Protein binders to irhom2 epitopes

Protein binders targeting iRhom2 provide a novel method to inhibit ADAM17, addressing the lack of effective clinical inhibitors and offering a therapeutic solution for inflammatory diseases by blocking cytokine release.

JP2025179064APending Publication Date: 2025-12-09スキロム ゲゼルシャフト ミット ベシュレンクテル ハフツング +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025131956
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-09-30
Filing Date
2025-08-07
Publication Date
2025-12-09

AI Technical Summary

Technical Problem

Current inhibitors for ADAM17, a critical mediator of resistance to radiotherapy and involved in the release of pathogenic factors, have not proven clinically successful.

Method used

Development of protein binders that specifically target and inhibit human iRhom2, thereby reducing ADAM17 activity.

Benefits of technology

The protein binders effectively inhibit ADAM17 activity, providing a potential therapeutic approach for inflammatory diseases by blocking the release of cytokines such as TNF-α and other factors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025179064000012
    Figure 2025179064000012
  • Figure 2025179064000013
    Figure 2025179064000013
  • Figure 2025179064000014
    Figure 2025179064000014
Patent Text Reader

Abstract

To provide a protein binder that inhibits and / or reduces TACE / ADAM17 activity when bound to human iRhom2.SOLUTION: Provided is a protein binder which, when bound to human iRhom2, binds at least within a region of Loop 1 thereof.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present application relates to protein binders to iRhom2. [Background technology]

[0002] ADAM metallopeptidase domain 17 (ADAM17) (NCBI reference for human ADAM17: NP_003174), also known as TACE (tumor necrosis factor-α-converting enzyme), is an enzyme that belongs to the ADAM protein family of disintegrin and metalloproteases. It is a polypeptide of 824 amino acids.

[0003] ADAM17 is understood to be involved in the processing of tumor necrosis factor alpha (TNF-α) from the cell surface and from within intracellular membranes in the trans-Golgi network. This process, also known as "shedding," involves the cleavage and release of soluble ectodomains from membrane-bound proproteins (e.g., pro-TNF-α) and is known to be physiologically important. ADAM17 was the first "sheddase" to be identified and has also been shown to be involved in the release of various membrane-bound cytokines, cell adhesion molecules, receptors, ligands, and enzymes.

[0004] Cloning of the TNF-α gene revealed that it encodes a 26-kDa type II transmembrane propolypeptide. This propolypeptide is inserted into the plasma membrane as it translocates through the endoplasmic reticulum. At the cell surface, pro-TNF-α is biologically active and can induce immune responses through juxta-crine cell-cell signaling. However, pro-TNF-α can undergo proteolytic cleavage at its Ala76-Val77 amide bond, which releases a soluble 17-kDa extracellular domain (ectodomain) from the pro-TNF-α molecule. This soluble ectodomain is crucial for the paracrine signaling of the cytokine commonly known as TNF-α. This proteolytic release of soluble TNF-α is catalyzed by ADAM17.

[0005] ADAM17 also regulates the MAP kinase signaling pathway by regulating the cleavage of the EGFR ligand amphiregulin in the mammary gland. ADAM17 is important for activating several ligands for EGFR, including TGFα, AREG, EREG, HB-EGF, and Epigen. Furthermore, ADAM17 is involved in shedding of the cell adhesion molecule L-selectin.

[0006] Recently, ADAM17 has been identified as a critical mediator of resistance to radiotherapy, and radiotherapy-induced ADAM17 activation has been shown to result in the shedding of multiple survival factors, activation of growth factor pathways, and resistance to radiotherapy.

[0007] ADAM17 is thought to be crucial for the release of various pathogenic and non-pathogenic factors, including TNFα, and has therefore become a promising therapeutic target, leading to numerous attempts to develop inhibitors of ADAM17.

[0008] However, to date, no such inhibitors have proven clinically successful.

[0009] It is therefore an object of the present invention to provide new methods that allow for the control, modulation, reduction or inhibition of ADAM17 activity.

[0010] It is another object of the present invention to provide new approaches that allow the treatment of inflammatory diseases.

[0011] These and other objects are solved by the features of the independent claims. The dependent claims disclose embodiments of the invention that may be preferred, under particular circumstances. Similarly, further embodiments of the invention that may be preferred, under particular circumstances, are disclosed herein. Summary of the Invention

[0012] The present invention provides, inter alia, protein binders that bind to human iRhom2, and that upon binding to human iRhom2 inhibit and / or reduce TACE / ADAM17 activity. [Brief explanation of the drawings]

[0013] [Figure 1] Figure 1 shows an outline of the target sequences encoded by the expression vectors used for DNA immunization of iRhom2 knockout mice.

[0014] [Figure 2] Figure 2 shows the results of a TNFα release assay (shedding assay) for functional screening of hybridoma supernatants, demonstrating that the supernatant of hybridoma cell pool 14C2 (the primary material leading to antibody 3 of the present invention), as a representative example of selected candidates, effectively interferes with LPS-induced TNFα shedding in THP-1 cells.

[0015] [Figure 3]Figure 3 shows the results of fluorescence-activated cell sorting (FACS) analysis of genetically engineered mouse L929 cell populations. Two variants of human iRhom2—a T7-tagged deletion mutant lacking amino acids 1–242 (Δ242) and a T7-tagged full-length wild-type (WT) form—ectopically expressed in L929-2041-hiR2-Δ242-T7 cells and L929-2041-hiR2-FL-WT-T7 cells, respectively, are shown to localize to the cell surface. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0016] [Figure 4] Figure 4 shows the results of FACS analysis for target recognition-based screening of hybridoma supernatants, demonstrating that the supernatant of hybridoma cell pool 14C2 (primary material leading to antibody 3 of the present invention), as a representative example of selected candidates, clearly recognizes both the human iRhom2 variants ectopically expressed in L929-2041-hiR2-Δ242-T7 cells and L929-2041-hiR2-FL-WT-T7 cells. Staining: gray = secondary antibody only, black = 14C2 supernatant.

[0017] [Figure 5] FIG. 5 shows the results of ELISA analysis for antibody isotype determination, demonstrating that purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 52, 54, 56, and 57 of the present invention are of the mouse IgG isotype.

