Apparatus for cathode reaction and its application

A galvanic corrosion-based device using dissimilar metals generates a spontaneous electron flow to sustain cathodic reactions, addressing the limitations of external power dependence and enabling stable, long-term reactions in diverse environments.

JP2025167542APending Publication Date: 2025-11-07JAPAN AGENCY FOR MARINE-EARTH SCIENCE AND TECHNOLOGY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024072290
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-04-26
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing electrochemical systems for cathodic reactions require external power sources, limiting their use in environments without access to sunlight or hydrothermal wells, and suffer from low current and potential differences.

Method used

A device utilizing a galvanic corrosion reaction between dissimilar metals to generate a spontaneous flow of electrons, connecting an anode and cathode via an electrical resistor to maintain cathodic reactions without external power, using metals like iron, zinc, and carbon materials for the anode and cathode, respectively.

Benefits of technology

The device stably maintains cathodic reactions for extended periods in various environments, including the deep seabed, without external power, and allows for precise control of cathode potential and current, facilitating applications such as microbial culture and environmental purification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025167542000001_ABST
    Figure 2025167542000001_ABST
Patent Text Reader

Abstract

To provide a device capable of stably maintaining a cathode reaction over a long period of time without requiring an external power source under various environmental conditions, and its application.SOLUTION: There are provided: a device for cathodic reaction including an anode and a cathode, in which the anode and the cathode are electrically connected to each other via an electrical resistor without an external power source; a method for performing cathode reaction by immersing the anode and cathode in a sea, river, lake, or pond by using the device; a method for culturing or screening microorganisms, in which the anode is immersed in an electrolyte while the cathode is immersed in water inhabited by microorganisms; and an array of devices comprising a plurality of the devices, in which the resistance values of the electrical resistors differ between the devices in the array.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a device for a cathodic reaction and its applications, and more particularly to such a device that does not require an external power source and its applications. [Background technology]

[0002] Electrochemical reactions are the basis of various technologies, such as material and energy production. In particular, in recent years, cathodic reactions have been used for the purposes of electrosynthetic microorganism discovery and pollution purification. For example, Patent Document 1 discloses a method in which a precipitate in which microorganisms are accumulated by a cathodic reaction is formed and heavy metal ions in the treated water, such as mine wastewater, are concentrated in the precipitate.

[0003] Technologies are being investigated that can maintain the above electrochemical reaction even in environments where it is difficult to use external power sources such as grid power or batteries. Non-Patent Document 1 discloses an outdoor electrochemical system with constant potential control that supplies power through solar power generation. Non-patent document 2 discloses the supply of power to sensors and acoustic communications in an underwater probe using a fuel cell that utilizes microorganisms on the deep seafloor. Patent Document 2 discloses a power generation system comprising a borehole extending from the seabed surface to a hot water reservoir located below the seabed, a hot water well having a casing installed in the borehole via a guide base on the seabed surface, an anode installed on the hot water flow path of the hot water well, a cathode installed in seawater other than the hot water flow path of the hot water well, and power extraction means connected to the anode and the cathode, respectively, for extracting generated electricity. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Publication No. 2023-130005 [Patent Document 2] Patent No. 5842703 [Non-patent literature]

[0005] [Non-Patent Document 1] Biosensors and Bioelectronics 32.1 (2012): 309-313. [Non-patent document 2] Journal of Atmospheric and Oceanic Technology 33.3 (2016): 607-617 Summary of the Invention [Problem to be solved by the invention]

[0006] The system described in Non-Patent Document 1 cannot be used in environments such as the deep seabed where sunlight is unavailable. Furthermore, the system described in Patent Document 1 can only be realized around hydrothermal wells. The system described in Non-Patent Document 2 has the problem that the current and potential difference obtained are too small. An object of the present invention is to provide an apparatus and method that can stably maintain a cathode reaction for a long period of time under various environments without requiring an external power source. [Means for solving the problem]

[0007] The inventors focused on the galvanic corrosion reaction caused by contact between dissimilar metals, which is known as the principle behind corrosion prevention technology and corrosion cells (seawater batteries), and considered this reaction to be a mechanism that generates the spontaneous flow of electrons necessary for the cathodic reaction without relying on an external power source. As a result, they succeeded in constructing a new electrochemical system that generates a current potential difference equivalent to that of a corrosion cell over a long period of time, thereby completing this invention.

[0008] Specifically, the present invention provides the following as representative embodiments. <1> An apparatus for a cathodic reaction, comprising an anode and a cathode, the anode and the cathode being electrically connected to each other via an electrical resistor and without an external power source, and in the cathodic reaction, electrons are supplied to the cathode as the anode corrodes. <2> The anode is selected from the group consisting of iron, zinc, aluminum, magnesium, and alloys of metals containing any of these, and the cathode is selected from the group consisting of carbon materials, conductive polymers, metals, alloys, metal oxides, and metal sulfides. <1> The device described in <3> the cathode is selected from the group consisting of carbon paper, carbon felt, and carbon cloth; <1> or <2> The device described in <4> an anode tank containing the anode, the anode tank having a liquid junction between its interior and exterior; <1> ~ <3> 1. The device according to claim 1 , <5> The liquid junction is an ion exchange membrane. <4> The device described in <6> <1> ~ <5> The device according to any one of the above, which may further include a reference electrode, and includes at least one of a voltmeter for measuring the potential difference between the electrodes and an ammeter for measuring the current between the electrodes. <7> The electrical resistor is a variable resistor. <1> ~ <6> 1. The device according to claim 1 , <8> For seawater treatment <1> ~ <7> 10. The device according to any one of claims 1 to 9, wherein the effective area of ​​the anode is equal to or greater than the effective area of ​​the cathode. <9> <1> ~ <7> 2. A method for carrying out the cathode reaction by using the apparatus according to any one of the above items 1 to 11, immersing the anode and the cathode in the sea, river, or lake, and using water from the sea, river, or lake as a cathode electrolyte. <10> The cathode reaction is carried out in the deep sea. <9> The method described below. <11> <1> ~ <7> A method for culturing or screening microorganisms using the device described in any one of the above, which comprises immersing the anode in an electrolyte solution and the cathode in water inhabited by microorganisms. <12> A method for recovering heavy metal ions from water to be treated in which microorganisms containing heavy metal ions and capable of metabolizing heavy metals live, comprising: <1> ~ <7> immersing the anode in an electrolytic solution and the cathode in the water to be treated, and forming a precipitate in which the microorganisms are accumulated by the cathode reaction and concentrating the heavy metal ions in the precipitate. <13> <1> ~ <7> 10. A device array comprising a plurality of devices according to any one of claims 1 to 9, wherein the electrical resistors in the plurality of devices have different resistance values. <14> For use in microbial culture or microbial screening, <13> 2. The device array according to claim 1 . [Effects of the Invention]

[0009] The present invention provides an apparatus that can stably maintain an electrochemical reaction, particularly a cathode reaction, for a long period of time without requiring an external power source, and a method that applies this apparatus. [Brief explanation of the drawings]

