Compositions and methods for enhancing gamma delta t cells in gut

By using polynucleotides and Vγ4+ cells to modulate Vγ4+ cell activity, the invention addresses the immune response challenges in IBD, enhancing γδ T cell function and treating intestinal inflammation and cancer.

JP2025161855APending Publication Date: 2025-10-24KINGS COLLEGE LONDON
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025134654
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2017-09-15
Filing Date
2025-08-13
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

Current treatments for inflammatory bowel disease (IBD) do not effectively modulate immune responses in the intestinal tract, particularly due to the lack of understanding of the interaction of BTNL3 and BTNL8 with γδ T cells and the role of Vγ4+ cells in intestinal inflammation.

Method used

Compositions and methods involving polynucleotides encoding BTNL3 and BTNL8, or HNF4A, and the administration of Vγ4+ cells, including recombinant cells expressing heterologous proteins, to modulate Vγ4+ cell activity and expression, thereby treating intestinal inflammation and cancer.

Benefits of technology

Enhances γδ T cell activity in the intestinal tract, effectively treating IBD and intestinal cancer by recruiting and retaining Vγ4+ cells, increasing their frequency, and addressing mutations in BTNL3, BTNL8, and HNF4A.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025161855000002
    Figure 2025161855000002
  • Figure 2025161855000003
    Figure 2025161855000003
  • Figure 2025161855000004
    Figure 2025161855000004
Patent Text Reader

Abstract

To provide compositions and methods useful in treating inflammation of the gut, such as inflammation associated with inflammatory bowel disease, by modulating γδ T cells (e.g., Vγ4+ cells).SOLUTION: Particular embodiments include: Vγ4+ cells expressing heterologous protein; polynucleotides containing genes contributing to functional expression of BTNL3, BTNL8, and HNF4A; methods of treating a subject using Vγ4+ cells or gene therapy; and methods of identifying a subject having mutations associated with inflammation of a gut. Compositions and methods of the invention can be used in treatment of inflammation and cancer of the gut.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims priority to US 62 / 559225, filed September 15, 2017, the contents and elements of which are incorporated herein by reference for all purposes.

[0002] The present invention relates to the activation and enhancement of γδ T cells in the intestinal tract, for example for the treatment of inflammatory bowel disease (IBD). [Background technology]

[0003] Inflammatory bowel disease (IBD) is characterized by chronic inflammation of the gastrointestinal (GI) tract. It is estimated that over 3 million residents in the United States and 2.5 million in Europe have IBD, and the global prevalence of IBD is increasing due to the emergence of IBD in newly industrialized countries in Asia, South America, and the Middle East. The intestinal tract contains a variety of immune cells that maintain intestinal homeostasis, and IBD can develop in response to abnormal immune cell composition or activity within the intestinal tract.

[0004] There is a need in the art for novel treatments for IBD that involve modulating immune responses in the intestinal tract. Human intestinal epithelial cells have been reported to express BTNL3 and BTNL8. These factors have been reported to cooperate to selectively induce TCR-dependent responses in human colonic Vγ4+ cells (Di Marco Barros (22 September 2016) Cell 167 203-218). However, details regarding the interaction of BTNL3 and BTNL8 with intraepithelial lymphocytes (IELs) in the intestine, including the receptors to which BTNL3 and BTNL8 bind on IELs such as γδ T cells (Chapoval (2013) Mol Immunol 56 819-828), and the role of Vγ4+ cells in IBD and other intestinal inflammatory disorders, remain to be established. Summary of the Invention

[0005] The present inventors have found that atypical levels or activity of Vγ4+ cells are associated with human intestinal inflammation. The atypical levels or activity of Vγ4+ cells may be due to reduced butyrophilin 3 (BTNL3) and / or butyrophilin 8 (BTNL8) function in the human intestine. These findings may be useful for the diagnosis and treatment of conditions associated with intestinal inflammation, such as IBD, e.g., ulcerative colitis and / or Crohn's disease.

[0006] In various embodiments, the present invention provides compositions and methods for treating inflammation in the intestinal tract associated with atypical levels of Vγ4+ cells or Vγ4+ cell activity in the intestinal tract (e.g., loss of Vγ4+ cell presence or activity associated with mutations in BTNL3 and / or BTNL8 and / or loss of function of BTNL3 and / or BTNL8 in the intestinal tract, e.g., as a result of mutations or loss of function of HNF4A). The compositions and methods of the present invention include polynucleotides encoding BTNL3 and BTNL8, and / or HNF4A, to modulate the expression of BTNL3 and BTNL8, which can affect intestinal inflammation (e.g., IBD) by recruiting, retaining, or otherwise affecting the activity of Vγ4+ cells in the intestinal tract of patients (e.g., subjects heterozygous or homozygous for mutations in polynucleotides encoding BTNL3, BTNL8, and / or HNF4A). The compositions and methods also include administration of Vy4+ cells to treat intestinal inflammation (e.g., IBD, e.g., in a subject heterozygous for a mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A) or intestinal cancer. The Vy4+ cells can be recombinant cells, e.g., cells expressing a heterologous protein.

[0007] In a first aspect, the present invention provides Vγ4+ cells that express a heterologous protein. In some embodiments, the Vγ4+ cells are derived from Vγ4− cells, and the Vγ4 is a heterologous protein. The Vγ4− cells can be mammalian cells of any suitable cell type, including immune cells (e.g., innate lymphoid cells, monocytes, macrophages, dendritic cells, neutrophils, eosinophils, basophils, mast cells, or lymphocytes, such as T cells, B cells, or NK cells). In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are T cells (e.g., CD8 T cells or CD4 T cells) or NK cells. In some embodiments, the T cells are γδ T cells. In some embodiments, the γδ T cells are Vδ2 cells (e.g., Vγ9δ2 cells). In some embodiments, the Vγ4+ cells are derived from human cells. In some embodiments, the Vγ4+ cells are derived from induced pluripotent stem cells. In some embodiments, Vγ4 is an endogenously expressed protein (e.g., as in the case of endogenous Vγ4δ1+ cells) and the heterologous protein expressed by the Vγ4+ cells is a protein other than Vγ4.

[0008] In some embodiments, the Vγ4+ cells expressing a heterologous protein are intended for use in the manufacture of a medicament. In some embodiments, the Vγ4+ cells expressing a heterologous protein, or the medicament, are intended for use in treating inflammation (e.g., IBD, e.g., ulcerative colitis and / or Crohn's disease) or cancer (e.g., colorectal cancer, colon cancer, rectal cancer, anal cancer, hereditary nonpolyposis colorectal cancer (HNPCC), familial adenomatous polyposis (FAP), small intestine cancer (e.g., adenocarcinoma, sarcoma, gastrointestinal carcinoid tumor, lymphoma, or gastrointestinal stromal tumor)) in a subject's intestinal tract. For example, Vγ4+ cells expressing a heterologous protein, or a medicament thereof, can be used in a method of treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level (e.g., as a result of heterozygosity for a mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, e.g., a gene encoding BTNL3, BTNL8, and / or HNF4A). The reference expression level can be a wild-type expression level. In another example, Vγ4+ cells expressing a heterologous protein, or a medicament thereof, can be used in a method of increasing the number or frequency of Vγ4+ cells in the intestinal tract of a subject (e.g., as a result of heterozygosity for a mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, e.g., a gene encoding BTNL3, BTNL8, and / or HNF4A).

[0009] In a second aspect, the present invention provides a composition comprising a population of Vγ4+ cells according to the first aspect. The population comprises 10 6 ~10 10 cells (e.g., 1 x 10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×10 8 cells, 5 x 10 8 cells ~1×109 cells, 1 x 10 9 cells ~5×10 9 cells, 5 x 10 9 cells ~1×10 10 Cells, e.g., about 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7 cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 10 8 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, approximately 5 x 10 9 cells, or approximately 1 x 10 10 In some embodiments, 10 to 50% of the population is a population of Vγ4+ T cells (e.g., 10% to 20%, 20% to 30%, 30% to 40%, or 40% to 50% of the population, e.g., about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% of the population is a population of Vγ4+ T cells). In some embodiments, the number of Vγ4+ T cells in the composition is 1×10 5 ~5×10 9 (e.g., 1×10 5 cells ~5×10 5 cells, 5 x 10 5 cells ~1×10 6 , 1×10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×108 cells, 5 x 10 8 cells ~1×10 9 cells, or 1 x 10 9 cells ~5×10 9 Cells, e.g., about 1 x 10 5 cells, approximately 1.5 x 10 5 cells, approximately 2 x 10 5 cells, approximately 3 x 10 5 cells, approximately 5 x 10 5 cells, approximately 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7 cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 10 8 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, or approximately 5 x 10 9 In some embodiments, the Vγ4+ cells express a heterologous protein (e.g., a Vγ4 or a protein other than a Vγ4). For example, the cells in the population can be Vγ4+ cells of the first aspect. The composition can further comprise one or more additional components, e.g., a pharmaceutically acceptable excipient or diluent.

[0010] In a third aspect, the present invention provides a vector containing a polynucleotide sequence encoding a Vγ4 protein and a polynucleotide sequence encoding a Vδ1 protein (e.g., a polycistronic polynucleotide encoding a Vγ4 protein and a Vδ1 protein). In some embodiments, the vector further comprises a polynucleotide sequence encoding a CD3 protein. In some embodiments, vectors containing one or more polynucleotides encoding a Vγ4 protein and a Vδ1 protein are intended for use in transduction of Vγ4δ1 receptors in T cells (e.g., non-Vγ4+ cells, e.g., αβ T cells (e.g., CD8 T cells, CD4 T cells, or regulatory T cells), or non-Vγ4+ γδ cells such as Vδ2 cells). In some embodiments, vectors containing one or more polynucleotides encoding a Vγ4 protein, a Vδ1 protein, and a CD3 protein are intended for use in transduction of non-T cells (e.g., monocytes, macrophages, dendritic cells, NK cells, or B cells) to express the Vδ1γ4 receptor. In some embodiments, the polynucleotide is DNA. In other embodiments, the polynucleotide is RNA. In some embodiments, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector.

[0011] In a fourth aspect, the invention provides a vector containing a polynucleotide sequence encoding a Vy4 protein and a polynucleotide sequence encoding a V53 protein (e.g., a polycistronic polynucleotide encoding a Vy4 protein and a V53 protein). In some embodiments, the vector further comprises a polynucleotide sequence encoding a CD3 protein. In some embodiments, vectors containing one or more polynucleotides encoding Vy4 and V53 proteins are intended for use in transduction of Vy453 receptors in T cells (e.g., non-Vy4+ cells, e.g., αβ T cells (e.g., CD8 T cells, CD4 T cells, or regulatory T cells), or non-Vy4+ γδ cells such as V52 cells). In some embodiments, vectors containing one or more polynucleotides encoding Vy4, V53, and CD3 proteins are intended for use in transduction of non-T cells (e.g., monocytes, macrophages, dendritic cells, NK cells, or B cells) to express Vy453 receptors. In some embodiments, the polynucleotide is DNA. In other embodiments, the polynucleotide is RNA. In some embodiments, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector.

[0012] In some embodiments, the vector containing a polynucleotide sequence encoding a Vy4, V51 or V53 protein, and / or a CD3 protein is for use in producing a population of Vy4+ T cells, hi some embodiments, the population of Vy4+ T cells has a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level (e.g., as a result of being heterozygous for a mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, e.g., a gene encoding BTNL3, BTNL8, and / or HNF4A), for treating inflammation in the intestinal tract of a subject.

[0013] In some embodiments, the number of Vy4+ T cells in a population produced using a vector containing a polynucleotide sequence encoding a Vy4 protein, a V51 protein or a V53 protein, and / or a CD3 protein is greater than or equal to 1 x 10 5 ~5×10 9 (e.g., 1×10 5 cells ~5×10 5 cells, 5 x 10 5 cells ~1×10 6 , 1×10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×10 8 cells, 5 x 10 8 cells ~1×10 9 cells, or 1 x 10 9 cells ~5×10 9 Cells, e.g., about 1 x 10 5 cells, approximately 1.5 x 10 5 cells, approximately 2 x 10 5 cells, approximately 3 x 10 5 cells, approximately 5 x 10 5 cells, approximately 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7 cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 10 8 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, or approximately 5 x 10 9cells).

[0014] In a fifth aspect, the present invention provides vectors containing a polynucleotide encoding a BTNL3 protein and a polynucleotide encoding a BTNL8 protein (e.g., a polycistronic polynucleotide encoding a BTNL3 protein and a BTNL8 protein). In some embodiments, the vectors containing one or more polynucleotides encoding a BTNL3 protein and a BTNL8 protein are intended for use in transducing intestinal epithelial cells (e.g., intestinal epithelial cells having a mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, e.g., an intestinal epithelial cell having a heterozygous mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, or a homozygous mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A). In some embodiments, the vector further comprises an HNF4A promoter. In some embodiments, the vector further comprises a polynucleotide encoding an HNF4A protein, which may be useful when a subject is heterozygous or homozygous for a mutation in HNF4A. In some embodiments, the polynucleotide is DNA. In other embodiments, the polynucleotide is RNA. In some embodiments, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector.

[0015] In some embodiments, vectors containing polynucleotides encoding BTNL3 and BTNL8 proteins are intended for use in the manufacture of medicaments. In some embodiments, vectors containing polynucleotides encoding BTNL3 and BTNL8 proteins are intended for use in treating inflammation (e.g., IBD) or cancer in the intestinal tract of a subject. For example, vectors containing polynucleotides encoding BTNL3 and BTNL8 proteins can be administered to a subject with a reduced expression level of BTNL3 and / or BTNL8 compared to a reference expression level (e.g., as a result of a homozygous mutation in a polynucleotide encoding BTNL3 or BTNL8 or a heterozygous mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, e.g., a gene encoding BTNL3, BTNL8, and / or HNF4A). The reference expression level can be a wild-type expression level. In another example, vectors containing a polynucleotide encoding a BTNL3 protein and a polynucleotide encoding a BTNL8 protein can be used in a method of increasing the number or frequency of Vγ4+ cells in the intestinal tract of a subject (e.g., as a result of a homozygous mutation in a polynucleotide encoding BTNL3 or BTNL8 or a heterozygous mutation in a polynucleotide encoding BTNL3, BTNL8, and / or HNF4A, e.g., a gene encoding BTNL3, BTNL8, and / or HNF4A).

[0016] In a sixth aspect, the present invention provides a cell transduced with a vector of the third, fourth or fifth aspect or any of its embodiments.

[0017] In a seventh aspect, the present invention provides a composition comprising the vector of any of the third, fourth, or fifth aspects or embodiments thereof. In some embodiments, the composition is used in a method of increasing the number or frequency of Vγ4+ cells in the intestinal tract of a subject. In some embodiments, the composition is used in a method of treating inflammation in the intestinal tract of a subject, or in a method of treating cancer in the intestinal tract of a subject. In some embodiments, the inflammation in the intestinal tract of a subject is associated with inflammatory bowel disease (IBD).

[0018] In an eighth aspect, the present invention provides a method for treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level (e.g., a wild-type expression level), by administering to the subject a polynucleotide encoding BTNL3 protein and a polynucleotide encoding BTNL8 protein, a cell according to the first aspect, a composition according to the second aspect, a vector according to any of the third to fifth aspects, a cell according to the sixth aspect, or a composition according to the seventh aspect.

[0019] In some embodiments, the decreased expression levels of BTNL3 and / or BTNL8 are the result of a mutation in the polynucleotide sequence encoding BTNL3 and / or BTNL8. In some embodiments, the mutation is a deletion variant. In some embodiments, the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface. In some embodiments, the mutation is characterized by expression of a BTNL8*3 fusion protein. In other embodiments, the mutation is characterized by one or more variant SNPs in the BTNL-3 and / or BTNL-8 gene, e.g., the L3B30.2cl genotype. In some embodiments, the mutation is a heterozygous mutation. In some embodiments, the mutation is a homozygous mutation. In some embodiments, the mutation is a single nucleotide polymorphism (SNP). In some embodiments, the mutation is a SNP in a BTNL3 intron. In some embodiments, the polynucleotide encoding the BTNL3 protein and the polynucleotide encoding the BTNL8 protein are on the same expression cassette.

[0020] In some embodiments, the polynucleotide encoding the BTNL3 protein and the polynucleotide encoding the BTNL8 protein are encoded by a vector, which in some embodiments is a viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector).

[0021] In a ninth aspect, the present invention provides methods for treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level (e.g., a wild-type expression level) by administering to the subject a polynucleotide encoding an HNF4A protein. In some embodiments, the subject has a decreased expression level of HNF4A compared to a reference population. In some embodiments, the subject has a mutation in HNF4A that is associated with decreased expression of BTNL3 and / or BTNL8. In some embodiments, the polynucleotide further comprises an HNF4A promoter. In some embodiments, the polynucleotide encoding the HNF4A protein is encoded by a vector, e.g., a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector. In some embodiments, the vector further comprises an HNF4A promoter.

[0022] In a tenth aspect, the present invention provides a method of increasing the number or frequency of Vy4+ cells in the intestinal tract of a subject by administering to the subject a population of Vy4+ cells, wherein the administered population of Vy4+ cells has been screened for expression of Vy4. In some embodiments, screening for Vy4 expression comprises determining whether Vy4 is expressed or the degree of Vy4 expression (e.g., by the percentage of cells expressing Vy4, the mean expression density of Vy4 (e.g., by mean fluorescence intensity), or any combination thereof). In some embodiments, the population of Vy4+ T cells administered to the subject is greater than or equal to 1 x 105 ~5×10 9 (e.g., 1×10 5 cells ~5×10 5 cells, 5 x 10 5 cells ~1×10 6 , 1×10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×10 8 cells, 5 x 10 8 cells ~1×10 9 cells, or 1 x 10 9 cells ~5×10 9 Cells, e.g., about 1 x 10 5 cells, approximately 1.5 x 10 5 cells, approximately 2 x 10 5 cells, approximately 3 x 10 5 cells, approximately 5 x 10 5 cells, approximately 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7 cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 10 8 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, or approximately 5 x 10 9In some embodiments, the population of Vγ4+ T cells administered to a subject is within a mixed cell population that also includes non-Vγ4+ cells. For example, Vγ4+ cells in the population may account for 10 to 50% of the total cell population. The population of Vγ4+ T cells may be, for example, cells according to the first to sixth aspects of the present invention.

[0023] In an eleventh aspect, the present invention provides methods of increasing the number or frequency of Vy4+ cells in the intestinal tract of a subject by administering a population of Vy4+ cells to the subject, wherein the subject has a mutation (e.g., a heterozygous mutation) in a polynucleotide sequence encoding BTNL3 and BTNL8. In some embodiments, the population of Vy4+ T cells administered to the subject is greater than or equal to 1 x 10 5 ~5×10 9 (e.g., 1×10 5 cells ~5×10 5 cells, 5 x 10 5 cells ~1×10 6 , 1×10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×10 8 cells, 5 x 10 8 cells ~1×10 9 cells, or 1 x 10 9 cells ~5×10 9 Cells, e.g., about 1 x 10 5 cells, approximately 1.5 x 10 5 cells, approximately 2 x 10 5 cells, approximately 3 x 10 5 cells, approximately 5 x 10 5 cells, approximately 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 10 8 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, or approximately 5 x 10 9 In some embodiments, the population of Vγ4+ T cells administered to a subject is within a mixed cell population that also includes non-Vγ4+ cells. For example, Vγ4+ cells in the population may account for 10 to 50% of the total cell population. The Vγ4+ T cells may be, for example, cells according to the first to sixth aspects of the present invention.

[0024] In a twelfth aspect, the present invention provides a method of increasing the number or frequency of Vy4+ cells in the intestinal tract of a subject by administering a population of Vy4+ cells to the subject, wherein the subject has intestinal inflammation, such as IBD, or intestinal cancer. In some embodiments, the population of Vy4+ T cells administered to the subject is greater than or equal to 1 x 10 5 ~5×10 9 (e.g., 1×10 5 cells ~5×10 5 cells, 5 x 10 5 cells ~1×10 6 , 1×10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×10 8 cells, 5 x 10 8 cells ~1×10 9 cells, or 1 x 10 9 cells ~5×10 9 Cells, e.g., about 1 x 10 5 cells, approximately 1.5 x 10 5 cells, approximately 2 x 105 cells, approximately 3 x 10 5 cells, approximately 5 x 10 5 cells, approximately 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7 cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 10 8 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, or approximately 5 x 10 9 In some embodiments, the population of Vγ4+ T cells administered to a subject is within a mixed cell population that also includes non-Vγ4+ cells. For example, Vγ4+ cells in the population may account for 10 to 50% of the total cell population. The population of Vγ4+ T cells may be, for example, cells according to the first to sixth aspects of the present invention.

[0025] In some embodiments, Vγ4+ cells administered to a subject to treat inflammation in the subject's intestinal tract or to increase the number or frequency of Vγ4+ cells in the subject's intestinal tract express a heterologous protein. In some embodiments, the Vγ4+ cells administered to a subject are derived from Vγ4− cells, and Vγ4 is a heterologous protein. The Vγ4− cells can be any suitable cell type, including immune cells (e.g., monocytes, macrophages, dendritic cells, neutrophils, eosinophils, basophils, mast cells, lymphocytes (e.g., T cells, B cells, NK cells, or combinations thereof)), or combinations thereof. In some embodiments, the immune cells comprise lymphocytes. In some embodiments, the lymphocytes comprise T cells (e.g., CD8 T cells, CD4 T cells, or regulatory T cells) or NK cells. In some embodiments, the T cells comprise γδ T cells. In some embodiments, the γδ T cells comprise Vδ2 cells (e.g., Vγ9δ2 cells).

[0026] In some embodiments of any of the first through twelfth aspects, the Vγ4+ cells are derived from human cells. In some embodiments, Vγ4 is an endogenously expressed protein (e.g., as in the case of endogenous Vγ4δ1+ cells) and the heterologous protein expressed by the Vγ4+ cells is a protein other than Vγ4. In some embodiments, Vγ4 is an endogenously expressed protein (e.g., as in the case of endogenous Vγ1γ4+ cells or Vγ4δ3+ cells) and the heterologous protein expressed by the Vγ4+ cells is a protein other than Vγ4.

[0027] In some embodiments of any of the first through twelfth aspects, the Vγ4+ cells administered to the subject endogenously express Vγ4. In some embodiments, the Vγ4+ cells administered to the subject have not been modified to express a heterologous protein.