[0018] [Figure 6] Figure 6 shows the results of FACS Scatchard analysis for antibody affinity determination, demonstrating that the K values ​​for binding to THP-1 cells of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 are in the subnanomolar to low nanomolar range.

[0019] [Figure 7a]Figure 7a shows the results of FACS analysis on genetically engineered mouse embryonic fibroblast (MEF) populations, demonstrating that T7-tagged variants of human and mouse iRhom2 full-length wild-type ectopically expressed by MEF-DKO-hiR2-FL-WT-T7 (SEQ ID NO: 190) and MEF-DKO-miR2-FL-WT-T7 (SEQ ID NO: 193) cells, respectively, are localized on the surface of these cells. Staining: gray = secondary antibody only, black = anti-T7 antibody.

[0020] [Figure 7b] Figure 7b shows the results of FACS analysis to determine mouse cross-reactivity of the antibodies of the present invention, demonstrating that purified antibody 3 (except antibody 52), as a representative example of the antibodies of the present invention, clearly recognizes the human iRhom2 variant ectopically expressed by MEF-DKO-hiR2-FL-WT-T7 cells, but does not cross-react with the mouse iRhom2 variant ectopically expressed by MEF-DKO-miR2-FL-WT-T7 cells, and therefore does not cross-react with mouse iRhom2. Staining: gray = secondary antibody only, black = antibody 3.

[0021] [Figure 8a] Figure 8a shows the results of FACS analysis of the engineered MEF population, demonstrating that a T7-tagged version of the full-length wild-type human iRhom1 ectopically expressed in MEF-DKO-hiR1-FL-WT-T7 cells also localizes to the cell surface. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0022] [Figure 8b] Figure 8b shows the results of FACS analysis to determine the specificity of the antibodies of the present invention. Purified antibody 3, as a representative example of the antibodies of the present invention, does not recognize the closely related human iRhom1 ectopically expressed in MEF-DKO-hiR1-FL-WT-T7 cells, in contrast to the human iRhom2 variant ectopically expressed in MEF-DKO-hiR2-FL-WT-T7 cells, and therefore exhibits specificity for human iRhom2. Staining: gray = secondary antibody only, black = antibody 3.

[0023] [Figure 9a] Figure 9a shows the results of a TNFα release assay, demonstrating that purified antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the invention block LPS-induced shedding of TNFα in THP-1 cells, whereas purified antibodies 48 and 50 have no inhibitory effect on TNFα release. The data demonstrate the effect of test articles on the absolute amount of TNFα released. The antibodies analyzed were purified from hybridoma supernatants.

[0024] [Figure 9b] FIG. 9b is a graph showing the effect of test articles on TNFα release as percent inhibition, with reference to the results shown in FIG. 9a.

[0025] [Figure 10a] Figure 10a shows the results of FACS analysis of one MEF population containing a single amino acid substitution or deletion related to mouse iRhom2, which was genetically engineered for epitope definition. The data demonstrate that T7-tagged variants of full-length wild-type human and mouse iRhom2 expressed ectopically in MEF-DKO-hiR2-FL-WT-T7 and MEF-DKO-miR2-FL-WT-T7 cells, as well as the T7-tagged human iRhom2 variant hiR2-FL-P533- (P533 deletion) expressed ectopically in MEF-DKO-hiR2-FL-T7 cells, are localized to the surface of these cells. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0026] [Figure 10b] Figure 10b shows the results of a TGFα release assay (shedding assay), demonstrating that all 25 human iRhom2 variants with single amino acid substitutions related to mouse iRhom2, including the single amino acid deletion hiR2-FL-P533-, were functionally active and could support PMA-stimulated shedding of TGFα to varying degrees, indicating that these variants are likely to be the most properly folded.

[0027] [Figure 11a] Figure 11a shows the results of FACS analysis for determining the epitope of an antibody of the present invention. For example, the analysis data for a full panel of 25 human iRhom2 variants with single amino acid substitutions or deletions relative to mouse iRhom2 are shown for MEF-DKO-hiR2-FL-P533-T7 cells ectopically expressing the human iRhom2 variant hiR2-FL-P533. The data demonstrate that deletion of the single amino acid proline 533 in human iRhom2 strongly impairs and thus contributes to the binding of purified Antibody 3, a representative example of an antibody of the present invention that has an inhibitory effect on TNFα release. In contrast, this deletion does not affect and therefore does not contribute to the binding of purified Antibody 50, a representative example of an antibody of the present invention that does not have an inhibitory effect on TNFα release. Staining: gray = secondary antibody only; black = Antibody 3 / Antibody 50.

[0028] [Figure 11b] Figure 11b summarizes the results of FACS analysis of purified antibodies of the present invention against a panel of 25 genetically engineered MEF populations ectopically expressing human iRhom2 variants with mouse iRhom2-related single amino acid substitutions (including the deletion variant hiR2-FL-P533-). This data revealed that the patterns of amino acid positions associated with iRhom2 binding for antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention (excluding antibody 16), which have inhibitory effects on TNFα release, are distinct from the patterns of amino acid positions contributing to binding for antibodies 48 and 50, which do not have inhibitory effects on TNFα release.

[0029] [Figure 12a]Figure 12a depicts the results of FACS analysis of one MEF population carrying a human iRhom1-related single amino acid substitution or deletion within the central region of the large extracellular loop (AA498 to AA562 of human iRhom2), engineered for epitope definition. The data demonstrate that T7-tagged variants of human iRhom2 and iRhom1 full-length wild-type expressed in MEF-DKO-hiR2-FL-WT-T7 and MEF-DKO-hiR1-FL-WT-T7 cells, as well as the T7-tagged human iRhom2 variant hiR2-FL-L539A expressed in MEF-DKO-hiR2-FL-L539A-T7 cells, are localized to the surface of these cells. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0030] [Figure 12b] Figure 12b shows the results of a TGFα release assay (shedding assay). It was shown that all 30 human iRhom2 variants with human iRhom1-related single amino acid substitutions or deletions within the central region of the large extracellular loop (AA498 to AA562 of human iRhom2), such as hiR2-FL-M534-, hiR2-FL-D535-, and hiR2-FL-K536-, were functionally active and could support PMA-stimulated TGFα shedding to various degrees, indicating that these variants are likely properly folded.

