Nucleic acid combination, kit and detection method for detecting anemone nepovirus a in codonopsis pilosula
The PAE-RT-qLAMP method addresses the limitations of existing detection technologies by enabling rapid, cost-effective, and sensitive detection of Codonopsis nipovirus A without antibodies, suitable for field applications.
Patent Information
- Application Number
- JP2025044461
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-25
- Filing Date
- 2025-03-19
- Publication Date
- 2025-10-07
- Estimated Expiration
- 2045-03-19
AI Technical Summary
Current detection methods for Codonopsis nipovirus A, such as ELISA and RT-PCR, rely on antibodies and require specialized technicians, leading to high costs and limited applicability in field settings, and there is a lack of specific antibodies and primer sequences for this virus pathogen.
A nucleic acid combination using physical adsorption enrichment (PAE) followed by RT-qLAMP for virus particle concentration and amplification, eliminating the need for antibodies and RNA extraction, enabling rapid, simple, and quantitative detection.
The method provides highly sensitive and specific detection of Codonopsis nipovirus A, suitable for field use, with reduced costs and operational complexity, supporting rapid screening and real-time monitoring of pathogens.
Smart Images

Figure 2025148292000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to the technical field of detecting pathogens in traditional Chinese medicine materials, and particularly to a nucleic acid combination, kit and detection method for detecting Codonopsis nipovirus A in Codonopsis nipoides. [Background technology]
[0002] Codonopsis tangshen (Codonopsis pilosida (Franch.) Nannf.), C. pilosula Nannf. var. modesta (Nannf.) LTShen, or C. tangshen Oliv. (Campanulaceae) is the dried root of this plant, a widely used medicinal material in China. Codonopsis tangshen (Codonopsis pilosida (Franch.) Nannf.), a simple flowering plant of the Campanulaceae family, has the effects of replenishing qi and strengthening the spleen and lungs. It is commonly used to treat weakened spleen and lungs, shortness of breath, palpitations, internal fever, and thirst. Commonly known as "little ginseng," it was one of the earliest well-known medicinal materials cultivated and exported on a large scale in China. In recent years, with continued deepening and improvement in research on its chemical composition and mechanism of action, the medicinal properties of Codonopsis pilosida have been further developed, and its economic value has also increased significantly.
[0003] Gansu Province is one of the important producers of traditional Chinese medicines in China, with abundant genetic resources and a long history of cultivating authentic medicinal herbs such as Codonopsis glabra, with an average cultivation area accounting for more than 90% of China's total in the past five years. However, due to the continuous expansion of the scale and area of artificial plantings and continuous planting, the Codonopsis glabra production area has deteriorated, the seed quality has declined, and diseases, particularly those caused by continuous cropping, have become prevalent, resulting in reduced medicinal yields and quality, causing serious economic losses to farmers and becoming a bottleneck restricting the development of high-quality traditional Chinese medicines and revitalizing rural areas.
[0004] Currently, research on ginseng root rot has focused primarily on fungal and bacterial pathogens, such as root rot and soft rot, with few reports on viral pathogens. In fact, viral diseases are extremely serious plant diseases that are difficult to control. Once infected, plant development slows, and growth, photosynthesis, and physiological, biochemical, and metabolic processes are all inhibited. This leads to degeneration of the plant, weakening its resistance and immune system, making it more susceptible to bacterial and fungal infections. In severe cases, the plant may even become unyielding.
[0005] From 2021 to 2023, the inventors conducted systematic investigations, detection, and analysis of viral diseases in major Anemone nepovirus-producing areas in Gansu Province, including Weiyuan, Jiang, Min, Lintao, Yongdeng, and Yuzhong counties. Among 61 samples from different geographical locations, 41 showed symptoms suspected to be viral diseases, such as yellowing, mottling, and mosaic, resulting in a positive rate of 67.2%. Small RNA sequencing (sRNA-seq) identified Anemone nepovirus A (AVA) in some samples, marking the first time that an AVA virus pathogen has been found to infect Anemone nepovirus. Reverse transcription-polymerase chain reaction (RT-PCR) analysis of positive field samples and observation of plant morphology and growth showed that when AVA virus infected C. chinensis, symptoms such as mosaic, mottling, yellowing, and necrotic spots appeared on the leaves, and the plantlets became smaller. It is therefore speculated that AVA virus is a harmful pathogen of C. chinensis, which may inhibit the growth, development, metabolism, and quality formation of C. chinensis. Therefore, there is an urgent need to develop corresponding detection and prevention technologies.
[0006] Currently, there are no relevant reports on the C. chinensis virus pathogen and its gene sequence, specific antibodies and primer sequences for nucleic acid amplification are not available, and immunological and molecular detection techniques commonly used for the detection and diagnosis of known pathogens, such as enzyme-linked immunosorbent assay (ELISA) and RT-PCR, cannot be applied to the C. chinensis virus pathogen.
[0007] Furthermore, common techniques such as ELISA and immunocapture reverse transcription polymerase chain reaction (IC-RT-PCR) rely on antibodies for specificity and have the problem of high detection costs. They also require experienced personnel with specialized operating skills to complete them, which limits their scope of use and prevents them from meeting the actual needs of field and county-level agricultural technology extension departments for disease detection, diagnosis, prevention and control.
[0008] In view of the above, the present invention is proposed. Summary of the Invention [Problem to be solved by the invention]
[0009] In order to solve the above problems, the object of the present invention is to provide a nucleic acid combination, a kit and a detection method for detecting Codonopsis nipovirus A in Codonopsis nipoides. [Means for solving the problem]
[0010] Existing ELISA and its derivative technologies rely on antibodies and are prone to false negative results due to limited sensitivity. RT-PCR and its derivative nucleic acid amplification technologies require high-quality RNA extraction, are difficult to detect, and require specialized technicians with laboratory experience to operate, which has limited their popularity and application to some extent. Therefore, there is an urgent need to develop simple, highly sensitive, and rapid technologies and methods for detecting new pathogens.
[0011] The inventors have improved the physical adsorption enrichment (PAE) method by first enriching virus particles in the test sample, and then combining the enriched virus particles with RT-qLAMP (Reverse Transcription-Quantitative Loop-mediated Isothermal Amplification) for amplification and detection. The entire process does not rely on antibodies or require extraction of viral nucleic acid RNA, achieving the goal of rapid, simple, and quantitative pathogen detection. The specific method involves first concentrating and purifying virus particles in the test sample using a pretreatment device to increase the amount of virus per unit volume. Then, the virus particles in the test sample are concentrated by physically adsorbing them to the wall of a reaction vessel (e.g., a PCR tube). Reverse transcription (RT) is then performed using the accumulated virus particles and a reverse primer specific to the screened target gene to synthesize the first strand of cDNA. The nucleic acid is then amplified using real-time fluorescent quantitative DNA loop-mediated isothermal amplification (qLAMP). The amplification product is monitored in real time based on the quantitative peak time, allowing accurate determination of the viral infection status in the sample. This successfully established a PAE-RT-qLAMP technology and method for specifically detecting P. nipovirus A, a new pathogen of Codonopsis nipovirus A, without the need for antibodies or nucleic acid extraction. Furthermore, quantitative polymerase chain reaction (qPCR) and polymerase chain reaction (PCR) methods and kits for detecting P. nipovirus A, a new pathogen of Codonopsis nipovirus A, have also been developed.
[0012] The present invention is realized as follows.
[0013] Nepovirus A is an unclassified virus belonging to the genus Nepovirus in the subfamily Comovirinae of the family Secoviridae. Nepovirus viruses are widely distributed in temperate regions worldwide, and many members of this genus have a wide range of natural and experimental hosts, including annual and perennial herbaceous and woody plants. One-third of nepoviruses are persistently transmitted by soil-borne nematodes of the genera Amphilithium and Amphilithium. Although the mediators for many nepoviruses are currently unknown, all viruses can be transmitted by mechanical inoculation. Many nepoviruses are capable of long-distance transmission via seeds, making them an important class of seed-borne viruses in plants.
[0014] From 2023 to 2024, the inventors conducted germination culture and virus RT-PCR detection of commercial seeds of C. sieboldii produced in various geographical regions across China. The results showed that 12 out of 19 batches of seeds germinated, and AVA virus was detected in 6 out of 12 batches of samples, with the AVA infection rate of seeds reaching 50.0%. It is speculated that AVA may be a seed-borne virus of C. sieboldii and may be transmitted and spread long distances through C. sieboldii seeds, posing a high risk of harm and requiring great attention and caution from seed quality supervision and testing departments.
[0015] AVA virus members have a single-stranded, bipartite RNA genome consisting of two linear sense RNAs, RNA1 and RNA2. Each RNA encodes a polyprotein, which is processed to generate functional gene products. The protein encoded by RNA1 is involved in viral replication, while the protein encoded by RNA2 is the coat protein (CP) and cell-to-cell movement protein. RNA2 produces a single open reading frame (ORF) that encodes the polyprotein precursor and is cleaved by a protease generated by RNA1 to generate the coat protein, mobile protein, and N-terminal protein. The coat protein (CP) of Nepoviruses consists of a single polypeptide ranging in size from 52 to 60 kDa.
