Gene knockout of NRF2 for treatment of cancer

Abstract

To provide compositions and methods for knocking out NRF2 to treat cancer using Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) / endonuclease gene editing.SOLUTION: A Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) system for use as a medicament, comprising: (a) a guide RNA (gRNA) comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target domain from an NRF2 gene, and (b) a CRISPR-associated endonuclease.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 62 / 852,076, filed May 23, 2019, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing The sequence listing associated with this application has been filed in electronic format via EFS-Web and is incorporated herein by reference in its entirety. The name of the text file containing the sequence listing is 130949_00120_SEQUENCELISTING.TXT. The text file size is 13KB and the text file was created on May 22, 2020.

[0003] Field The present disclosure relates to compositions and methods for knocking out NRF2 to treat cancer using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / endonuclease gene editing. [Background technology]

[0004] Cancer is currently one of the leading causes of death in developed countries. Traditionally, a cancer diagnosis is accompanied by serious health complications. Cancer can cause disfigurement, chronic or acute pain, lesions, organ failure, or even death. Commonly diagnosed cancers include lung cancer, pancreatic cancer, breast cancer, melanoma, lymphoma, carcinoma, sarcoma, leukemia, endometrial cancer, colon and rectal cancer, prostate cancer, and bladder cancer. Traditionally, many cancers are treated with surgery, chemotherapy, radiation, or a combination thereof. Chemotherapeutic agents used in cancer treatment are known to cause numerous serious and unpleasant side effects in patients. For example, some chemotherapeutic agents cause neuropathy, nephrotoxicity, stomatitis, hair loss, decreased immunity, anemia, cardiac toxicity, fatigue, neuropathy, bone marrow suppression, or a combination thereof. Chemotherapy often becomes ineffective or loses effectiveness after a period of efficacy, either during treatment or shortly after the treatment regimen is completed. Thus, there is a need for improved methods of treating cancer. Summary of the Invention

[0005] One aspect relates to a method for reducing the expression or activity of NRF2 in a cell, the method comprising: (a) introducing into a cell one or more DNA sequences encoding one or more guide RNAs (gRNAs) that are complementary to one or more target sequences in the NRF2 gene; and (b) a nucleic acid sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease, whereby the one or more gRNAs hybridize to the NRF2 gene, the CRISPR-associated endonuclease cleaves the NRF2 gene, and the expression or activity of NRF2 in the cell is reduced compared to a cell into which the one or more DNA sequences encoding the one or more gRNAs and the nucleic acid sequence encoding the CRISPR-associated endonuclease have not been introduced. In some embodiments, the one or more gRNAs are complementary to one or more target sequences in exon 1, 2, 3, 4, or 5 of the NRF2 gene, or across two exons. In some embodiments, the one or more gRNAs comprise a transactivating small RNA (tracrRNA) and a CRISPR RNA (crRNA). In some embodiments, the one or more gRNAs are one or more single guide RNAs. In some embodiments, the CRISPR-associated endonuclease is a class 2 CRISPR-associated endonuclease, and in some embodiments, the class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. In some embodiments, the expression of one or more alleles of the NRF2 gene is reduced in the cell. In some embodiments, NRF2 activity is reduced in the cell. In some embodiments, NRF2 expression or activity is not completely eliminated in the cell. In some embodiments, NRF2 expression or activity is completely eliminated in the cell. In some embodiments, the cell is a eukaryotic cell; in some embodiments, the eukaryotic cell is a mammalian cell; in some embodiments, the mammalian cell is a human cell.

[0006] An additional embodiment relates to a cell comprising a mutant NRF2 gene produced by the aforementioned method.

[0007] Another aspect relates to a method for reducing the expression or activity of NRF2 in a cell, the method comprising: (a) introducing one or more guide RNAs (gRNAs) complementary to one or more target sequences in the NRF2 gene and (b) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease into the cell, whereby the one or more gRNAs hybridize to the NRF2 gene, the CRISPR-associated endonuclease cleaves the NRF2 gene, and the expression or activity of NRF2 in the cell is reduced compared to a cell in which the one or more gRNAs and the CRISPR-associated endonuclease are not introduced. In some embodiments, the one or more gRNAs are complementary to one or more target sequences in exon 1, 2, 3, 4, or 5 of the NRF2 gene, or spanning two exons. In some embodiments, the one or more gRNAs comprise a transactivating small RNA (tracrRNA) and a CRISPR RNA (crRNA). In some embodiments, the one or more gRNAs are one or more single guide RNAs. In some embodiments, the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease, and in some embodiments, the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. In some embodiments, the expression of one or more alleles of the NRF2 gene is reduced in the cell. In some embodiments, NRF2 activity is reduced in the cell. In some embodiments, NRF2 expression or activity is not completely eliminated in the cell. In some embodiments, NRF2 expression or activity is completely eliminated in the cell. In some embodiments, the cell is a eukaryotic cell; in some embodiments, the eukaryotic cell is a mammalian cell; in some embodiments, the mammalian cell is a human cell.

[0008] An additional embodiment relates to a cell comprising a mutant NRF2 gene produced by the aforementioned method.

[0009] A further aspect relates to a guide RNA (gRNA) comprising a DNA-binding domain and a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in the NRF2 gene, and the gRNA does not comprise the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the gRNA is complementary to the target sequence in exon 1, 2, 3, 4, or 5 of the NRF2 gene, or across two exons. In some embodiments, the DNA-binding domain comprises the nucleic acid sequence of SEQ ID NO: 2, or a biologically active fragment thereof. In some embodiments, the gRNA comprises a trans-activating small RNA (tracrRNA) and a CRISPR RNA (crRNA). In some embodiments, the gRNA is a single guide RNA.

[0010] Additional aspects relate to pharmaceutical compositions comprising the gRNA described above. In some embodiments, the pharmaceutical composition further comprises a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease; in some embodiments, the CRISPR-associated endonuclease is a class 2 CRISPR-associated endonuclease; in some embodiments, the class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

[0011] Another aspect relates to a ribonucleoprotein (RNP) complex comprising the gRNA and a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease. In some embodiments, the CRISPR-associated endonuclease is a class 2 CRISPR-associated endonuclease; in some embodiments, the class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

[0012] A further aspect relates to a pharmaceutical composition comprising the aforementioned RNP complex.

[0013] Additional aspects relate to DNA sequences encoding the aforementioned gRNAs or biologically active fragments thereof. In some embodiments, the biologically active fragment is a tracrRNA or a crRNA, and in some embodiments, the biologically active fragment is a crRNA comprising the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the DNA sequence comprises the nucleic acid sequence of SEQ ID NO: 1.

[0014] Another aspect relates to the vector comprising the DNA sequence described above.In some embodiments, the vector is an adeno-associated virus (AAV) vector.In some embodiments, the vector further comprises the nucleic acid sequence encoding clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease protein;In some embodiments, the CRISPR-associated endonuclease is class 2 CRISPR-associated endonuclease;In some embodiments, the class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

[0015] Further aspects relate to pharmaceutical compositions comprising the aforementioned DNA sequence or the aforementioned vector.In some embodiments, the pharmaceutical composition further comprises a nucleic acid sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease protein; in some embodiments, the CRISPR-associated endonuclease is a class 2 CRISPR-associated endonuclease; in some embodiments, the class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

[0016] An additional aspect relates to a pharmaceutical composition comprising the aforementioned DNA sequence, further comprising a nucleic acid sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR) associated endonuclease protein.

[0017] Another aspect relates to a method for treating cancer in a subject, comprising administering a therapeutically effective amount of the pharmaceutical composition to the subject. In some embodiments, the cancer is resistant to one or more chemotherapeutic agents. In some embodiments, the cancer is selected from the group consisting of lung cancer, melanoma, esophageal squamous cell carcinoma (ESC), head and neck squamous cell carcinoma (HNSCC), and breast cancer; in some embodiments, the lung cancer is non-small cell lung cancer (NSCLC); in some embodiments, the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. In some embodiments, the method further comprises administering one or more chemotherapeutic agents to the subject; in some embodiments, the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof; in some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce cancer cell proliferation compared to cancer cells treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition; in some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to tumors treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition. In some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce proliferation of cancer cells compared to cancer cells not treated with the pharmaceutical composition. In some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to tumors not treated with the pharmaceutical composition. In some embodiments, the subject is a human.

[0018] A further aspect relates to a method of reducing resistance to chemotherapeutic agents in cancer, comprising administering to a subject a therapeutically effective amount of the aforementioned pharmaceutical composition.

[0019] Other objects and advantages will become apparent to those skilled in the art upon reference to the following detailed description. The present invention also relates to the following: [Item 1] A clustered regularly interspaced short palindromic repeats (CRISPR) system for use as a pharmaceutical, comprising: (a) a guide RNA (gRNA) comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a CRISPR-associated endonuclease. [Item 2] 2. The CRISPR system for use according to item 1, wherein the gRNA is complementary to a target sequence in exon 2, exon 4, and / or exon 5 of the NRF2 gene. [Item 3] 3. The CRISPR system for use according to item 1 or 2, wherein the DNA-binding domain comprises the nucleic acid sequence of SEQ ID NO: 2 or a biologically active fragment thereof. [Item 4] 4. The CRISPR system for use of any one of items 1 to 3, wherein the gRNA comprises a trans-activating small RNA (tracrRNA) and a CRISPR RNA (crRNA). [Item 5] 5. The CRISPR system for use of any one of items 1 to 4, wherein the gRNA is a single gRNA. [Item 6] 6. The CRISPR system of any one of items 1 to 5 for use in treating cancer. [Item 7] 7. The CRISPR system for use according to item 6, wherein the cancer is resistant to one or more chemotherapeutic agents. [Item 8] Item 9. The CRISPR system for use according to Item 6 or 7, wherein the cancer is selected from the group consisting of lung cancer, melanoma, esophageal squamous cell carcinoma (ESC), head and neck squamous cell carcinoma (HNSCC), and breast cancer. Item 9. The CRISPR system for use according to item 8, wherein the lung cancer is non-small cell lung cancer (NSCLC). [Item 10] 10. The CRISPR system for use according to item 9, wherein the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. [Item 11] 11. The CRISPR system for use according to any one of items 1 to 10, further comprising one or more chemotherapeutic agents. [Item 12] 12. The CRISPR system for use according to item 11, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof. [Item 13] 13. The CRISPR system for use according to any one of items 1 to 12, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 14] 14. The CRISPR system for use according to item 13, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 15] A ribonucleoprotein (RNP) complex for use as a pharmaceutical, comprising: (a) a gRNA comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a CRISPR-associated endonuclease. [Item 16] 16. The RNP complex for use according to item 15, wherein the gRNA is complementary to a target sequence in exon 2, exon 4, and / or exon 5 of the NRF2 gene. [Item 17] 17. The RNP complex for use according to item 15 or 16, wherein the DNA-binding domain comprises the nucleic acid sequence of SEQ ID NO: 2 or a biologically active fragment thereof. [Item 18] 18. The RNP complex for use according to any one of items 15 to 17, wherein the gRNA comprises a tracrRNA and a crRNA. [Item 19] 19. The RNP complex for use according to any one of items 15 to 18, wherein the gRNA is a single gRNA. [Item 20] 21. The RNP complex of any one of items 15 to 19, for use in treating cancer. 21. The RNP complex for use according to item 20, wherein the cancer is resistant to one or more chemotherapeutic agents. [Item 22] 22. The RNP complex for use according to item 20 or 21, wherein the cancer is selected from the group consisting of lung cancer, melanoma, ESC, HNSCC, and breast cancer. [Item 23] 23. The RNP complex for use according to item 22, wherein the lung cancer is NSCLC. [Item 24] 24. The RNP complex for use according to item 23, wherein the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. [Item 25] 25. The RNP complex for use according to any one of items 15 to 24, further comprising one or more chemotherapeutic agents. [Item 26] 26. The RNP complex for use according to item 25, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof. [Item 27] 27. The RNP complex for use according to any one of items 15 to 26, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 28] 28. The RNP complex for use according to item 27, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 29] 1. A method for reducing the expression or activity of NRF2 in a cell, comprising introducing into the cell (a) one or more DNA sequences encoding one or more gRNAs complementary to one or more target sequences in the NRF2 gene, and (b) a nucleic acid sequence encoding a CRISPR-associated endonuclease, whereby the one or more gRNAs hybridize to the NRF2 gene and the CRISPR-associated endonuclease cleaves the NRF2 gene, and the expression or activity of NRF2 is reduced in the cell compared to a cell into which the one or more DNA sequences encoding the one or more gRNAs and the nucleic acid sequence encoding the CRISPR-associated endonuclease have not been introduced. [Item 30] 30. The method of item 29, wherein the one or more gRNAs are complementary to one or more target sequences in exon 2, exon 4, and / or exon 5 of the NRF2 gene. [Item 31] 31. The method of item 29 or 30, wherein the one or more gRNAs comprise a tracrRNA and a crRNA. [Item 32] 32. The method of any one of items 29 to 31, wherein the one or more gRNAs are one or more single gRNAs. [Item 33] 33. The method of any one of paragraphs 29 to 32, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 34] 34. The method of claim 33, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 35] 35. The method of any one of items 29 to 34, wherein the expression of one or more alleles of the NRF2 gene is reduced in the cell. [Item 36] 36. The method of any one of items 29 to 35, wherein NRF2 activity is reduced in the cell. [Item 37] 36. The method of any one of items 29 to 35, wherein NRF2 expression or activity is not completely eliminated in the cell. [Item 38] 36. The method of any one of items 29 to 35, wherein NRF2 expression or activity is completely eliminated in the cell. [Item 39] 39. The method of any one of items 29 to 38, wherein the cell is a eukaryotic cell. [Item 40] 40. The method of item 39, wherein the cell is a mammalian cell. [Item 41] 41. The method of item 40, wherein the mammalian cells are human cells. [Item 42] 42. The method of any one of items 29 to 41, wherein the cell is a cancer cell. [Item 43] 43. The method of item 42, wherein the cancer cells are selected from the group consisting of lung cancer cells, melanoma cells, ESC cells, HNSCC cells, and breast cancer cells. [Item 44] Item 44. The method of item 43, wherein the lung cancer cells are NSCLC cells. [Item 45] 45. The method of item 44, wherein the NSCLC cells are adenocarcinoma cells, squamous cell carcinoma cells, or large cell carcinoma cells. [Item 46] 46. ​​A cell containing a mutant NRF2 gene produced by the method according to any one of items 29 to 45. [Item 47] A method for reducing the expression or activity of NRF2 in a cell, comprising introducing into the cell (a) one or more gRNAs complementary to one or more target sequences in the NRF2 gene, and (b) a CRISPR-associated endonuclease, whereby the one or more gRNAs hybridize to the NRF2 gene and the CRISPR-associated endonuclease cleaves the NRF2 gene, and the expression or activity of NRF2 is reduced in the cell compared to a cell in which the one or more gRNAs and CRISPR-associated endonuclease have not been introduced. [Item 48] 48. The method of item 47, wherein the one or more gRNAs are complementary to one or more target sequences in exon 2, exon 4, and / or exon 5 of the NRF2 gene. [Item 49] 49. The method of item 47 or 48, wherein the one or more gRNAs comprise a tracrRNA and a crRNA. [Item 50] 50. The method of any one of items 47 to 49, wherein the one or more gRNAs are one or more single gRNAs. [Item 51] 51. The method of any one of paragraphs 47 to 50, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 52] 52. The method of claim 51, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 53] 53. The method of any one of items 47 to 52, wherein the expression of one or more alleles of the NRF2 gene is reduced in the cell. [Item 54] 54. The method of any one of items 47 to 53, wherein NRF2 activity is reduced in the cell. [Item 55] 54. The method of any one of paragraphs 47 to 53, wherein NRF2 expression or activity is not completely eliminated in the cell. [Item 56] 54. The method of any one of items 47 to 53, wherein NRF2 expression or activity is completely eliminated in the cell. [Item 57] 57. The method of any one of items 47 to 56, wherein the cell is a eukaryotic cell. [Item 58] 58. The method of item 57, wherein the cell is a mammalian cell. [Item 59] 59. The method of item 58, wherein the mammalian cells are human cells. [Item 60] 60. The method of any one of items 47 to 59, wherein the cell is a cancer cell. [Item 61] 61. The method of item 60, wherein the cancer cells are selected from the group consisting of lung cancer cells, melanoma cells, ESC cells, HNSCC cells, and breast cancer cells. [Item 62] Item 62. The method of item 61, wherein the lung cancer cells are NSCLC cells. [Item 63] 63. The method of item 62, wherein the NSCLC cells are adenocarcinoma cells, squamous cell carcinoma cells, or large cell carcinoma cells. [Item 64] 64. A cell containing a mutant NRF2 gene produced by the method according to any one of items 47 to 63. [Item 65] A gRNA comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in an NRF2 gene, and the gRNA does not comprise the nucleic acid sequence of SEQ ID NO:4. [Item 66] 66. The gRNA of item 65, wherein the gRNA is complementary to a target sequence in exon 2, exon 4, and / or exon 5 of the NRF2 gene. [Item 67] 67. The gRNA of item 65 or 66, wherein the DNA-binding domain comprises the nucleic acid sequence of SEQ ID NO: 2 or a biologically active fragment thereof. [Item 68] 68. The gRNA of any one of items 65 to 67, comprising a tracrRNA and a crRNA. [Item 69] 69. The gRNA of any one of items 65 to 68, wherein the gRNA is a single gRNA. [Item 70] 70. A pharmaceutical composition comprising the gRNA of any one of items 65 to 69. [Item 71] 71. The pharmaceutical composition of item 70, further comprising a CRISPR-associated endonuclease. [Item 72] 72. The pharmaceutical composition of claim 71, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 73] 73. The pharmaceutical composition of item 72, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 74] 70. An RNP complex comprising the gRNA and CRISPR-associated endonuclease of any one of items 65 to 69. [Item 75] 75. The RNP complex of item 74, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 76] 76. The RNP complex of item 75, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 77] 77. A pharmaceutical composition comprising an RNP complex according to any one of items 74 to 76. [Item 78] 70. A DNA sequence encoding the gRNA of any one of items 65 to 69, or a biologically active fragment thereof. [Item 79] 79. The DNA sequence of item 78, wherein the biologically active fragment is tracrRNA or crRNA. [Item 80] 80. The DNA sequence of item 79, wherein the DNA sequence comprises the nucleic acid sequence of SEQ ID NO: 1. [Item 81] 81. The DNA sequence of item 80, wherein the biologically active fragment is a crRNA comprising the nucleic acid sequence of SEQ ID NO: 1. [Item 82] 82. A vector comprising the DNA sequence of any one of items 78 to 81. [Item 83] 83. The vector of item 82, wherein the vector is an adeno-associated virus (AAV) vector. [Item 84] 84. The vector of item 82 or 83, further comprising a nucleic acid sequence encoding a CRISPR-associated endonuclease protein. [Item 85] 85. The vector of item 84, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 86] 86. The vector of item 85, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 87] 87. A pharmaceutical composition comprising a DNA sequence according to any one of items 78 to 81 or a vector according to any one of items 82 to 86. [Item 88] 82. A pharmaceutical composition comprising the DNA sequence of any one of items 78 to 81, further comprising a nucleic acid sequence encoding a CRISPR-associated endonuclease protein. [Item 89] 89. The pharmaceutical composition of item 88, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease. [Item 90] 90. The pharmaceutical composition of item 89, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a. [Item 91] 10. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of any one of items 70 to 73, 77, or 87 to 90. [Item 92] 92. The method of item 91, wherein the cancer is resistant to one or more chemotherapeutic agents. [Item 93] 93. The method of item 91 or 92, wherein the cancer is selected from the group consisting of lung cancer, melanoma, ESC, HNSCC, and breast cancer. [Item 94] Item 94. The method of item 93, wherein the lung cancer is NSCLC. [Item 95] 95. The method of item 94, wherein the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. [Item 96] 96. The method of any one of items 91 to 95, further comprising administering one or more chemotherapeutic agents to the subject. [Item 97] 97. The method of item 96, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof. [Item 98] 98. The method of any one of paragraphs 91 to 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce proliferation of cells of the cancer compared to cancer cells not treated with the pharmaceutical composition. [Item 99] 98. The method of any one of items 91 to 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to a tumor not treated with the pharmaceutical composition. [Item 100] 98. The method of item 96 or 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce proliferation of cells of the cancer compared to cancer cells that have been treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition. [Item 101] 98. The method of item 96 or 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to a tumor that has been treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition. [Item 102] 102. The method of any one of items 91 to 101, wherein the subject is a human. [Brief explanation of the drawings]