[0010] [Figure 1] (a) Schematic diagram of the principle of the device of the present invention, (b) shows the potentials of the cathode and anode when the resistance value of an electric resistor placed between a metal corrosion anode and an inert cathode is changed. [Figure 2] (a) Shows the potential of the cathode and anode and the current flowing between the two electrodes when the resistance value of the electrical resistor is changed. The notation next to each potential-current data point indicates the resistance value between the two electrodes and the open circuit state (OPEN). (b) A graph plotting the measured current value and the calculated current value calculated using Ohm's law from the resistance value and the potential difference between the two electrodes. The notation next to each data point indicates the resistance value between the two electrodes. [Figure 3] The polarization curves of two-electrode systems with different cathode / anode effective area ratios are shown. [Figure 4]The difference in polarization characteristics between nitrogen bubbling and air bubbling is shown. The notation accompanying each potential-current data point indicates the resistance between the two electrodes and the open circuit state (OPEN). [Figure 5] Polarization characteristics are shown for typical inorganic and organic electrode materials used as cathodes. (a) Polarization characteristics are shown for a carbon material used as the cathode. CCloth, CFelt, carbon felt, CPaper, carbon paper, Graphite, and GCarbon represent the polarization characteristics for the cathodes. (b) Polarization characteristics are shown for metals and metal oxides used as cathodes. Pt represents platinum, SS represents stainless steel (SUS304), SSOxide represents heat-treated oxide of stainless steel (SUS304), ITO represents ITO (indium-tin oxide) thin-film glass, and Ti represents titanium. (c) Polarization characteristics are shown for mineral fragments and rock fragments used as cathodes. Sulfide Rock represents sulfide mineral rock fragments, and Chalcopyrite represents chalcopyrite fragments. [Figure 6] The polarization characteristics are shown below when a typical corroding metal is used as the anode. [Figure 7] This shows the potentials of the cathode and anode and the current flowing between the two electrodes when the resistance value of the electrical resistor is changed in electrolytes with different salt concentrations. [Figure 8] This shows the effect of solution electrolyte concentration on the electrode reactions at the anode and cathode, and the migration characteristics of the solution electrolyte through the anion exchange membrane. (a) This shows the transition of the cathode and anode potentials in a galvanic corrosion stand-alone electrode system (operated for approximately one month with an inter-electrode resistance of 10 Ω) in a two-chamber electrolysis cell, with simulated seawater electrolyte (SW) and simulated freshwater electrolyte (FW) filled in each electrode chamber, separated by an anion exchange membrane. (b) This shows the transition of the electrical conductivity of each electrode chamber in the same experiment. [Figure 9]The results of a two-week demonstration experiment of a galvanic corrosion standalone electrode system in an actual shallow marine environment are shown. (a) The graph shows the changes in the anode and cathode potential of the electrode system in an open circuit (non-energized) and when the galvanic corrosion current intensity was controlled using four levels of interelectrode resistance (5 kΩ, 2 kΩ, 750 Ω, and 12 Ω). (b) The graph shows the changes in the current for each electrode system. [Figure 10] The cathode electrode after two weeks of demonstration testing in a shallow sea environment is shown. (a) The carbon felt electrode and PVC electrode fixture. (b) A scanning electron microscope (SEM) image of the carbon felt electrode. [Figure 11] This shows the appearance of the microbial community and deposits formed on the cathode-polarized electrode in a demonstration experiment in a shallow sea environment. (a) and (b) are scanning electron microscope (SEM) images of a bacillus biofilm formed around the surface of a carbon fiber electrode. (c) and (d) are scanning electron microscope images of the deposits and the cut cross section of the electrode fiber. [Figure 12] This shows the community structure of the microbial community formed on the cathode electrode in a demonstration experiment in a shallow sea environment. (a) Prokaryotic microbial community structure of the on-site seawater, PVC electrode jig surface, open-circuit control electrode, and various cathode-polarized electrodes in the shallow-sea demonstration experiment (16S rRNA gene amplicon sequencing analysis). (b) Maximum likelihood phylogenetic tree of the dominant phylogenetic sequences obtained from amplicon sequencing analysis of the 16S rRNA gene of the various cathode-polarized electrodes, and known closely related sequences. The numbers in the figure are bootstrap values ​​for each branch. [Figure 13] This shows the appearance of precipitates formed on the surface of the polarized cathode of a galvanic corrosion standalone electrode system operated for a long period in artificial seawater. (a) This is a photograph of white precipitates confirmed on the surface of the polarized cathode (operated with interelectrode resistances of 5 kΩ, 750 Ω, and 2 Ω) of an electrode system operated for six months in artificial seawater at 4°C. (b) This shows the results of powder X-ray diffraction analysis of the precipitate phase peeled off from the cathode electrode surface. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present invention will be described in detail below. The following description of the components may be based on representative embodiments or specific examples, but the present invention is not limited to such embodiments.

[0012] The device according to one embodiment of the present invention (hereinafter referred to as the "device of this embodiment") is a device for carrying out an electrochemical reaction. The electrochemical reaction is a reaction involving electrons supplied to a cathode, i.e., a "cathode reaction." The anode and cathode are connected via an electrical resistor, and electrons are supplied to the cathode only by corrosion of the anode, meaning that no external power source is required to supply electrons to the cathode.

[0013] This device utilizes the galvanic corrosion reaction caused by dissimilar metal contact, which is known as the principle of corrosion prevention technology and corrosion cells (seawater cells). This allows the spontaneous flow of electrons required for the cathodic reaction to be generated without relying on an external power source. The flow of electrons from the anode to the cathode associated with the corrosion reaction is controlled by connecting the anode and cathode via an electrical resistor of a desired resistance value. This allows the strength of cathodic polarization to be maintained at any desired level.

[0014] The anode may be made of a metal that corrodes in the electrolyte. The oxidation of the anode metal in the electrolyte creates a flow of electrons from the anode to the cathode. Specific examples of metals that can be used for the anode include iron, nickel, chromium, zinc, tantalum, manganese, zirconium, titanium, aluminum, beryllium, magnesium, and alloys containing any of these metals. Among these, iron, zinc, aluminum, magnesium, and alloys consisting of two or more of these metals are preferred.

[0015] The cathode is not particularly limited as long as it is a conductor capable of accepting electrons; typically, an inactive electrode is used. Specific examples include precious metals such as copper, platinum, silver, and gold, metals plated with these metals, iron, stainless steel, titanium, carbon materials, metal oxides, and metal sulfides. These can be used, for example, as thin-film electrodes. Examples of carbon materials include glassy carbon, graphite, carbon paper, carbon felt, carbon cloth, carbon fiber brushes, carbonized biomass materials such as activated carbon and charcoal, graphite sheets, graphene, and conductive polymers. Furthermore, a carbon material with high corrosion resistance and a wide potential window is preferred for the cathode. In particular, for the purposes of microbial enrichment and environmental purification on the cathode, carbon fiber is preferred because of its high conductivity, high bioaffinity, and a large true surface area relative to the geometric surface area due to its microstructure, resulting in high activity per geometric area. Specifically, a material selected from the group consisting of carbon paper, carbon felt, carbon cloth, and carbon fiber brushes is preferred. When any of these materials is used, as shown in the examples, the current value can be adjusted over a wide range by adjusting the resistance value, regardless of the type of anode, and the cathode potential and current value can be precisely adjusted. A laminate in which multiple materials described above are stacked may also be used. The shape of the cathode is not particularly limited and can be selected from various shapes such as a flat plate, mesh, lattice, block, porous, brush, thin film, etc.

[0016] In the device of this embodiment, cathode polarization is achieved by storing (charging) electrons supplied by the metal corrosion reaction at the anode in the cathode. At the cathode, a reduction reaction (cathode reaction) of oxidized substances in the cathode electrolyte occurs depending on the properties of the electrode and the cathode electrolyte, and the charged electrons are consumed by this cathode reaction. Here, cathode polarization is maintained by supplying electrons from the anode at a rate that exceeds the electron consumption rate at the cathode. Therefore, two electrodes are usually combined under conditions that provide a sufficiently high anode reaction activity compared to the cathode reaction activity, so that a strong cathode polarization state can be created by connecting the anode and cathode without a resistor. Preferred combinations include, for example, those shown in the table below.