[0028] In some embodiments, the population of Vy4+ cells administered to the subject increases the number of Vy4+ cells in a γδ T cell population in the subject's intestinal tract to a number effective to alleviate one or more symptoms associated with intestinal inflammation or intestinal cancer, in some embodiments, the intestinal inflammation is associated with IBD.

[0029] In some embodiments, the method further comprises administering to the subject one or more additional therapeutic agents.

[0030] In a thirteenth aspect, the present invention provides a population of Vγ4+ cells for use in a method according to any one of the tenth, eleventh or twelfth aspects. The population of Vγ4+ cells may, for example, be the Vγ4+ cells of the first aspect.

[0031] In a fourteenth aspect, the present invention provides a method for identifying mutations in polynucleotide sequences encoding BTNL3 and BTNL8 by: (a) comparing the level of polynucleotide sequences associated with deletion variants in polynucleotides encoding BTNL3 and BTNL8 in a subject's sample with a reference level of polynucleotide sequences associated with deletion variants, whereby an increased level of polynucleotide sequences associated with deletion variants in polynucleotides encoding BTNL3 and BTNL8 in the subject's sample compared to the reference level indicates the presence of mutations in the polynucleotide sequences encoding BTNL3 and BTNL8; or (b) comparing the level of polynucleotide sequences encoding BTNL3 and BTNL8 in a subject's sample with a reference level of polynucleotide sequences encoding BTNL3 and BTNL8, whereby a decreased level of polynucleotides encoding BTNL3 and BTNL8 in the subject's sample compared to the reference level indicates the presence of mutations in the polynucleotide sequences encoding BTNL3 and BTNL8.

[0032] In some embodiments, the reference levels are from a sample having wild-type BTNL3 and BTNL8 genes.

[0033] In some embodiments, the mutation is a deletion variant. In some embodiments, the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface, e.g., compared to a reference sample, e.g., a wild-type sample.

[0034] In some embodiments, the mutation is characterized by the expression of a BTNL8*3 fusion protein.

[0035] In some embodiments, the mutation is a single nucleotide polymorphism (SNP). In some embodiments, the mutation is a SNP in a BTNL3 intron.

[0036] In a fifteenth aspect, the present invention provides a method for identifying a subject susceptible to inflammation in the intestinal tract, the method comprising: Providing a cell sample from a subject; and determining the presence of a mutation in a polynucleotide sequence encoding HNF4A, BTNL3 and / or BTNL8 in the cell, wherein the presence of the mutation indicates that the subject is susceptible to inflammation in the intestinal tract.

[0037] In some embodiments, a method for identifying a subject who is likely to develop or is at risk for developing inflammation in the intestinal tract (e.g., IBD) may include (a) determining whether the subject has a mutation in a polynucleotide sequence encoding BTNL3 and BTNL8, and (b) identifying the subject as likely to develop IBD based on the presence of the mutation.

[0038] In some embodiments, step (a) comprises identifying mutations in the polynucleotide sequences encoding BTNL3 and BTNL8 by: (i) comparing the level of polynucleotide sequences associated with deletion variants in polynucleotides encoding BTNL3 and BTNL8 in the subject's sample to a reference level of polynucleotide sequences associated with deletion variants, whereby an increased level of polynucleotide sequences associated with deletion variants in polynucleotides encoding BTNL3 and BTNL8 in the subject's sample compared to the reference level indicates the presence of a mutation in the polynucleotide sequences encoding BTNL3 and BTNL8; or (ii) comparing the level of polynucleotide sequences encoding BTNL3 and BTNL8 in the subject's sample to a reference level of polynucleotide sequences encoding BTNL3 and BTNL8, whereby a decreased level of polynucleotides encoding BTNL3 and BTNL8 in the subject's sample compared to the reference level indicates the presence of a mutation in the polynucleotide sequences encoding BTNL3 and BTNL8. In some embodiments, the reference level is that of a sample having wild-type BTNL3 and BTNL8 genes. In some embodiments, the mutation is a deletion variant. In some embodiments, the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface. In some embodiments, the mutation is characterized by expression of a BTNL8*3 fusion protein. In some embodiments, the mutation is a single nucleotide polymorphism (SNP). In some embodiments, the mutation is a SNP in a BTNL3 intron.

[0039] In some embodiments, the method further includes (c) providing a recommendation to the subject to pursue gene therapy or selecting the individual for gene therapy, wherein the gene therapy is directed at inducing BTNL3 and / or BTNL8 expression. For example, the subject may have decreased expression of BTNL3 and / or BTNL8, e.g., as a result of a heterozygous mutation in one or more genes encoding BTNL3, BTNL8, and HNF4A. Alternatively, the subject may have no functional expression of BTNL3 and / or BTNL8, e.g., as a result of a homozygous mutation in one or more genes encoding BTNL3, BTNL8, and HNF4A.

[0040] In some embodiments, gene therapy involves administering to a subject a polynucleotide encoding a BTNL3 protein and a polynucleotide encoding a BTNL8 protein. In some embodiments, the polynucleotide encoding the BTNL3 protein and the polynucleotide encoding the BTNL8 protein are on the same expression cassette. In some embodiments, the polynucleotide encoding the BTNL3 protein and the polynucleotide encoding the BTNL8 protein are encoded by a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector.

[0041] In other embodiments, gene therapy comprises administering to a subject a polynucleotide encoding HNF4A protein. In some embodiments, the polynucleotide encoding HNF4A protein is encoded by a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, or an AAV vector.

[0042] In some embodiments, the method further includes (c) providing a recommendation to the subject to pursue adoptive cell therapy or selecting the subject for adoptive cell therapy. For example, the subject may be recommended for or selected for treatment using the method of any one of the tenth, eleventh, or twelfth aspects. The adoptive cell therapy may include, for example, administering a population of Vy4+ cells to the subject, wherein the subject has a mutation (e.g., a heterozygous mutation) in the polynucleotide sequence encoding BTNL3 and BTNL8. In some embodiments, the population of Vy4+ T cells administered to the subject is greater than or equal to 1×10 5 ~5×10 9 (e.g., 1×10 5 cells ~5×10 5 cells, 5 x 10 5 cells ~1×10 6 , 1×10 6 cells ~5×10 6 cells, 5 x 10 6 cells ~1×10 7 cells, 1 x 10 7 cells ~5×10 7 cells, 5 x 10 7 cells ~1×10 8 cells, 1 x 10 8 cells ~5×10 8 cells, 5 x 10 8 cells ~1×10 9 cells, or 1 x 10 9 cells ~5×10 9 Cells, e.g., about 1 x 10 5 cells, approximately 1.5 x 10 5 cells, approximately 2 x 10 5 cells, approximately 3 x 10 5 cells, approximately 5 x 10 5 cells, approximately 1 x 10 6 cells, approximately 1.5 x 10 6 cells, approximately 2 x 10 6 cells, approximately 3 x 10 6 cells, approximately 5 x 10 6 cells, approximately 1 x 10 7 cells, approximately 1.5 x 10 7 cells, approximately 2 x 10 7 cells, approximately 3 x 10 7 cells, approximately 5 x 10 7 cells, approximately 1 x 108 cells, approximately 2 x 10 8 cells, approximately 3 x 10 8 cells, approximately 5 x 10 8 cells, approximately 1 x 10 9 cells, approximately 2 x 10 9 cells, approximately 3 x 10 9 cells, or approximately 5 x 10 9 In some embodiments, the population of Vγ4+ T cells administered to a subject is within a mixed cell population that also includes non-Vγ4+ cells. For example, Vγ4+ cells in the population may account for 10-50% of the total cell population.

[0043] Any embodiment disclosed in this application may be combined with any other disclosed embodiment within each of the first to fourteenth aspects of the present invention.

[0044] BRIEF DESCRIPTION OF THE DRAWINGS Embodiments and experiments illustrating the principles of the present invention will be discussed below in conjunction with the accompanying drawings, in which: [Brief explanation of the drawings]

[0045] [Figure 1A] Figures 1A-1G are a series of graphs describing the development and maturation of mouse intraepithelial lymphocytes (IELs). All error bars represent the mean ± SD. Small intestinal Vγ7+ IELs developed between 2 and 3 weeks of age and remained stable for at least 9 months (Figure 1A). [Figure 1B] By day 21, the majority of IELs were Vγ7+ in whole-mount small intestine (SI) confocal microscopy (Fig. 1B). [Figure 1C] Vγ7+ IELs from 21-40 day old mice had high surface expression of CD122, TIGIT, CD3 (TCR), and CD45RB, and low expression of Rorγc and Sox13 (Fig. 1C). In contrast, Vγ7- and αβ IELs had low surface levels of CD122 and TIGIT, and Vγ7- IELs expressed higher levels of Rorγc and Sox13 (Fig. 1C). [Figure 1D]Surface levels of various markers in Vγ7+ IELs increased on days 21–40 compared with days 14–17 (CD122, TIGIT, Lag3, CD8α), and immature Vγ7+ IELs had a phenotype more similar to mature Vγ7- IELs (Figures 1D–E). [Figure 1E] Surface levels of various markers in Vγ7+ IELs increased on days 21–40 compared with days 14–17 (CD122, TIGIT, Lag3, CD8α), and immature Vγ7+ IELs had a phenotype more similar to mature Vγ7- IELs (Figures 1D–E). [Figure 1F] Genes differentially expressed between Vγ7+CD122HI and Vγ7+CD122LOIEL from day 14–17 mice were similar to genes differentially expressed between Skint1-selected and non-selected Vγ5+ dendritic epidermal T cell (DETC) precursors ( Figure 1F ). [Figure 1G] Vγ7+ IELs also had higher Ki67 expression than Vγ7- IELs, indicating cell cycle progression (FIG. 1G). D, days; W, weeks. All error bars represent the mean ± SD. [Figure 2] Figures 2A-2D are a series of graphs showing phenotypic differences between CD122 HIV γ7+ IELs and other IEL subsets. Vγ7+, Vγ7-, and TCRβ+ IELs express distinct cell surface markers. Vγ7+ expressed higher surface levels of Lag3, CD69, and CD8αα+, and lower levels of Thy1 and CD5 (Figure 2A). WT Vγ7+CD122HI IELs had a distinct cell surface phenotype from Vγ7+CD122LO IELs (Figure 2B). Vγ7+CD122HI and Vγ7+CD122LO IELs derived from WT mice at D14-D17 showed differential gene expression (log-2 fold change) of many cell surface proteins. Many of the same genes were also regulated by Skint1 selection of DETC progenitors (Figure 2C). Vγ7+ IELs incorporated significantly more EdU than Vγ7- IELs, indicating increased cell division (Fig. 2D). All error bars represent the mean ± SD. [Figure 3A]Figures 3A-E are a series of graphs demonstrating that endogenous intestinal elements form IELs. All error bars represent the mean ± SD. IELs were present in athymic NU / NU mice, and antibody GL2 detected the Vδ4 (encoded by TRDV2-2) chain in IELs (Figure 3A). [Figure 3B] Vγ7+ IELs had similar CD122 and TCR surface levels between mice housed in conventional cages and mice housed in germ-free conditions, fed a protein-free diet, or both, indicating that Vγ7+ IELs may be regulated by intrinsic rather than environmental factors (Fig. 3B). [Figure 3C] Btnl1, Btnl4, and Btnl6 were expressed in the proximal SI, with levels stabilizing at approximately postnatal day 14 (Fig. 3C). [Figure 3D] Histological analysis showed that Btnl1, Btnl4, and Btnl6 were expressed in postmitotic villous enterocytes interspersed with IELs (Figures 3D-3E). [Figure 3E] Histological analysis showed that Btnl1, Btnl4, and Btnl6 were expressed in postmitotic villous enterocytes interspersed with IELs (Figures 3D-E). All error bars represent the mean ± SD. [Figure 4A] Figures 4A-4K are a series of graphs and schematics characterizing the local intestinal development of CD122HIVγ7+ IELs. All error bars represent the mean ± SD. Deep sequencing of TCR Vδ chain usage in WT Vγ7+ IELs sorted from C57Bl / 6 (WT) mice at W7-10 revealed approximately 25% TRDV2-2 (Figure 4A). [Figure 4B] Vγ7+ and Vγ7+GL2+ thymocytes were not observed in large numbers at 8 weeks of age (Fig. 4B). [Figure 4C] Vγ7+ thymocytes express cell surface markers indicative of a lack of maturation compared to Vγ7+ IELs (CD5+, Thy1+, and CD122, CD45RB, and TCR low) (Figure 4C-4E). [Figure 4D]Vγ7+ thymocytes express cell surface markers indicative of a lack of maturation compared to Vγ7+ IELs (CD5+, Thy1+, and CD122, CD45RB, and TCR low) (Figure 4C-4E). [Figure 4E] Vγ7+ thymocytes express cell surface markers indicative of a lack of maturation compared to Vγ7+ IELs (CD5+, Thy1+, and CD122, CD45RB, and TCR low) (Figure 4C-4E). [Figure 4F] Mice lacking lymph nodes and Peyer's patches (aly / aly) expressed Vγ7+ and Vγ7+GL2+ IELs (Fig. 4F). [Figure 4G] Btnl1 was expressed in postmitotic villous enterocytes interspersed with IELs (Fig. 4G), and Btnl1 expression was highest in the proximal and central SI (Fig. 4H), with much higher expression in the proximal SI than in the thymus (Fig. 4I). [Figure 4H] Btnl1 was expressed in postmitotic villous enterocytes interspersed with IELs (Fig. 4G), and Btnl1 expression was highest in the proximal and central SI (Fig. 4H), with much higher expression in the proximal SI than in the thymus (Fig. 4I). [Figure 4I] Btnl1 was expressed in postmitotic villous enterocytes interspersed with IELs (Fig. 4G), and Btnl1 expression was highest in the proximal and central SI (Fig. 4H), with much higher expression in the proximal SI than in the thymus (Fig. 4I). [Figure 4J] Schematic diagram showing the targeted loci in Btnl1 − / − and Btnl4 − / − mice ( Fig. 4J ). [Figure 4K] Southern blot analysis confirmed that Btnl1 and Btnl4 genomic DNA sequences were absent in the knockout mice (Fig. 4K). All error bars represent the mean ± SD. [Figure 5A] Figures 5A-5D are a series of graphs demonstrating that intestinal IEL composition is dependent on Btnl1. All error bars represent the mean ± SD. Vγ7+ and Vγ7+GL2+ IELs were reduced in Btnl1- / - mice, whereas other IEL cell types were unaffected (Figures 5A-5B). [Figure 5B] Vγ7+ and Vγ7+GL2+ IELs were reduced in Btnl1- / - mice, whereas other IEL cell types were unaffected (Figures 5A-5B). [Figure 5C] A decrease in Vγ7+ and Vγ7+GL2+ IELs was also observed in Btnl- / -NU / NU mice, indicating that Btnl functions outside the thymus (Fig. 5C). [Figure 5D] Vγ7+ and Vγ7+GL2+ IELs were not reduced in Btnl4- / - mice, indicating that Vγ7+ and Vγ7+GL2+ IELs are specifically dependent on Btnl1 (Figure 5D). All error bars represent the mean ± SD. [Figure 6A] Figures 6A-6E are a series of graphs and tables demonstrating that Btnl1 has no detectable effect on systemic T, B, and myeloid cell compartments. All error bars represent the mean ± SD. Vγ7+ IELs were reduced in Btnl1 indel / indel mice compared to WT mice (Figure 6A). [Figure 6B] The immune compartments of WT, Btnl1+ / -, and Btnl1- / - mesenteric lymph nodes (MLNs) and spleens were analyzed by flow cytometry and found to be comparable among all three genotypes (Figures 6B-C). [Figure 6C] The immune compartments of WT, Btnl1+ / -, and Btnl1- / - mesenteric lymph nodes (MLNs) and spleens were analyzed by flow cytometry and found to be comparable among all three genotypes (Figures 6B-C). [Figure 6D] We assessed TCRV γ-chain usage in MLN and splenic lymphocytes from WT, Btnl1 + / − , and Btnl1 − / − mice by flow cytometry and found it was comparable among the three genotypes (Fig. 6D ). [Figure 6E]Vγ7+ and Vγ7+GL2+ thymocytes from WT or Btnl1+ / − and Btnl1− / − mice were assayed by flow cytometry to enumerate total cell numbers (left) and cell surface phenotypes (right) at three time points, which were similar among the three genotypes (Figure 6E). All error bars represent the mean ± SD. [Figure 7A] Figures 7A-7E are a series of graphs showing that Btnl1 induces selective proliferation and maturation of intestinal IELs. All error bars represent the mean ± SD. Compared to WT mice, significantly fewer Vγ7+ IELs incorporated EdU in 5-week-old Btnl1- / - mice (Figure 7A). [Figure 7B] Vγ7+ and Vγ7+GL2+ IELs in Btnl1- / - mice also retained an immature phenotype, with lower levels of CD122 and TIGIT and higher levels of Thy1 than mature WT Vγ7+ and Vγ7+GL2+ IELs (Figures 7B-7C). [Figure 7C] Vγ7+ and Vγ7+GL2+ IELs in Btnl1- / - mice also retained an immature phenotype, with lower levels of CD122 and TIGIT and higher levels of Thy1 than mature WT Vγ7+ and Vγ7+GL2+ IELs (Figures 7B-7C). [Figure 7D] Bone marrow (BM) transplantation into irradiated TCRδ − / − mice demonstrated that BM from either WT or Btnl1 − / − mice was equally effective in IEL reconstitution ( Fig. 7D ). [Figure 7E] However, reconstitution of irradiated Btnl1- / -Vγ7+ IELs was much less effective than reconstitution of irradiated CD45.2+C57Bl / 6Vγ7+ IELs in CD45.2+C57Bl / 6BM (Figure 7E). All error bars represent the mean ± SD. [Figure 8]Figures 8A-8D are a series of graphs showing the effect of Btnl1 on the intestinal engraftment, proliferation, and retention of CD122 HIV γ7 + IELs. Significantly fewer Vγ7 + IELs expressed Ki67 in Btnl1 − / − mice than in WT mice, indicating reduced cell cycle progression (Figure 8A). btnl1 − / − Vγ7 + CD122 HI and Vγ7 + GL2 + CD122 HI IELs, shown in Figure 7B, have a distinct cell surface phenotype from Vγ7 + CD122 LO and Vγ7 + GL2 + CD122 LO IELs, also shown in Figure 7B (Figure 8B). Irradiated TCRδ KO mice reconstituted with WT BM were analyzed for γδ IEL composition at the indicated time points after BM transplantation to confirm the time course (Figure 8C). IELs isolated from W4-5 WT mice were column-purified using CD45 microbeads and adoptively transferred intravenously into W6 TCRδ- / - or TCRδ- / -Btnl1- / - hosts. γδ T cell composition was assayed by flow cytometry 2-3 weeks later, demonstrating impaired reconstitution in TCRδ- / -Btnl1- / - hosts (Figure 8D). All error bars represent the mean ± SD. [Figure 9A] Figures 9A-9E are a series of graphs showing that villin-specific Btnl1 induction restores Vγ7+ IELs in vivo. All error bars represent the mean ± SD. Vγ7+ IELs in bitransgenic (BiTg) adult mice expressing Dox-inducible Btnl1 and rtTA under the control of the villin promoter showed a shift in surface marker expression toward a more mature Vγ7+ phenotype when the mice were administered Dox (1 mg / ml, 2% sucrose) (Figure 9A). [Figure 9B] Dox-treated adult BiTg mice also showed an increase in Ki67, which was not observed in single-transgenic (SiTg) Dox-treated mice that did not have rtTA or in mice that did not receive Dox (received 2% sucrose) (Fig. 9B ). [Figure 9C] Dox-treated adult BiTg mice showed no change in the number of Vγ7+ cells (Fig. 9C). [Figure 9D]Dox treatment of BiTg pups increased the percentage of Vγ7+ IELs (Fig. 9D) and altered the expression of cell surface markers such that Vγ7+ cells derived from Dox-exposed BiTg pups phenocopied WT Vγ7+ cells (Fig. 9E). [Figure 9E] Dox treatment of BiTg pups increased the percentage of Vγ7+ IELs (Figure 9D) and altered the expression of cell surface markers such that Vγ7+ cells from Dox-exposed BiTg pups phenocopied WT Vγ7+ cells (Figure 9E). All error bars represent the mean ± SD. [Figure 10]Figures 10A-10F are a series of schematics and graphs characterizing inducible Btnl1 transgene expression and its effects in adult mice. Schematic representation of the WT Btnl1 locus (top) and the TRE-Btnl1 transgene construct (bottom). Light bars: untranslated region; dark bars: translated region. (TRE) Upstream—tetracycline response element / CMV promoter and downstream—β-globin / polyA (Figure 10A). Southern blot detecting transgene insertion. Genomic DNA was digested with EcoRI as indicated (arrows), and probes (schematic representation below the bar in Figure 10A) targeting the indicated region (exon 3 / 4 boundary of the ORF) were generated to detect WT and targeted alleles (Figure 10B). W7-13 (adult) mice with the indicated genotype on a Btnl1- / - background were administered doxycycline water (1 mg / ml Dox, 2% sucrose) or control water (2% sucrose) for 1–2 weeks. Gene expression assessed by qRTPCR in the proximal small intestine of adult mice after the indicated treatment demonstrated that btnl1 expression was increased in Dox-treated BiTg mice (Figure 10C). γδ IEL composition (left) and absolute cell number (right) were assessed by flow cytometry in adult mice after the indicated treatment and found that treatment did not affect the proportion or number of Vγ7+ cells (Figure 10D). Ki67 and cell surface CD122 expression were analyzed in Vγ7+ IELs derived from adult mice after the indicated treatment and found that both were increased in Dox-treated BiTg mice (Figure 10E). Ki67 expression was significantly higher in Vγ7+ IELs than in Vγ7- and TCRβ+ IELs from Dox-treated BiTg adult mice (FIG. 10F). All error bars represent the mean ± SD. [Figure 11A] Figures 11A-11H are a series of graphs showing that intestinal Vγ7+ IELs respond to Btnl proteins. All error bars represent the mean ± SD. IELs exposed to L1+6MODE-K cells (transfected with Btnl1 and Btnl6) for 12 hours showed upregulation of CD25, a measure of TCR stimulation, primarily in Vγ7+ IELs (Figure 11A). [Figure 11B]Co-culture of L1+6 cells with IELs derived from Nur77.gfp mice for 12 hours resulted in an increase in GFP, another indicator of TCR activation, in Vγ7+ IELs (FIG. 11B). [Figure 11C] CD25 activation also resulted in downregulation of CD122, and a CD25+GFP+CD122- population emerged in Vγ7+ IELs cocultured with L1+6 MODE-K cells, but not in Vγ7+ IELs cocultured with empty vector (EV)-transfected MODE-K cells (Fig. 11C). [Figure 11D] Vγ7+CD25+ IELs cocultured with L1+6MODE-K cells also showed a slight downregulation of TCR (CD3) (Figure 11D). [Figure 11E] Only IELs in contact with L1+6 cells showed an increase in CD25 (Fig. 11E). [Figure 11F] Vγ7+ cells derived from Btnl1- / - mice could also respond to L1+6 by increasing surface expression of CD25 (Figure 11F), and IELs that did not undergo Btnl1 selection in vivo (IELs derived from Btnl1- / - mice, as well as TCRαβ+ and Vγ7+ IELs) responded to anti-CD3 by increasing surface CD25 expression (Figure 11G). [Figure 11G] Vγ7+ cells derived from Btnl1- / - mice could also respond to L1+6 by increasing surface expression of CD25 (Figure 11F), and IELs that did not undergo Btnl1 selection in vivo (IELs derived from Btnl1- / - mice, as well as TCRαβ+ and Vγ7+ IELs) responded to anti-CD3 by increasing surface CD25 expression (Figure 11G). [Figure 11H] Increased IEL effector cytokines IFNγ, CCL4, and GM-CSF were observed in supernatants of IEL cocultures with L1+6 cells from WT and TCRβ mice, but not from TCRδ mice (Figure 11H). All error bars represent the mean ± SD. [Figure 12A]Figures 12A-12E are a series of graphs showing the effect of coexpression of Btnl1 and Btnl6 on Vγ7+ IELs. All error bars represent the mean ± SD. Cell surface expression of cotransfected FLAG-Btnl1, HIS-Btnl4, or HA-Btnl6 in MODE-K cells. Histogram overlays show the expression of each Btnl1 after gating on GFP+ cells (numbers in parentheses indicate geometric mean fluorescence intensity (gMFI)), demonstrating that coexpression of Btnl1 with Btnl4 or Btnl6 increases surface expression (Figure 12A). [Figure 12B] Primary small intestinal IELs cultured for the indicated times with MODE-K cells transduced with constructs expressing empty vector (EV) versus Btnl1 + Btnl6 (L1 + 6) showed that Vγ7 + IELs had increased CD25 surface expression when cocultured with L1 + 6-expressing MODE-K cells ( Figure 12B ). [Figure 12C] Representative plots of cell surface CD122 and CD25 expression on Vγ7+ cells after overnight culture under the indicated conditions demonstrated that co-culture with MODE-K cells resulted in an increase in CD25 and a decrease in CD122 (Figure 12C). [Figure 12D] Cell surface CD25 expression was increased in positive FACS-sorted Vγ7+ IELs after overnight coculture with L1+6-expressing MODE-K cells compared to EVs (Figure 12D). [Figure 12E] After overnight coculture with the indicated MODE-K transductants in the presence of PP2, PP3, or vehicle, cell surface CD25 expression in primary Vγ7+ IELs shows that CD25 upregulation was inhibited by PP2 (FIG. 12E). All error bars represent the mean ± SD. [Figure 13A] Figures 13A-H are a series of graphs demonstrating the regulation of human intestinal Vγ4+ cells by BTNL3 and BTNL8. All error bars represent the mean ± SD. Human γδ cells isolated from the ascending colon were enriched for Vδ1+ cells, although Vδ2+ and Vδ1-Vδ2- cells were also present (Figure 13A). [Figure 13B]Human intestinal γδ T cells with specific Vδ profiles reacted with distinct Vγ antibodies, indicating the existence of cell subsets (Fig. 13B). [Figure 13C] Surface TCRγδ / Vδ1 expression on human intestinal lymphocytes was reduced after 12 hours of co-culture with BTNL3 and BTNL8 (L3+8)-transduced HEK293T cells compared to BTNL3 (L3)-transduced HEK293T cells. Arrows indicate shifts in TCR staining (Figure 13C). [Figure 13D] TCR downregulation was observed only in V52- cells and only in response to co-culture with L3+8 cells (Fig. 13D). [Figure 13E] L3+8 cells also induced upregulation of CD25 (FIG. 13E). [Figure 13F] Vδ2- cells, which showed TCR downregulation after coculture with L3+8 cells, were detected with antibodies against Vγ2 / 3 / 4, but not Vγ8, Vγ5 / 3, or Vγ9 (Figures S13F-G). [Figure 13G] Vδ2- cells, which showed TCR downregulation after coculture with L3+8 cells, were detected with antibodies against Vγ2 / 3 / 4, but not Vγ8, Vγ5 / 3, or Vγ9 (Figures S13F-G). [Figure 13H] L3+8 did not induce TCR downregulation in γδ T cells derived from skin or peripheral blood mononuclear cells (PBMCs) (FIG. 13H). All error bars represent the mean ± SD. [Figure 14A] Figures 14A-14I are a series of graphs, gels, and schematics characterizing the selective impact of BTNL3 and BTNL8 co-expression on human intestinal γδ cells and γδ T cells. FACS-sorted γδ T cells harvested from human intestinal tissue were analyzed by deep sequencing for TCR Vγ chain usage and found to express primarily Vγ4 and Vγ8 (Figure 14A). [Figure 14B] Schematic diagram illustrating the mouse and human Btnl2 / BTNL2 and Btnl9 / BTNL9 loci compiled from the NCBI gene viewer (Figure 14B). [Figure 14C] (C) Conventional RT-PCR analysis of BTN3A2, BTNL3, and BTNL8 expression in the indicated tissues showed that BTNL3 and BTNL8 were specifically expressed in the intestinal tract (Figure 14C). [Figure 14D] Conventional RT-PCR analysis of BTN3A1, BTNL3, BTNL8, EPCAM, and TCRVγ2 / 3 / 4 expression in the indicated samples showed that BTNL3 and BTNL8 were expressed in EpCAM+ epithelial cells (Figure 14D). [Figure 14E] Cell surface expression of FLAG-BTNL3, FLAG-BTNL8S, or FLAG-BTNL8 cotransfected in HEK293 cells with the indicated constructs. Histogram overlays show the expression of each BTNL after gating on GFP+ cells (numbers in parentheses indicate geometric mean fluorescence intensity (gMFI)), demonstrating that coexpression of BTNL3 and BTNL8 increases the expression of both proteins (Figure 14E). [Figure 14F] Schematic illustrating the method for isolation of human intestinal tissue-resident lymphocytes and coculture with HEK293 transducins. (1) Endoscopic biopsies collected from the ascending colon of healthy donors. (2) Washed in complete medium supplemented with antibiotics. (3) One biopsy applied to each matrix. (4) Cultured for 5–7 days in complete medium supplemented with antibiotics, IL-2, and IL-15. (5) Coculture with HEK293 cell lines transduced with EV, L3, L8, or L3+8 (Figure 14F). [Figure 14G] Cell surface CD25 expression was increased in a subset of human intestinal-derived lymphocytes after co-culture with L3+8-transduced HEK293 cells compared to EV-transduced cells (Figure 14G). [Figure 14H] Gating parameters for sorting of Btnl3+8-responsive human gut-derived lymphocytes. More Vγ4 expression was observed when L3+8-responsive cells were sorted (FIG. 14H). [Figure 14I]TCR Vγ-chain usage (left) and cell surface TCRγδ expression (right) in gut-derived γδ T cells (isolated from a donor unresponsive to BTNL3+8) after coculture with EV vs. L3+8-transduced HEK293 cells showed that the unresponsive donor had a γδ T cell population dominated by Vγ8+ cells (Figure S14I). [Figure 15] Sequence alignment showing TCR gamma chain sequences from gut and skin cells. The top four sequences are from L3+8-responsive gut lymphocytes with downregulated TCRs sorted by flow cytometry from a single donor. These cells expressed Vγ4. The bottom four sequences are TCR gamma transcripts from skin-derived TCR gamma delta cells (G234SK01), which were biased toward Vγ3. [Figure 16] Figure 16A is a series of flow cytometry histograms showing the response of human intestinal γδ cells after overnight coculture with 293 cells transduced with empty vector (EV) or vectors expressing BTNL3 and BTNL8 (red histograms). Figure 16B is a series of graphs. The first panel from the left shows quantification of TCRγδ expression measured as in Figure 16A for seven donors. The second panel from the left shows TCRγδ expression in TCRγ2 / 3 / 4 cells compared to total TCRγ9 cells. The third panel from the left shows γδ cell frequency as a percentage of CD3 cells. The fourth (far right) panel shows the percentage of each cell type expressing TCRγ2 / 3. [Figure 17] Figure 17A shows the schematic protein-coding structures of human BTNL3, BTNL8, and BTNL8*3. BTNL8*3 is a fusion protein encoded by a haplotype in which the BTNL8 ectodomain and transmembrane (TM) domain are fused to the intracellular domain of BTNL3, as shown (Figure 17A). Figure 17B shows the PCR strategy used to detect common haplotypes encoding BTNL8 and BTNL3 from rare haplotypes encoding BTNL8*3. There is a common forward primer (black) and genotype-specific reverse primers (blue, red). The product of each PCR reaction is approximately 1.3 kb. [Figure 18] This is a series of images showing BTNL8*3 genotyping results. Gel electrophoresis PCR products of individual donors designated on each lane were aligned with size markers of approximately 1 kb, 1.5 kb, 2 kb, and 3 kb in ascending order. Donor names are color-coded by the genotype identified by the PCR analysis, summarized in the box at the top left. Top left: Red = homozygous for BTNL8*3; Purple = heterozygous for BTNL8*3 and the alleles encoding BTNL8 and BTNL3 [termed WT]; Blue = two alleles encoding BTNL8 and BTNL3, respectively. [Figure 19]