[0016] In a first aspect, the present invention provides a LAMP nucleic acid combination for detecting Anemone nepovirus A (abbreviated as AVA) in Codonopsis crohnii, comprising a reverse transcription primer shown in SEQ ID NO: 1, a LAMP forward outer primer F3 shown in SEQ ID NO: 2, a LAMP reverse outer primer B3 shown in SEQ ID NO: 3, a LAMP forward inner primer FIP shown in SEQ ID NO: 4, a LAMP reverse inner primer BIP shown in SEQ ID NO: 5, and a LAMP forward loop primer LF shown in SEQ ID NO: 6.
[0017] The nucleotide sequences of the nucleic acid combinations are specifically as follows: SEQ ID NO:1: Reverse transcription primer: 5'-GTAGGACCATACAACTTCAGGC-3', SEQ ID NO: 2: F3: 5'-GTGCGCATACTATGTATGGT-3', SEQ ID NO: 3: B3: 5'-ACAACTTCAGGCCTGGTT-3', SEQ ID NO: 4: FIP: 5'-TCACCCGCAACATATTGGAAGACGAGGACCTGTTCACTCTG-3', SEQ ID NO: 5: BIP: 5'-CACCTCTGGTGATTCTGGCTTTGCCCTTGCTTGAGAGATG-3', SEQ ID NO: 6: LF: 5'-TGTAGCGGCTGGGTAACCA-3'.
[0018] After extensive primer screening and optimization over a long period of time, the present inventors finally obtained the above primer composition, which can detect Codonopsis ginseng AVA virus pathogen in target samples with high specificity and sensitivity.
[0019] In a second aspect, the present invention provides a nucleic acid combination for detecting Coprinus nipovirus A in Coprinus nipoides, comprising a reverse transcription primer shown in SEQ ID NO: 1, an upstream primer shown in SEQ ID NO: 7, and a downstream primer shown in SEQ ID NO: 8.
[0020] The upstream and downstream primers of the nucleic acid combination are qPCR detection primers; in other embodiments, the upstream and downstream primers can also be used as conventional PCR detection primers. SEQ ID NO: 7: GTTCCTCGTGTTCTTTGCGTTGAC, SEQ ID NO: 8: GATAACCGGGCAGGGAATGTAGC.
[0021] In a third aspect, the present invention provides a nucleic acid combination for detecting Codonopsis nipovirus A in Codonopsis nipoides, comprising a reverse transcription primer set forth in SEQ ID NO: 1, an upstream primer set forth in SEQ ID NO: 9, and a downstream primer set forth in SEQ ID NO: 10. The primers can be used as conventional PCR detection primers. SEQ ID NO: 9: GAGGTATTCTCGCTTGCGGA, SEQ ID NO: 10: ATTCGACCTCCCCGGACATA.
[0022] In a fourth aspect, the present invention provides a kit for detecting P. nipovirus A in C. mongolica, comprising at least one of a LAMP nucleic acid combination for detecting P. nipovirus A in C. mongolica and a nucleic acid combination for detecting P. nipovirus A in C. mongolica.
[0023] When the kit contains the above three nucleic acid combinations simultaneously, the kit can simultaneously have the functions of LAMP amplification, qPCR detection, and PCR detection; when the kit contains only a LAMP nucleic acid combination for detecting Pseudomonas nipovirus A in Pseudomonas nipovirus, the kit has the function of LAMP amplification (including RT-qLAMP and RT-LAMP amplification); when the kit contains only a nucleic acid combination for qPCR detection for detecting Pseudomonas nipovirus A in Pseudomonas nipovirus, the kit has the function of RT-qPCR detection; and when the kit contains only a nucleic acid combination for PCR detection for detecting Pseudomonas nipovirus A in Pseudomonas nipovirus, the kit has the function of RT-PCR detection.
[0024] In a preferred embodiment of the present invention, the above-mentioned kit further includes a reverse transcription reagent, which includes a reverse transcriptase, a reverse transcriptase buffer, an RNase (ribonuclease) inhibitor, a dNTP (deoxyribonucleoside triphosphate) mixture, and water.
[0025] Reverse transcriptases include, but are not limited to, AMV reverse transcriptase or M-MLV reverse transcriptase, as well as mutants and conjugates of the above reverse transcriptases.
[0026] The RNase inhibitor can be DEPC (Diethyl Pyrocarbonate), guanidine isothiocyanate, or ribonucleoside-vanadyl complex.
[0027] In a preferred embodiment of the present invention, when the kit is used for LAMP amplification, the kit further comprises LAMP amplification reagents, which include dNTPs, ThermoPol reaction buffer, Mg ions, DNA polymerase, LAMP fluorescent dye, and water.
[0028] The DNA polymerase is selected from, for example, Bst DNA polymerase. Furthermore, in other embodiments, the type of DNA polymerase can be selected as desired.
[0029] LAMP fluorescent dyes include, but are not limited to, SYBR series dyes, including, but not limited to, Cyber Green I, Cyber Green II, Cyber Gold, and Cyber Safe.
[0030] In a preferred embodiment of the present invention, when the kit is used to perform a fluorescent quantitative qPCR reaction, the kit further comprises a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix. The qPCR fluorescent dye includes, but is not limited to, the SYBR series dyes, ROX, and EvaGreen. The SYBR series dyes include, but are not limited to, CyberGreen I, CyberGreen II, CyberGold, and CyberSafe.
[0031] In a preferred embodiment of the present invention, when the kit is used to carry out a PCR reaction, the kit further comprises a PCR reaction premix.
[0032] In a preferred embodiment of the present invention, the PCR reaction premix further comprises a DNA polymerase, a PCR buffer, dNTPs, and water.
[0033] In a preferred embodiment of the present invention, the kit further includes a positive control and a negative control. The positive control is a positive standard for Aspergillus oryzae AVA virus, specifically the CP gene of Aspergillus oryzae virus A. The negative control is water.
[0034] The sequence of the positive standard of the AVACP gene of Codonopsis ginseng is as follows:
[0035]
[0036] In a preferred embodiment of the present invention, the kit further includes a physical adsorption / accumulation device for tissue separation of a test sample, the physical adsorption / accumulation device including a filter and an ultrafiltration tube, and the filter is provided with a hydrophilic membrane filter.
[0037] In use, Codonopsis carota tissue (roots, stems, leaves, or seeds) is first ground in PBS buffer, the ground solution is centrifuged, and the supernatant is collected as a crude tissue extract. The crude tissue extract is then filtered to remove cellular debris and other large particle aggregates for clarification, and further concentrated through an ultrafiltration tube to increase the amount of virus per unit volume. A concentrated solution of infected tissue is obtained, and the concentrated infected tissue is then cultured. The concentrated infected tissue is then discarded and washed to obtain a test sample. In a preferred embodiment of the present invention, the washed test sample is first denatured and then used for reverse transcription.
[0038] The physical adsorption and enrichment (PAE)-RT-qLAMP kit provided by the present invention combines the physical adsorption and enrichment PAE of target virus particles with the nucleic acid RT-qLAMP method. It does not rely on antibodies for virus specificity, does not require nucleic acid RNA extraction, and has the technical advantages of being simple to operate, highly specific, highly sensitive, simple to operate, and low cost. The detection results can be analyzed by computer and analysis software without the need for nucleic acid gel electrophoresis, saving detection time, improving detection efficiency, and improving detection sensitivity. It is suitable for rapid screening and real-time monitoring of pathogens, and provides technical support for quality monitoring of Codonopsis ginseng seeds, tissue culture detoxification of viral pathogens, field management, and comprehensive prevention and control.
[0039] In a fifth aspect, the present invention provides a method for producing a pharmaceutical composition comprising: The present invention further provides a method for detecting japonica nipovirus A in Codonopsis cernua, which comprises the steps of: subjecting a test sample to a reverse transcription reaction using the above-mentioned LAMP nucleic acid combination or the reverse transcription primer in the above-mentioned kit to obtain cDNA; and then subjecting the cDNA to a LAMP reaction using the above-mentioned LAMP nucleic acid combination under reaction conditions of 58 to 66°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
[0040] The above reaction conditions enable efficient amplification of the AVACP gene of Codonopsis ginseng. The LAMP reaction conditions are, for example, 58°C, 59°C, 60°C, 61°C, 62°C, 62.5°C, 63°C, 64°C, 65°C, or 66°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
[0041] The amplification time during the LAMP reaction is one of the following time points: 30 to 60 minutes, 40 to 80 minutes, 50 to 90 minutes, 60 to 80 minutes, or 70 to 100 minutes.