[0017] [Table 1]

[0018] Furthermore, by using the above combinations and suppressing the flow of electrons supplied from the anode to a desired level with a desired inter-electrode electrical resistance, it is possible to obtain a cathodic polarization state of any desired intensity. On the other hand, if the cathodic reaction activity exceeds the anodic reaction activity, the cathode will be electron-deficient and will not be able to maintain the desired cathodic polarization state. To maintain a high anodic reaction activity relative to the cathodic reaction activity, the effective area of ​​the anode and cathode is set using the following method. The reaction activity of the anode and cathode per unit effective area is determined by the electrode material and shape and the properties of the electrolyte in contact with them. Therefore, by immersing the anode and cathode of the desired material and shape in the intended electrolyte and determining the reaction activity per unit effective area of ​​each anode and cathode, the effective area ratio of the anode and cathode can be set so that the anodic reaction activity is sufficiently greater than the cathodic reaction activity, allowing for a wide range of cathodic polarization states to be maintained satisfactorily. Specifically, for example, when the anode is zinc, the cathode is carbon cloth, and the electrolyte in which both electrodes are immersed is an aerobic seawater-like solution with a salt concentration similar to seawater and dissolved oxygen, the zinc anode reaction activity is sufficiently greater than the carbon cloth cathode reaction activity for the same effective area, so it is preferable to set the anode effective area equal to or greater than the cathode effective area. As shown in the examples, specifically, the ratio of the carbon cloth cathode effective area to the zinc anode effective area is preferably 300 or less, more preferably 100 or less, even more preferably 10 or less, and particularly preferably 1 or less. In other words, it is particularly preferable for the anode effective area to be equal to or greater than the cathode effective area.

[0019] In this specification, the term "effective area" refers to the geometric area of ​​the portion of the anode and cathode that contacts the electrolyte as electrodes.

[0020] The effective area of ​​each of the anode and cathode is not particularly limited and can be determined appropriately taking into account the ratio between the two. However, in consideration of practically appropriate sizes, the following ranges can be mentioned: The effective area of ​​the anode is 1 cm 2 ~200cm 2is preferable, 5cm 2 ~100cm 2 It is more preferable that the 2 ~50cm 2 It is more preferable that: The effective area of ​​the cathode is 0.5 cm 2 ~100cm 2 is preferred, 1cm 2 ~50cm 2 It is more preferable that it is 5cm 2 ~25cm 2 Furthermore, since the corroding metal anode is depleted as the reaction proceeds, in order to maintain the cathodic reaction for a long period of time, it is necessary to use an anode with a mass that exceeds the amount lost during that period. This loss per unit time can be estimated from the knowledge of the loss when corroding metal is used as a sacrificial anode for corrosion protection. 2 Zinc round bar (φ2cm, length 2cm) (ZAP M-20, Mitsui Kinzoku Shoji) with an effective area of ​​9.6cm 2 Carbon felt (Tsukuba Materials Information Institute) was used as the anode and cathode, respectively, and a fixed resistor was placed between the two electrodes so that the electrical resistance between the two electrodes was 1kΩ, 2kΩ, 5kΩ, 10kΩ, and 20kΩ, and a cathodic reaction was maintained on the seafloor of a deep-sea hydrothermal field at a depth of approximately 1,000m.When the device was recovered after being installed on the deep seafloor for approximately 24 months, each zinc anode remained intact, and measurements of the cathodic potential after recovery showed that each cathodic polarized electrode showed a lower potential than the open-circuit control carbon felt, confirming that the anodic corrosion reaction and cathodic polarization had been maintained over the installation period.

[0021] The cathode and anode are electrically connected to each other via an electrical resistor and without an external power source. The anode, electrical resistor, and cathode may be connected by conductors that have sufficient conductivity, corrosion resistance against electrolytes such as seawater, and mechanical resistance to changes in water pressure, low and high temperatures, etc. Specifically, it is preferable to use coated conductor wire or titanium wire that has been treated to be waterproof and corrosion resistant, and connect them by soldering, bonding with conductive epoxy, or crimping, with the connecting parts treated to be water and corrosion resistant.

[0022] The resistance value of the electrical resistor can be selected depending on the material and effective area of ​​the electrode used, the properties of the electrolyte, and the intended use. For example, it may be selected in the range of 10 Ω to 10 kΩ. The electrical resistor may be a fixed resistor with a constant (fixed) resistance value, a variable resistor whose resistance value can be changed, or a semi-fixed resistor. A variable resistor is preferable in that it can easily control the cathode polarization state (cathode potential) to any desired state. For example, as described below, it can be used in a device equipped with a voltmeter or ammeter, and the cathode polarization state can be controlled by adjusting the resistance value of the variable resistor based on information on the cathode polarization state obtained by the voltmeter or ammeter.

[0023] In the device of this embodiment, the cathode and anode are electrically connected to each other without an external power source. The device of this embodiment can induce a cathodic reaction by utilizing the spontaneous flow of electrons from the anode to the cathode due to a corrosion reaction at the anode, so no external power source such as a grid power supply or a battery is required. Therefore, the device can be used to carry out cathodic reactions in various environments, including the deep seabed.

[0024] Furthermore, the device of this embodiment can maintain a constant potential and constant current state for a long period of time inexpensively and simply without using expensive and large-scale electrochemical devices (having a stabilized power supply and a current / potential control mechanism) such as conventional potentio-galvanostats. Therefore, it can be used in various natural environments, including the deep seabed, as well as in factories and laboratories. Because the potential and current of the cathode vary depending on the properties of the electrodes and electrolyte, the required potential and current conditions can be roughly set based on the knowledge and experience of the device user. Furthermore, by simultaneously operating multiple devices equipped with electrical resistors of different resistance values, various cathode polarization states can be created. Such an array of devices allows for the operation of cathodes with potential and current conditions close to the required conditions. Because each device is easy to fabricate, inexpensive, and compact, multiple devices using cathodes with various conditions can be arranged in an array and examined, allowing the device closest to the required conditions to be screened.

[0025] The device of this embodiment may further include a voltmeter or an ammeter. The voltmeter can be positioned so as to measure, for example, the potential difference between the anode and the cathode. Furthermore, the ammeter can be positioned so as to measure, for example, the current flowing between the anode and the cathode. The device of this embodiment may further include a reference electrode. A reference electrode is an electrode whose potential is always maintained constant, and by measuring the potential difference between the cathode or anode and the reference electrode with a voltmeter, the cathode potential or anode potential at any resistor connection can be determined. The device of this embodiment may include a current-voltage logger or the like as a voltmeter or ammeter. The current-voltage logger can record the potential and current of each electrode.

[0026] By immersing the anode and cathode of the device in an electrolyte, a cathode reaction can be carried out starting from a corrosion reaction at the anode. The electrolyte is not particularly limited and may be seawater, or water from a river or lake. For example, the anode and cathode can be immersed in seawater, a river, or a lake, and the cathode reaction can be carried out using the seawater, riverwater, or lakewater as the cathode electrolyte. The anode may be disposed so that it is entirely or partially immersed in the electrolyte. The cathode may be disposed so that it is entirely or partially immersed in the electrolyte. The anode electrolyte in contact with the anode and the cathode electrolyte in contact with the cathode may or may not be separated by a liquid junction. The anolyte may be a medium in which the cathode reaction described below occurs in the catholyte. Alternatively, for example, the anolyte separated from the catholyte may be artificially adjusted to a desired composition. The anode electrolyte preferably has high electrical conductivity, more preferably at least as high as seawater. As will be shown in the examples below, the anode corrosion activity is strongly governed by the electrical conductivity of the anode electrolyte. Specifically, in a water environment with low electrical conductivity, such as a river or lake, the anode corrosion activity is low and the cathodic polarization strength is limited. When the device of this embodiment is used in such a water environment with low electrical conductivity, a liquid junction such as an ion exchange membrane may be provided separately, and an anode tank filled with a high electrical conductivity electrolyte such as saltwater may be provided, and the anode may be placed in the anode tank.

