or improved Zc3h12b proteins may be conjugates of Zc3h12b proteins or may contain substituted or artificial amino acids.

[0028] That is, any form of substitution that does not affect the biological activity of the Zc3h12b protein may be used in the present invention.

[0029] Similarly, any naturally occurring, isolated and purified, artificially prepared, modified or improved Zc3h12b gene or fragment thereof that still has the ability to encode Zc3h12b protein may be used in the present invention.

[0030] Upregulator As used herein, the Zc3h12b upregulator includes promoters, agonists, etc. Any substance that enhances the activity of Zc3h12b protein, maintains the stability of Zc3h12b protein, promotes the expression of Zc3h12b protein, promotes the secretion of Zc3h12b protein, extends the effective action time of Zc3h12b protein, or promotes the transcription and translation of Zc3h12b can be used in the present invention.

[0031] In a preferred embodiment of the present invention, the Zc3h12b protein upregulator includes, but is not limited to, a vector or expression construct capable of expressing (preferably overexpressing) Zc3h12b after being introduced into a cell. Generally, the expression vector contains a gene cassette, which contains a Zc3h12b-encoding gene and an expression control sequence operably linked thereto. "Operably linked" or "operably linked" refers to a situation in which a portion of a linear DNA sequence can regulate or control the activity of another portion of the same linear DNA sequence. For example, a promoter is operably linked to a coding sequence when it controls the transcription of the sequence.

[0032] application The present invention provides the application of ZC3H12B gene or protein, or their upregulators, in the preparation of drugs for treating intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

[0033] Cholangiocarcinoma is a malignant tumor of the liver, divided into primary and secondary types. In this invention, it preferably refers to primary intrahepatic biliary cystadenocarcinoma, i.e., a malignant tumor of the liver derived from the hepatobiliary epithelium. Its etiology includes hepatitis B virus (HBV) and hepatitis C virus (HCV) infection, aflatoxin, drinking water contamination, alcohol, cirrhosis, sex hormones, nitrosamines, trace elements, and autoimmune liver disease.

[0034] The present invention also provides an application in the preparation of diagnostic reagents or kits for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or related fatty liver or liver cancer, using the ZC3H12B gene or protein as a diagnostic marker. According to the present invention, a reagent for detecting the amount of ZC3H12B gene or protein can be used to prepare diagnostic reagents or kits for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or related fatty liver or liver cancer. By analyzing the expression status of Zc3h12b protein or its encoding gene in a measurement sample, the disease status of the subject can be determined, providing evidence for disease diagnosis and prognosis. The measurement sample or the measurement target sample is a patient's tissue or body fluid.

[0035] Various techniques can be used to detect the expression status of Zc3h12b, and these techniques are included in the present invention. Existing techniques available for detecting nucleic acids include, but are not limited to, gene chip technology, probe hybridization technology, polymerase chain reaction (PCR), Northern Blot, etc. Protein detection can be performed by mass spectrometry or by Western Blot or ELISA.

[0036] The present invention also provides a method for screening for a drug that targets the ZC3H12B gene or protein and treats intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith, the method comprising: treating a ZC3H12B gene or protein expression system with a candidate substance; detecting expression of the ZC3H12B gene or protein in said system; If the candidate substance can enhance the expression of ZC3H12B gene or protein, it indicates that the candidate substance is a potential desired substance, and vice versa, it indicates that the candidate substance is a potential disliked substance.

[0037] The Zc3h12b expression system may be a cell that endogenously expresses Zc3h12b, or a cell that recombinantly expresses Zc3h12b. Such a Zc3h12b expression system may be a subcellular system, a solution system, a tissue system, an organ system, or an animal system (e.g., an animal model, preferably a lower or higher vertebrate model such as fish, mice, rabbits, sheep, or monkeys). In a preferred embodiment of the present invention, a control group can be further set up during screening to more easily observe changes in Zc3h12b expression, and the control group may be a Zc3h12b expression system to which the candidate substance is not added.