[0020] [Figure 1A]Figure 1 shows the CRISPR design and NRF2 knockout experimental workflow. The NRF2 coding region, containing six known gene isoforms, was utilized for CRISPR / Cas9 targeting. gRNA sequences are shown along with their chromosomal locus and cloning details (A). Structural domains and locations for CRISPR-directed gene editing of the NRF2 protein (B). Experimental workflow for testing the effects of CRISPR / Cas9 knockout of NRF2 in targeted populations and isolated, expanded clonal cell lines (C). [Figure 1B] Continuation of Figure 1A. [Figure 1C] This is a continuation of Figure 1B. [Figure 2A] Genomic analysis of NRF2 knockout clones. Bulk-sorted GFP+ A549 cells transfected with either gRNA1 or gRNA2 were Sanger sequenced and analyzed for indel activity by TIDE (A). Clonally isolated NRF2-targeted cells were genomically analyzed for CRISPR / Cas9-induced NHEJ activity. Genomic DNA was Sanger sequenced, and TIDE was used to develop the indel spectrum, sequence resolution, and allelic pattern of NRF2, as shown in clones 1–40 and 2–11 (B). [Figure 2B] Continuation of Figure 2A. [Figure 3A] Figure 1 shows cell proliferation profile and Western blot analysis of NRF2 knockout A549 cells. Cells were fixed with ethanol for 72 hours and stained with Alexa Fluor 647 Anti-Ki67. The intensity of Ki67-stained cells was captured using fluorescence-activated cell sorting (FACS) and plotted as a histogram using FlowJo software (left panel) (A). Cell proliferation was measured by bioreduction of MTS to a formazan product and plotted as the mean raw absorbance value (right panel). Error bars represent ± SEM (A). Western blot analysis of wild-type A549 cells and NRF2 knockout 2-11 cells using an antibody against phosphorylated NRF2 (B). [Figure 3B]This is a continuation of Figure 3A. [Figure 4] Figure 2 shows the proliferation potential of wild-type and NRF2-modified A549 cells (2-11) in response to chemotherapeutic drugs. Proliferation was measured by bioreduction of MTS to a formazan product. Cells were treated with increasing doses of cisplatin (A) and increasing doses of cisplatin and 5 µM vinorelbine (B) for 72 hours, and then cell proliferation was assessed. Error bars represent ± SEM. [Figure 5A] Figure 1. Restored chemosensitivity in mice with NRF2 knockout tumors. Experimental workflow for mouse xenografts. Athymic nude mice were subcutaneously injected with either wild-type A549 cells or NRF2 knockout A549 cells. Once tumors reached 100 mm3, they were treated with the first dose of chemotherapy on day 0. Mice were then treated with chemotherapy on days 3, 6, and 9. Tumor volume was measured daily for 16 days until tumors reached 2000 mm3 (A). Wild-type A549 or NRF2 knockout A549 tumors were treated with either 2 mg / kg cisplatin (B), 5 mg / kg cisplatin and 5 mg / kg vinorelbine (C), 25 mg / kg carboplatin (D), or saline, and tumor size was measured for 16 days. Error bars represent ± SEM. Tumors (treated with 2 mg / kg cisplatin or saline) were excised from both wild-type A549 and NRF2 knockout A549 (2–11) mice. Representative tumors from each group are shown (n = 3) (E). [Figure 5B] This is a continuation of Figure 5A. [Figure 5C] This is a continuation of Figure 5B. [Figure 5D] This is a continuation of Figure 5C. [Figure 5E] This is a continuation of Figure 5D. [Figure 6]Figure 1. Xenograft tumor growth. Representative images of xenograft tumors excised from mice implanted with either wild-type A549 or NRF2 knockout A549 cells (2-11) 16 days after initial treatment with either 2 mg / kg cisplatin or saline were segmented and stained with Ki67 (green) and DAPI (blue). Mean fluorescence intensity values ​​for DAPI and Ki67 were obtained for the images using Zeiss Zen software, and relative values ​​were obtained for Ki67 fluorescence intensity. Scale bar represents 100 µm. [Figure 7A] Figure 1 shows cisplatin-induced nuclear and cytoplasmic localization of NRF2 in wild-type A549 cells and clone 2-11. Cells were treated with 2 μM cisplatin, fixed, and stained for NRF2. Immunocytochemistry was performed using a fluorescent microscope. Random fields were imaged and the total number of cells / field was counted. The percentage of NRF2-positive staining cells relative to the total cells analyzed in each category was plotted on this graph. Error bars represent ± SEM, and * indicates a significant p-value less than 0.05 (Student's t-test) (A). Representative images of nuclear and cytoplasmic localization of NRF2 in wild-type A549 and NRF2 knockout A549 (2-11) (B). Scale bar represents 50 μm. [Figure 7B] This is a continuation of Figure 7A. [Figure 8] Clonal analysis using two CRISPR plasmid constructs to cleave 103 bases in exon 4 of NRF2. The upper panel shows the structural domains and target regions of gRNA1 and gRNA2, designed and used by Bialk et al., Mol. Ther. - Oncolytics 11, 75-89 (2018). The lower panel shows genetic analysis of various clones recovered by fluorescence-activated single-cell sorting (FACS). The green sequence indicates the wild-type sequence, and the bases highlighted in red indicate a frameshift resulting in a stop codon. [Figure 9]Figure 1 shows population sequencing analysis of CRISPR / Cas9-targeted cells. A549 cell line was transfected with an RNP complex targeting the Neh2 domain in exon 2 using gRNA 5' TGGATTTGATTGACATACTTTGG 3'. Cells were harvested 1, 4, 8, 12, 24, and 48 hours post-transfection. DNA was isolated, sequenced (across exon 2 of NRF2), and analyzed using Tracking of Indels by DEcomposition (TIDE). Indel efficiency (%) is shown in the figure. [Figure 10] Figure 1 shows population sequencing analysis of CRISPR / Cas12a-targeted cells. A549 cell line was transfected with an RNP complex targeting the Neh2 domain in exon 2 using gRNA 5' TTTGATTGACATACTTTGGAGGCAA 3'. Cells were harvested 1, 4, 8, 12, 24, and 48 hours post-transfection. DNA was isolated, sequenced (across exon 2 of NRF2), and analyzed using TIDE. Indel efficiency (%) is shown in the figure. [Figure 11] Genetic analysis of H1703 NRF2 KO clone-derived cell lines. Exon 2 gRNA3 and R34G ssDNA template were transfected into H1703 cell lines. Cells were grown and analyzed. Several NRF2 KO clones were selected for further characterization. DETAILED DESCRIPTION OF THE INVENTION

[0021] This disclosure is based, at least in part, on the discovery that successful knockout of the NRF2 gene using CRISPR / Cas9 in chemotherapy-resistant A549 lung cancer cells reduced cancer cell proliferation and increased the efficacy of the anticancer drugs cisplatin, carboplatin, and vinorelbine in both in vitro culture and xenograft mouse models. The overall strategy involved designing and utilizing CRISPR / Cas gene editing tools to disable the NRF2 gene in cancer cells, preventing them from producing functional protein. The CRISPR / Cas9 complex aligns with regions of homology to the target gene, enabling it to execute a double-stranded DNA break. Following this, the cell most often attempts to reseal the break through a process known as non-homologous end joining (NHEJ). Resealing is often incomplete and infidelity, as several nucleotides are lost during the process, resulting in a genetic frameshift and subsequent production of a nonfunctional transcript, resulting in gene knockout of NRF2.

[0022] The compositions described herein include a nucleic acid encoding a CRISPR-associated endonuclease (e.g., Cas9) and a guide RNA complementary to the NRF2 gene (e.g., exon 1, 2, 3, 4, or 5 of the NRF2 gene). Compositions including the guide RNA and the CRISPR-associated endonuclease are also described, as well as methods of administering the compositions to a subject for the treatment of cancer.

[0023] definition The applicant specifically incorporates the entire contents of all references cited in this disclosure. Furthermore, when an amount, concentration, or other value or parameter is described as either a range or a list of upper and lower limits, this shall be understood to specifically disclose all ranges formed from any pairing of any upper range limit or value with any lower range limit or value, regardless of whether the ranges are separately disclosed. When a range of numerical values ​​is recited herein, unless otherwise specified, the range is intended to include its endpoints, and all integers and fractions within the range. When defining a range, it is not intended that the scope of the present disclosure be limited to the specific values ​​recited.

[0024] The indefinite articles "a" and "an," as used herein, should be understood to mean "at least one," unless the specification and claims clearly indicate otherwise.

[0025] The phrase "and / or," as used herein in the specification and claims, should be understood to mean "either or both" of the elements connected by it, i.e., in some cases conjunctively, and in other cases disjunctively. Other elements, whether related or unrelated to those elements specifically associated, may optionally be present other than the elements specifically associated with the "and / or" clause, unless expressly indicated otherwise. Thus, as a non-limiting example, a reference to "A and / or B," when used with open-ended language such as "comprising," can refer to, in one embodiment, including A but not B (optionally including elements other than B); in another embodiment, including B but not A (optionally including elements other than A); in yet another embodiment, both A and B (optionally including other elements), etc.

[0026] As used herein, in the specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be construed as inclusive, i.e., including not only at least one of a number or list of elements, but more than one of them, and optionally additional unlisted items. Only terms clearly indicated otherwise, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," shall refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or," as used herein, shall be construed as indicating exclusive alternatives (i.e., "one or the other, but not both") only when followed by terms of exclusivity such as "any of," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0027] The term "about," as used herein, when referring to a measurable value, e.g., an amount, a time course, etc., encompasses variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, such variations being intended to be appropriate for practicing the disclosed methods.

[0028] A "clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease protein binding domain" or "Cas binding domain" refers to a nucleic acid element or domain within a nucleic acid sequence or polynucleotide sequence that binds to or has affinity for one or more CRISPR-associated endonucleases (or functional fragments thereof) in an effective amount. In some embodiments, in the presence of one or more proteins (or functional fragments thereof) and a target sequence, the one or more proteins and nucleic acid elements can form a biologically active CRISPR complex and / or be enzymatically active at the target sequence. In some embodiments, the CRISPR-associated endonuclease is a Class 1 or Class 2 CRISPR-associated endonuclease, and in some embodiments, is a Cas9 or Cas12a endonuclease. The Cas9 endonuclease may have a nucleotide sequence identical to that of wild-type Streptococcus pyogenes. In some embodiments, the CRISPR-associated endonuclease may be a sequence from another species, such as another Streptococcus species, such as Streptococcus thermophilus; Pseudomonas aeruginosa; Escherichia coli; or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. Such species include Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinobacillus species, Cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, and others.smithii, Bacillus thuringiensis, Bacteroides spp., Blastopirellula marina, Bradyrhizobium spp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheriae diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae kingae, Lactobacillus crispatus, Listeria ivanoviiivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis spp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria spp., Neisseria wadsworthii, Nitrosomonas spp., Parvibaculum lavamentivorans lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodoblum species, Simonsiella muelleri, Sphingomonas species, Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus species, Subdoligranulum species, Tistrella mobilis, Treponema species, and Verminephrobacter eisenii eiseniae) (or a functional fragment or variant of any of the foregoing sequences having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing Cas9 endonucleases). In some embodiments, the CRISPR-associated endonuclease may be a Cas12a nuclease. The Cas12a nuclease may have a nucleotide sequence identical to a wild-type Prevotella or Frankincella sequence (or a functional fragment or variant of any of the foregoing sequences having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing Cas12 endonucleases).

[0029] In some embodiments, the term "(CRISPR)-associated endonuclease protein binding domain" or "Cas binding domain" refers to a nucleic acid element or domain (e.g., and RNA element or domain) within a nucleic acid sequence that binds to or has affinity for one or more CRISPR-associated endonucleases (or a functional fragment or variant thereof that is at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to a CRISPR-associated endonuclease) in an effective amount. In some embodiments, the Cas binding domain comprises at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, The CRISPR-associated endonuclease comprises at least one sequence of 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides or less, which is capable of forming a hairpin or duplex that partially associates with or binds to a biologically active CRISPR-associated endonuclease at a concentration and in a microenvironment suitable for forming a CRISPR system.

[0030] A "clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system guide RNA" or "CRISPR-Cas system guide RNA" may contain a transcription terminator domain. The term "transcription terminator domain" refers to a nucleic acid element or domain within a nucleic acid sequence (or polynucleotide sequence) that, in effective amounts, prevents transcription in bacteria when a CRISPR complex is present in the bacterial species and / or creates a secondary structure that stabilizes the association of the nucleic acid sequence to one or more Cas proteins (or functional fragments thereof) such that, in the presence of one or more proteins (or functional fragments thereof), the one or more Cas proteins and nucleic acid element form a biologically active CRISPR complex and / or, in the presence of such target sequence and DNA-binding domain, can be enzymatically active at the target sequence. In some embodiments, the transcription terminator domain is at least about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, The nucleic acid sequence comprises 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides or less, and comprises at least one sequence capable of forming a hairpin or duplex that, in part, promotes association of a nucleic acid sequence (such as an sgRNA, crRNA with a tracrRNA, or other nucleic acid sequence) into a biologically active CRISPR complex at a concentration and microenvironment suitable for CRISPR complex formation.

[0031] The term "DNA-binding domain" refers to a nucleic acid element or domain within a nucleic acid sequence (e.g., a guide RNA) that is complementary to a target sequence (e.g., an NRF2 gene). In some embodiments, the DNA-binding domain binds to or has affinity for the NRF2 gene such that, in the presence of a biologically active CRISPR complex, one or more Cas proteins can be enzymatically active at the target sequence. In some embodiments, the DNA-binding domain comprises at least one sequence capable of Watson-Crick base pairing with the target sequence as part of a biologically active CRISPR system at a concentration and in a microenvironment suitable for CRISPR system formation.

[0032] "CRISPR system" collectively refers to transcripts or synthetically produced transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or an active partial tracrRNA), tracr-mate sequences (including "direct repeats" and, in the context of endogenous CRISPR systems, tracrRNA-processed partial direct repeats), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system are derived from a Type I, Type II, or Type III CRISPR system. In some embodiments, one or more elements of a CRISPR system are derived from a particular organism containing an endogenous CRISPR system, such as Streptococcus pyogenes. Generally, CRISPR systems feature elements (also referred to as protospacers in the context of endogenous CRISPR systems) that promote the formation of a CRISPR complex at the site of a target sequence. In the context of CRISPR complex formation, a "target sequence" refers to a nucleic acid sequence to which a guide sequence is designed to be complementary, where hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. Perfect complementarity is not necessary, as long as there is sufficient complementarity to allow hybridization to occur and promote the formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as a DNA or RNA polynucleotide. In some embodiments, the target sequence is a DNA polynucleotide and is referred to as a DNA target sequence. In some embodiments, the target sequence comprises at least three nucleic acid sequences that are recognized by a Cas protein when the Cas protein associates with a CRISPR complex, or a system comprising at least one sgRNA or one tracrRNA / crRNA duplex, at a concentration and in a microenvironment suitable for the association of such a system.In some embodiments, the target DNA comprises at least one or more protospacer adjacent motifs, the sequences of which are known in the art and depend on the Cas protein system used with the sgRNA or crRNA / tracrRNA employed in this study. In some embodiments, the target DNA comprises NNG, where G is guanine and N is any naturally occurring nucleic acid. In some embodiments, the target DNA comprises any one or combination of NNG, NNA, GAA, NNAGAAW, and NGGNG, where G is guanine, A is adenine, and N is any naturally occurring nucleic acid.

[0033] In some embodiments, the target sequence is located in the nucleus or cytoplasm of the cell.

[0034] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands at or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more base pairs from the target sequence). Without wishing to be bound by theory, the tracr sequence may comprise or consist of all or a portion of the wild-type tracr sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of the wild-type tracr sequence, or more), and may form part of a CRISPR complex, e.g., by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence operably linked to a guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to the tracr mate sequence to hybridize and participate in the formation of a CRISPR complex. Similarly, perfect complementarity is not believed to be necessary for the target sequence, as long as it is sufficient to be functional (e.g., to bind to a Cas protein or a functional fragment thereof). In some embodiments, the tracr sequence has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence complementarity along the length of the tracr mate sequence when optimally aligned.In some embodiments, one or more vectors promoting the expression of one or more elements of the CRISPR system are introduced into a host cell so that the presence and / or expression of the elements of the CRISPR system directs the formation of a CRISPR complex at one or more target sites. For example, the Cas enzyme, the guide sequence linked to the tracr-mate sequence, and the tracr sequence may each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined into a single vector, with one or more additional vectors providing any elements of the CRISPR system not included in the first vector. In some embodiments, with at least some of the modifications anticipated by this disclosure, the guide sequence or RNA or DNA sequence forming the CRISPR complex is at least partially synthetic. The CRISPR system elements combined into a single vector may be arranged in any suitable orientation, for example, one element may be positioned 5' to the second element ("upstream" of the second element) or 3' to the second element ("downstream" of the second element). In some embodiments, the present disclosure relates to a composition comprising a chemically synthesized guide sequence. In some embodiments, the chemically synthesized guide sequence is used with a vector comprising a coding sequence encoding a CRISPR enzyme, such as class 2 Cas9 or Cas12a protein. In some embodiments, the chemically synthesized guide sequence is used with one or more vectors, each vector comprising a coding sequence encoding a CRISPR enzyme, such as class 2 Cas9 or Cas12a protein. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of the second element, and may be oriented in the same or opposite direction.In some embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more additional (second, third, fourth, etc.) guide sequences, a tracr mate sequence (optionally operably linked to a guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, one or more additional guide sequences, the tracr mate sequence, and the tracr sequence are each elements of different nucleic acid sequences. For example, in the case of tracr and tracr mate sequences, in some embodiments, the present disclosure relates to compositions comprising at least a first and a second nucleic acid sequence, where the first nucleic acid sequence comprises a tracr sequence and the second nucleic acid sequence comprises a tracr mate sequence, and the first nucleic acid sequence is at least partially complementary to the second nucleic acid sequence, such that the first and second nucleic acids of the duplex further comprise, individually or collectively, a DNA targeting domain, a Cas protein binding domain, and a transcription terminator domain. In some embodiments, the CRISPR enzyme, one or more additional guide sequences, the tracr mate sequence, and the tracr sequence are operably linked to and expressed from the same promoter. In some embodiments, the present disclosure relates to compositions comprising any one or combination of the disclosed domains, with or without the disclosed modifications, on a single guide sequence or two separate tracrRNA / crRNA sequences. Any of the methods disclosed herein also relate to the use of tracrRNA / crRNA sequences, which are interchangeable with the use of guide sequences, such that a composition can include a single synthetic guide sequence and / or synthetic tracrRNA / crRNA with any one or combination of the modified domains disclosed herein.

[0035] In some embodiments, the guide RNA may be a short, synthetic, chimeric tracrRNA / crRNA ("single guide RNA" or "sgRNA"). The guide RNA may also comprise two short, synthetic tracrRNA / crRNAs ("dual guide RNA" or "dgRNA").

[0036] The terms "cancer" or "tumor" are well known in the art and refer to the presence, e.g., in a subject, of cells that have characteristics typical of carcinogenic cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, decreased cell death / apoptosis, and certain characteristic morphological features.