[0027] In addition, ions of the metal constituting the anode are released into the solution as a result of the anode corrosion reaction. To prevent these metal ions from reaching the vicinity of the cathode, for example, the cathode electrolyte, or from diffusing to the surroundings, an anode tank may be provided as described above, and an anion (cation) ion exchange membrane may be used at the external liquid junction. The cation (cation) metal ions released by the corrosion reaction can be retained in the anode tank and prevented from moving outside the tank, allowing the electrochemical reaction to proceed.

[0028] Furthermore, in a configuration using an anode tank connected to the liquid junction by an anion (cation) ion exchange membrane, an intermediate tank separated by another ion exchange membrane may be provided outside the anode tank to prevent anions from migrating into the anode tank (and cations from the anode tank to the outside) during the cathode reaction. This reduces ion migration. For example, an intermediate tank connected to the outside of the anode tank via a cation exchange membrane can be provided outside the anode tank connected to the liquid junction with the cathode, and filled with an electrolyte containing cations that may migrate to the outside and anions that may migrate to the anode tank. The ion migration required to balance the charge during the electrochemical reaction occurs through the migration of anions and cations from the intermediate tank to the anode tank and the outside, preventing the migration of metal ions to the outside and the migration of anions from the outside to the anode tank during the corrosion reaction.

[0029] The cathode electrolyte is a medium in which the cathode reaction takes place, and can be water (aqueous solution or suspension) intended to accumulate or chemically change the components present therein through the cathode reaction, or water to be treated through the cathode reaction. As mentioned above, examples of the cathode electrolyte include seawater or water (surface water) from rivers, lakes, and marshes. The device of this embodiment may also be used so that water inhabited by microorganisms serves as the cathode electrolyte. Examples of microorganisms include marine microorganisms, surface aquatic microorganisms, subsurface microorganisms, alkaliphilic or alkali-tolerant microorganisms, electrochemically active microorganisms, and microorganisms capable of metabolizing heavy metals. Examples of water inhabited by microorganisms include water inhabited by microorganisms in nature (e.g., mine wastewater, industrial wastewater, groundwater, hot spring water, and environmental water), as well as completely artificially produced solutions such as microbial culture solutions and partially artificially or intentionally modified solutions, such as mine wastewater to which carbonate components have been artificially added in order to remove heavy metals from the mine wastewater. Furthermore, the device of this embodiment may be used to prepare the cathode electrolyte from mine wastewater (pit water and wastewater) (e.g., mine drainage), industrial wastewater, groundwater, hot spring water, environmental water (e.g., surface water, seawater), etc. The cathode electrolyte may be sludge, muddy water, or a suspension of these in water.

[0030] The characteristics of cathodic polarization can vary depending on the properties of the cathode electrolyte. For example, they vary depending on whether the cathode electrolyte is seawater or freshwater. They also vary depending on the presence or absence of sediments. Dissolved oxygen, in particular, can have an effect depending on these environments. Dissolved oxygen influences biological and chemical reactions at the cathode, making it such an important characteristic of the cathode electrolyte that environmental conditions are broadly classified as "aerobic" or "anaerobic" depending on the amount of dissolved oxygen. As shown in the examples below, the greater the amount of dissolved oxygen, a strong electron acceptor in the cathode electrolyte, the greater the activity of the cathodic reaction that determines the overall reaction rate. This results in a higher current value and a higher cathodic potential under the same electrical resistance. Conversely, a lack of dissolved oxygen reduces the cathodic reaction activity, and even a small corrosion current can cause strong cathodic polarization. Therefore, even if the corrosion current flowing to the cathode is strongly suppressed by a large electrical resistance, the cathode potential is low, while even if a small electrical resistance between the two electrodes is provided, the current value remains small because the electron consumption rate at the cathode is low due to the low cathodic reaction activity. Therefore, when the electrochemical reaction proceeds in this embodiment, the cathode potential may be adjusted by adjusting the amount of dissolved oxygen near the cathode. The amount of dissolved oxygen can be adjusted by air bubbling, for example.

[0031] The device of this embodiment can be applied to cathode reaction-based technologies such as the screening (search) of electrochemically active microorganisms such as electrosynthetic microorganisms, their physiological and ecological analysis (such as in situ electrode enrichment culture in real environments, including remote extreme environments such as the deep seafloor), and environmental purification. By using the device of this embodiment, cathode reactions can be maintained for long periods of time under any conditions in remote environments, including the deep seafloor, and can be implemented more cheaply, simply, and compactly than conventional technologies. When using the device of this embodiment in the above-mentioned microbial screening method, water inhabited by microorganisms can be used as the cathode electrolyte.

[0032] The device of this embodiment can also be used to purify rivers, lakes, and other areas contaminated with metals. For example, as described in Patent Document 1 (JP 2023-130005 A, the contents of which are incorporated herein by reference), it can be used to recover harmful metal ions present in water to be treated that contains heavy metal ions and is inhabited by microorganisms capable of metabolizing heavy metals. Specifically, the cathode of the device of this embodiment is immersed in the water to be treated, and the anode is immersed in an appropriate electrolyte (which may be the water to be treated). A carbonate precipitate in which the microorganisms accumulate is formed by a cathode reaction, and the heavy metal ions can be concentrated and recovered in this precipitate. Examples of water to be treated include mine wastewater, industrial wastewater, groundwater, and environmental water.

[0033] The device of this embodiment can also be applied to promoting coral growth on or near the surface of the cathode (electrified reefs) and efforts to create revetments (Biorock).

[0034] The device of this embodiment is also suitable for use in laboratories, factories, etc., not just in remote environments such as the deep seabed, because it allows cathode reactions to be carried out anywhere, inexpensively, simply, compactly, and for a long period of time. For example, the device of this embodiment can be used for laboratory microbial screening and electrode culture of microbial communities and isolated strains. It can also be applied to electrochemically active microbiology research, exemplified by the exploratory research and ecological analysis of electrosynthetic microorganisms, which use electrons from electrodes as an electron and energy source to grow biomass by carbon dioxide fixation, which began around 2010. This research requires long-term laboratory electrode culture experiments using multiple cathode electrodes controlled to various polarization states, and the need to create cathode-polarized electrodes using expensive, large-scale electrochemical equipment limits research throughput. The device of this embodiment enables microbial culture using a simple device. In particular, as described above, electrode culture experiments can be performed with throughput comparable to that of agar plate culture experiments using an array of devices equipped with electrical resistors of different resistance values. Thus, the device of this embodiment can be used for applications requiring simultaneous analysis or screening of multiple systems, which is not anticipated by conventional electrochemical devices.

[0035] Furthermore, even when the cathode electrochemical system is operated in a low electrical conductivity solution (such as a freshwater river or lake) that limits its performance, or when metal ions generated by metal corrosion must be prevented from diffusing out of the system, the cathode reaction can be carried out while suppressing these effects by adding the additional measures described in this specification. [Example]

[0036] The present invention will be described in more detail below with reference to examples. The materials, reagents, amounts and proportions of substances, procedures, etc. shown in the following examples can be changed as appropriate without departing from the spirit of the present invention. Therefore, the scope of the present invention is not limited to the following examples. In the examples, unless otherwise specified, a silver-silver chloride saturated KCl reference electrode (RE-1B, EC Frontier) was used as the "reference electrode," and a VSP from Bio-Logic Science Instruments was used as the potentiogalvanostat.