[0038] Animal models Based on the findings of the present invention, a method for establishing an animal model of liver disease is provided, comprising knocking down the expression of the ZC3H12b gene or protein in an animal. The liver disease can be intrahepatic bile duct cyst, intrahepatic bile duct cystadenocarcinoma, or related fatty liver or liver cancer. The animal can be selected from lower to higher vertebrates other than humans, including fish, amphibians, reptiles, birds, and mammals, including rodents, dogs, rabbits, monkeys, and humans.

[0039] The animal model of the present invention can serve as a good platform for studying the molecular mechanisms of intrahepatic bile duct cyst adenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

[0040] Drug Composition The pharmaceutical compositions of the present invention can comprise an active agent described herein and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are generally safe and nontoxic and can include any substance commonly used in the pharmaceutical industry for preparing pharmaceutical compositions, such as fillers, diluents, coagulants, adhesives, lubricants, glidants, stabilizers, colorants, wetting agents, and disintegrants. The selection of suitable excipients for synthetic peptide delivery primarily depends on the administration method of the pharmaceutical composition, and those skilled in the art are familiar with this technology. The content of the active agent in the pharmaceutical compositions of the present invention can be determined according to different therapeutic applications. The pharmaceutical compositions can be prepared according to known pharmaceutical science programs, such as those described in detail in "Remington's Pharmaceutical Sciences," 17th Edition, edited by Alfonoso R. Gennaro, Mack Publishing Company, Easton, Pennsylvania (1985). Pharmaceutical compositions of the present invention can be prepared in the form of capsules, granules, tablets, pills, oral solutions, injections, and the like, but are not limited to these.

[0041] The present invention will be further described below based on specific embodiments. It should be understood that these embodiments are only used to describe the present invention without limiting the scope of the present invention. In the following embodiments, experimental methods for which specific conditions are not specified generally follow general conditions, such as those described in Joseph Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Scientific Press, 2002, or those recommended by manufacturers. [Example]

[0042] Example 1 1. Knockout and identification of the zc3h12b gene Using the CRISPR / Cas 9 system, we microinjected 1-cell stage fertilized eggs of medaka fish to knock out the zc3h12b gene. The specific method is as follows.

[0043] (1) Medaka fish from the Enseble website (http: / / asia.ensembl.org / index.html) Obtain the zc3h12b gene sequence of Japanese medaka (HdrR, Oryzias latipes). Search for target knockout sites for the CRISPR / CAS9 editing system based on the medaka zc3h12b gene sequence on the Crisprscan website (http: / / crisprscan.org / ), and perform a cross-reference search with the medaka transcriptome using BLAST to select candidate sites that are not predicted to exhibit any nonspecific binding. Select the target site as close to the first ATG after the promoter as possible. Add a T7 promoter sequence before the target sequence and a gRNA scaffold sequence to the rear end. At the same time, to ensure the efficiency of the T7 promoter, the first two bases at the 5' end of the target site should be GG; otherwise, change C to G. The actual target site for this project is as follows: zc3h12bCrispr1:GCATGCCACTGAGGAGTCGG(SEQ ID NO:1) zc3h12bCrispr2:GGGAGAAACTAGGCCGGTCG(SEQ ID NO:2) They were synthesized by Shanghai Biotech Co. Ltd., and their synthetic sequences are as follows: (a) zc3h12bgRNA1: 5'- TAATACGACTCACTATA GGATGCCACTGAGGAGTCGG GTTTTAGAGCTAGAAATAGC (SEQ ID NO:3) (b) zc3h12bgRNA2: 5'- TAATACGACTCACTATA GGGAGAAACTAGGCCGGTCG GTTTTAGAGCTAGAAATAGC (SEQ ID NO:4) gRNA1 of zc3h12b and gRNA2 of zc3h12b were ligated to the sgRNA-scaffold 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 5) via PCR (1 round at 94°C for 3 minutes, 30 seconds at 94°C, 30 seconds at 65°C, 1 minute at 72°C (34 rounds), and 1 round at 72°C for 5 minutes). The PCR product was purified using a QIAquick PCR Purification Kit and then in vitro transcribed using the MAXIscript® T7 In Vitro Transcription Kit (Thermo Fisher Scientific, USA) to synthesize gRNAs. The gRNAs were mixed with Cas9 protein (Jinsirui Biotechnology, China) and microinjected to detect the knockout efficiency after embryo injection, ultimately focusing on the two target sites.