[0037] "Cancer," as used herein, refers to all types of cancers or neoplasms or malignant tumors found in humans, including, but not limited to, leukemia, lymphoma, melanoma, carcinoma, and sarcoma. The terms "cancer," "neoplasm," and "tumor," as used herein, are used interchangeably, and in either the singular or plural form, to refer to cells that have undergone malignant transformation that makes them pathological for the host organism. Primary cancer cells (i.e., cells obtained from near the site of malignant transformation) can be easily distinguished from non-cancerous cells by well-established techniques, particularly histological examination. The definition of cancer cells, as used herein, includes not only primary cancer cells but also cancer stem cells, as well as any cells derived from cancer progenitor cells or cancer cell ancestors. This includes metastasized cancer cells and in vitro cultures and cell lines derived from cancer cells. In certain embodiments, the cancer is a hematoma (i.e., a non-solid tumor). In some embodiments, the cancer is a lymphoid malignancy, such as diffuse large B-cell lymphoma, cholangiocarcinoma, uterine carcinosarcoma, chromophobe kidney chromophobe), uveal melanoma, mesothelioma, adrenocortical carcinoma, thymoma, acute myeloid leukemia, testicular germ cell tumor, rectal adenocarcinoma, pancreatic adenocarcinoma, phenochromocytoma and paraganglioma, esophageal carcinoma, sarcoma, papillary renal cell carcinoma of the kidney, squamous cell carcinoma and endocervical adenocarcinoma of the cervix, renal clear cell carcinoma of the kidney, hepatocellular carcinoma of the liver, glioblastoma multiforme, urothelial carcinoma of the bladder, colon adenocarcinoma, gastric adenocarcinoma, serous cystadenocarcinoma of the ovary, cutaneous melanoma of the skin, prostate adenocarcinoma, thyroid carcinoma, lung squamous cell carcinoma, head and neck squamous cell carcinoma, low-grade glioma of the brain, endometrial carcinoma of the uterine corpus, lung adenocarcinoma, or invasive breast cancer (see, e.g., Kerins et al., Sci. Rep. 8:12846 (2018)).

[0038] In certain embodiments, cancer is a solid tumor. A "solid tumor" is a tumor that can be detected based on tumor volume by procedures such as CAT scan, magnetic resonance imaging, X-ray, ultrasound or palpation; and / or can be detected due to the expression of one or more cancer-specific antigens in samples obtained from patients. A tumor does not necessarily have to have measurable dimensions.

[0039] The specific criteria for staging cancer depend on the specific cancer type, based on tumor size, histological characteristics, tumor markers, and other criteria known to those skilled in the art. Generally, cancer stages can be described as follows: Stage 0 - Carcinoma in situ. Stage I, Stage II, and Stage III - The higher the number, the greater the extent of the disease: indicating larger tumor size and / or the spread of cancer beyond the organs that develop to nearby lymph nodes and / or tissues or organs adjacent to the primary tumor location. Stage IV - Cancer has spread to distant tissues or organs.

[0040] The terms "treat," "treating," or "treatment," as used herein, refer to an action to obtain a beneficial or desired clinical result, such as, but not limited to, alleviation or alleviation of one or more signs or symptoms of a disease or condition (e.g., remission, partial remission, or complete remission), lessening the extent of the disease, stabilization of the disease state (i.e., not worsening, achieving stable disease), alleviation or palliation of the disease state, reduction in the rate or time to progression, and remission (whether partial or complete remission). "Treatment" of cancer can also mean prolonging survival compared to expected survival if no treatment is administered. Treatment may not necessarily be curative. In certain embodiments, treatment includes one or more of a decrease in pain or an increase in quality of life (QOL), as determined by a qualified individual, e.g., the treating physician, using, for example, accepted pain and QOL assessment tools. In certain embodiments, a decrease in pain or an increase in quality of life, as determined by a qualified individual, e.g., a treating physician, using, e.g., accepted pain and quality of life assessment tools, is not considered to be a "treatment" of cancer.

[0041] "Chemotherapeutic agent" refers to a drug used to treat cancer. Chemotherapeutic agents include, but are not limited to, small molecules, hormones and hormone analogs, and biologics (e.g., antibodies, peptide drugs, nucleic acid drugs). In certain embodiments, chemotherapy does not include hormones and hormone analogs.

[0042] A "cancer resistant to one or more chemotherapeutic agents" is a cancer that does not respond or has become unresponsive to treatment with a chemotherapy regimen, i.e., does not achieve at least stable disease (i.e., stable disease, partial response, or complete response) in target lesions either during or after the chemotherapy regimen. Resistance to one or more chemotherapeutic agents can result in, for example, tumor growth, increased tumor burden, and / or tumor metastasis.

[0043] A "therapeutically effective amount" is an amount sufficient, at the dosage and for the period of time necessary, to achieve a desired therapeutic outcome, e.g., for treating a disease (e.g., cancer), condition, or disorder, and / or the pharmacokinetic or pharmacodynamic effects of treatment in a subject. A therapeutically effective amount can be administered in one or more administrations. A therapeutically effective amount can vary according to factors such as the condition, age, sex, and weight of the subject.

[0044] NRF2 Nuclear factor erythroid 2-related factor (NRF2) is considered a master regulator of 100–200 target genes involved in the cellular response to oxidative / electrophilic stress. Targets include genes controlling glutathione (GSH) mediators, antioxidants, and efflux pumps. Hayden et al., Urol. Oncol. Semin. Orig. Investig. 32, 806–814 (2014). NRF2 is also known to regulate the expression of genes involved in protein degradation and detoxification and is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1), a substrate adaptor for the Cul3-dependent E3 ubiquitin ligase complex. Under normal conditions, Keap1 constantly targets NRF2 for ubiquitin-dependent degradation, maintaining low expression of NRF2 at downstream target genes. However, chemotherapy has been shown to activate the transcriptional activity of NRF2 target genes, often promoting cytoprotective responses, and enhanced NRF2 expression occurs in response to environmental stress or adverse growth conditions. Other mechanisms leading to NRF2 upregulation include mutations in KEAP1 or epigenetic changes in the promoter region. Upregulation of NRF2 expression leads to enhanced resistance of cancer cells to chemotherapy drugs, which in turn induces an unfavorable environment for cell growth. Indeed, Hayden et al. (ibid.) clearly demonstrated that increased NRF2 expression confers resistance to chemotherapy drugs such as cisplatin in cancer cells. Singh et al. (2010, Antioxidants & Redox Signaling 13) also demonstrated that constitutive expression of NRF2 leads to radioresistance, and that inhibition of NRF2 leads to decreased survival in addition to increased levels of endogenous reactive oxygen species (ROS). Recently, Torrente et al. (Oncogene (2017). doi:10.1038 / onc.2017.221) identified crosstalk between NRF2 and two HIPK2 homeodomain-interacting protein kinases and demonstrated that HIPK2 exerts cytoprotective effects via NRF2.

[0045] CRISPR / endonuclease CRISPR / endonuclease (e.g., CRISPR / Cas9) systems are known in the art and are described, for example, in U.S. Patent No. 9,925,248, the entirety of which is incorporated herein by reference. CRISPR-directed gene editing can identify and perform DNA cleavage at specific sites within chromosomes with surprisingly high efficiency and precision. The natural activity of CRISPR / Cas9 is to disable the viral genome that infects bacterial cells. Subsequent genetic reconstitution of CRISPR / Cas function in human cells offers the possibility of disabling human genes with remarkable frequency.

[0046] In bacteria, CRISPR / Cas loci encode an RNA-guided adaptive immune system against mobile genetic elements (viruses, transposable elements, and conjugative plasmids). Three types of CRISPR systems (I-III) have been identified. CRISPR clusters contain a spacer, a sequence complementary to the preceding mobile element. CRISPR clusters are transcribed and processed into mature CRISPR (clustered regularly interspaced short palindromic repeats) RNA (crRNA), which contains a DNA-binding region (spacer) complementary to the target gene. The CRISPR-associated endonuclease, Cas9, belongs to the type II CRISPR / Cas system and has strong endonuclease activity for cleaving target DNA. Cas9 is guided by the mature crRNA, which contains a unique target sequence of approximately 20 base pairs (bp) (called the spacer) and a trans-activating small RNA (tracrRNA), which serves as a guide for processing of the pre-crRNA, assisted by RNase III. The crRNA:tracrRNA duplex directs Cas9 to the target DNA through complementary base pairing between the spacer on the crRNA and a complementary sequence on the target DNA (called the protospacer). Cas9 recognizes a trinucleotide (NGG) protospacer-adjacent motif (PAM) to identify the cleavage site (the third nucleotide from the PAM).

[0047] The composition described herein can comprise the nucleic acid encoding CRISPR-associated endonuclease.CRISPR-associated endonuclease can be, for example, class 1 CRISPR-associated endonuclease or class 2 CRISPR-associated endonuclease.Class 1 CRISPR-associated endonuclease includes type I, type III and type IV CRISPR-Cas system, which have effector molecules that comprise multiple subunits. For Class 1 CRISPR-associated endonucleases, the effector molecule may, in some embodiments, include Cas7 and Cas5, as well as, in some embodiments, SS(Cas11) and Cas8a1; Cas8b1; Cas8c; Cas8u2 and Cas6; Cas3" and Cas10d; CasSS(Cas11), Cas8e, and Cas6; Cas8f and Cas6f; Cas6f; Cas8-like (Csf1); SS(Cas11) and Cas8-like (Csf1); or SS(Cas11) and Cas10. Class 1 In some embodiments, the CRISPR-associated endonuclease may also be associated with a target cleavage molecule, which may be Cas3 (Type I) or Cas10 (Type III), and may also be associated with a spacer acquisition molecule, such as Cas1, Cas2, and / or Cas4. See, e.g., Koonin et al., Curr. Opin. Microbiol. 37:67-78 (2017); Strich and Chertow, J. Clin. Microbiol. 57:1307-18 (2019).

[0048] Class 2 CRISPR-associated endonucleases include Type I, Type V, and Type VI CRISPR-Cas systems, which have a single effector molecule. In the case of Class 2 CRISPR-associated endonucleases, the effector molecule may, in some embodiments, comprise Cas9, Cas12a(cpf1), Cas12b1(c2c1), Cas12b2, Cas12c(c2c3), Cas12d(CasY), Cas12e(CasX), Cas12f1(Cas14a), Cas12f2(Cas14b), Cas12f3(Cas14c), Cas12g, Cas12h, Cas12i, Cas12k(c2c5), Cas13a(c2c2), Cas13b1(c2c6), Cas13b2(c2c6), Cas13c(c2c7), Cas13d, c2c4, c2c8, c2c9, and / or c2c10. See, e.g., Koonin et al., Curr. Opin. Microbiol. 37:67-78 (2017); Strich and Chertow, J. Clin. Microbiol. 57:1307-18 (2019); Makarova et al., Nat. Rev. Microbiol. 18:67-83 (2020).

[0049] In some embodiments, the CRISPR-associated endonuclease may be a Cas9 nuclease. The Cas9 nuclease may have a nucleotide sequence identical to a wild-type Streptococcus pyogenes sequence. In some embodiments, the CRISPR-associated endonuclease may be a sequence from other Streptococcus species, such as Streptococcus thermophilus; Pseudomonas aeruginosa; Escherichia coli; or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms.Such species include Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces spp., Cyclophilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides spp., Blastopyrella marina, Bradyrhizobium spp., Brevibacillus laterosporus, Campylobacter coli, and Campylobacter germplasm. Juni, Campylobacter lari, Candidatus puniseispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accholens, Corynebacterium diphtheriae, Corynebacterium maturschotti, Dinortheobacter shibae, Eubacterium doricum, Gammaproteobacteria, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputum, Helicobacter canadensis, Helicobacter cinerea, Helicobacter Insecticides include: Iliobacter mustelae, Iriobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae, Methylocystis species, Methylocysinus trichosporium, Mobiluncus murielis, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria species, Neisseria wadsworthyi, Nitrosomonas species, Parvibacrum lavamentivorans, Pasteurella multocida, Phascolactomabacterium succinateutens, Ralstonia szygii, Rhodopseudomonas palustris, Rhodoburum species, Simonsiella muerelli, Sphingomonas species, Sporolactobacillus vinea, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus species, Subdoligranulum species, Chistrella mobilis, Treponema species, and Verminephrobacter eiseniae.

[0050] Alternatively, the wild-type Streptococcus pyogenes Cas9 sequence may be modified. The nucleic acid sequence may be codon-optimized for efficient expression in mammalian cells, such as human cells. The Cas9 nuclease sequence codon-optimized for expression in human cells may be, for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed under GenBank accession numbers KM099231.1GI:669193757; KM099232.1GI:669193761; or KM099233.1GI:669193765. Alternatively, the Cas9 nuclease sequence may be, for example, a sequence contained within a commercially available vector, such as pX458, pX330, or pX260 from Addgene (Cambridge, Mass.). In some embodiments, the Cas9 endonuclease may have an amino acid sequence that is a variant or fragment of any of the Cas9 endonuclease sequences of Genbank Accession Nos. KM099231.1GI:669193757; KM099232.1GI:669193761; or KM099233.1GI:669193765, or the Cas9 amino acid sequence of pX458, pX330, or pX260 (Addgene, Cambridge, Mass.). Cas9 nucleotide sequences may be modified to encode biologically active variants of Cas9, which may have, or may comprise, an amino acid sequence that differs from wild-type Cas9 by containing one or more mutations (e.g., addition, deletion, or substitution mutations, or a combination of such mutations). One or more of the substitution mutations may be substitutions (e.g., conservative amino acid substitutions).For example, a biologically active variant of a Cas9 polypeptide may have at least or about 50% sequence identity (e.g., at least or about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68% or more) with a wild-type Cas9 polypeptide. , 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0051] In some embodiments, the CRISPR-associated endonuclease may be a Cas12a nuclease. The Cas12a nuclease may have a nucleotide sequence identical to that of a wild-type Prevotella or Francisella sequence. Alternatively, the wild-type Prevotella or Francisella Cas12a sequence may be modified. The nucleic acid sequence may be codon-optimized for efficient expression in mammalian cells, such as human cells. The Cas12a nuclease sequence codon-optimized for expression in human cells may be, for example, a Cas9 nuclease sequence encoded by any of the expression vectors listed under GenBank accession numbers MF193599.1GI:1214941796, KY985374.1GI:1242863785, KY985375.1GI:1242863787, or KY985376.1GI:1242863789. Alternatively, the Cas12a nuclease sequence may be, for example, a sequence contained within a commercially available vector, such as pAs-Cpf1 or pLb-Cpf1 from Addgene (Cambridge, Mass.). In some embodiments, the Cas12a endonuclease may have an amino acid sequence that is a variant or fragment of any of the Cas12a endonuclease sequences in Genbank Accession Nos. MF193599.1GI:1214941796, KY985374.1GI:1242863785, KY985375.1GI:1242863787, or KY985376.1GI:1242863789, or the Cas12a amino acid sequence of pAs-Cpf1 or pLb-Cpf1 (Addgene, Cambridge, Mass.). Cas12a nucleotide sequences may be modified to encode biologically active variants of Cas12a, which may have or, for example, comprise an amino acid sequence that differs from wild-type Cas12a by containing one or more mutations (e.g., addition, deletion, or substitution mutations, or a combination of such mutations). One or more of the substitution mutations may be substitutions (e.g., conservative amino acid substitutions).For example, a biologically active variant of a Cas12a polypeptide may have at least or about 50% sequence identity (e.g., at least or about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 10 8%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0052] The compositions described herein may also include a guide RNA (gRNA) containing a DNA-binding domain complementary to a target domain from the NRF2 gene (e.g., a target domain from exon 1, 2, 3, 4, or 5 of the NRF2 gene) and a sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease protein-binding domain. The guide RNA sequence may be a sense or antisense sequence. The guide RNA sequence may also contain a protospacer adjacent motif (PAM). The sequence of the PAM may vary depending on the specificity requirements of the CRISPR endonuclease used. In the S. pyogenes-derived CRISPR-Cas system, the target DNA is typically immediately preceded by a 5'-NGG protospacer adjacent motif (PAM). Therefore, in the case of S. pyogenes Cas9, the PAM sequence can be AGG, TGG, CGG, or GGG. Other Cas9 orthologs may have different PAM specificities. The specific sequence of the guide RNA may vary, but regardless of the sequence, a useful guide RNA sequence is one that achieves high efficiency while minimizing off-target effects. In some embodiments, the guide RNA sequence achieves complete ablation of the NRF2 gene.

[0053] In some embodiments, the DNA binding domain varies in length from about 20 to about 55 nucleotides, e.g., about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, or about 55 nucleotides in length. In some embodiments, the Cas protein binding domain varies in length from about 30 to about 55 nucleotides, for example, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, or about 55 nucleotides in length.

[0054] In some embodiments, the composition comprises one or more nucleic acid (i.e., DNA) sequences encoding a guide RNA and a CRISPR endonuclease. When the composition is administered as a nucleic acid or contained in an expression vector, the CRISPR endonuclease may be encoded by the same nucleic acid or vector as the guide RNA sequence. In some embodiments, the CRISPR endonuclease may be encoded in a nucleic acid or vector that is physically separate from the guide RNA sequence. The nucleic acid sequence encoding the guide RNA may include a DNA binding domain, a Cas protein binding domain, and a transcription terminator domain.

[0055] The nucleic acid encoding the guide RNA and / or CRISPR endonuclease may be an isolated nucleic acid. An "isolated" nucleic acid may be, for example, a naturally occurring DNA molecule or a fragment thereof, provided that at least one of the nucleic acid sequences that normally flank the DNA molecule in the naturally occurring genome is removed or absent. Isolated nucleic acid molecules can be produced by standard techniques. For example, polymerase chain reaction (PCR) technology can be used to obtain isolated nucleic acids containing the nucleotide sequences described herein, such as the nucleotide sequences encoding the polypeptides described herein. PCR can be used to amplify specific sequences from DNA as well as RNA, for example, from sequences from total genomic DNA or total cellular RNA. Various PCR methods are described, for example, in PCR Primer: A Laboratory Manual, edited by Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the ends or beyond of the region of interest is used to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. A variety of PCR strategies are also available that allow site-specific nucleotide sequence modifications to be introduced into a template nucleic acid.

[0056] Isolated nucleic acids can also be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3' to 5' direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g., >50-100 nucleotides) containing the desired sequence can be synthesized, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex forms when the oligonucleotide pair anneals. DNA polymerase is used to extend the oligonucleotides, resulting in single-stranded, double-stranded nucleic acid molecules for each oligonucleotide pair, which can then be ligated into a vector. Isolated nucleic acids can also be obtained, for example, by mutagenesis of a naturally occurring portion of DNA encoding Cas9 (e.g., according to the formula above).