[0037] <Example 1: Proof of concept of cathodic polarization technology using galvanic corrosion reaction and polarization characteristic analysis experiment of two-electrode system> [Example 1-1: Proof-of-concept experiment of cathodic polarization technology using galvanic corrosion reaction] Effective area: 0.5cm 2 The carbon cloth (Tsukuba Materials Information Laboratory) specified in 2 A two-electrode system was used, with a zinc plate (Nilaco) as the anode. The anode and cathode were immersed in 50 mL of artificial seawater (Daigo Artificial Seawater SP, Shioya MS) stirred at 200 rpm while compressed air was bubbled through a 20G needle at 0.01 MPa. Polarization experiments were performed at room temperature (23-25°C) while varying the interelectrode resistance. The interelectrode resistance was varied by first establishing an open circuit between the two electrodes, then gradually decreasing the interelectrode resistance (from 1 MΩ to 10 Ω) by changing the resistor between the two electrodes from 1 MΩ to 95 kΩ to 20 kΩ, and then returning to an open circuit (Figure 1(a)). The potentials of both electrodes were measured using a potentiogalvanostat by measuring the potential difference between the anode and cathode electrodes and a reference electrode, both of which were also immersed in the artificial seawater. Simultaneously, the current flowing between the electrodes was measured. The interelectrode electrical resistance was changed by changing the resistor between the electrodes after 20 minutes of operation at each interelectrode electrical resistance, or when it was determined that the fluctuations in the electrode potential in response to the electrical resistance change had subsided (when the potential change over 2 minutes was less than 10 mV), and it was determined that a steady state of polarization had been reached at that interelectrode electrical resistance. The average potential and current recorded during the time (approximately 2 minutes) before changing to the next resistor, which was considered to represent the steady state of polarization at that interelectrode electrical resistance, were then used as representative electrode potential and current values ​​for that polarization state. The obtained electrode potential data revealed the changes in the potential at each electrode due to changes in the magnitude of the interelectrode electrical resistance, and the polarization characteristics of the two-electrode system were clarified (Figure 1(b)).

[0038] In addition, a polarization curve was created by plotting the potential of each electrode on the vertical axis and the current value flowing between the two electrodes on the horizontal axis. The results are shown in Figure 2(a). These results show that the polarization strength of the carbon cloth cathode changes depending on the electrical resistance between the two electrodes. Furthermore, when the representative current values ​​measured in the polarization characteristic analysis experiment described above were plotted against the current values ​​calculated using Ohm's law from the respective inter-electrode resistance values ​​and inter-electrode potential differences, it was shown that the two were proportional (Figure 2(b)). These results demonstrate that the polarization state of both electrodes is predominantly determined by the magnitude of the inter-electrode resistance.

[0039] [Example 1-2: Conditions required for arbitrarily controlling the polarization strength of the cathode in cathodic polarization technology utilizing galvanic corrosion reactions (keeping the anodic reaction activity higher than the cathodic reaction activity)] Effective area: 2400mm 2 (24cm 2 A polarization analysis experiment was conducted using a two-electrode system consisting of a carbon cloth cathode of 2400mm2 and zinc anodes (zinc round bars and zinc plates) with the following six levels of effective area. The difference in polarization characteristics due to the difference in the effective area ratio between the zinc anode and the carbon cloth cathode was verified. The zinc anode had an effective area of ​​2400mm2. 2 , 628mm 2 , 157mm 2 , 31.4mm 2 , 7.065mm 2 , 0.785mm 2 Six two-electrode systems were fabricated with six cathode / anode effective area ratios of 1.0, 3.8, 15.3, 76.4, 339.7, and 3057.3. 300 mL of artificial seawater (Daigo Artificial Seawater SP) was stirred at 200 rpm, and the anode, cathode, and reference electrodes were immersed in the solution. A potentiogalvanostat was used to measure the anode-cathode potential and the current flowing between the electrodes under each electrical resistance condition, and a polarization curve was created.

[0040] The results are shown in Figure 3. For the combination of a zinc anode and a carbon cloth cathode, when the cathode / anode effective area ratio was 76.4 or greater, regardless of the magnitude of the interelectrode electrical resistance, only the cathode potential changed, while the anode potential remained almost constant. This suggests that the electron input reaction to the anode due to zinc corrosion was not rate-limiting the overall reaction in the two-electrode system, and that the anode reaction activity was sufficiently high relative to the cathode reaction activity. On the other hand, in a system with a cathode / anode effective area ratio of 339.7, the anode potential tended to gradually increase as the interelectrode resistance decreased and the interelectrode current increased. At an interelectrode resistance of 10 Ω, where the maximum interelectrode current (approximately 3.9 mA) was recorded, the anode potential was approximately 150 mV higher than under open-circuit conditions. Furthermore, in the system with a small relative anode area (cathode / anode effective area ratio of 3057.3), the anodic potential increased significantly with increasing interelectrode current, and the resulting interelectrode current was significantly smaller than in the other systems. These results indicate that when the anode / cathode effective area ratio falls below a certain value and the anodic reaction activity relative to the cathode decreases, the electron consumption rate in the cathodic reaction exceeds the electron supply rate in the anodic corrosion reaction, causing the anode to become electron-deficient and resulting in anodic polarization, which increases the potential. This suggests that the current flowing between the electrodes is supplied by the corrosion reaction at the anode, so the current value is limited by a small anode effective area. To stably achieve cathodic polarization of a desired magnitude, it is necessary to maintain the anode / cathode effective area ratio above a certain value and ensure sufficiently high relative anodic reaction activity.

[0041] [Example 1-3: Factors that determine the polarization characteristics of a cathode in cathodic polarization technology using galvanic corrosion reactions (differences in cathode electrolyte)] Effective area: 0.5cm 2 The carbon cloth (Tsukuba Materials Information Laboratory) specified in 2A two-electrode system was used, with a zinc plate as the anode. Pure nitrogen gas (N2) and compressed air (air) were bubbled through a 20G needle at 0.01 MPa, respectively. The anode, cathode, and reference electrodes were immersed in 50 mL of artificial seawater (Daigo Artificial Seawater SP) stirred at 200 rpm. Polarization experiments were performed at room temperature (23-25°C). A potentiogalvanostat was used to measure the anode-cathode potential and the current flowing between the electrodes at each resistance while varying the resistance between the two electrodes, and a polarization curve was created.

[0042] The results are shown in Figure 4. Comparing the polarization curves under pure nitrogen bubbling and air bubbling conditions, the zinc corrosion anode potential was less than 70 mV at each inter-electrode resistance between 1 MΩ and 10 Ω, with no significant difference observed. On the other hand, the carbon cloth cathode potential decreased rapidly as the inter-electrode resistance decreased under pure nitrogen bubbling conditions compared to air bubbling conditions, and at an inter-electrode resistance of 3.26 kΩ, the cathode-node potential difference approached the anodic potential at 42 mV (under air bubbling conditions, the inter-electrode potential difference was 403 mV at 3.26 kΩ), and no increase in the current value was observed even when the inter-electrode resistance was reduced. This is thought to be due to the fact that under air bubbling conditions, cathodic polarization occurs accompanied by cathodic oxidation and dissolved oxygen reduction reactions, whereas under pure nitrogen bubbling conditions, the presence of very little dissolved oxygen and the scarcity of potential electron acceptors for oxidizing other carbon cloth cathodes resulted in extremely low electron consumption activity at the cathode (cathodic reaction activity). In other words, electrons supplied from the anode accumulated excessively at the cathode compared to the presence of dissolved oxygen (air bubbling conditions), resulting in strong cathodic polarization and a low cathodic potential even under low current conditions with a large electrical resistance between the two electrodes. At the same time, the extremely low cathodic reaction activity due to the lack of electron acceptors is thought to have limited the overall reaction rate and suppressed the current between the two electrodes. On the other hand, the zinc corrosion reaction, which is responsible for the anodic reaction, is highly active regardless of the presence or absence of dissolved oxygen, which is thought to be why no difference in the anode potential was observed. As has been shown, the cathode polarization characteristics differ depending on the amount of dissolved oxygen, and the cathode polarization characteristics in this technology are also determined by the properties of the cathode electrolyte in contact with the electrode.