[0031] [Figure 13a]Figure 13a shows the results of FACS analysis for determining the epitope of an antibody of the present invention. For example, analysis data for MEF-DKO-hiR2-FL-L539A-T7 cells ectopically expressing the human iRhom2 variant hiR2-FL-L539A are shown for a full panel of 30 human iRhom2 variants with a single human iRhom1-related amino acid substitution or deletion within the central region of the large extracellular loop (AA498 to AA562 of human iRhom2). These data demonstrate that substituting the single amino acid leucine 539 of human iRhom2 with alanine at the corresponding position in human iRhom1 strongly impairs the binding of purified antibody 3, a representative example of an antibody of the present invention that has an inhibitory effect on TNFα release, and thus contributes to binding. On the other hand, this substitution does not affect the binding of purified antibody 50, a representative example of an antibody of the present invention that does not have an inhibitory effect on TNFα release, and therefore does not contribute to binding. Staining: gray = secondary antibody only; black = antibody 3 / antibody 50.

[0032] [Figure 13b] Figure 13b summarizes the results of FACS analysis of all purified antibodies of the present invention against a panel of 30 genetically engineered MEF populations ectopically expressing human iRhom2 variants with human iRhom1-related single amino acid substitutions within the central region of the large extracellular loop (AA498-AA562 of human iRhom2), including the deletion variants hiR2-FL-M534-, hiR2-FL-D535-, and hiR2-FL-K536-. The data again reveal a pattern of amino acid positions associated with iRhom2 binding for antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have an inhibitory effect on TNFα release, that differs from the pattern of amino acid positions contributing to binding for antibodies 48 and 50 of the present invention, which do not have an inhibitory effect on TNFα release.

[0033] [Figure 14a]Figure 14a shows the results of a TNFα release assay, demonstrating that antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 49, 54, 56, and 57 of the invention interfere with LPS-induced shedding of TNFα in THP-1 cells, while antibodies 47, 48, 50, 51, and 52 have no inhibitory effect on TNFα release. The data show the effect of the test article on the absolute amount of TNFα released. The antibodies analyzed were transiently expressed in Expi293F cells, each of 18 heavy chain / kappa light chain pairs.

[0034] [Figure 14b] FIG. 14b is a graph showing the effect of test articles on TNFα release as percent inhibition, with reference to the results shown in FIG. 14a.

[0035] [Figure 15] Figures 15a and 15b are schematic diagrams of iRhom2, showing the location of the juxtamembrane domain (JMD) adjacent to transmembrane domain 1 (TMD1) (A), loop 1 (B), and the C-terminus (C). The table in Figure 15b shows the amino acid positions set forth in SEQ ID NO:181.

[0036] [Figure 16] FIG. 16 shows the amino acid sequence of human iRhom2 according to SEQ ID NO: 181, with the preferred binding regions marked.

[0037] [Figure 17a] FIG. 17a shows the alignment of human iRhom2 (>NP_078875.4 human iRhom2 isoform 1) according to SEQ ID NO: 181 and human iRhom1 (>NP_071895.3 human iRhom1) according to SEQ ID NO: 182.

[0038] [Figure 17b]FIG. 17b shows the alignment of human iRhom2 according to SEQ ID NO: 181 (>NP_078875.4 human iRhom2 isoform 1) and mouse iRhom2 according to SEQ ID NO: 183 (>NP_766160 mouse iRhom2).

[0039] [Figure 18a] Figure 18a shows the results of FACS analysis to determine the cross-reactivity of antibodies of the invention with rhesus monkeys, showing that both the murine (upper panel) and chimeric (lower panel) versions of antibody 16, as representative of antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 54, 56, and 57 of the invention, clearly recognize the rhesus iRhom2 variant (UniProt Identifier: F6Y4X6) ectopically expressed in MEF-DKO-Rhesus-iR2-FL-WT-T7 cells, but do not recognize the rhesus iRhom1 variant (UniProt Identifier: F6ZPC8) ectopically expressed in MEF-DKO-Rhesus-iR2-FL-WT-T7 cells, cross-reacting with rhesus iRhom2 but not binding to rhesus iRhom1. The antibodies analyzed were obtained by transiently expressing the respective heavy chain / kappa light chain pairs in Expi293F (mouse version) or CHO (chimeric version). Staining: gray = secondary antibody only, black = antibody 16

[0040] [Figure 18b]FIG. 18b shows the results of FACS analysis to determine the cross-reactivity of antibodies of the invention with cynomolgus monkeys. Both the murine (upper panel) and chimeric (lower panel) versions of antibody 16, as a representative example of antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 54, 56, and 57 of the invention, clearly recognize the cynomolgus monkey iRhom2 variant (UniProt Identifier: A0A2K5TX07) ectopically expressed in MEF-DKO-Cyno-iR2-FL-WT-T7 cells, but not the cynomolgus monkey iRhom1 variant (UniProt Identifier: A0A2K5TX07) ectopically expressed in MEF-DKO-Cyno-iR1-FL-WT-T7 cells. The results show that the antibody does not recognize the cynomolgus monkey iRhom2 (Identifier: A0A2K5TUM2) and cross-reacts with cynomolgus monkey iRhom2, but does not bind to cynomolgus monkey iRhom1. The antibodies analyzed were obtained by transiently expressing the respective heavy chain / kappa light chain pairs in Expi293F (mouse version) or CHO (chimeric version). Staining: gray = secondary antibody only, black = antibody 16

[0041] [Figure 18c] Figure 18c shows the results of FACS analysis to determine the cross-reactivity of antibodies of the invention with canine, demonstrating that both the murine (upper panel) and chimeric (lower panel) versions of antibody 16, as representative of antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 54, 56, and 57 of the invention, clearly recognize the canine iRhom2 variant (UniProt Identifier Q00M95) ectopically expressed in MEF-DKO-Dog-iR2-FL-WT-T7 cells, but do not recognize the canine iRhom1 variant (UniProt Identifier: A0A5F4CNN3) ectopically expressed in MEF-DKO-Dog-iR1-FL-WT-T7 cells, cross-reacting with canine iRhom2 but not binding to canine iRhom1. The antibodies analyzed were obtained by transiently expressing the respective heavy chain / kappa light chain pairs in Expi293F (mouse version) or CHO (chimeric version). Staining: gray = secondary antibody only, black = antibody 16

