Methods for detecting polymorphism in gene having repetitive sequence polymorphism, methods for setting threshold values, methods for designing sets of detection probes, and detection probe sets

Abstract

To provide a method of improved detection accuracy for detecting genetic polymorphism including repetitive sequences.SOLUTION: Disclosed is a detection method comprising a step of detecting repetitive sequence polymorphism in a gene having at least four types of repetitive sequence polymorphism using at least four types of detection probes, where the first to fourth detection probes each comprises a 5'-region, an internal region, a 3'-region and a label, where the internal regions of the first to fourth detection probes each comprise a sequence hybridizable with a repetitive sequence of repetition number k, l, m and n respectively, the 5' region is disposed on 5' terminal side of the internal region and comprise a sequence hybridizable with a franking region of the 5' terminus of the gene, the 3' region has a sequence hybridizable with the base sequence of a franking region on 3' terminal side, where the detection step comprises a step of nucleic acid amplification in the presence of a sample, primers and detection probes to detect signals and a step of evaluating repetitive sequence polymorphism on the basis of threshold values.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] The present disclosure relates to a method for detecting a polymorphism in a gene having a polymorphism in a repetitive sequence, a method for setting a threshold value, a method for designing a detection probe set, and a detection probe set. [Background technology]

[0002] Genomic DNA is known to contain DNA regions (tandem repeats or short tandem repeats (STRs)) in which the same base sequence is repeated in the same direction. The number of repeats (repeat range) of the STRs varies among individuals (polymorphisms). Furthermore, the number of repeats is known to be associated with disease or drug side effects (Patent Document 1).

[0003] Methods for detecting STR polymorphisms include sequence analysis, which directly decodes the base sequence of the region containing the repetitive sequence; electrophoretic analysis, which amplifies the region containing the repetitive sequence by PCR (Polymerase Chain Reaction) and determines the sequence by electrophoretic separation; and TaqMan-PCR, which detects the repetitive sequence using a TaqMan (registered trademark) probe specific to the repetitive sequence. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Laid-Open No. 2010-233496 Summary of the Invention [Problem to be solved by the invention]

[0005] The inventors used TaqMan-PCR to detect genes with four or more types of repeat sequence polymorphisms and discovered that the detection probe for the repeat sequence polymorphisms binds to nucleic acids containing repeat sequences with non-target polymorphisms, resulting in reduced specificity and detection accuracy.

[0006] Therefore, the present disclosure aims to provide a method for detecting polymorphisms of genes containing repetitive sequences with improved detection accuracy, a method for setting a threshold value usable in the detection method, a method for designing a detection probe set usable in the detection method, and a detection probe set usable in the detection method.

Means for Solving the Problems

[0007] To achieve the above object, a method for detecting polymorphisms of a gene having a polymorphism of a repetitive sequence in the present disclosure (hereinafter, also referred to as "detection method") includes a detection step of detecting a polymorphism of a repetitive sequence in a gene having polymorphisms of at least four types of repetitive sequences using at least four types of detection probes for a target sample. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes are each a polynucleotide including a base sequence capable of hybridizing to a repetitive sequence having a repetition number of k, l, m, and n times (where k < l < m < n and k is an integer of 2 or more). The 5'-region is arranged on the 5'-terminal side of the internal region and is a polynucleotide including a base sequence capable of hybridizing to the base sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is arranged on the 3'-terminal side of the internal region and is a polynucleotide including a base sequence capable of hybridizing to the base sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and the same full-length length. The third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and the same full-length length. The total lengths of the third detection probe and the fourth detection probe are longer than the total lengths of the first detection probe and the second detection probe. The detection step A signal detection step of nucleic acid amplification of the region in the coexistence of the sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe to detect a signal of the label of the detection probe. It includes an evaluation step of evaluating the polymorphism of the repetitive sequence based on the detected signal and a threshold value. The threshold value is a threshold value set based on a reference nucleic acid containing a repetitive sequence of the same number of repetitions as the repetitive sequence of the target of the detection probe and / or a reference nucleic acid containing repetitive sequences of different numbers of repetitions for the detection probe.

[0008] A method for setting a threshold value (hereinafter, also referred to as "setting method") used for polymorphism detection of a gene having polymorphisms of at least four types of repetitive sequences according to the present disclosure includes a setting step of setting a threshold value for evaluating the polymorphism of the repetitive sequence in a gene having polymorphisms of at least four types of repetitive sequences using at least four types of detection probes for a reference sample. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes are each a polynucleotide containing a base sequence capable of hybridizing to a repetitive sequence of k, l, m, and n repetitions (where k < l < m < n and k is an integer of 2 or more). The 5'-region is arranged on the 5'-terminal side of the internal region and is a polynucleotide containing a base sequence capable of hybridizing to the base sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is arranged on the 3'-terminal side of the internal region and is a polynucleotide containing a base sequence capable of hybridizing to the base sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same full-length length. The third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same full-length length. The full-length lengths of the third detection probe and the fourth detection probe are longer than the full-length lengths of the first detection probe and the second detection probe. The setting step A signal detection step of nucleic acid amplification of the region in the coexistence of the reference sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting the signal of the label of the detection probe. Based on the detected signal, it includes a threshold setting step of setting a threshold for evaluating the polymorphism of the repetitive sequence of the number of repetitions of the target of the detection probe. The reference sample includes a reference nucleic acid containing the same number of repetitive sequences as the repetitive sequence of the number of repetitions of the target of the detection probe and / or a reference nucleic acid containing different numbers of repetitive sequences for the detection probe.

[0009] The detection probe set of the present disclosure is a detection probe set for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes are each a polynucleotide containing a base sequence capable of hybridizing to a repetitive sequence of k, l, m, and n repetitions (where k < l < m < n and k is an integer of 2 or more). The 5'-region is arranged on the 5'-terminal side of the internal region and contains a base sequence capable of hybridizing to the base sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is a polynucleotide that is located on the 3'-terminal side of the internal region and contains a base sequence that can hybridize to the base sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same full-length length. The third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same full-length length. The full-length lengths of the third detection probe and the fourth detection probe are longer than the full-length lengths of the first detection probe and the second detection probe.

[0010] A method of designing a detection probe set for detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms of the present disclosure (hereinafter also referred to as "design method") includes a step of designing a detection probe set for evaluating the repetitive sequence polymorphism in a gene having at least four types of repetitive sequence polymorphisms. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes are each a polynucleotide containing a base sequence that can hybridize to a repetitive sequence with a repetition number of k, l, m, and n times (where k < l < m < n and k is an integer of 2 or more). The 5'-region is a polynucleotide that is located on the 5'-terminal side of the internal region and contains a base sequence that can hybridize to the base sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is a polynucleotide that is located on the 3'-terminal side of the internal region and contains a base sequence that can hybridize to the base sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; The overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe.

[0011] A polymorphism detection reagent (hereinafter also referred to as a "detection reagent") for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms of the present disclosure includes a detection probe set of the present disclosure and a nucleic acid amplification reagent. [Effects of the Invention]

[0012] According to the present disclosure, it is possible to provide a method for detecting a polymorphism of a gene containing a repetitive sequence with improved specificity, a method for setting a threshold that can be used in the detection method, a method for designing a detection probe set that can be used in the detection method, and a detection probe set that can be used in the detection method. [Brief explanation of the drawings]

[0013] [Figure 1] FIG. 1 is a diagram illustrating an example of a design method according to the present disclosure. [Figure 2] FIG. 2 is a graph showing the results of analyzing the real-time PCR measurement results in Example 1. [Figure 3] FIG. 3 is a schematic diagram showing a coordinate system in the setting method of the present disclosure. [Figure 4] FIG. 4 is a graph showing the detection results of the signals of the reference nucleic acid in Example 4 in a coordinate system in which the signals of each polymorphism are used as the coordinate axes. [Figure 5] FIG. 5 is a schematic diagram showing the evaluation flow based on the slope of the signal of the sample in Example 4. [Figure 6]FIG. 6 is a schematic diagram showing the evaluation flow based on the slope of the signal of the sample in Example 4. DETAILED DESCRIPTION OF THE INVENTION

[0014] <Definition> As used herein, "nucleic acid," "polynucleotide," or "oligonucleotide" refers to a polymer of deoxyribonucleotides (DNA), ribonucleotides (RNA), and / or modified nucleotides. The nucleic acid may be a single-stranded or double-stranded nucleic acid molecule. The polynucleotide may be composed of naturally occurring nucleotides, modified or artificial nucleotides, or both.

[0015] As used herein, the term "gene" refers to a factor that determines a genetic trait, and may refer to a "polynucleotide," an "oligonucleotide," and a "nucleic acid."

[0016] As used herein, "A," "T," "G," and "C," when written as bases, refer to adenine, thymine, guanine, and cytosine, respectively.

[0017] As used herein, "UGT1A1 gene" refers to a gene encoding a type of UDP-glucuronosyltransferase. UGT1A1 is also known as an enzyme that metabolizes irinotecan hydrochloride hydrate, and it has been reported that the incidence of side effects caused by irinotecan hydrochloride hydrate varies depending on polymorphisms in the repetitive sequence of the UGT1A1 gene. A specific example of the human UGT1A1 gene is the gene registered with Gene ID: 54658 in NCBI. The human UGT1A1 gene is known to contain at least four types of repetitive sequence polymorphisms (UGT1A1*1 (wild type), UGT1A1*28, UGT1A1*36, and UGT1A1*37) in the promoter region, each of which has a "TA" repeat unit. In UGT1A1*1, UGT1A1*28, UGT1A1*36, and UGT1A1*37, the number of repeats of the repeating unit "TA" is 6, 7, 5, and 8, respectively.

[0018] As used herein, "repeated sequence" refers to a sequence in which the same nucleotide sequence is repeated multiple times in a genomic DNA nucleotide sequence. The repetitive sequence is also generally called a tandem repeat sequence or a microsatellite. Furthermore, "repeated unit" refers to a nucleotide sequence of a repeat unit of generally 1 to 6 nucleotides in the repetitive sequence. "Number of repeats" refers to the number of repeats of the repeat unit in the repetitive sequence. As a specific example, in the repetitive sequence of SEQ ID NO: 1 below, the repetitive unit is (CAG) and the number of repeats is 6. SEQ ID NO: 1: 5'-CAGCAGCAGCAGCAGCAG-3'

[0019] As used herein, the term "probe" refers to a polynucleotide that hybridizes to a polynucleotide having a target base sequence.

[0020] As used herein, the term "label" refers to a label used to distinguish a molecule or substance of interest from other molecules or substances. Examples of the label include fluorescent labels such as fluorescent dyes or fluorescent substances (e.g., fluorescein, fluorescein isothiocyanate, rhodamine), chemiluminescent labels such as luciferin and aequorin, luminescent substances such as acridinium derivatives, enzyme labels such as horseradish peroxidase, alkaline phosphatase, β-galactosidase (β-gal), glucose oxidase, and luciferase, and the like. 3 H, 14 C. 32 P, 35 S, 125 Examples of the fluorescent label include radioisotope (RI) labels such as I. When the fluorescent label is used in combination with the probe, the fluorescent label is also referred to as a reporter, for example. When a reporter is used as the label, the label may contain the reporter in combination with a quencher.

[0021] As used herein, "reporter" refers to a fluorescent dye or fluorescent substance that, in its excited state, is capable of donating or releasing energy to a quencher when in sufficient proximity to the quencher.

[0022] As used herein, "quencher" refers to a molecule that, when in sufficient proximity to a reporter, accepts the energy of an excited reporter and dissipates the energy as heat or emits light at a wavelength longer than the fluorescence wavelength of the reporter.

[0023] As used herein, the term "subject" refers to living organisms such as animals, plants, bacteria, fungi, and viruses. The subject is preferably an animal or a cell, tissue, or organ derived from an animal. The animal refers to humans and non-human animals. Examples of the non-human animals include mammals such as mice, rats, rabbits, dogs, cats, cows, horses, pigs, monkeys, dolphins, and sea lions.

[0024] As used herein, a "sample" may refer to a substance containing nucleic acid, a substance that may contain nucleic acid, or a substance whose presence or absence of nucleic acid is unknown. Examples of the sample include biological samples (e.g., biological samples or specimens). Examples of the biological sample include samples containing body fluids, cells, tissues, organs, etc., such as feces, saliva, samples derived from the lower respiratory tract (e.g., sputum, tracheal aspirate, etc.), oral swabs, pharyngeal swabs, nasopharyngeal swabs, nasal swabs, nasal mucus, conjunctival swabs, whole blood, serum, plasma, cerebrospinal fluid, urine, sweat, semen, vaginal fluid, paracentesis fluid, gastric juice, endometrium, vaginal skin, sebum, dental plaque, tongue coating, and bile. The sample may be liquid or solid. When the sample is solid, it is preferable in the present disclosure to prepare a liquid sample by mixing the solid sample with a liquid. Examples of the liquid include water; physiological saline; and buffer solutions such as Hank's buffer solution, Good's buffer solution (HEPES buffer solution, Tricine buffer solution, etc.), Tris buffer solution, phosphate buffer solution, and glycine buffer solution.

[0025] As used herein, the term "kit" generally refers to a unit in which the components to be provided (e.g., detection reagent, label, instructions, etc.) are provided separately in two or more compartments. The kit can be suitably used to provide a composition that is not provided in a mixed state, but is preferably mixed immediately before use, for reasons of stability, etc. The kit preferably includes, for example, instructions or instructions on how to use the components to be provided (e.g., detection reagent, etc.), or instructions or instructions describing the processing of the components. As used herein, when the kit is used as a reagent kit, the kit may include instructions, etc. describing how to use the detection reagent, etc.

[0026] As used herein, "instructions" or "instructions" refer to written instructions to a physician or other user on how to use the present disclosure. The instructions include, for example, instructions on how to use the detection method, detection reagent, or kit of the present disclosure. The instructions may be prepared in accordance with a format specified by a regulatory agency of the country in which the present disclosure is implemented (e.g., the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, the European Medicines Agency (EMA) in Europe, etc.), and may clearly state that they have been approved by the regulatory agency. The instructions may be a so-called package insert, and are usually provided in paper form, but are not limited thereto, and may also be provided in the form of, for example, electronic media (e.g., a homepage provided on the Internet, email).

[0027] Sequence information for the proteins described herein or the nucleic acids (e.g., DNA or RNA) encoding them is available from Protein Data Bank, UniProt, GenBank, etc. RNA nucleic acid sequences can also be obtained from the corresponding DNA base sequences using appropriate sequence conversion software, etc.

[0028] The present disclosure will be specifically described below using examples. Unless otherwise specified, each disclosure may incorporate the explanations of other disclosures.

[0029] <How to set the threshold> In one aspect, the present disclosure provides a method capable of setting a threshold value for use in detecting polymorphisms of a gene having polymorphisms of at least four types of repetitive sequences. The method for setting a threshold value for use in detecting polymorphisms of a gene containing a repetitive sequence of the present disclosure (hereinafter, also referred to as "setting method") includes a setting step of setting a threshold value for evaluating polymorphisms of repetitive sequences in a gene having polymorphisms of at least four types of repetitive sequences using at least four types of detection probes for a reference sample. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes each have k, l, m, and n repeats (where k < l < m < n and k is an integer of 2 or more).the 5'-region is a polynucleotide located on the 5'-end side of the internal region and comprising a base sequence capable of hybridizing to a base sequence in an adjacent region on the 5'-end side of the repetitive sequence in the gene; the 3'-region is a polynucleotide located on the 3'-end side of the internal region and comprising a base sequence capable of hybridizing to a base sequence in an adjacent region on the 3'-end side of the repetitive sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and are the same in overall length; and the third detection probe and the fourth detection probe have at least one of the 5'-region and the 3'-region and the number of bases in each of the detection probes is the same as that in the first detection probe; the total length of the third detection probe and the fourth detection probe is longer than that of the first detection probe and the second detection probe; the setting step includes a signal detection step of nucleic acid amplifying the region in the presence of the reference sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; and a threshold setting step of setting a threshold for evaluating a polymorphism in the repetitive sequence of the target number of repeats of the detection probe based on the detected signal; and the reference sample includes, for the detection probe, a reference nucleic acid containing a repetitive sequence of the same number of repeats as the repetitive sequence of the target number of repeats of the detection probe, and / or a reference nucleic acid containing a repetitive sequence of a different number of repeats.