[0044] (2) One-cell stage fertilized eggs were microinjected twice. Composition of microinjection solution: 1) gRNA1 (100 ng / μl) and Cas9 protein (100 ng / μl) added; 2) Add gRNA1 (100 ng / μl), gRNA2 (100 ng / μl), and Cas9 protein (100 ng / μl).

[0045] (3) Identification of target knockout results 1) Primer synthesis Fw9:5'- GACTTAGACGGAGAAGACCATATTAG(SEQ ID NO:6) Rv10:5'-CGCACCAATTCAGCAAGAAC(SEQ ID NO:7) Primers Fw9 and Rv10 can specifically amplify the exon 1 segment fragment of medaka zc3h12b to distinguish between the wild type and the zc3h12b knockout type.

[0046] 2) DNA was extracted from fish eggs 5 days after injection and PCR was performed using primers Fw9 and Rv10. The PCR products were then subjected to direct sequencing to detect the mutation efficiency of the target site. Compared to normal wild-type (WT) embryos, PCR direct sequencing of the knockout embryos revealed clear overlapping peaks at the target site, indicating that the target site had been edited, demonstrating the successful editing effect of the gRNA / Cas9 system.

[0047] 3) The injected eggs were raised to adulthood, and their tails were clipped to extract DNA. PCR amplification was performed using primers FW9 and RV10. The PCR products were then sequenced to confirm the presence of overlapping peaks. Furthermore, the presence of gene editing in the zc3h12b gene in the detected adult fish was confirmed. The results are shown in Table 1. A total of 134 fertilized eggs were injected in two microinjections, resulting in a 76% survival rate for blastulae and a 66% hatching rate for fry. Finally, five F0 seed fish were obtained (Founder: three single-targeted fish (one female, two males); two double-targeted fish (one female, one male) with germ cells capable of transmitting genes to offspring).

[0048] [Table 1]

[0049] 2. Genetic crossing and selective breeding to obtain different zc3h12b knockout fish Medaka fish were raised in a water-circulating system at 26–28°C with a 14 / 10 h light / dark cycle, strictly following the guidelines of the Shanghai Ocean University Laboratory Animal Research Committee. Both gRNA 1 and gRNA 2 targets were injected simultaneously. Gene-edited adult fish were used as breeding stock and paired with wild-type males and females. The resulting offspring were then raised to adulthood. Their tails were then clipped to extract DNA, and PCR was performed using FW9 and RV10 primers to identify the zc3h12b genotype. The PCR product was then ligated into the pGEM®-T Easy (Promega, USA) vector, and the plasmid was extracted and sequenced to identify the DNA sequence. Confirmed heterozygotes were paired with each other, and the offspring genotype was confirmed to conform to Mendelian inheritance rules. Finally, homozygotes with zc3h12b knockout were obtained.

[0050] Specific PCR was performed on genomic DNA using primers FW9 and RV10 to amplify a local region of exon 1 of zc3h12b and identify wild-type, heterozygote, and homozygote individuals. Five mutants were identified: Mut 1, a 214-bp deletion; Mut 2, a 68-bp deletion; Mut 3, a 137-bp insertion; Mut 4, a 1-bp gain; and Mut 5, a 4-bp gain. The PCR amplification products of the wild-type and knockout mutants were detected and compared by electrophoresis, based on the gain or loss of the knockout mutant bases, to obtain the genotypes of the wild-type and multiple mutant individuals (Figure 4-7).