[0042] [Figure 18d] Figure 18d shows the results of FACS analysis to determine the cross-reactivity of antibodies of the present invention with rabbits, showing that both the mouse (upper panel) and chimeric (lower panel) versions of antibody 16, which is a representative example of antibodies 3, 5, 16, 22, 34, 42, 43, 44, 49, 51, 54, and 56 of the present invention, clearly recognize the rabbit iRhom2 variant (UniProt Identifier G1T7M2) ectopically expressed in MEF-DKO-Rabbit-iR2-FL-WT-T7 cells, but do not recognize the rabbit iRhom1 variant (UniProt Identifier: B8K128) ectopically expressed in MEF-DKO-Rabbit-iR1-FL-WT-T7 cells, cross-reacting with rabbit iRhom2 but not binding to rabbit iRhom1. The antibodies analyzed were derived from either Expi293F (mouse version) or CHO (chimeric version) transiently expressed heavy chain / kappa light chain pairs. Staining: gray = secondary antibody only, black = antibody 16.

[0043] [Figure 19a] Figure 19a shows the results of FACS analysis on genetically engineered mouse embryonic fibroblast (MEF) populations, demonstrating that FLAG-tagged variants of human and mouse iRhom2 full-length wild-type ectopically expressed by MEF-DKO-hiR2-FL-WT-FLAG (SEQ ID NO: 198) and MEF-DKO-miR2-FL-WT-FLAG (SEQ ID NO: 199) cells, respectively, are localized on the surface of these cells. Staining: grey = secondary antibody only, black = anti-FLAG antibody.

[0044] [Figure 19b]Figure 19b shows the results of FACS analysis to determine mouse cross-reactivity of the antibodies of the present invention. The results demonstrate that mouse antibody 3, a representative example of the antibodies of the present invention excluding antibody 52, clearly recognizes human iRhom2 variants ectopically expressed in MEF-DKO-hiR2-FL-WT-FLAG cells, but does not recognize mouse iRhom2 variants ectopically expressed in MEF-DKO-miR2-FL-WT-FLAG cells, and therefore does not cross-react with mouse iRhom2. The analyzed mouse antibodies were transiently expressed in Expi293F cells with their respective heavy chain / kappa light chain pairs. Staining: gray = secondary antibody only, black = antibody 3.

[0045] [Figure 20a] Figure 20a shows the results of FACS analysis to determine the specificity of the antibodies of the present invention, demonstrating that the primary material leading to antibody 16 of the present invention, which is representative of antibodies 3, 16, 22, and 42 of the present invention, binds to RPMI-8226 cells (left panel) and THP-1 cells (middle panel), which endogenously express iRhom2, but not to RH-30 cells (right panel), which do not endogenously express iRhom2, thus specifically recognizing endogenous human iRhom2. Staining: grey = secondary antibody only, black = supernatant leading to antibody 16.

[0046] [Figure 20b] Figure 20b shows the results of FACS analysis to determine the specificity of the antibodies of the present invention. Both the mouse version (upper panel) and the chimeric version (lower panel) of antibody 16, which is a representative example of antibodies 16, 22, and 42 of the present invention, bind to RPMI-8226 cells (left panel) and THP-1 cells (middle panel), which endogenously express iRhom2, but do not bind to RH-30 cells (right panel), which do not endogenously express iRhom2, demonstrating that endogenous human iRhom2 is specifically recognized. The antibodies analyzed were those transiently expressed in Expi293F (mouse version) or CHO (chimeric version) with their respective heavy chain / kappa light chain pairs. Staining: gray = secondary antibody only; black = antibody 16.

[0047] [Figure 21a] Figure 21a depicts the results of FACS analysis of one MEF population bearing a human iRhom1-related single amino acid substitution at the N-terminus of the central region of the large extracellular loop (AA431 to AA496 of human iRhom2), which was engineered for epitope definition. The data demonstrate that a T7-tagged human iRhom2 variant, hiR2-FL-S448N, ectopically expressed in MEF-DKO-hiR2-FL-WT-T7 cells, as well as a full-length wild-type T7-tagged variant of human iRhom2, ectopically expressed in MEF-DKO-hiR2-FL-S448N-T7 cells, localizes to the cell surface. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0048] [Figure 21b] Figure 21b shows the results of a TGFα release assay (shedding assay), demonstrating that all 23 human iRhom2 variants with human iRhom1-related single amino acid substitutions at the N-terminus of the central region of the large extracellular loop (AA431 to AA496 in human iRhom2) were functionally active and could support PMA-stimulated TGFα shedding to varying degrees, indicating that these variants are likely to be the most properly folded.

[0049] [Figure 22a]Figure 22a shows the results of FACS analysis for determining the epitope of the antibodies of the present invention. For example, the analysis data for the entire panel of 23 human iRhom2 variants with a single human iRhom1-related amino acid substitution at the N-terminus of the central region of the large extracellular loop (AA431 to AA496 of human iRhom2) are shown in MEF-DKO-hiR2-S448N-T7 cells ectopically expressing the human iRhom2 variant hiR2-FL-S448N. The data demonstrate that the substitution of the single amino acid serine 448 of human iRhom2 with an asparagine at the corresponding position in human iRhom1 does not affect, and therefore does not contribute to, the binding of both antibody 5, a representative example of an antibody of the present invention that has a TNFα release inhibitory effect, and antibody 50, a representative example of an antibody of the present invention that does not have a TNFα release inhibitory effect. Staining: gray = secondary antibody only; black = antibody 5 / antibody 50, respectively.

[0050] [Figure 22b] Figure 22b summarizes the results of FACS analysis of all antibodies of the present invention against a panel of 23 genetically engineered MEF populations ectopically expressing human iRhom2 variants with a single human iRhom1-related amino acid substitution at the N-terminus of the central region of the large extracellular loop (AA431 to AA496 of human iRhom2). These data revealed that no amino acid positions are involved in iRhom2 binding for antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have the TNFα release inhibitory effect. On the other hand, some amino acid positions contribute to the binding of antibodies 48 and 50, which do not have the TNFα release inhibitory effect.