[0030]

[0003] After extensive research, the present inventors have used TaqMan-PCR to detect genes with four or more repeat sequence polymorphisms and found that the specificity and detection accuracy of detection probes for the repeat sequence polymorphisms are reduced when they bind to nucleic acids containing repeat sequences with non-target polymorphisms. Further research led the present inventors to find that by using a set of detection probes that satisfy certain conditions described below and setting a threshold based on the signal generated when each detection probe binds to a nucleic acid containing a repeat sequence with a polymorphism other than the target polymorphism (non-target polymorphism), it is possible to distinguish between a nucleic acid containing a repeat sequence with a polymorphism targeted by the detection probe (target polymorphism) and a nucleic acid containing a repeat sequence with the non-target polymorphism, thereby establishing the present disclosure. Furthermore, the present inventors have found that nucleic acids containing each polymorphism can be distinguished by using a set of detection probes that satisfy the above-mentioned certain conditions and evaluating the signals generated when the detection probes bind to nucleic acids containing a repeat sequence with the same number of repeats as the target repeat sequence and / or a nucleic acid containing a repeat sequence with a different number of repeats as the target repeat sequence, as the slope of these signals in a coordinate system, thereby establishing the present invention. Therefore, according to the present disclosure, genetic polymorphisms containing multiple types of repeat sequences can be detected with higher accuracy.

[0031] The setting method of the present disclosure includes a setting step of setting a threshold for evaluating repetitive sequence polymorphisms in a gene having at least four types of repetitive sequence polymorphisms for the reference sample using at least four types of detection probes. As described below, in the setting step, for example, a threshold may be set for each detection probe, or the threshold may be set as a slope in a coordinate system with the signals from two detection probes as coordinate axes. When a threshold is set for each detection probe, the reference sample contains, for each detection probe, a reference nucleic acid containing a repetitive sequence with a different number of repeats from the target polymorphism of the detection probe. In this case, as described below, in the setting step, nucleic acid amplification is performed using a reference sample containing the reference nucleic acid to obtain a signal when the nucleic acid binds to a nucleic acid containing a repetitive sequence with a non-target polymorphism. Therefore, in the setting step, a threshold capable of distinguishing between a gene containing a repetitive sequence with the target polymorphism and a gene containing a repetitive sequence with the non-target polymorphism can be set using the signal derived from the label of each detection probe. Furthermore, when the threshold is set as the gradient in a coordinate system with the signals of two detection probes as the coordinate axes, the reference sample includes, for the detection probe, a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the detection probe, and / or a reference nucleic acid containing a repeat sequence with a different number of repeats. The reference sample used in the setting step may be of one type or of multiple types. The number of reference nucleic acids contained in the reference sample used in the setting step may be one or more.

[0032] The detection probes (detection probe set) used in the setting step include at least four types of probes. Therefore, the detection probes used in the setting step include at least a first detection probe, a second detection probe, a third detection probe, and a fourth detection probe. Each detection probe is a polynucleotide including the 5'-region, the internal region, the 3'-region, and a label.

[0033] The internal region of each detection probe contains a polynucleotide including a base sequence capable of hybridizing to the repetitive sequences of the target's repeat number. The internal regions of the first to fourth detection probes respectively contain a polynucleotide including a base sequence capable of hybridizing to the repetitive sequences of k, l, m, and n repeat numbers. Here, k, l, m, and n satisfy k < l < m < n, and k is an integer of 2 or more. The k, l, m, and n can be appropriately determined according to, for example, the gene having the polymorphism of the repetitive sequence. When the gene is the UGT1A1 gene, the repeat number is, for example, 5 to 8. In this case, the k, l, m, and n are, for example, 5 to 8. The detection method of the present disclosure described later can accurately detect the repeat number in the gene within, for example, 100 or less, particularly in the range of 2 to 20 or 2 to 10. In this case, it is preferable to set the k, l, m, and n in the range of 2 to 20 or 2 to 10.

[0034] The polynucleotide constituting the internal region of each detection probe may, for example, hybridize to the repetitive sequence having the polymorphism of the target under stringent conditions, and may be completely complementary or partially complementary to the repetitive sequence, but preferably is completely complementary. The hybridization can be detected by, for example, various hybridization assays. The hybridization assay is not particularly limited, and for example, the method described in "Molecular Cloning: A Laboratory Manual 2nd Ed." edited by Sambrook et al. [Cold Spring Harbor Laboratory Press (1989)] can also be adopted.

[0035] The "stringent conditions" may be, for example, low stringency conditions, moderate stringency conditions, or high stringency conditions. "Low stringency conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 32°C. "Medium stringency conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 42°C. "High stringency conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 50°C. Those skilled in the art can set the degree of stringency by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, and time. The "stringent conditions" are, for example, those described in the aforementioned "Molecular Cloning: A Laboratory Manual 2nd Edition" edited by Sambrook et al. nd The conditions described in "Cold Spring Harbor Laboratory Press (1989)" can also be used.

[0036] The 5'-region is a polynucleotide located on the 5'-end of the internal region and containing a nucleotide sequence capable of hybridizing to the nucleotide sequence of the flanking region on the 5'-end of the repeat sequence in the gene. The 3'-region is a polynucleotide located on the 3'-end of the internal region and containing a nucleotide sequence capable of hybridizing to the nucleotide sequence of the flanking region on the 3'-end of the repeat sequence in the gene. The detection probe contains the 5'-region and / or the 3'-region in addition to the internal region, thereby enabling accurate detection of the target polymorphism. The 5'-region is, for example, a polynucleotide containing a nucleotide sequence partially or completely complementary to the nucleotide sequence of the flanking region on the 5'-end of the repeat sequence. Because this allows accurate detection of the target polymorphism, it is preferably a polynucleotide containing a nucleotide sequence completely complementary to the nucleotide sequence of the flanking region on the 5'-end of the repeat sequence. Furthermore, the 3'-region is, for example, a polynucleotide containing a base sequence that is partially or completely complementary to the base sequence of the adjacent region on the 3'-end of the repeat sequence, and is preferably a polynucleotide containing a base sequence that is completely complementary to the base sequence of the adjacent region on the 3'-end of the repeat sequence, since this allows for accurate detection of the target polymorphism.

[0037] The 5'-region and the 3'-region are each directly or indirectly linked (bound) to the internal region, preferably directly linked (bound).

[0038] The detection probes are paired in ascending order of the number of repeats of the target, and the detection probes constituting each pair have the same overall length and the same number of bases in at least one of the 5'-region and the 3'-region of each pair, thereby enabling accurate detection of the target polymorphism. In the setting method of the present disclosure, the number of repeats of the target increases in the first to fourth detection probes in this order. Therefore, the first detection probe (number of repeats of target = k) and the second detection probe (number of repeats of target = l) have the same number of bases in at least one of the 5'-region and the 3'-region, and also have the same overall length. The first detection probe and the second detection probe can also be said to have the same base sequence in at least one of the 5'-region and the 3'-region, for example. Furthermore, the third detection probe (number of repeats of target = m) and the fourth detection probe (number of repeats of target = n) have the same number of bases in at least one of the 5'-region and the 3'-region, and also have the same overall length. It can also be said that the third detection probe and the fourth detection probe have the same base sequence in at least one of the base sequence of the 5'-region and the base sequence of the 3'-region, for example.

[0039] The detection probes are paired in ascending order of the number of repeats of the target, and each pair of detection probes is designed so that the total length of the detection probe in the pair with the largest number of repeats is longer than the total length of the detection probe in the pair with the smallest number of repeats, thereby enabling accurate detection of the target polymorphism. Therefore, the total lengths of the third detection probe and the fourth detection probe are longer than the total lengths of the first detection probe and the second detection probe. The total lengths of the third detection probe and the fourth detection probe (L l ) and the total length of the first detection probe and the second detection probe (L s ) and the difference (L l -L s ) may be set, for example, depending on the repeat unit of the repeat sequence, and is, for example, 2 to 30 bases long, 2 to 24 bases long, or 2 to 20 bases long.

[0040] It is preferable that each detection probe has the same number of bases in its 5'-region or 3'-region. That is, it is preferable that the first to fourth detection probes have, for example, the same base sequence in the 5'-region or the same base sequence in the 3'-region. When the first to fourth detection probes have the same number of bases in their 5'-regions, it is preferable that the first detection probe and the third detection probe have the same number of bases in their 3'-regions, and the second detection probe and the fourth detection probe have the same number of bases in their 3'-regions. That is, it is preferable that the first detection probe and the third detection probe have the same base sequence in their 3'-regions, and the second detection probe and the fourth detection probe have the same base sequence in their 3'-regions. Furthermore, when the first to fourth detection probes have the same number of bases in their 3'-regions, it is preferable that the first detection probe and the third detection probe have the same number of bases in their 5'-regions, and the second detection probe and the fourth detection probe have the same number of bases in their 5'-regions. That is, it is preferable that the first detection probe and the third detection probe have the same base sequence in the 5'-region, and that the second detection probe and the fourth detection probe have the same base sequence in the 5'-region.

[0041] The length of each region in the detection probe can be appropriately designed depending on, for example, the length of the repeat sequence of the target polymorphism, the Tm value of the detection probe, and the type of the detection probe. When the detection probe contains a reporter and a quencher as the label, the length of the 5'-region is, for example, 0 to 56 bases, 1 to 56 bases, 0 to 46 bases, 3 to 46 bases, 0 to 36 bases, or 5 to 36 bases. The length of the 3'-region is, for example, 0 to 56 bases, 1 to 56 bases, 0 to 46 bases, 3 to 46 bases, 0 to 36 bases, or 5 to 36 bases. The length of the detection probe is, for example, 8 to 60 bases, 10 to 50 bases, or 12 to 40 bases.

[0042] When the gene is the UGT1A1 gene, examples of the detection probe include the probes (1) to (4) below. In the nucleotide sequences of SEQ ID NOs: 2 to 5 below, the underlined nucleotide sequences correspond to the internal region, and the nucleotide sequences on the 5'-end and 3'-end sides of the underlined nucleotide sequences correspond to the 5'-region and the 3'-region, respectively. The probe (1) below can be used to detect a polymorphism of the UGT1A1 gene (UGT1A1*36) in which the repeat unit is TA and the number of repeats is 5. The probe (2) below can be used to detect a polymorphism of the UGT1A1 gene (UGT1A1*1) in which the repeat unit is TA and the number of repeats is 6. The probe (3) below can be used to detect a polymorphism of the UGT1A1 gene (UGT1A1*28) in which the repeat unit is TA and the number of repeats is 7. The probe (4) below can be used to detect a polymorphism of the UGT1A1 gene (UGT1A1*37) in which the repeat unit is TA and the number of repeats is 8. (1) Probe for UGT1A1*36: a detection probe containing a polynucleotide having a base sequence consisting of SEQ ID NO: 2 5'-TGCCATA TATATATATA AGTAGGA-3' (SEQ ID NO: 2) (2) Probe for UGT1A1*1: a detection probe containing a polynucleotide having a base sequence consisting of SEQ ID NO: 3 5'-TGCCATA TATATATATA AGTAG-3' (SEQ ID NO: 3) (3) Probe for UGT1A1*28: a detection probe containing a polynucleotide having a base sequence consisting of SEQ ID NO: 4 5'-TGCCATA TATATATATATA AGTAGGA-3' (SEQ ID NO: 4) (4) Probe for UGT1A1*37: a detection probe containing a polynucleotide having a base sequence consisting of SEQ ID NO: 5 5'-TGCCATA TATATATATATATA AGTAG-3' (SEQ ID NO: 5)

[0043] The at least four types of detection probes may consist solely of the first to fourth detection probes, or may include other detection probes. The other detection probes may, for example, be detection probes that contain the 5'-region, the internal region, and the 3'-region, similar to the first to fourth detection probes, or may be detection probes with other configurations. When the other detection probes contain the 5'-region, the internal region, and the 3'-region, the internal region of the other detection probes preferably contains a base sequence that can hybridize to a repeat sequence with a different number of repeats than the first to fourth detection probes. Such detection probes can be designed, for example, by the design method of the present disclosure, which will be described later.

[0044] The label can be appropriately set depending on the detection method in the signal detection step described below. The label is preferably, for example, a fluorescent label that is commonly used for modifying nucleic acids and that can be easily detected during amplification of the nucleic acid. The fluorescent label is preferably a combination of a reporter and a quencher, for example, because it enables accurate detection of target polymorphisms. The first to fourth detection probes are preferably configured, for example, to enable discrimination of signals derived from the labels of the respective detection probes in the signal detection step described below. That is, the first to fourth detection probes preferably have different labels. Thus, for example, when the detection method of the present disclosure described below is performed using a threshold set by the setting method of the present disclosure, multiple target polymorphisms can be detected using a single nucleic acid amplification system.

[0045] The reporter can be, for example, a fluorescent substance such as a fluorescent dye or fluorescent molecule used to modify nucleic acids, and is preferably a fluorescent substance commonly used in TaqMan probes. Specific examples of the reporter include 5-FAM, 6-FAM, VIC, NED, fluorescein (FAM), FITC, IRD-700 / 800, CY3, CY5, CY3.5, CY5.5, TET (5-tetrachlorofluorescein), TAMRA (6-carboxytetramethylrhodamine), BODIPY, TMR, Oregon Green, rhodamine green, rhodamine red, Biosearch Blue™, Marina Blue™, Bothell Blue™, Alexa Fluor™ 350, SYBR™ Green 1, EvaGreen™, Alexa Fluor™ 488, JOE™, HEX™, CAL Fluor™ Gold 540, YAKIMA YELLOW™, ROX™ (6-carboxy-X-rhodamine), CAL Fluor™ Red 610, Texas Red (registered trademark), Alexa Fluor (registered trademark) 568, Cry5 (trademark), Quasar (trademark) 670, LightCycler (registered trademark) Red 640, Alexa Fluor (registered trademark) 633, Quasar (trademark) 705, LightCycler (registered trademark) Red 705, Alexa Fluor (registered trademark) 680, SYTO9 (registered trademark), LC Green (registered trademark), LC Green (registered trademark) Plus, etc.

[0046] The quencher can be set depending on the type of the reporter, and examples of the quencher include TAMRA, ROX, Eclipse (registered trademark) Dark quencher, BHQ (Black Hole Quencher), DABCYL, and Non-Fluorescent Quencher (NFQ).

[0047] The position of the label in the detection probe can be, for example, a common labeling site in a nucleic acid molecule, such as the 5' region, the internal region, and / or the 3' region, preferably the 5' end and / or the 3' end of the detection probe. The method for modifying the detection probe with the label can be carried out, for example, by a known method for modifying nucleic acid molecules with the fluorescent substance. The detection probe and the label can be bound directly or indirectly via a linker.

[0048] The positions of the reporter and the quencher in the detection probe are, for example, such that when the detection probe is not hybridized to a polynucleotide containing a repetitive sequence having the same number of repeats as the target, the signal from the reporter is suppressed, but when the detection probe is hybridized to a polynucleotide containing a repetitive sequence having the same number of repeats as the target, the signal from the reporter is detected. Specifically, the reporter may be located in the 5'-region, and the quencher in the 3'-region. Alternatively, the reporter may be located in the 3'-region, and the quencher in the 5'-region. The reporter is preferably located at the 5'-end of the detection probe, and the quencher is located at the 3'-end of the detection probe. Alternatively, the reporter is preferably located at the 3'-end of the detection probe, and the quencher is located at the 5'-end of the detection probe. The reporter and quencher can be modified to the detection probe by, for example, a known method for modifying a fluorescent substance to a nucleic acid molecule. The detection probe may be directly bound to the reporter and the quencher, or may be indirectly bound to the reporter and the quencher via a linker.