[0023] Figure 1 is a series of graphs showing cell biological analysis of BTNL proteins. Flow cytometry of surface protein expression by 293 cells of FLAG-tagged proteins (as indicated above each plot) transfected into 293 cells, along with the untagged constructs listed below the panel, are color-coded to match each histogram. [Figure 20] A series of flow cytometry plots showing functional analysis of BTNL protein. Flow cytometry data for TCRγδ expression (x-axis) and TCR Vγ2 / 3 / 4 expression (y-axis) after co-culture with 293 cells transfected with empty vector (EV) or the BTNL gene indicated in each panel. [Figure 21] (a) and (b) are a set of flow cytometry plots showing the intestinal γδ T cell compartment in BTNL8*3 homozygotes. The left panel shows the γδ T cell population in patient GN006, who was diagnosed with IBD, and the right panel shows the γδ T cell population in patient GN014, who has a family history of ulcerative colitis. [Figure 22] A series of immunoblots showing the indicated TCR expression in BTNL8*3 heterozygotes. Band 1 (left) is from whole grid culture cells from patient GN017, band 2 (center) is from whole grid culture cells from patient GN019, and band 3 (right) is from Vγ2 / 3 / 4+ sorted cells from patient GN019. [Figure 23]Figures 23A-B are a series of graphs showing the effect of SNPs on BTNL3 and BTNL8 cell surface levels. Figure 23A is a set of whisker plots showing the expression of BTNL3 (left) and BTNL8 (right) in subjects with the rs4700772 haplotype as homozygotes (AA, n=9) or heterozygotes (GA, n=36) compared to the more common allele (GG, n=75). Figure 23B is a set of whisker plots showing the expression of BTNL3 (left) and BTNL8 (right) in subjects with the rs6868418 haplotype as homozygotes (TT, n=6) or heterozygotes (CT, n=30) compared to the more common allele (CC, n=69). Expression levels were obtained from normalized RNASeq data from individual colon biopsy samples. [Figure 24] Figures 24A-B are a series of graphs showing BTNL responsiveness conferred by γδ TCRs. The left panels show flow cytometry plots of J76 human T cells expressing transduced recombinant TCRs of Vγ4Vδ1 (top) or Vγ9Vδ2 (bottom), as assessed by antibody-mediated detection of CD3 (x-axis) or TCRγδ (y-axis). The right panels show quantification of triplicate measurements of TCR and CD69 expression for the cells shown in the left panels after overnight exposure to the indicated conditions: empty vector-transduced 293 cells, BTNL3-transduced 293 cells, and BTNL3- and BTNL8-transduced 293 cells. PMAiono = PMA / ionomycin. [Figure 25] Figure 25A is a schematic diagram showing various growth conditions for human epithelial cells (Caco2) as used in this study. Figure 25B is a graph showing transepithelial electrical resistance (TEER) measurements, with the x-axis showing days in culture. Figure 25C is a series of graphs showing quantitative RT-PCR of indicated gene expression by Caco2 cells grown under the conditions shown in Figure 25A. [Figure 26] 26A-26B are a set of graphs showing the effect of stress on BTNL3 and BTNL8, HNF4A, CDX2, and IL-8 expression. [Figure 27]Figures 27A-B show additional BTNL polymorphisms that may affect function. Figure 27A is a panel of nonsynonymous SNPs in the B30.2 domain of BTNL3 (L3B30.2cl). Figure 27B illustrates the association of BTNL3*8 and L3B30.2cl genotypes with responsiveness. Copy number variant (CNV) status: NEG = negative L8*3 allele. HET = heterozygous for L8*3. UC = ulcerative colitis. "rs" numbers indicate single nucleotide polymorphisms. Response was defined as >25% TCR downregulation compared to EV after co-culture with full-length L3+L8. [Figure 28] Figures 28A-B demonstrate that carriage of two or more BTNL polymorphisms is associated with a disruption of the Vγ4-BTNL axis and a non-responder endophenotype. Figure 28A: % TCR downregulation compared to EV after co-culture with donor L3+L8-expressing HEK293Ts by donor genotype. HOM (donors homozygous for L8*3 / L3B30.2cl) (n=10), L3B30.2cl+L8*3 (compound heterozygotes) (n=4), L8*3HET (n=21), NEG (n=31). Figure 28B: TCR Vg strand usage analyzed by TCR sequencing of whole colon mRNA. Vg4 is shown as number of reads per 10,000 total Vg strand reads and is indicated by genotype. HOM = donors with a homozygous genotype of L8*3. HET(R) = donors homozygous for L8*3 who give the expected TCR downregulation response (>25%) in response to L3+L8 in an in vitro BTNL response assay. NEG(R) = donors negative for the L8*3 allele who give the expected TCR downregulation response (>25%) in response to L3+L8 in an in vitro BTNL response assay. (Analyzed by one-way ANOVA). [Figure 29]The association of the BTNL polymorphism in a case-control study genotyped by TaqMan SNP assay for the associated polymorphisms rs72494581, a surrogate for the L8*3CNV, and rs59220426, one of four missense polymorphisms in the L3B30.2 domain, is shown. These were analyzed by chi-square test. Genotypes are combined in the last column, demonstrating that carriers of ≥2 polymorphisms are more prevalent in the diseased group. Carriers of ≥2 polymorphisms identified the BTNL polymorphism as conferring an odds ratio of 1.38 (1.1-1.6, p<0.004). [Figure 30-1] Figures 30A-30D show that the typical colonic γδ surface phenotype is dysregulated in IBD. Figure 30A: Representative flow cytometry contour plots demonstrating CD103 expression on TCRγδ+Vδ2- cells obtained from colonic mucosa of control donors and donors with active UC (UCI) after isolation by short-term explant culture (gray isotype control). Figure 30B: Summary data (analyzed by one-way ANOVA) of TCRγδ+Vδ2- cell expression levels by disease subtype (n=5-14). [Figure 30-2] Figure 30C: Representative flow cytometry contour plots demonstrating CD103 expression on TCRγδ+Vδ2- cells obtained from colonic mucosa of control donors and donors with active UC (UCI) after isolation by short-term explant culture (grey isotype control). Figure 30D: Summary data (analyzed by one-way ANOVA) of TCRγδ+Vδ2- cell expression levels by disease subtype (n=5-14). HC: healthy control, CDU: non-inflamed Crohn's disease, CDI: inflamed Crohn's disease, UCU: non-inflamed ulcerative colitis, UCI: inflamed ulcerative colitis. DETAILED DESCRIPTION OF THE INVENTION

[0046] Aspects and embodiments of the present invention will be discussed below in conjunction with the accompanying drawings. Further aspects and embodiments will be apparent to those skilled in the art. All literature and database accession numbers referred to herein are incorporated by reference for all purposes.

[0047] The present invention is based, in part, on the discovery that mutations in the polynucleotide region containing the genes encoding BTNL3 and BTNL8 can result in the fusion of two proteins that cannot be transported to the cell surface. In individuals homozygous for such mutations, Vγ4+ T cells are rarely present in the intestinal tract, even if they are present. In heterozygous patients, the presence of Vγ4+ T cells is reduced. The absence of Vγ4+ T cells in these patients is associated (e.g., correlated) with an altered risk of inflammatory bowel disease (IBD). Therefore, by restoring expression of BTNL3 and BTNL8 or the expression of transcription factors that promote their expression (e.g., via gene therapy), Vγ4+ T cells can be recruited to restore intestinal homeostasis and control inflammation. Similarly, the administration of Vγ4+ T cells (e.g., Vγ4+ T cells expressing heterologous proteins or Vγ4-expressing Vγ4- cells) can support strategies for treating IBD. Indeed, we show that heterologous expression of Vγ4 on cells was shown to be sufficient to bind and respond to BTNL3+BTNL8.

[0048] Aspects and embodiments of the invention described herein should be understood to include aspects and embodiments "comprising," "consisting of," and "consisting essentially of." As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise indicated.

[0049] The term "about," as used herein, refers to a normal error range for a particular value that is readily apparent to one of ordinary skill in the art. Reference herein to "about" a value or parameter includes (and describes) embodiments that are directed to the value or parameter itself. In some cases, "about" encompasses variations of +20%, in some cases +10%, in some cases +5%, in some cases +1%, or in some cases +0.1% from the specified value, such variations being appropriate for carrying out the disclosed methods. As used herein, the term "subject" refers to any single animal, more preferably a mammal (e.g., a non-human animal such as a human or a non-human primate), for which treatment is contemplated or desired. In certain embodiments, the subject herein is a human. The subject may be a "cancer patient," i.e., a subject suffering from cancer, at risk of suffering from cancer, or suffering from one or more symptoms of cancer.

[0050] The term "butyrophilin 3" or "BTNL3," as used herein, refers to any functional BTNL3 protein from any primate (e.g., human), unless otherwise indicated. Functional BTNL3 is expressed on the cell surface and binds to BTNL8 to retain Vγ4+ cells in tissues such as the intestine. The amino acid sequence of an exemplary human BTNL3 is set forth in SEQ ID NO:1 and corresponds to accession number AAQ88751.1. The nucleic acid sequence of an exemplary gene encoding human BTNL3 is set forth in SEQ ID NO:2 and corresponds to accession number NM_197975.2. Mouse butyrophilin 1 or BTNL1 is an ortholog of human BTNL3. The amino acid sequence of an exemplary mouse BTNL1 is set forth in SEQ ID NO:3 and corresponds to accession number NP_001104564.1. The nucleic acid sequence of an exemplary gene encoding mouse BTNL1 is set forth in SEQ ID NO:4 and corresponds to accession number NM_001111094.1. The BTNL3 or BTNL1 protein may comprise, for example, a reference amino acid sequence as listed above, or a variant thereof.

[0051] The term "butyrophilin 8" or "BTNL8," as used herein, refers to any functional BTNL8 protein from any primate (e.g., human), unless otherwise indicated. Functional BTNL8 is expressed on the cell surface and binds to BTNL3 to retain Vγ4+ cells in tissues such as the intestinal tract. The amino acid sequence of an exemplary human BTNL8 is set forth in SEQ ID NO: 5 and corresponds to accession number AAI19697.1. The nucleic acid sequence of an exemplary gene encoding human BTNL8 is set forth in SEQ ID NO: 6 and corresponds to accession number NM_001040462.2. BTNL8S is an exemplary splice variant of BTNL8. The amino acid sequence of an exemplary human BTNL8S is set forth in SEQ ID NO: 7 and corresponds to accession number NP_079126.1. The nucleic acid sequence of an exemplary gene encoding human BTNL8S is set forth in SEQ ID NO: 8 and corresponds to accession number NM_024850.2. The BTNL8 or BTNL8S protein may comprise, for example, a reference amino acid sequence as listed above, or a variant thereof.

[0052] As used herein, the term "BTNL8*3 fusion protein" refers to a protein containing BTNL8 (or a portion thereof) and BTNL3 (or a portion thereof). An exemplary BTNL8*3 fusion protein results from an approximately 56 kb deletion polymorphism (chr5:180375027-180430596 in hg19) as reported in Aigner et al., BMC Genetics (2013), 14:16.

[0053] As used herein, the term L3B30.2cl refers to the gene encoding BTNL-3 or the protein encoded thereby, which contains four SNPs within the L3B30.2 domain, as shown in FIG.

[0054] The term "hepatocyte nuclear factor 4-alpha" or "HNF4A," as used herein, unless otherwise indicated, refers to any functional HNF4A protein from any primate (e.g., human). Functional HNF4A is a transcription factor expressed in the intestine. The amino acid sequence of an exemplary human HNF4A is set forth in SEQ ID NO:9 and corresponds to accession number NP_001274113.1. The nucleic acid sequence of an exemplary gene encoding human HNF4A is set forth in SEQ ID NO:10 and corresponds to accession number P41235 (Gene ID:3172). The nucleic acid sequence of an exemplary gene encoding the mouse ortholog of Hnf4a is set forth in SEQ ID NO:11, which encodes a protein having the sequence set forth in SEQ ID NO:12. An HNF4A protein may comprise, for example, a reference amino acid sequence as listed above, or a variant thereof.

[0055] The term "CD103" or "cluster of differentiation 103" (gene ID 3682), as used herein, refers to any functional CD103 protein of any primate origin (e.g., human), unless otherwise indicated. An exemplary or reference human CD103 amino acid sequence may include the amino acid sequence of database accession number NP_002199.3. An exemplary or reference nucleotide sequence encoding human CD103 may include the sequence of database accession number NM_002208.4. A CD103 protein may include, for example, the reference amino acid sequence as listed above, or a variant thereof.

[0056] The term "2B4" (also called CD244, gene ID 51744), as used herein, refers to any functional 2B4 protein of any primate origin (e.g., human), unless otherwise indicated. An exemplary or reference human 2B4 amino acid sequence may include the amino acid sequence of database accession number NP_001160135.1. An exemplary or reference nucleotide sequence encoding human 2B4 may include the sequence of database accession number NM_001166663.1. A 2B4 protein may include, for example, the reference amino acid sequence as listed above, or a variant thereof.