[0042] In a preferred embodiment of the present invention, the LAMP reaction is carried out at 60 to 62°C for 30 to 100 minutes and at 80°C for 5 to 10 minutes.
[0043] In the LAMP reaction, qLAMP amplification can be performed using a device such as a real-time fluorescent quantitative PCR thermal cycler. If such a device is not available, a regular LAMP detection reaction can also be performed using a constant temperature device such as a water bath, a constant temperature incubator, or a regular PCR thermal cycler.
[0044] In a preferred embodiment of the present invention, the LAMP reaction system comprises a LAMP reverse outer primer B3 at a final concentration of 0.2 to 0.4 μM, a LAMP forward outer primer F3 at a final concentration of 0.2 to 0.4 μM, a LAMP forward inner primer FIP at a final concentration of 1.5 to 1.7 μM, a LAMP reverse inner primer BIP at a final concentration of 1.5 to 1.7 μM, and a LAMP forward loop primer LF at a final concentration of 0.3 to 0.5 μM.
[0045] In a preferred embodiment of the present invention, the LAMP reaction system further comprises Mg ions at a final concentration of 8.0 to 12.5 mM, a dNTP mixture at a final concentration of 1.4 to 2.8 mM, and a DNA polymerase at a final concentration of 0.32 to 0.64 U.
[0046] In a preferred embodiment of the present invention, the method further includes preparing a test sample before performing the reverse transcription reaction, and the test sample is prepared by crudely extracting the test Aspergillus oryzae material with a tissue extract, filtering the sample, transferring the collected filtrate to an ultrafiltration tube, concentrating it, culturing it, and washing it.
[0047] In a preferred embodiment of the present invention, the washed test sample is subjected to an initial denaturation before use in a reverse transcription reaction, and the initial denaturation conditions are 85 to 95°C for 1 to 5 minutes in an ice bath.
[0048] The PAE-qRT-LAMP kit and detection method overcome the drawbacks of existing techniques, such as the need to prepare or purchase expensive antibodies or extract high-quality nucleic acids for detection, which are costly, time-consuming, and labor-intensive, and require extensive training for detection personnel. Specifically, to purify the virus, a crude extract from the test sample is first filtered and concentrated using a filtration and concentration device. The virus particles are then physically adsorbed to the wall of the PCR tube. The first strand of cDNA is synthesized by reverse transcription-reverse transcription using selected AVA gene-specific primers. The amplified product is then directly analyzed using a computer and analytical software, taking advantage of the highly sensitive fluorometric technique. The entire detection process does not rely on virus-specific antibodies or the need for tedious RNA extraction, lowering the detection threshold and difficulty. Because qLAMP amplification does not require additional reagents, the risk of contamination is reduced, increasing its value and broadening its application prospects.
[0049] Detection of Codonopsis nipovirus A in Codonopsis nipoides by a combination of LAMP nucleic acids can be qualitative or quantitative.
[0050] If a clear fluorescent signal was detected in the sample reaction tube, this indicated a positive result, indicating that the sample contained the Codonopsis AVA virus.
[0051] If no obvious fluorescent signal is detected in the sample reaction tube, it means negative, indicating that the sample does not contain Codonopsis AVA virus.
[0052] Preferably, if one wants to clarify the content of AVA virus in a positive sample, it is necessary to quantitatively determine the copy number of AVA virus in the positive sample by fitting a standard curve based on the amplification Ct value of the positive sample.
[0053] Preferably, in the case of a normal LAMP color reaction, after the completion of the above LAMP reaction, the reaction tube is centrifuged or gently shaken without opening the lid to mix the SYBR Green I fluorescent dye on the inner wall of the lid of the reaction tube with the LAMP amplification product, and then mixed upside down, and the color change of the mixture in the reaction tube is observed with the naked eye.
[0054] If the mixture turns green, it means that the SYBR Green I dye has bound to the double-stranded DNA, which is a positive reaction and indicates that the test sample contains the Codonopsis AVA virus.
[0055] If the mixture is orange in color, it is a negative reaction, indicating that the sample does not contain Codonopsis AVA virus.
[0056] In a sixth aspect, the present invention provides a method for producing a composition comprising: The present invention further provides a method for detecting Copernicia nipovirus A in Copernicia nipoides, which comprises the steps of: performing a reverse transcription reaction on a test sample using a reverse transcription primer in the above nucleic acid combination or a reverse transcription primer in the above kit to obtain cDNA; and then amplifying the cDNA using the upstream and downstream primers in the above nucleic acid combination via qPCR.
[0057] In a preferred embodiment of the present invention, the qPCR reaction conditions are 30 to 40 cycles of amplification at 95°C for 30 seconds, 95°C for 5 seconds, and 60°C for 34 seconds.
[0058] After the fluorescent quantitative qPCR reaction is completed, observe the fluorescent signal detected by the real-time fluorescent PCR instrument. If a clear fluorescent signal is detected in the sample reaction tube, this indicates a positive result, indicating that the sample contains the Codonopsis AVA virus.
[0059] If no obvious fluorescent signal is detected in the sample reaction tube, it means negative, indicating that the sample does not contain Codonopsis AVA virus.
[0060] When quantitative analysis is performed, a standard curve should be fitted based on the amplification Ct value of the positive sample to quantitatively determine the copy number of the AVA virus in the positive sample.
[0061] In a preferred embodiment of the present invention, the qPCR reaction system contains an upstream primer at a final concentration of 0.2 to 0.7 μM and a downstream primer at a final concentration of 0.2 to 0.7 μM.
[0062] In a seventh aspect, the present invention provides a method for producing a composition comprising: The present invention further provides a method for detecting Copernicia nipovirus A in Copernicia nipoides, which comprises the steps of performing a reverse transcription reaction on a test sample using a reverse transcription primer in the above nucleic acid combination or a reverse transcription primer in the above kit to obtain cDNA, and then PCR amplifying the cDNA using an upstream primer and a downstream primer in the above nucleic acid combination.
[0063] After the PCR amplification reaction is completed, the amplified product is subjected to gel electrophoresis, and the presence or absence of japonica virus A in the Codonopsis ginseng is determined based on the size and presence of the bands in the product.
[0064] In a preferred embodiment of the present invention, the PCR reaction conditions are 95°C for 3 to 5 minutes, followed by 30 to 40 cycles of amplification at 95°C for 5 seconds, 54°C for 30 seconds, and 70 to 72°C for 45 seconds.
[0065] In a preferred embodiment of the present invention, the PCR reaction system contains 0.2 to 1.0 μM of an upstream primer and 0.2 to 1.0 μM of a downstream primer. [Effects of the Invention]
[0066] (1) The present invention provides a LAMP nucleic acid combination for detecting Codonopsis ginseng AVA virus. The nucleic acid combination can be used in RT-qLAMP, PAE-RT-qLAMP, or PAE-RT-LAMP amplification reactions. LAMP amplification uses a total of five primers, F3, B3, FIP, BIP, and LF, to recognize seven sequences of the AVACP gene, which has the technical advantages of strong specificity and high accuracy.
[0067] (2) The present invention further provides a nucleic acid combination for detecting Codonopsis ginseng AVA virus, which can be used for both conventional PCR detection and qPCR detection, and has high detection specificity and accuracy.
[0068] (3) The kit for rapid and quantitative detection of Codonopsis fasciatus AVA virus pathogens by RT-qLAMP provided by the present invention has technical advantages such as simple operation, high speed, and low cost. The detection primer composition can achieve highly sensitive and reliable detection of Codonopsis fasciatus AVA virus in target samples. In particular, the PAE-qRT-LAMP kit has the advantages of low cost, no need for nucleic acid extraction, and simple detection procedures.
[0069] The present invention performs RT-qLAMP amplification with high specificity and sensitivity, improving the specificity of detection and reducing the occurrence of false positives.
[0070] (4) This invention provides a new technical idea for detecting new pathogens in ginseng and other crops, which can be used for accurate quantification and conventional qualitative analysis of ginseng AVA virus, providing technical support for monitoring the occurrence, spread, and cross-species transmission of AVA virus, as well as for biosafety and comprehensive prevention and control.