[0049] The detection probe preferably includes a modification that increases the melting temperature (Tm) value, for example, since this can improve the Tm value. The modification is, for example, an MGB (Minor Groove Binder). When the detection probe includes an MGB, the detection probe can also be called an MGB probe. The MGB is a molecule that has a structure that binds to the minor groove of the DNA double helix structure. For information on the MGB, see, for example, the following references: Reference: Kutyavin IV et.al., "3'-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures." Nucleic Acids Res. 2000 Jan 15;28(2):655-61.

[0050] When the detection probe contains an MGB, the MGB is preferably positioned (modified) at the 3' end of the detection probe. In this manner, in the present disclosure, for example, the binding between the detection probe and a nucleic acid containing a repeat sequence of the target polymorphism can be stabilized, thereby improving the detection accuracy of the target polymorphism. Furthermore, the reporter and the quencher are preferably positioned (modified) at the 3' end of the MGB in the detection probe. The binding between the detection probe and the MGB may be direct or indirect via a linker.

[0051] In the setting method of the present disclosure, the gene for which the threshold is set can be a desired gene having a repetitive sequence polymorphism. In the gene, the location of the repetitive sequence polymorphism can be, for example, a promoter region, an exon region, an intron region, etc. The repeat unit in the gene can be appropriately determined depending on the gene having the repetitive sequence polymorphism, and can be, for example, TA, CG, CAG, CCTG, ATTCT, etc. When the gene is the UGT1A1 gene, the repeat unit is TA. The repeat unit may be determined by reference to Table 1 described below. The number of repeats in the gene can be appropriately determined depending on the gene having the repetitive sequence polymorphism. When the gene is the UGT1A1 gene, the number of repeats is, for example, 5 to 8. The detection method of the present disclosure described below can accurately detect a gene having a repeat number of, for example, 100 or less, particularly, in the range of 2 to 20 or 2 to 10. Therefore, the number of repeats in the gene is preferably in the range of 2 to 20 or 2 to 10.

[0052] Specific examples of genes having polymorphisms in the repeat sequence include the genes listed in Table 1 below. Table 1 below shows the repeat unit of each gene, the normal number of repeats (normal repeats), the number of repeats in disease patients (expanded repeats), and associated diseases.

[0053] [Table 1]

[0054] The reference sample is a sample containing, for the detection probe, a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the detection probe, and / or a reference nucleic acid containing a repeat sequence with a different number of repeats. The reference sample may contain only a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the detection probe, or only a reference nucleic acid containing a repeat sequence with a different number of repeats than the repeat sequence of the target of the detection probe, or may contain both. The reference sample used in the design method of the present disclosure may be one type or multiple types. Furthermore, the reference sample may contain, for example, one type of reference nucleic acid or multiple types of reference nucleic acids. The types of the reference sample and the reference nucleic acids can be set, for example, according to the threshold setting method in the threshold setting step described below. As described below, when a threshold is set for each detection probe, the reference samples may be, for example, at least four types, and each reference sample may contain, for example, one type of reference nucleic acid for each different detection probe, and the reference nucleic acid contains a reference nucleic acid containing a repeat sequence with a different number of repeats than the polymorphism targeted by the detection probe. When a threshold value is set for each detection probe, the reference sample is, for example, a sample containing a reference nucleic acid for each detection probe, the reference sample containing a repetitive sequence with a different number of repeats from the target polymorphism of the detection probe. When the reference sample contains a reference nucleic acid containing a repetitive sequence with a different number of repeats from the target polymorphism of the detection probe, the number of repeats of the repetitive sequence in the reference nucleic acid may be any positive number, as long as it is different from the number of repeats in the target polymorphism (p: an integer of 2 or greater). The number of repeats of the repetitive sequence in the reference nucleic acid is preferably 1 or more greater than the number of repeats of the target polymorphism, i.e., p+1 or greater, and more preferably 1 greater than the number of repeats of the target polymorphism, i.e., p+1, in order to enable more accurate detection of, for example, genetic polymorphisms containing multiple types of repetitive sequences. When a threshold value is set for each detection probe, the setting method of the present disclosure, for example, sets the number of repeats of the repetitive sequence in the reference nucleic acid to p+1, thereby enabling the setting of a threshold that enables particularly accurate detection of the target polymorphism in the detection method of the present disclosure described below.Specifically, when the gene is the UGT1A1 gene and the target polymorphism is UGT1A1*1, the reference nucleic acid is preferably a nucleic acid containing seven TA repeats. When the gene is the UGT1A1 gene and the target polymorphism is UGT1A1*28, the reference nucleic acid is preferably a nucleic acid containing eight TA repeats. When the gene is the UGT1A1 gene and the target polymorphism is UGT1A1*36, the reference nucleic acid is preferably a nucleic acid containing six TA repeats. When the gene is the UGT1A1 gene and the target polymorphism is UGT1A1*37, the reference nucleic acid is preferably a nucleic acid containing nine TA repeats. Furthermore, as described below, when the threshold is set as the slope of a coordinate system with the signals from two detection probes as the coordinate axes, the reference sample may, for example, be of multiple types, and the reference sample may contain, for example, one or two types of reference nucleic acids for the same or different detection probes, each of which may contain a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence targeted by the detection probe, and / or a reference nucleic acid containing a repeat sequence with a different number of repeats. When the reference sample contains a reference nucleic acid containing a repeat sequence with a different number of repeats from the polymorphism targeted by the detection probe, the number of repeats of the repeat sequence in the reference nucleic acid may be any positive number as long as it is different from the number of repeats in the target polymorphism (p: an integer of 2 or greater). The number of repeats of the repeat sequence in the reference nucleic acid is preferably one or more times greater than the number of repeats of the target polymorphism, i.e., p+1 or greater, specifically p+1, p+2, or p+3, in order to enable more accurate detection of, for example, genetic polymorphisms containing multiple types of repeat sequences. When the reference sample contains a reference nucleic acid containing a repeat sequence with the same number of repeats as the target polymorphism of the detection probe, the number of repeats of the repeat sequence in the reference nucleic acid may be any positive number as long as it is the same as the number of repeats in the target polymorphism (p: an integer of 2 or more).When the threshold is set as the gradient in a coordinate system using the signals from the two detection probes as coordinate axes, the reference sample may include, for example, a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe. Furthermore, when the threshold is set as the gradient in a coordinate system using the signals from two detection probes as coordinate axes, the reference sample may include, for example, a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with a different number of repeats than the repeat sequence of the target of the other detection probe. The reference nucleic acid may be, for example, a nucleic acid isolated from a biological sample containing the off-target polymorphism, or may be chemically synthesized using an automated DNA synthesizer based on a designed base sequence, or may be a polynucleotide encoding a gene having the off-target polymorphism ligated to a vector.

[0055] In the setting method of the present disclosure, the setting step includes a signal detection step of nucleic acid amplifying the region in the presence of the reference sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; and a threshold setting step of setting a threshold for evaluating polymorphism in the repetitive sequence of the number of repeats targeted by the detection probe based on the detected signal.

[0056] In the signal detection step, the coexistence can be prepared, for example, by mixing the reference sample, the primer, and the detection probe. The coexistence is preferably performed in a liquid system (coexistence system or mixed system) containing water, physiological saline, the buffer solution, or the like. The order of the contact or mixing is not particularly limited and can be any order. When the detection probes include multiple types of detection probes with different target polymorphisms, the coexistence system may include any one of the detection probes, multiple detection probes, or all of the detection probes. That is, in the signal detection step, for example, the nucleic acid amplification and detection may be performed in separate liquid systems containing each detection probe and a sample containing a reference nucleic acid corresponding to the detection probe, or the nucleic acid amplification and detection may be performed in a single liquid system containing multiple or all types of detection probes and a sample containing a reference nucleic acid corresponding to the detection probe. When the coexistence system includes multiple detection probes, it is preferable that each detection probe contains a different label. In the signal detection step, for example, a nucleic acid amplification reagent to be used for nucleic acid amplification is further added to the coexistence system to prepare an amplification reaction system. Next, in the signal detection step, for example, a nucleic acid amplification reaction is performed on the amplification reaction system to amplify a region containing the repetitive sequence of the off-target polymorphism in the reference sample.

[0057] The nucleic acid amplification reaction is, for example, a DNA amplification reaction that uses DNA as a template to amplify a region containing a repetitive sequence in the gene. Examples of the DNA amplification reaction include the polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), isothermal chimeric primer nucleic acid amplification (ICAN), strand displacement amplification (SDA), recombinase polymerase amplification (RPA), and helicase-dependent amplification (HDA).

[0058] The reaction conditions for the nucleic acid amplification reaction (for example, temperature, time, and number of cycles) can be appropriately set depending on, for example, the type of nucleic acid amplification reaction, the type of DNA polymerase described below, the primers and the detection probe, and the like.

[0059] The nucleic acid amplification reagent is a reagent capable of amplifying nucleic acid in the sample, and examples thereof include DNA polymerase, primers, substrates, buffer solutions, etc. The nucleic acid amplification reagent includes one or more types of reagents.

[0060] The DNA polymerase can be selected depending on the nucleic acid amplification method. For example, a thermostable polymerase can be used as the DNA polymerase. Specific examples include Taq, Tbr, Tfl, Tru, Tth, TTx, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, GBD, Sac, Sso, Poc, Pab, Mth, Pho, Pfu, ES4, VENT™, DEEPVENT™, and their variants. The DNA polymerase may be, for example, a hot-start DNA polymerase. When the detection probe contains the reporter and quencher, the DNA polymerase preferably has 5' exonuclease activity, which allows efficient release of the reporter from the detection probe. Specific examples include Taq.

[0061] The primers are, for example, a primer set (e.g., a forward primer and a reverse primer) specific to a region of the gene containing a repetitive sequence, and can be designed according to the base sequence of the nucleic acid to be amplified, i.e., the base sequence of the region of the gene containing the repetitive sequence. The base sequence of the primers can be designed, for example, using a primer design tool (software). The primers can be chemically synthesized, for example, using an automatic DNA synthesizer based on the designed base sequence. The primers may include, for example, one or more types, and may include three or more types depending on the region of the gene containing the repetitive sequence.

[0062] The substrate may be, for example, a deoxynucleoside triphosphate or a mixture thereof, such as deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxyuridine triphosphate (dUTP), a derivative thereof, or a mixture of two or more thereof. Examples of the mixture include a mixture of dCTP, dGTP, dATP, and dTTP, a mixture of dCTP, dGTP, dATP, and dUTP, or a mixture of dCTP, dGTP, dATP, dTTP, and dUTP.

[0063] Examples of the buffer solution include Tris buffer, Tris-EDTA (TE) buffer, Bis-Tris-Tricine buffer, Bis-Tricine buffer, phosphate buffer, HEPES buffer, Mops buffer, Tes buffer, Taps buffer, Pipes buffer, Caps buffer, and MES buffer.

[0064] The nucleic acid amplification reagent may contain, for example, other components. The other components include, for example, manganese ions (Mn 2+ ), cobalt ions (CO 2+ ), magnesium ions (Mg 2+divalent ions such as; chlorides such as lithium chloride, sodium chloride, potassium chloride, magnesium chloride, manganese chloride, acetates such as lithium acetate, sodium acetate, potassium acetate, magnesium acetate, manganese acetate, sulfates such as potassium sulfate, magnesium sulfate, manganese sulfate, and salts; anionic surfactants such as sodium dodecyl sulfate, sodium cholate, sodium deoxycholate, cationic surfactants such as cetyltrimethylammonium bromide; octylphenol ethoxylate, polyoxyethylene lauryl ether, polyoxyethylene oleyl ether, polyoxyethylene stearyl ether, polyoxyethylene sorbitan monolaurate, Triton (registered trademark)-X-100, Triton (registered trademark)-X-102, Triton (registered trademark)-X-114, Triton (registered trademark)-X-165, Triton (registered trademark)-X-45, Triton (registered trademark) Examples of surfactants include nonionic surfactants such as Triton®-X-305, Triton®-X-405, NP40, Brij-35, Brij-58, n-octyl-β-d-glucoside, Tween® 20, Tween® 40, Tween® 60, Tween® 65, and Tween® 80; surfactants such as zwitterionic surfactants such as 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; organic solvents such as methanol, ethanol, isopropanol, acetonitrile, and dimethyl sulfoxide; molecular chaperones such as α-cyclodextrin, β-cyclodextrin, or γ-cyclodextrin and their derivatives, and cycloamylose; dimethyl sulfoxide (DMSO), glycerol, formamide, polyethylene glycol (PEG), ammonium sulfate, bovine serum albumin (BSA), and gelatin.

[0065] In the signal detection step, the signal of the label of the detection probe is detected in conjunction with the nucleic acid amplification. In the signal detection step, the nucleic acid amplification and the signal detection may be performed in parallel, or the signal detection may be performed after the nucleic acid amplification. When the signal detection step involves detecting the signal in conjunction with the nucleic acid amplification, the signal detection step is preferably performed by real-time PCR. In the setting method of the present disclosure, when a probe containing the reporter and the quencher, i.e., a TaqMan probe, is used as the detection probe, the real-time PCR method can also be referred to as, for example, TaqMan PCR.

[0066] In the real-time PCR method, the detection probe hybridizes to the PCR amplification product, and in the subsequent extension reaction, the detection probe is hydrolyzed, and the reporter is separated from the quencher to emit fluorescence. In the signal detection step, the fluorescent signal from this released reporter can be detected (monitored) for each cycle by, for example, a detection optical system such as a detection system of a real-time PCR device.

[0067] Next, in the threshold setting step, a threshold is set based on the signal obtained in the signal detection step. The signal obtained in the signal detection step may be, for example, a signal obtained during the nucleic acid amplification, a signal obtained after the nucleic acid amplification, or a signal obtained after the completion of the nucleic acid amplification, i.e., a signal obtained after the final nucleic acid amplification in the signal detection step. The signal obtained in the signal detection step may be corrected, for example, by the signal before the start of the nucleic acid amplification, particularly the background signal before the start of the first nucleic acid amplification. For example, the correction may be performed by removing the signal before the start of the nucleic acid amplification. Preferably, the signal obtained after the completion of the nucleic acid amplification is obtained by removing the background signal before the start of the first nucleic acid amplification. Furthermore, the signal may be corrected based on the signal of a reference dye, such as ROX dye, or may be corrected as a signal ratio relative to the signal of the reference dye.

[0068] In the threshold setting step, for example, a threshold may be set for each detection probe, or the threshold may be set as the slope of a coordinate system (e.g., a Cartesian coordinate system) with the signals of two detection probes as its coordinate axes. Therefore, each of these methods will be described below. When a threshold is set for each detection probe in the threshold setting step, the threshold can be set, for example, based on a cutoff value setting method. For example, the threshold may be the measured value of the signal obtained in the signal detection step, or may be set with the measured value of the signal obtained in the signal detection step taken into consideration of the standard error (SE) or standard deviation (SD) of the signal detection system.