[0057] The term "CD3" or "cluster of differentiation 3," as used herein, unless otherwise indicated, refers to any functional CD3 protein of any primate origin (e.g., human). The term CD3 may include CD3G (gene ID 917), CD3E (gene ID 916), and / or CD3E (gene ID 915). In some embodiments, expression of CD3 as described herein may include expression of any one, two, or all three of CD3G, CD3E, and CD3D. Exemplary or reference human CD3 amino acid sequences may include the amino acid sequences of database accession numbers NP_000064.1 (CD3G), NP_000724.1 (CD3E), or NP_000723.1 (CD3D). An exemplary or reference nucleotide sequence encoding human CD3 may comprise the sequence of database accession number NM_000073.2 (CD3G), NM_000733.3 (CD3E), or NM_000732.4 (CD3D). The CD3 protein may comprise, for example, the reference amino acid sequence as listed above, or a variant thereof.

[0058] As used herein, " wild-type " or WT protein or polynucleotide refers to the reference sequence from which mutant variants are derived.Generally, the wild-type sequence of a given protein is the most common sequence in nature.Similarly, wild-type gene sequence is the sequence of that gene that is most commonly found in nature.

[0059] Proteins described herein that are variants of a reference sequence, such as the BTNL8, BTNL3, or HNF4A sequences described above, may have one or more amino acid residues changed compared to the reference sequence. For example, 50 or fewer amino acid residues may be changed compared to the reference sequence, preferably 45 or fewer, 40 or fewer, 30 or fewer, 20 or fewer, 15 or fewer, 10 or fewer, 5 or fewer, or 3 or fewer, 2 or 1. For example, variants described herein may include sequences in which 50 or fewer, 45 or fewer, 40 or fewer, 30 or fewer, 20 or fewer, 15 or fewer, 10 or fewer, 5 or fewer, 3 or fewer, 2 or 1 amino acid residue of the reference sequence is mutated. For example, chimeric proteins described herein may include amino acid sequences having 50 or fewer, 45 or fewer, 40 or fewer, 30 or fewer, 20 or fewer, 15 or fewer, 10 or fewer, 5 or fewer, 3 or fewer, 2 or 1 amino acid residue changed compared to any one of SEQ ID NOs: 1, 3, 5, 7, or 9.

[0060] Amino acid residues in the reference sequence may be changed or mutated by insertion, deletion or substitution, preferably by substitution with a different amino acid residue. Such changes may be caused by one or more of addition, insertion, deletion or substitution of one or more nucleotides in the encoding nucleic acid.

[0061] Proteins described herein that are variants of a reference sequence, such as the BTNL8, BTNL3, or HNF4A sequences described above, may share at least 50% sequence identity with the reference amino acid sequence, i.e., at least 55%, at least 60%, at least 65%, at least 70%, at least about 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. For example, a variant of a protein described herein may comprise an amino acid sequence that has at least 50% sequence identity with a reference amino acid sequence, i.e., at least 55%, at least 60%, at least 65%, at least 70%, at least about 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with one or more of the reference amino acid sequences, e.g., SEQ ID NOs: 1, 3, 5, 7, or 9.

[0062] Sequence identity is generally defined with reference to the algorithm GAP (Wisconsin GCG package, Accelerys Inc, San Diego, USA). GAP uses the Needleman and Wunsch algorithm to align two complete sequences, maximizing the number of matches and minimizing the number of gaps. Generally, default parameters are used, with a gap creation penalty of 12 and a gap extension penalty of 4. Although the use of GAP may be preferred, other algorithms may be used, such as BLAST (which uses the method of Altschul et al. (1990) J. Mol. Biol. 215:405-410), FASTA (which uses the method of Pearson and Lipman (1988) PNAS USA 85:2444-2448), or the Smith-Waterman algorithm (Smith and Waterman (1981) J. Mol. Biol. 147:195-197), or the TBLASTN program of Altschul et al. (1990), supra, generally using default parameters. In particular, the psi-Blast algorithm may be used (Nucl. Acids Res. (1997) 25 3389-3402). Sequence identity and similarity may also be determined using Genomequest™ software (Gene-IT, Worcester MA USA).

[0063] Sequence comparisons are preferably made over the entire length of the relevant sequences described herein.

[0064] As used herein, the terms "reference level," "reference expression level," or "reference sample" refer to a level, expression level, sample, or standard used for comparison purposes. For example, a reference sample can be obtained from a healthy individual (e.g., an individual expressing functional levels of BTNL3 and / or BTNL8). The reference level can be the expression level of one or more reference samples. For example, the average expression (e.g., mean expression or median expression) among multiple individuals (e.g., healthy individuals or individuals expressing functional levels of BTNL3 and / or BTNL8). In other cases, the reference level can be a predetermined threshold level based on, for example, functional expression, as determined otherwise, for example, by empirical assay.

[0065] As used herein, a "Vy4+ cell" or "Vy4+ T cell" refers to a Vy4V51 T cell (e.g., a CD3+ T cell expressing V51 and Vy4) or a Vy4V53 T cell (e.g., a CD3+ T cell expressing V53 and Vy4). A Vy4+ cell may express V51 or V53, and / or Vy4 as endogenous proteins or as heterologous proteins. In some cases, a Vy4+ cell is a non-hematopoietic cell, as defined in WO2017 / 072367.

[0066] As used herein, a cell or cell population "screened for" expression of a marker (e.g., Vy4) refers to a cell or cell population in which the marker has been explicitly identified and / or quantified ex vivo. In some embodiments, for example, a population of Vy4+ cells to be administered to a subject will be screened for expression of Vy4 (e.g., after isolation and / or expansion from the donor and prior to administration to the subject) to ascertain the presence of Vy4+ cells, the total number of Vy4+ cells, the frequency of Vy4+ cells within a given cell population (e.g., the percentage of Vy4+ cells among the total number of V51+ cells, the percentage of Vy4+ cells among the total number of V53+ cells, the percentage of Vy4+ cells among the total number of γδT cells, or the percentage of Vy4+ cells among the total number of T cells), the mean or median Vy4 expression level in a given population, or any measure of one or more such characteristics.

[0067] As used herein, a cell "derived from" a cell of a different phenotype refers to a cell that has been modified from the endogenous cell type. For example, Vγ4+ cells derived from Vγ4- cells describe cells that were endogenously negative for Vγ4 but became Vγ4+ by transduction with a gene encoding Vγ4.

[0068] A cell or cell population that "expresses" a marker of interest is one in which the mRNA encoding the protein, or the protein itself, including a fragment thereof, has been determined to be present in the cell or population. Marker expression can be detected by various means. For example, in some embodiments, marker expression refers to the surface density of the marker on the cells. Mean fluorescence intensity (MFI), for example, when used as a flow cytometry measurement, represents the density of the marker on a cell population. Those skilled in the art will understand that MFI values ​​depend on staining parameters (e.g., concentration, duration, and temperature) and fluorochrome composition. However, MFI can be quantitative when considered in the context of appropriate controls. For example, a cell population can be said to express a marker if the MFI of an antibody against that marker is significantly higher than the MFI of an appropriate isotype control antibody on the same cell population stained under comparable conditions. Additionally or alternatively, a cell population can be said to express a marker according to cells using positive and negative gates by conventional flow cytometry analysis (e.g., by gating by isotype or "fluorescence minus one" (FMO) controls). By this metric, a population can be said to "express" a marker if the number of cells detected as positive for the marker is significantly higher than background (e.g., by gating on an isotype control).

[0069] As used herein, when the expression of a population is described as the percentage of positive cells, and this percentage is compared with the corresponding percentage of positive cells in a reference population, the difference in percentage is the percentage of each individual population in the overall population.For example, if a marker is expressed on 10% of the cells in population A, and the same marker is expressed on 1% of the cells in population B, then population A is said to have a 9% higher frequency of marker-positive cells than population B (i.e., 10%-1%, not 10%÷1%).Multiplying this frequency by the number of cells in the overall population calculates the difference in absolute number of cells.In the above example, if there are 100 cells in population A and 10 cells in population B, then population A has 100 times more cells than population B, i.e., (10%×100)÷(1%×10).

[0070] The expression level of a marker may be a nucleic acid expression level (e.g., a DNA expression level or an RNA expression level, e.g., an mRNA expression level). Any suitable method for determining nucleic acid expression levels may be used. In some embodiments, the nucleic acid expression level is determined using qPCR, rtPCR, RNA-seq, multiplex qPCR or RT-qPCR, microarray analysis, serial analysis of gene expression (SAGE), MassARRAY technology, in situ hybridization (e.g., FISH), or a combination thereof.

[0071] As used herein, "treatment" (and grammatical variations thereof, such as "treat" or "treating") refers to clinical intervention, whether in a human or animal (e.g., in veterinary applications), in which some desired therapeutic effect is achieved, such as inhibiting or slowing the progression of a condition, including slowing the rate of progression, halting the rate of progression, ameliorating the condition, curing or ameliorating (either partially or totally) the condition, preventing, delaying, alleviating, or arresting one or more symptoms and / or signs of the condition, or prolonging the survival of a subject or patient beyond that which would be expected in the absence of treatment.

[0072] Also included is treatment as a preventative measure (i.e., prevention).For example, patients, subjects or individuals who are susceptible to or at risk of developing or recurring inflammation can be treated as described herein.Such treatment can prevent or delay the development or recurrence of inflammation in patients, subjects or individuals.

[0073] As used herein, "administering" refers to a method of administering a therapeutic composition (e.g., pharmaceutical composition) to a subject.The compositions used in the methods described herein can be administered, for example, intramuscularly, intravenously, intradermally, transcutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intrathecally, intranasally, intravaginally, intrarectally, topically, intratumorally, intraperitoneally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, intraocularly, intraorbitally, intravitreally (e.g., by intravitreal injection), by eye drops, orally, topically, transdermally, by inhalation, by injection, by implantation, by infusion, by continuous infusion, by direct local perfusion bath of target cells, by catheter, by lavage, by cream, or by lipid composition.The compositions used in the methods described herein can also be administered systemically or locally. Methods of administration can vary depending on a variety of factors, such as the therapeutic agent or composition being administered and the severity of the condition, disease, or disorder being treated.

[0074] The term "pharmaceutical composition" refers to a preparation in a form such that the biological activity of one or more active ingredients contained therein can be effective, and which does not contain any additional ingredients that are unacceptably toxic to the patient to whom the formulation is to be administered.

[0075] Cells obtained by any of the methods described herein (e.g., Vy4+ T cells, e.g., Vy4+ T cells expressing a heterologous protein) may be used as a medicine, e.g., as adoptive T cell therapy. The therapy may be autologous, or the therapy may be allogeneic. In cases involving the transplantation of Vy4+ T cells, the Vy4+ T cells may be substantially free of non-Vy4+ T cells, such as Vy952 T cells or αβ T cells. For example, non-Vy4+ T cells (e.g., Vy952 T cells or αβ T cells) may be depleted from the Vy4+ T cell population before, after, or at any time during in vivo expansion using any suitable means known in the art (e.g., by negative selection, e.g., using magnetic beads). In other embodiments, the cells are not selected, and a mixed cell population may be administered.

[0076] In some cases, the population of Vy4+ T cells administered to the patient is part of a larger population that includes non-Vy4+ T cells, such as Vy952 T cells and αβ T cells. The Vy4+ T cells can also be part of a population that includes αβ T cells, NK cells, B cells, and innate lymphoid cells (ILCs). Vγ4+ T cells may comprise 1% to 99% of the total cell population administered to a patient in a single dose or over a regimen (e.g., 5% to 95%, 10% to 90%, 15% to 85%, 20% to 80%, 25% to 75%, 30% to 70%, 35% to 65%, 40% to 60%, or 45% to 55%, e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60 ... 5%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, e.g., 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less, 55% or less, 60% or less, 65% or less, 70% or less, 75% or less, 80% or less, 85% or less, 90% or less, or 95% or less, e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0077] In some embodiments, the dose of expanded cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein) is about 1×10 6 , 1.1×10 6 , 2 × 10 6 , 3.6×10 6 , 5×10 6 , 1×10 7 , 1.8×10 7 , 2 × 10 7 , 5×10 7 , 1×10 8 , 2 × 10 8, or 5 × 10 8 In some embodiments, the dose of cells (e.g., Vy4+ T cells, e.g., Vy4+ T cells expressing a heterologous protein) comprises at least about 1 x 10 cells / kg. 6 , 1.1×10 6 , 2 × 10 6 , 3.6×10 6 , 5×10 6 , 1×10 7 , 1.8×10 7 , 2 × 10 7 , 5×10 7 , 1×10 8 , 2 × 10 8 , or 5 × 10 8 In some embodiments, the dose of expanded cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein) comprises up to about 1×10 cells / kg. 6 , 1.1×10 6 , 2 × 10 6 , 3.6×10 6 , 5×10 6 , 1×10 7 , 1.8×10 7 , 2 × 10 7 , 5×10 7 , 1×10 8 , 2 × 10 8 , or 5 × 10 8 In some embodiments, the dose of expanded cells (e.g., Vy4+ T cells, e.g., Vy4+ T cells expressing a heterologous protein) comprises about 1.1 x 10 cells / kg. 6 ~Approx. 1.8×10 7 In some embodiments, the dose of expanded cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein) comprises about 1×10 cells / kg. 7 , 2 × 10 7 , 5×10 7 , 1×10 8 , 2 × 10 8 , 5×10 8 , 1×10 9 , 2 × 10 9 , or 5 × 10 9In some embodiments, the dose of expanded cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein) is at least about 1×10 7 , 2 × 10 7 , 5×10 7 , 1×10 8 , 2 × 10 8 , 5×10 8 , 1×10 9 , 2 × 10 9 , or 5 × 10 9 In some embodiments, the dose of expanded cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein) is up to about 1×10 7 , 2 × 10 7 , 5×10 7 , 1×10 8 , 2 × 10 8 , 5×10 8 , 1×10 9 , 2 × 10 9 , or 5 × 10 9 In some embodiments, the subject receives 10 cells per kg of the subject's body weight. 4 ~10 6 In some embodiments, the subject is administered an initial administration of a population of cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein, e.g., 10 per kg of the subject's body weight). 4 ~10 6 cells, e.g., 10 per kg of subject body weight 4 ~10 5 an initial administration of cells), and one or more (e.g., two, three, four, or five) subsequent administrations of cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein, e.g., 10 / kg body weight of the subject 4 ~10 6 10 expanded non-hematopoietic tissue-resident γδ T cells, e.g., 10 per kg of subject body weight 4 ~10 5In some embodiments, the one or more subsequent administrations of expanded cells are administered less than 15 days after the previous administration, e.g., less than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 days after the previous administration, e.g., less than 4, 3, or 2 days after the previous administration. Treatment can be administered once, or, optionally, repeatedly, one or more times, e.g., once weekly, once every two weeks, once monthly, once every two months, three times a year, twice a year, or once a year. In some embodiments, the subject receives a total of about 10 6 cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein), e.g., the subject receives 1×10 5 Initial dose of cells, 3 x 10 5 The second dose of cells, and 6 x 10 5 A third dose of cells is administered, with each dose administered less than 4 days, 3 days, or 2 days after the previous dose.

[0078] Vγ4+ T cells useful as part of the present invention can be derived from any suitable cell source. For example, Vγ4+ cells for use as part of the compositions and methods of the present invention can be derived from solid tissue (e.g., epithelial tissue, such as tissue of the gastrointestinal epithelium (e.g., from a biopsy of the colon, e.g., the ascending colon), or skin tissue) or bodily fluids, such as blood. Cells derived from tissue can be manipulated after isolation from the donor tissue, for example, by separation (e.g., positive or negative selection from another population). In some cases, lymphocytes can be cultured in organotypic cell culture, e.g., as described by Clark, et al. (Clark, et al., Journal of Cells may be isolated from solid tissue using methods such as those described by I. Investigational Dermatology. 2006.126(5):1059-70 and International Patent Application No. WO2017 / 072367, each of which is incorporated herein by reference in its entirety. Cells may be expanded by known methods before and / or after the isolation step. Cells for use in the present invention may be autologous or allogeneic.

[0079] In some embodiments, Vγ4+ T cells useful as part of the present invention can be derived from induced pluripotent stem cells (iPSCs). For example, Vγ4+ T cells can be differentiated from iPSCs or can be the progeny of such cells. Methods for generating T cells from iPSCs are well known in the art (see, e.g., WO2018 / 147801).

[0080] The present invention includes the generation and use of cells (e.g., Vγ4+ cells) that express heterologous proteins. For example, Vγ4+ cells can be endogenous Vγ4δ1 cells transduced with a gene encoding a heterologous protein. In other cases, Vγ4+ cells can be derived from Vγ4− cells, with Vγ4 transduced as the heterologous protein. Suitable methods for transducing mammalian cells to express heterologous proteins, for example, using viral vectors, are well known in the art. In this case, the Vγ4− cells can be any suitable cell type, including immune cells (e.g., monocytes, macrophages, dendritic cells, neutrophils, eosinophils, basophils, mast cells, or lymphocytes, such as T cells, B cells, ILCs, or NK cells). For example, the immune cells can be lymphocytes. In some embodiments, the lymphocytes are T cells (e.g., CD8 T cells, CD4 T cells, or regulatory T cells (e.g., Foxp3+ Treg)) or NK cells. For example, CD8 and / or CD4 T cells can be used to treat cancer of the intestinal tract, or Treg or other suppressive T cells can be used to treat inflammation in the intestinal tract.

[0081] In some preferred embodiments, the T cells are γδ T cells (e.g., Vδ2 cells, e.g., Vγ9δ2 cells).

[0082] In some embodiments, one or more additional therapeutic agents may be administered to the subject. The additional therapeutic agent may be selected from the group consisting of an immunotherapeutic agent, a cytotoxic agent, a growth inhibitory agent, a radiotherapeutic agent, an anti-angiogenic agent, or a combination of two or more thereof. The additional therapeutic agent may be administered simultaneously with, before, or after administration of the cells (e.g., Vγ4+ T cells, e.g., Vγ4+ T cells expressing a heterologous protein). The additional therapeutic agent may be an immunotherapeutic agent, which may act on a target within the subject's body (e.g., the subject's own immune system) and / or on the transplanted cells. Administration of the composition may be carried out in any convenient manner. The compositions described herein may be administered to a patient intraarterially, subcutaneously, intradermally, intranodally, intramuscularly, by intravenous injection, intrarectally, intraperitoneally, by intradermal or subcutaneous injection, mixed with fecal transplant material (e.g., as part of a fecal transplant (e.g., by colonoscopy, enema, or oral gavage)), or orally.

[0083] Pharmaceutical compositions may include cells (e.g., Vγ4+ T cells) as described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers, such as neutral buffered saline, phosphate buffered saline, carbohydrates, such as glucose, mannose, sucrose, or dextran, mannitol, proteins, polypeptides, or amino acids, such as glycine, antioxidants, chelating agents, such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), and preservatives. Cryopreservation solutions that may be used in the pharmaceutical compositions of the present invention include, for example, DMSO. The compositions may be formulated, for example, for intravenous administration.

[0084] Subjects who may be treated with the compositions (e.g., cells or vectors) described herein and by the methods described herein include those with IBD or at risk of developing IBD. IBD includes disorders involving chronic inflammation of the gastrointestinal tract, and types of IBD include ulcerative colitis (UC) and Crohn's disease. The compositions and methods described herein can also be used to treat subjects with cancer, such as colorectal cancer, colon cancer, rectal cancer, anal cancer, hereditary nonpolyposis colorectal cancer (HNPCC), familial adenomatous polyposis (FAP), small intestine cancer (e.g., adenocarcinoma, sarcoma, gastrointestinal carcinoid tumor, lymphoma, or gastrointestinal stromal tumor), and small bowel cancer. In some embodiments, the cancer is a gastrointestinal cancer, such as non-metastatic or metastatic colorectal cancer, pancreatic cancer, gastric cancer, or hepatocellular carcinoma. The compositions and methods described herein can be used to treat subjects with normal numbers of intestinal γδ T cells, reduced numbers of intestinal γδ T cells, reduced cell surface expression of BTNL3 and / or BTNL8, normal surface expression of BTNL3 and / or BTNL8, mutations in BTNL3 and / or BTNL8, reduced expression of HNF4A, or normal expression of HNF4A. The compositions (e.g., cells or vectors) of the invention are administered in an amount sufficient to ameliorate one or more symptoms of IBD or cancer. The compositions described herein can be administered in an amount sufficient to reduce or inhibit one or more of the following symptoms: diarrhea, fever, fatigue, abdominal pain and cramps, loss of appetite, or unintentional weight loss. The compositions described herein can be administered in an amount sufficient to treat cancer or tumors, induce remission, reduce tumor growth, volume, metastasis, invasion, proliferation, or number, increase cancer cell death, increase time to recurrence, or improve survival. The compositions described herein can be administered in an amount sufficient to increase the number of γδ T cells in the intestinal tract, or, in the case of administering a vector, increase BTNL3 cell surface expression, increase BTNL8 cell surface expression, and / or increase HNF4A expression.The compositions described herein may reduce one or more IBD symptoms by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. These effects may occur within, for example, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more after administration of the compositions described herein. Patients may be evaluated, for example, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more after administration of the compositions, depending on the route of administration used for treatment.

[0085] Any expression product provided by the present invention (e.g., BTNL3 / 8, Vy451 TCR, Vy453 TCR, or HNF4A) can be encoded on a vector known in the art or described herein. In some cases, BTNL3 and BTNL8 are delivered together (e.g., on the same vector) to promote dimerization on the cell surface. Similarly, V51 and Vy4 or V53 and Vy4 can be delivered together (e.g., on the same vector) to promote correct TCR assembly.