[0051] 3. Observation of the liver structure and histological morphology of wild-type and zc3h12b gene knockout medaka fish This study involved dissection and stereoscopic observation of sexually mature medaka (over 3 months old). Wild-type adult fish, three males and three females, were prepared. Two heterozygous males and five homozygous fish were stereoscopically dissected, and tissues such as the liver and gonads were fixed in 4% paraformaldehyde (PFA) using standard methods. The tissues were embedded in paraffin and cut into tissue sections (6 microns thick) using a Leica RM 2265 automated microtome, Germany. These were then stained with hematoxylin and eosin (HE) to observe histological and morphological changes in the liver and other tissues of wild-type and zc3h12b gene knockout individuals.

[0052] The results are shown in Figure 8. While the wild-type livers of both sexes were pale brown (Fig. 8a and b), the livers of the knockout homozygotes were slightly pale yellow or milky white, with obvious nodules and cysts (Fig. 8c, d, c' and d'). In contrast to the green gallbladders of the wild-type animals (Fig. 8a" and b"), the gallbladders of the knockout homozygotes were significantly atrophied, with bile stasis in the liver (Fig. 8c" and d"). In normal liver sections, hepatocytes in the hepatic sinusoids were neatly arranged, and no bile stasis was observed in the bile ducts (Fig. 8e and e'). However, in the knockout livers, obvious cysts were present, and at higher magnification, numerous bile duct proliferations, irregular fusions, bile stasis in the bile ducts, and hepatocyte necrosis and loss were evident (Fig. 8f and f').

[0053] 4. Immunohistochemical analysis of surface antibodies in liver cancer [Table 2]

[0054] Immunohistochemistry and / or immunofluorescence analysis was performed on liver sections from normal and knockout groups using rabbit anti-human α-SMA (or rabbit anti-human CK 19, rabbit anti-human MMP 3, mouse anti-human GPC 3, etc.) antibody as the primary antibody (1:100) and goat anti-rabbit (or mouse) IgG-HRP conjugate (MBL, Japan) as the secondary antibody (2nd antibody, 1:1000). Chemical color development was performed using diaminobenzidine (DAB, Denmark), a peroxidase chromogenic substrate, or by tyramide fluorescent signal amplification (TSA) technology.TM The images were taken using a Plus Fluorescence System (PerkinElmer Life Science, USA) and a confocal laser scanning microscope (Leica DMi8 TCS SP 8, Germany).

[0055] In normal liver sections from 6-month-old wild-type mice, a small number of cells showed faint α-SMA-positive reactions (Fig. 9A and A'), and many α-SMA-positive cells were found near localized fat particles in males (Fig. 9B and B'). In 6-month-old knockout livers, abnormal proliferation of α-SMA-positive cells was observed around areas of bile duct proliferation (Fig. 9C and C'). In negative control sections, no primary antibody was added, and thus no signals were detected (Fig. 9A", B", C").

[0056] Cytokeratin 19 (CK 19) is one of the key antibodies for the differential diagnosis between hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC). In the livers of 3- to 6-month-old knockout male and female mice, there were varying degrees of anti-human CK 19-positive cells around the bile ducts (Figure 10), suggesting that zc3h12b knockout is likely to cause cholestasis and ICC.

[0057] The human liver and bile duct tumor cell markers matrix metalloproteinase-9 (MMP-9) and glypican-3 (GPC-3) were significantly higher in liver sections from zc3h12b knockout medaka fish than in normal liver controls (Figure 11). The distribution of GPC-3 / MMP-9 and GPC-3 / CK-19 co-expression in some cells (Figure 11B and C) indicates that GPC-3 is expressed in cells distinct from SMA (Figure 11D-D', arrows indicate α-SMA-positive cells, and triangles indicate α-GPC-3-positive cells).