[0069] Next, an example of setting the threshold as a gradient in a coordinate system with the signals from two detection probes as the coordinate axes in the threshold setting step will be described with reference to Figure 3. As shown in Figure 3, in the threshold setting step, for example, a threshold is set for detecting a nucleic acid containing a repetitive sequence with the same number of repeats as the detection probe in the x-axis direction, a threshold for detecting a nucleic acid containing a nucleic acid containing a repetitive sequence with the same number of repeats as the detection probe in the x-axis direction and a nucleic acid containing a repetitive sequence with the same number of repeats as the detection probe in the y-axis direction, and / or a threshold for detecting a nucleic acid containing a repetitive sequence with the same number of repeats as the detection probe in the y-axis direction. Figure 3 is a schematic diagram in which signals obtained from a reference sample containing a reference nucleic acid containing multiple repetitive sequences of the same or different types with the same number of repeats are plotted on a coordinate system (orthogonal coordinate system) with the signals from two detection probes as the coordinate axes. In FIG. 3, (A) is a schematic diagram of a coordinate system with the signal from the first detection probe (horizontal axis, x-axis) and the signal from the second detection probe (vertical axis, y-axis) as its coordinate axes; (B) is a schematic diagram of a coordinate system with the signal from the second detection probe (x-axis) and the signal from the third detection probe (y-axis) as its coordinate axes; and (C) is a schematic diagram of a coordinate system with the signal from the third detection probe (x-axis) and the signal from the fourth detection probe (y-axis) as its coordinate axes. As shown in FIGS. 3(A) to 3(C), when the reference sample contains a reference nucleic acid having a repeat sequence with the same number of repeats as the detection probe on the x-axis, the signal in the x-axis direction increases. When the reference sample contains a reference nucleic acid having a repeat sequence with the same number of repeats as the detection probe on the y-axis, the signal in the y-axis direction increases. Also, as shown in FIGS. 3(A) to 3(C), when the reference sample contains a reference nucleic acid having a repeat sequence with the same number of repeats as the detection probe on the x-axis and the reference sample contains a reference nucleic acid having a repeat sequence with the same number of repeats as the detection probe on the y-axis, the signals in the x-axis and y-axis directions increase.Therefore, by setting the slope (angle) relative to the origin in a coordinate system with the signal from a sample not containing the reference nucleic acid as the origin, it is possible to evaluate whether the target sample contains a nucleic acid having the same number of repeats as the detection probe in the x-axis direction (region 2), whether the target sample contains a nucleic acid having the same number of repeats as the detection probe in the y-axis direction (region 3), or whether the target sample contains a nucleic acid having the same number of repeats as the detection probe in the x-axis and y-axis directions (region 1). Note that in FIG. 3(A), the threshold is set as the slope (angle) from the x-axis, with the origin (the intersection of the x-axis and y-axis) as the reference point. However, the threshold may also be set as the slope (angle) from the y-axis. The slope may be, for example, the slope of a line passing through the sample signal and the origin, or the angle relative to the x-axis or y-axis, or the angle of polar coordinates in a coordinate system with the signal from a sample not containing the reference nucleic acid as the origin, or the tangent value of the coordinate of the sample signal in the coordinate system. However, the angle relative to the x-axis or y-axis or the angle of polar coordinates allows for more efficient threshold setting.

[0070] Specifically, in the threshold setting step, for example, a slope may be calculated and set as the threshold based on a detection signal obtained using a reference sample containing a reference nucleic acid whose signal is detected in region 1, a slope may be calculated and set as the threshold based on a detection signal obtained using a reference sample containing a reference nucleic acid whose signal is detected in regions 2 and 3, or a slope may be calculated and set as the threshold based on detection signals obtained using both reference samples. When a reference sample containing a reference nucleic acid whose signal is detected in region 1 is used, the threshold setting step sets, for example, a slope that is set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe. On the other hand, when a reference sample containing a reference nucleic acid whose signal is detected in Regions 2 and 3 is used, the threshold setting step sets the threshold as a slope based on, for example, a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with a different number of repeats from the repeat sequence of the target of the other detection probe. Because measurement errors occur in the sample measurement, the threshold setting step may set the threshold as, for example, a numerical range with a certain width relative to the slope of the signal of the reference sample. The certain width can take into account, for example, measurement error, standard error (SE), or standard deviation (SD). Specifically, when a reference sample containing a reference nucleic acid whose signal is detected in Region 1 is used, the numerical range of the threshold can be set to, for example, -15° to 15°, -10° to 10°, or -5° to 5° relative to the angle obtained by the signal of the reference sample (the threshold between Regions 2 and 3 and Region 1). When using a reference sample containing a reference nucleic acid whose signal is detected in region 2, the threshold can be set, for example, in the range of 0° to +15°, 0° to +10°, or 0° to +5° relative to the angle obtained by the signal from the reference sample (threshold between region 2 and region 1).When using a reference sample containing a reference nucleic acid whose signal is detected in region 3, the threshold can be set, for example, in the range of -15° to 0°, -10° to 0°, or -5° to 0° relative to the angle obtained by the signal from the reference sample (threshold between region 3 and region 1).

[0071] In the threshold setting step, for example, a plurality of coordinate systems having different coordinate axes are combined so that each of the first to fourth detection probes is present as at least one coordinate axis, and a threshold is set in each coordinate system. Specifically, in the threshold setting step, thresholds are set in at least the following coordinate systems (a), (b), and (c), or at least the following (a), (c), and (d). In this case, the reference sample includes, for example, a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes and a reference nucleic acid (nucleic acid in region 1) with the same number of repeats as the repeat sequence of the target of the other detection probe, or a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes and a reference nucleic acid (nucleic acid in region 2 or 3) with a different number of repeats than the repeat sequence of the target of the other detection probe, for two of the first to fourth detection probes. (a) A coordinate system having the signal of the first detection probe and the signal of the second detection probe as its coordinate axes. (b) a coordinate system having the signal of the second detection probe and the signal of the third detection probe as its coordinate axes; (c) a coordinate system having the signal of the third detection probe and the signal of the fourth detection probe as its coordinate axes; (d) a coordinate system having the signal of the second detection probe and the signal of the fourth detection probe as its coordinate axes;

[0072] Furthermore, in the threshold setting step, for example, since this can further improve the accuracy of detecting polymorphisms in the sample, the threshold may be set in a coordinate system other than the combination of detection probes (a), (b), and (c) or (a), (c), and (d) and having the signals of two of the first to fourth detection probes as its coordinate axes. Specific examples include a coordinate system having the signal of the first detection probe and the signal of the third or fourth detection probe as its coordinate axes, and a coordinate system having the signal of the second detection probe and the signal of the third or fourth detection probe as its coordinate axes. In the threshold setting step, the threshold is preferably set in the coordinate system (e) and / or (f) below. The reference sample can be set, for example, in the same way as the reference sample used to set the threshold in the coordinate system (a), (b), and (c) or the coordinate system (a), (c), and (d). (e) a coordinate system having the signal of the first detection probe and the signal of the third detection probe as its coordinate axes; (f) a coordinate system having the signal of the first detection probe and the signal of the fourth detection probe as its coordinate axes;

[0073] The reference sample used in the threshold setting step may be one type or multiple types. When multiple reference samples are used, the reference samples preferably include, for example, a reference sample containing a reference nucleic acid containing a repetitive sequence with one type of repeat number among the repetitive sequences with multiple repeat numbers, and a reference sample containing a reference nucleic acid containing a repetitive sequence with two types of repeat numbers among the repetitive sequences with multiple repeat numbers. Specific examples of the reference samples include a reference sample containing a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence of the target of the first detection probe, a reference sample containing a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence of the target of the second detection probe, a reference sample containing a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence of the target of the third detection probe, and a reference sample containing a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence of the target of the fourth detection probe; and a reference sample containing a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence of the target of one of the first to fourth detection probes and a reference nucleic acid containing the same number of repeats as the repetitive sequence of the target of the other detection probe.

[0074] In this way, the setting method of the present disclosure can set a threshold value used to detect polymorphisms in genes having polymorphisms in repetitive sequences. According to the threshold value set by the setting method of the present disclosure, for example, using the four or more types of detection probes, nucleic acids containing the repetitive sequences of the target polymorphisms can be suitably detected for genes having four or more types of polymorphisms in repetitive sequences. The design method of the present disclosure can be executed, for example, using a computer. The design method of the present disclosure may be in the form of, for example, a computer-executable program.

[0075] <How to design a detection probe set> In another aspect, the present disclosure provides a design method capable of designing detection probes for detecting polymorphisms of a gene having polymorphisms of at least four types of repetitive sequences. The design method of a detection probe set for detecting a repetitive sequence in a gene having polymorphisms of at least four types of repetitive sequences according to the present disclosure (hereinafter, also referred to as "design method") includes a step of designing a detection probe set for use in evaluating polymorphisms of repetitive sequences in a gene having polymorphisms of at least four types of repetitive sequences. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes each include a polynucleotide having a base sequence capable of hybridizing to a repetitive sequence having a repetition number of k, l, m, and n times (where k < l < m < n and k is an integer of 2 or more). The 5'-region is disposed on the 5'-terminal side of the internal region and includes a polynucleotide having a base sequence capable of hybridizing to the base sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is disposed on the 3'-terminal side of the internal region and includes a polynucleotide having a base sequence capable of hybridizing to the base sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and the same full-length length. The third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and the same full-length length. The full-length lengths of the third detection probe and the fourth detection probe are longer than the full-length lengths of the first detection probe and the second detection probe.

[0076] The design method of the present disclosure can be obtained by designing each detection probe so as to satisfy the conditions of the first to fourth detection probes based on the base sequence of a gene having polymorphisms of at least four types of repetitive sequences. As an example, the design method of the present disclosure can be implemented as follows.

[0077] Referring to Figure 1, an example of the design method of the present disclosure will be described using the example of designing a detection probe capable of detecting a polymorphism in a repetitive sequence of the UGT1A1 gene. As shown in Figure 1, the design method of this embodiment includes S1 (Step 1), S2 (Step 2), S3 (Step 3), and S4 (Step 4). Note that in the following description, steps S1 to S4 are performed in this order, but steps S1 to S3 can be performed in any order. In Figure 1, the underlined base sequence is the repetitive sequence.

[0078] In step S1, the base sequences of genes containing repeat sequences with at least four target repeat numbers are aligned (alignment step) using the 5'-terminal base or the 3'-terminal base of the repeat sequence as a reference. As shown in FIG. 1(A), in this embodiment, the repeat unit of the repeat sequence is TA. Therefore, in the first design method of this embodiment, each base sequence is aligned using the T base at the 5'-terminal of the repeat sequence as a reference.

[0079] Next, in S2, each base sequence is divided into pairs in ascending order of the number of repeats (division step). Specifically, as shown in FIG. 1(B), in this embodiment, the number of TA repeats in each base sequence is 5, 6, 7, or 8. Therefore, in S2, base sequences with 5 and 6 TA repeats are set as pair A, and base sequences with 7 and 8 TA repeats are set as pair B. The number of base sequences constituting the pair is preferably 2 to 4 or 2 to 3, and more preferably 2, since a detection probe set with higher detection accuracy can be designed when there are multiple base sequences.

[0080] In S3, regions of each base sequence are classified into the 5'-region, internal region, and 3'-region using the repeat sequence as a reference. Specifically, as shown in Figure 1(C), for each base sequence, the base sequence of the flanking region on the 5'-end of the repeat sequence in the gene, the repeat sequence, and the base sequence of the flanking region on the 3'-end of the repeat sequence in the gene are classified into the 5'-region, internal region, and 3'-region, respectively, using the repeat sequence as a reference.

[0081] Then, in S4, the base sequences of the 5'-region and 3'-region are adjusted to design each detection probe. Specifically, in S4, as shown in FIG. 1(D), the number of bases in the 5'-region, i.e., the base sequence of the 5'-region, is designed to be the same in pair A and pair B. Also, in S4, the number of bases in the 3'-region is designed so that the overall length of the detection probes in each pair is the same, i.e., the total number of bases in the detection probes in each pair is the same, and the overall length of the detection probe in pair B is longer than the overall length of the detection probe in pair A. Then, in S4, each detection probe is designed by linking the designed base sequences of the 5'-region and 3'-region to a repeat sequence.

[0082] As a result, in the design method of this embodiment, the following detection probes (1) to (4) can be designed as probes for detecting polymorphisms in the repetitive sequence of the UGT1A1 gene. (1) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 2 (2) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 3 (3) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 4 (4) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 5

[0083] In this embodiment, in S1, alignment was performed based on the base T at the 5' end of the repeat sequence. However, the design method of the present disclosure is not limited to this, and alignment may also be performed based on the base A at the 3' end of the repeat sequence. In this case, in S4, the design method of the present disclosure designs pair A and pair B so that the number of bases in the 3' region, i.e., the base sequence of the 3' region, is the same. Furthermore, in S4, the number of bases in the 5' region is designed so that the overall length of the detection probes in each pair is the same, i.e., the total number of bases in the detection probes in each pair is the same. Then, in S4, each detection probe can be designed by linking the designed base sequences of the 5' region and 3' region to the repeat sequence.

[0084] In this embodiment, in S4, the base sequences of the 5'-region and 3'-region of each detection probe of each pair are designed. However, the design method of the present disclosure is not limited to this. The base sequences of the 5'-region and 3'-region of one pair may be designed, and the base sequences of the 5'-region and 3'-region of the other pair may be designed based on this. In FIG. 1(D), the detection probe in the upper row of pair A corresponds to the first detection probe, and the detection probe in the lower row corresponds to the second detection probe. Furthermore, the detection probe in the upper row of pair B corresponds to the third probe, and the detection probe in the lower row corresponds to the fourth detection probe. The base sequences of the 5'-region and 3'-region of the first detection probe and the third detection probe may be the same. Furthermore, the base sequences of the 5'-region and 3'-region of the second detection probe and the fourth detection probe may be the same. Therefore, in S4, the base sequences of the 5'-region and 3'-region of one of the pairs are designed in the same manner as described above. Then, in S4, each detection probe may be designed using the base sequences of the 5'-region and 3'-region of one designed pair as the base sequences of the 5'-region and 3'-region of another pair.

[0085] In this embodiment, four types of detection probes, the first to fourth detection probes, were designed, but the number of types of detection probes designed in the design method of the present disclosure is not limited to this. For example, other detection probes may be designed in addition to the first to fourth detection probes, that is, five or more types of detection probes may be designed. The number of types of detection probes designed in the design method of the present disclosure may be designed according to, for example, the number of types of polymorphisms in the gene having a polymorphism in the repetitive sequence. The design method of the present disclosure can be executed, for example, using a computer. The design method of the present disclosure may be in the form of, for example, a program executable by a computer.

[0086] According to the design method of the present disclosure, it is possible to easily design detection probes that can be suitably used to detect polymorphisms in genes that have at least four types of repeat sequence polymorphisms.

[0087] <Polymorphism detection method> In another aspect, the present disclosure provides a method capable of detecting a polymorphism of a gene having polymorphisms of at least four types of repetitive sequences. The method for detecting a polymorphism of a gene having a polymorphism of a repetitive sequence of the present disclosure (hereinafter, also referred to as "detection method") includes a detection step of detecting a polymorphism of a repetitive sequence in a gene having polymorphisms of at least four types of repetitive sequences using at least four types of detection probes for a target sample. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes are k, l, m, and n times, respectively (where k < l < m < n and k is an integer of 2 or more).the 5'-region is a polynucleotide located on the 5'-end side of the internal region and containing a base sequence capable of hybridizing to a base sequence in an adjacent region on the 5'-end side of the repetitive sequence in the gene; the 3'-region is a polynucleotide located on the 3'-end side of the internal region and containing a base sequence capable of hybridizing to a base sequence in an adjacent region on the 3'-end side of the repetitive sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and are the same in overall length; and the third detection probe and the fourth detection probe have the same number of bases in the 5'-region and the 3'-region. the number of bases in at least one of the regions is the same and the overall lengths are the same, and the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe; the detection step includes a signal detection step of nucleic acid amplifying the region in the presence of the sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; and an evaluation step of evaluating the polymorphism of the repetitive sequence based on the detected signal and a threshold value, wherein the threshold value is set for the detection probe based on a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence with the same number of repeats as the repetitive sequence targeted by the detection probe, and / or a reference nucleic acid containing a repetitive sequence with a different number of repeats.