[0086] In addition to achieving high transcription and translation rates, stable expression of foreign genes in mammalian cells can be achieved by integrating a polynucleotide containing the gene into the nuclear genome of the mammalian cell. Various vectors have been developed for delivering and integrating polynucleotides encoding foreign proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are disclosed, for example, in WO 1994 / 011026, which is incorporated herein by reference. Expression vectors for use in the compositions and methods described herein contain, in addition to polynucleotide sequences encoding BTNL3, BTNL8, V51, V53, Vy4, or HNF4A, additional sequence elements used, for example, to express these agents and / or integrate these polynucleotide sequences into the genome of mammalian cells. Certain vectors that can be used to express BTNL3, BTNL8, V51, V53, Vy4, or HNF4A include plasmids containing regulatory sequences, such as promoter and enhancer regions, that direct gene transcription. Other vectors useful for expressing BTNL3, BTNL8, V51, V53, V74, or HNF4A contain polynucleotide sequences that enhance the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, internal ribosome entry sites (IRES), and polyadenylation signal sites to direct efficient transcription of genes carried on the expression vector. Expression vectors suitable for use with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selecting cells containing such a vector. Suitable markers include genes encoding resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0087] Expression vectors for use in the compositions and methods described herein may express BTNL3, BTNL8, Vδ1, Vδ3, Vγ4, or HNF4A from monocistronic or polycistronic expression cassettes. Monocistronic expression cassettes contain polynucleotide sequences encoding a single gene. The pluripotent cells described herein can be transfected, for example, with multiple plasmids, each containing a monocistronic expression cassette, or with a single plasmid containing two or more monocistronic expression cassettes. Polycistronic expression cassettes can be used to simultaneously express two or more proteins from a single transcript. Polycistronic expression cassettes include bicistronic expression cassettes, which can be used to produce two proteins from a single transcript and may contain an IRES sequence to recruit ribosomes to initiate translation from a region of the mRNA other than the 5' cap.

[0088] Viral genomes provide a rich source of vectors that can be used to efficiently deliver foreign genes, such as BTNL3 / 8 and Vy4δ1 or Vy4δ3 TCR, into mammalian cells. Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically integrated into the nuclear genome of mammalian cells by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors include retroviruses (e.g., Retroviridae viral vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza virus), rhabdoviruses (e.g., rabies and vesicular stomatitis viruses), paramyxoviruses (e.g., measles and Sendai), positive-strand RNA viruses such as picornaviruses and alphaviruses, as well as double-stranded DNA viruses including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include avian leukosis sarcoma, avian C virus, mammalian C, B, and D viruses, oncoretrovirus, HTLV-BLV complex, lentivirus, alpharetrovirus, gammaretrovirus, and spumavirus (Coffin, J.M., Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, 1996)).Other examples include murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon ape leukemia virus, Mason-Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentivirus. Other examples of vectors are described, for example, in McVey et al. (US Pat. No. 5,801,030), the teachings of which are incorporated herein by reference.

[0089] The nucleic acids of the compositions and methods described herein may be incorporated into rAAV vectors and / or virions to facilitate their introduction into cells. AAV vectors can be used in the central nervous system, and appropriate promoters and serotypes are described in Pignataro et al. al., J Neural Transm (2017) (Epub ahead of print), the disclosure of which is incorporated herein by reference as it relates to promoters and AAV serotypes useful in CNS gene therapy. rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs containing (1) a heterologous sequence to be expressed and (2) viral sequences that facilitate the integration and expression of the heterologous gene. The viral sequences may include those sequences of AAV required in cis for DNA replication and packaging of DNA into virions (e.g., functional ITRs). Such rAAV vectors may also contain a marker or reporter gene. Useful rAAV vectors have one or more AAV WT genes deleted in whole or in part, but retain functional flanking ITR sequences. The AAV ITRs may be of any serotype suitable for a particular application. Methods for using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated herein by reference in their entirety as they relate to AAV vectors for gene delivery.

[0090] The nucleic acids and vectors described herein can be incorporated into rAAV virions to facilitate the introduction of the nucleic acid or vector into cells. The AAV capsid protein constitutes the outer, non-nucleic acid portion of the virion and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, which are required for virion assembly. Construction of rAAV virions is described, for example, in US Pat. Nos. 5,173,414, 5,139,941, 5,863,541, 5,869,305, 6,057,152, and 6,376,237, as well as Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), the disclosures of each of which are incorporated herein by reference as they relate to AAV vectors for gene delivery.

[0091] rAAV virions useful in combination with the compositions and methods described herein include those derived from various AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and rh74. AAV2, AAV9, and AAV10 may be particularly useful for targeting cells located in or delivered to the central nervous system. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619 (2000), Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000), Xiao et al., J. Virol. 72:2224 (1998), Halbert et al., J. Virol. 74:1524 (2000), Halbert et al., J. Virol. 75:6615 (2001), and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the disclosures of each of which are incorporated herein by reference in their entirety as they relate to AAV vectors for gene delivery. Also useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype pseudotyped with capsid genes from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10, among others). Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001), Halbert et al., J. Virol. 74:1524 (2000), Zolotukhin et al., Methods, 28:158 (2002), and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001). AAV virions with mutations in the virion capsid may be used to infect particular cell types more efficiently than non-mutated capsid virions. For example, suitable AAV mutants may have ligand insertion mutations to facilitate targeting of AAV to particular cell types.The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV virions that can be used in the methods described herein include those capsid hybrids generated by molecular breeding of viruses, as well as by exon shuffling. See, e.g., Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0092] The delivery vector used in the methods and compositions described herein may be a retroviral vector. One type of retroviral vector that may be used in the methods and compositions described herein is a lentiviral vector. Lentiviral vectors (LVs), a subset of retroviruses, transduce a wide range of dividing and non-dividing cell types with high efficiency and confer stable, long-term expression of transgenes. An overview of lentiviral vector optimization strategies is provided in Delenda, The Journal of Gene Medicine 6:S125 (2004), the disclosure of which is incorporated herein by reference. The use of lentiviral-based gene transfer technology relies on the in vitro production of recombinant lentiviral particles with a highly deleted viral genome harboring a transgene of interest. In particular, recombinant lentiviruses consist of (1) a packaging construct, i.e., a vector expressing (or expressed in trans) the Gag-Pol precursor together with Rev, (2) a vector expressing an envelope receptor, generally heterologous, and (3) viral cDNA from which all open reading frames have been removed but which maintains sequences necessary for replication, encapsidation, and expression, and are then recovered by coexpression in trans in a permissive cell line of a transfer vector into which the sequence to be expressed has been inserted. The lentiviral vectors used in the methods and compositions described herein may include one or more of the following: a 5' long terminal repeat (LTR), an HIV signal sequence, an HIV Psi signal 5' splice site (SD), a delta-GAG element, a Rev response element (RRE), a 3' splice site (SA), an elongation factor (EF) 1-alpha promoter, and a 3'-self-inactivating LTR (SIN-LTR). The lentiviral vector optionally comprises a central polypurine tract (cPPT) and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), as described in US 6,136,597, the disclosure of which is incorporated herein by reference as it relates to the WPRE. The lentiviral vector may further comprise a pHR' backbone, which may include, for example, those provided below.

[0093] The Lentigen lentiviral vector, described in Lu et al., Journal of Gene Medicine 6:963 (2004), may be used to express DNA molecules and / or transduce cells. The lentiviral vectors used in the methods and compositions described herein may contain a 5' long terminal repeat (LTR), an HIV signal sequence, an HIV Psi signal 5' splice site (SD), a delta-GAG element, a Rev response element (RRE), a 3' splice site (SA), an elongation factor (EF) 1-alpha promoter, and a 3'-self-inactivating LTR (SIN-LTR). It will be readily apparent to those skilled in the art that, in some cases, one or more of these regions may be replaced with another region performing a similar function. Transgene expression is driven by a promoter sequence. Optionally, the lentiviral vector contains a CMV promoter. The promoter may also be an elongation factor (EF) 1-alpha promoter or a PGK promoter. Those skilled in the art will be familiar with numerous promoters that may be suitable for the vector constructs described herein.

[0094] Enhancer elements can be used to increase expression of modified DNA molecules or to increase lentiviral integration efficiency. Lentiviral vectors used in the methods and compositions described herein may further comprise a nef sequence. Lentiviral vectors used in the methods and compositions described herein may further comprise a cPPT sequence, which enhances vector integration. cPPT functions as a second origin of (+)-strand DNA synthesis and introduces a partial strand overlap in the middle of the native HIV genome. Introduction of a cPPT sequence into the transfer vector backbone strongly increased nuclear transport and the total amount of genome integrated into target cell DNA. Lentiviral vectors used in the methods and compositions described herein may further comprise a woodchuck posttranscriptional regulatory element (WPRE). The WPRE functions at the transcriptional level by promoting nuclear export of transcripts and / or increasing the efficiency of polyadenylation of nascent transcripts, thus increasing the total amount of mRNA in the cell. Addition of a WPRE to a lentiviral vector results in substantial improvements in transgene expression levels from several different promoters, both in vitro and in vivo. The lentiviral vector used in the methods and compositions described herein may contain both a cPPT sequence and a WPRE sequence. The vector may also contain an internal ribosome entry site (IRES) sequence, which allows for the expression of multiple polypeptides from a single promoter. In addition to the IRES sequence, other elements known in the art that allow for the expression of multiple polypeptides are useful.

[0095] The vectors used in the methods and compositions described herein may be clinical grade vectors.

[0096] Viral regulatory elements are components of the delivery vehicle used to introduce nucleic acid molecules into host cells.Viral regulatory elements can be retroviral regulatory elements.For example, viral regulatory elements can be the LTR and gag sequences from HSC1 or MSCV.Retroviral regulatory elements can be derived from lentivirus, or they can be heterologous sequences identified from other genome regions.Those skilled in the art will also understand that if other viral regulatory elements are identified, they can be used with the nucleic acid molecules described herein.

[0097] The vectors of the present invention may be capable of directing expression specifically in the intestinal tract by using an intestinal-specific promoter (e.g., a constitutively active intestinal-specific promoter). Such promoters are known in the art and include, for example, intestinal fatty acid binding protein (IFABP), human mucin-2 promoter (HMUC2), human lysozyme promoter (HLY), human sucrose-isomaltase enhancer (HIS), CDX2, villin, and PDX1.

[0098] Subjects that may be treated as described herein may include subjects who have or are at risk of developing intestinal inflammation, such as intestinal inflammation associated with IBD. Whether a subject has or is at risk of developing intestinal inflammation (e.g., IBD) can be determined by identifying certain mutations that affect the presence and function of Vγ4+ T cells in the intestinal tract.

[0099] A subject at risk of developing intestinal inflammation may have an increased risk or susceptibility to this condition compared to a control subject.

[0100] A subject can be identified as having a mutation in a polynucleotide sequence encoding BTNL3 and BTNL8 (e.g., an approximately 56 kb deletion polymorphism (chr5:180375027-180430596 in hg19)) by comparing the level of a polynucleotide sequence associated with a BTNL8*3 mutation in a subject's sample to a reference level of the polynucleotide sequence using the genotyping methods described, as illustrated in Figure 17B. The mutation can be characterized, for example, by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface compared to a reference sample, e.g., a wild-type sample. In some cases, the mutation is characterized by expression of a BTNL8*3 fusion protein. For example, an individual can be heterozygous or homozygous for a BTNL8*3 mutation.

[0101] The mutation can be a single nucleotide polymorphism (SNP), such as an SNP in the BTNL3 intron or the BTNL8 intron. Suitable SNPs include rs6868418 and rs4700772 (see, for example, the NCBI Short Genetic Variations database, dbSNP). For example, a subject can be homozygous (TT) or heterozygous (CT) for T at rs6868418 (common allele CC) and / or homozygous (AA) or heterozygous (GA) for A at rs4700772 (common allele GG).

[0102] In some embodiments, the mutation may be the L3B30.2lc genotype. For example, the subject may be heterozygous (GT) or homozygous (TT) for T at rs73815153, heterozygous (CG) or homozygous (GG) for G at rs7726604, heterozygous (CG) or homozygous (GG) for G at rs7726607, and heterozygous (CG) or homozygous (GG) for G at rs59220426.

[0103] Subjects identified as having a mutation that affects the presence and function of Vγ4+ T cells in the intestinal tract may be suitable or amenable to treatment as described herein.

[0104] A subject identified as having or at risk of having intestinal inflammation, which may be as described herein, may be treated or selected for treatment according to aspects of the present invention.

[0105] In some embodiments, a subject may be identified as having intestinal inflammation or as likely to develop or at risk of developing intestinal inflammation, followed by a recommendation to pursue therapy (e.g., gene therapy or cell therapy, according to any of the methods described herein or known in the art).

[0106] In some preferred embodiments, an individual identified, treated, or selected for treatment as described herein may lack the BTNL8*3 mutation and may be heterozygous (GT) at rs73815153, heterozygous (CG) at rs7726604, heterozygous (CG) at rs7726607, and heterozygous (CG) at rs59220426.

[0107] The features disclosed in the foregoing description, or in the following claims, or in the accompanying drawings, are presented in their specific form, or, as appropriate, in terms of means for performing a disclosed function, or a method or process for obtaining a disclosed result, and may be utilized separately or in any combination of such features to realize the invention in various of its forms.

[0108] While the present invention has been described in conjunction with the exemplary embodiments set forth above, many equivalent modifications and variations will become apparent to those skilled in the art given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.

[0109] For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purpose of enhancing the understanding of the reader, and the inventors do not wish to be bound by any of these theoretical explanations.

[0110] Any section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0111] Throughout this specification, including the claims which follow, unless the context otherwise requires, the words "comprise" and "include," as well as variations such as "comprises," "comprising," and "including," will be understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integers or steps.

[0112] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values ​​are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. The term "about" in connection with numerical values ​​is arbitrary and means, for example, + / - 10%. [Example]

[0113] The following examples are put forth to provide one of ordinary skill in the art with an illustration of how the compositions and methods described herein may be used, performed, and evaluated, and are intended merely to be exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0114] Example 1. Selection of intestinal epithelial T cells By flow cytometry of cells recovered from the epithelium and by confocal visualization of epithelial whole mounts, we found that a characteristic murine small intestinal Vγ7+ intraepithelial (IEL) compartment primarily formed between 2 and 3 weeks of age and remained stable for at least 9 months thereafter (Figures 1A and 1B). At day 21, Vγ7+ cells largely phenocopied mature Skint1-selected dendritic epithelial T cells (DETCs) and uniformly expressed high levels of CD122 (IL-2R / IL-15R β chain), TIGIT (an inhibitory coreceptor), and TCR (detected with anti-CD3 antibodies), as well as low levels of RNA for Rorγc and Sox13, two transcription factors that contribute to γδ T cell differentiation (Figure 1C). Vγ7- IELs (mostly Vγ1 or Vγ4) did not display this phenotype, and both Vγ7+ and Vγ7- IEL subsets differed in that they were predominantly CD45RBhi, CD44+, and CCR9+, whereas Vγ7+ IELs were Lag3+, Thy1-, CD69+, CD5-, and CD8αα+ (Figures 1C and 2A).

[0115] However, by day 21, Vγ7+ IELs phenocopied Vγ7- IELs from adult mice. Thus, by sequential gating and radar plots of surface protein coexpression, we were able to clearly distinguish mature Vγ7+ IELs (CD122hi [MFI>500], Thy1-, TIGIT+, Lag3+, CD8αα+, CD5-, CD24-, TCRhi) from putative Vγ7+ IEL progenitors (CD122lo [MFI<200], Thy1+, TIGIT-, Lag3-, CD8αα-, CD5+, CD24+, TCRlo; Figures 1D, 1E, and 2B), the latter of which also phenocopied DETC progenitors before Skint1 selection.

[0116] To further compare IELs with their putative progenitors, CD122hi Vγ7+ and CD122lo Vγ7+ IELs were purified four times independently from the same 14- to 17-day-old mice and assessed by RNA sequencing (RNA-seq, Figure 2C). Consistent with their distinct phenotypes, the cells exhibited significantly different expression of many genes related to cell surface proteins (Figure 2C). Furthermore, many genes that were upregulated (e.g., Tnfrsf9 [4-1BB / CD137], Xcl1 [lymphotactin], Nasp) or downregulated (e.g., sox13, Bcl11b, Cx3cr1) in CD122hi versus CD122lo Vγ7+ cells were similarly regulated by Skint1 selection of DETC progenitors (Figure 1F and Figure 2C).

[0117] Furthermore, CD122hi Vγ7+ cells were enriched for cell cycle genes, consistent with approximately 100% of Vγ7+ IELs being Ki67+ (i.e., outside of G0) compared with <40% of Vγ7- cells at days 21–24 (p<0.0001) (Figure 1G). Similarly, Vγ7+ IELs at day 28 phenocopied rapidly dividing thymocytes in that approximately 10% incorporated ethynyldeoxyuridine (EdU) (a labeled nucleotide) during a 3-h pulse, compared with only 4% of Vγ7- IELs (Figure 2D). Altogether, these data are consistent with the gut supporting the selective maturation and expansion of CD122hi, Thy1-, TIGIT+, Lag3+, CD8αα+, CD5-, CD24-, TCRhi Vγ7+ cells, which dominate the γδ IEL compartment by weeks 3–4. From week 5 onwards, the proportion of steady-state cycling (Ki67+) Vγ7+ IELs decreased to a level similar to that of Vγ7- IELs (Fig. 1G).

[0118] Example 2. Intestinal epithelial selection element Because Skint1 selects for characteristic Vγ5+ DETC progenitors in the thymus, DETCs are absent in athymic NU / NU mice. In contrast, intestinal IELs are present in NU / NU mice, although their numbers are slightly reduced (average of approximately 1.3 × 106 cells compared with >2.0 × 106 cells in thymic mice), and the compartment is again dominated by CD122hi Vγ7+ IELs. Furthermore, approximately 25% of Vγ7+ IELs in NU / NU and thymic mice reacted with antibody GL2, which detects the Vδ4 (encoded by TRDV2-2) chain. Consistent with this, TRDV2-2 sequences accounted for approximately 25% of the TCRδ chain RNA expressed by purified Vγ7+ IELs (Figures 3A and 4A). Thus, the formation of the intestinal Vγ7+ IEL compartment did not require the thymus.

[0119] Consistent with this, Vγ7+ thymocytes were rare, comprising <10% of TCRγδ+ cells in fetal and postnatal thymuses throughout the first 8 weeks of life, the peak period of thymic function in mice (Figure 4B). Furthermore, the majority of Vγ7+ thymocytes were CD45RBlo, Thy1+, CD5hi, CD122lo, TCRlo, and CD8αα-, thus providing no evidence of intrathymic maturation (Figure 4C and Figure 4E). Similarly, neither lymph nodes nor Peyer's patches (PPs) were required for the formation of the IEL compartment, as normal numbers of Vγ7+ and Vγ7GL2+ IELs with characteristic phenotypes were present in aly / aly (lymphoplastic) mice, which were confirmed after surgery to lack PPs and peripheral and mesenteric lymph nodes (MLNs) (Figure 4F).

[0120] Microbial and / or food antigens were logical candidates for the intestinal inducer(s) of IEL maturation in weanling mice. However, C57Bl / 6 mice raised and maintained in a germ-free environment and / or on a basal protein-antigen-free diet exhibited Vγ7+ and Vγ7GL2+ IEL compartments comparable to their conventionally raised counterparts (Figure 3B). Vγ7+ IELs were uniformly TCRhi, CD122hi, and their absolute numbers were slightly increased, partially compensating for the decline in TCRαβ IELs in germ-free and protein-antigen-free mice (Figure 3B). Thus, the local T cell compartment is most likely formed by endogenous intestinal element(s). In searching for this element(s), we focused on three genes closely related to Skint1: Btnl1, Btnl4, and Btnl6. Btnl4 originates in the fetus and is expressed at low levels in the proximal small intestine. Btnl1 and Btnl6 RNA was detected on postnatal day 6, and Btnl1 levels further increased around day 14, before expression of all three Btnl genes stabilized (Figure 3C). Expression was in postmitotic villous enterocytes interspersed with IELs, retaining replicating epithelial cell progenitors, and was essentially absent from villous crypts, which lack IELs (Figures 3D, 3E, and 4G). Btnl1 expression peaked in the proximal and mid-small intestine (Figure 4H), where its expression was >107-fold higher than in the thymus (Figure 4I). These expression patterns may allow Btnl1, Btnl4, and / or Btnl6 to function locally on Vγ7+ IELs in weanling mice. To investigate this possibility, we obtained three independent strains of Btnl1 mice and one strain of Btnl4 mice, each generated by targeted mutagenesis of embryonic stem cells (ESCs), as well as a strain with an internal deletion of the Btnl1 locus generated by clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 in mouse eggs (Figure 4J). The strains were confirmed as gene knockouts by DNA analysis and the absence of the respective Btnl RNAs (Figures 3E and 4I-K).

[0121] Example 3. Btnl1 shapes the intestinal IEL compartment Each of the four Btnl1 - / - strains showed a highly selective loss of the majority of Vγ7 + IELs, as assessed by flow cytometry or confocal microscopy (Figures 5A, 5B, and 6A). Vγ7 + IEL numbers were depleted by approximately 90%, and Vγ7GL2 + cells were nearly eliminated. Because Vγ7 - IEL numbers were barely increased, the percentage of Vγ7 + cells among γδ IELs was only approximately one-third reduced compared to wild-type (WT) mice, but this was set against the background of dramatically reduced γδ IEL numbers (Figures 5A and 6A). In contrast, the number of TCRβ + CD8α + IELs was significantly increased in Btnl1 - / - mice (Figures 5A and 5B).

[0122] The specificity of Btnl1 for Vγ7+ IELs was highlighted by comprehensive immunophenotypic analysis of Btnl1- / -, WT, and Btnl1+ / - mice, which showed comparable splenic or MLN immune cell subsets (including the γδ cell repertoire) and comparable expression and phenotype of Vγ7+ thymocytes between days 4 and 8 (Figures 6B-6E). Consistent with its expression pattern, Btnl1 functions outside the thymus; thus, Btnl1 deficiency in NU / NU mice reduced the average number of Vγ7+ IELs by approximately 90% and Vγ7GL2+ IELs almost completely disappeared (Figure 5C). Because NU / NU mice lack most αβ T cells, this result rules out the formal possibility that the lack of Vγ7+ IELs in thymic Btnl1- / - mice indirectly reflected proliferating TCRαβ IELs. The specificity of Vγ7 + IELs for Btnl1 was highlighted by the fact that Btnl4 − / − mice did not exhibit any obvious defects in either major IEL subset ( Fig. 5D ).