[0071] In order to more clearly explain the technical solutions of the embodiments of the present invention, the drawings used in the embodiments are briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and that those skilled in the art can obtain other related drawings without any creative efforts. [Brief explanation of the drawings]
[0072] [Figure 1] FIG. 1 is a schematic plan view of a physical adsorption / enrichment PAE purification device (i.e., a filter) for detecting the Codonopsis ginseng AVA virus pathogen by PAE-qRT-LAMP in an embodiment of the present invention. [Figure 2] FIG. 2 is a schematic plan view of a physical adsorption / enrichment PAE concentration device (i.e., an ultrafiltration tube) for detecting the Codonopsis ginseng AVA virus pathogen by PAE-qRT-LAMP in an embodiment of the present invention. [Figure 3] Figure 3 is an analysis diagram of PCR amplification electrophoresis of the CP gene from a sample of AVA-positive leaves of Copernicia glabra in an example of the present invention, in which rails 1 and 2 correspond to positive amplification of the AVACP gene, respectively, and rail CK is a negative control. [Figure 4] Figure 4 is a graph of the fluorescent quantitative detection of primer screening when detecting the AVA virus pathogen of Codonopsis ginseng by PAE-RT-qLAMP in an embodiment of the present invention, in which the curve CK is the negative control, the curve AVA1 is the AVA-qLAMP1 primer group, the curve AVA2 is the AVA-qLAMP2 primer group, the curve AVA3 is the AVA-qLAMP3 primer group, and the curve AVA4 is the AVA-qLAMP4 primer group. [Figure 5] Figure 5 is a visual observation diagram of typical colorimetric LAMP at different reaction temperatures when detecting the Codonopsis ginseng AVA virus pathogen using PAE-RT-qLAMP in an embodiment of the present invention. In the figure, reaction tube CK is the negative control, and reaction tubes 56°C to 70°C correspond to 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C, respectively. [Figure 6] Figure 6 is a typical visual observation experiment diagram of colorimetric LAMP of the reaction time when detecting the Codonopsis ginseng AVA virus pathogen using PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, reaction tube CK is the negative control, and reaction tubes 20 minutes to 100 minutes correspond to 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 70 minutes, 80 minutes, 90 minutes, and 100 minutes, respectively. [Figure 7]FIG. 7 is a fluorometric detection diagram of the specificity of detecting the AVA virus pathogen of Codonopsis chinensis by PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, the curve NC is the negative control, the curve HC is the healthy Codonopsis chinensis control, the curve LSV is the Lily latent virus LSV tissue infecting a lily, the curve CMV is the Cucumber mosaic virus CMV tissue infecting a lily, the curve LMoV is the Lily mottle virus LMoV tissue infecting a lily, the curve AMV is the Alfalfa mosaic virus AMV tissue infecting Angelica chinensis, the curve ALSV is the Apple small spherical latent virus ALSV tissue infecting Angelica chinensis, the curve KoMV is the Taro mosaic virus KoMV tissue infecting Angelica chinensis, the curve LycMoV is the Celestial mottle virus LycMoV tissue infecting Angelica chinensis, and the curve AVA is the AVA Codonopsis chinensis-infected tissue. [Figure 8] FIG. 8 is a typical colorimetric LAMP visual observation diagram of the specificity of detecting AVA virus pathogens by PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, the reaction tube NC is a negative control, the reaction tube HC is a healthy Codonopsis ginseng control, the reaction tube LSV is a lily latent virus LSV tissue infecting lilies, the reaction tube CMV is a cucumber mosaic virus CMV tissue infecting lilies, and the reaction tube LMoV is a lily mottle virus infecting lilies. LMoV tissue, reaction tube AMV is alfalfa mosaic virus AMV tissue that infects Chinese angelica, reaction tube ALSV is apple latent spherical virus ALSV tissue that infects Chinese angelica, reaction tube KoMV is taro mosaic virus KoMV tissue that infects Chinese angelica, reaction tube LycMoV is Sennou mottle virus LycMoV tissue that infects Chinese angelica, and reaction tube AVA is AVA mandarin orange-infective tissue. [Figure 9]FIG. 9 is a fluorometric detection diagram of the sensitivity of detecting the C. cerevisiae AVA virus pathogen by PAE-RT-qLAMP in an embodiment of the present invention, in which curve NC is the negative control, curve HC is the healthy C. cerevisiae control, curve 1 is the C. cerevisiae AVA positive cDNA, curve 10-1 is the C. cerevisiae AVA positive cDNA diluted 101 times, curve 10-2 is the C. cerevisiae AVA positive cDNA diluted 102 times, curve 10- Curve 3 is AVA-positive cDNA diluted 103-fold, curve 10-4 is AVA-positive cDNA diluted 104-fold, curve 10-5 is AVA-positive cDNA diluted 105-fold, curve 10-6 is AVA-positive cDNA diluted 106-fold, curve 10-7 is AVA-positive cDNA diluted 107-fold, and curve 10-8 is AVA-positive cDNA diluted 108-fold. [Figure 10] FIG. 10 is a fluorometric detection diagram of the sensitivity of detecting the C. cerevisiae AVA virus pathogen by PAE-RT-qPCR in an embodiment of the present invention, where curve NC is the negative control, curve HC is the healthy C. cerevisiae control, curve 1 is the C. cerevisiae AVA positive cDNA, curve 10-1 is the C. cerevisiae AVA positive cDNA diluted 101 times, and curve 10- Curve 2 is the AVA-positive cDNA of C. cerasifera diluted 102-fold, curve 10-3 is the AVA-positive cDNA of C. cerasifera diluted 103-fold, curve 10-4 is the AVA-positive cDNA of C. cerasifera diluted 104-fold, curve 10-5 is the AVA-positive cDNA of C. cerasifera diluted 105-fold, and curve 10-6 is the AVA-positive cDNA of C. cerasifera diluted 106-fold. [Figure 11]Figure 11 shows the fluorometric melting curves for detecting the C. cerevisiae AVA virus pathogen by PAE-RT-qPCR in an embodiment of the present invention. In the figure, curve NC is the negative control, curve HC is the healthy C. cerevisiae control, curve 1 is the C. cerevisiae AVA-positive cDNA, curve 10-1 is the C. cerevisiae AVA-positive cDNA diluted 101-fold, curve 10-2 is the C. cerevisiae AVA-positive cDNA diluted 102-fold, curve 10-3 is the C. cerevisiae AVA-positive cDNA diluted 103-fold, curve 10-4 is the C. cerevisiae AVA-positive cDNA diluted 104-fold, curve 10-5 is the C. cerevisiae AVA-positive cDNA diluted 105-fold, and curve 10-6 is the C. cerevisiae AVA-positive cDNA diluted 106-fold. [Figure 12] Figure 12 is a PCR electrophoresis analysis diagram of the sensitivity when detecting the C. cernus AVA virus pathogen by PAE-RT-PCR in an embodiment of the present invention, where rail 1 is C. cernus AVA-positive cDNA, rail 10-1 is C. cernus AVA-positive cDNA diluted 101-fold, rail 10-2 is C. cernus AVA-positive cDNA diluted 102-fold, rail 10-3 is C. cernus AVA-positive cDNA diluted 103-fold, rail 10-4 is C. cernus AVA-positive cDNA diluted 104-fold, rail 10-5 is C. cernus AVA-positive cDNA diluted 105-fold, rail 10-6 is C. cernus AVA-positive cDNA diluted 106-fold, and rail CK is a negative control. [Figure 13]FIG. 13 is a fluorometric melting curve diagram for detecting the C. rhododendron AVA virus pathogen by PAE-RT-qLAMP in an embodiment of the present invention. In the diagram, curve NC is the negative control, curve HC is the healthy C. rhododendron control, curve 10-1 is the C. rhododendron AVA positive cDNA diluted 101 times, curve 10-2 is the C. rhododendron AVA positive cDNA diluted 102 times, and curve 10-3 is the C. rhododendron AVA positive cDNA diluted 103 times. Curve 10-1 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 104 times, curve 10-2 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 105 times, curve 10-3 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 106 times, curve 10-4 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 104 times, curve 10-5 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 105 times, curve 10-6 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 106 times, curve 10-7 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 107 times, and curve 10-8 is the AVA-positive cDNA of Codonopsis cerevisiae diluted 108 times. [Figure 14] Figure 14 is a standard curve diagram for detecting the Codonopsis ginseng AVA virus pathogen using PAE-RT-qLAMP in an embodiment of the present invention. The initial concentration of the Codonopsis ginseng AVA virus positive standard in the diagram is 2.18x1010 copies / μL. After 10-fold dilution, the concentrations of the six dilutions after 10-fold dilution are 2.18x109 copies / μL, 2.18x108 copies / μL, 2.18x107 copies / μL, 2.18x106 copies / μL, 2.18x105 copies / μL, and 2.18x104 copies / μL, respectively. DETAILED DESCRIPTION OF THE INVENTION
[0073] Reference will now be made in detail to the embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, and not as a limitation of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used with another embodiment to yield a still further embodiment.
[0074] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the skill of the art. Such techniques are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd edition (Sambrook et al., 1989), Oligonucleotide Synthesis (M.J. Gait, ed., 1984), Animal Cell Culture (R.I. Freshney, ed., 1987), Methods in Enzymology (Academic Press, Inc.), Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds.), Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987), Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987), and PCR: The Polymerase Chain Reaction (PCR). These techniques are described in detail in "Current Protocols in Immunology" (eds. Mullis et al., 1994), and "Current Protocols in Immunology" (eds. J.E. Coligan et al., 1991), each of which is expressly incorporated herein by reference.