[0051] [Figure 23a]Figure 23a depicts the results from FACS analysis of one MEF population bearing human iRhom1-related single amino acid substitutions in the C-terminus (AA563-AA638 of human iRhom2), loop 5 (AA771 of human iRhom2), or the C-terminus (AA825-AA844 of human iRhom2) of the central region of the large extracellular loop, which were engineered for epitope definition. The data show that the T7-tagged human iRhom2 variant iR2-FL-I566E ectopically expressed in MEF-DKO-hiR2-FL-WT-T7 cells, as well as the full-length wild-type T7-tagged variant of human iRhom2, expressed in MEF-DKO-hiR2-FL-I566E-T7 cells, are localized to the surface of these cells. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0052] [Figure 23b] Figure 23b shows the results of a TGFα release assay (shedding assay), demonstrating that all 33 human iRhom2 variants with human iRhom1-related single amino acid substitutions in the C-terminus of the central region of the large extracellular loop (AA563-AA638 of human iRhom2), loop 5 (AA771 of human iRhom2), or the C-terminus (AA825-AA844 of human iRhom2) were functionally active and could support PMA-stimulated TGFα shedding to varying degrees, indicating that these variants are likely to be properly folded.

[0053] [Figure 24a]Figure 24a shows the results of FACS analysis for determining the epitope of the antibodies of the present invention. For example, the data are shown for the analysis of a panel of 33 human iRhom2 variants containing a single human iRhom1-related amino acid substitution at the C-terminus of the central region of the large extracellular loop (AA563 to AA638 of human iRhom2), loop 5 (AA771 of human iRhom2), or the C-terminus (AA825 to AA844 of human iRhom2) in MEF-DKO-hiR2-FL-I566E-T7 cells ectopically expressing the human iRhom2 variant hiR2-FL-I566E. The data show that the substitution of the single amino acid isoleucine 566 of human iRhom2 with glutamic acid at the corresponding position in human iRhom1 strongly impairs the binding of antibody 5, a representative example of an antibody of the present invention that has the effect of inhibiting TNFα release, and thus contributes to binding. On the other hand, this substitution does not affect, and therefore does not contribute to, the binding of Antibody 50, which is representative of antibodies of the invention that have no inhibitory effect on TNFα release. Staining: grey = secondary antibody only, black = Antibody 5 / Antibody 50, respectively.

[0054] [Figure 24b] Figure 24b summarizes the results of FACS analysis of all antibodies of the present invention on a panel of 33 genetically engineered MEF individuals ectopically expressing human iRhom2 variants with human iRhom1-related single amino acid substitutions in the C-terminus of the central region of the large extracellular loop (AA563-AA638 of human iRhom2), loop 5 (AA771 of human iRhom2), or the C-terminus (AA825-AA844 of human iRhom2). These data again reveal the pattern of amino acid positions associated with iRhom2 binding for antibodies 3, 5, 22, 34, 42, 43, and 44 of the present invention, which have the TNFα release inhibitory effect, and show that this pattern is different from the pattern of amino acid positions contributing to binding for antibodies 48 and 50, which do not have the TNFα release inhibitory effect.

[0055] [Figure 25a]Figure 25a depicts the results of FACS analysis of one MEF population carrying a single alanine amino acid substitution (AA503 to AA593 in human iRhom2) within the central region of the large extracellular loop, engineered for epitope definition. The data show that the T7-tagged human iRhom2 variant hiR2-FL-K536A ectopically expressed in MEF-DKO-hiR2-FL-WT-T7 cells, as well as the full-length wild-type T7-tagged variant of human iRhom2 ectopically expressed in MEF-DKO-hiR2-FL-K536A-T7 cells, are localized on the cell surface. Staining: gray = secondary antibody only; black = anti-T7 antibody.

[0056] [Figure 25b] Figure 25b shows the results of a TGFα shedding assay. All 91 human iRhom2 variants with a single alanine amino acid substitution within the central region of the large extracellular loop (AA503–AA593 in human iRhom2) were functionally active and could support PMA-stimulated TGFα shedding to varying degrees, indicating that these variants were correctly folded.

[0057] [Figure 26a]Figure 26a shows the results of FACS analysis for determining the epitope of an antibody of the present invention. As an example of the full panel of 83 functional human iRhom2 variants with a single amino acid substitution to alanine within the central region of the large extracellular loop (AA503 to AA593 of human iRhom2), analysis data from MEF-DKO-hiR2-FL-K536A-T7 cells ectopically expressing the human iRhom2 variant hiR2-FL-K536A are shown. The data demonstrate that the substitution of the single amino acid leucine 536 of human iRhom2 with alanine strongly impairs the binding of antibody 5, a representative example of an antibody of the present invention that has an inhibitory effect on TNFα release, and thus contributes to binding. In contrast, this substitution does not affect the binding of antibody 50, a representative example of an antibody of the present invention that does not have an inhibitory effect on TNFα release, and therefore does not contribute to binding. Staining: gray = secondary antibody only; black = antibody 5 / antibody 50, respectively.

[0058] [Figure 26b] Figure 26b summarizes the results of FACS analysis of all antibodies of the present invention against a panel of 83 genetically engineered functional MEF populations ectopically expressing human iRhom2 variants with a single alanine amino acid substitution within the central region of the large extracellular loop (AA503-AA593 of human iRhom2). The data again reveal a pattern of amino acid positions associated with iRhom2 binding for antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have TNFα release inhibitory effects, that is distinct from the pattern of amino acid positions contributing to binding for antibodies 48 and 50, which do not have TNFα release inhibitory effects.

[0059] [Figure 27a] Figure 27a shows the results of a TNFα release assay demonstrating that antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the invention block PMA-induced shedding of TNFα in U937 cells. The data show the effect of the test article on the absolute amount of TNFα released. The murine antibodies analyzed were transiently expressed in Expi293F cells with their respective heavy chain / kappa light chain pairs.

[0060] [Figure 27b] FIG. 27b is a graph showing the effect of test articles on TNFα release as percent inhibition, with reference to the results shown in FIG. 27a.