[0058] 5. In the liver of zc3h12b knockout mice, macrophages loaded with large amounts of iron are activated. Prussian blue staining of iron-depositing macrophages: Paraffin liver sections were dewaxed using xylene, rehydrated through a series of alcohols of decreasing concentration, washed three times with deionized water, and then stained with a 1:1 mixture of freshly prepared 20% hydrochloric acid and 10% potassium ferrocyanide for 2 hours at room temperature, away from light, and then left overnight at 4°C. The next day, they were returned to room temperature for 30 minutes, washed three times with distilled water (5 minutes each), stained with eosin for 2-3 minutes, dehydrated with increasing concentrations of alcohol, reduced to xylene, and mounted in neutral resin. The sections were then observed under a microscope and photographed (Nikon NI-SE).

[0059] Hepatic macrophages regulate and maintain the local liver microenvironment by releasing various pro- and anti-inflammatory factors and are key innate immune cells within the liver. Using a combination of iron Prussian blue staining and eosin-negative staining, we detected a small number of Prussian blue-positive (iron particle-containing) macrophages in normal male and female livers, while activated macrophage proliferation containing large amounts of iron particles was detected in the zc3h12b knockout livers (Figure 12).

[0060] Based on the above, by knocking out ZC3H12B, the present invention establishes hypertrophic medaka that mimic human intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or associated fatty liver or liver cancer. These medaka exhibit signs of liver cancer, such as bile stagnation in the liver, fused bile duct proliferation, fatty inflammation and activated macrophages, and an increase in cells positive for human liver and bile duct tumor cell markers, and can provide a living animal model for research on intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or associated fatty liver or liver cancer.

[0061] It should be noted that the above is only a preferred embodiment of the present invention, and those skilled in the art may make some improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered as part of the protection scope of the present invention.

Claims

1. The use of ZC3H12b gene or protein, or their upregulators, in the preparation of a drug for treating intrahepatic biliary cystadenoma (BCA), intrahepatic biliary cystadenocarcinoma (BCAC), or fatty liver or liver cancer associated therewith.

2. The application according to claim 1, characterized in that the upregulator is selected from small molecule compounds or biopolymers.

3. A pharmaceutical composition for treating intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith, comprising an upregulator of the ZC3H12B gene or protein and a pharmaceutically acceptable carrier.

4. Application of the ZC3H12B gene or protein as a diagnostic marker in the preparation of diagnostic reagents or diagnostic kits for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

5. The use of a reagent for detecting the amount of ZC3H12B gene or protein in the preparation of a diagnostic reagent or kit for intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

6. A method for screening drugs for treating intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith, by targeting the ZC3H12B gene or protein, comprising: treating a ZC3H12B gene or protein expression system with a candidate substance; detecting expression of the ZC3H12B gene or protein in said system; A method characterized in that if the candidate substance can improve the expression of the ZC3H12B gene or protein, the candidate substance is indicated as a potential substance that is necessary, and vice versa, the candidate substance is indicated as a potential substance that is unnecessary.

7. A method for establishing an animal model of liver disease, comprising the step of knocking down ZC3H12B gene or protein expression in the animal.

8. The application according to claim 7, characterized in that the liver disease is intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or fatty liver or liver cancer associated therewith.

9. 8. The application according to claim 7, characterized in that the animal is selected from lower to higher vertebrates other than humans.

10. Use of an animal model of liver disease established according to the method of any one of claims 7 to 9, said use comprising: a) Study of the molecular mechanisms involved in the regulation of macrophage-mediated fatty liver development and liver cancer-like changes by ZC3H12b in humans and / or animals; b) Research into the molecular pathogenesis of intrahepatic bile duct cystadenoma, intrahepatic bile duct cystadenocarcinoma, or related fatty liver or liver cancer caused by Zc3h12b in humans or animals; c) Research into the pathogenic mechanisms and mechanisms of Zc3h12b-induced atrophy and necrosis of the liver parenchyma and fibrocarcinoma in intrahepatic bile duct cystadenoma or intrahepatic bile duct cystadenocarcinoma; d) The use is selected from the following: effects on the differentiation or development of male and female livers in humans and animals; and screening for the identification of the effects of inherent sex differences or exogenous environmental factors on the incidence of intrahepatic bile duct cystadenoma or intrahepatic bile duct cystadenocarcinoma.