[0075] In order to clarify the objectives, technical solutions, and advantages of the embodiments of the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described below. Conditions not specifically described in the examples shall be in accordance with conventional conditions or manufacturer's recommendations. If the manufacturers of the reagents and equipment used are not listed, they shall be conventional products available on the market.
[0076] The features and performance of the present invention will be described in more detail below with reference to examples. [Example]
[0077] This example provides a PAE-RT-qLAMP kit for rapid and quantitative detection of the emerging viral pathogen AVA of Asclepias gracilis, in which the PAE-RT-qLAMP kit consists of a filter and ultrafiltration tube for the Asclepias gracilis AVA viral pathogen, a RT-qLAMP-specific primer composition, a reverse transcription RT synthesis reagent, and a qLAMP amplification reaction reagent, as shown in Figures 1 and 2.
[0078] In addition, the PAE-RT-qLAMP kit further includes phosphate buffer PBS, phosphate washing buffer PBST, a negative control, and a positive control.
[0079] Among them, the RT-qLAMP-specific primer composition includes the RT reverse primer AVA-R shown in SEQ ID NO: 1, the LAMP forward outer primer F3 shown in SEQ ID NO: 2, the LAMP reverse outer primer B3 shown in SEQ ID NO: 3, the LAMP forward inner primer FIP shown in SEQ ID NO: 4, the LAMP reverse inner primer BIP shown in SEQ ID NO: 5, and the LAMP forward loop primer LF shown in SEQ ID NO: 6.
[0080] The specific sequences of the primers are as follows: AVA-R:5'-GTAGGACCATACAACTTCAGGC-3', F3:5'-GTGCGCATACTATGTATGGT-3', B3:5'-ACAACTTCAGGCCTGGTT-3', FIP:5'-TCACCCGCAACATATTGGAAGACGAGGACCTGTCACTCTG-3', BIP:5'-CACCTCTGGTGATTCTGGCTTTGCCCTTGCTTGAGAGATG-3', LF:5'-TGTAGCGGCTGGGTAACCA-3'.
[0081] The reverse transcription RT synthesis reagent consisted of 10 mM dNTP mixture, 5× M-MLV reaction buffer, 30 U / μL RNase inhibitor, 200 U / μL M-MLV reverse transcriptase, and RNA-free H O.
[0082] The qLAMP amplification reaction reagents consisted of 10 mM dNTP mixture, 10× ThermoPol reaction buffer, 100 mM MgSO 4 , 8 U / μL Bst DNA polymerase, 50× LAMP fluorescent dye, and nuclease-free H 2 O.
[0083] The concentration of the phosphate buffer PBS and the phosphate washing buffer PBST is 0.02M and the pH value is 7.4.
[0084] The negative control was nuclease-free H2O.
[0085] The positive control was a positive standard for Codonopsis ginseng AVA virus.
[0086] This example also provides a method for preparing a positive control sample of Codonopsis ginseng AVA virus, the specific preparation method is as follows:
[0087] 1. Extraction of total RNA from leaves of Codonopsis glabra 50–100 mg of AVA-infected C. chinensis leaves were polished with liquid nitrogen, and total RNA was extracted from the infected C. chinensis leaf tissue using a plant total RNA extraction kit.
[0088] 2. Primer design and synthesis Based on the contig of A. ginseng AVA obtained by small RNA sequencing, forward (AVA-F) and reverse (AVA-R) primers specific for the CP gene were designed and synthesized. The primer sequences are as follows: AVA-F:5'-ACGCTGCTAAGGTGACCTGTC-3', AVA-R:5'-GTAGGACCATACAACTTCAGGC-3'.
[0089] 3. Preparation of positive control 1) RT reaction The first strand of cDNA was synthesized using the AVA reverse primer AVA-R and M-MLV reverse transcriptase in an RT reaction. A 10 μL RT reaction system consisted of 2 μL total RNA, 1 μL 10 μM AVA-specific reverse primer AVA-R, and 3 μL RNA-free HO. The reaction was denatured at 70°C for 10 minutes and rapidly cooled on ice for 2 minutes. Then, 2 μL 5x M-MLV buffer, 1 μL 10 mM dNTP mixture, 0.34 μL 30 U / μL RNase inhibitor, 0.35 μL 200 U / μL M-MLV reverse transcriptase, and 0.31 μL RNA-free HO were added. After mixing, the reaction was placed in a 42°C water bath for 1 hour, incubated at 70°C for 15 minutes, and then placed on ice until use.
[0090] 2) PCR reaction Using the first strand of the cDNA as a template, PCR amplification of the AVACP gene of Codonopsis ginseng was carried out using Ex Taq DNA polymerase.
[0091] The PCR reaction system was 25.0 μL and contained 1.0 μL of 50 ng cDNA, 0.2 μL of 5 U / μL Ex Taq DNA polymerase, 2.5 μL of 10× PCR buffer, 2 μL of 2.5 mM dNTP mixture, 0.5 μL of 10 μM forward primer AVA-F, and 0.5 μL of 10 μM reverse primer AVA-R, and was made up to 25.0 μL with nuclease-free HO.
[0092] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 45 seconds; 35 cycles of amplification were performed, followed by a final extension at 72°C for 5 minutes.
[0093] As shown in Figure 3, the PCR product was detected by 1.5% agarose gel electrophoresis, and the target fragment was recovered. The target fragment was then ligated into the pMD18-T vector using a clone vector kit and transformed into DH5α susceptible cells. Screening was performed on blue-white plates. Three white-spotted colonies were randomly selected and inoculated into ampicillin-LB medium. After shaking at 37°C for 12-16 hours, the plasmids were extracted using a plasmid microextraction kit. 1 μL of each plasmid was then amplified by PCR under the same conditions as the PCR reaction system described above. The positive recombinant plasmids detected by PCR were sequenced. The sequence of the positive plasmids was confirmed to be completely correct, i.e., the positive control. The length of the corresponding Codonopsis ginseng AVA virus gene fragment was 1493 bp. The plasmid concentration of the standard was measured using a NanoDrop ND-1000 nucleic acid / protein analyzer.
[0094] 4. Positive control sequence After sequencing, the above Codonopsis ginseng AVACP gene positive standard was completely consistent with the expectation, and the sequence of the recovered control fragment was as follows: The sequence of the AVACP gene-positive standard of Codonopsis ginseng is [Example]
[0095] This example further provides a method for rapid detection of Codonopsis ginseng AVA virus pathogen by PAE-RT-qLAMP kit.
[0096] 1. Concentration, Purification, and PAE Adsorption / Enrichment of Codonopsis ginseng AVA Virus Particles 1) Take 50-100 mg of tissue material such as leaves or seeds of the test plant, add 1 mL of phosphate buffer (PBS) and grind it. Then, transfer the grinding liquid to a 1.5 mL sterile centrifuge tube and centrifuge it at 3000 rpm for 2 minutes. The supernatant is a crude extract of the infectious tissue.
[0097] 2) The crude extract of the above infected tissue is filtered through a 0.45 μm hydrophilic membrane filter to remove cell debris and other large particle aggregates, thereby achieving the purpose of clarification.
[0098] 3) The virus solution purified by the above filtration was further concentrated using a centrifugal ultrafiltration tube to obtain a concentrated solution of infected tissue.
[0099] 4) 100 μL of the concentrated solution from the infected tissue was taken and added to a 0.5 mL PCR tube, and incubated at 4°C for 15 minutes.
[0100] 5) The crude extract of the infected tissue was discarded, washed once with phosphate wash buffer PBST, washed once with RNA-free HO, briefly centrifuged, and the residual liquid was aspirated.
[0101] 2. Initial denaturation of virus particles Add 10 μL of DEPC water or RNA-free water containing 15 units (U) of RNase inhibitor to the bottom of the PCR tube, incubate at 95°C for 1 minute to denature, immediately place in an ice bath for 1 minute, and use in the subsequent reaction.
[0102] 3.RT Reaction 1) Take a new PCR tube, add 2 μL of the above denatured solution, 1 μL of the AVA-specific reverse primer AVA-R at a concentration of 10 μM, and 2 μL of RNA-free H2O, mix, and incubate at 70°C for 10 minutes, then immediately place in an ice bath for 2 minutes.
[0103] 2) Add 2 μL of 5x M-MLV buffer, 1 μL of 10 mM dNTP mixture, 0.34 μL of 30 U / μL RNase inhibitor, and 0.35 μL of 200 U / μL M-MLV reverse transcriptase to the PCR tube, add RNA-free HO to make 10 μL, mix thoroughly, and then incubate at 42°C for 1 hour in a water bath and then at 70°C for 15 minutes to obtain the first strand of cDNA, which will be used for the subsequent LAMP amplification.