[0123] Example 4. Btnl1 selects for Vγ7+ IELs in trans To determine how and when Btnl1 affects IELs, we examined the remaining Vγ7+ and Vγ7GL2+ IELs in Btnl1- / - mice. Compared with those in WT mice, significantly fewer Vγ7+ IELs incorporated EdU (p<0.0001) or expressed Ki67 at D28, a period that remained unchanged until W7, when most Vγ7+ IELs in WT mice had stopped cycling (Figures 7A and 8A). Thus, there was no selective expansion of Vγ7+ IELs in Btnl1- / - mice. Similarly, many remaining Vγ7+ and Vγ7GL2+ IELs at weeks 3–5 were observed, although their TCR levels were elevated. Btnl1 - / - mice were CD122lo, Thy1+, TIGIT-, Lag3-, CD8αα-, CD5+, and CD24+, thereby phenocopying immature Vγ7+ IELs from 14- to 17-day-old WT mice (Figures 7B, 7C, and 8B). To demonstrate that Btnl1 exerts its selective effect on Vγ7+ T cells in trans, we reconstituted the Vγ7+ and Vγ7GL2+ IEL compartments of 3- to 5-week-old WT mice within approximately 5 weeks of donor bone marrow (BM) transplantation into irradiated 8- to 10-week-old γδ T cell-deficient TCRδ - / - mice (Figure 8C). BM from either WT or Btnl1 - / - mice proved equally effective in IEL reconstitution (Figure 7D). Although WT BM reconstitution of Vγ7+ IELs in irradiated congenic T cell-sufficient CD45.2+ WT recipients was less efficient than that in TCRδ- / - hosts (comparison plots, upper left of Figures 7D and 7E), reconstitution in Btnl1- / - hosts was still much less efficient, and the small number of Vγ7+ and Vγ7GL2+ IELs generated in Btnl1- / - recipients phenocopied the residual Vγ7+ cells in Btnl1- / - mice and immature IELs in 14- to 17-day-old WT mice (Figure 7E). Complementing these findings, purified IELs from 4-week-old mice were able to reconstitute Vγ7+ IELs in recipient TCRδ- / - mice, albeit very inefficiently, which was also significantly impaired in Btnl1- / - TCRδ- / - hosts (Figure 8D).Thus, Btnl1 functions in non-hematopoietic cells to support the selective proliferation and maturation of Vγ7+ IELs.

[0124] To attempt to restore IEL selection, we provided transgenic Btnl1 mice expressing Btnl1 from a doxycycline (Dox)-inducible promoter (Figures 10A and 10B) and crossed them with Btnl1 mice, into which we introduced a Dox-responsive transactivator (rtTA) controlled by the ubiquitously expressed Rosa26 promoter. As reported, adding low-dose Dox to drinking water had little apparent effect on the intestinal tract over several weeks. Thus, this system provided a means to de novo globally induce Btnl1 in Btnl1 bitransgenic (BiTg) mice, which inherited both the rtTA and inducible Btnl1 transgenes. Conversely, sugar-water-treated BiTg mice and Dox-treated single-transgenic (SiTg) Btnl1 mice (which inherited only the Btnl1 transgene) served as controls. Btnl1 induction in mice with the appropriate genotype was verified by qPCR ( Fig. 10C ).

[0125] When some W11 Btnl1- / - BiTg mice were treated in this manner, the expression of Vγ7+ and Vγ7+GL2+ IELs remained unchanged compared with littermate controls, but the percentage of Vγ7+ IELs that were CD122hi increased significantly, and the majority expressed Ki67. This was not true for Vγ7- or TCRβ+ IELs (Figures 10D-10F). Thus, de novo Btnl1 induction in adult mice partially phenocopied Vγ7+ IEL-specific maturation early in life but did not reconstitute Vγ7+ IEL numbers. Global Btnl1 induction also did not induce ectopic Vγ7+ cell maturation in any other tissues.

[0126] Example 5. Time window of epithelial Btnl activity In further experiments, we restricted Btnl1 induction to mature intestinal cells by generating transgenic Btnl1- / - mice expressing rtTA from the villin promoter. Within 1–2 weeks of Dox treatment of several W11 BiTg Btnl1- / - mice, the majority of Vγ7+ IELs became Lag3hi, Thy1-, and CD122hi, and the majority were also Ki67+ (Figures 9A and 9B). Again, this phenotypic transition was specific to Vγ7+ IELs, despite the occasional Btnl1-independent increase in Ki67+ TCRβ+ IELs in sugar water-treated mice (Figure 9B). Furthermore, the number and expression of Vγ7+ IELs remained unchanged even in mice maintained on Dox for 3–4 weeks (Figure 9C). This demonstrates that Btnl1 does not simply promote the selective proliferation of mature Vγ7+ cells, but can also bring about the phenotypic conversion of immature Vγ7+ IELs.

[0127] However, when Btnl1 expression was induced early in life in Btnl1 - / - mice, Dox treatment of lactating females on D7 or weaned pups on D21, followed by maintenance treatment for 2–5 weeks, significantly increased the representation of Vγ7+ and Vγ7GL2+ IELs (Figure 9D). Furthermore, the expanded Vγ7+ cells phenocopied IELs from W4–5 WT mice and were significantly different from IELs from Dox-treated SiTg and Btnl1 - / - mice (Figure 9E). Thus, acute expression of Btnl1 purely in the intestinal epithelium induces selective phenotypic maturation and proliferation of Vγ7+ IELs, but these effects are separable, and selective proliferation is largely restricted to a developmental window within the first 5 weeks of life.

[0128] Example 6. Epithelial Btnl1 and Btnl6 regulate Vγ7+ cells Given that acute expression of Btnl1 promotes the selective maturation of Vγ7+ IELs in vivo, we examined whether Btnl1 might exhibit specificity for Vγ7+ IELs ex vivo. Because primary intestinal epithelial cells have been reported to retain Btnl1 in a complex with Btnl6, we sought evidence of heterotypic interactions between Btnl proteins. Indeed, cell surface expression of Btnl1 in Btnl1-transfected MODE-K cells (a pre-existing intestinal epithelial cell line in which the endogenous Btnl gene is negligibly expressed) was significantly enhanced by cotransfection with Btnl4 or Btnl6 (Figure 12A). Similarly, surface Btnl6 expression was significantly enhanced by Btnl1, but there was no evidence of cooperation between Btnl6 and Btnl4 (Figure 12A). Considering the specificity of Btnl6 over Btnl1 and the fact that Btnl4- / - mice did not exhibit any IEL phenotype, the inventors focused on Btnl1 and Btnl6.

[0129] We cocultured MODE-K cells stably transduced with Btnl1 (L1), Btnl6 (L6), Btnl1 plus Btnl6 (L1+6), or empty vector (EV) with freshly explanted IELs, which were then assayed for CD25 (IL-2Rα chain) upregulation, one of the most robust measures of TCR stimulation of systemic T cells. Mixed TCRαβ and TCRγδ IELs exhibited modest CD25 upregulation upon coculture with EV, L1, or L6 cells, whereas IELs exposed to L1+6 cells exhibited highly significant CD25 upregulation, entirely attributable to approximately 20% of Vγ7 cells (both Vγ7GL2+ and Vγ7GL2- cells) (Figure 11A). Significant CD25 upregulation was first evident within 4-6 hours, as is true for systemic TCR stimulation (Fig. 12B).

[0130] When L1+6 cells were cocultured with primary IELs derived from Nur77.gfp mice, GFP was upregulated downstream of TCR signaling by nuclear factor of activated T cells (NFAT) activation, and essentially all IELs that upregulated CD25 were GFP+ (Figure 11B). This phenotype was not observed in Vγ7- or TCRαβ+ IELs in the same coculture (Figure 11B). IELs that upregulated CD25 also downregulated CD122, an additional symptom of systemic TCR stimulation (Figure 12C). Thus, CD25+GFP+CD122- cells only arose in Vγ7+ IELs cocultured with L1+6 cells (Figure 11C). Furthermore, CD25 upregulation was accompanied by a slight but significant TCR downregulation, another rapid response to TCR stimulation (Figure 11D). Btnl1+Btnl6 acted directly on Vγ7+ IELs, as CD25 was upregulated on cells purified by flow cytometry before coculture with L1+6 cells (Fig. 12D). Note that background CD25 expression was increased by TCR-dependent sorting, but this did not obscure the results.

[0131] When IELs were separated from L1+6 cells by transwell, CD25 upregulation was abolished and they could not be secondarily transactivated, for example, via secreted cytokines, by IELs in contact with L1+6 cells (Fig. 11E).CD25 upregulation by IELs in contact with L1+6 cells was dose-dependently inhibited by PP2, which inhibits signaling by src family kinases such as Lck and Fyn, but not by PP3, a known control for PP2 specificity (Fig. 12E).

[0132] Just as the remaining Vγ7+ IELs from Btnl1- / - mice responded to acute transgenic Btnl1 induction in vivo, they were comparable to WT Vγ7+ IELs in their responses to Btnl1 plus Btnl6 ex vivo (Figure 6F). In the same experiment, WT Vγ7+ IELs displayed relatively weak responses to anti-CD3, phenocopying the attenuation of responsiveness seen in Vγ5+ DETC progenitors by Skint1, whereas Vγ7+ IELs from Btnl1- / - mice, as well as TCRαβ+ and Vγ7- IELs from WT mice, all displayed strong responses to anti-CD3, since none of these subsets had undergone prior Btnl1 selection in vivo (Figures 6F and 6G).

[0133] Finally, supernatants from IEL cocultures with L1+6 cells showed a small but significant increase in interferon-γ (IFN-γ), CCL4, and granulocyte-macrophage colony-stimulating factor (GM-CSF), among 36 cytokines tested (Figure 11H). These are typical IEL effectors whose production was technically difficult to attribute to Vγ7+ IELs; however, such increases were not observed in supernatants from L1+6 cells cultured with IELs from TCRδ- / - mice. Note that the higher background cytokine expression in TCRδ- / - mice may reflect the innate inflammation often associated with γδ deficiency. In summary, various metrics demonstrated a highly specific and direct ex vivo interaction between Vγ7+ IELs and Btnl1 and Btnl6 coexpressed on intestinal epithelial cells.

[0134] Example 7. Characterizing human intestinal γδ T cells Due to limited tissue availability, human intestinal T cells remain under investigation. Nevertheless, gut-associated γδ cells exist, and their TCR usage differs significantly from that of the Vγ9+Vδ2+ cells that dominate peripheral blood. To better characterize such cells, we subjected biopsies from healthy ascending colons to a modified version of the protocol used to isolate human skin T cells (Clark, et al., Journal of Investigational Dermatology. 2006. 126(5):1059-70, incorporated herein by reference). For 16 of 17 donors, γδ cells were enriched in Vδ1+ cells, but Vδ1-Vδ2- cells were also present; therefore, we use the term "Vδ2-" to distinguish tissue-associated γδ cells from Vδ2+ cells, which were similarly recoverable, albeit in highly variable numbers, from many intestinal samples (Figure 13A).

[0135] Of the six functional human Vγ chain genes (Vγ2, 3, 4, 5, 8, and 9), Vγ4 has been reported to be the signature chain of intestinal Vδ2 cells. Indeed, for up to 10 donors tested, the majority of intestinal Vδ2 cells reacted with Vγ2 / 3 / 4-specific antibodies but not with Vγ5 / 3-specific antibodies (Figure 13B, Table 1), and TCR deep sequencing showed that Vγ4 sequences were far more abundant than Vγ2 sequences (Figure 14A). Thus, despite individual differences, most intestinal γδ T cell compartments contained a substantial Vγ4+Vδ2- subset, while some donors also showed a relatively high representation of Vγ8+Vδ1+ cells (Figure 13B, Table 1). [Table 1]

[0136] Example 8. BTNL3 and BTNL8 regulate human Vγ4+ cells The Btnl2 proximal amplicon on mouse chromosome 17, which encodes Btnl1, Btnl4, and Btnl6, does not have a human equivalent. However, the amplicon adjacent to human BTNL9 encodes BTNL3 and BTNL8, whose expression is highly enriched in the intestinal tract, particularly in EpCAM+ epithelial cells (Figures 14B-14D). Interestingly, similar to the behavior of Btnl1 and Btnl6 described above, neither BTNL3 nor BTNL8 proteins were efficiently expressed in cells transfected with their respective genes unless both were coexpressed (Figure 14E). Conversely, BTNL8S (a splice variant of BTNL8) failed to restore surface BTNL3 expression (Figure 14E).

[0137] While we were unable to test the developmental dependence of human intestinal γδ cells on BTNL3 and BTNL8, we were able to assess whether BTNL3 and BTNL8 phenocopied Btnl1 and Btnl6 by specifically activating characteristic intestinal γδ cells in a TCR-dependent manner. Therefore, we established short-term cocultures of primary gut-derived lymphocytes with HEK293T cells transduced with BTNL3 (L3), BTNL8 (L8), BTNL3 and BTNL8 (L3+8), or EV (Figure 14F). For the representative donor shown, several individual subsets of Vδ1- and Vδ1+ γδ cells that were evident in T cell cocultures with control (EV, L3, and L8) cells exhibited significant TCR downregulation when cocultured with L3+8 cells (arrows, Figure 13C).

[0138] Highlighting specificity, TCR downregulation occurred in response to L3+8 cells in 21 of 23 donors but was never seen in cocultures with L3 or L8 cells, nor was it demonstrated in intestinal V52+ or TCRαβ+ cells, even in the same cultures as responding V52- cells (Figure 13D). Although higher baseline CD25 expression reduced the sensitivity of this assay for ex vivo human vs. mouse intestinal T cell activation, L3+8 cells induced significant CD25 upregulation on intestinal T cells cocultured with control cells (Figure 13E), with CD25 upregulation most evident on cells with a downregulated TCR (Figure 14G).

[0139] Not all V52 cells responded to L3+8 (Figure 13C). Therefore, we speculated that the TCR γ chain might determine BTNL responsiveness, as is the case in mice. Indeed, human V52 populations that downregulated TCRs in coculture with L3+8 cells were detected with Vγ2 / 3 / 4-specific antibodies but not with antibodies against Vγ8, Vγ5 / 3, or Vγ9 (Figures 13F and 13G). Furthermore, when L3+8-responder cells with downregulated TCRs were sorted by flow cytometry from a single donor (Figure 14H) and their Vγ chains were amplified and sequenced unbiasedly, productively rearranged Vγ4 genes were frequently observed (top four sequences, Figure 15). In contrast, TCR γ transcripts from skin-derived TCR γδ cells (G234SK01) were biased toward Vγ3 (bottom four sequences, Figure 15). Interestingly, of the two donors who failed to demonstrate any substantial response to BTNL3+8, one was post hoc demonstrated to have an atypical gut γδ T cell repertoire dominated by Vγ8+ cells (Figure S4I). Similarly, L3+8 cells failed to induce any significant TCR downregulation by primary γδ+ T cells from the skin or blood, where Vγ4+ cells are rare (Figure S3H). Thus, epithelial BTNL genes regulate human tissue-resident γδ T cells in an organ-specific and TCR γ-chain-specific manner.

[0140] Example 9. Experimental Method The following methods were performed as necessary to carry out the studies described in Examples 1-8.

[0141] mouse Wild-type (WT) C57Bl / 6 mice were obtained from Charles River and Harlan. Three independently derived embryonic stem (ES) cells from Btnl1- / - (Btnl1tm1(KOMP)Mbp) mice and ES cells from Btnl4- / - (Btnl4tm1(KOMP)Mbp) mice were obtained from the International Mouse Phenotyping Consortium (IMPC) (Project IDs: CSD67994 and CSD81524). Btnl1 indel / indel mice were generated using CrisprCas technology. Briefly, two independent short guide RNAs targeting the intronic regions between exons 1 and 2 and between exons 5 and 6 were engineered using the online tool: crispr.mit.edu / (CRISPR Design Platform, Broad Institute). The sgRNA and PAM sequences were identified using the sgRNA gene (MA USA). Intron 1 / 2: CCAGCTCCAAGATCCCCCTTGG (SEQ ID NO: 13), intron 5 / 6: TCCATAGCACCTTATCCGGTTGG (SEQ ID NO: 14). The sgRNA and PAM sequences were cloned into the g-RNA base vector, translated in vitro, purified, and coinjected with Cas9 into day-1 fertilized eggs and implanted into pseudopregnant foster mice. WT and Btnl knockout strains were generated and maintained at the Biological Resource Facilities of The Francis Crick Institute. For timed pregnancies, mice were mated overnight, and E0 was considered the day a vaginal plug was observed. Both male and female mice aged 1 to 35 weeks (as indicated) were used in this study. No gender differences were observed.

[0142] Germ-free mice and food antigen-free nutrition Germ-free (GF) mice were housed in plastic isolators with autoclaved food, bedding, and water. Animal sterility was confirmed biweekly by culturing feces in thioglycollate medium under aerobic and anaerobic conditions for at least 10 days. All handling procedures involving GF mice were performed under sterile conditions in a laminar flow hood. Food-free (FAF) mice were maintained on an amino acid-containing diet for up to five generations. The FAF diet (ssniff, S7242-E014 / -E714) pellets contained all essential vitamins, minerals, trace elements, fat, dextrin, sucrose, and free amino acids in a molar ratio equivalent to the protein content of regular rodent chow (LASQCdietRod16, LASvendi).

[0143] Generation of doxycycline-inducible Btnl-1 transgenic (Tg) mice Doxycycline (Dox)-inducible Btnl1-Tg mice were generated by injection of Btnl1- / - blastocysts carrying a linearized cassette containing a TRE / CMV promoter upstream of the Btnl1-ORF. The TRE / CMV cassette was previously described (Oppenheim et al., 2005). R26-rtTA2-M2 (Hochedlinger et al., 2005) or villin-rtTA2-M2 (Roth et al., 2005) were used. (e.g., A. et al., 2009) mice were bred homozygous for Btnl1 deficiency and backcrossed to Btnl-Tg mice for three generations to promote global (R26) or local (villin) induction of Btnl1 transgene expression by doxycycline (1 mg / ml Dox, 2% sucrose) administered in drinking water. Animal experiments were performed in full compliance with UK Home Office regulations and under project license (80 / 2480) for AH.

[0144] Flow cytometry Flow cytometry was performed using the following antibodies conjugated to the indicated fluorochromes: Antibodies against mouse: CD3 APC Cy7(17A2), CD3 PerCPCy5.5(145-2C11), TCRβ Brilliant Violet421(H57-597), TCRβ APC(H57-597), CD122 PE(TMβ1), CD122 Brilliant Violet421(TMβ1), CD122 APC (TMβ1), TIGIT PE (GIGD7), CD45RB APC Cy7 (C363-16A), Thy1.2 Brilliant Violet510 (53-2.1), Lag3 PerCP-efluor710 (C9B7W), CD5 PE (53-7.3), CD24 FITC (M1 / 69), CD24 PECy7(M1 / 69), CD8α PECy7(53-6.7), CD8α PECy7(53-6.7), TCR Vδ4 FITC(GL-2), TCR Vδ4 PE(GL-2), CD8β PerCpCy5.5(YTS156.7.7), CD25 PerCpCy5.5(PC61), CD69 PECy7(H1.2F3), CCR9 PECy7(CW-1.2), CD44 PECy7(IM7), TCRVγ7(F2.67) were provided by Pablo Pereira (Institut Pasteur, Paris, France), TCRVγ1 APC(2.11), TCRVγ4 APC(UC3-10A6), TCRδ BV421(GL3), Ki67 FITC(B56 / MOPC-21), CD45 Qdot605(30-35 F11), CD5 Brilliant Violet510(53-7.3), TCRδ PeCy7(GL3), CD161 / NK1.1 Brilliant Violet650(PK136), CD4 Brilliant Violet786(GK1.5)、CD8α AlexaFluor700(53-6.7)、CD25 APC(PC61)、GITR PE(DTA-1)、CD44 FITC(IM7)、CD62L PerCP-Cy5.5(MEL-14)、KLRG1 BV421(2F1)、CD11c BV786(HL3)、CD11b BV510(M1 / 70)、F4 / 80 PerCPCy5.5(BM8)、Ly6G APC(1A8)、Ly6C AlexaFluor700(AL-21)、CD103 PE(M290)、CD317 Brilliant Violet650(927)、MHCII / IA / IE FITC(2G9)、CD86 Pe-Cy7(GL1)、CD3 Brilliant Violet421(145-2C11)、CD19 Brilliant Violet421(1D3)、CD161 / NK1.1(lin)Brilliant Violet421(PK136)、IgG1 PE(A85-1)、B220(CD45R)AlexaFulor700(RA3-6B2)、IgM Brilliant Violet786(R6-60.2)、IgD PerCPCy5.5(11-26c.2a)、GL-7 AlexaFulor647(GL7)、CD95 PECy7(Jo2)、CD138 Brilliant Violet650(281-2)、CD21 / 35 FITC(7G6)、CD23 Brilliant Violet(B-ly6)。

[0145] Human antibodies: CD25 Brilliant Violet™ 421 (BC96), CD25 PE (BC96), CD3 Brilliant Violet™ 510 (OKT3), CD3 BUV (UCHT1), EpCAM eFlour™ 660 (1B7), Streptavidin APC-Cy7, Streptavidin Brilliant Violet™ 421, TCRγδ PeCy7 (IMMU510), Vγ9 PC5 (IMMU360), Vγ9 PE (B3), Vδ1 APC (REA173), Vδ2 PerCP (B6), Vγ2 / 3 / 4 biotin (23D12), Vγ3 / 5 biotin (56.3) and Vγ8 biotin (R4.5.1) were provided by D. Kabelitz and D. Wesch (Kiel University).

[0146] Other antibodies: DYKDDDDK-PE(Flag), DYKDDDDK-APC(Flag), HA-DyLight650, 6x-histidine-PE. Commercial antibodies were purchased from Biolegend, eBioscience, BD-Bioscience, Thermo Fisher Scientific, or Miltenyi. Viability dye (near-IR or blue) was from Invitrogen. Anti-TCRVγ7 (F2.67) was purified from hybridoma supernatants using the Mouse TCS Purification System (Abcam) and conjugated with biotin or AF647.

[0147] Ki-67 staining was performed on fixed and permeabilized cells using Foxp3 staining buffer set (eBioscience). BrdU (Sigma-Aldrich) and EdU incorporation were assessed by immunohistochemistry or flow cytometry (Click-iT EdU AF647 Assay Kit, Invitrogen) 3 hours after intraperitoneal injection (50 mg / kg), respectively. Anti-TCRVγ7 (F2.67) was purified from hybridoma supernatants using the mouse TCS purification system (abcam-ab128749). Purified anti-TCRVγ7 was then transferred to biotin (EZ-Link Sulfo-NHS-LC Biotinylation Kit, Thermo Fisher Scientific). The antibodies were conjugated with either AF647 (labeling kit, Thermo Fisher Scientific) or AF647 (labeling kit, Thermo Fisher Scientific). Other antibodies were anti-human Vγ2 / 3 / 4 (23D12, biotinylated), Vγ5 / 3 (56.3, biotinylated), and Vγ8 (R4.5.1, biotinylated). Flow cytometry data analysis was performed with FlowJo (version 9.9).