[0043] [Example 1-4: Polarization characteristic analysis experiment of a galvanic corrosion two-electrode system using representative inorganic and organic electrode materials as the cathode] Effective area: 0.5cm 2 The following materials are used as cathodes, with an effective area of ​​8cm 2A polarization experiment was carried out using a zinc plate as the anode, measuring the anode-cathode potential and the current flowing between the electrodes at each resistance while changing the resistance between the two electrodes, and a polarization curve was created. The effective area of ​​the chalcopyrite piece was 0.16 cm. 2 , the effective area of ​​the sulfide mineral rock fragment is 1.20 cm 2 It is stipulated in the Cathode Material: Carbon felt (Tsukuba Materials Information Institute) Carbon cloth (Tsukuba Materials Information Institute) Graphite sheet (Tsukuba Materials Information Institute) Glassy Carbon (BAS Inc.) Carbon paper (Tsukuba Materials Information Institute) Stainless steel (SUS304, Nilaco Co., Ltd.) Stainless steel heat-treated oxide (stainless steel oxide obtained by heat-treating stainless steel (SUS304, Nilaco Corporation) in an electric furnace at 700°C for 1 hour) Titanium (Nilaco Co., Ltd.) Platinum (Nilaco Co., Ltd.) ITO thin film (8-12Ω, SPI supplies) Chalcopyrite fragments (Osarizawa Mine) Sulfide mineral rock fragments (collected from the seafloor of the deep-sea hydrothermal field in the Iheya North Knoll, Central Okinawa Trough)

[0044] The anode, cathode, and reference electrodes were immersed in 300 mL of artificial seawater (Daigo Artificial Seawater SP) stirred at 200 rpm. Using a potentiogalvanostat, the anode-cathode potential and the current flowing between the electrodes were measured under each electrical resistance condition. The current density was calculated by dividing the current value by the effective area of ​​the cathode.

[0045] The results are shown in Figure 5. These results demonstrate that various inorganic and organic materials, artificial objects, and natural minerals (chalcopyrite flakes and sulfide mineral rock fragments) were used as cathodes, and that the cathodic polarization intensity varied depending on the interelectrode electrical resistance. This indicates that various cathodic polarization states could be created by varying the magnitude of the interelectrode electrical resistance. The cathodic potential and interelectrode current density varied depending on the material under each interelectrode electrical resistance condition, which is thought to reflect the differences in the polarization characteristics of each material. The fact that there was almost no variation in the anode potential for all materials under all interelectrode electrical resistance conditions suggests that in the two-electrode system used in this study, the electron injection reaction initiated by zinc corrosion into the anode did not limit the overall reaction rate of the two-electrode system, and that the magnitude of the electrical resistance was the dominant factor in determining the cathodic polarization state.

[0046] [Example 1-5: Polarization characteristic analysis experiment of a galvanic corrosion two-electrode system using a representative corroding metal as the anode] Effective area: 8cm 2 The following corrosion metals are used as anodes, with an effective area of ​​0.5 cm 2 In a two-electrode system using the carbon cloth specified in the above as the cathode, a polarization experiment was carried out in which the anode-cathode potential and the current value flowing between the two electrodes were measured at each resistance while changing the resistance between the two electrodes, and a polarization curve was created. Anode Material: Zinc round bar (Nilaco Co., Ltd.) Magnesium round bar (Nilaco Co., Ltd.) Iron round bar (Nilaco Co., Ltd.) Aluminum round bar (Nilaco Co., Ltd.)

[0047] The anode, cathode, and reference electrodes were immersed in 300 mL of artificial seawater (Daigo Artificial Seawater SP) stirred at 200 rpm. Using a potentiogalvanostat, the anode-cathode potential and the current flowing between the electrodes were measured under each electrical resistance condition.

[0048] The results are shown in Figure 6. In two-electrode systems using each corroding metal as the anode, we observed changes in the cathodic polarization state depending on the interelectrode electrical resistance. Each metal had a different anode potential, reflecting its corrosion potential. However, the potential of each corroding metal anode varied little with the magnitude of the interelectrode electrical resistance. On the other hand, in all systems, the cathodic potential tended to decrease with increasing interelectrode current due to a decrease in interelectrode electrical resistance. The cathodic potential at a given current value was nearly identical between two-electrode systems using different anode metals. These results indicate that in various combinations of corroding metal anodes and carbon cloth cathodes, the electron injection reaction initiated by the corrosion of each metal did not rate-limit the overall reaction in the two-electrode system; instead, the magnitude of the electrical resistance dominated the cathodic polarization state. This suggests that any cathodic polarization state can be created using these various corroding metals as the anode. They also showed that if a metal with a low corrosion potential and high corrosion activity that can generate a large current, such as magnesium, is used as the anode, it is possible to create a cathodic polarization state with a lower potential and a larger current. However, considering that the anode is depleted as the corrosion reaction progresses, this high corrosion activity means a high anode depletion rate, so it is thought that long-term cathodic polarization operation will require a larger anode that can withstand depletion compared to metals with lower corrosion activity.

[0049] [Example 1-6: Analysis of the relationship between electrolyte electrical conductivity and polarization characteristics, and demonstration of improved polarization performance of a cathode in contact with a low-conductivity electrolyte by providing an anode electrolytic cell with a high-conductivity electrolyte connected to a liquid junction via an ion exchange membrane] Using electrolytes prepared with different salt concentrations, the effective area was set to 4cm 2 The carbon cloth specified in is used as the cathode, and the effective area is 8 cm 2A polarization experiment was conducted in a two-electrode system using a zinc plate as the anode, measuring the anode-cathode potential and the current flowing between the two electrodes at each resistance while changing the resistance between the two electrodes, and a polarization curve was created. A 3.5% NaCl aqueous solution, with a salinity similar to seawater, was prepared as the electrolyte, and this was diluted with pure water to prepare 50%, 10%, 1%, and 0.1% solutions, respectively.

[0050] 300 mL of each electrolyte solution with the above salinity was stirred at 200 rpm, and the anode, cathode, and reference electrode were immersed in it. Using a potentiogalvanostat, the anode-cathode potential and the current flowing between the electrodes were measured under each of the interelectrode electrical resistance conditions.

[0051] The results are shown in Figure 7. It was confirmed that when the electrical conductivity of the electrolyte is low (salt concentration of 1% or lower than that of seawater), the anodic potential increases when two electrodes are connected with a small electrical resistance, and the current between the electrodes is smaller than in high-salinity solutions. This indicates that in low-conductivity solutions, the zinc corrosion activity at the anode, which creates a spontaneous flow of electrons in the two-electrode system, decreases, limiting the anodic reaction and, consequently, the strength of cathodic polarization.

[0052] From the above results, it was found that the cathode polarization performance is limited by the weakening of anode activity in low-conductivity solutions. To overcome this problem, assuming use in low-conductivity solutions such as freshwater, the following experiment was conducted to demonstrate that the polarization performance of the cathode in contact with low-conductivity electrolyte is improved by providing an anode electrolysis cell with high-conductivity electrolyte connected to the liquid junction via an ion-exchange membrane.

[0053] Effective area: 4cm 2 The carbon cloth cathode specified in and the effective area is 8cm 2A two-electrode system under high current conditions was created, connecting a zinc plate anode specified in [1] with an interelectrode resistance of 10 Ω, and placed in each chamber of a two-compartment electrochemical cell (VB8, EC Frontier) with a liquid junction via an anion exchange membrane (AMVN-Selemion, AGC Engineering). 50 ml of simulated seawater electrolyte (3.5% NaCl aqueous solution) and simulated freshwater electrolyte (NaCl aqueous solution diluted with pure water to a salt concentration of 0.1% of the simulated seawater electrolyte) were placed in each of the anode and cathode chambers, and cathodic polarization operation was performed at room temperature for approximately one month, during which the electrode potential, solution pH, and solution electrical conductivity were measured periodically. Three systems were created: one with simulated freshwater in both the anode and cathode tanks (FW_Ano FW_Cat), one with simulated seawater in both tanks (SW_Ano SW_Cat), and one with simulated seawater in the anode tank and simulated freshwater in the cathode tank (SW_Ano FW_Cat), and each was operated under high current conditions.