[0061] [Figure 28a] Figure 28a shows the results of a TNFα release assay, demonstrating that both murine (indicated by an m after the antibody number) and chimeric (indicated by a ch after the antibody number) versions of antibodies 16, 22, 34, 42, and 44 of the invention block PMA-induced shedding of TNFα in U937 cells. The data show the effect of the test article on the absolute amount of TNFα released. The antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F (murine version) or CHO (chimeric version).

[0062] [Figure 28b] FIG. 28b refers to the results depicted in FIG. 28a and shows the effect of test articles on TNFα release as percent inhibition.

[0063] [Figure 29a] Figure 29a shows the results of an IL-6R release assay demonstrating that antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention block PMA-induced IL-6R shedding in THP-1 cells. The data show the effect of the test article on the absolute number of released IL-6R. The mouse antibodies analyzed were transiently expressed in Expi293F cells with their respective heavy chain / kappa light chain pairs.

[0064] [Figure 29b] FIG. 29b is a graph showing the effect of test articles on IL-6R release as percent inhibition, with reference to the results depicted in FIG. 29c.

[0065] [Figure 30a]Figure 30a shows the results of an IL-6R release assay demonstrating that antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention block PMA-induced IL-6R shedding in U937 cells. The data show the effect of the test article on the absolute number of released IL-6R. The mouse antibodies analyzed were transiently expressed in Expi293F cells with their respective heavy chain / kappa light chain pairs.

[0066] [Figure 30b] FIG. 30b is a graph showing the effect of test articles on IL-6R release as percent inhibition, referring to the results depicted in FIG. 30a.

[0067] [Figure 31a] Figure 31a shows the results of an IL-6R release assay, demonstrating that both the murine (antibody number followed by m) and chimeric (antibody number followed by ch) versions of antibodies 16, 22, 34, 42, and 44 of the present invention block PMA-induced shedding of IL-6R in U937 cells. The data show the effect of the test article on the absolute number of released IL-6R. The antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F (murine version) or CHO (chimeric version).

[0068] [Figure 31b] FIG. 31b is a graph showing the effect of test articles on IL-6R release as percent inhibition, referring to the results depicted in FIG. 31a.

[0069] [Figure 32a]Figure 32a shows the results of an HB-EGF release assay, demonstrating that both murine (antibody number followed by m) and chimeric (antibody number followed by ch) versions of antibodies 16, 22, 34, 42, and 44 of the invention block PMA-induced shedding of HB-EGF in THP-1 cells. The data demonstrate the effect of the test article on the absolute amount of HB-EGF released. The antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F (murine version) or CHO (chimeric version).

[0070] [Figure 32b] FIG. 32b refers to the results shown in FIG. 32a and shows the effect of the test article on HB-EGF release as percent inhibition.

[0071] [Figure 33a] Figure 33a shows the results of an HB-EGF release assay, demonstrating that both murine (antibody number followed by m) and chimeric (antibody number followed by ch) versions of antibodies 16, 22, 34, 42, and 44 of the invention block PMA-induced shedding of HB-EGF in U937 cells. The data demonstrate the effect of the test article on the absolute amount of HB-EGF released. The antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F (murine version) or CHO (chimeric version).

[0072] [Figure 33b] FIG. 33b refers to the results shown in FIG. 33a and shows the effect of the test article on HB-EGF release as percent inhibition.

[0073] [Figure 34a]Figure 34a shows the results of a TGFα release assay, demonstrating that antibodies 16, 22, 42, 43, and 44 of the invention weakly interfere with PMA-induced shedding of TGFα in PC3 cells, while antibodies 3, 5, and 34 have no inhibitory effect on TGFα release. The data show the effect of the test articles on the absolute amount of TGFα released. The mouse antibodies analyzed were transiently expressed in Expi293F cells with their respective heavy chain / kappa light chain pairs.

[0074] [Figure 34b] FIG. 34b refers to the results depicted in FIG. 34a and shows the effect of test articles on TGFα release as percent inhibition.

[0075] [Figure 35a] Figure 35a shows the results of a TNFα release assay demonstrating that antibodies 16, 22, and 42 of the invention block LPS-induced shedding of TNFα in human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. The data show the effect of the test articles on the absolute amounts of TNFα released. The murine antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F cells.

[0076] [Figure 35b] FIG. 35b refers to the results depicted in FIG. 35a and shows the effect of test articles on TNFα release as percent inhibition.

[0077] [Figure 36a] Figure 36a shows the results of a TNFα release assay demonstrating that antibodies 16, 22, and 42 of the invention block LPS-induced shedding of TNFα in human macrophages isolated from peripheral blood mononuclear cells (PBMCs) of healthy donors. The data show the effect of the test articles on the absolute amounts of TNFα released. The murine antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F cells.

[0078] [Figure 36b] FIG. 36b refers to the results depicted in FIG. 36a and shows the effect of test articles on TNFα release as percent inhibition.

[0079] [Figure 37a] Figure 37a shows the results of an IL-6R release assay, demonstrating that antibodies 16, 22, and 42 of the invention block PMA-induced shedding of IL-6R in human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. The data show the effect of the test article on the absolute number of released IL-6R. The mouse antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F cells.

[0080] [Figure 37b] FIG. 37b is a graph showing the effect of test articles on IL-6R release as percent inhibition, referring to the results depicted in FIG. 37a.

[0081] [Figure 38a] Figure 38a shows the results of an HB-EGF release assay demonstrating that antibodies 16, 22, and 42 of the invention block PMA-induced shedding of HB-EGF in human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. The data demonstrate the effect of the test article on the absolute amount of HB-EGF released. The murine antibodies analyzed were transiently expressed with their respective heavy chain / kappa light chain pairs in Expi293F cells.

[0082] [Figure 38b] FIG. 38b refers to the results shown in FIG. 38a and shows the effect of the test article on HB-EGF release as percent inhibition.

[0083] [Figure 39a]Figure 39a shows the results of an in vivo septic shock model in humanized hsNOG-EXL mice (human CD34+), demonstrating that antibodies 16, 22, and 42 of the invention block LPS-induced shedding of TNFα in humanized hsNOG-EXL mice. The data show the effect of the test articles on the absolute amount of TNFα released. The mouse antibodies analyzed were transiently expressed in Expi293F cells with their respective heavy chain / kappa light chain pairs.