[0148] Plasmids, cloning, RT-PCR, transfection and lentiviral transduction The self-inactivating lentiviral vector pCSIGPW (SFFV promoter-multiple cloning site [MCS]-IRES-GFP-CMV promoter-puromycin R) was constructed by replacing the puromycin R / mIR cassette from the pAPM vector (Pertel et al., 2011) with a custom EcoRI-XhoI-PmeI-NotI-BamHI-XbaI-MluI MCS. The IRES-GFP cassette was cloned by PCR from the pIRES2-eGFP vector (Clonetech) using the BamHI / XbaI sites. The CMV promoter was cloned by PCR from the pCDNA3.1+ vector (Thermo Fisher Scientific) using the MluI / ClaI sites. The puromycin resistance gene was cloned by PCR from the pGIPZ vector (Dharmacon) using the ClaI / AgeI sites. The pCSIGHW variant was generated by exchanging the puromycin resistance gene with the hygromycin B resistance gene, which was cloned by PCR from the pLHCX vector (Clontech).

[0149] cDNAs were (sub)cloned into pCSIGPW or variant vectors. Btnl1, Btnl4, and Btnl6 were previously described (Bas et al., 2011). BTNL3, BTNL8S, and BTNL8 (GenBank accession numbers NM_197975.2, NM_024850.2, and NM_001040462.2) were cloned from Caco-2 cells by conventional RT-PCR using the following primers: BTNL3 For 5'-GAATATCCATGGCTTTTGTGC-3' (SEQ ID NO: 15) BTNL3 Rev 5'-GTCTTCTCTGTCTCATCCCC-3' (SEQ ID NO: 16) BTNL8 For 5'-CCATTCACAGAACACATCCATG-3' (SEQ ID NO: 17) BTNL8S Rev 5'-TATGGGTTACAGTTTTCAGATCAG-3' (SEQ ID NO: 18) BTNL8 Rev 5'-GTGGGATGTGATTCATCCTAC-3' (SEQ ID NO: 19)

[0150] FLAG, HA, and HIS tags were added downstream of the putative leader peptide by overlap PCR. Human full-length TCR gamma and delta chains were cloned using the following primers (XhoI / NotI, pCSIGPW): Vγ2 / 3 / 4 For 5'-ATGCAGTGGGCCCTAGCG-3' (SEQ ID NO: 20) Vγ8 For 5'-ATGCTGTTGGCTCTAGCTCTGCTTC-3' (SEQ ID NO: 21) Vγ9 For 5′-ATGCTGTCACTGCTCCACACATC-3′ (SEQ ID NO: 22) Cγ1 / 2 Rev 5'-TTATGATTTCTCTCCATTGCAGCAG-3' (SEQ ID NO: 23) Vδ1 For 5'-ATGCTGTTCTCCAGCCTGCTG-3' (SEQ ID NO: 24) Vδ2 For 5'-ATGCAGAGGATCTCCTCCCTCAT-3' (SEQ ID NO: 25) Vδ3 For 5'-ATGATTCTTACTGTGGGCTTTAGCTTTTTG-3' (SEQ ID NO: 26) Cδ Rev 5'-TTACAAGAAAAATAACTTGGCAGTCAAGAG-3' (SEQ ID NO: 27)

[0151] The expression of BTNL3 and BTNL8 was confirmed by conventional RT-PCR using the primers shown above. BTN3A1, BTN3A2, EPCAM, and GAPDH were used as control genes. BTN3A1 For 5'-AGTATCTCCTGATATGCAGCATG-3' (SEQ ID NO: 28) BTN3A1 Rev 5'-GGAGGAACTCTCTTCTTCTTTTCAC-3' (SEQ ID NO: 29) BTN3A2 For 5'-TGGTATCTCTTGATATGCAGCATAG-3' (SEQ ID NO: 30) BTN3A2 Rev 5'-AGAGCATCAGGCTGACTTATTGG-3' (SEQ ID NO: 31) EPCAM For 5'-GCCGCCACCATGGCGCCCCCGCAG-3' (SEQ ID NO: 32) EPCAM Rev 5'-TTATGCATTGAGTTCCCTATGCA-3' (SEQ ID NO: 33) GAPDH For 5'-GAAGGTGAAGGTCGGAGTC-3' (SEQ ID NO: 34) GAPDH Rev 5'-GAAGATGGTGATGGGATTTC-3' (SEQ ID NO: 35)

[0152] Transfection was performed in HEK293T cells using PEI (3:1 PEI:DNA ratio, Polysciences). Btnl / BTNL expression was confirmed 48 hours after transfection. Lentiviral particles were produced in HEK293T cells by cotransfection of either empty or pCSIGPW or pCSIGHW containing Btnl / BTNL cDNA, pCMVΔR8.91 (HIV-1 tat / rev / gag / pol), and pHIT / G (MLV env). Transduced cells were treated with puromycin and hygromycin for 7 days starting 48 hours after transduction, sorted based on GFP expression, and used for functional assays.

[0153] Quantitative RT-PCR Samples were stored in RNAlater (Ambion) before RNA purification (Qiagen RNeasy kit) or directly frozen in RLT buffer. cDNA was generated using Superscript-II (Invitrogen) and analyzed using a ViiA7 real-time PCR machine (Applied Biosystems) with the Sybr-green assay (Invitrogen).

[0154] Mouse qPCR primers: Btnl1 For: 5'-TGACCAGGAGAAATCGAAGG-3' (SEQ ID NO: 36) Btnl1 Rev: 5'-CACCGAGCAGGACCAATAGT-3' (SEQ ID NO: 37) Btnl4 For: 5'-CATTCTCCTCAGAGACCCACACTA-3' (SEQ ID NO: 38) Btnl4 Rev: 5'-GAGAGGCCTGAGGGAAGAA-3' (SEQ ID NO: 39) BTNL6 For: 5'-GCACCTCTCTGGTGAAGGAG-3' (SEQ ID NO: 40) Btnl6 Rev: 5'-ACCGTCTTCTGGACCTTTGA-3' (SEQ ID NO: 41) β-actin For: 5'-CAGCTTCTTTGCAGCTCCTT-3' (SEQ ID NO: 42) β-actin Rev: 5'-CACGATGGAGGGGAATACAG-3' (SEQ ID NO: 43) Sox-13 For: 5'-CTCCAGGCCTTCCCAGAC-3' (SEQ ID NO: 44) Sox-13 Rev: 5'-CATGGACTTCCAGCGAGAAC-3' (SEQ ID NO: 45) Rorγc For: 5'-GGTGACCAGCTACCAGAGGA-3' (SEQ ID NO: 46) Rorγc Rev: 5'-CCACATACTGAATGGCCTCA-3' (SEQ ID NO: 47) Tbp For: 5'-GGGGAGCTGTGATGTGAAGT-3' (SEQ ID NO: 48) Tbp Rev: 5'-CCAGGAAATAATTCTGGCTCA-3' (SEQ ID NO: 49) Cyclo For: 5'-CAAATGCTGGACCAAACACAA-3' (SEQ ID NO: 50) Cyclo Rev: 5'-CCATCCAGCCATTCAGTCTTG-3' (SEQ ID NO: 51)

[0155] Southern blotting Southern blots were performed with probes generated using the Dig-Probe labeling kit, and blots were hybridized overnight in DIG-Easy-hyb buffer and developed using a DIG-Luminescence Detection Kit (Sigma-Aldrich). DIG-labeled probes for Southern blotting were generated using the following primers: Btnl1 For: 5'-ACTGGCTTCCTCAGAGTCAT-3' (SEQ ID NO: 52) Btnl1 Rev: 5'-CAGTAGTGAATGGCCCCTGA-3' (SEQ ID NO: 53) Btnl4 For: 5'-GACCAACGCTTCCCTACCTC-3' (SEQ ID NO: 54) Btnl4 Rev: 5'-GCCTTGGGTCCAACAAGACA-3' (SEQ ID NO: 55) Btnl1-Tg-Ex3-For: 5'-GGTTTTCTGTGAAGGGACCA-3' (SEQ ID NO: 56) Btnl1-Tg-Ex4-Rev: 5'-GGTCTGCAACTCAGAGGAGG-3' (SEQ ID NO: 57)

[0156] RNAscope RNAscope was performed on paraffin-embedded sections using the RNAscope 2.0 HD Reagent Kit-BROWN with probes and kits obtained from Advanced Cell Diagnostics Inc. The reference sequences are as follows: Btnl1.NM_001111094.1 (576-1723), Btnl4.NM_030746.1 (560-968), Btnl6.NM_030747.1 (245-1552).

[0157] Isolation of murine intestinal intraepithelial lymphocytes (IEL) IELs were isolated from mouse small intestines as described by Wencker et al., Nat. Immunol. 2014, 15:80-87 (incorporated herein by reference in its entirety). The small intestine was opened, washed with PBS, cut into 1 cm pieces, and incubated on a rotating wheel for 20 minutes in RPMI 1640 supplemented with 1% penicillin / streptomycin (pen / strep), 10% fetal calf serum (FCS), and 1 mM dithiothreitol. The tissue was washed and vortexed in RPMI, then passed twice through a 70 μm nylon cell strainer and centrifuged at 700 g for 30 minutes on a 20 / 40 / 80% Percoll density gradient. IELs were collected from the 40-80% Percoll interface.

[0158] MODE-K co-culture assay Cells were co-cultured in RPMI 1640 supplemented with 10% FCS, Pen / Strep, 2.5% HEPES, 1% glutamine, 1% non-essential amino acids, 1% sodium pyruvate, 0.2% β-mercaptoethanol (Gibco) and cytokines including IL-2 (10 U / ml), IL-15 (10 ng / ml) (Immunotools), IL-3 (100 U / ml), and IL-4 (200 U / ml) (R&D). 10 MODE-K cells were seeded into 48-well plates 24 h before the addition of 10 unsorted or (where indicated) positive FACS-sorted (CD45+Vγ7+) IELs and incubated for 16–18 h in 10% CO2, unless otherwise indicated. For transwell assays, 2 × 105 MODE-K cells were seeded onto 24-well transwell plates (3 μm pore size—Corning) 24 h before the addition of 3 × 105 IELs either in direct contact with the MODE-K cells (bottom), away from the cells (top), or with a 50:50 split of the cells (top and bottom of the transwell).

[0159] IEL stimulation 96-well U-bottom plates were coated overnight at 4°C with 10 μg / ml leaf-purified anti-mouse CD3ε or hamster IgG isotype control (Biolegend) and washed once with 1x PBS before seeding with IELs. 100,000 IELs were seeded per well. Cells were incubated at 37°C in 10% CO2 for 16-18 hours before analysis.

[0160] Confocal imaging Proximal small intestine (SI) samples were fixed in Zamboni fixative, blocked with normal goat serum, and stained with antibodies against TCRβ, TCRδ, TCR Vδ4 (encoded by TRDV2-2) (GL2), CD3, and Vγ7. Z-sections were acquired on a confocal LSM-710 microscope (Zeiss) and processed and analyzed using Imaris software (Bitplane Scientific Solutions).

[0161] Bone marrow chimeras and adoptive IEL transfer Ten- to twelve-week-old recipient mice were irradiated with 950 rads for 24 hours and then injected (IV) with 5–10 × 10 donor bone marrow cells for analysis 4–12 weeks later. IELs collected from 4-week-old WT mice were column-purified using CD45 microbeads (MACS Miltenyi Biotec) and injected IV into 6-week-old TCRδ- / - and TCRδ- / -Btnl1- / - recipients. Analysis was performed 2–3 weeks later.

[0162] RNA sequencing Vγ7+CD122hi and Vγ7+CD122lo IELs were sorted directly into RLT buffer from pooled D14-17 pups. RNA was prepared using the RNA-Micro-plus kit (Qiagen). RNA libraries were generated using the KAPA Stranded RNA-seq Kit with RiboErase (HMR) (KAPA BIOSYSTEMS). Paired-end sequencing was performed on a HiSeq2500 (Illumina) using rapid run chemistry (read length: 100 bp).

[0163] Human samples and isolation of primary lymphocytes Endoscopic biopsies were obtained from the ascending colon of adult donors undergoing routine diagnostic colonoscopy. Skin or excess excised skin discarded during reconstructive surgery was obtained from adult donors. Primary intestinal lymphocytes were obtained using a modified version of the method by Kupper and Clarke (Clark, et al., Journal of Investigational Dermatology. 2006. 126(5):1059-70) (Figure 14F). Skin lymphocytes were isolated using the method originally described. 9 mm x 9 mm x 1.5 mm Cellfoam matrices (Cytomatrix PTY Ltd) were autoclaved and incubated in 100 mg / mL rat tail collagen I (BD Biosciences) in PBS for 30 minutes at 37°C and washed twice in PBS. Following local ethical approval, 12 endoscopic biopsies were taken from the ascending colon of donors. Biopsies were washed for 20 minutes in 5 mL of wash medium (RPMI 1640 10% FCS, β-mercaptoethanol, penicillin [500 U / mL], streptomycin [500 μg / mL], metronidazole [5 μg / mL, Pharmacy department, Guy's Hospital], gentamicin [100 μg / mL, Sigma-Aldrich], and amphotericin 12.5 μg / mL [Thermo Fisher Scientific]). One endoscopic biopsy was placed on each matrix, which was then inverted and pressure was applied to crush the biopsy into the matrix. Matrices were placed in 24-well plates (1 per well) and covered with 2 mL of RPMI 1640 (supplemented with 10% FCS, β-mercaptoethanol, penicillin [100 U / ml], streptomycin [100 μg / ml], metronidazole [1 μg / ml], gentamicin [20 μg / ml], and amphotericin [2.5 μg / ml]), IL-2 (100 U / mL, Novartis Pharmaceutical UK), and IL-15 (10 ng / mL, Biolegend). Every other day, 1 mL of medium was aspirated and replaced with complete medium containing 2x concentrated cytokines. Cells were harvested, and remaining biopsies and empty wells were filled with PBS. The cells were washed with 0.02 mM Hepes. The cell suspension was passed through a 70 μm nylon cell strainer, centrifuged at 400 g for 5 min, resuspended in complete medium without additional cytokines, and immediately placed in coculture. Lymphocytes were used after 5–7 days of culture. PBMCs were isolated by Ficoll gradient from blood obtained from a blood donation service.

[0164] Isolation of human epithelial cells Colon samples were incubated with 5 mM 1,4-dithiothreitol (Sigma) followed by enzymatic digestion with 1.5 mg / ml collagenase VIII (Sigma) and 0.05 mg / mL DNase I (Sigma). EpCAM cells were sorted by flow cytometry directly into RLT lysis buffer. RNA and cDNA were prepared as described above.

[0165] HEK293T co-culture assay 5 × 10 HEK293T cells transduced with either empty vector (EV), BTNL3, BTNL8, or BTNL3+8 and 2 × 10 freshly harvested primary human lymphocytes were co-cultured in 96-well plates with complete medium without supplemented cytokines and incubated at 37°C, 5% CO for 16 hours (Figure 14F).

[0166] Deep sequencing Amplification and sequencing of mouse TRDV genes:TCRδ CDR3 from RNA purified from sorted Vγ7+ IELs was performed using the Amp2Seq platform (iRepertoire). Amplification and sequencing of human TCRG Vγ genes:TCRγ CDR3 was performed using the immunoSEQ platform (Adaptive Biotechnologies).

[0167] statistics Unless otherwise stated, bar graphs / spider charts show the mean ± SD, and p values ​​were obtained from unpaired two-tailed t tests assuming equal SD (ns>0.05).

[0168] Imaris Image Analysis Confocal microscopy was performed using an LSM710 laser scanning confocal microscope (Zeiss) equipped with a 40x oil objective (numerical aperture 1.3). 3D image analysis on z-stacks was performed using Imaris (Bitplane). CD3+ cells were identified using the surface tool. Voxels outside these structures were set to zero in each channel to create a mask.

[0169] Bioinformatics analysis of RNA sequencing Paired-end reads of 101 base pairs were aligned and quantified using RSEM (v1.2.11) with Bowtie2 (Li and Dewey, 2011). Reads were aligned to a transcriptome constructed from the mm10 mouse genome and UCSC known gene gtf file. An average alignment rate of 57.4 million fragments per sample was observed. Gene-level quantification was used to select only detected genes (average TPM value >1 across all samples, 13,313 genes). Differential expression between CD122hi and CD122lo Vγ7+ IEL groups was identified using DESeq2 by considering pair structure within replicate groups. 2664 phenotype-dependent gene expression effects were identified using an FDR of 0.01.

[0170] Data Source RNA sequencing data: GEO accession number-GSE85422.

[0171] Example 10. Characterization of the role of BTNL3 / BTNL8 on γδ cells in disease Surface expression of TCRγδ (Figure 16A, left three panels) or TCR.CD3 (Figure 16A, rightmost panel) was analyzed for the T cell subtypes indicated in each panel after overnight coculture of human intestinal T cells with 293 cells transduced with empty vector (EV, blue histogram) or 293 cells transduced with vectors expressing BTNL3 and BTNL8 (red histogram). For each subtype, TCR / CD3 expression in the two coculture situations essentially overlapped, whereas for γδ cells expressing Vγ2, Vγ3, or Vγ4 (which cannot be distinguished by the detection reagents used), TCRγδ expression by cells exposed to BTNL3 and BTNL8 (red histogram) was left-shifted (downregulated) compared to that expressed by cells exposed to EV (blue). TCR expression was quantified in seven donors (Figure 16B, left panel). The downregulation in TCR Vγ2 / 3 / 4 cells was comparable to that in all TCR Vγ9(-) cells, thus explaining the complete downregulation observed (Figure 16B, second panel). Donor γδ and TCR Vγ2 / 3 / 4 frequencies in these donors were characterized (Figure 16B, right two panels).

[0172] The strategy for detecting common haplotypes encoding BTNL8 and BTNL3 from rare haplotypes encoding BTNL8*3 is shown in Figures 17A and 17B. Genotype-specific primers (L8R and L3R) were used in combination with a common forward primer (L8F) to generate approximately 1.3 kb PCR products. The results are shown in Figure 18. Approximately 46% of the mutations were heterozygous, and approximately 8% were homozygous. Expression of the transduced proteins was detected using FLAG-tagged proteins, as shown in Figure 19. BTNL3 was weakly expressed on the cell surface unless coexpressed with either BTNL8 or the BTNL8 allelic variant BTNL8S179F. However, coexpression with BTNL8*3 did not enhance its surface expression. Conversely, BTNL8*3 enhanced the cell surface expression of BTNL8 and BTNL8S179F.

[0173] Figure 20 shows that TCRγδ and TCRγ2 / 3 / 4 expression were coordinately reduced after exposure to BTNL3+BTNL8 and BTNL3+BTNL8S179F, but not in other contexts. Flow cytometry reveals that homozygous patients diagnosed with IBD exhibit a very small γδ T cell compartment, the majority of which are Vδ1+. Similarly, homozygous patients with a family history of ulcerative colitis also have very low γδ T cell numbers, with over 85% of γδ T cells not expressing TCRγ2 / 3 / 4 (Figure 21).

[0174] Two heterozygous patient samples were analyzed and are shown in Figure 22. Patient GN017 expressed primarily TCR Vγ2 / 3 / 4 as well as Vδ1, Vδ3, Vγ9, and Vδ2, whereas patient GN019 expressed a more diverse set of genes, with readily detectable signals for Vγ8 and Vδ5 in addition to those detected in GN017.

[0175] Consistent with this, when TCR γ-chain cDNAs were cloned from intestinal samples from two donors, 31 / 31 sequences in GN017 were Vγ4-Jγ1, whereas GN019 had much more diverse γ-chain sequences, with only 6 / 33 encoding Vγ4-Jγ1. Notably, GN017 was a "responder" whose γδ cells downregulated their TCR upon exposure to BTNL3 + BTNL8, whereas GN019 was a non-responder. The effects of the indicated SNPs on BTNL3 and BTNL8 expression are shown in Figures 23A and 23B.

[0176] We found that cells heterologously expressing Vγ4 also specifically respond to BTNL3 and BTNL8. J76 cells, Jurkat cells that do not endogenously express either TCR, were transduced with vectors encoding either Vγ4Vδ1 or Vγ9Vδ2 and then cocultured with HEK293T cells expressing either an empty vector, BTNL3 alone, or BTNL3 and BTNL8. Figures 24A and 24B show that J76Vγ4Vδ1 cells specifically exposed to BTNL3 + BTNL8 or PMA + ionomycin specifically downregulated TCR and upregulated CD69. Conversely, J76Vγ9Vδ2 cells showed TCR downregulation and CD69 upregulation only upon exposure to PMA + ionomycin. This is the first time that heterologous expression of Vγ4 on cells is sufficient to bind and respond to BTNL3 + BTNL8.

[0177] In the Caco2 polarization experiments shown in Figures 25A-C, BTNL3 expression was significantly and exclusively expressed in polarized Caco2 cells (Figures 25B and 25C). HNF4a and IL-8 expression were also both upregulated in polarized Caco2 cells (Figure 25C). BTNL8 expression was upregulated in confluent / quiescent Caco2 cells regardless of polarization.

[0178] Examination of the effects of stress (e.g., stress mimicking the inflamed intestinal microenvironment, such as the presence of TNFα and free radicals (e.g., HO)) revealed that TNFα reduced the expression of BTNL3, BTNL8, HNF4, and CDX2, while IL-8 was upregulated (Figure 26A). Kinetic assays revealed that in the presence of TNFα, electrical resistance disappeared over time compared to untreated controls (Figure 26B).

[0179] Example 11. Administration of Vγ4+ T cell populations to treat IBD According to the methods disclosed herein, a physician of skill in the art can treat a patient, such as a human patient, to reduce or alleviate the symptoms of IBD. To this end, a physician of skill in the art can administer to the human patient a population of Vy4+ T cells, wherein 5% or more (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more) of the cells are Vy451+ or Vy453+ T cells. 6 Vγ4+ T cells are administered to patients by intravenous administration every two months.Depending on the administration route used for treatment, patients are evaluated after administration of IEL population, for example, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more.Finding that after administration of Vγ4+ T cell population, one or more IBD symptoms are reduced provides an indication that this treatment is successful in treating IBD.

[0180] Example 12. Generation of γδ T cells expressing Vγ4δ1 Non-Vγ4δ1 γδ T cells, such as Vγ9δ2 cells, can be isolated from a patient sample and transduced to express Vγ4δ1. In an exemplary method for generating Vγ4δ1+ γδ T cells, a viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector) containing a constitutively activated promoter (e.g., any constitutively activated promoter known in the art, such as a human retroviral LTR, SFFV, EIF1α, or PGK) and nucleic acid sequences encoding Vδ1 and Vγ4 is engineered using standard techniques known in the art. To express both Vδ1 and Vγ4, a bicistronic expression cassette is used, in which an IRES sequence is placed between the nucleic acid sequences encoding Vδ1 and Vγ4. After engineering the viral vector, the virus can be used to transduce γδ T cells to generate a population of γδ T cells expressing Vδ1 and Vγ4.