[0057] Also provided herein are recombinant constructs that can be used to transform cells to express a CRISPR endonuclease and / or a guide RNA complementary to the NRF2 gene. The recombinant nucleic acid construct may include a nucleic acid encoding a CRISPR endonuclease and / or a guide RNA complementary to the NRF2 gene operably linked to a promoter suitable for expressing the CRISPR endonuclease and / or the guide RNA complementary to the NRF2 gene in the cell. In some embodiments, the nucleic acid encoding the CRISPR endonuclease is operably linked to the same promoter as the nucleic acid encoding the guide RNA. In other embodiments, the nucleic acid encoding the CRISPR endonuclease and the nucleic acid encoding the guide RNA are operably linked to different promoters. In some embodiments, the nucleic acid encoding the CRISPR endonuclease and / or the nucleic acid encoding the guide RNA is operably linked to a lung-specific promoter. Suitable lung-specific promoters include, but are not limited to, promoters encoding Clara cell 10 kDa protein (CC ). 10) (commonly known as Scgb1a1) promoter (Stripp et al., J. Biol. Chem. 267:14703-12 (1992)), SFTPC promoter (Wert et al., Dev. Biol. 156:426-43 (1993)), FOXJ1 promoter (Ostrowski et al., Mol. Ther. 8:637-45 (2003)), aquaporin (Aqp5) promoter (Funaki et al., Am. J. Physiol. 275:C1151-57 (1998)), keratin 5 (Krt5) promoter (Rock et al., Dis. Model Mech. 3:545-56 (2010)), keratin 14 (Krt14) promoter (Rock et al., Dis. Model Mech. 3:545-56 (2010)), (2010)), cytokeratin 18 (K18) promoter (Chow et al., Proc. Natl. Acad. Sci. USA 94:14695-14700 (1997)), surfactant protein B (SP-B) promoter (Strayer et al., Am. J. Physiol. Lung Cell Mol. Physiol. 282:L394-404 (2002)), TTF1 gene under the control of the human telomerase reverse transcriptase promoter and the human surfactant protein A1 promoter (Fukazawa et al., Cancer Res. 64:363-69 (2004)), surfactant protein C (SP-C) promoter (Zhuo et al., Transgenic Res. 15:543-55 (2006)), insulinoma-associated antigen-1 (INSM1) promoter (Li et al., Biochem. Biophys. Res. Commun. 236:776-81 (1997)), and the surfactant protein A (SP-A) promoter (Bruno et al., J. Biol. Chem. 270:6531-36 (1995)).

[0058] In some embodiments, one or more CRISPR endonucleases and one or more guide RNAs may be combined and provided in the form of a ribonucleoprotein particle (RNP). The RNP complex can be introduced into a subject, for example, by injection, electroporation, nanoparticles, vesicles, and / or with the aid of cell-penetrating peptides.

[0059] DNA vectors containing nucleic acids, such as those described herein, are also provided. A "DNA vector" is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to allow replication of the inserted segment. Generally, DNA vectors are capable of replication when associated with appropriate control elements. Suitable vector backbones include those commonly used in the art, such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs. The term "DNA vector" includes cloning and expression vectors, as well as viral vectors and integrating vectors. An "expression vector" is a vector containing a regulatory region. Various host / expression vector combinations can be used to express the nucleic acid sequences described herein. Suitable expression vectors include, but are not limited to, plasmids and viral vectors derived from bacteriophages, baculoviruses, and retroviruses. Many vectors and expression systems are commercially available from companies such as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif.), Stratagene (La Jolla, Calif.), and Invitrogen / Life Technologies (Carlsbad, Calif.).

[0060] The DNA vectors provided herein may also contain, for example, an origin of replication, a scaffold attachment region (SAR), and / or a marker. A marker gene can confer a selectable phenotype to a host cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin, or hygromycin). As described above, expression vectors may contain a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or Flag™ tag (Kodak, New Haven, Conn.), are typically expressed as a fusion with the encoded polypeptide. Such tags may be inserted anywhere within the polypeptide, for example, at either the carboxyl or amino terminus.

[0061] The DNA vector may contain a regulatory region. The term "regulatory region" refers to a nucleotide sequence that influences the initiation and rate of transcription or translation, as well as the stability and / or mobility of the transcription or translation product. Regulatory regions include, but are not limited to, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5' and 3' untranslated regions (UTRs), transcription initiation sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.

[0062] The term "operably linked," as used herein, refers to a regulatory region (e.g., a promoter) and a sequence to be transcribed in a nucleic acid positioned so as to affect the transcription or translation of such sequence. For example, by placing a coding sequence under the control of a promoter, the translation start site of the translation reading frame of a polypeptide is typically positioned 1 to about 50 nucleotides downstream from the promoter. However, the promoter may be positioned as much as about 5,000 nucleotides upstream from the translation start site or as much as 2,000 nucleotides upstream from the transcription start site. A promoter typically includes at least a core (basal) promoter. A promoter may also include at least one control element, such as an enhancer sequence, upstream element, or upstream activation region (UAR). The choice of promoter to include depends on several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell- or tissue-preferential expression. It is routine for those skilled in the art to appropriately select promoters and other regulatory regions and position them relative to the coding sequence to modulate the expression of a coding sequence.

[0063] Vectors include, for example, viral vectors (e.g., adenovirus ("Ad"), adeno-associated virus (AAV), and vesicular stomatitis virus (VSV) and retroviruses), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating the delivery of polynucleotides to host cells. Direct injection of adenoviral vectors into lung tumors remains a routine procedure in clinical trials evaluating gene therapy for lung cancer. Dong et al., J. Int. Med. Res. 36, 1273-1287 (2008); Li et al., Cancer Gene Ther. 20, 251-259 (2013); Zhou et al., Cancer Gene Ther. 23, 1-6 (2016). Vectors may also contain other elements or functionalities that further modulate gene delivery and / or gene expression or otherwise provide beneficial properties to targeted cells. As described and exemplified in more detail below, such other elements include, for example, elements that affect cell binding or targeting (such as elements that mediate cell-type or tissue-specific binding); elements that affect cellular uptake of the vector nucleic acid; elements that affect localization of the polynucleotide within the cell after uptake (e.g., agents that mediate nuclear localization); and elements that affect expression of the polynucleotide. Such elements can also include markers, such as detectable and / or selectable markers that can be used to detect or select cells that have taken up and are expressing the nucleic acid delivered by the vector. Such elements can be provided as natural mechanisms of the vector (e.g., the use of certain viral vectors that have elements or functionality that mediate binding or uptake), or the vector can be modified to provide such functionality. Other vectors include those described by Chen et al., BioTechniques, 34: 167-171 (2003). A wide variety of such vectors are known in the art and are generally available.

[0064] Suitable nucleic acid delivery systems include recombinant viral vectors, typically sequences from at least one of adenovirus, adeno-associated virus (AAV), helper-dependent adenovirus, retrovirus, or Sendai virus (hemagglutinating virus of Japan)-liposome (HVJ) complexes. In such cases, the viral vector contains a strong eukaryotic promoter, such as a cytomegalovirus (CMV) promoter, operably linked to the polynucleotide. The recombinant viral vector may contain one or more polynucleotides therein, and in some embodiments, may contain about one polynucleotide. In embodiments in which the polynucleotide is administered with a non-viral vector, use of about 0.1 nanograms to about 4000 micrograms is often useful, e.g., about 0.1 ng to about 3900 μg, about 0.1 ng to about 3800 μg, about 0.1 ng to about 3700 μg, about 0.1 ng to about 3600 μg, about 0.1 ng to about 3500 μg, about 0.1 ng to about 3400 μg, about 0 .1ng to about 3300μg, about 0.1ng to about 3200μg, about 0.1ng to about 3100μg, about 0.1ng to about 3000μg, about 0.1ng to about 2900μg, about 0.1ng to about 2800 μg, about 0.1ng to about 2700μg, about 0.1ng to about 2600μg, about 0.1ng to about 2500μg, about 0.1ng to about 2400μg, about 0.1ng to about 2300μg, about 0.1ng to about Approximately 2200μg, approximately 0.1ng to approximately 2100μg, approximately 0.1ng to approximately 2000μg, approximately 0.1ng to approximately 1900μg, approximately 0.1ng to approximately 1800μg, approximately 0.1ng to approximately 1700μg, approximately 0 .1ng to about 1600μg, about 0.1ng to about 1500μg, about 0.1ng to about 1400μg, about 0.1ng to about 1300μg, about 0.1ng to about 1200μg, about 0.1ng to about 1100 μg, approximately 0.1ng to approximately 1000μg, approximately 0.1ng to approximately 900μg, approximately 0.1ng to approximately 800μg, approximately 0.1ng to approximately 700μg, approximately 0.1ng to approximately 600μg, approximately 0.1ng to approximately 500 μg, about 0.1ng to about 400μg, about 0.1ng to about 300μg, about 0.1ng to about 200μg, about 0.1ng to about 100μg, about 0.1ng to about 90μg, about 0.1ng to about 80μg,about 0.1 ng to about 70 μg, about 0.1 ng to about 60 μg, about 0.1 ng to about 50 μg, about 0.1 ng to about 40 μg, about 0.1 ng to about 30 μg, about 0.1 ng to about 20 μg, about 0.1 ng to about 10 μg, about 0.1 ng to about 1 μg, about 0.1 ng to about 900 ng, about 0.1 ng to about 800 ng, about 0.1 ng to about 700 ng, about 0.1 ng to about 600 ng, about 0.1 ng to about 500 ng, about 0.1 ng to about 400 ng, about 0.1 ng to about 300 ng, about 0.1 ng to about 200 ng, about 0.1 ng to about 100 ng, about 0.1 ng to about 90 ng, about 0.1 n g to about 80 ng, about 0.1 ng to about 70 ng, about 0.1 ng to about 60 ng, about 0.1 ng to about 50 ng, about 0.1 ng to about 40 ng, about 0.1 ng to about 30 ng, about 0.1 ng to about 20 ng, about 0.1 ng to about 10 ng, about 0.1 ng to about 1 ng, about 1 ng to about 4000 μg, about 1 ng to about 3900 μg, about 1 ng to about 3800 μg, about 1 ng to about 3700 μg, about 1 ng to about 3600 μg, about 1 ng to about 3500 μg, about 1 ng to about 3400 μg, about 1 ng to about 3300 μg, about 1 ng to about 3200 μg, about 1 ng to about 3100 μg, about 1 ng to about 3 1 ng to about 1900 μg, about 1 ng to about 1800 μg, about 1 ng to about 1700 μg, about 1 ng to about 1600 μg, about 1 ng to about 1500 μg, about 1 ng to about 1400 μg, about 1 ng to about 1300 μg, about 1 ng to about 1200 μg, about 1 ng to about 1 100 μg, about 1 ng to about 1000 μg, about 1 ng to about 900 μg, about 1 ng to about 800 μg, about 1 ng to about 700 μg, about 1 ng to about 600 μg, about 1 ng to about 500 μg, about 1 ng to about 400 μg, about 1 ng to about 300 μg, about 1 ng to about 200 μg, about 1 ng to about 100 μg, about 1 ng to about 90 μg, about 1 ng to about 80 μg, about 1 ng to about 70 μg, about 1 ng to about 60 μg, about 1 ng to about 50 μg, about 1 ng to about 40 μg, about 1 ng to about 30 μg, about 1 ng to about 20 μg, about 1 ng to about 10 μg, about 1 ng to about 1 μg, about 1 ng to about 900 ng,about 1 ng to about 800 ng, about 1 ng to about 700 ng, about 1 ng to about 600 ng, about 1 ng to about 500 ng, about 1 ng to about 400 ng, about 1 ng to about 300 ng, about 1 ng to about 200 ng, about 1 ng to about 100 ng, about 1 ng to about 90 ng, about 1 ng to about 80 ng, about 1 ng to about 70 ng, about 1 ng to about 60 ng, about 1 ng to about 50 ng, about 1 ng to about 40 ng, about 1 ng to about 30ng, about 1ng to about 20ng, about 1ng to about 10ng, about 10ng to about 4000μg, about 20ng to about 4000μg, about 30ng to about 4000μg, about 40ng to about 4000μg, about 50ng to about 4000μg, about 60ng to about 4000μg, about 70ng to about 4000μg, about 80ng to about 4000μg, about 90ng to about 4000μg, about 100ng to about about 4000 μg, about 200 ng to about 4000 μg, about 300 ng to about 4000 μg, about 400 ng to about 4000 μg, about 500 ng to about 4000 μg, about 600 ng to about 4000 μg, about 700 ng to about 4000 μg, about 800 ng to about 4000 μg, about 900 ng to about 4000 μg, about 1 μg to about 4000 μg, 10 μg to about 4000 μg, 20 μg to about 4000 μg, 30 μg to about 4000 μg, 40 μg to about 4000 μg, 50 μg to about 4000 μg, 60 μg to about 4000 μg, 70 μg to about 4000 μg, 80 μg to about 4000 μg, 90 μg to about 4000 μg, 100 μg to about 4000 μg, 200 μg to about 4000 μg, 300 μg to about 4000 μg, 400 μg to about 4000 μg, 500 μg to about 4000 μg, 600μg~about 4000μg, 700μg~about 4000μg, 800μg~about 4000μg, 900μg~about 4000μg, 1000μg~about 4000μg, 1100μg~about 4000μg, 1200μg~about 4000μg, 1300μg~about 4000μg, 1400μg~about 4000 μg, 1500 μg ~ approx. 4000 μg, 1600 μg ~ approx. 4000 μg, 1700 μg ~ approx. 4000 μg, 1800 μg ~ approx. 4000 μg, 1 900μg~about 4000μg, 2000μg~about 4000μg, 2100μg~about 4000μg, 2200μg~about 4000μg, 2300μg ~4000μg, 2400μg~4000μg, 2500μg~4000μg, 2600μg~4000μg, 2700μg~40 00μg, 2800μg~about 4000μg, 2900μg~about 4000μg, 3000μg~about 4000μg, 3100μg~about 4000μg, Doses of 3200 μg to about 4000 μg, 3300 μg to about 4000 μg, 3400 μg to about 4000 μg, 3500 μg to about 4000 μg, 3600 μg to about 4000 μg, 3700 μg to about 4000 μg, 3800 μg to about 4000 μg, or 3900 μg to about 4000 μg are useful.

[0065] Additional vectors include viral vectors, fusion proteins, and chemical conjugates. Retroviral vectors include Moloney murine leukemia virus and HIV-based viruses. An HIV-based viral vector contains at least two vectors, the gag and pol genes of the HIV genome, and the env gene of another virus. DNA viral vectors include pox vectors, such as orthopox or avipox vectors, herpes viral vectors, such as herpes simplex virus (HSV) vectors [Geller, AI et al., J. Neurochem, 64: 487 (1995); Lim, F. et al., DNA Cloning: Mammalian Systems, edited by D. Glover (Oxford Univ. Press, Oxford England) (1995); Geller, AI et al., Proc Natl. Acad. Sci.: USA: 90 7603 (1993); Geller, AI et al., Proc Natl. Acad. Sci. USA: 87: 1149 (1990)], adenoviral vectors [LeGal LaSalle et al., Science, 259: 988 (1993); Davidson et al., Nat. Genet. 3: 219 (1993)], and the like. (1993); Yang et al., J. Virol. 69: 2004 (1995)] and adeno-associated virus vectors [Kaplitt, MG et al., Nat. Genet. 8:148 (1994)].

[0066] If necessary, the polynucleotides described herein can also be used with microdelivery vehicles, such as cationic liposomes, adenovirus vectors, and exosomes.For a general discussion of liposome preparation, targeting, and content delivery procedures, see Mannino and Gould-Fogerite, BioTechniques, 6:682 (1988).See also Feigner and Holm, Bethesda Res. Lab. Focus, 11(2):21 (1989) and Maurer, RA, Bethesda Res. Lab. Focus, 11(2):25 (1989).In some embodiments, exosomes can be used to deliver nucleic acids encoding CRISPR endonucleases and / or guide RNAs to target cells, such as cancer cells.Exosomes are nano-sized vesicles secreted by various cells and are composed of cell membranes. Exosomes can attach to target cells via various surface adhesion proteins and vector ligands (tetraspanins, integrins, CD11b, and CD18 receptors) and deliver their payloads to target cells. Numerous studies have shown that exosomes have specific cellular affinities according to their characteristics and origin and can be used to target them to diseased tissues and / or organs. See Batrakova et al., 2015, J Control Release 219: 396-405. For example, cancer-derived exosomes function as natural carriers that can efficiently deliver CRISPR / Cas9 plasmids to cancer cells. See Kim et al., 2017, J Control Release 266: 8-16.

[0067] Replication-defective recombinant adenovirus vectors can be produced according to known techniques (see Quantin et al., Proc. Natl. Acad. Sci. USA, 89:2581-2584 (1992); Stratford-Perricadet et al., J. Clin. Invest., 90:626-630 (1992); and Rosenfeld et al., Cell, 68:143-155 (1992)).

[0068] Another delivery method is to use a single-stranded DNA production vector that can produce an expressed product intracellularly. See, e.g., Chen et al., BioTechniques, 34: 167-171 (2003), which is incorporated herein by reference in its entirety.

[0069] Pharmaceutical Composition Any of the pharmaceutical compositions disclosed herein can be formulated for use in pharmaceutical preparations, and particular uses are indicated in the context of the following treatments, for example, the treatment of subjects with cancer. When employed as a pharmaceutical, any of the nucleic acids and vectors can be administered in the form of a pharmaceutical composition. Administration can be pulmonary (e.g., by inhalation or insufflation of powders or aerosols, e.g., by nebulizer; intratracheal, nasal, epidermal, transdermal, etc.), topical (e.g., to the eyes and mucous membranes, e.g., intranasal, vaginal, and rectal delivery), ocular, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular administration. Parenteral administration can be in the form of a single bolus dose or can be, for example, administered by a continuous perfusion pump. Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, powders, etc. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.

[0070] In some embodiments, pharmaceutical compositions may contain the nucleic acids and vectors described herein as active ingredients in combination with one or more pharmaceutically acceptable carriers. The term "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans as needed. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, and the like that can be used as a vehicle for a pharmaceutically acceptable substance. In preparing the pharmaceutical compositions disclosed herein, the active ingredient is typically mixed with an excipient, diluted by the excipient, or enclosed within such a carrier, for example, in the form of a capsule, tablet, pod, paper, or other container. When the excipient serves as a diluent, it can be a solid, semi-solid, or liquid material (e.g., saline) that acts as a vehicle, carrier, or medium for the active ingredient. Thus, the compositions may be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as solids or in liquid media), lotions, creams, ointments, gels, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders. As is known in the art, the type of diluent may vary depending on the intended route of administration. The resulting composition may also contain additional agents, such as preservatives. In some embodiments, the carrier may be or include a lipid- or polymer-based colloid. In some embodiments, the carrier material may be a colloid formulated as a liposome, hydrogel, microparticle, nanoparticle, or block copolymer micelle. As mentioned, the carrier material may form a capsule, which may be a polymer-based colloid.

[0071] The nucleic acid sequences disclosed herein can be delivered to appropriate cells of a subject, such as cancer cells. This can be achieved, for example, by using biodegradable polymeric microparticles or microcapsule delivery vehicles sized to optimize phagocytosis by phagocytes such as macrophages. Another means for achieving in vivo expression is the delivery of "naked DNA" (i.e., without a delivery vehicle) to intramuscular, intradermal, or subcutaneous sites. In the relevant polynucleotide (e.g., expression vector), the nucleic acid sequence encoding the isolated nucleic acid sequence comprising the sequence encoding the CRISPR-associated endonuclease and guide RNA can be operably linked to a promoter or enhancer-promoter combination. Promoters and enhancers are described above.

[0072] In some embodiments, the pharmaceutical composition can be formulated as nanoparticles, e.g., nanoparticles composed of a core of high molecular weight linear polyethyleneimine (LPEI) complexed with DNA, surrounded by a shell of low molecular weight LPEI that has been modified with polyethylene glycol (PEGylated).

[0073] The nucleic acids and vectors may also be applied to the surface of a device (e.g., a catheter) or contained within a pump, patch, or other drug delivery device. The nucleic acids and vectors disclosed herein can be administered alone or in admixture in the presence of a pharmaceutically acceptable excipient or carrier (e.g., physiological saline solution). The excipient or carrier is selected based on the mode and route of administration. Suitable pharmaceutical carriers, as well as the pharmaceutical requirements for use in pharmaceutical formulations, are described in Remington's Pharmaceutical Sciences (E.W. Martin) and USP / NF (United States Pharmacopeia and National Formulary), well-known reference books in this field.

[0074] In some embodiments, the composition can be formulated as nanoparticles encapsulating a CRISPR-associated endonuclease and a nucleic acid encoding a guide RNA sequence complementary to the NRF2 gene, or as a vector comprising a nucleic acid encoding a CRISPR-associated endonuclease and a guide RNA sequence complementary to the NRF2 gene.