[0104] 4. Fluorometric Quantitative qLAMP Amplification Reaction Fluorometric quantitative qLAMP amplification was performed in a new PCR tube by adding the following reagents. The reaction volume was 12.5 μL. The qLAMP amplification reagents were 50 ng cDNA (1.0 μL), 10× ThermoPol buffer (2.5 μL), 100 mM MgSO (1.5 μL), 10 mM dNTP mixture (3.5 μL), 10 μM B3 and F3 primers (0.5 μL each), 10 μM FIP and BIP primers (2.0 μL each), 10 μM LF primer (0.5 μL), and 8 U / μL Bst. The mixture contained 1.0 μL of DNA polymerase and 0.25 μL of LAMP fluorescent dye, and was made up to 12.5 μL with nuclease-free H2O. Nuclease-free H2O was also used as a negative control, and a positive standard of Codonopsis ginseng AVA virus was used as a positive control. LAMP amplification was performed in a real-time fluorescent quantitative PCR thermal cycler. The reaction conditions were amplification at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes to terminate the reaction.
[0105] In another embodiment, if you want to detect the content of AVA virus in a sample, when performing the above qLAMP amplification reaction, you need to simultaneously amplify a positive standard of AVA virus diluted 10 times and draw a standard curve.
[0106] 5.Analysis and determination of reaction products After the above fluorescent quantitative qLAMP amplification reaction is completed, observe whether the real-time fluorescent PCR instrument detects a fluorescent signal in the PCR tube.
[0107] If a clear fluorescent signal is detected in the sample PCR tube, this indicates a positive result and indicates that the sample contains the Codonopsis AVA virus.
[0108] If no obvious fluorescent signal is detected in the sample PCR tube, this means a negative result, indicating that the sample does not contain the Codonopsis AVA virus.
[0109] In other embodiments, if you want to clarify the content of AVA virus in a positive sample, you need to quantitatively determine the copy number of AVA virus in the positive sample by fitting a standard curve based on the amplification Ct value of the positive sample. [Example]
[0110] This example provides a method (PAE-RT-LAMP) for rapid detection of the Codonopsis ginseng AVA virus pathogen using a conventional PCR thermal cycler based on the PAE-RT-qLAMP kit of Example 1. The method does not require a real-time fluorescent quantitative PCR thermal cycler. In other embodiments, constant temperature devices such as a water bath, a constant temperature incubator, or a metal bath can be selected for the conventional LAMP detection reaction.
[0111] The difference compared to Example 2 is that the LAMP amplification reaction in step 4 is as follows.
[0112] The reaction system was 12.5 μL, and the LAMP amplification reagents were 1.0 μL of 50 ng cDNA, 2.5 μL of 10× ThermoPol buffer, 1.5 μL of 100 mM MgSO4, 3.5 μL of 10 mM dNTP mixture, 0.5 μL each of 10 μM B3 and F3 primers, 2.0 μL each of 10 μM FIP and BIP primers, 0.5 μL of 10 μM LF primer, and 8 U / μL Bst. The reaction mixture contained 1.0 μL of DNA polymerase and was made up to 12.5 μL with nuclease-free H2O. Nuclease-free H2O was used as the negative control, and a positive control of Codonopsis ginseng AVA virus was used as the positive control. After the reaction system was completed, 1 μL of 100x Cyber Green I fluorescent dye coloring solution was added to the inner wall of the PCR tube lid, and the PCR tube lid was tightly closed to perform LAMP amplification. The LAMP reaction conditions were amplification at 62°C for 80 minutes, followed by denaturation at 80°C for 5 minutes to terminate the reaction.
[0113] Analysis and determination of reaction products After the LAMP reaction is complete, centrifuge or gently shake the PCR tube without opening the lid to mix the Cyber Green I fluorescent dye on the inner wall of the PCR tube lid with the LAMP amplified product, then turn the tube upside down and observe the color change of the mixture in the PCR tube with the naked eye.
[0114] If the mixture turns green, it means that the SYBR Green I dye has bound to the double-stranded DNA, which is a positive reaction and indicates that the test sample contains the Codonopsis AVA virus.
[0115] If the mixture is orange in color, it is a negative reaction, indicating that the sample does not contain Codonopsis AVA virus. [Example]
[0116] This example provides a method for detecting the Codonopsis ginseng AVA virus pathogen by RT-qPCR.
[0117] The primers for fluorescent quantitative qPCR amplification and conventional PCR amplification of the AVACP gene are as follows:
[0118] [Table 1]
[0119] The fluorescent quantitative qPCR reaction system consisted of 10 μL and contained 1.0 μL of 50 ng cDNA, 5.0 μL of TB Green Premix Ex Taq (2X) (Tli RNase H Plus), 0.2 μL of 10 μM forward primer AVA-qPCR-F1, 0.2 μL of 10 μM reverse primer AVA-qPCR-R1, and 0.2 μL of ROX reference dye (50X). Nuclease-free HO was added to the reaction mixture to make a final volume of 10 μL. Nuclease-free HO was also used as a negative control. The qPCR amplification was performed using a real-time fluorescent quantitative PCR thermal cycler. The reaction conditions were 95°C for 30 seconds of pre-denaturation, 95°C for 5 seconds of denaturation, and 60°C for 34 seconds of annealing, followed by 35 cycles of amplification.
[0120] To assess the accuracy of the method results, in this example, melting curve amplification was also performed with the following parameters: 95°C for 15 seconds, 60°C for 60 seconds, 95°C for 15 seconds. [Example]
[0121] This example provides a method for detecting the Codonopsis ginseng AVA virus pathogen by RT-PCR.
[0122] The primers for conventional PCR amplification of the AVACP gene are as follows:
[0123] [Table 2]
[0124] A typical PCR reaction system was 25.0 μL and contained 1.0 μL of 50 ng cDNA, 0.2 μL of 5 U / μL Ex Taq DNA polymerase, 2.5 μL of 10× PCR buffer, 2 μL of 2.5 mM dNTP mixture, 0.5 μL of 10 μM forward primer AVA-PCR-F1, and 0.5 μL of 10 μM reverse primer AVA-PCR-R1. The volume was adjusted to 25.0 μL with nuclease-free HO. The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 45 seconds. 35 cycles of amplification were performed, followed by a final extension at 72°C for 5 minutes.
[0125] The amplification products were analyzed by gel electrophoresis.
[0126] (Experimental Example 1) qLAMP primer group screening experiment To screen for the optimal primer set for qLAMP amplification, four sets of LAMP primers were designed using Primer Explorer 5 software with default settings for the region containing the C. cerevisiae AVA capsid protein CP gene. The primers were synthesized by Seiko Biotechnology (Shanghai) Co., Ltd. cDNA from a healthy C. cerevisiae plant was used as the negative control, and cDNA from the C. cerevisiae AVA-positive leaf sample from the previous example was used as the reaction sample. qLAMP reactions were performed using the Mx3000p real-time PCR thermal cycler using the qLAMP detection system and detection method described in the previous example. The reaction process was amplified at 60°C for 60 minutes, and the fluorescent signal amplification curves of each reaction sample were observed after amplification. The experiment was repeated three times, and the primer sequences are listed in the table below.
[0127] [Table 3]
[0128] As shown in Figure 4, the amplification results showed that among the four primer groups, the AVA2 primer group did not produce a fluorescent signal and could not amplify the AVACP gene of Aspergillus oryzae. The other three primer groups, AVA1, AVA3, and AVA4, were all able to rapidly amplify Aspergillus oryzae AVA disease-positive sample cDNA, with the AVA4 primer group having the fastest peak time of 25 minutes, followed by the AVA1 primer group at 34 minutes, and finally the AVA3 primer group at 46 minutes. After extensive screening and repeated validation, the AVA4 primer group was finally determined to be the most sensitive for the Aspergillus oryzae AVA disease-positive sample cDNA and was used in subsequent experiments.
[0129] (Experimental Example 2) This experimental example provides a visual observation experiment of fluorescent dyes at different reaction temperatures and reaction times when using the PAE-RT-qLAMP kit in Example 2 to rapidly detect Codonopsis ginseng AVA virus. The detection method is as shown in Example 2.
[0130] The results of 80-minute amplification at RT-LAMP temperatures of 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C were tested. As shown in FIG. 5, the reaction tube CK in the figure is the negative control, and the reaction tubes 56°C to 70°C correspond to 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C, and 70°C, respectively. As can be seen from the figure, the combination of amplification primers provided in the examples of the present invention achieved efficient amplification of the AVACP gene of Codonopsis ginseng at temperatures of 58 to 66°C.
[0131] The amplification results were tested by performing RT-LAMP amplification at an amplification temperature of 62°C for 20, 30, 40, 50, 60, 70, 80, 90, and 100 minutes. As shown in Figure 6, reaction tube CK in the figure is a negative control, and reaction tubes 20 to 100 minutes correspond to 20, 30, 40, 50, 60, 70, 80, 90, and 100 minutes, respectively. As can be seen from the figure, the amplification primer combinations provided in the examples of the present invention were able to efficiently amplify the AVACP gene of Codonopsis ginseng within 30 to 100 minutes.