[0054] The results are shown in Figure 8. It was confirmed that by maintaining the electrical conductivity of the anodic electrolyte in contact with the zinc corrosion anode at a level comparable to that of seawater, high anodic activity can be maintained, resulting in a strong cathodic polarization state (low cathodic potential). It was also confirmed that as the two-electrode reaction progresses, ions move at the liquid junction of the anion exchange membrane, resulting in a change in the electrical conductivity of the solution.

[0055] <Example 2: Experiment demonstrating cathodic polarization performance in an actual marine environment> A test device with five pairs of two-electrode systems was installed on the seabed at a depth of approximately 6-7 m directly below the quay of the Misaki Marine Biological Laboratory of the University of Tokyo in Miura City, Kanagawa Prefecture, and a cathodic polarization operation experiment was conducted for 14 days in a real marine environment. 2 Zinc round bar (ZAP M-20, Mitsui Kinzoku Shoji) with an effective area of ​​9.6 cm 2Four sets of galvanic corrosion cathodic polarization two-electrode systems were set up, each with a fixed resistor placed between the two electrodes, so that the electrical resistance between the two electrodes was 12Ω, 750Ω, 2kΩ (actual measurement: 1.98kΩ), and 5kΩ (actual measurement: 5.07kΩ). In addition, one set of zinc electrode and carbon felt electrode in an open circuit state was set up as a control in which no cathodic polarization occurred. A silver-silver chloride reference electrode (0.6 M NaCl) was fabricated and installed in accordance with the test equipment. Each electrode of the test equipment, installed on the seabed, was connected to a 10 m electric cable (VCTF cable, Fuji Electric Wire Co., Ltd.) with its wiring covered with epoxy resin and waterproofed. This cable was then routed into a waterproof and dustproof container installed on the quay, and connected to a fixed resistor and voltage / current logger placed between the two electrodes. During cathodic polarization experiments using the test equipment equipped with this current / potential monitor unit, the potential difference between the reference electrode and the carbon felt cathode, and the potential difference between the zinc anode and the carbon felt cathode, were recorded every minute using a voltage logger (LR5041 or LR5042, Hioki E.E.), respectively. In the system with the lowest interelectrode resistance, a fixed resistor was not placed between the two electrodes, but instead a current logger (LR5031, Hioki E.E.) with an internal resistance of 10 Ω was placed in series, and the current flowing between the two electrodes was recorded every minute. In the systems where no current logger was installed (three systems in which the interelectrode resistance was set to 750 Ω, 2 kΩ, and 5 kΩ), the cathode current at the time of potential difference recording every minute was calculated using Ohm's law from the recorded anode-cathode potential difference and interelectrode resistance value. The electrical resistance between the two electrodes, including the 20-meter electrical cable connecting the two electrodes of the seabed test machine via the current and potential monitor unit on the quay and the wiring connections inside the monitor unit, was 2 Ω or less in all two-electrode systems. The electrical resistance resulting from this electrical cable and wiring connections was very small compared to the electrical resistance of the installed resistors in systems where the inter-electrode resistance was 750 Ω, 2 kΩ, and 5 kΩ, so it was ignored. On the other hand, in systems where the inter-electrode resistance was minimized by installing a current logger, it was recognized as contributing to the inter-electrode resistance, and the inter-electrode resistance of that system was treated as 12 Ω (the sum of the 10 Ω current logger resistance and the 2 Ω cable wiring connection resistance). The results are shown in Figure 9.

[0056] Example 3: Electron microscope observation of electrode-microbial adhesion complex formed through cathodic polarization operation in a real marine environment After the subsea cathodic polarization experiment (14 days), each carbon felt electrode sample was fixed in a 2.5% glutaraldehyde solution, stained with osmium, and observed under a scanning electron microscope using a field emission scanning electron microscope (Quanta 450 FEG, Thermo Fisher). The same samples were also subjected to a focused ion beam cutting process using a field emission scanning electron microscope (Helios G4 UX, Thermo Fisher) to remove the felt electrode fibers and the deposits covering them, and the cut cross sections of the deposits and electrode fibers were observed under a scanning electron microscope. The results are shown in Figures 10 and 11. Figure 10-a shows the appearance of the carbon felt cathode at the end of the cathodic polarization performance demonstration experiment in a real marine environment. Figure 10-b shows SEM images of the carbon felt cathode electrode and the open-circuit control carbon felt, respectively. The amount of deposits on the surface of the felt carbon fiber increased with increasing current and cathodic polarization intensity, and this deposit accumulation was thought to be due to the cathodic reaction. Figures 11-a and 11-b show the appearance of the microbial community observed on the surface of the carbon felt cathode. A population of bacillus cells was observed, forming a biofilm by connecting cells to the carbon fiber or to each other with pilus-like structures. Figure 11-c shows an SEM image of the deposits and the cut cross section of the electrode fiber. The deposits covering the electrode fiber surface were found to be a mixture of the bacillus biofilm formed on the fiber surface and diatom remains, which are thought to have washed ashore and attached to the surface. Figure 11-d is an enlarged image of Figure 11-c (the area enclosed by the square in Figure 11-c), where multiple bacillus cell-like objects (indicated by the arrows in the figure) were confirmed near the surface of the electrode fiber.

[0057] Example 4: Analysis of the microbial flora of the electrode-microbial adhesion complex formed through cathodic polarization operation in a real marine environment To search for electrosynthetic microorganisms in the environment, we performed cathodic polarization operation (14 days) in the above-mentioned real marine environment on a carbon felt cathode and the layer of adhesion formed on its surface, and performed microbial community analysis using amplicon sequencing of the 16S rRNA gene targeting prokaryotes. DNA was extracted from approximately 0.1 g of the frozen carbon felt cathode described above using the DNeasy PowerSoil Kit (Qiagen) according to the kit's protocol. For comparison, DNA was similarly extracted from approximately 0.1 g of frozen samples of deposits on the plastic surface (hard polyvinyl chloride) of the electrode installed on the seafloor in the experiment, as well as from frozen 0.2 μm PES filters (Millipore) (containing 500 mL of seawater filtered and frozen). DNA was quantified using the Qubit 1X dsDNA High Sensitivity Assay Kit (Thermo Fisher). 1–2 ng of each extracted DNA was used as template DNA for amplicon sequencing targeting the V4–V5 region of the prokaryotic 16S rRNA gene, as previously reported (Hirai et al. 2017. Microbe Environ. 32:336–343). Specifically, we used a primer cocktail (U530 / U907) containing multiple forward and reverse primer pairs to amplify the V4-V5 regions of bacterial and archaeal 16S rRNA genes. The primers consisted of multiple 5'-end primers (U530 primer) and 3'-end primers (U907 primer) covering the V4-V5 regions of bacteria and archaea. The forward and reverse primers were oligonucleotides with an Illumina adapter sequence (ACACTCTTTCCCTACACGACGCTCTTCCGATCT: SEQ ID NO: 8) and an Illumina Multiplex PCR Primer 2.0 sequence (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT: SEQ ID NO: 9) attached to their 5' ends. DNA amplification was confirmed by agarose gel electrophoresis, and the remaining oligonucleotides were digested with Exonuclease I and Shrimp Alkaline Phosphatase (Affymetrix). The PCR reaction product was diluted 100-fold and used as template DNA for PCR to add sequencing indexes and adapter sequences (Illumina).The PCR-reacted DNA was confirmed by agarose gel electrophoresis, purified with magnetic beads (AMPure XP, Beckman Coulter, Inc.), and then inserted into Qubit. TM The samples were quantified using a 1X dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific) and pooled at equimolar concentrations. Paired-end sequencing was performed on a MiSeq sequencer (Illumina Corporation) using a 600-cycle Miseq Reagent Kit (Illumina Corporation) together with an internal standard (PhiX Control v3, Illumina Corporation).