[0075] Methods for reducing NRF2 expression or activity in cells In certain aspects, the disclosure relates to a method of reducing the expression or activity of NRF2 in a cell, the method comprising introducing into the cell (a) one or more DNA sequences encoding guide RNAs (gRNAs) complementary to a target sequence in the NRF2 gene, and (b) a nucleic acid sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease, whereby the gRNA hybridizes to the NRF2 gene and the CRISPR-associated endonuclease cleaves the NRF2 gene, and NRF2 expression or activity is reduced in the cell compared to a cell into which the one or more DNA sequences encoding the gRNA and the nucleic acid sequence encoding the CRISPR-associated nuclease have not been introduced.

[0076] Reducing the expression of NRF2 in cells may include reducing the expression of NRF2 mRNA in cells, reducing the expression of NRF2 protein in cells, or both. In some embodiments, the expression of one or more alleles of the NRF2 gene is reduced. In some embodiments, introducing one or more DNA sequences encoding gRNA and a nucleic acid sequence encoding a CRISPR-associated endonuclease into cells reduces the expression and / or activity of NRF2 in cells, but does not completely eliminate it. In other embodiments, the expression and / or activity of NRF2 in cells is completely eliminated.

[0077] The gRNA may be complementary to a target sequence in an exon of the NRF2 gene. In certain embodiments, the gRNA is complementary to a target sequence in exon 1, 2, 3, 4, or 5 of the NRF2 gene. In some embodiments, the gRNA is encoded by a single DNA sequence. In other embodiments, the gRNA is encoded by two or more DNA sequences. For example, in some embodiments, the gRNA is encoded by a first DNA sequence encoding a transactivating small RNA (tracrRNA) and a second DNA sequence encoding a CRISPR RNA (crRNA). The tracrRNA and crRNA can hybridize in a cell to form a guide RNA. Thus, in some embodiments, the gRNA comprises a transactivating small RNA (tracrRNA) and a CRISPR RNA (crRNA).

[0078] In some embodiments, CRISPR-associated endonucleases suitable for use in reducing expression of the NRF2 gene include, but are not limited to, Class 1 CRISPR-associated endonucleases, such as, for example, Cas7 and Cas5, along with, in some embodiments, SS(Cas11) and Cas8a1; Cas8b1; Cas8c; Cas8u2 and Cas6; Cas3" and Cas10d; Cas SS(Cas11), Cas8e, and Cas6; Cas8f and Cas6f; Cas6f; Cas8-like (Csf1); SS(Cas11) and Cas8-like (Csf1); or SS(Cas11) and Cas10. Class 2 CRISPR-associated endonucleases include Type I, Type V, and Type VI CRISPR-associated endonucleases that have a single effector molecule. Examples include CRISPR-Cas systems. In some embodiments, CRISPR-associated endonucleases suitable for use in reducing the expression of the NRF2 gene include, but are not limited to, class 2 CRISPR-associated endonucleases, such as Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas13a, Cas13b, Cas13c, c2c4, c2c5, c2c8, c2c9, and / or c2c10. In some embodiments, CRISPR-associated endonucleases suitable for use in reducing the expression of the NRF2 gene include, but are not limited to, CasX, CasY, and / or MAD6 (see, e.g., Liu et al., Nature 566:218-23 (2019)).

[0079] Any cell that contains NRF2 gene may be suitable for use in the method of reducing NRF2 expression or activity described herein.In some embodiments, the cell is a eukaryotic cell, for example, a mammalian cell.In some embodiments, the cell is a human cell.In some embodiments, the NRF2 gene is a human NRF2 gene.

[0080] In certain aspects, the present disclosure also relates to cells containing a mutant NRF2 gene produced by the methods for reducing NRF2 expression or activity described herein. In some embodiments, the mutant NRF2 gene contains an insertion or deletion compared to a wild-type NRF2 gene. In some embodiments, the insertion or deletion occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides of the protospacer adjacent motif (PAM) sequence in the NRF2 gene.

[0081] Methods for treating cancer In certain embodiments, the present disclosure relates to a method of treating cancer in a subject, comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease and a guide RNA complementary to a target domain from the NRF2 gene in the subject.

[0082] In certain embodiments, the present disclosure relates to a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising: (a) a DNA sequence encoding a guide RNA complementary to a target domain from an NRF2 gene in the subject; and (b) a nucleic acid sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease.

[0083] In certain embodiments, the cancer is a solid tumor. In certain embodiments, the cancer is non-small cell lung cancer. In certain embodiments, the cancer is treated only with a pharmaceutical composition comprising a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease and a guide RNA complementary to a target domain from the NRF2 gene in the subject, or only with a pharmaceutical composition comprising (a) a DNA sequence encoding a guide RNA complementary to a target domain from the NRF2 gene in the subject; and (b) a nucleic acid sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease. In certain embodiments, the cancer is treated with the pharmaceutical composition described herein and an additional agent, such as a chemotherapeutic agent. In certain embodiments, treatment with the chemotherapeutic agent is initiated simultaneously with treatment with the pharmaceutical composition. In certain embodiments, treatment with the chemotherapeutic agent is initiated after treatment with the pharmaceutical composition has begun. In certain embodiments, treatment with the chemotherapeutic agent is initiated before treatment with the pharmaceutical composition.

[0084] In certain embodiments, the pharmaceutical compositions of the present disclosure can be used to treat cancer, where the subject has failed at least one prior chemotherapy regimen. For example, in some embodiments, the cancer is resistant to one or more chemotherapeutic agents. Accordingly, the present disclosure provides a method for treating cancer in a subject, where the subject has failed at least one prior chemotherapy regimen for cancer, comprising administering to the subject a pharmaceutical composition described herein in an amount sufficient to treat the cancer, thereby treating the cancer. The pharmaceutical compositions described herein can also be used to inhibit tumor cell growth in a subject, where the subject has failed at least one prior chemotherapy regimen. Accordingly, the present disclosure further provides a method for inhibiting tumor cell growth in a subject, where, for example, the subject has failed at least one prior chemotherapy regimen, comprising administering to the subject a pharmaceutical composition described herein such that tumor cell growth is inhibited. In certain embodiments, the subject is a mammal, for example, a human.

[0085] For example, the pharmaceutical compositions described herein may be administered to a subject in an amount sufficient to reduce cancer cell proliferation compared to cancer cells not treated with the pharmaceutical composition. The pharmaceutical composition may reduce cancer cell proliferation by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, The reduction may be 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0086] In some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to tumors not treated with the pharmaceutical composition. The pharmaceutical composition may reduce tumor growth by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 11 In certain embodiments, administration of the pharmaceutical composition to a subject completely inhibits tumor growth.

[0087] In one embodiment, administration of a pharmaceutical composition described herein achieves at least stable disease, reduces tumor size, inhibits tumor growth, and / or prolongs survival of a tumor-bearing subject compared to a suitable control. Accordingly, this disclosure also relates to methods of treating tumors in humans or other animals, e.g., in subjects who have failed at least one prior chemotherapy regimen, by administering to such humans or animals an effective amount of a pharmaceutical composition described herein. One of ordinary skill in the art may be able to determine, by routine experimentation using the guidance provided herein, what effective amount of a pharmaceutical composition is required for the purpose of treating, e.g., a malignant tumor in a subject who has failed at least one prior chemotherapy regimen. For example, a therapeutically active amount of a pharmaceutical composition may vary according to factors such as the subject's disease stage (e.g., stage I or stage IV), age, sex, medical complications, and weight, as well as the ability of the pharmaceutical composition to elicit a desired response in the subject. Dosage regimens can be adjusted to provide an optimal therapeutic response. For example, several divided doses may be administered daily, the dose may be administered by continuous infusion or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0088] In certain embodiments, the method further comprises a treatment regimen comprising any one or combination of surgery, radiation, chemotherapy, e.g., hormone therapy, antibody therapy, therapy with growth factors, cytokines, and anti-angiogenic therapy.

[0089] Cancers that can be treated using the methods disclosed herein include, for example, all types of cancers, neoplasms, or malignant tumors found in mammals, including, but not limited to, leukemia, lymphoma, melanoma, carcinoma, and sarcoma. In one embodiment, cancers that can be treated using the methods disclosed herein include melanoma, carcinoma, and sarcoma. In some embodiments, Coenzyme Q10 compositions are used to treat various types of solid tumors, such as breast cancer, bladder cancer, colon and rectal cancer, endometrial cancer, kidney (renal cell) cancer, lung cancer, melanoma, pancreatic cancer, prostate cancer, thyroid cancer, skin cancer, bone cancer, brain cancer, cervical cancer, liver cancer, stomach cancer, oral and cavities cancer, neuroblastoma, testicular cancer, uterine cancer, thyroid cancer, head and neck cancer, kidney cancer, lung cancer, non-small cell lung cancer, melanoma, mesothelioma, ovarian cancer, sarcoma, stomach cancer, uterine cancer, and medulloblastoma, and vulvar cancer. In certain embodiments, solid tumors include breast cancer, such as triple-negative breast cancer. In certain embodiments, the skin cancer includes melanoma, squamous cell carcinoma, and cutaneous T-cell lymphoma (CTCL). In certain embodiments, the cancer includes leukemia. In certain embodiments, the cancer is selected from the group consisting of lung cancer, melanoma, esophageal squamous cell carcinoma (ESC), head and neck squamous cell carcinoma (HNSCC), and breast cancer.

[0090] In certain embodiments, the cancer is lung cancer, such as non-small cell lung cancer (NSCLC). In some embodiments, the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. In addition to the currently well-established combinatorial drug strategies used to treat NSCLC, several different combinatorial approaches are also being investigated for cancer treatment. For example, the use of oncolytic viruses to infect tumor cells has been found to enhance the activity of chemotherapy. Infection with myxoma virus in combination with cisplatin or gemcitabine efficiently destroyed ovarian cancer cells at lower dosages than those required without additional virus. Nounamo et al., Mol. Ther. Oncolytics 6, 90-99 (2017). The use of oncolytic virus therapy and cytotoxic chemotherapy to improve the efficacy of cancer treatment is an area of ​​active development. Wennier et al., Curr. Pharm. Biotechnol. 13, 1817-33 (2012); Pandha et al., Oncolytic Virotherapy 5, 1 (2016). Infection with a replication-competent virus prior to treatment with cisplatin significantly enhances the therapeutic benefit of chemotherapy.

[0091] Clinical management of NSCLC has improved significantly with the use of targeted therapies (e.g., targeting EGFR mutations, ALK rearrangements) and immunotherapies (e.g., checkpoint inhibitors, anti-PD1, anti-CTLA4). Patients may enjoy longer and better quality of life. However, these therapies cannot solve all problems. For example, drugs targeting specific molecules typically have a response rate of approximately 70%. However, after a median period of 8–16 months, almost all patients experience relapse due to inevitable resistance. Anichini et al., Cancer Immunol. Immunother. 67, 1011–1022 (2018). Regarding immunotherapy, pembrolizumab (Keytruda) can be used as a first-line treatment in certain lung cancer patients, but only a small proportion of them respond. Bianco et al., Curr. Opin. Pharmacol. 40, 46–50 (2018).

[0092] However, chemotherapy remains essential in the lung cancer treatment paradigm. In patients with locoregional NSCLC, chemotherapy is the only systemic therapy proven to improve the chances of cure when combined with surgery or radiation. Wang et al., Investig. Ophthalmology Vis. Sci. 58, 3896 (2017). In patients with metastatic disease, chemotherapy remains the mainstay of care for patients who develop resistance to targeted therapy agents. In the meantime, stimulating the immune system can boost the effectiveness of immunotherapy.

[0093] Combination therapy In certain embodiments, the pharmaceutical compositions described herein can be used in combination therapy with at least one additional anti-cancer agent, such as a chemotherapeutic agent.

[0094] Small molecule chemotherapeutic agents generally include, for example, 1. topoisomerase II inhibitors (cytotoxic antibiotics), such as anthracyclines / anthracenediones, e.g., doxorubicin, epirubicin, idarubicin, and nemorubicin, anthraquinones, e.g., mitoxantrone and losoxantrone, and podophillotoxines, e.g., etoposide and teniposide; 2. agents that affect microtubule formation (mitotic inhibitors), such as plant alkaloids (e.g., compounds belonging to a family of alkaline, nitrogen-containing molecules derived from plants that are biologically active and cytotoxic), e.g., taxanes, e.g., paclitaxel and docetaxel, and vinca alkaloids, e.g., vinblastine, vincristine, and vinorelbine, and podophyllotoxins. 3. Alkylating agents such as nitrogen mustards, ethylenimine compounds, alkyl sulfonates and other compounds with alkylating action, such as nitrosoureas, dacarbazine, cyclophosphamide, ifosfamide and melphalan; 4. Antimetabolites (nucleoside inhibitors), such as folates, e.g., folic acid, fluoropyrimidines, purine or pyrimidine analogues, e.g., 5-fluorouracil, capecitabine, gemcitabine, methotrexate, and edatrexate; 5. Topoisomerase I inhibitors, such as topotecan, irinotecan, and 9-nitrocamptothecin, camptothecin derivatives, and retinoic acid; and 6. Platinum compounds / complexes, belonging to various classes including, for example, cisplatin, oxaliplatin, and carboplatin. Exemplary chemotherapeutic agents for use in the methods disclosed herein include, but are not limited to, amifostine (ethyol), cisplatin, dacarbazine (DTIC), dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), doxorubicin (adriamycin), doxorubicin lipoprotein (doxorubicin), and cisplatin.lipo) (doxil), gemcitabine (Gemzar), daunorubicin, daunorubicin lipo lipo) (daunoxome), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil (5-FU), vinblastine, vincristine, bleomycin, paclitaxel (Taxol), docetaxel (Taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecin, CPT-II, 10-hydroxy-7-ethyl-camptothecin (SN38), capecitabine, ftorafur, 5'-deoxyfluorouridine, UFT, eniluracil, deoxycytidine, 5-azacytosine, 5-azadeoxycytosine, allopurinol, 2-chloroadenosine Camptothecin, trimetrexate, aminopterin, methylene-10-deazaaminopterin (MDAM), oxaliplatin, picoplatin, tetraplatin, satraplatin, platinum-DACH, ormaplatin, CI-973 (and its analogs), JM-216 (and its analogs), epirubicin, 9-aminocamptothecin, 10,11-methylenedioxycamptothecin, karenitecin, 9-nitrocamptothecin, TAS103, vindesine, L-phenylalanine mustard, ifosfamide, mefosphamide, perfosfamide, trofosfamide, carmustinecarmustine), semustine, epothilone A to E, Tomudex, 6-mercaptopurine, 6-thioguanine, amsacrine, etoposide phosphate, acyclovir, valacyclovir, ganciclovir, amantadine, rimantadine, lamivudine, zidovudine, bevacizumab, trastuzumab, rituximab, pentostatin, floxiridine, fludarabine, hydroxyurea, ifosfamide, idarubicin, mesna, irinotecan, mitoxantrone, Included are potecan, leuprolide, megestrol, melphalan, plicamycin, mitotane, pegaspargase, pipobroman, tamoxifen, teniposide, testolactone, thiotepa, uracil mustard, vinorelbine, chlorambucil, mTor, epidermal growth factor receptor (EGFR), and fibroblast growth factor (FGF), and combinations thereof, which will be readily apparent to one of skill in the art based on the appropriate standard of care for the particular tumor or cancer. In certain embodiments, the chemotherapeutic agent is selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof (e.g., cisplatin and vinorelbine; cisplatin and carboplatin; vinorelbine and carboplatin; cisplatin, vinorelbine, and carboplatin).

[0095] In some embodiments, the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to tumors treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition. The pharmaceutical composition may reduce tumor growth by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, %, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% reduction.

[0096] [Table 1-1] [Table 1-2]

[0097] NM_006164.5 (SEQ ID NO: 7) TIFF2025134847000003.tif128154TIFF2025134847000004.tif229154TIFF2025134847000005.tif17152NP_006155.2 (SEQ ID NO: 8) TIFF2025134847000006.tif99153

[0098] [Example] [Example 1] A method for generating NRF2 knockout clonal A549 cell lines using a CRISPR-directed gene editing approach Cell culture conditions Human lung cancer A549 cells were purchased from ATCC (Manassas, VA, USA). A549 is a well-established non-small cell lung adenocarcinoma cell line that harbors a mutation in the Kelch domain of KEAP1, leading to overexpression of NRF2. It is often used as a standard for discovering novel therapeutic agents for cancer. Cells were thawed according to the manufacturer's protocol and grown in F-12K medium (ATCC, Manassas, VA, USA) supplemented with 10% FBS (ATCC, Manassas, VA, USA) and 1% penicillin-streptomycin solution (ATCC, Manassas, VA, USA). Cells were cultured at 2 × 10 3 From 1×10 4 viable cells / cm 2 The cells were maintained at a concentration between 0.01 and 0.1% and incubated at 37°C and 5% CO2. Cell numbers were determined using a hemocytometer.

[0099] Guide RNA design and construction Input the NRF2 gene coding sequence into the Zhang lab's online generator (crispr.mit.edu / ), and select the gRNA with the highest score as gRNA1 (5'-UCGAUGUGACCGGGAAUAUC AGG ) (SEQ ID NO: 2), and a previously validated gRNA targeting NRF2 (Sanjana et al., 2014, Nature Methods 11(8); 783-784) was selected as gRNA2 (5'-UGAUUUAGACGGUAUGCAAC AGG) (SEQ ID NO: 4). The CRISPR-directed gene editing system was designed to disable the NES domain of NRF2, thereby reducing the protein's ability to re-enter the nucleus and activate transcription factors. CRISPR plasmids were cloned using a standard single-step digestion-ligation cloning method. CRISPR guide sequences with appropriate 5' overhangs were cloned into a BbsI-digested pX458 backbone vector (plasmid 48138; Addgene), human codon-optimized pSpCas9, and a chimeric guide RNA expression plasmid containing 2AeGFP purchased from Addgene (addgene.org). The guide RNA sequence was under the transcriptional control of a constitutive U6 promoter. See Figure 1A. After construction, the plasmid was verified by Sanger sequencing (Genewiz Inc., South Plainfield, NJ, USA).

[0100] Transfection and clonal isolation A549 cells were cultured at 5 × 10 in a 4 mm gap cuvette (BioExpress, Kaysville, UT, USA). 5 The NRF2-targeting pX458 constructs were transfected at a concentration of 100 μl cells / 100 μl. The NRF2-targeting pX458 constructs were separately electroporated into A549 cells using a Bio-Rad Gene Pulser XCell Electroporation System (Bio-Rad Laboratories, Hercules, CA, USA) (250 V, LV, 13 ms pulse length, 2 pulses, 1 s interval). Cells were then allowed to recover in 6-well plates containing complete growth medium for 72 hours at 37°C before being sorted. A549 cells were sorted into 96-well plates using a FACS Aria II flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA), and individual eGFP+ cells were sorted into each well. Clones were expanded, and when individual clones reached confluence, they were transferred to larger plates. Cells were grown until they reached confluence (1 × 10 cells / 10 cells) in the 6-well plates. 6 DNA isolation was performed when the cell density reached 1000kJ / mL.

[0101] Sequencing and sequence analysis CRISPR / Cas9-targeted A549 clones were PCR amplified using Amplitaq Gold Fast PCR Master Mix (Applied Biosystems, Foster City, CA) (forward 5'-gtagtggtgccttagagcttactcatcc (SEQ ID NO: 5), reverse 5'-ctagcatgggcagtactcatgactaag (SEQ ID NO: 6)). Briefly, template DNA, primers, water, and master mix were combined and cycled: 95°C for 10 minutes, (96°C for 3 seconds, 60°C for 3 seconds, 68°C for 5 seconds) × 35 cycles, and 72°C for 10 seconds. The 402-bp product was purified (Qiagen, Hilden, Germany) and Sanger sequenced using the forward PCR primer. Clonal allele analysis of individual A549 cell clones was performed using the software program Tracking of Indels by DEcomposition (TIDE) to determine individual subsequences within the multipeak degradation products following CRISPR / Cas9 activity. Brinkman et al., Nucleic Acids Res. 42, e168--(2014). TIDE analysis provides a visual representation of sequence degradation, clonal indel patterns, and the relative ratios of indel patterns for each clone, serving as an intermediate step in determining each allele profile. Using the indel patterns and their relative ratios provided by TIDE, control and clone trace sequences were manually aligned, allowing visualization of the indel patterns for each allele of the clone.