[0132] (Experimental Example 3) Specificity of the PAE-RT-qLAMP kit for rapid detection of the AVA virus pathogen of Asclepias gracilis To analyze the specificity of the PAE-RT-qLAMP kit for detecting AVA viruses of the common crested vine, we tested the field infection of eight plant viruses, including Lily latent virus LSV, Cucumber mosaic virus CMV, and Lily mottle virus LMoV, which infect lilies; Alfalfa mosaic virus AMV, Apple small spherical latent virus ALSV, Taro mosaic virus KoMV, and Cinnamo mottle virus LycMoV, which infect Angelica acutiloba; and Lilium nipovirus AAVA, which infects common crested vine. The infected leaves were used as samples and ground with phosphate buffered saline (PBS) to obtain crude extracts and concentrates of infected tissues. RT-qLAMP amplification was performed according to the PAE-RT-qLAMP detection system and detection method described in the above example. The reaction process consisted of amplification at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes to terminate the reaction. After amplification was completed, the fluorescent signal detected by a real-time fluorescent PCR thermal cycler was observed. Nuclease-free H2O was used as the blank control, and healthy Codonopsis ginseng leaves were used as the negative control. The experiment was repeated three times.
[0133] As shown in Figure 7, the fluorescence signal observation results showed that only AVA-infected Codonopsis ginseng leaves amplified the fluorescence curve, while no obvious fluorescence signals were detected in the amplification products of other infected leaves, the blank control, and healthy Codonopsis ginseng leaves. This indicated that the PAE-RT-qLAMP method established in this invention is highly specific to Codonopsis ginseng AVA virus and does not cross-react with other common herbal medicine viruses.
[0134] For comparative detection, leaves infected with the eight plant viruses mentioned above were used as samples. These were ground with phosphate buffered saline (PBS) to obtain crude extracts and concentrates of the infected tissues. RT reactions were performed to synthesize the first strand of cDNA according to the detection system and method described in Example 3 above, followed by a standard LAMP color reaction. The reaction process was carried out at 62°C for 80 minutes. After amplification was complete, the PCR tubes were centrifuged or gently shaken without opening the lids. The Cyber Green I fluorescent dye on the inner wall of the PCR tube lid was mixed with the LAMP amplified product, and the tubes were then mixed upside down. The color change of the mixture in the PCR tube was observed with the naked eye under natural light. Nuclease-free H2O was used as a blank control, and healthy Codonopsis ginseng leaves were used as a negative control. The experiment was repeated three times.
[0135] The color development results were observed with the naked eye under natural light. As shown in Figure 8, only the sample mixture of AVA-infected Codonopsis ginseng leaves turned green, while the mixtures of other infected leaves, the blank control, and healthy Codonopsis ginseng leaves were all orange, indicating that the PAE-RT-LAMP method established in this invention has high specificity for Codonopsis ginseng AVA virus and does not cross-react with other common Chinese herbal medicine viruses.
[0136] The above results indicated that the two detection methods, PAE-RT-qLAMP and PAE-RT-LAMP, showed complete agreement in the detection results of specificity for Codonopsis ginseng AVA virus.
[0137] (Experimental Example 4) Sensitivity of the PAE-RT-qLAMP kit for rapid detection of C. ginseng AVA virus To evaluate the sensitivity of the PAE-RT-qLAMP kit for quantitative detection of Codonopsis cerevisiae AVA virus, cDNA from the positive Codonopsis cerevisiae AVA-infected leaves from the previous example was used as a sample. The cDNA sample was diluted 10-fold with nuclease-free HO and stored at -20°C to serve as a template. After 10-fold dilutions, 1.0 μL of each diluted solution was used as a template. Fluorescent quantitative qLAMP amplification was performed with the qLAMP reaction reagents from the previous example. The reaction was amplified at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes. After amplification, the fluorescent signal detected by a real-time fluorescent PCR thermal cycler was monitored. Nuclease-free HO served as a blank control, and healthy Codonopsis cerevisiae leaves served as a negative control. The experiment was repeated three times.
[0138] For comparative detection, fluorescent quantitative qPCR amplification (Example 4) and regular PCR amplification (Example 5) were performed on each diluted solution at the above 10-fold ratio. After the qLAMP reaction was completed, the fluorescent signal detected by the real-time fluorescent PCR thermal cycler was observed. As shown in Figure 9, the reaction sensitivity of PAE-RT-qLAMP to the cDNA of the AVA-positive leaf sample of Codonopsis glabra was 10 -6 Dilute with.
[0139] After the fluorescent quantitative qPCR reaction was completed, the fluorescent signal detected by the real-time fluorescent PCR device was observed. As shown in Figure 10, the reaction sensitivity of PAE-RT-qPCR to the AVA-positive sample cDNA was 10 -5 The melting curve analysis showed that the melting temperature of the AVA target product was about 82°C, the amplified product was single, and a specific melting peak was formed without any impurity peaks. The peak values were relatively consistent, indicating that the PAE-RT-qPCR quantification results were reliable.
[0140] After the PCR reaction was completed, 5 μL of the amplified product was loaded and subjected to agarose gel electrophoresis. As shown in Figure 12, the size of the product was 920 bp, which was consistent with the expectation. The sensitivity of PAE-RT-PCR to the cDNA of the AVA-positive leaf sample was 10 -4 is.
[0141] In summary, the sensitivity of detecting C. ginseng AVA-positive sample cDNA by PAE-RT-qLAMP is 10-fold higher than that of PAE-RT-qPCR and 100-fold higher than that of PAE-RT-PCR.
[0142] (Experimental Example 5) Melting curves for rapid detection of C. ginseng AVA virus by PAE-RT-qLAMP kit To quantitatively detect AVA virus using the PAE-RT-qLAMP kit, cDNA from the infected, positive leaves of the Codonopsis mongolica AVA virus (see Example 1) was used as a sample. The cDNA sample was diluted 10-fold with nuclease-free HO and stored at -20°C. After 10-fold dilution, 1.0 μL of each diluted solution was used as a template. Fluorescent quantitative qLAMP amplification was performed using the qLAMP reaction reagent (see Example 1). The reaction was amplified at 60°C for 60 minutes, denatured at 80°C for 5 minutes, and then heated to 50-95°C to obtain a melting curve at a rate of 1°C / sec. Nuclease-free HO was used as the blank control, and healthy Codonopsis mongolica leaves were used as the negative control. The experiment was repeated three times.
[0143] After the qLAMP reaction was completed, the fluorescent signal and melting curve detected by a real-time fluorescent PCR thermal cycler were observed. As shown in Figure 13, the original concentration and the 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6Each of the diluted cDNA samples produced a single melting peak with a melting temperature of approximately 87°C. 7 and 10 8 The 2x diluted cDNA sample, the blank control of nuclease-free H2O, and the cDNA negative control of healthy Codonopsis ginseng leaves all showed no amplified fluorescent signals, indicating that nonspecific products and dimers did not appear in the qLAMP amplification and that the PAE-RT-qLAMP kit was highly reliable for detecting Codonopsis ginseng AVA virus pathogens.
[0144] (Experimental Example 6) Establishment of a standard curve for quantitative detection of Codonopsis ginseng AVA virus using the PAE-RT-qLAMP kit To accurately quantify the content of AVA virus particles in the sample, the positive standard of Aspergillus oryzae AVA virus was used as the sample, and the starting concentration was 100 ng / μl, i.e., 2.18 x 10 10 The positive standard for the Codonopsis ginseng AVA virus was diluted 10-fold with nuclease-free HO and stored at -20°C. Six serial 10-fold dilutions from the starting concentration were performed using 1.0 μL of each dilution as template. Fluorometric qLAMP amplification was performed using the qLAMP reaction reagents described in the previous example. The reaction was amplified at 60°C for 60 minutes, followed by denaturation at 80°C for 5 minutes. Nuclease-free HO was used as a negative control. The experiment was repeated three times.
[0145] After the qLAMP reaction was completed, the fluorescence signal detected by the real-time fluorescent PCR thermal cycler and the cycle number (cycle threshold, Ct value) of the fluorescence signal baseline were observed to obtain an amplification curve, as shown in Figure 14. A standard curve was drawn with the logarithm of the copy number on the x-axis and the Ct value on the y-axis. The standard curve of PAE-RT-qLAMP for Codonopsis ginseng AVA was obtained, y = -3.185x + 42.536, R 2 =0.99, the curve is 2.18x10 10 ~2.18x10 4The results showed an excellent linear relationship in the range of copies / μL, indicating that the AVA virus could be accurately quantified.