[0088] The detection step involves detecting repeat sequence polymorphisms in a gene having at least four repeat sequence polymorphisms using at least four detection probes in a sample from the subject. The sample from the subject is, for example, a biological sample from the subject, preferably a blood sample. The sample from the subject may be, for example, nucleic acid isolated from the sample from the subject. The nucleic acid can be isolated by, for example, a conventional method, specifically, by subjecting the sample to alcohol precipitation (e.g., ethanol precipitation, isopropanol precipitation, etc.), polyethylene glycol precipitation, phenol treatment (e.g., phenol-chloroform treatment, etc.), gel filtration, adsorption with silica or cellulose (e.g., spin column method, magnetic bead method, etc.), electrophoresis, dialysis, affinity chromatography, etc.

[0089] In the detection step, the number of types of polymorphisms in the repetitive sequence to be detected may be four or more, and may include other detection probes in addition to the first to fourth detection probes. In the detection step, the number of types of polymorphisms in the repetitive sequence to be detected may be set, for example, according to the number of types of polymorphisms in the repetitive sequence contained in the gene to be detected. Furthermore, the number of types of detection probes used in the detection step may be four or more, and can be set according to the number of types of polymorphisms in the repetitive sequence to be detected in the target sample.

[0090] The signal detection step in the detection step can be carried out in the same manner as in the set method of the present disclosure, except that the subject sample is used instead of or in addition to the reference sample.

[0091] Next, in the evaluation step, the polymorphism of the repetitive sequence is evaluated based on the detected signal and a threshold value. The evaluation step can be determined, for example, according to the type of threshold value set. When the threshold value is a cutoff value, for example, if the detected signal is equal to or greater than the threshold value in the evaluation step, the subject sample can be evaluated as containing a repetitive sequence of the polymorphism targeted by the detection probe, i.e., containing the target polymorphism. On the other hand, for example, if the detected signal is less than the threshold value in the evaluation step, the subject sample can be evaluated as not containing a repetitive sequence of the polymorphism targeted by the detection probe, i.e., not containing the target polymorphism. In the evaluation step, the signals detected using each of at least four types of detection probes are similarly evaluated to evaluate the presence or absence of the target polymorphism in the subject sample.

[0092] As a specific example, when the detection probes (1) to (4) are used, the evaluation can be performed as follows. In the evaluation step, if the signal emitted using the detection probe (1) is equal to or greater than the threshold, the target sample can be evaluated to contain UGT1A1*36. On the other hand, if the signal emitted using the detection probe (1) is less than the threshold, the target sample can be evaluated to not contain UGT1A1*36. Furthermore, if the signal emitted using the detection probe (2) is equal to or greater than the threshold, the target sample can be evaluated to contain UGT1A1*1 (wild-type). On the other hand, if the signal emitted using the detection probe (2) is less than the threshold, the target sample can be evaluated to not contain UGT1A1*1 (wild-type). Furthermore, if the signal emitted using the detection probe (3) is equal to or greater than the threshold, the target sample can be evaluated to contain UGT1A1*28. On the other hand, if the signal emitted using the detection probe (3) is less than the threshold, the target sample can be evaluated to not contain UGT1A1*28. If the signal emitted using the detection probe (4) is equal to or greater than the threshold, the subject sample can be evaluated as containing UGT1A1*37. On the other hand, if the signal emitted using the detection probe (4) is less than the threshold, the subject sample can be evaluated as not containing UGT1A1*37.

[0093] If the threshold is a slope, the evaluation step evaluates the polymorphism of the repetitive sequence based on the slope of the detected signal in a coordinate system in which the signals of two of the first to fourth detection probes are used as coordinate axes, and the threshold. The slope can be, for example, as described above. Specifically, if the slope of the detected signal in the evaluation step is within the range of region 1 in Figures 3(A) to 3(C), the sample can be evaluated as containing a polymorphism containing a repetitive sequence with the same number of repeats as the repetitive sequence targeted by the detection probes on the x and y axes, i.e., a heterozygous polymorphism. Furthermore, if the slope of the detected signal in the evaluation step is within the range of region 2 in Figures 3(A) to 3(C), the sample can be evaluated as containing a polymorphism containing a repetitive sequence with the same number of repeats as the repetitive sequence targeted by the detection probe on the x axis. Furthermore, in the evaluation step, if the slope of the detected signal is within the range of region 3 in Figures 3(A) to 3(C), the sample can be evaluated as containing a polymorphism containing a repetitive sequence with the same number of repeats as the repetitive sequence targeted by the detection probe on the y-axis. Therefore, in the evaluation step, for example, since the combination of regions detected in each coordinate system differs depending on the polymorphism of the repetitive sequence contained in the sample, the polymorphism of the repetitive sequence contained in the sample is evaluated based on the combination of regions detected in each coordinate system. Furthermore, in the evaluation step, for example, if the detected signal is below a certain value on each coordinate axis, the signal may be evaluated as noise, i.e., as not containing a repetitive sequence with the same number of repeats as the detection probe on each coordinate axis.

[0094] In the evaluation step, the combination of coordinate systems used for evaluation and the evaluation order can be set appropriately, for example, within a range that allows detection of polymorphisms in the sample. In the evaluation step, the combination of coordinate systems and the evaluation order can be set, for example, as follows. Specifically, in setting the evaluation order, for example, the coordinate systems are classified into a coordinate system that includes the signal of the first detection probe as a coordinate axis and a coordinate system that does not include the signal of the first detection probe as a coordinate axis. The coordinate system that includes the signal of the first detection probe as a coordinate axis is, for example, a coordinate system that includes the signals of the first and second detection probes as coordinate axes, a coordinate system that includes the signals of the first and third detection probes as coordinate axes, or a coordinate system that includes the signals of the first and fourth detection probes as coordinate axes. Examples of coordinate systems that do not include the signal of the first detection probe as a coordinate axis include a coordinate system that includes the signals of the second and third detection probes as coordinate axes, a coordinate system that includes the signals of the second and fourth detection probes as coordinate axes, or a coordinate system that includes the signals of the third and fourth detection probes as coordinate axes. Next, in setting the evaluation order, for example, three types of coordinate systems that include the signal of the first detection probe as a coordinate axis and two types of coordinate systems that do not include the signal of the first detection probe as a coordinate axis are extracted. Then, in setting the evaluation order, for example, the three types of coordinate systems that include the signal of the first detection probe as a coordinate axis are arranged in an arbitrary evaluation order, and after evaluation of the three types, coordinate systems that do not include the signal of the first detection probe as a coordinate axis are arranged in an arbitrary order. As a specific example, when the polymorphism is a polymorphism in the UGT1A1 gene, in the evaluation step, the polymorphism of the repetitive sequence in the sample can be evaluated using, for example, a coordinate system including the signals of the first and second detection probes as its coordinate axes, a coordinate system including the signals of the first and third detection probes as its coordinate axes, a coordinate system including the signals of the first and fourth detection probes as its coordinate axes, a coordinate system including the signals of the second and third detection probes as its coordinate axes, and a coordinate system including the signals of the third and fourth detection probes as its coordinate axes, in this order.Furthermore, when the polymorphism is a polymorphism in the UGT1A1 gene, the evaluation step can evaluate the polymorphism of the repetitive sequence in the sample using, for example, a coordinate system including the signals of the first and second detection probes as its coordinate axes, a coordinate system including the signals of the first and third detection probes as its coordinate axes, a coordinate system including the signals of the first and fourth detection probes as its coordinate axes, a coordinate system including the signals of the second and fourth detection probes as its coordinate axes, and a coordinate system including the signals of the third and fourth detection probes as its coordinate axes, in this order.

[0095] When the coordinate systems (a) to (c) are used, the evaluation step can be performed as follows. In the evaluation step, the slope in the coordinate system (a) (the coordinate system of FIG. 3(A)) is calculated from the detected signal. Next, it is evaluated whether the obtained slope falls within any of the slope ranges of regions 1 to 3 of the coordinate system (a). If the slope of the detected signal falls within the slope range of region 1 of the coordinate system (a), the sample can be evaluated as containing a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe. If the slope of the detected signal falls within the slope range of region 2 or region 3 of the coordinate system (a), the evaluation step proceeds to evaluation using the coordinate system (b). Next, the slope in the coordinate system (b) (the coordinate system of FIG. 3(B)) is calculated from the detected signal. The obtained slope is then evaluated to determine which of the slope ranges in regions 1 to 3 of the coordinate system (b) it is in. If the slope of the detected signal is within the slope range of region 1 of the coordinate system (b), the sample can be evaluated to contain a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence targeted by the second detection probe and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence targeted by the third detection probe. If the slope of the detected signal is within the slope range of region 2 of the coordinate system (a) and within the slope range of region 2 of the coordinate system (b), the sample can be evaluated to contain a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence targeted by the first detection probe. If the slope of the detected signal is within the slope range of region 2 of the coordinate system (a) and within the slope range of region 3 of the coordinate system (b), the evaluation step proceeds to evaluation using the coordinate system (c). If the slope of the detected signal is within the range of slopes in region 3 of the coordinate system (a) and within the range of slopes in region 2 or region 3 of the coordinate system (b), the evaluation step proceeds to evaluation using the coordinate system (c). Next, the slope in the coordinate system (c) (the coordinate system of FIG. 3(C)) is calculated from the detected signal.The obtained slope is then evaluated to determine which of the slope ranges in regions 1 to 3 of the coordinate system (c) it is in. If the slope of the detected signal is within the slope range of region 1 of the coordinate system (c), the sample can be evaluated as containing a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe. If the slope of the detected signal is within the slope range of region 2 of the coordinate system (a), the slope range of region 3 of the coordinate system (b), and the slope range of region 2 of the coordinate system (c), the sample can be evaluated as containing a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe. When the slope of the detected signal is within the slope range of region 2 of the coordinate system (a), within the slope range of region 3 of the coordinate system (b), and within the slope range of region 3 of the coordinate system (c), the sample can be evaluated as containing, in a heterozygous manner, a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe.When the slope of the detected signal is within the slope range of region 3 of the coordinate system (a), within the slope range of region 2 of the coordinate system (b), and within the slope range of region 2 of the coordinate system (c), the sample can be evaluated as containing, in a homozygous manner, a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe. If the slope of the detected signal is within the range of slope in region 3 of the coordinate system (a), within the range of slope in region 2 of the coordinate system (b), and within the range of slope in region 3 of the coordinate system (c), the sample can be evaluated as containing a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe, in a heterogeneous manner.When the slope of the detected signal is within the slope range of region 3 of the coordinate system (a), within the slope range of region 3 of the coordinate system (b), and within the slope range of region 2 of the coordinate system (c), the sample can be evaluated as containing a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe.When the slope of the detected signal is within the slope range of region 3 of the coordinate system (a), within the slope range of region 3 of the coordinate system (b), and within the slope range of region 3 of the coordinate system (c), the sample can be evaluated as containing a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe. As an example, the evaluation using the coordinate systems (a) to (c) has been described in this order, but the evaluation order of each coordinate system is arbitrary, and the evaluation may be performed in the order of the coordinate systems (c), (b), and (a), or the evaluation may be performed in the order of the coordinate system (b) and then in the coordinate systems (c) and (a), which will allow the polymorphism to be evaluated in the same way.

[0096] When the coordinate systems (a), (d), and (c) are used, the evaluation step can be performed as follows. In the evaluation step, the slope in the coordinate system (a) is calculated from the detected signal. Next, it is evaluated whether the obtained slope falls within any of the slope ranges of regions 1 to 3 of the coordinate system (a), or whether each signal is noise below a certain value. If the slope of the detected signal falls within the slope range of region 1 of the coordinate system (a), the sample can be evaluated as containing a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe. If the slope of the detected signal falls within the slope range of region 2 or region 3 of the coordinate system (a), the evaluation step proceeds to evaluation using the coordinate system (d). Next, the slope in the coordinate system (d) is calculated from the detected signal. The obtained slope is then evaluated to determine whether it falls within any of the slope ranges of regions 1 to 3 in the coordinate system (d), or whether each signal is noise below a certain value. If the slope of the detected signal falls within the slope range of region 1 in the coordinate system (d), the sample can be evaluated to contain a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe. If the slope of the detected signal falls within the slope range of region 2 or region 3 in the coordinate system (d), the evaluation step proceeds to evaluation using the coordinate system (c). Next, the slope in the coordinate system (c) is calculated from the detected signal. Then, the obtained slope is evaluated to determine whether it falls within any of the slope ranges of regions 1 to 3 in the coordinate system (c), or whether each signal is noise below a certain value. If the slope of the detected signal is within the slope range of region 1 of the coordinate system (c), the sample can be evaluated as containing a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe, in a heterozygous state.When the slope of the detected signal is within the slope range of region 2 of the coordinate system (a), within the slope range of region 2 of the coordinate system (d), and within the slope range of the noise range of the coordinate system (c), the sample can be evaluated as containing a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe.When the slope of the detected signal is within the slope range of region 2 of the coordinate system (a), within the slope range of region 2 of the coordinate system (d), and within the slope range of region 2 of the coordinate system (c), the sample can be evaluated as containing a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe. When the slope of the detected signal is within the slope range of region 2 of the coordinate system (a), within the slope range of region 3 of the coordinate system (d), and within the slope range of region 3 of the coordinate system (c), the sample can be evaluated as containing a heterozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the first detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe.When the slope of the detected signal is within the slope range of region 3 of the coordinate system (a), within the slope range of region 2 of the coordinate system (d), and within the slope range of the noise range of the coordinate system (c), the sample can be evaluated as containing a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe. If the slope of the detected signal is within the range of slope of region 3 of the coordinate system (a), within the range of slope of region 2 of the coordinate system (d), and within the range of slope of region 2 of the coordinate system (c), the sample can be evaluated as containing a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the second detection probe, and a polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe, in a heterogeneous manner.When the slope of the detected signal is within the slope range of region 3 of the coordinate system (a), within the slope range of region 3 of the coordinate system (d), and within the slope range of region 2 of the coordinate system (c), the sample can be evaluated as containing a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the third detection probe.When the slope of the detected signal is within the slope range of region 3 of the coordinate system (a), within the slope range of region 3 of the coordinate system (d), and within the slope range of region 3 of the coordinate system (c), the sample can be evaluated as containing a homozygous polymorphism containing a repeat sequence with the same number of repeats as the repeat sequence of the target of the fourth detection probe. As an example, the evaluation using the coordinate systems (a), (d), and (c) has been described in this order. However, the evaluation order of each coordinate system is arbitrary, and the evaluation may be performed in the order of the coordinate systems (d), (c), and (a). Alternatively, evaluation may be performed in the order of the coordinate system (c) and then in the coordinate systems (d) and (a), which will allow similar evaluation of polymorphisms.

[0097] In the evaluation step, for example, since the accuracy of detecting polymorphisms in the sample can be further improved, coordinate systems other than (a), (b), and (c) or (a), (d), and (c) may also be used in combination for evaluation. Specifically, in the evaluation step, polymorphisms in the repeat sequence may be evaluated based on the detection signals in the coordinate systems (e) and / or (f) and the threshold values ​​corresponding to each coordinate system. In this case, the order of evaluation using the coordinate systems (a), (b), (c), (e), and (f) or (a), (d), (c), (e), and (f) may be arbitrary. In this case, the evaluation step can be performed in accordance with Example 4 described below.

[0098] The threshold value in the evaluation step may be set in advance for each detection probe using the reference sample and each detection probe according to the setting method of the present disclosure, or may be set in parallel with the detection method of the present disclosure. In the latter case, the detection method of the present disclosure performs the signal detection step using the reference sample in addition to the target sample, and then sets the threshold value based on the signal detected using the reference sample, similar to the threshold setting step of the setting method of the present disclosure. The detection method of the present disclosure then performs the evaluation step based on the threshold value.