[0102] Western blot analysis Total cellular protein was harvested from A549 cell lines using standard RIPA lysis buffer containing a protease inhibitor cocktail. Protein concentration was determined using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). Samples were heated at 95°C for 10 minutes and then subjected to SDS-PAGE on a 10% polyacrylamide gel at 100V for 90 minutes. The gel was transferred to a nitrocellulose membrane at 100V for 1 hour. Blots were placed in 3% BSA and blocked overnight on a shaker at 4°C. Primary antibody incubations were performed overnight at 4°C on a shaker for NRF2 (phospho-S40) (1:10,000, Abcam ab76026) and 1 hour at room temperature for beta-actin (1:8,000, Abcam ab8226). Secondary antibody (Jackson Immunoresearch, West Grove, PA, USA) incubations were all performed at a 1:10,000 dilution for 1 hour at room temperature. Protein bands were visualized by chemiluminescence using Super Signal West Dura Extended Duration ECL (Pierce) and detected with a LiCor Odyssey FC. All bands were quantified for densitometry using the Image Studio software system.

[0103] Cell proliferation by FACS analysis A549 cell line was trypsinized and harvested at 50-70% confluency. Cells were fixed by adding ice-cold 70% ethanol dropwise while vortexing and incubated at 4°C for a minimum of 72 hours. Fixed cells were pelleted, washed twice with PBS, and then incubated on ice for 30 minutes. Immunohistochemical analysis was performed using 10% Alexa Fluor 647 Mouse anti-Ki67 (561126, BD Biosciences) as directed in the manufacturer's protocol (BD Biosciences). 620 μl per cell was added to the cells and incubated for 30 minutes. Controls included Alexa Fluor 647 Mouse IgG1 k isotype control (557714, BD Biosciences) at the same dilution. After incubation, cells were washed twice and resuspended in staining buffer (5% BSA in 1x PBS). Cells were analyzed using a FACS Aria II flow cytometer and processed using FlowJo software.

[0104] result The strategy was to functionally disable the NRF2 allele in A549 lung cancer cells using CRISPR-directed gene editing. It is important to establish that gene editing techniques can knock out targeted genes. Below, we provide details of the strategy utilized to generate the genetic tool used to disable NRF2 in A549 cells. Figure 1A shows the CRISPR / Cas9 machinery designed to target and knock out NRF2. The gray bar extending along the top of the panel represents the genomic sequence of NRF2, and the red block indicates the coding region. The blue brackets indicate the relative region where each CRISPR / Cas9 is designed to cut DNA. Each gRNA was designed to target four exons of NRF2 in a region containing all known isoforms to ensure complete removal of the gene (ncbi.nlm.nih.gov / gene / 4780). The gRNA with the highest score according to the Broad Institute's CRISPR Design software (crispr.mit.edu / ) was selected as gRNA1, and a previously validated gRNA (Sanjana et al., bioRxiv 006726 (2014). doi:10.1101 / 006726) was selected as gRNA2. gRNAs were assembled by annealing the crRNA oligos and ligating them to the complementary cleavage site overhangs in BbsI-digested plasmid px458 (Addgene #48138), as indicated in each panel.

[0105] Figure 1B shows the functional domains of the NRF2 protein, including the KEAP1-binding domain, transactivation domain, repressor-binding domain, β-TrCP-binding domain, DNA-binding domain, and transcriptional activation domain. Pandey et al., Crit. Rev. Oncol. Hematol. 116, 89-98 (2017); Jung et al., Molecular Mechanisms to Therapeutic Opportunities. 26, 57-68 (2018); Namani et al., Biochim. Biophys. Acta - Mol. Cell Res. 1843, 1875-1885 (2014). The Neh5 domain spans exons 4 and 5 and contains a redox-sensitive nuclear export signal (NES) that regulates the subcellular localization of NRF2. Jung et al., Molecular Mechanisms to Therapeutic Opportunities. 26, 57-68 (2018). Theoretically, disrupting genes / proteins within the Neh4 and Neh5 domains would shift the NES and render it nonfunctional. Figure 1C illustrates the experimental workflow, beginning with transfection of pX458 containing either gRNA1 or gRNA2 into A549 lung adenocarcinoma cells and proceeding to the final step of allelic analysis of individual clonal populations. Importantly, plasmid pX458 contains the eGFP receptor, which allows for the isolation of individual transfected cells by FACS. To assess the efficiency of CRISPR-directed NRF2 knockout in all targeted populations, eGFP+ cells were isolated as a population and the extent of gene disruption at the NRF2 locus in cells transfected with either gRNA1 or gRNA2 pX458 was determined. Sorted populations were subjected to Sanger sequencing, and the resulting trace files were analyzed for the presence of indels, a marker of gene disruption. These data were obtained using a program known as Tracking of Indels by Decomposition (TIDE). Brinkman et al., Nucleic Acids Res. 42, e168--(2014).As shown in Figure 2A, both CRISPR / Cas9 designs generated significant amounts of indels, as evidenced by the TIDE results, demonstrating high levels of NRF2 disruption. These results validate this approach and demonstrate that NRF2 disruption is possible in A549 cells using CRISPR / Cas9.

[0106] Next, we performed the same experiment, except that in this case, individual cells were isolated by FACS sorting to obtain single-cell clonal expansions. After expanding the isolated single cells to sufficient quantities, half of each clonal population was cryopreserved, and allelic sequence analysis was performed on the other half using the same strategy and method described above. Figure 2B shows allelic analysis of two clones, 1-40 and 2-11, derived from each of the gRNA1 and gRNA2 transfected cells, selected from a total of nine (figure supplement 1) for subsequent experiments and analysis. It quickly became apparent that all of the isolated clones generated from this parental lot of A549 cells obtained from ATCC possessed three alleles at the NRF2 locus. Red columns indicate the indel sizes present and their respective representative ratios within the clone. Clone 1-40 contained a 9-bp deletion at a 2:1 ratio to a 0-bp indel, revealing a heterozygous KO of NRF2. Clone 2-11 contains a 10-bp, 6-bp, and 1-bp deletion in a 1:1:1 ratio, resulting in a homozygous knockout of NRF2. The specific indel patterns in each allele of both clones were characterized by manually aligning the sequence trace files to the wild-type sequence using TIDE indel data as a guide. For convenience, we refer to clone 1-40 as the heterozygous knockout and clone 2-11 as the homozygous knockout.

[0107] A fundamental cellular phenotype that may be affected by the lack of an NES is the rate at which cells proliferate in culture. Murakami et al., Free Radic. Biol. Med. 88, 168-178 (2015); Mitsuishi et al., Cancer Cell 22, 66-79 (2012). While wild-type A549 cells typically have a doubling time of 24 hours, clones 1-40, and more specifically 2-11, were found to proliferate more slowly during the clonal expansion process (data not shown). This observation led us to further investigate the growth profiles of clones 1-40 and 2-11 by staining the cells with an antibody against Ki67 followed by FACS analysis. Ki67 is a nuclear antigen expressed in actively proliferating cells. Therefore, reduced Ki67 expression can be predicted based on the growth characteristics observed in cell culture. Ethanol-fixed cells were stained with Alexa Fluor 647 anti-Ki67, analyzed by FACS, and plotted as a histogram (left panel, Figure 3A). A mouse IgG1 kappa isotype control provided and gated by FlowJo was used to control for nonspecific binding. The x-axis represents the fluorescence intensity of allophycocyanin (APC)-conjugated anti-Ki67; a shift to the left can be seen in clone 2-11, indicating a decrease in fluorescence intensity that correlates with a decrease in cell proliferation.

[0108] The decrease in proliferation of 2-11 cells was significant, but the decrease in proliferation of 1-40 cells was not as significant. Therefore, we decided to continue our study of the effects of NRF2 knockout using only 2-11 cells, because CRISPR-directed gene editing was successful in more completely disrupting function in these cells. Based on growth characteristics in cell culture and FACS analysis, we used an MTS assay to evaluate the proliferation of 2-11 cells compared to wild-type cells (right panel, Figure 3A). Allelic analysis of clone 2-11 demonstrated that NRF2 was genetically abolished; when normalized to beta-actin, clone 2-11 showed approximately 68% knockdown compared to wild-type A549 cells (Figure 3B). This result is not unexpected, as one of the three alleles in clone 2-11 maintains a functional reading frame. Genetic analysis indicated that the Neh5 domain, which contains the NES, was disrupted. Therefore, we proceeded to characterize this clone, which we identified as a functional knockout.

[0109] [Example 2] Chemosensitivity is increased in the NRF2 knockout A549 cell line method MTS cell proliferation assay Cell viability was assessed using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI). A549 cell line was plated at 2 × 10 cells per well. 3Cells were plated on wells and cultured for 24 hours. The cell medium was then aspirated, the cells were washed with PBS, and then exposed to the MTS reagent for 3 hours. After 3 hours of MTS bioreduction by proliferating cells, the absorbance of the formazan product was measured using a 450 nm filter in an Infinite 2000 PRO microplate reader (Tecan, Mannadorf, Switzerland). Cell viability after drug exposure was assessed using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay. A549 cell line was plated at 2 × 10 cells per well. 3 Cells were plated with cisplatin and cultured for 24 hours. Cells were then treated with cisplatin, carboplatin, or a combination of cisplatin and vinorelbine for 3 days. The cell medium was then aspirated, and cells were washed with PBS and then exposed to MTS reagent for 3 hours. After 3 hours of MTS bioreduction by proliferating cells, the absorbance of the formazan product was measured using a 450 nm filter in an Infinite 2000 PRO microplate reader.

[0110] result To examine the chemical sensitivity of the genetically engineered NRF2-deficient A549 cell line, we utilized the MTS assay shown in Figure 4. In Figure 4A, wild-type and 2-11 A549 cells were exposed to increasing doses of cisplatin. After 72 hours, cisplatin was removed, and the MTS reagent was added for 3 hours, after which time the population was measured for formazan absorbance. This data demonstrates that wild-type A549 cells are resistant to high doses of cisplatin, as expected. Indeed, wild-type A549 cells show a slight increase in cell proliferation up to 3 μM cisplatin before proliferation is adversely affected at final concentrations of 5 μM and 10 μM, respectively. In the genetically engineered knockout cell line, we clearly observe a dose-dependent increase in chemical sensitivity. 2-11 homozygous knockout cells lose proliferation at concentrations above 1 μM, demonstrating a clear increase in sensitivity even at the lowest dose. Thus, we observe a gene dosage effect in that heterozygous cell lines, containing at least one viable gene copy, exhibit greater resistance to cisplatin than homozygous knockout cells. In Figure 4, we show results from cells exposed to the same increasing doses of cisplatin as described in Panel A, except that vinorelbine was added at a final concentration of 5 μM. Vinorelbine is an established treatment for cisplatin and combination chemotherapy regimens in NSCLC. Hellmann et al., Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 27, 1829-35 (2016). Wild-type A549 cells again showed a dramatic increase in proliferation even at lower doses and did not show increased sensitivity until the dosage exceeded 5 μM, whereas knockout cell lines (2-11) showed increased sensitivity to the combination drug therapy. Carboplatin, a related anticancer drug and a commonly used chemotherapy agent for NSCLC (Hellmann et al., ibid.), was also evaluated for enhanced chemosensitivity in these engineered A549 cells, and the cell killing response mirrored that observed in experiments using cisplatin (data not shown).

[0111] [Example 3] Genetically re-engineered A549 cells exhibited a slower growth rate and increased chemosensitivity in a xenograft mouse model of lung cancer. method Animal experiments and statistical analyses The animal studies presented herein were performed at Washington Biotechnology Inc., Simpsonville, Maryland, under animal use and care protocols (SOP 505, SOP 520, SOP 522, SOP 1610, SOP 1650) approved by the Washington Biotechnology Inc. Animal Care and Use Committee (AAALAC-approved Animal Welfare Assurance No. A4192-01). A human xenograft model was established using previously reported methodology (Kellar et al., Biomed Res. Int. 2015, 1-17 (2015)). Female athymic nude mice (Envigo, 5-6 weeks old) were used in this study. Approximately 5 x 10 cells were suspended in PBS containing 20% ​​Matrigel. 6 Cells (wild-type A549 or homozygous knockout (clonal expansion 2-11)) were injected subcutaneously into the right flank of each mouse. Tumor volume was measured three times a week using digital calipers once palpable and calculated using the formula: tumor size = ab 2 / 2 (where "a" is the larger of the two dimensions and "b" is the smaller). 3Once tumors reached a near-average volume, A549 or A549-2-11 tumor-bearing mice were randomly divided into seven groups (n=5 per group) for a dose / regimen-finding study. They were treated via tail vein injection with (1) cisplatin (2 mg / kg), (2) carboplatin (25 mg / kg), (3) cisplatin (5 mg / kg) and vinorelbine (5 mg / kg), or (4) saline on days 0, 3, 6, and 9 (day 0 was designated as the start of treatment) (Sanjana et al., 2014, Nature Methods 11(8); 783-784). Tumor volume and body weight were closely monitored over time. After 16 days, animals were sacrificed, tumors were removed, weighed, and processed for molecular analysis. Mice were euthanized. Data are presented as mean ± SD. The significance of differences was assessed using Student's t-test and one-way or two-way ANOVA. A P value <0.05 was considered significant.

[0112] Immunofluorescence staining A549 xenografts were excised on day 16, flash-frozen in liquid nitrogen, and stored at -80°C until use. All immunofluorescence staining was performed as previously described (Wang et al., Investig. Ophthalmology Vis. Sci. 58, 3896 (2017)). Briefly, tumors were embedded in Optimum Cutting Temperature (Tissue Tek, Torrance, CA, USA), and 16-μm-thick sections were obtained using a Leica CM3050 cryostat (Leica Microsystems, Buffalo Grove, IL, USA) and mounted on slides. Slides were fixed and incubated with blocking buffer for 1 hour at room temperature. Sections were then incubated with primary antibodies (see Table 2 for more details), washed in PBS, and incubated with Alexa Fluor 488-conjugated secondary antibodies (1:200 dilution, Invitrogen, Grand Island, NY, USA) for 1 hour at room temperature. Sections were washed in PBS and then mounted with SlowFade Gold antifade mounting medium with DAPI (Invitrogen, Carlsbad, CA, USA). Images were obtained using a Zeiss Observer.Z1 microscope (Carl Zeiss, Inc., Göttingen, Germany). TUNEL assays were performed using the In Situ Cell Death Detection Kit, Fluorescein (Roche, Base, Switzerland) according to the manufacturer's instructions.

[0113] [Table 2]

[0114] Immunocytochemistry and image quantification A549 cell lines were seeded in 8-well chamber slides (LabTek II) and grown for 24 hours. After 48 hours of exposure to 2 μM cisplatin, cells were washed with PBS, fixed, and permeabilized with 4% paraformaldehyde + 0.1% Triton X-100 for 45 minutes at room temperature with shaking. Cells were washed three times with PBS and blocked with blocking buffer (5% normal goat serum + 0.3% Triton X-100 in 1x PBS) for 2 hours at room temperature. After blocking, cells were incubated overnight at 4°C in a humidified chamber with primary antibody (NRF2 1:500, Abcam ab62352) prepared in antibody dilution buffer (1% BSA + 0.3% Triton X-100 in 1x PBS). Cells were washed three times with PBS and incubated with a conjugated secondary antibody (goat anti-rabbit Alexafluor 594, Thermo Fisher A-11037) made in antibody dilution buffer at a concentration of 1:200. Controls included staining with the secondary antibody alone at the same dilution. Cells were incubated for 1 hour at room temperature in the dark. Cells were washed three times with PBS, and the chambers were separated from the slides. Immediately after this step, 5 μl of Slow Fade Gold antifade reagent containing DAPI (S36938, Invitrogen) was added to each section of the slide, and a coverslip was added and sealed. Slides were imaged using a Zeiss Axio fluorescence microscope. Z1 microscope and images were processed with AxioVision software. Random fields were imaged, and the total number of cells / field was counted. Each field was quantified for no staining (none), nuclear staining, or cytoplasmic staining. Images were counted and quantified independently by two individuals, and values ​​were averaged. The percentage of NRF2-positive staining cells relative to the total cells analyzed in each category was plotted on a graph. Error bars represent ±SEM, and * indicates a significant p-value less than 0.05 (Student's T-test).

[0115] result Because CRISPR / Cas9-mediated NRF2 knockdown increased the chemosensitivity of A549 cells in vitro, we investigated the enhanced chemosensitivity driven by gene editing in a xenograft mouse model. Homozygous knockout A549 cells (clone 2-11) and wild-type A549 cells (control group) were transplanted into the dorsum of nude mice, and cells (5 × 10 per cell line) were added. 6 ) about 100mm 3 The tumors were grown to a diameter of 100 μg / cm. The workflow is shown in Figure 5A. As part of the strategy, chemotherapy was administered via tail vein injection on days 0, 3, 6, and 9, as indicated in the figure. Tumor growth by volume and proliferation was measured over a 16-day period, starting from the time of the first chemotherapy injection on day 0, and the results are presented in Figures 5B, 5C, and 5D.

[0116] Figure 5B shows the results of tumor growth over a 16-day period. As expected, growth of wild-type A549 cells treated with either saline or 2 mg / kg cisplatin was not inhibited by the drugs, confirming the well-established resistance of A549 cells to cisplatin. NRF2 knockout xenografts grew in mice but at a reduced rate even without the addition of cisplatin. The most dramatic effect was seen when we performed a combination approach, treating NRF2 knockout cells with cisplatin for 16 days. In this case, growth of the transplanted cells stopped, and tumor size remained at the same level throughout the course of the experiment, confirming our previous results from experiments performed in cell culture (Figure 4).

[0117] Figure 5C shows similar results when a fixed concentration of 5 mg / kg cisplatin and 5 mg / kg vinorelbine were used in combination, following the same xenograft mouse experimental protocol. Interestingly, wild-type A549 cells appear more sensitive to this drug combination. This observation may reflect a synergistic effect of vinorelbine on cisplatin killing of A549 cells, providing our experimental system with a sufficient internal control to recapitulate previously known outcomes. Again, the homozygous knockout 2-11 cell line proliferates at a slower rate than wild-type cells in the absence of drug treatment, but the combination of NRF2 knockout and drug treatment results in tumor growth arrest and maintenance of tumor size over a 16-day period. The same response is again seen in the data presented in Figure 5D, where 25 mg / kg carboplatin is injected into the tail vein, recapitulating the same trends of reduced proliferation and growth described above. These results suggest that the combination of gene editing with chemotherapy results in enhanced chemosensitivity in A549 cells in both cell culture and xenograft mouse models.

[0118] Analysis of A549 tumor growth Representative tumor samples were collected from four groups (wild-type A549 treated with saline, wild-type A549 treated with 2 mg / kg cisplatin, knockout 2-11 treated with saline, and knockout 2-11 treated with 2 mg / kg cisplatin) (N = 3 for each group). As shown in Figure 5E, clear differences between the four excised tumor groups are evident. As noted above, tumors arising from wild-type cells grow aggressively in xenograft mouse models in the absence or presence of cisplatin. NRF2 knockout cell lines grow more slowly than wild-type cells, even in the absence of the drug. However, minimal tumors are observed in all samples from mice bearing NRF2 knockout cells treated with cisplatin.