[0084] [Figure 39b] Figure 39b refers to the results depicted in Figure 39a and shows the effect of test article on TNFα release as a percentage compared to buffer-treated control animals, which was set at 100%.

[0085] [Figure 40a] Figure 40a shows the results of a TNFα release assay demonstrating that antibodies 16, 22, 34, 42, and 44 of the invention block LPS-induced shedding of TNFα in human peripheral blood mononuclear cells (PBMCs) isolated from patients with rheumatoid arthritis. The data show the effect of the test articles on the absolute amounts of TNFα released. The chimeric antibodies analyzed were prepared by transiently expressing the respective heavy chain / kappa light chain pairs in CHO cells.

[0086] [Figure 40b] FIG. 40b refers to the results depicted in FIG. 40a and shows the effect of test articles on TNFα release as percent inhibition.

[0087] [Figure 41a]Figure 41a shows the results of an IL-6R release assay, demonstrating that antibodies 16, 22, 34, 42, and 44 of the present invention block PMA-induced shedding of IL-6R in human peripheral blood mononuclear cells (PBMCs) isolated from patients with rheumatoid arthritis. The data show the effect of the test article on the absolute number of released IL-6R. The chimeric antibodies analyzed were prepared by transiently expressing their respective heavy chain / kappa light chain pairs in CHO cells.

[0088] [Figure 41b] FIG. 41b refers to the results depicted in FIG. 41a and shows the effect of the test article on IL-6R release as percent inhibition.

[0089] [Figure 42a] Figure 42a shows the results of an HB-EGF release assay demonstrating that antibodies 16, 22, 34, 42, and 44 of the invention block PMA-induced shedding of HB-EGF in human peripheral blood mononuclear cells (PBMCs) isolated from patients with rheumatoid arthritis. The data show the effect of the test article on the absolute amount of HB-EGF released. The chimeric antibodies analyzed were prepared by transiently expressing the respective heavy chain / kappa light chain pairs in CHO cells.

[0090] [Figure 42b] FIG. 42b refers to the results shown in FIG. 42a and shows the effect of the test article on HB-EGF release as percent inhibition.

[0091] (Detailed explanation) According to one aspect of the present invention, there is provided a protein binder that, when bound to human iRhom2, binds within at least the loop 1 region thereof.

[0092] According to another aspect of the present invention, there is provided a protein binder that binds to the extracellular domain of human iRhom2, wherein the protein binder is an IgG antibody.

[0093] Inactive Rhomboid family member 2 (iRhom2) is a protein encoded by the RHBDF2 gene in humans. It is a transmembrane protein consisting of approximately 850 amino acids and has seven transmembrane domains. We first demonstrated that iRhom2 acts as a target for protein binders and inhibits TACE / ADAM17 activity.

[0094] Different isoforms of iRhom2 exist. The experiments performed herein were established with the isoform defined as NCBI reference NP_078875.4. However, the present teachings are transferable to, but not limited to, other isoforms of iRhom2, as shown in the table below.

[0095] JPEG2025179064000001.jpg24170

[0096] Loop 1 of Rhom2 comprises amino acid residues 474 to 660 of SEQ ID NO: 181. See Figure 15, item "B" for explanation.

[0097] In one embodiment of the invention, the protein binder also binds to one or more other regions of human iRhom2, such as the juxtamembrane domain (JMD) located N-terminal to loop 1 (shown as item "A" in Figure 15), or a region near the C-terminus. The JMD comprises amino acid residues 431-473 of SEQ ID NO:181.

[0098] In another embodiment, the protein binder does not bind to the juxtamembrane domain (JMD), which is located N-terminal to loop1.

[0099] According to one embodiment of the present invention, the protein binder binds within at least the region of human iRhom2 spanning from W526 to I566 (and inclusive) according to the numbering set forth in SEQ ID NO:181.

[0100] Preferably, the protein binders bind within a region having a length of at least three amino acids.

[0101] In one or more embodiments, the protein binder binds to ≥2, ≥3, ≥4, ≥5, ≥6, ≥7, ≥8, ≥9, ≥10, ≥11, ≥12, 13, ≥14, ≥15, ≥16, ≥17, ≥18, ≥19, ≥20, ≥21, ≥22, ≥23, ≥24, or ≥25 amino acids within the region. The individual amino acid residues can be present in a discrete, contiguous sequence, or in two or more clusters, each of one or more amino acid residues.

[0102] Preferably, the protein binder binds within a region of human iRhom2 spanning from P533 (and inclusive) to K536 (and inclusive), according to the numbering set forth in SEQ ID NO:181.

[0103] According to one embodiment of the present invention, the protein binder binds a stretch of human iRhom2 comprising at least one residue selected from the group comprising: W526; Q527; P532; P533; M534; D535; K536; S537; L539; K542; R543; T544; G546; R554; E557; S561; and / or I566, according to the numbering set forth in SEQ ID NO: 181.

[0104] In one or more embodiments, the protein binder binds to ≥2, ≥3, ≥4, ≥5, ≥6, ≥7, ≥8, ≥9, ≥10, ≥11, or ≥12 amino acid residues from the list above. The individual amino acid residues can be present in a discrete, contiguous sequence, or in two or more clusters, each of one or more amino acid residues.

[0105] Preferably, the protein binder binds to a stretch of iRhom2 comprising at least one residue selected from the group consisting of: P533; M534; D535; K536; and / or L539, according to the numbering set forth in SEQ ID NO:181.

[0106] In one or more embodiments, the protein binder binds to ≥ 2, ≥ 3, or ≥ 4 amino acid residues from the list above. The individual amino acid residues can be present in a discrete, contiguous sequence or in two or more clusters, each of one or more amino acid residues.

[0107] According to one embodiment of the present invention, the protein binder inhibits and / or reduces TACE / ADAM17 activity when bound to human iRhom2.

[0108] As used herein, the term "inhibiting and / or reducing TACE / ADAM17 activity" is meant to refer to the effect produced by a protein binder that blocks or reduces the activity of TACE / ADAM17, for example, as measured in a respective shedding assay (see, e.g., Figure 9 and Example 14).