[0181] Example 13. Generation of Vγ4δ1-expressing Tregs Regulatory T cells (Tregs) can be isolated from patient samples and transduced to express Vγ4δ1. In an exemplary method for generating Vγ4δ1+ Tregs, a viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector) containing a constitutively activated promoter (e.g., any constitutively activated promoter known in the art, such as human retroviral LTR, SFFV, EIF1α, or PGK) and nucleic acid sequences encoding Vδ1 and Vγ4 is engineered using standard techniques known in the art. To express both Vδ1 and Vγ4, a bicistronic expression cassette is used, in which an IRES sequence is placed between the nucleic acid sequences encoding Vδ1 and Vγ4. After engineering the viral vector, the virus can be used to transduce Tregs, generating a population of Tregs expressing Vδ1 and Vγ4.

[0182] Example 14. Generation of NK cells expressing Vγ4δ1 Natural killer (NK) cells can be isolated from patient samples and transduced to express Vγ4δ1. In an exemplary method for generating Vγ4δ1 NK cells, a viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector) containing a constitutively activated promoter (e.g., any constitutively activated promoter known in the art, such as a human retroviral LTR, SFFV, EIF1α, or PGK) and nucleic acid sequences encoding Vδ1 and Vγ4 is engineered using standard techniques known in the art. To express both Vδ1 and Vγ4, a bicistronic expression cassette is used, in which an IRES sequence is positioned between the nucleic acid sequences encoding Vδ1 and Vγ4. A viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector) containing an NK cell promoter and a nucleic acid sequence encoding CD3 is also engineered using standard techniques known in the art. After engineering the viral vectors, V51 and Vγ4 viruses and CD3 viruses are used to co-transduce NK cells to generate a population of NK cells expressing V51, Vγ4, and CD3.

[0183] Example 15. Gene therapy using BTNL3 and BTNL8 According to the methods disclosed herein, a physician skilled in the art can treat a patient, such as a human patient, to reduce or alleviate the symptoms of IBD. To this end, a physician skilled in the art administers a virus expressing BTNL3 and BTNL8 to a human patient. A viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector) containing an HNF4A promoter and nucleic acid sequences encoding BTNL3 and BTNL8 is engineered using standard techniques known in the art. To express both BTNL3 and BTNL8, a bicistronic expression cassette is used, in which an IRES sequence is located between the nucleic acid sequence encoding BTNL3 and the nucleic acid sequence encoding BTNL8. A therapeutically effective amount of the virus is administered intravenously to the patient to treat IBD. Treatment is administered once, or optionally repeatedly one or more times, for example, monthly, bimonthly, three times a year, twice a year, or once a year. The patient is evaluated, for example, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more after administration of the virus, depending on the route of administration used for the treatment. A finding of a reduction in one or more IBD symptoms after administration of the virus provides an indication that the treatment is successful in treating IBD.

[0184] Example 16. Gene therapy using HNF4A According to the methods disclosed herein, a physician skilled in the art can treat a patient, such as a human patient (e.g., a human expressing at least one wild-type copy of BTNL3 and BTNL8), to reduce or alleviate the symptoms of IBD. To this end, a physician skilled in the art administers a virus expressing HNF4A to the human patient. A viral vector (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector) containing an HNF4A promoter and a nucleic acid sequence encoding HNF4A is engineered using standard techniques known in the art. The virus is administered intravenously in a therapeutically effective amount to treat IBD. Treatment can be administered once, or, optionally, repeatedly one or more times, for example, monthly, bimonthly, three times a year, twice a year, or once a year. The patient is evaluated, for example, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more, after administration of the virus, depending on the route of administration used for treatment. A finding of a decrease in one or more IBD symptoms following administration of the virus provides an indication that the treatment is successful in treating IBD.

[0185] Example 17. BTNL polymorphisms and disease associations As shown in Figures 27A-B, L8*3 and L3B30.2cl were investigated for their ability to induce TCR downregulation. Donors with known disease states were genotyped for the indicated polymorphisms. Those donors who were either homozygous or compound heterozygous tended to be non-responders, while negative controls were responders. Responsiveness is shown in Figures 28A-B.

[0186] The association with polymorphisms was assessed by genotyping a cohort of 2,048 Crohn's disease patients and 1,879 healthy controls. As shown in Figure 29, homozygosity for each polymorphism did not show a significant association with Crohn's disease incidence, but carriers of two or more BTNL polymorphisms are associated with Crohn's disease. L3B30.2 frequency was also associated with ulcerative colitis in addition to Crohn's disease (UC N=1,932). L3B30.2 frequency: 3.4% in controls, 4.7% in UC p=0.003, 4.9% in Crohn's disease p=0.0009, 4.8% in IBD p=0.0004.

[0187] Example 18. Dysregulation of colonic γδ T cell surface phenotype. Expression of the gut-homing integrin CD103 in γδ+Vδ2- T cells was measured in tissue explant cultures of normal and active UC, as well as in different IBD disease subtypes, as shown in Figures 30A-B. Similarly, expression of the costimulatory molecule 2B4 was measured. Downregulation was associated with disease for both surface markers when compared with normal controls.

[0188] Other embodiments Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. Other embodiments are within the scope of the following claims. (Addendum) The technical concepts that can be understood from the above-described embodiments and modifications will be described below. [Item 1] Isolated Vγ4+ cells expressing heterologous proteins. [Item 2] 2. The isolated Vγ4+ cell of item 1, wherein Vγ4 is the heterologous protein and the Vγ4+ cell is derived from a Vγ4− cell. [Item 3] 3. The isolated Vγ4+ cell of item 1 or 2, wherein the Vγ4− cell is an immune cell. [Item 4] 4. The isolated Vγ4+ cell of item 3, wherein the immune cell is a lymphocyte. [Item 5] 5. The isolated Vγ4+ cell of item 4, wherein the lymphocyte is a T cell or an NK cell. [Item 6] 6. The isolated Vγ4+ cell of item 5, wherein the T cell is a γδ T cell. [Item 7] 7. The isolated Vγ4+ cell of item 6, wherein the γδ T cell is a Vδ2− cell. [Item 8] 8. The isolated Vγ4+ cells according to any one of items 1 to 7, wherein the Vγ4+ cells are derived from human cells. [Item 9] 2. The isolated Vγ4+ cell of item 1, wherein Vγ4 is an endogenously expressed protein. [Item 10] 10. The isolated Vγ4+ cell of any one of paragraphs 1 to 9, which further expresses a surface marker associated with Vγ4+ γδ T cells. [Item 11] 11. The isolated Vγ4+ cell of item 10, wherein the surface marker is selected from CD103 or 2B4. [Item 12] 12. The isolated Vγ4+ cell of item 10 or 11, wherein the surface marker is heterologous. [Item 13] 13. The isolated Vγ4+ cell of any one of items 1 to 12, wherein the cell is derived from an induced pluripotent stem cell (iPSC). [Item 14] 10 6 ~10 10 14. A composition comprising a population of cells, wherein at least 10% of said population is the isolated population of Vγ4+ T cells of any one of items 1 to 13. [Item 15] A vector comprising a polynucleotide encoding a Vγ4 protein and, optionally, a polynucleotide encoding a Vδ1 protein. [Item 16] 16. The vector of item 15, further comprising a polynucleotide sequence encoding a CD3 protein. [Item 17] A vector comprising a polynucleotide sequence encoding a BTNL3 protein and / or a polynucleotide sequence encoding a BTNL8 protein. [Item 18] Item 18. The vector according to item 17, wherein the vector encodes a BTNL3 protein and a BTNL8 protein. [Item 19] A vector comprising a polynucleotide encoding the HNF4A protein. [Item 20] 20. The vector according to any one of items 15 to 19, wherein the vector is a viral vector. [Item 21] 21. The vector of item 20, wherein the viral vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector. [Item 22] 22. A composition comprising the vector according to any one of items 15 to 21. [Item 23] 23. The composition of item 14 or 22 for use in a method for increasing the number or frequency of Vγ4+ cells in the intestinal tract of a subject. [Item 24] 23. The composition of claim 14 or 22 for use in a method for treating inflammation in the intestinal tract of a subject. [Item 25] 25. The composition of claim 24, wherein the inflammation in the intestinal tract of the subject is associated with inflammatory bowel disease (IBD). [Item 26] 26. The composition of item 25, wherein the IBD is Crohn's disease and / or ulcerative colitis. [Item 27] 27. A method for treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level, the method comprising administering to the subject the isolated Vγ4+ cells of any one of Items 1 to 13, the vector of any one of Items 14 to 21, or the composition of any one of Items 22 to 26. [Item 28] 28. The method of claim 27, wherein the decreased expression level of BTNL3 and / or BTNL8 is the result of a mutation in the polynucleotide sequence encoding BTNL3 and / or BTNL8. [Item 29] 29. The method of item 27 or 28, wherein the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface. [Item 30] 30. The method according to any one of items 27 to 29, wherein the mutation is a deletion variant, a fusion variant and / or a single nucleotide polymorphism (SNP). [Item 31] 31. The method of any one of items 27 to 30, wherein the mutation is one or more SNPs in a BTNL3 intron. [Item 32] 31. The method according to any one of items 27 to 30, wherein the mutation is a fusion of BTNL3 and BTNL8. [Item 33] 33. The method of any one of items 27 to 32, wherein the mutation is characterized by expression of a BTNL8*3 fusion protein and / or an L3B30.2lc genotype. [Item 34] 34. The method according to any one of items 27 to 33, wherein the mutation is a heterozygous mutation. [Item 35] 35. The method according to any one of items 27 to 34, wherein two or more variants are present. [Item 36] A method for treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level, the method comprising administering to the subject a polynucleotide encoding an HNF4A protein. [Item 37] 37. The method of claim 36, wherein the polynucleotide encoding the HNF4A protein is encoded by a viral vector. [Item 38] 38. The method of item 36 or 37, wherein the viral vector is a lentiviral vector, an adenoviral vector, or an AAV vector. [Item 39] A method for increasing the number of Vγ4+ cells in a γδ T cell population in the intestinal tract of a subject, the method comprising administering a population of Vγ4+ cells to the subject, wherein the administered population of Vγ4+ cells has been screened for expression of Vγ4. [Item 40] 40. The method of item 39, wherein the subject has been diagnosed with IBD. [Item 41] 41. The method of claim 40, wherein the IBD is Crohn's disease and / or ulcerative colitis. [Item 42] 42. The method of claim 39, 40, or 41, wherein the subject has a mutation in the polynucleotide sequence encoding BTNL3 and / or BTNL8. [Item 43] 43. The method according to any one of items 39 to 42, wherein the Vγ4+ cells administered to the subject are the isolated Vγ4+ cells according to any one of items 1 to 13. [Item 44] 43. The method of any one of items 39 to 42, wherein the Vγ4+ cells administered to the subject have not been modified to express a heterologous protein. [Item 45] 45. The method of any one of items 39 to 44, wherein the population of Vγ4+ cells administered to the subject increases the number of Vγ4+ cells in the intestinal tract of the subject to a number effective to reduce one or more symptoms associated with inflammation in the intestinal tract. [Item 46] 46. ​​The method of claim 45, wherein the inflammation in the intestinal tract is associated with IBD. [Item 47] 47. The method of claim 46, wherein the IBD is Crohn's disease and / or ulcerative colitis. [Item 48] 48. The method of any one of items 39 to 47, further comprising administering to the subject one or more additional therapeutic agents. [Item 49] 1. A method for identifying mutations in a polynucleotide sequence encoding BTNL3 and / or BTNL8, comprising: (a) comparing the level of a polynucleotide sequence associated with a deletion variant in a polynucleotide sequence encoding BTNL3 and / or BTNL8 in a sample from the subject to a reference level of the polynucleotide sequence associated with the deletion variant, wherein an increased level of the polynucleotide sequence associated with a deletion variant in a polynucleotide sequence encoding BTNL3 and BTNL8 in the sample from the subject relative to the reference level indicates the presence of the mutation in the polynucleotide sequence encoding BTNL3 and / or BTNL8; or (b) comparing the level of a polynucleotide sequence encoding BTNL3 and / or BTNL8 in the subject's sample to a reference level of the polynucleotide sequence encoding BTNL3 and BTNL8; a decrease in the level of the polynucleotide sequence encoding BTNL3 and / or BTNL8 in the sample from the subject compared to the reference level indicates the presence of the mutation in the polynucleotide sequence encoding BTNL3 and BTNL8. [Item 50] 50. The method of claim 49, wherein the reference level is of a sample having wild-type BTNL3 and BTNL8 genes. [Item 51] 51. The method of item 49 or 50, wherein the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface. [Item 52] 52. The method of any one of items 49 to 51, wherein the mutation is a deletion variant, a fusion variant, and / or a SNP. [Item 53] 53. The method according to any one of items 49 to 52, wherein the mutation is an intronic SNP in the BTNL3 intron. [Item 54] 53. The method of any one of items 49 to 52, wherein the mutation is a fusion of BTNL3 and BTNL8. [Item 55] 53. The method of any one of items 49 to 52, wherein the mutation is characterized by expression of a BTNL8*3 fusion protein and / or an L3B30.2lc genotype. [Item 56] 56. The method according to any one of items 49 to 55, wherein the mutation is a heterozygous mutation. [Item 57] 57. The method according to any one of items 49 to 56, wherein two or more variants are present. [Item 58] 1. A method for identifying a subject who is likely to develop IBD, comprising: (a) determining whether the subject has a mutation in a polynucleotide sequence encoding BTNL3 and / or BTNL8; (b) identifying said subject as likely to develop IBD based on the presence of said mutation. [Item 59] Item 59. The method according to Item 58, wherein step (a) comprises the method according to any one of Items 49 to 57. [Item 60] 60. The method of item 58 or 59, wherein the IBD is Crohn's disease and / or ulcerative colitis. [Item 61] (c) The method of item 58, 59 or 60, further comprising treating the subject according to the method of any one of items 27 to 48.

Claims

1. Isolated Vγ4+ cells expressing heterologous proteins.

2. 2. The isolated Vγ4+ cell of claim 1, wherein Vγ4 is the heterologous protein and the Vγ4+ cell is derived from a Vγ4- cell.

3. The isolated Vγ4+ cell of claim 1 or 2, wherein the Vγ4− cell is an immune cell.

4. The isolated Vγ4+ cell of claim 3, wherein the immune cell is a lymphocyte.

5. The isolated Vγ4+ cell of claim 4, wherein the lymphocyte is a T cell or an NK cell.

6. The isolated Vγ4+ cell of claim 5, wherein the T cell is a γδ T cell.

7. The isolated Vγ4+ cell of claim 6, wherein the γδ T cell is a Vδ2− cell.

8. The isolated Vγ4+ cell of any one of claims 1 to 7, wherein the Vγ4+ cell is derived from a human cell.

9. The isolated Vγ4+ cell of claim 1, wherein Vγ4 is an endogenously expressed protein.

10. The isolated Vγ4+ cell of any one of claims 1 to 9, further expressing a surface marker associated with Vγ4+ γδ T cells.

11. The isolated Vγ4+ cell of claim 10, wherein the surface marker is selected from CD103 or 2B4.

12. The isolated Vγ4+ cell of claim 10 or 11, wherein the surface marker is heterologous.

13. The isolated Vγ4+ cell of any one of claims 1 to 12, wherein the cell is derived from an induced pluripotent stem cell (iPSC).

14. 10 6 ~10 10 14. A composition comprising a population of cells, wherein at least 10% of said population is the isolated population of Vγ4+ T cells of any one of claims 1 to 13.

15. A vector comprising a polynucleotide encoding a Vγ4 protein and, optionally, a polynucleotide encoding a Vδ1 protein.

16. The vector of claim 15, further comprising a polynucleotide sequence encoding a CD3 protein.

17. A vector comprising a polynucleotide sequence encoding a BTNL3 protein and / or a polynucleotide sequence encoding a BTNL8 protein.

18. 18. The vector of claim 17, wherein the vector encodes a BTNL3 protein and a BTNL8 protein.

19. A vector comprising a polynucleotide encoding an HNF4A protein.

20. The vector according to any one of claims 15 to 19, wherein the vector is a viral vector.

21. 21. The vector of claim 20, wherein the viral vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral (AAV) vector.

22. A composition comprising the vector according to any one of claims 15 to 21.

23. 23. The composition of claim 14 or 22 for use in a method for increasing the number or frequency of Vγ4+ cells in the intestinal tract of a subject.

24. 23. The composition of claim 14 or 22 for use in a method of treating inflammation in the intestinal tract of a subject.

25. 25. The composition of claim 24, wherein the inflammation in the intestinal tract of the subject is associated with inflammatory bowel disease (IBD).

26. 26. The composition of claim 25, wherein the IBD is Crohn's disease and / or ulcerative colitis.

27. 27. A method of treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level, comprising administering to the subject the isolated Vγ4+ cells of any one of claims 1-13, the vector of any one of claims 14-21, or the composition of any one of claims 22-26.

28. 28. The method of claim 27, wherein the decreased expression level of BTNL3 and / or BTNL8 is the result of a mutation in a polynucleotide sequence encoding BTNL3 and / or BTNL8.

29. 29. The method of claim 27 or 28, wherein the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface.

30. 30. The method of any one of claims 27 to 29, wherein the mutation is a deletion variant, a fusion variant and / or a single nucleotide polymorphism (SNP).

31. The method of any one of claims 27 to 30, wherein the mutation is one or more SNPs in a BTNL3 intron.

32. The method of any one of claims 27 to 30, wherein the mutation is a fusion of BTNL3 and BTNL8.

33. The method of any one of claims 27 to 32, wherein the mutation is characterized by the expression of a BTNL8*3 fusion protein and / or the L3B30.21c genotype.

34. The method according to any one of claims 27 to 33, wherein the mutation is a heterozygous mutation.

35. The method of any one of claims 27 to 34, wherein two or more variants are present.

36. A method for treating inflammation in the intestinal tract of a subject having a decreased expression level of BTNL3 and / or BTNL8 compared to a reference expression level, the method comprising administering to the subject a polynucleotide encoding an HNF4A protein.

37. 37. The method of claim 36, wherein the polynucleotide encoding the HNF4A protein is encoded by a viral vector.

38. 38. The method of claim 36 or 37, wherein the viral vector is a lentiviral vector, an adenoviral vector, or an AAV vector.

39. A method for increasing the number of Vγ4+ cells in a γδ T cell population in the intestinal tract of a subject, the method comprising administering a population of Vγ4+ cells to the subject, wherein the administered population of Vγ4+ cells has been screened for expression of Vγ4.

40. 40. The method of claim 39, wherein the subject has been diagnosed with IBD.

41. 41. The method of claim 40, wherein the IBD is Crohn's disease and / or ulcerative colitis.

42. 42. The method of claim 39, 40, or 41, wherein the subject has a mutation in the polynucleotide sequence encoding BTNL3 and / or BTNL8.

43. The method of any one of claims 39 to 42, wherein the Vγ4+ cells administered to the subject are the isolated Vγ4+ cells of any one of claims 1 to 13.

44. 43. The method of any one of claims 39 to 42, wherein the Vγ4+ cells administered to the subject have not been modified to express a heterologous protein.

45. 45. The method of any one of claims 39-44, wherein the population of Vγ4+ cells administered to the subject increases the number of Vγ4+ cells in the intestinal tract of the subject to a number effective to reduce one or more symptoms associated with inflammation in the intestinal tract.

46. 46. ​​The method of claim 45, wherein the inflammation in the intestinal tract is associated with IBD.

47. 47. The method of claim 46, wherein the IBD is Crohn's disease and / or ulcerative colitis.

48. 48. The method of any one of claims 39 to 47, further comprising administering to the subject one or more additional therapeutic agents.

49. 1. A method for identifying mutations in a polynucleotide sequence encoding BTNL3 and / or BTNL8, comprising: (a) comparing the level of a polynucleotide sequence associated with a deletion variant in a polynucleotide sequence encoding BTNL3 and / or BTNL8 in a sample from the subject to a reference level of the polynucleotide sequence associated with the deletion variant, wherein an increased level of the polynucleotide sequence associated with a deletion variant in a polynucleotide sequence encoding BTNL3 and BTNL8 in the sample from the subject relative to the reference level indicates the presence of the mutation in the polynucleotide sequence encoding BTNL3 and / or BTNL8; or (b) comparing the level of polynucleotide sequences encoding BTNL3 and / or BTNL8 in the subject's sample to reference levels of the polynucleotide sequences encoding BTNL3 and BTNL8; A decrease in the level of the polynucleotide sequence encoding BTNL3 and / or BTNL8 in the sample from the subject compared to the reference level indicates the presence of the mutation in the polynucleotide sequence encoding BTNL3 and BTNL8.

50. 50. The method of claim 49, wherein the reference levels are from a sample having wild-type BTNL3 and BTNL8 genes.

51. 51. The method of claim 49 or 50, wherein the mutation is characterized by reduced or eliminated transport of BTNL3 and / or BTNL8 to the cell surface.

52. 52. The method of any one of claims 49 to 51, wherein the mutation is a deletion variant, a fusion variant, and / or a SNP.

53. 53. The method of any one of claims 49 to 52, wherein the mutation is an intronic SNP in the BTNL3 intron.

54. 53. The method of any one of claims 49 to 52, wherein the mutation is a fusion of BTNL3 and BTNL8.

55. 53. The method of any one of claims 49 to 52, wherein the mutation is characterized by expression of a BTNL8*3 fusion protein and / or an L3B30.21c genotype.

56. The method of any one of claims 49 to 55, wherein the mutation is a heterozygous mutation.

57. 57. The method of any one of claims 49 to 56, wherein two or more variants are present.

58. 1. A method for identifying a subject who is likely to develop IBD, comprising: (a) determining whether the subject has a mutation in a polynucleotide sequence encoding BTNL3 and / or BTNL8; (b) identifying said subject as likely to develop IBD based on the presence of said mutation.

59. 59. The method of claim 58, wherein step (a) comprises the method of any one of claims 49 to 57.

60. 60. The method of claim 58 or 59, wherein the IBD is Crohn's disease and / or ulcerative colitis.

61. 61. The method of claim 58, 59 or 60, further comprising (c) treating the subject according to the method of any one of claims 27 to 48.