[0119] Because A549 2-11 knockout xenograft tumors exhibited smaller tumor volumes compared with their wild-type counterparts, we sought to examine the proliferative activity within the tumors using Ki67, a well-known marker of proliferation that is present during all active phases of the cell cycle (G1, S, G2, and mitosis). Scholzen et al., J. Cell. Physiol. 182, 311–322 (2000). As shown in Figure 6, abundant Ki67-positive cells were observed in A549 cells treated with saline alone, and tumors excised from mice treated with cisplatin produced similar levels of Ki67-positive cells. In tumors arising from 2-11 cells, Ki67 staining was significantly reduced, and treatment with cisplatin resulted in even lower levels of Ki67, suggesting that cisplatin enhances the response of KO2-11 cells by slowing their proliferation even further.

[0120] Taken together, the accumulated data constitute a strong case for clone 2-11 as a functional knockout, as these cells are more sensitive to chemotherapy than their wild-type counterparts. We sought to provide some explanation for this phenotype observed in both cell culture and mice. We further characterized the effect of disruption of the NES region, located in the Neh5 domain of NRF2, using immunocytochemistry. Wild-type A549 and clone 2-11 cells were pretreated with 2 μM cisplatin to stimulate NRF2 expression. Random fields in each cell sample were identified, imaged, and the total cell number determined. Cells were quantified based on the following observed results: no NRF2 staining, nuclear staining only, or cytoplasmic staining only. Figure 7A represents the average quantification of multiple replicates of several experiments with at least 10 fields combined into a dataset. We observed statistically significant differences in the degree of NRF2 nuclear localization between wild-type A549 and clone 2-11 cells, respectively. In wild-type cells, NRF2 is mostly located in the nucleus, whereas in functional knockout cell lines (2-11), NRF2 is found primarily in the cytoplasm, as seen in Figure 7B. Images of wild-type and knockout cells induced with cisplatin (Figure 7B) mirror the data shown in Figure 7A.

[0121] Cell line 2-11 showed high sensitivity to increasing doses of cisplatin and, to a lesser extent, response to increasing concentrations of carboplatin. Similar high sensitivity is observed when cisplatin is combined with vinorelbine. Cell killing was determined by a standard MTS assay. The chemosensitivity of the homozygous knockout cell line 2-11 was then evaluated in a xenograft mouse model in which cells were implanted into the dorsum of nude mice and allowed to grow for 16 days. After tumors reached approximately 100 mm 3Tail vein injection of cisplatin, carboplatin, or cisplatin and vinorelbine at various days after growth into the NRF2-positive cells resulted in a reduction in tumor growth over the next 16 days. Interestingly, only cell line 2-11 exhibited a slower growth phenotype in xenograft mouse models, even without the addition of chemotherapy. These results indicate that disruption of the NRF2 gene itself slightly reduces proliferative activity, but the addition of cisplatin, carboplatin, or cisplatin / vinorelbine results in a significant reduction in tumor cell proliferation.

[0122] Tumors isolated from mice implanted with wild-type A549 cells or cloned knockout cells treated with either cisplatin or saline were sectioned and stained for Ki67, a commonly used marker for cell proliferation. Ki67 is strictly associated with cell proliferation and is present during all active phases of the cell cycle but absent in resting cells. Our results suggest no difference in Ki67 levels in treated or untreated wild-type A549 cells grown in the xenograft model, again reflecting the well-known resistance of A549 cells to cisplatin. In contrast, Ki67 levels in cisplatin-treated NRF2 knockout cells were found to be substantially lower compared to their wild-type counterparts. These results provide a plausible explanation for the reduced tumor size found in mice implanted with NRF2 knockout cells, a reduction in tumor cell proliferation as a function of CRISPR-directed gene editing. These results mirror those of Velma et al. (Biomark Insights 11, BMI.S39445, 2016), who reported that cells treated with cisplatin arrested at the G0 / G1 boundary as the concentration increased. Cisplatin affects the boundary between G0 and G1, reducing proliferation and cell cycle progression. These data confirm that disruption of NRF2 in A549 cells results in a reduced proliferative phenotype and eliminates the appearance of apoptosis in tumors analyzed at day 16. It is possible that apoptosis could be evident immediately after the introduction of any of the four cisplatin treatments administered early in the experiment.

[0123] Upon stressor stimulation, functional NRF2 translocates to the nucleus, where it binds to ARE (antioxidant response element) sequences and activates the transcription of various downstream cytoprotective genes. Nuclear translocation of NRF2 (represented as purple) can be seen in images of wild-type A549 cells (Figure 7B). However, as also seen in Figure 7B, genetic knockout of NRF2 in clone 2-11 results in loss of NRF2 function, halting protein translocation and instead appearing to remain in the cytoplasm. Functional knockout may be valuable as CRISPR advances into clinical applications, particularly cancer therapy.

[0124] Our results support the concept that the combination of gene editing activity and chemotherapy acts synergistically to reduce tumor cell growth. In our case, treatment of A549 cells with CRISPR / Cas9 to disable NRF at the genetic level also resulted in effective killing with lower doses of multiple chemotherapy agents.

[0125] [Example 4] Chemosensitivity (predictive) in vitro and xenograft mouse models of melanoma, ESC, HNSCC, and breast cancer Following the methods of the above examples, the effect of CRISPR / Cas9-mediated NRF2 knockdown is evaluated for additional cancers both in vitro and in xenograft mouse models. For example, following the methods of Example 1 above, the gRNA1 sequence (5'-UCGAUGUGACCGGGAAUAUC AGG ) (SEQ ID NO: 2) or gRNA2 sequence (5'-UGAUUUAGACGGUAUGCAAC AGG) (SEQ ID NO: 4) was used to generate NRF2 knockdown cell lines of the human malignant melanoma A375 cell line (Wang et al., 2018, Oxidative Medicine and Cellular Longevity Volume 2018, Article ID 9742154), the esophageal squamous cell carcinoma (ESC) cell lines KYSE-30, -50, -70, -110, -140, -150, -170, -180, -220, and 270 (Shibata et al., 2015, Neoplasia 13:864), the head and neck squamous cell carcinoma (HNSCC) HSC-4 cell line (Kitamura & Motohashi, 2018, Cancer Science 109:900), and the breast cancer (adenocarcinoma) cell line MCF7 (Kang et al., 2014, Scientific Reports 4:7201). The chemosensitivity of the genetically engineered NRF2-deficient cancer cell lines is compared to that of the corresponding wild-type cancer cell lines in vitro according to the methods provided above in Example 2. For each cell line, the chemosensitivity to the following chemotherapeutic agents is assessed as shown in Table 3 below.

[0126] [Table 3]

[0127] Wild-type and NRF2-deficient cancer cell lines, as shown in Table 3 above, are implanted into nude mice and chemosensitivity is assessed as described in Example 3 above.

[0128] [Example 5] RF2 gRNA design px458 plasmid vector Exon 4 gRNA1-5' TCGATGTGACCGGGAATATC AGG 3' (SEQ ID NO: 9) Exon 4 gRNA2-5' TGATTTAGACGGTATGCAAC AGG 3' (SEQ ID NO: 10) Input the NRF2 gene coding sequence into the Zhang lab's online generator (http: / / crispr.mit.edu / ) and select the gRNA with the highest score, designated as gRNA1 (5' TCGATGTGACCGGGAATATC AGG The gRNA targeting NRF2, selected and previously validated as gRNA2 (5' TGATTTAGACGGTATGCAAC AGG The 3' (SEQ ID NO: 10) was selected as the CRISPR guide sequence (SEQ ID NO: 10) (1). CRISPR plasmids were cloned using a standard single-step digestion-ligation cloning method. CRISPR guide sequences with appropriate 5' overhangs were cloned into a BbsI-digested px458 backbone vector (plasmid 48138, Addgene). These two plasmids were transfected separately to knock out NRF2 in the A549 cell line, generating cell lines 1-40 and 2-11, which have a small indel at the break site (2).

[0129] Both plasmid constructs, gRNA1 and gRNA2, were transfected (lipofection) into an A549 cell line targeting NRF2, cleaving and removing the 103 base pair fragment. Transfected cells were single-cell sorted and expanded. Clonal populations were initially screened using PCR and gel electrophoresis to visually analyze changes in amplicon size. After screening, DNA was sent for sequencing across exon 4 of NRF2. Figure 8 shows the 10 clones analyzed for indel formation.

[0130] Exon 3 gRNA3-5' AAGTACAAAGCATCTGATTT GGG 3' (SEQ ID NO: 11) Exon 3 gRNA4-5' AGCATCTGATTTGGGAATGT GGG 3' (SEQ ID NO: 12) The previously described experiment was designed to cut within exon 4. To ensure complete knockout of NRF2, gRNA3 (5' AAGTACAAAGCATCTGATTT GGG 3' (SEQ ID NO: 11)) and gRNA4 (5' AGCATCTGATTTGGGAATGT GGG 3' (SEQ ID NO: 12)) (the NRF2 sequence was entered into Benchling and gRNAs were strategically selected) were cloned into a px458 backbone vector and designed to cleave within exon 3. The newly designed gRNAs were used in conjunction with previously designed gRNA1 and gRNA2 to cleave exon 3 through exon 4. gRNA4 was designed for use with gRNA1, which removes 782 bases. gRNA3 was designed for use with gRNA2, which removes 877 bases. Both of these combinations resulted in the loss of most of exon 3 and exon 4, leaving only the beginning of exon 3 and the end of exon 4. (Sanjana et al., Nat. Methods 11:783 (2014); Bialk et al., Mol. Ther. - Oncolytics 11:75-89 (2018))

[0131] Cas9 RNP Exon 2 gRNA-5' TGGATTTGATTGACATACTT TGG 3' (Neh2 for NRF2 KO) (SEQ ID NO: 13) Exon 5 gRNA-5' GCTTCTTACTTTTGGGAACA AGG 3' (Neh3 for NRF2 KO) (SEQ ID NO: 14) The following gRNAs were designed to complex with tracrRNA and Cas9 protein to form ribonucleoprotein (RNP) complexes: gRNAs were designed using the NRF2 sequence in Benchling.

[0132] Exon 2 gRNA (5' TGGATTTGATTGACATACTT TGG3' (SEQ ID NO: 13)) was designed to cleave at the beginning of Neh2 in exon 2 to knock out NRF2. RNPs were transfected into A549 cells and harvested at various time points to assess indel formation (TIDE analysis) as shown in Figure 9. Cells were sorted by FACS to single cells to obtain clonal populations so the extent of NRF2 KO can be determined.

[0133] Exon 5 gRNA (5' GCTTCTTACTTTTGGGAACA AGG The 3' (SEQ ID NO: 14) gRNA was designed to cleave at the end of Neh3 in exon 5 and be used in conjunction with the exon 2 gRNA. Using both gRNAs, the entire NRF2 gene (3429 bp) was removed. Both RNP complexes were transfected into cells and single-cell sorted by FACS. Clonal populations were analyzed for NRF2 KO.

[0134] Cas12a RNP Exon 2 gRNA-5' TTTG ATTGACATACTTTGGAGGCAA 3' (Neh2 for NRF2 KO) (SEQ ID NO: 15) Exon 5 gRNA-5' TTTT CCTTGTTCCCAAAAGTAAGAA 3' (Neh3 for NRF2 KO) (SEQ ID NO: 16) The following gRNAs were designed to complex with tracrRNA and Cas12a protein to form ribonucleoprotein (RNP) complexes: gRNAs were designed using the NRF2 sequence in Benchling.

[0135] Exon 2 gRNA (5' TTTGATTGACATACTTTGGAGGCAA 3' (SEQ ID NO: 15) was designed to cleave at the beginning of Neh2 in exon 2 to knock out NRF2. RNPs were transfected into A549 cells and harvested at various time points to assess indel formation as shown in Figure 10. Cells were sorted by FACS into single cells to obtain clonal populations so the extent of NRF2 KO can be determined.

[0136] Exon 5 gRNA (5' TTTT The RNP complex CCTTGTTCCCAAAAGTAAGAA 3' (SEQ ID NO: 16) was designed to cleave at the end of Neh3 in exon 5 and be used in conjunction with the exon 2 gRNA. Using both gRNAs, the entire NRF2 gene (3432 bp) was removed. Both RNP complexes were transfected into cells and single-cell sorted by FACS. Clonal populations were analyzed for NRF2 KO.

[0137] [Example 6] H1703 (NCI-H1703) is a lung squamous cell carcinoma cell line that has a missense mutation (GAG → AAG) at codon 285 of its p53 gene. You et al., Cancer Res. 60:1009-13 (2000). NCI-H1703 expresses primarily FGFR1c and has been shown to induce Erk1 / 2 phosphorylation upon stimulation with FGF2. Marek et al., Mol. Pharmacol. 75:196-207 (2009).

[0138] Cas9 RNP Exon 2 gRNA3-5' TGGAGGCAAGATATAGATCT TGG 3' (Neh2 for NRF2 KO) (SEQ ID NO: 22) TIFF2025134847000009.tif33170

[0139] Exon 2 gRNA3 was designed to cleave at the D29 codon in exon 2 of the NRF2 gene to recreate the R34G mutation. The gRNA was complexed with Cas9 protein to form an RNP and used with the R34G template DNA to facilitate DNA repair and introduce the desired R34G mutation into the NRF2 gene. This experiment yielded several clone-derived cell lines that were further characterized. Figure 11 shows clones genetically analyzed by DECODR for indel formation. Clone 26 (G9_H1703-26) contains a homozygous R34G mutation preceded by a 4-bp deletion at the cleavage site of the gRNA used for transfection. Clone 53 (G2_H1703_R34G_53) contains a homozygous R34G mutation preceded by a 2-bp deletion at the cleavage site of the gRNA used for transfection. Clone 2-31 (H1703_R34G_2-31) contains two wild-type alleles with two different indel patterns, a 6-bp deletion in one allele and a 4-bp deletion in the other allele, at the cleavage site of the gRNA used for transfection. Clone 2-91 (H1703_R34G_2-91) contains a heterozygous R34G mutation along with a wild-type allele containing a 20-bp deletion at the cleavage site of the gRNA used for transfection. These clones will be used to further characterize the effects of the R34G mutation and NRF2 KO in exon 2 of the H1703 cell line.

[0140] The following gRNAs were designed for use in the px458 plasmid vector and with the Cas9 RNP for further experiments in the H1703 cell line. Individual and both RNP complexes will be used to generate NRF2 knockout clone-derived cell lines for characterizing NRF2 knockout in the H1703 cell line. The clone-derived cell lines will be used in MTS proliferation assays to determine chemical sensitivity.

[0141] Cas9 RNP Exon 4 gRNA1-5' TCGATGTGACCGGGAATATC AGG3'(NRF2 KO) (SEQ ID NO: 24) Exon 4 gRNA2-5' TGATTTAGACGGTATGCAAC AGG 3'(NRF2 KO) (SEQ ID NO: 25)

[0142] [Example 7] (Predictive) Chemosensitivity is increased in the NRF2 knockout H1703 cell line. method MTS cell proliferation assay Cell viability was assessed using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI). H1703 cell line was plated at 2 × 10 cells per well. 3 Cells are plated and cultured for 24 hours. The cell medium is then aspirated, the cells are washed with PBS, and then exposed to the MTS reagent for 3 hours. After 3 hours of MTS bioreduction by proliferating cells, the absorbance of the formazan product is measured using a 450 nm filter in an Infinite 2000 PRO microplate reader (Tecan, Mannadorf, Switzerland). Cell viability after drug exposure is assessed using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay. The H1703 cell line is plated at 2 × 10 cells per well. 3 Cells are plated and cultured for 24 hours. The cells are then treated with cisplatin, carboplatin, or a combination of cisplatin and vinorelbine for 3 days. The cell culture medium is then aspirated, the cells are washed with PBS, and then exposed to the MTS reagent for 3 hours. After 3 hours of MTS bioreduction by proliferating cells, the absorbance of the formazan product is measured using a 450 nm filter in an Infinite 2000 PRO microplate reader.