[0099] In this manner, the detection method of the present disclosure can detect genetic polymorphisms with at least four types of repeat sequence polymorphisms. The detection method of the present disclosure, for example, uses a threshold value set based on a reference nucleic acid containing a repeat sequence with a different number of repeats from the target polymorphism of the detection probe, and uses detection probes suitable for detecting genetic polymorphisms with at least four types of repeat sequence polymorphisms. Therefore, nucleic acids containing repeat sequences with the target polymorphism of each detection probe can be distinguished from nucleic acids containing repeat sequences with non-target polymorphisms, thereby enabling accurate detection of genetic polymorphisms with at least four types of repeat sequence polymorphisms. Furthermore, the detection method of the present disclosure can distinguish between nucleic acids containing repeat sequences with the target polymorphism of each detection probe and nucleic acids containing repeat sequences with non-target polymorphisms, for example, by evaluating the signal of each detection probe as the slope in a coordinate system with the coordinate axes, thereby enabling accurate detection of genetic polymorphisms with at least four types of repeat sequence polymorphisms. The detection method of the present disclosure can be implemented, for example, using a computer. The detection method of the present disclosure may also be in the form of a computer-executable program.

[0100] <Detection probe set> In another aspect, the present disclosure provides a detection probe set capable of detecting polymorphisms of a gene having polymorphisms of at least four types of repetitive sequences. The detection probe set of the present disclosure is a detection probe set for use in detecting repetitive sequences in a gene having polymorphisms of at least four types of repetitive sequences. The at least four types of detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes each include a polynucleotide having a base sequence capable of hybridizing to a repetitive sequence having a repetition number of k, l, m, and n times (where k < l < m < n and k is an integer of 2 or more). The 5'-region is disposed on the 5'-terminal side of the internal region and includes a polynucleotide having a base sequence capable of hybridizing to the base sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is disposed on the 3'-terminal side of the internal region and includes a polynucleotide having a base sequence capable of hybridizing to the base sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same full-length length. The third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same full-length length. The full-length lengths of the third detection probe and the fourth detection probe are longer than the full-length lengths of the first detection probe and the second detection probe. According to the detection probe set of the present disclosure, polymorphisms of a gene having polymorphisms of at least four types of repetitive sequences can be suitably detected.

[0101] The detection probe set of the present disclosure may include four or more types of detection probes, and may include other detection probes in addition to the first to fourth detection probes. The number of types of detection probes included in the detection probe set may be set, for example, according to the number of types of polymorphisms of the repetitive sequences for which the detection is performed.

[0102] In the detection probe set of the present disclosure, when the gene is the UGT1A1 gene, the detection probe set for the UGT1A1 gene of the present disclosure includes, for example, the following detection probes (1) to (3) and / or (4). (1) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 2 (2) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 3 (3) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 4 (4) A detection probe comprising a polynucleotide containing the base sequence of SEQ ID NO: 5

[0103] The detection probe set of the present disclosure may include one, two, three, or all of the detection probes (1) to (4) above.

[0104] The polymorphism detection probe set of the present disclosure preferably includes the detection probes (1) to (3) and (4) above, since it can accurately detect all polymorphisms in the repetitive sequence of the UGT1A1 gene, for example.

[0105] In the detection probe set of the present disclosure, each detection probe contains, for example, a reporter and a quencher as the label. The reporter is, for example, located in the 5'-region, and the quencher is located in the 3'-region. Alternatively, the reporter may be, for example, located in the 3'-region, and the quencher may be located in the 5'-region. The reporter is preferably located at the 5'-end of the detection probe, and the quencher is located at the 3'-end of the detection probe. Alternatively, the reporter may be, for example, located at the 3'-end of the detection probe, and the quencher may be located at the 5'-end of the detection probe. Preferably, each detection probe contains, for example, the MGB.

[0106] According to the detection probe set of the present disclosure, polymorphisms in a gene having at least four types of repeat sequence polymorphisms can be detected with high accuracy using the detection method of the present disclosure.

[0107] <Detection reagents and detection kits> In another aspect, the present disclosure provides a detection reagent or kit capable of detecting polymorphisms in a gene having at least four types of repeat sequence polymorphisms. The polymorphism detection reagent (hereinafter also referred to as a "detection reagent") for use in detecting a repeat sequence in a gene having at least four types of repeat sequence polymorphisms of the present disclosure comprises a detection probe set and a nucleic acid amplification reagent of the present disclosure. Furthermore, the polymorphism detection kit (hereinafter also referred to as a "detection kit") for use in detecting a repeat sequence in a gene having at least four types of repeat sequence polymorphisms of the present disclosure comprises a detection probe set and a nucleic acid amplification reagent of the present disclosure.

[0108] In the detection reagent or detection kit of the present disclosure, the polymorphism detection probe and each reagent may be in a solid form such as powder or granules, or in a liquid form such as a slurry (suspension), jelly, or solution.

[0109] In the detection reagent of the present disclosure, the polymorphism detection probe and all the reagents are contained in a single container, for example, in a mixed or unmixed state. In the detection reagent of the present disclosure, for example, the polymorphism detection probe and the nucleic acid amplification reagent, each component may be contained separately, or part or all may be contained in a mixed or unmixed state. In this case, the detection reagent of the present disclosure can also be called, for example, a detection kit.

[0110] The detection reagents or detection kits of the present disclosure may include, for example, instructions or manuals.

[0111] The detection reagent or kit of the present disclosure can be suitably used, for example, to detect polymorphisms in a gene having at least four types of polymorphisms in a repeat sequence in a sample of interest.Furthermore, the detection reagent of the present disclosure can be used to accurately detect polymorphisms in a gene having at least four types of polymorphisms in a repeat sequence by using the detection method of the present disclosure. [Example]

[0112] Next, examples of the present disclosure will be described. However, the present disclosure is not limited to the following examples. Commercially available reagents were used according to their protocols unless otherwise specified. Note that "mol / l" may also be abbreviated as "M."

[0113] [Example 1] A detection probe for a polymorphism in the repeat sequence of the UGT1A1 gene was designed and confirmed to be capable of detecting the polymorphism.

[0114] (1-1) Preparation of primers The primers used in real-time PCR were prepared by ThermoFisher Scientific's oligo DNA synthesis service. The primer sequences are shown in Table 2 below. The primers were purified by HPLC. Unless otherwise specified, each base sequence is shown from the 5' end to the 3' end.

[0115] [Table 2]

[0116] (1-2) Preparation of TaqMan-MGB probe The TaqMan-MGB probes used in real-time PCR were prepared using ThermoFisher Scientific's Applied Biosystems TaqMan MGB Probe Synthesis Service or Integrated DNA Technologies' custom synthesis service (GMP Probe). Table 3 below shows the nucleotide sequences of the TaqMan-MGB probes. In Table 3 below, the underlined nucleotide sequences are complementary to the repeat sequences. The 5' ends of the TaqMan-MGB probes for alleles with different numbers of TA repeats were modified with four different fluorescent dyes (FAM, VIC, Cy5, and NED). The 3' ends of the TaqMan-MGB probes were modified with a non-fluorescent quencher and MGB (NFQ-MGB).

[0117] [Table 3] *1: ThermoFisher Scientific *2: Manufactured by Integrated DNA Technologies

[0118] (1-3) Preparation of target nucleic acid The target nucleic acid (PCR template) for real-time PCR was a plasmid DNA into which a portion of the promoter region of the UGT1A1 gene had been inserted. The types of plasmid DNA are shown in Table 4 below. In Table 4 below, X in the TA repeat name "TAX" indicates the number of repeats.

[0119] [Table 4]

[0120] The wild-type UGT1A1 gene was prepared by inserting the PCR target amplified region into a pUC19 vector with reference to the DNA sequence of GenBank accession No. D87674 (UGT1A1_TA6 plasmid). The UGT1A1_TA6 plasmid had the same DNA sequence as Probe TA6-5, "TGCCATATATATATATATAAGTAG" (SEQ ID NO: 13) (the recognition sequence of Probe TA6-5). The UGT1A1_TA5 plasmid was prepared by deleting the "TA" following the 1st to 7th recognition sequence of Probe TA6-5, "TGCCATA" (SEQ ID NO: 14), and inserting the PCR amplified region into a pUC19 vector. As a result, the UGT1A1_TA5 plasmid had the same DNA sequence as Probe TA7-5. The UGT1A1_TA7 plasmid was prepared by inserting into a pUC19 vector a PCR-amplified region in which "TA" was added after the first to seventh positions of the Probe TA6-5 recognition sequence, "TGCCATA" (SEQ ID NO: 14). As a result, the UGT1A1_TA7 plasmid had the same DNA sequence as the Probe TA7. The UGT1A1_TA8 plasmid was prepared by inserting into a pUC19 vector a PCR-amplified region in which "TATA" was added after the first to seventh positions of the Probe TA6-5 recognition sequence, "TGCCATA" (SEQ ID NO: 14). As a result, the UGT1A1_TA8 plasmid had the same DNA sequence as the Probe TA8-2. The UGT1A1_TA9 plasmid was prepared by inserting into a pUC19 vector a PCR-amplified region in which "TATATA" (SEQ ID NO: 15) was added after the first to seventh positions of the Probe TA6-5 recognition sequence, "TGCCATA" (SEQ ID NO: 14).

[0121] (1-4) Sample preparation The plasmid DNA obtained in Example 1 (1-3) was diluted with TE buffer. After the dilution, the plasmid DNA concentration was measured by measuring absorbance (260 nm) using an absorptiometer (ThermoFisher Scientific). Next, to calculate the copy number of the target contained in the plasmid DNA solution, the copy number / μl was calculated using the following formula. Samples 1 to 11 were then prepared from the plasmid DNA solution so that the final concentrations of TA5, TA6, TA7, TA8, or TA9 were as shown in Table 5 below. Calculation formula: Copy number / μl = (DNA concentration × Avogadro's number) / (number of plasmid bases × molecular weight of 1 base × 10 9 ) DNA concentration unit: ng / μl Avogadro's number: 6.02 x 10 23 Molecular weight of one base: 660

[0122] [Table 5]

[0123] (1-5) Real-time PCR measurement Next, real-time PCR measurements were performed to examine the number of bases in the probe that recognizes sequences with a large number of TA repeats. Specifically, Premix Ex Taq™ (Probe qPCR, manufactured by TAKARA Bio) was used as the real-time PCR reagent. Tables 6 and 7 below show the compositions of the real-time PCR reaction solutions (Set 1 and Set 2). The reaction solutions (Set 1 and Set 2) were dispensed into a real-time PCR microplate at 15 µl / well. After dispensing, Sample 8 prepared in Example 1 (1-4) above was added to the microplate at 5 µl / well, and the microplate was sealed. The total volume of the PCR reaction solution was 20 µl / well. A real-time PCR device (Applied Biosystems QuantStudio™ 5 Dx Real-Time PCR) was used for the real-time PCR measurements. Table 8 below shows the real-time PCR conditions. The fluorescence detection settings were FAM, VIC, and Cy5 as reporters, NFQ-MGB as quencher, and Rox as passive reference. After the real-time PCR measurement, the data for each sample was analyzed using the software provided with the real-time PCR instrument (QuantStudio™ 5 Dx TD Software v1.0). The software automatically calculated the PCR amplification curve and ΔRn values, outputting the results. The Rn (normalized reporter) represents the normalized fluorescence signal intensity obtained by dividing the fluorescence intensity of the reporter dyes (FAM / VIC / Cy5) by the fluorescence intensity of the passive reference dye (ROX). The ΔRn represents the magnitude of the fluorescence signal and is calculated as Rn+ (the Rn value of the target amplification reaction) - Rn- (the Rn value of the initial PCR cycle without target amplification). These results are shown in Figure 2.

[0124] [Table 6]

[0125] [Table 7]

[0126] [Table 8]

[0127] Figure 2 is a graph showing the results of analyzing real-time PCR measurement results. In Figure 2, the vertical axis represents the fluorescent signal (ΔRn), and the horizontal axis represents the number of PCR cycles. Figure 2(A) shows the amplification curve when TA7 / 7 was measured using the Set 1 reaction solution, and Figure 2(B) shows the amplification curve when TA7 / 7 was measured using the Set 2 reaction solution. As shown in Figure 2, no reactivity was observed with the TA7 probe, while reactivity was observed with the TA7-5 probe. These results indicate that simply matching the number of bases in the probe does not increase the reactivity of the probe to sequences with many TA sequence repeats. Furthermore, it was found that probes that recognize sequences with many TA sequence repeats require a longer base length.

[0128] [Example 2] Using detection probes for polymorphisms in the repeat sequence of the UGT1A1 gene, thresholds for detecting polymorphisms of each target were set.

[0129] Real-time PCR was performed to determine the cutoff value (detection / non-detection determination) for detecting TA5, TA6, TA7, and TA8. Specifically, Premix Ex Taq™ (Probe qPCR, manufactured by TAKARA Bio) was used as the real-time PCR reagent. Table 9 below shows the composition of the real-time PCR reaction solution. The reaction solution was dispensed into a real-time PCR microplate at 15 μl / well. After dispensing, Samples 1 to 11 prepared in Example 1 (1-4) were added to the microplate at 5 μl / well, and the microplate was sealed. The total volume of the PCR reaction solution was 20 μl / well. The real-time PCR was performed using the real-time PCR device described above. The real-time PCR conditions were the same as those in Example 1 (1-5). The fluorescence detection settings were as follows: FAM, VIC, Cy5, and NED were set as reporters, NFQ-MGB as quencher, and Rox as passive reference. After the real-time PCR measurement, the data for each sample was analyzed using the software provided with the real-time PCR instrument. The software automatically calculated the PCR amplification curve and ΔRn values, which were output as results. The Rn (normalized reporter) indicates the intensity of the fluorescent signal normalized by dividing the fluorescence intensity of the reporter dye (FAM / VIC / Cy5 / NED) by the fluorescence intensity of the passive reference dye (ROX). The ΔRn indicates the magnitude of the fluorescent signal and is calculated as Rn+ (the Rn value of the target amplification reaction) - Rn- (the Rn value of the initial PCR cycle without target amplification). The results are shown in Table 10 below.

[0130] [Table 9]

[0131] [Table 10]

[0132] Table 10 shows the results of calculating the cutoff value. The cutoff value was set based on the fluorescent signal (ΔRn) detected when DNA having a sequence with one more TA repeat than the number of TA repeats in the detection probe was used as a template. The cutoff value was calculated as the mean value + 4 SD from n = 12 measurements.

[0133] [Example 3] It was confirmed that polymorphisms in the repetitive sequence of the UGT1A1 gene can be detected using detection probes for polymorphisms in the repetitive sequence of the UGT1A1 gene and threshold values ​​for detecting each target polymorphism.

[0134] Real-time PCR was performed to examine whether multiplex detection using probes specific to TA5 to TA8 could identify one TA type from a combination of 10 TA types. Specifically, Premix Ex Taq™ (Probe qPCR, manufactured by TAKARA Bio) was used as the real-time PCR reagent. The composition of the real-time PCR reaction solution was the same as in Example 1 (1-5). The reaction solution was dispensed into a real-time PCR microplate at 15 μl / well. After dispensing, 5 μl / well of sample 1 to sample 10 prepared in Example 1 (1-4) was added to the microplate, and the microplate was sealed. The total volume of the PCR reaction solution was 20 μl / well. The real-time PCR device was used for real-time PCR measurements. The real-time PCR conditions were the same as in Example 1 (1-5). The settings for fluorescence detection were as follows: FAM, VIC, Cy5, and NED were set as reporters, NFQ-MGB as quencher, and Rox as passive reference. After the real-time PCR measurement, the data for each sample was analyzed in the same manner as in Example 2. The results are shown in Table 11 below.