[0146] (Experimental Example 7) The PAE-RT-qLAMP kit detects laboratory-detoxified and field-derived Codonopsis ginseng samples. Samples of leaves, seeds, etc. from laboratory-detoxified or field-derived Codonopsis fasciatus were polished with phosphate buffered saline (PBS), then filtered, purified, and concentrated according to the PAE method described in Example 2 above to obtain a concentrated solution of infectious tissue. RT-qLAMP amplification was performed using the PAE-RT-qLAMP detection system described in Example 2 above. Nuclease-free HO was used as the negative control, and a 10-fold diluted Codonopsis fasciatus AVA virus positive standard was used as the positive control. The experiment was repeated three times. After amplification was complete, the PCR tubes were monitored for fluorescent signals using a real-time fluorescent PCR thermal cycler.
[0147] If a clear fluorescent signal is detected in the sample PCR tube, this indicates a positive result and indicates that the sample contains the Codonopsis AVA virus.
[0148] If no obvious fluorescent signal is detected in the sample PCR tube, this means a negative result, indicating that the sample does not contain the Codonopsis AVA virus.
[0149] Preferably, if you want to detect the content of AVA virus in a sample, you need to simultaneously amplify a 10-fold diluted P. nipovirus A positive standard, draw a standard curve, detect the Ct value of the sample amplification, and align the standard curve to quantitatively obtain the copy number of P. nipovirus A in the test sample.
[0150] Preferably, if experimental equipment such as a real-time fluorescent PCR thermal cycler is not available, a conventional RT-qLAMP color reaction is performed using the PAE-RT-LAMP detection system described in Example 2 above. After the LAMP reaction is completed, the PCR tube is centrifuged or gently shaken without opening the lid to mix the Cyber Green I fluorescent dye on the inner wall of the PCR tube lid with the LAMP amplified product, and then mixed upside down. The color change of the mixture in the PCR tube is observed with the naked eye under natural light.
[0151] If the mixture turns green, this is a positive reaction and indicates that the test sample contains the Codonopsis AVA virus.
[0152] If the mixture is orange in color, it is a negative reaction, indicating that the sample does not contain Codonopsis AVA virus.
[0153] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention to those skilled in the art. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A combination of LAMP nucleic acids for detecting Anemone nepovirus A in Codonopsis ginseng, characterized by comprising a reverse transcription primer shown in SEQ ID NO: 1, a LAMP forward outer primer F3 shown in SEQ ID NO: 2, a LAMP reverse outer primer B3 shown in SEQ ID NO: 3, a LAMP forward inner primer FIP shown in SEQ ID NO: 4, a LAMP reverse inner primer BIP shown in SEQ ID NO: 5, and a LAMP forward loop primer LF shown in SEQ ID NO:
6.
2. A nucleic acid combination for detecting Triticum vulgare virus A in Codonopsis nipponicum, characterized by comprising a reverse transcription primer shown in SEQ ID NO: 1, an upstream primer shown in SEQ ID NO: 7, and a downstream primer shown in SEQ ID NO:
8.
3. A nucleic acid combination for detecting Triticum vulgare virus A in Codonopsis nipponicum, characterized by comprising a reverse transcription primer shown in SEQ ID NO: 1, an upstream primer shown in SEQ ID NO: 9, and a downstream primer shown in SEQ ID NO:
10.
4. A kit for detecting P. nipovirus A in P. sieboldii, characterized by comprising at least one of the following: a combination of LAMP nucleic acids for detecting P. nipovirus A in P. sieboldii described in claim 1; a combination of nucleic acids for detecting P. nipovirus A in P. sieboldii described in claim 2; and a combination of nucleic acids for detecting P. nipovirus A in P. sieboldii described in claim 3.
5. The kit of claim 4, further comprising a reverse transcription reagent, the reverse transcription reagent comprising a reverse transcriptase, a reverse transcriptase buffer, an RNase inhibitor, a dNTP mixture, and water.
6. 6. The kit of claim 5, wherein when the kit is used for LAMP amplification, the kit further comprises a LAMP amplification reagent, the LAMP amplification reagent comprising a dNTP mixture, a ThermoPol reaction buffer, Mg ions, a DNA polymerase, a LAMP fluorescent dye, and water.
7. 6. The kit of claim 5, wherein when the kit is used to perform a fluorescent quantitative qPCR reaction, the kit further comprises a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix.
8. The kit according to claim 5, wherein when the kit is used to perform a PCR reaction, the kit further comprises a PCR fluorescent dye and a PCR reaction premix.
9. 9. The kit of claim 8, wherein the PCR reaction premix further comprises a DNA polymerase, a PCR buffer, a dNTP mixture, and water.
10. The kit of claim 5, further comprising a positive control and a negative control.
11. The kit according to claim 4, further comprising a physical adsorption / accumulation device for tissue separation of the test sample, the physical adsorption / accumulation device comprising a filter and an ultrafiltration tube, the filter being provided with a hydrophilic membrane filter.
12. The method includes a step of performing a reverse transcription reaction of a test sample using the combination of LAMP nucleic acids according to claim 1 or the reverse transcription primer in the kit according to any one of claims 4 to 11 to obtain cDNA, and then performing a LAMP reaction of the cDNA using the combination of LAMP nucleic acids according to claim 1 under reaction conditions of 58 to 66°C for 30 to 100 minutes and 80°C for 5 to 10 minutes. A method for detecting Codonopsis nipovirus A in Codonopsis nipoides, comprising:
13. The method for detecting japonica virus A in Codonopsis nipoides according to claim 12, characterized in that the LAMP reaction is carried out under conditions of 60 to 62°C for 30 to 100 minutes and 80°C for 5 to 10 minutes.
14. The method for detecting Coleoptera nipovirus A in Coleoptera ginseng according to claim 12, characterized in that the LAMP reaction system comprises a LAMP reverse outer primer B3 having a final concentration of 0.2-0.4 μM, a LAMP forward outer primer F3 having a final concentration of 0.2-0.4 μM, a LAMP forward inner primer FIP having a final concentration of 1.5-1.7 μM, a LAMP reverse inner primer BIP having a final concentration of 1.5-1.7 μM, and a LAMP forward loop primer LF having a final concentration of 0.3-0.5 μM.
15. The method for detecting Coleoptera nipovirus A in Coleoptera crotalaria according to claim 14, characterized in that the LAMP reaction system comprises Mg ions with a final concentration of 8.0 to 12.5 mM, a dNTP mixture with a final concentration of 1.4 to 2.8 mM, and a DNA polymerase with a final concentration of 0.32 to 0.64 U.
16. The method for detecting P. nipovirus A in C. cerevisiae as described in claim 12, characterized in that the method further comprises preparing a test sample before performing the reverse transcription reaction, wherein the test sample is prepared by crudely extracting the test C. cerevisiae material with a tissue extract, filtering the sample through a filter, transferring the collected filtrate to an ultrafiltration tube for concentration, culturing, and washing.
17. The method for detecting P. nipovirus A in Codonopsis cernua described in claim 16, characterized in that the washed test sample is subjected to an initial denaturation and then used for reverse transcription reaction, and the initial denaturation conditions are 85°C to 95°C for 1 to 5 minutes in an ice bath.
18. The kit comprises a step of performing a reverse transcription reaction of a test sample using the nucleic acid combination according to claim 2 or the reverse transcription primer in any one of claims 4 to 11 to obtain cDNA, and then amplifying the cDNA using the upstream primer and downstream primer in the nucleic acid combination according to claim 2 by qPCR. A method for detecting Codonopsis nipovirus A in Codonopsis nipoides, comprising:
19. The method for detecting P. nipovirus A in Codonopsis gracilis according to claim 18, characterized in that the qPCR reaction conditions are 30 to 40 cycles of amplification at 95°C for 30 seconds, 95°C for 5 seconds, and 60°C for 34 seconds.
20. The method for detecting P. nipovirus A in Codonopsis gracilis according to claim 18, characterized in that the qPCR reaction system comprises an upstream primer having a final concentration of 0.2 to 0.7 μM and a downstream primer having a final concentration of 0.2 to 0.7 μM.
21. The kit comprises a step of performing a reverse transcription reaction on a test sample using the nucleic acid combination according to claim 3 or the reverse transcription primer in any one of claims 4 to 11 to obtain cDNA, and then amplifying the cDNA by PCR using the upstream primer and downstream primer in the nucleic acid combination according to claim 3. A method for detecting Codonopsis nipovirus A in Codonopsis nipoides, comprising:
22. The method for detecting P. nipovirus A in Codonopsis gracilis described in claim 21, characterized in that the PCR reaction conditions are 95°C for 3 to 5 minutes, 95°C for 5 seconds, 54°C for 30 seconds, and 70 to 72°C for 45 seconds, with amplification being performed for 30 to 40 cycles.
23. The method for detecting Codonopsis nipovirus A in Codonopsis nipoides according to claim 21, characterized in that the PCR reaction system comprises 0.2-1.0 μM of an upstream primer and 0.2-1.0 μM of a downstream primer.
Citation Information
Patent Citations
All solid lithium secondary ion battery including both side coated electrodes and method for producing the same
KR1020230147572A
Composition containing natural extracts for enhancement of innate immunity or antiviral use against influenza virus or corona virus
US20220211792A1