[0143] result We used an MTS assay to examine the chemical sensitivity of genetically engineered NRF2-deficient H1703 cell lines. Wild-type and NRF-2-deficient H1703 cells were exposed to increasing doses of cisplatin. After 72 hours, cisplatin was removed, and MTS reagent was added for 3 hours, after which the population was measured for formazan absorbance. The data show that wild-type H1703 cells are resistant to high doses of cisplatin. In genetically engineered knockout cell lines, we observed a dose-dependent increase in chemical sensitivity. NRF2 knockout cells exhibited increased sensitivity. Thus, we observed a gene dosage effect, in which heterozygous cell lines, containing at least one viable gene copy, exhibited greater resistance to cisplatin than homozygous knockout cells. SEQUENCE LISTING <110> Christiana Care Gene Editing Institute, Inc. <120> Gene Knockout of NRF2 for Treatment of Cancer <130> PA25-279 <150> US 62 / 852,076 <151> 2019-05-23 <160> twenty five <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Guide RNA recognition element <400> 1 agctactctg gcccttatag tcc 23 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Guide RNA <400> 2 ucgaugugac cgggaauauc agg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA recognition element <400> 3 actaaatctg ccatacgttg tcc 23 <210> 4 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Guide RNA <400> 4 ugauuuagac gguaugcaac agg 23 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 gtagtggtgc cttagagctt actcatcc 28 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 ctagcatggg cagtactcat gactaag 27 <210> 7 <211> 2446 <212> DNA <213> Homo sapiens <400> 7 gattaccgag tgccggggag cccggaggag ccgccgacgc agccgccacc gccgccgccg 60 ccgccaccag agccgccctg tccgcgccgc gctcggcag ccggaacagg gccgccgtcg 120 gggagcccca acacacggtc cacagctcat catgatggac ttggagctgc cgccgccggg 180 actcccgtcc cagcaggaca tggatttgat tgacatactt tggaggcaag atatagatct 240 tggagtaagt cgagaagtat ttgacttcag tcagcgacgg aaagagtatg agctggaaaa 300 acagaaaaaa cttgaaaagg aaagacaaga acaactccaa aaggagcaag agaaagcctt 360 ttcgctcag ttacaactag atgaagagac aggtgaattt ctcccaattc agccagccca 420 gcacatccag tcagaaacca gtggatctgc caactactcc caggttgccc acattcccaa 480 atcagatgct ttgtactttg atgactgcat gcagcttttg gcgcagacat tcccgtttgt 540 agatgacaat gaggtttctt cggctacgtt tcagtcactt gttcctgata ttcccggtca 600 catcgagagc ccagtcttca ttgctactaa tcaggctcag tcacctgaaa cttctgttgc 660 tcaggtagcc cctgttgatt tagacggtat gcaacaggac attgagcaag tttgggagga 720 gctattatcc attcctgagt tacagtgtct tatattgaa aatgacaagc tggttgagac 780 taccatggtt ccaagtccag aagccaaact gacagaagtt gacaattatc atttttactc 840 atctataccc tcaatggaaa aagaagtagg taactgtagt ccacattttc ttaatgcttt 900 tgaggattcc ttcagcagca tcctctccac agaagacccc aaccagttga cagtgaactc 960 attaaattca gatgccacag tcaacacaga ttttggtgat gaattttatt ctgctttcat 1020 agctgagccc agtatcagca acagcatgcc ctcacctgct actttaagcc attcactctc 1080 tgaacttcta aatgggccca ttgatgtttc tgatctatca ctttgcaaag ctttcaacca 1140 aaaccaccct gaaagcacag cagaattcaa tgattctgac tccggcattt cactaaacac 1200 aagtcccagt gtggcatcac cagaacactc agtggaatct tccagctatg gagacacact 1260 acttggcctc agtgattctg aagtggaaga gctagatagt gcccctggaa gtgtcaaaca 1320 gaatggtcct aaaacaccag tacattcttc tggggatatg gtacaaccct tgtcaccatc 1380 tcaggggcag agcactcacg tgcatgatgc ccaatgtgag aacacaccag agaaagaatt 1440 gcctgtaagt cctggtcatc ggaaaacccc attcacaaaa gacaaacatt caagccgctt 1500 ggaggctcat ctcacaagag atgaacttag ggcaaaagct ctccatatcc cattccctgt 1560. agaaaaaatc attaacctcc ctgttgttga cttcaacgaa atgatgtcca aagagcagtt caatgaagct caacttgcat father father aggggtaga father tgctcagaat tgcagaaaaa gaaaactgga aaatatagta gaactagagc aagatttag tcatttgaaa gatgaaaaag aaaaattgct caaagaaaaa ggagaaaatg acaaaagcct tcacctactg aaaaaacaac tcagcacctt atatctcga gttttcagca tgctacgtga tgaagatgga aaaccttatt ctcctagtga atactccctg 1920s tgttttcctt gttcccaaaa gtaagaagcc agatgttaag aaaaactaga tttaggagga tttgaccttt tctgagctag tttttttgta ctattatact aaaagctcct actgtgatgt gaaatgctca tactttataa gtaattctat gcaaaatcat agccaaaact agtatagaaa ataatacgaa actttaaaaa gcattggagt gtcagtatgt tgaatcagta gtttcacttt 2160 aactgtaaac aatttcttag gacaccattt gggctagttt ctgtgtaagt gtaaatacta 2220 caaaaactta tttatactgt tcttatgtca tttgttatat tcatagattt atatgatgat 2280 atgacatctg gctaaaaaga aattattgca aaactaacca ctatgtactt ttttataaat 2340 actgtatgga caaaaaatgg cattttttat attaaattgt ttagctctgg caaaaaaaaa 2400 aaatttaag agctggtact aataaaggat tattatgact gttaaa 2446 <210> 8 <211> 605 <212> PRT <213> Homo sapiens <400> 8 Met Met Asp Leu Glu Leu Pro Pro Pro Gly Leu Pro Ser Gln Gln Asp 1 5 10 15 Met Asp Leu Ile Asp Ile Leu Trp Arg Gln Asp Ile Asp Leu Gly Val 20 25 30 Ser Arg Glu Val Phe Asp Phe Ser Gln Arg Arg Lys Glu Tyr Glu Leu 35 40 45 Glu Lys Gln Lys Lys Leu Glu Lys Glu Arg Gln Glu Gln Leu Gln Lys 50 55 60 Glu Gln Glu Lys Ala Phe Phe Ala Gln Leu Gln Leu Asp Glu Glu Thr 65 70 75 80 Gly Glu Phe Leu Pro Ile Gln Pro Ala Gln His Ile Gln Ser Glu Thr 85 90 95 Ser Gly Ser Ala Asn Tyr Ser Gln Val Ala His Ile Pro Lys Ser Asp 100 105 110 Ala Leu Tyr Phe Asp Asp Cys Met Gln Leu Leu Ala Gln Thr Phe Pro 115 120 125 Phe Val Asp Asp Asn Glu Val Ser Ser Ala Thr Phe Gln Ser Leu Val 130 135 140 Pro Asp Ile Pro Gly His Ile Glu Ser Pro Val Phe Ile Ala Thr Asn 145 150 155 160 Gln Ala Gln Ser Pro Glu Thr Ser Val Ala Gln Val Ala Pro Val Asp 165 170 175 Leu Asp Gly Met Gln Gln Asp Ile Glu Gln Val Trp Glu Glu Leu Leu 180 185 190 Ser Ile Pro Glu Leu Gln Cys Leu Asn Ile Glu Asn Asp Lys Leu Val 195 200 205 Glu Thr Thr Met Val Pro Ser Pro Glu Ala Lys Leu Thr Glu Val Asp 210 215 220 Asn Tyr His Phe Tyr Ser Ser Ile Pro Ser Met Glu Lys Glu Val Gly 225 230 235 240 Asn Cys Ser Pro His Phe Leu Asn Ala Phe Glu Asp Ser Phe Ser Ser 245 250 255 Ile Leu Ser Thr Glu Asp Pro Asn Gln Leu Thr Val Asn Ser Leu Asn 260 265 270 Ser Asp Ala Thr Val Asn Thr Asp Phe Gly Asp Glu Phe Tyr Ser Ala 275 280 285 Phe Ile Ala Glu Pro Ser Ile Ser Asn Ser Met Pro Ser Pro Ala Thr 290 295 300 Leu Ser His Ser Leu Ser Glu Leu Leu Asn Gly Pro Ile Asp Val Ser 305 310 315 320 Asp Leu Ser Leu Cys Lys Ala Phe Asn Gln Asn His Pro Glu Ser Thr 325 330 335 Ala Glu Phe Asn Asp Ser Asp Ser Gly Ile Ser Leu Asn Thr Ser Pro 340 345 350 Ser Val Ala Ser Pro Glu His Ser Val Glu Ser Ser Ser Tyr Gly Asp 355 360 365 Thr Leu Leu Gly Leu Ser Asp Ser Glu Val Glu Glu Leu Asp Ser Ala 370 375 380 Pro Gly Ser Val Lys Gln Asn Gly Pro Lys Thr Pro Val His Ser Ser 385 390 395 400 Gly Asp Met Val Gln Pro Leu Ser Pro Ser Gln Gly Gln Ser Thr His 405 410 415 Val His Asp Ala Gln Cys Glu Asn Thr Pro Glu Lys Glu Leu Pro Val 420 425 430 Ser Pro Gly His Arg Lys Thr Pro Phe Thr Lys Asp Lys His Ser Ser 435 440 445 Arg Leu Glu Ala His Leu Thr Arg Asp Glu Leu Arg Ala Lys Ala Leu 450 455 460 His Ile Pro Phe Pro Val Glu Lys Ile Ile Asn Leu Pro Val Val Asp 465 470 475 480 Phe Asn Glu Met Met Ser Lys Glu Gln Phe Asn Glu Ala Gln Leu Ala 485 490 495 Leu Ile Arg Asp Ile Arg Arg Arg Gly Lys Asn Lys Val Ala Ala Gln 500 505 510 Asn Cys Arg Lys Arg Lys Leu Glu Asn Ile Val Glu Leu Glu Gln Asp 515 520 525 Leu Asp His Leu Lys Asp Glu Lys Glu Lys Leu Leu Lys Glu Lys Gly 530 535 540 Glu Asn Asp Lys Ser Leu His Leu Leu Lys Lys Gln Leu Ser Thr Leu 545 550 555 560 Tyr Leu Glu Val Phe Ser Met Leu Arg Asp Glu Asp Gly Lys Pro Tyr 565 570 575 Ser Pro Ser Glu Tyr Ser Leu Gln Gln Thr Arg Asp Gly Asn Val Phe 580 585 590 Leu Val Pro Lys Ser Lys Lys Pro Asp Val Lys Lys Asn 595 600 605 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 9 tcgatgtgac cgggaatatc agg 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 10 tgatttagac ggtatgcaac agg 23 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 11 aagtacaaag catctgattt ggg 23 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 12 agcatctgat ttgggaatgt ggg 23 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 13 tggatttgat tgacatactt tgg 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 14 gcttcttact tttgggaaca agg 23 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 15 tttgattgac atactttgga ggcaa 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 16 ttttccttgt tcccaaaagt aagaa 25 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 17 caagatatag atcttggagt aag 23 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 18 aagatataga tcttggagta ag 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 19 gatatagatc ttggagtaag 20 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 20 tatagatctt ggagtaag 18 <210> 21 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 21 atagatcttg gagtaag 17 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 22 tggaggcaag atatagatct tgg 23 <210> 23 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> ssDNA template <400> 23 ttaaaaaaca tgagctctct ccttcctttt tttgtcttaa acataggaca tggatttgat 60 tgacatactt tggaggcaag atatagatct tggagtaagt ggagaagtat ttgacttcag 120 tcagcgacgg aaagagtatg agctggaaaa acagaaaaaa cttgaaaagg aaagacaaga 180 acaactccaa aaggagcaag 200 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 24 tcgatgtgac cgggaatatc agg 23 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Guide RNA <400> 25 tgatttagac ggtatgcaac agg 23

Claims

1. A clustered regularly interspaced short palindromic repeats (CRISPR) system for use as a pharmaceutical, comprising: (a) a guide RNA (gRNA) comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a CRISPR-associated endonuclease.

2. 2. The CRISPR system for use of claim 1, wherein the gRNA is complementary to a target sequence in exon 2, exon 4, and / or exon 5 of the NRF2 gene.

3. 3. The CRISPR system for use according to claim 1 or 2, wherein the DNA binding domain comprises the nucleic acid sequence of SEQ ID NO: 2 or a biologically active fragment thereof.

4. 4. The CRISPR system for use according to any one of claims 1 to 3, wherein the gRNA comprises a trans-activating small RNA (tracrRNA) and a CRISPR RNA (crRNA).

5. 5. The CRISPR system for use according to any one of claims 1 to 4, wherein the gRNA is a single gRNA.

6. 6. The CRISPR system of any one of claims 1 to 5 for use in the treatment of cancer.

7. 7. The CRISPR system for use according to claim 6, wherein the cancer is resistant to one or more chemotherapeutic agents.

8. 8. The CRISPR system for use of claim 6 or 7, wherein the cancer is selected from the group consisting of lung cancer, melanoma, esophageal squamous cell carcinoma (ESC), head and neck squamous cell carcinoma (HNSCC), and breast cancer.

9. 9. The CRISPR system for use according to claim 8, wherein the lung cancer is non-small cell lung cancer (NSCLC).

10. 10. The CRISPR system for use according to claim 9, wherein the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma.

11. 11. The CRISPR system for use according to any one of claims 1 to 10, further comprising one or more chemotherapeutic agents.

12. 12. The CRISPR system for use of claim 11, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof.

13. 13. The CRISPR system for use according to any one of claims 1 to 12, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

14. 14. The CRISPR system for use according to claim 13, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

15. A ribonucleoprotein (RNP) complex for use as a pharmaceutical, comprising: (a) a gRNA comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in an NRF2 gene; and (b) a CRISPR-associated endonuclease.

16. 16. The RNP complex for use according to claim 15, wherein the gRNA is complementary to a target sequence in exon 2, exon 4, and / or exon 5 of the NRF2 gene.

17. 17. The RNP complex for use according to claim 15 or 16, wherein the DNA binding domain comprises the nucleic acid sequence of SEQ ID NO: 2 or a biologically active fragment thereof.

18. 18. The RNP complex for use according to any one of claims 15 to 17, wherein the gRNA comprises a tracrRNA and a crRNA.

19. 19. The RNP complex for use according to any one of claims 15 to 18, wherein the gRNA is a single gRNA.

20. 20. An RNP complex according to any one of claims 15 to 19 for use in the treatment of cancer.

21. 21. The RNP complex for use according to claim 20, wherein the cancer is resistant to one or more chemotherapeutic agents.

22. 22. The RNP complex for use according to claim 20 or 21, wherein the cancer is selected from the group consisting of lung cancer, melanoma, ESC, HNSCC, and breast cancer.

23. 23. The RNP complex for use according to claim 22, wherein the lung cancer is NSCLC.

24. 24. The RNP complex for use according to claim 23, wherein the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma.

25. 25. The RNP complex for use according to any one of claims 15 to 24, further comprising one or more chemotherapeutic agents.

26. 26. The RNP complex for use according to claim 25, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof.

27. 27. The RNP complex for use according to any one of claims 15 to 26, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

28. 28. The RNP complex for use according to claim 27, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

29. 1. A method for reducing the expression or activity of NRF2 in a cell, comprising introducing into the cell (a) one or more DNA sequences encoding one or more gRNAs complementary to one or more target sequences in the NRF2 gene, and (b) a nucleic acid sequence encoding a CRISPR-associated endonuclease, whereby the one or more gRNAs hybridize to the NRF2 gene and the CRISPR-associated endonuclease cleaves the NRF2 gene, and the expression or activity of NRF2 is reduced in the cell compared to a cell into which the one or more DNA sequences encoding the one or more gRNAs and the nucleic acid sequence encoding the CRISPR-associated endonuclease have not been introduced.

30. 30. The method of claim 29, wherein the one or more gRNAs are complementary to one or more target sequences in exon 2, exon 4, and / or exon 5 of the NRF2 gene.

31. 31. The method of Claim 29 or 30, wherein the one or more gRNAs comprise a tracrRNA and a crRNA.

32. 32. The method of any one of Claims 29 to 31, wherein the one or more gRNAs are one or more single gRNAs.

33. 33. The method of any one of claims 29 to 32, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

34. 34. The method of claim 33, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

35. 35. The method of any one of claims 29 to 34, wherein the expression of one or more alleles of the NRF2 gene is reduced in the cell.

36. 36. The method of any one of claims 29 to 35, wherein NRF2 activity is reduced in the cell.

37. 36. The method of any one of claims 29 to 35, wherein NRF2 expression or activity is not completely eliminated in the cell.

38. 36. The method of any one of claims 29 to 35, wherein NRF2 expression or activity is completely eliminated in the cell.

39. 39. The method of any one of claims 29 to 38, wherein the cell is a eukaryotic cell.

40. 40. The method of claim 39, wherein the cell is a mammalian cell.

41. 41. The method of claim 40, wherein the mammalian cell is a human cell.

42. 42. The method of any one of claims 29 to 41, wherein the cell is a cancer cell.

43. 43. The method of claim 42, wherein the cancer cells are selected from the group consisting of lung cancer cells, melanoma cells, ESC cells, HNSCC cells, and breast cancer cells.

44. 44. The method of claim 43, wherein the lung cancer cells are NSCLC cells.

45. 45. The method of claim 44, wherein the NSCLC cells are adenocarcinoma cells, squamous cell carcinoma cells, or large cell carcinoma cells.

46. 46. ​​A cell comprising a mutant NRF2 gene produced by the method of any one of claims 29 to 45.

47. A method for reducing the expression or activity of NRF2 in a cell, comprising introducing into the cell (a) one or more gRNAs complementary to one or more target sequences in the NRF2 gene, and (b) a CRISPR-associated endonuclease, whereby the one or more gRNAs hybridize to the NRF2 gene and the CRISPR-associated endonuclease cleaves the NRF2 gene, and the expression or activity of NRF2 is reduced in the cell compared to a cell in which the one or more gRNAs and CRISPR-associated endonuclease have not been introduced.

48. 48. The method of claim 47, wherein the one or more gRNAs are complementary to one or more target sequences in exon 2, exon 4, and / or exon 5 of the NRF2 gene.

49. 49. The method of Claim 47 or 48, wherein the one or more gRNAs comprise a tracrRNA and a crRNA.

50. 50. The method of any one of Claims 47 to 49, wherein the one or more gRNAs are one or more single gRNAs.

51. 51. The method of any one of claims 47 to 50, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

52. 52. The method of claim 51, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

53. 53. The method of any one of claims 47 to 52, wherein the expression of one or more alleles of the NRF2 gene is reduced in the cell.

54. 54. The method of any one of claims 47 to 53, wherein NRF2 activity is reduced in the cell.

55. 54. The method of any one of claims 47 to 53, wherein NRF2 expression or activity is not completely eliminated in the cell.

56. 54. The method of any one of claims 47 to 53, wherein NRF2 expression or activity is completely eliminated in the cell.

57. 57. The method of any one of claims 47 to 56, wherein the cell is a eukaryotic cell.

58. 58. The method of claim 57, wherein the cell is a mammalian cell.

59. 59. The method of claim 58, wherein the mammalian cell is a human cell.

60. 60. The method of any one of claims 47 to 59, wherein the cell is a cancer cell.

61. 61. The method of claim 60, wherein the cancer cells are selected from the group consisting of lung cancer cells, melanoma cells, ESC cells, HNSCC cells, and breast cancer cells.

62. 62. The method of claim 61, wherein the lung cancer cells are NSCLC cells.

63. 63. The method of claim 62, wherein the NSCLC cells are adenocarcinoma cells, squamous cell carcinoma cells, or large cell carcinoma cells.

64. 64. A cell comprising a mutant NRF2 gene produced by the method of any one of claims 47 to 63.

65. A gRNA comprising a DNA-binding domain and a CRISPR-associated endonuclease protein-binding domain, wherein the DNA-binding domain is complementary to a target sequence in an NRF2 gene, and the gRNA does not comprise the nucleic acid sequence of SEQ ID NO:

4.

66. 66. The gRNA of Claim 65, wherein the gRNA is complementary to a target sequence in exon 2, exon 4, and / or exon 5 of the NRF2 gene.

67. 67. The gRNA of Claim 65 or 66, wherein the DNA-binding domain comprises the nucleic acid sequence of SEQ ID NO: 2, or a biologically active fragment thereof.

68. 68. The gRNA of any one of Claims 65 to 67, comprising a tracrRNA and a crRNA.

69. 69. The gRNA of any one of Claims 65 to 68, wherein the gRNA is a single gRNA.

70. 70. A pharmaceutical composition comprising the gRNA of any one of Claims 65 to 69.

71. 71. The pharmaceutical composition of Claim 70, further comprising a CRISPR-associated endonuclease.

72. 72. The pharmaceutical composition of claim 71, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

73. 73. The pharmaceutical composition of claim 72, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

74. 70. An RNP complex comprising the gRNA of any one of Claims 65 to 69 and a CRISPR-associated endonuclease.

75. 75. The RNP complex of Claim 74, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

76. 76. The RNP complex of claim 75, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

77. 77. A pharmaceutical composition comprising an RNP complex according to any one of claims 74 to 76.

78. 70. A DNA sequence encoding the gRNA of any one of Claims 65 to 69, or a biologically active fragment thereof.

79. 79. The DNA sequence of Claim 78, wherein the biologically active fragment is tracrRNA or crRNA.

80. 80. The DNA sequence of claim 79, wherein the DNA sequence comprises the nucleic acid sequence of SEQ ID NO:

1.

81. 81. The DNA sequence of Claim 80, wherein the biologically active fragment is a crRNA comprising the nucleic acid sequence of SEQ ID NO:

1.

82. 82. A vector comprising the DNA sequence of any one of claims 78 to 81.

83. 83. The vector of claim 82, wherein the vector is an adeno-associated virus (AAV) vector.

84. 84. The vector of Claim 82 or 83, further comprising a nucleic acid sequence encoding a CRISPR-associated endonuclease protein.

85. 85. The vector of claim 84, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

86. 86. The vector of claim 85, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

87. 87. A pharmaceutical composition comprising a DNA sequence according to any one of claims 78 to 81 or a vector according to any one of claims 82 to 86.

88. 82. A pharmaceutical composition comprising the DNA sequence of any one of Claims 78 to 81, further comprising a nucleic acid sequence encoding a CRISPR-associated endonuclease protein.

89. 89. The pharmaceutical composition of Claim 88, wherein the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease.

90. 90. The pharmaceutical composition of claim 89, wherein the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.

91. 100. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of any one of claims 70-73, 77, or 87-90.

92. 92. The method of claim 91, wherein the cancer is resistant to one or more chemotherapeutic agents.

93. 93. The method of claim 91 or 92, wherein the cancer is selected from the group consisting of lung cancer, melanoma, ESC, HNSCC, and breast cancer.

94. 94. The method of claim 93, wherein the lung cancer is NSCLC.

95. 95. The method of claim 94, wherein the NSCLC is adenocarcinoma, squamous cell carcinoma, or large cell carcinoma.

96. 96. The method of any one of Claims 91 to 95, further comprising administering to the subject one or more chemotherapeutic agents.

97. 97. The method of claim 96, wherein the one or more chemotherapeutic agents are selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof.

98. 98. The method of any one of claims 91-97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce proliferation of cells of the cancer compared to cancer cells not treated with the pharmaceutical composition.

99. 98. The method of any one of claims 91 to 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to a tumor not treated with the pharmaceutical composition.

100. 98. The method of claim 96 or 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce proliferation of cells of the cancer compared to cancer cells that have been treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition.

101. 98. The method of claim 96 or 97, wherein the pharmaceutical composition is administered in an amount sufficient to reduce tumor growth compared to a tumor that has been treated with at least one chemotherapeutic agent but not treated with the pharmaceutical composition.

102. 102. The method of any one of claims 91 to 101, wherein the subject is a human.

Images