[0058] The resulting sequence reads were then trimmed to remove sequence adapter sequences and low-quality reads using Trimmomatic v0.33 (Bolger, AM, M. Lohse, and B. Usadel. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114-2120), and PCR primer sequences were removed using Cutadapt v1.10 (Martin, M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 17:10). The resulting reads were joined using QIIME v1.5.0 pipelines (Caporaso, JG, J. Kuczynski, J. Stombaugh, et al. 2010. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7:335-336). Chimeric sequences were identified and excluded. ASVs (Amplicon sequence variants) were generated by clustering using UNOISE3 at 99% sequence identity. Furthermore, QIIME v1.5.0 pipelines were used to generate OTUs (Operational Taxonomic Units) at 97% sequence identity. Representative sequences from each OTU were compared with the SILVA ribosomal RNA database for phylogenetic inference.

[0059] In addition, a BLAST search was performed against the 16S rRNA gene database provided by NCBI using the representative sequences (Gam1 to Gam, Table 3) of OTUs estimated to belong to Gammaproteobacteria, which were estimated to be dominant on the cathode-polarized electrode in a supply-dependent manner from the electrode, as the query sequence.A phylogenetic tree was created using the maximum likelihood method using molecular phylogenetic analysis software (MEGA5.2) in combination with closely related sequences derived from environmental metagenomes and cultured strain genomes registered in the database, and a phylogenetic analysis was performed.

[0060] [Table 2]

[0061] [Table 3]

[0062] The results are shown in Figure 12. As described above, 16S rRNA gene amplicon sequencing was performed. The dominant phylogenetic lineages were defined as those with abundances of 5% or greater in each sample. The abundances of the dominant phylogenetic lineages in each sample were compared. While the microbial communities formed on the PVC electrode fixture and the open-circuit control carbon felt were composed of diverse minority populations (<5%), specific phylogenetic groups dominated on the carbon felt cathode, which maintained cathodic polarization. These cathodic microbial communities were dominated by several Gammaproteobacteria lineages, distinct from the ubiquitous seawater lineages, such as SAR11 and Rhodobacteraceae, that dominated the in situ seawater at this experimental site. In particular, the abundance of Gam1, a putative uncultured Gammaproteobacterial lineage, increased with decreasing interelectrode resistance, i.e., increasing cathodic polarization strength. This cathodic polarization-dependent dominance suggests that the Gam1 population is an electrotrophic microorganism that relies on electron supply from the electrode for growth. Furthermore, the Gam3 population, which dominated at the cathode with an inter-electrode resistance of 750 Ω, was estimated to belong to the genus Thiomicrorhabdus and is presumed to be closely related to Candidatus Thiomicrorhabdus electrophagus, which has been reported as an electrosynthetic microorganism (see reference below). This suggests that the Gam3 population is also an electrosynthetic microorganism. Publication information on Candidatus Thiomicrorhabdus electrophagus: Masahiro Yamamoto, Yoshihiro Takaki, Hiroyuki Kashima, Miwako Tsuda, Akiko Tanizaki, Ryuhei Nakamura, Ken Takai, In situ electrosynthetic bacterial growth using electricity generated by a deep-sea hydrothermal vent, The ISME Journal, Volume 17, Issue 1, January 2023, Pages 12-20, https: / / doi.org / 10.1038 / s41396-022-01316-6 As described above, we were able to confirm the clear cathode polarization-dependent accumulation of multiple phylogenetic populations presumed to be electrosynthetic microorganisms, demonstrating that this device is useful for exploring electrosynthetic microorganisms in the environment.

[0063] Example 5: Analysis of the constituent phases of cathode precipitates by powder XRD Effective area: 4cm 2 Carbon cloth (Tsukuba Materials Information Laboratory) was used as the cathode, with an effective area of ​​15.7 cm 2Three sets of galvanic corrosion cathodic polarization electrode systems, each consisting of a zinc rod (ZAP M-20, Mitsui Kinzoku Shoji) as the anode and fixed resistors arranged to provide interelectrode resistances of 2 Ω, 750 Ω, and 5 kΩ, and an open-circuit control carbon cloth, were immersed in 6 L of sterile artificial seawater (Daigo Artificial Seawater SP) in an 8 L sealed plastic container (a 2 L headspace was filled with non-sterile air). Cathodic polarization was performed at 4°C in the dark. After 6 months of cathodic polarization, carbon cloth cathodes and open-circuit control carbon cloth pieces with white precipitates on their surfaces were collected and air-dried. The white precipitate was scraped off the carbon cloth surface with a spatula and crushed in an agate pestle and mortar to prepare pulverized precipitate samples. Powder X-ray diffraction data for these precipitate samples were obtained using an X-ray diffractometer (MiniFlex II, Rigaku). The obtained diffraction data was analyzed using the analysis software (PDXLII, Rigaku) ​​attached to the X-ray diffractometer. The results are shown in Figure 13. FIG. 13 shows that carbonate minerals (presumably containing aragonite as a constituent phase) are formed in a cathodic polarization-dependent manner on the cathodic polarized carbon cloth electrode after long-term operation in artificial seawater.

Claims

1. An apparatus for a cathodic reaction, comprising: an anode and a cathode; the anode and the cathode are electrically connected to each other via an electrical resistor and without an external power source; In the cathodic reaction, the anode corrodes to supply electrons to the cathode.

2. the anode is selected from the group consisting of iron, zinc, aluminum, magnesium, and alloys of any of these metals; 10. The device of claim 1, wherein the cathode is selected from the group consisting of carbon materials, conductive polymers, metals, alloys, metal oxides, and metal sulfides.

3. 3. The apparatus of claim 2, wherein the cathode is selected from the group consisting of carbon paper, carbon felt, and carbon cloth.

4. 10. The apparatus of claim 1, further comprising an anode chamber containing the anode, the anode chamber having a liquid junction between its interior and exterior.

5. 5. The device of claim 4, wherein the liquid junction is an ion exchange membrane.

6. 10. The apparatus of claim 1, It may further include a reference electrode, An apparatus including at least one of a voltmeter for measuring the potential difference between the electrodes and an ammeter for measuring the current between the electrodes.

7. The device according to any one of claims 1 to 6, wherein the electrical resistor is a variable resistor.

8. 7. An apparatus according to any one of claims 1 to 6 for the treatment of seawater, comprising: The device wherein the effective area of ​​the anode is equal to or greater than the effective area of ​​the cathode.

9. Using the device according to any one of claims 1 to 6, A method in which the anode and the cathode are immersed in the sea, river, or lake, and the cathode reaction is carried out using water from the sea, river, or lake as a cathode electrolyte.

10. The method of claim 9 , wherein the cathodic reaction occurs in deep water.

11. A method for culturing or screening microorganisms using the device according to any one of claims 1 to 6, comprising: The method comprises immersing the anode in an electrolyte solution and the cathode in water inhabited by microorganisms.

12. A method for recovering heavy metal ions from water to be treated in which microorganisms containing heavy metal ions and capable of metabolizing heavy metals live, comprising: Using the device according to any one of claims 1 to 6, Immersing the anode in an electrolytic solution and the cathode in the water to be treated; forming a precipitate in which the microorganisms are enriched by the cathodic reaction and concentrating the heavy metal ions in the precipitate.

13. A method for manufacturing a system comprising: A device array, wherein the electrical resistors in the plurality of devices have different resistance values.

14. 14. The device array of claim 13 for use in microbial culture or microbial screening.

Citation Information

Patent Citations

  • Manufacture of preform of one body powder alloy part from more than two kinds of powder alloy

    JP1983042703A

  • Method of recovering heavy metal ion, structure for recovering heavy metal ion, and method of accumulating microorganism

    JP2023130005A