[0135] [Table 11]

[0136] As shown in Table 11 above, when an allele showing a ΔRn value equal to or greater than the cutoff value was detected, it was found that each TA type (difference in the number of TA repeats) could be detected by the detection method of the present disclosure.

[0137] [Comparative Example 1] We used real-time PCR to investigate whether multiplex detection using probes specific to TA5 to TA8 could identify one TA type from a combination of 10 TA types when a cutoff value was set using a conventional threshold setting method. Specifically, we performed the same method as in Example 3, except that the cutoff value was set based on the signal obtained when measuring a sample containing a nucleic acid containing a repeat sequence of the target polymorphism. Tables 12 and 13 below show the conditions for setting the cutoff value.

[0138] [Table 12]

[0139] [Table 13]

[0140] As a result, when the cutoff value was set based on the amplification signal when measuring a sample containing a nucleic acid containing a repetitive sequence of the target polymorphism, the polymorphism of the repetitive sequence contained in the sample did not match the polymorphism in the measurement result.

[0141] Comparative Example 2 We used real-time PCR to investigate whether multiplex detection using probes specific to TA5 to TA8 could identify one TA type from a combination of 10 TAs when a cutoff value was set using conventional threshold setting methods. Specifically, we performed the same method as in Example 3, except that the cutoff value was set based on the signal obtained when measuring a sample containing a nucleic acid containing a repeat sequence of an off-target polymorphism. Tables 14 and 15 below show the conditions for setting the cutoff value.

[0142] [Table 14]

[0143] [Table 15]

[0144] As a result, when the cutoff value was set based on the signal obtained when measuring a sample containing a nucleic acid containing a repetitive sequence of an off-target polymorphism, the polymorphism of the repetitive sequence contained in the sample did not match the polymorphism in the measurement results.

[0145] [Example 4] It was confirmed that the TA5 to TA8 polymorphisms in the UGT1A1 gene can be detected using the fluorescent signal (ΔRn) and angle threshold obtained in Example 3.

[0146] From the signals in Table 11, threshold angles for the boundaries of Region 1 (R1) and Region 3 (R3) and Region 1 (R1) and Region 2 (R2) shown in Figures 3(A) to 3(C) were set. Specifically, as shown in Figure 4, in a coordinate system in which the signals of each polymorphism are used as the coordinate axes (diRn_TA5 to diRn_TA8), the threshold was calculated by calculating the angle (dashed line) relative to the x-axis based on the signals of a reference sample containing a reference nucleic acid for determining Region 1 (the signals on the dashed lines in each coordinate system). An angle of +5° from the obtained angle was used as the threshold for the boundary between Region 1 and Region 3 (solid line), and an angle of -5° from the obtained angle was used as the threshold for the boundary between Region 1 and Region 2 (solid line). Note that signals from samples containing combinations of reference nucleic acids other than the reference sample containing the reference nucleic acid for determining Region 1 are also shown in Figure 4. The results of the threshold setting are shown in Table 16 below.

[0147] [Table 16]

[0148] Next, the region to which each signal in Table 11 belongs was evaluated based on the threshold values ​​in Table 16. The results are shown in Table 17 below.

[0149] [Table 17]

[0150] The regions of each sample were then evaluated according to the evaluation flow shown in FIG. 5. FIG. 5 is a schematic diagram showing the evaluation flow of polymorphisms in the UGT1A1 gene, with the coordinate systems used for the evaluation, from left to right. As shown in FIG. 5, in Example 4, evaluation was performed in the order of the TA5 / TA6 coordinate system, the TA5 / TA7 coordinate system, the TA5 / TA8 coordinate system, the TA6 / TA7 coordinate system, and the TA7 / TA8 coordinate system. When evaluation was performed using each coordinate system, the evaluated region and the processing performed in the case of the evaluation result are indicated by solid lines (Yes) and dashed lines (No) below each coordinate system. As shown in the TA type determination in Table 17, it was found that evaluation according to the evaluation flow shown in FIG. 5 could accurately detect the TA5 to TA8 polymorphisms in the UGT1A1 gene contained in each sample.

[0151] Furthermore, to confirm that the polymorphisms can be evaluated using a combination of other coordinate systems, the regions to which each signal in Table 11 belongs were evaluated based on the thresholds in Table 16. The results are shown in Table 18 below. In Table 18 below, the evaluation was performed using the TA6 / TA8 coordinate system instead of the TA6 / TA7 coordinate system.

[0152] [Table 18]

[0153] Then, the regions of each sample were evaluated according to the evaluation flow shown in FIG. 6. FIG. 6 is an evaluation flow for polymorphisms in the UGT1A1 gene, and is a schematic diagram showing the coordinate system used for evaluation from left to right. As shown in FIG. 6, in Example 4, evaluations were performed in the order of the TA5 / TA6 coordinate system, the TA5 / TA7 coordinate system, the TA5 / TA8 coordinate system, the TA6 / TA8 coordinate system, and the TA7 / TA8 coordinate system. Also, when performing evaluations in each coordinate system, the processed regions evaluated at the lower part of each coordinate system and the evaluation results are indicated by solid lines (Yes) and broken lines (No). As shown in the TA type determination in Table 18 above, it was found that polymorphisms of TA5 to TA8 in the UGT1A1 gene contained in each sample can be accurately detected by evaluating according to the evaluation flow shown in FIG. 6.

[0154] As described above, the present disclosure has been described with reference to the embodiments and examples, but the present disclosure is not limited to the above embodiments and examples. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present disclosure within the scope of the present disclosure.

[0155] <Appendix> Some or all of the above embodiments and examples can be described as follows, but are not limited thereto. <Method for Detecting Polymorphism> (Appendix 1) A detection step of detecting a polymorphism of a repetitive sequence in a gene having polymorphisms of at least four repetitive sequences using at least four detection probes for a target sample is included. The at least four detection probes include first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes each include a polynucleotide having a base sequence that can hybridize to a repetitive sequence having k, l, m, and n repetitions (where k < l < m < n and k is an integer of 2 or more). the 5'-region is a polynucleotide located on the 5'-end side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 5'-end side of the repeat sequence in the gene; the 3'-region is a polynucleotide located on the 3'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 3'-terminal side of the repeat sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe; The detecting step a signal detection step of nucleic acid amplifying the region in the presence of the sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; an evaluation step of evaluating the polymorphism of the repeat sequence based on the detected signal and a threshold value; A method for detecting a polymorphism in a gene having a polymorphism in a repetitive sequence, wherein the threshold value is set for the detection probe based on a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence with the same number of repeats as the target repetition number of the detection probe, and / or a reference nucleic acid containing a repetitive sequence with a different number of repeats. (Appendix 2) the evaluation step evaluates the polymorphism of the repetitive sequence based on the slope of the detected signal in a coordinate system having coordinate axes defined by signals from two of the first to fourth detection probes and the threshold value; The detection method described in Appendix 1, wherein the threshold is a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of each detection probe in two of the first to fourth detection probes, and / or a reference nucleic acid containing a repeat sequence with a different number of repeats. (Appendix 3) The detection method described in Appendix 2, wherein the threshold value is a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe. (Appendix 4) The detection method described in Appendix 2 or 3, wherein the threshold value is a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with a different number of repeats from the repeat sequence of the target of the other detection probe. (Appendix 5) 5. The detection method according to any one of Appendices 2 to 4, wherein the evaluation step evaluates the polymorphism of the repetitive sequence based on detection signals in multiple coordinate systems and thresholds corresponding to each coordinate system. (Appendix 6) The detection method according to any one of Appendix 2 to 4, wherein the evaluation step evaluates the polymorphism of the repetitive sequence based on detection signals in at least the following coordinate systems (a), (b), and (c), or at least the following (a), (c), and (d), and thresholds corresponding to each coordinate system: (a) a coordinate system having the signal of the first detection probe and the signal of the second detection probe as its coordinate axes; (b) a coordinate system having the signal of the second detection probe and the signal of the third detection probe as its coordinate axes; (c) a coordinate system having the signal of the third detection probe and the signal of the fourth detection probe as its coordinate axes; (d) A coordinate system whose axes are the signal of the second detection probe and the signal of the fourth detection probe. (Appendix 7) The detection method according to Appendix 6, wherein the evaluation step further comprises evaluating the polymorphism of the repetitive sequence based on the slope of the detected signal in a coordinate system whose coordinate axes are signals from two of the first to fourth detection probes, other than the combination of detection probes (a), (b), and (c), or (a), (c), and (d). (Appendix 8) The detection method according to Appendix 6 or 7, wherein the evaluation step further evaluates the polymorphism of the repetitive sequence based on the detection signal in the coordinate system (e) and / or (f) below and a threshold value corresponding to each coordinate system: (e) a coordinate system having the signal of the first detection probe and the signal of the third detection probe as its coordinate axes; (f) A coordinate system whose axes are the signal of the first detection probe and the signal of the fourth detection probe. (Appendix 9) 9. The detection method according to any one of claims 2 to 8, wherein the tilt is an angle. (Appendix 10) 10. The detection method according to any one of appendices 2 to 9, wherein the coordinate system has its origin at a signal in a sample that does not contain the reference nucleic acid. (Appendix 11) The detection method described in Appendix 1, wherein the threshold is set for each detection probe based on a reference nucleic acid containing a repeat sequence with a different number of repeats than the repeat sequence of the target of the detection probe. (Appendix 12) The detection method according to Appendix 11, wherein the threshold value is set based on a signal obtained by amplifying nucleic acid using the primer, the detection probe, and a reference nucleic acid containing a repetitive sequence with one or more repeats greater than the polymorphism targeted by the detection probe, and detecting the signal of the label of the detection probe. (Appendix 13) The detection method according to Appendix 12, wherein the threshold value is set based on a signal obtained by amplifying nucleic acids using the primer, the detection probe, and a reference nucleic acid containing a repetitive sequence with one more repeat than the polymorphism targeted by the detection probe, and detecting a reporter signal of the detection probe. (Appendix 14) 14. The detection method according to any one of claims 1 to 13, wherein the repeat unit of the repeat sequence is TA. (Appendix 15) 15. The detection method according to any one of appendixes 1 to 14, wherein the number of repeats in the repeat sequence is 2 to 20. (Appendix 16) 16. The detection method according to any one of claims 1 to 15, wherein the detection probe comprises an MGB probe. (Appendix 17) the detection probe comprises a reporter and a quencher as the label; the reporter is located in the 5'-region and the quencher is located in the 3'-region; or the reporter is located in the 3'-region and the quencher is located in the 5'-region; 17. A detection method according to any one of appendices 1 to 16. (Appendix 18) the reporter is located at the 5' end of the detection probe and the quencher is located at the 3' end of the detection probe; or the reporter is located at the 3' end of the detection probe and the quencher is located at the 5' end of the detection probe; 18. The detection method of claim 17. (Appendix 19) 19. The detection method according to claim 17 or 18, wherein the nucleic acid amplification is carried out by TaqMan PCR. (Appendix 20) 20. The detection method according to any one of appendices 1 to 19, wherein the gene is the UGT1A1 gene. (Appendix 21) The detection probe includes the detection probes of the following (1) to (3) and / or (4), and is the detection method described in Supplementary Note 20. (1) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 2; (2) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 3; (3) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 4; (4) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 5. <Method for setting threshold value> (Supplementary Note 22) For a reference sample, it includes a setting step of setting a threshold value for evaluating the polymorphism of the repetitive sequence in a gene having polymorphisms of at least four types of repetitive sequences using at least four types of detection probes. The at least four types of detection probes include the first to fourth detection probes. The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label. The internal regions of the first to fourth detection probes are each a polynucleotide containing a nucleotide sequence capable of hybridizing to a repetitive sequence having k, l, m, and n repeats (where k < l < m < n and k is an integer of 2 or more). The 5'-region is arranged on the 5'-terminal side of the internal region and contains a nucleotide sequence capable of hybridizing to the nucleotide sequence of the adjacent region on the 5'-terminal side of the repetitive sequence in the gene. The 3'-region is arranged on the 3'-terminal side of the internal region and contains a nucleotide sequence capable of hybridizing to the nucleotide sequence of the adjacent region on the 3'-terminal side of the repetitive sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and the same full-length length. the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe; The setting step includes: a signal detection step of nucleic acid amplifying the region in the presence of the reference sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; a threshold setting step of setting a threshold for evaluating polymorphism of the repeat sequence of the repeat number of the target of the detection probe based on the detected signal; The reference sample includes, for the detection probe, a reference nucleic acid containing a repeat sequence having the same number of repeats as the repeat sequence of the target of the detection probe, and / or a reference nucleic acid containing a repeat sequence having a different number of repeats; A method for setting a threshold used to detect polymorphisms in a gene having at least four types of repeat sequence polymorphisms. (Appendix 23) The threshold setting method described in Appendix 22, wherein in the threshold setting step, the threshold is set as a slope set based on two of the first to fourth detection probes and a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of each detection probe and / or a reference nucleic acid containing a repeat sequence with a different number of repeats in a coordinate system whose coordinate axes are the signals of two of the first to fourth detection probes. (Appendix 24) The setting method described in Appendix 23, wherein in the threshold setting step, the threshold is set to a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe. (Appendix 25) The setting method described in Appendix 23 or 24, wherein in the threshold setting step, the threshold is set to a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with a different number of repeats from the repeat sequence of the target of the other detection probe. (Appendix 26) In the threshold setting step, thresholds are set in at least the following coordinate systems (a), (b), and (c), or at least the following coordinate systems (a), (c), and (d), The reference sample is A reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe, in two of the first to fourth detection probes; or The method for setting up the nucleic acid sequence according to any one of Appendices 23 to 25, wherein two of the first to fourth detection probes comprise a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one detection probe, and a reference nucleic acid with a different number of repeats from the repeat sequence of the target of the other detection probe: (a) a coordinate system having the signal of the first detection probe and the signal of the second detection probe as its coordinate axes; (b) a coordinate system having the signal of the second detection probe and the signal of the third detection probe as its coordinate axes; (c) a coordinate system having the signal of the third detection probe and the signal of the fourth detection probe as its coordinate axes; (d) A coordinate system whose axes are the signal of the second detection probe and the signal of the fourth detection probe. (Appendix 27) In the threshold setting step, a threshold is set in a coordinate system other than the combination of detection probes (a), (b), and (c), or (a), (c), and (d), and the coordinate axes are the signals of two of the first to fourth detection probes; The reference sample is A reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe, in two of the first to fourth detection probes; or The setting method described in Appendix 26, wherein two of the first to fourth detection probes include a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one detection probe, and a reference nucleic acid with a different number of repeats than the repeat sequence of the target of the other detection probe. (Appendix 28) In the threshold setting step, a threshold is set in the coordinate system (e) and / or (f) below, The reference sample is A reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe, in two of the first to fourth detection probes; or The setting method according to Appendix 26 or 27, wherein two of the first to fourth detection probes comprise a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one detection probe, and a reference nucleic acid with a different number of repeats from the repeat sequence of the target of the other detection probe: (e) a coordinate system having the signal of the first detection probe and the signal of the third detection probe as its coordinate axes; (f) A coordinate system whose axes are the signal of the first detection probe and the signal of the fourth detection probe. (Appendix 29) 29. The setting method according to any one of appendices 22 to 28, wherein the inclination is an angle. (Appendix 30) 30. The setting method according to any one of Appendices 22 to 29, wherein the coordinate system has its origin at a signal in a sample that does not contain the reference nucleic acid. (Appendix 31) In the threshold setting step, a threshold is set for each detection probe based on the detected signal to evaluate polymorphism of the repeat sequence of the target repeat number of the detection probe; The reference sample includes, for each detection probe, a reference nucleic acid containing a repeat sequence with a different number of repeats from the repeat sequence of the target of the detection probe; The setting method described in Appendix 22. (Appendix 32) The setting method described in Appendix 31, wherein the reference sample contains a reference nucleic acid containing a repetitive sequence with one or more repeats greater than the number of repeats of the polymorphism targeted by the detection probe. (Appendix 33) The setting method described in Appendix 32, wherein the reference sample contains a reference nucleic acid containing a repetitive sequence with one more repeat than the polymorphism targeted by the detection probe. (Appendix 34) A method for setting described in any of Appendices 22 to 33, wherein the repeat unit of the repeat sequence is TA. (Appendix 35) The method for selecting the repeat sequence according to any one of Appendices 22 to 34, wherein the number of repeats in the repeat sequence is 2 to 20. (Appendix 36) The internal region is a polynucleotide containing a base sequence complementary to a repeat sequence having the target polymorphism. the 5'-region is a polynucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of the adjacent region on the 5'-end of the repeat sequence, and / or 36. The design method according to any one of Appendices 22 to 35, wherein the 3'-region is a polynucleotide comprising a base sequence complementary to the base sequence of the adjacent region on the 3'-end side of the repeat sequence. (Appendix 37) 37. The setting method according to any one of appendices 22 to 36, wherein the detection probe comprises an MGB probe. (Appendix 38) the detection probe comprises a reporter and a quencher as the label; the reporter is located in the 5'-region and the quencher is located in the 3'-region; or the reporter is located in the 3'-region and the quencher is located in the 5'-region; 38. The design method of any one of appendixes 22 to 37. (Supplementary Note 39) The reporter is disposed at the 5'-end of the detection probe, and the quencher is disposed at the 3'-end of the detection probe, or The reporter is disposed at the 3'-end of the detection probe, and the quencher is disposed at the 5'-end of the detection probe. The design method described in Supplementary Note 38. (Supplementary Note 40) The nucleic acid amplification is nucleic acid amplification by the TaqMan PCR method, and the setting method described in Supplementary Note 38 or 39. (Supplementary Note 41) The gene is the UGT1A1 gene, and the setting method described in any one of Supplementary Notes 22 to 40. (Supplementary Note 42) The detection probe includes the detection probes of the following (1) to (3) and / or (4), and the setting method described in Supplementary Note 41. (1) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 2; (2) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 3; (3) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 4; (4) A detection probe containing a polynucleotide containing the nucleotide sequence consisting of SEQ ID NO: 5. <Detection Probe Set> (Supplementary Note 43) A detection probe set for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms, The at least four types of detection probes include the first to fourth detection probes, The first to fourth detection probes each include a 5'-region, an internal region, and a 3'-region, and a label, The internal regions of the first to fourth detection probes are each a polynucleotide containing a nucleotide sequence capable of hybridizing to a repetitive sequence having k, l, m, and n repeats (where k < l < m < n and k is an integer of 2 or more). the 5'-region is a polynucleotide located on the 5'-end side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 5'-end side of the repeat sequence in the gene; the 3'-region is a polynucleotide located on the 3'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 3'-terminal side of the repeat sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region, and have the same overall length; A detection probe set, wherein the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe. (Appendix 44) The detection probe set according to claim 43, wherein the repeat unit of the repeat sequence is TA. (Appendix 45) 45. The detection probe set according to appendix 43 or 44, wherein the number of repeats in the repeat sequence is 2 to 10. (Appendix 46) 46. ​​The detection probe set of any one of appendices 43 to 45, wherein the detection probe comprises an MGB probe. (Appendix 47) the detection probe comprises a reporter and a quencher as the label; the reporter is located in the 5'-region and the quencher is located in the 3'-region; or the reporter is located in the 3'-region and the quencher is located in the 5'-region; 47. A detection probe set according to any one of appendices 43 to 46. (Appendix 48) the reporter is located at the 5' end of the detection probe and the quencher is located at the 3' end of the detection probe; or the reporter is located at the 3' end of the detection probe and the quencher is located at the 5' end of the detection probe; A detection probe set as described in Appendix 47. (Appendix 49) 49. The detection probe set of any one of appendices 43 to 48, wherein the detection probe comprises an MGB probe. (Appendix 50) 50. The detection probe set according to any one of appendices 43 to 49, wherein the gene is the UGT1A1 gene. (Appendix 51) A detection probe set according to Appendix 50, comprising the following detection probes (1) to (3) and / or (4): (1) a detection probe comprising a polynucleotide having a nucleotide sequence consisting of SEQ ID NO: 2; (2) a detection probe comprising a polynucleotide containing the nucleotide sequence of SEQ ID NO: 3; (3) a detection probe comprising a polynucleotide having a base sequence consisting of SEQ ID NO: 4; (4) A detection probe comprising a polynucleotide having a base sequence consisting of SEQ ID NO:5. (Appendix 52) A detection probe according to any one of appendices 43 to 51 for use in a detection method according to any one of appendices 1 to 21. <How to design a detection probe set> (Appendix 53) Designing a detection probe set for use in evaluating repeat sequence polymorphisms in a gene having at least four types of repeat sequence polymorphisms, the at least four types of detection probes include first to fourth detection probes, the first to fourth detection probes each include a 5'-region, an internal region, a 3'-region, and a label; The internal regions of the first to fourth detection probes are each a polynucleotide containing a base sequence that can hybridize to an iterative sequence with k, l, m, and n repetitions (where k < l < m < n and k is an integer of 2 or more). The 5'-region is a polynucleotide that is arranged on the 5'-terminal side of the internal region and contains a base sequence that can hybridize to the base sequence of the adjacent region on the 5'-terminal side of the iterative sequence in the gene. The 3'-region is a polynucleotide that is arranged on the 3'-terminal side of the internal region and contains a base sequence that can hybridize to the base sequence of the adjacent region on the 3'-terminal side of the iterative sequence in the gene. The first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and the same full-length length. The third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and the same full-length length. A method for designing a detection probe set for detecting an iterative sequence in a gene having at least four types of iterative sequence polymorphisms, wherein the full-length lengths of the third detection probe and the fourth detection probe are longer than the full-length lengths of the first detection probe and the second detection probe. (Appendix 54) An alignment step of aligning the base sequences of a gene containing an iterative sequence having at least four types of target iteration counts with reference to the base at the 5'-end or 3'-end of the iterative sequence. A classification step of classifying each base sequence into groups in ascending order of the number of repetitions. For each base sequence, with reference to the iterative sequence, in the gene, the base sequence of the adjacent region on the 5'-terminal side of the iterative sequence, the iterative sequence, and the base sequence of the adjacent region on the 3'-terminal side of the iterative sequence in the gene are classified into a 5'-region, an internal region, and a 3'-region, respectively. A design step of designing each set of detection probes. When alignment is performed based on the base at the 5' end, In each set, the number of bases in the 5'-region of the detection probe is the same, and the overall length of the detection probe is the same; Designing each set of detection probes so that the overall length of the detection probes in the set with a higher number of repeats is longer than the overall length of the detection probes in the set with a lower number of repeats; or When alignment is performed based on the base at the 3' end, In each set, the number of bases in the 3'-region of the detection probe is the same, and the overall length of the detection probe is the same; designing each set of detection probes so that the total length of the set of detection probes with a higher number of repeats is longer than the total length of the set of detection probes with a lower number of repeats; The design method described in Appendix 53. (Appendix 55) 55. The design method according to claim 53 or 54, wherein the repeat unit of the repeat sequence is TA. (Appendix 56) 56. The design method according to any one of Appendices 53 to 55, wherein the number of repeats in the repeat sequence is 2 to 10. (Appendix 57) 57. A design method according to any one of appendices 53 to 56, comprising an addition step of adding an MGB probe to the detection probe. (Appendix 58) A design method according to any one of Appendices 53 to 57, comprising a labeling step of adding a label to the detection probe. (Appendix 59) In the labeling step, a reporter and a quencher are added to the detection probe as the labels; and The reporter is attached to the 5'-region and the quencher is attached to the 3'-region; or The reporter is attached to the 3'-region and the quencher is attached to the 5'-region. The design method described in Appendix 58. (Appendix 60) In the labeling step, the reporter is attached to the 5' end of the detection probe and the quencher is attached to the 3' end of the detection probe; or The reporter is attached to the 3' end of the detection probe and the quencher is attached to the 5' end of the detection probe; 59. The design method described in Appendix 59. (Appendix 61) 61. The design method according to any one of Appendices 53 to 60, wherein the gene is the UGT1A1 gene. <Detection reagents> (Appendix 62) A polymorphism detection reagent for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms, comprising a detection probe set described in any one of Appendices 43 to 52 and a nucleic acid amplification reagent. (Appendix 63) A polymorphism detection kit for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms, comprising a detection probe set described in any one of Appendices 43 to 52 and a nucleic acid amplification reagent. [Industrial Applicability]

[0156] As described above, the present disclosure provides a method for detecting polymorphisms in genes containing repetitive sequences with improved specificity, and is therefore extremely useful, for example, in the field of testing.

Claims

1. a detection step of detecting, for a subject sample, polymorphisms of repeat sequences in a gene having at least four types of polymorphisms of repeat sequences using at least four types of detection probes; the at least four types of detection probes include first to fourth detection probes; each of the first to fourth detection probes comprises a 5'-region, an internal region, and a 3'-region, and a label; the internal regions of the first to fourth detection probes are polynucleotides containing base sequences capable of hybridizing to repeat sequences repeated k, l, m, and n times (where k<l<m<n, and k is an integer of 2 or more), respectively; the 5'-region is a polynucleotide located on the 5'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 5'-terminal side of the repeat sequence in the gene; the 3'-region is a polynucleotide located on the 3'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 3'-terminal side of the repeat sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe; The detecting step a signal detection step of nucleic acid amplifying the region in the presence of the sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; an evaluation step of evaluating the polymorphism of the repeat sequence based on the detected signal and a threshold value; A method for detecting a polymorphism in a gene having a polymorphism in a repetitive sequence, wherein the threshold value is set for the detection probe based on a reference nucleic acid containing a repetitive sequence with the same number of repeats as the repetitive sequence with the same number of repeats as the target repetition number of the detection probe, and / or a reference nucleic acid containing a repetitive sequence with a different number of repeats.

2. the evaluation step evaluates the polymorphism of the repetitive sequence based on the slope of the detected signal in a coordinate system having coordinate axes of signals from two of the first to fourth detection probes and the threshold value; The detection method according to claim 1, wherein the threshold is a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of each detection probe in two of the first to fourth detection probes, and / or a reference nucleic acid containing a repeat sequence with a different number of repeats.

3. The detection method according to claim 2, wherein the threshold is a slope set based on a reference nucleic acid containing a repeat sequence with the same number of repeats as the repeat sequence of the target of one of the first to fourth detection probes, and a reference nucleic acid with the same number of repeats as the repeat sequence of the target of the other detection probe.

4. The detection method according to claim 2 or 3, wherein the evaluation step evaluates the polymorphism of the repeat sequence based on detection signals in at least the following coordinate systems (a), (b), and (c), or at least the following coordinate systems (a), (c), and (d), and thresholds corresponding to each coordinate system: (a) a coordinate system having the signal of the first detection probe and the signal of the second detection probe as its coordinate axes; (b) a coordinate system having the signal of the second detection probe and the signal of the third detection probe as its coordinate axes; (c) a coordinate system whose axes are the signal of the third detection probe and the signal of the fourth detection probe; (d) A coordinate system having the signal of the second detection probe and the signal of the fourth detection probe as its coordinate axes.

5. The detection method according to claim 2 or 3, wherein the tilt is an angle.

6. The detection method according to claim 2 or 3, wherein the coordinate system has an origin at a signal in a sample not containing the reference nucleic acid.

7. The detection method according to claim 1 , wherein the threshold is set for each detection probe based on a reference nucleic acid containing a repeat sequence with a different number of repeats from the repeat sequence of the target of the detection probe.

8. The detection method according to claim 7, wherein the threshold is set based on a signal obtained by amplifying nucleic acid using the primer, the detection probe, and a reference nucleic acid containing a repetitive sequence with one or more repeats greater than the number of repeats of the polymorphism targeted by the detection probe, and detecting a signal of the label of the detection probe.

9. The detection method according to claim 8, wherein the threshold is set based on a signal obtained by amplifying nucleic acids using the primer, the detection probe, and a reference nucleic acid containing a repeat sequence with one more repeat than the polymorphism targeted by the detection probe, and detecting a reporter signal of the detection probe.

10. The detection method according to claim 1 or 2, wherein the repeat unit of the repeat sequence is a TA.

11. The detection method according to claim 1 or 2, wherein the number of repeats in the repetitive sequence is 2 to 20.

12. The detection method according to claim 1 or 2, wherein the gene is the UGT1A1 gene.

13. a setting step of setting a threshold value for evaluating repeat sequence polymorphisms in a gene having at least four types of repeat sequence polymorphisms for a reference sample using at least four types of detection probes; the at least four types of detection probes include first to fourth detection probes; each of the first to fourth detection probes comprises a 5'-region, an internal region, and a 3'-region, and a label; the internal regions of the first to fourth detection probes are polynucleotides containing base sequences capable of hybridizing to repeat sequences repeated k, l, m, and n times (where k<l<m<n, and k is an integer of 2 or more), respectively; the 5'-region is a polynucleotide located on the 5'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 5'-terminal side of the repeat sequence in the gene; the 3'-region is a polynucleotide located on the 3'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 3'-terminal side of the repeat sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe; The setting step includes: a signal detection step of nucleic acid amplifying the region in the presence of the reference sample, a primer capable of amplifying the region containing the repetitive sequence, and the detection probe, and detecting a signal from the label of the detection probe; a threshold setting step of setting a threshold for evaluating polymorphism of the repeat sequence of the repeat number of the target of the detection probe based on the detected signal; The reference sample includes, for the detection probe, a reference nucleic acid containing a repeat sequence having the same number of repeats as the repeat sequence of the target of the detection probe, and / or a reference nucleic acid containing a repeat sequence having a different number of repeats. A method for setting a threshold value used to detect polymorphisms in a gene having at least four types of repeat sequence polymorphisms.

14. A detection probe set for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms, the at least four types of detection probes include first to fourth detection probes; each of the first to fourth detection probes comprises a 5'-region, an internal region, and a 3'-region, and a label; the internal regions of the first to fourth detection probes are polynucleotides containing base sequences capable of hybridizing to repeat sequences repeated k, l, m, and n times (where k<l<m<n, and k is an integer of 2 or more), respectively; the 5'-region is a polynucleotide located on the 5'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 5'-terminal side of the repeat sequence in the gene; the 3'-region is a polynucleotide located on the 3'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 3'-terminal side of the repeat sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; A detection probe set, wherein the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe.

15. Designing a detection probe set for use in evaluating repeat sequence polymorphisms in a gene having at least four types of repeat sequence polymorphisms, the at least four types of detection probes include first to fourth detection probes; each of the first to fourth detection probes comprises a 5'-region, an internal region, and a 3'-region, and a label; the internal regions of the first to fourth detection probes are polynucleotides containing base sequences capable of hybridizing to repeat sequences repeated k, l, m, and n times (where k<l<m<n, and k is an integer of 2 or more), respectively; the 5'-region is a polynucleotide located on the 5'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 5'-terminal side of the repeat sequence in the gene; the 3'-region is a polynucleotide located on the 3'-terminal side of the internal region and comprising a nucleotide sequence capable of hybridizing to a nucleotide sequence of an adjacent region on the 3'-terminal side of the repeat sequence in the gene; the first detection probe and the second detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; the third detection probe and the fourth detection probe have the same number of bases in at least one of the 5'-region and the 3'-region and have the same overall length; A method for designing a detection probe set for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms, wherein the overall lengths of the third detection probe and the fourth detection probe are longer than the overall lengths of the first detection probe and the second detection probe.

16. A polymorphism detection reagent for use in detecting a repetitive sequence in a gene having at least four types of repetitive sequence polymorphisms, comprising the detection probe set according to claim 14 and a nucleic acid amplification reagent.

Images