[0109] ADAM metallopeptidase domain 17 (ADAM17), also known as TACE (tumor necrosis factor-α-converting enzyme), is a disintegrin and metalloprotease member of the ADAM protein family. ADAM17 is understood to be involved in the processing of tumor necrosis factor-α (TNF-α) from the cell surface and from intracellular membranes in the trans-Golgi network. This process, also known as "shedding," involves the cleavage and release of soluble ectodomains from membrane-bound proproteins (e.g., pro-TNF-α) and is known to be physiologically important. ADAM17 was the first "sheddase" to be identified and has also been shown to be involved in the release of various membrane-bound cytokines, cell adhesion molecules, receptors, ligands, and enzymes.

[0110] Cloning of the TNF-α gene revealed that it encodes a 26-kDa type II transmembrane propolypeptide that is inserted into the plasma membrane during maturation. At the cell surface, pro-TNF-α is biologically active and can induce immune responses through juxta-crine cell-cell signaling. However, pro-TNF-α can undergo proteolysis at the Ala76-Val77 amide bond, releasing a soluble 17-kDa extracellular domain (ectodomain) from the pro-TNF-α molecule. This soluble ectodomain is the cytokine commonly known as TNF-α, which is crucial for paracrine signaling. This proteolytic release of soluble TNF-α is catalyzed by ADAM17.

[0111] Recently, ADAM17 has been found to be a key mediator of radiation resistance, and radiotherapy-induced ADAM17 activation has been shown to result in shedding of multiple survival factors, activation of growth factor pathways, and radiation therapy resistance in non-small cell lung cancer.

[0112] ADAM17 also regulates the MAP kinase signaling pathway by controlling the shedding of the EGFR ligand amphiregulin in the mammary gland, and is also involved in the shedding of the cell adhesion molecule L-selectin.

[0113] According to one embodiment of the present invention, inhibition or reduction of TACE / ADAM17 activity is caused by interference of protein binders with iRhom2-mediated TACE / ADAM17 activation or the interaction of TACE / ADAM17 with other proteins, including substrate molecules.

[0114] According to one embodiment of the present invention, the protein binder inhibits or reduces induced TNFα shedding upon binding to human iRhom2.

[0115] According to one embodiment of the present invention, the protein binder inhibits or reduces induced IL-6R shedding upon binding to human iRhom2.

[0116] According to one embodiment of the present invention, the protein binder inhibits or reduces induced HB-EGF shedding upon binding to human iRhom2.

[0117] As used herein, tumor necrosis factor alpha (TNFα) shedding or release refers to the process by which membrane-bound tumor necrosis factor alpha (mTNFα / pro-TNFα) is cleaved and released into the environment to form soluble TNFα (sTNFα or simply TNFα), a process mediated specifically by TACE / ADAM17.

[0118] Interleukin-6 receptor (IL-6R) release or shedding refers to the process in which membrane-bound IL-6R is cleaved at the cell surface by TACE / ADAM17 at a proteolytic site near the transmembrane domain to generate soluble IL-6R.

[0119] Heparin-binding EGF-like growth factor (HB-EGF) shedding is a cleavage process in which soluble HB-EGF is generated and released from the cell surface. HB-EGF is an epidermal growth factor with affinity for heparin and is synthesized as a membrane-anchored mitogenic and chemotactic glycoprotein. HB-EGF is an 87-amino acid glycoprotein that was first identified in the conditioned medium of human macrophage-like cells, and its gene expression is known to be highly regulated.

[0120] Suitable assays for measuring the shedding effect of TNFα are described, for example, in Figure 9 and Example 14. Suitable assays for determining the release or shedding of IL-6R and / or HB-EGF are described, for example, in Figure 29 and Example 26 or Figure 32 and Example 29, respectively.

[0121] According to one embodiment of the present invention, the human iRhom2 to which the protein binder binds is: a) the amino acid sequence set forth in SEQ ID NO: 181, or b) an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 181, provided that said sequence maintains iRhom2 activity. Includes:

[0122] In some embodiments, human iRhom2 comprises an amino acid sequence that is ≧81%, preferably ≧82%, more preferably ≧83%, ≧84%, ≧85%, ≧86%, ≧87%, ≧88%, ≧89%, ≧90%, ≧91%, ≧92%, ≧93%, ≧94%, ≧95%, ≧96%, ≧97%, ≧98, or most preferably ≧99% sequence identity to SEQ ID NO: 181.

[0123] SEQ ID NO: 181 represents the amino acid sequence of inactive rhomboid protein 2 (iRhom2) isoform 1 [Homo sapiens], accessible at NCBI reference NP_078875.4. Generally, various variants and isoforms of iRhom2 exist. Similarly, variants consisting of conservative or silent amino acid substitutions exist or may exist that retain full or at least substantial iRhom2 activity. These isoforms, variants, and mutants are included within the above-mentioned identity range, but non-functional, inactive variants and mutants are excluded.

[0124] According to one embodiment of the present invention, the protein binder is a monoclonal antibody, or a target-binding fragment or derivative thereof that retains target-binding ability, or an antibody mimetic.

[0125] As used herein, the term "monoclonal antibody (mAb)" is intended to mean an antibody composition having a homogeneous antibody population, i.e., a homogeneous population of whole immunoglobulins, or fragments or derivatives thereof, that retain target binding ability.

[0126] Particularly preferred are IgG antibodies, or fragments or derivatives thereof that retain target binding ability. Immunoglobulin G (IgG) is a type of antibody. IgG accounts for approximately 75% of human serum antibodies and is the most abundant type of antibody in the blood. IgG molecules are produced and released by plasma B cells. Each IgG has two antigen-binding sites.

[0127] IgG antibodies are large molecules with a molecular weight of approximately 150 kDa, consisting of four peptide chains. They contain two identical class γ heavy chains of approximately 50 kDa and two identical light chains of approximately 25 kDa, forming a quaternary tetrameric structure. The two heavy chains are linked to each other and to the light chains by disulfide bonds. As a result, the tetramer has two identical halves, which together form a Y-shaped structure. Each end of the fork contains an identical antigen-binding site. The Fc region of IgG contains highly conserved N-glycosylation sites. N-glycans bound to these sites are primarily core-fucosylated, diantennary, and complex. Additionally, these N-glycans also contain small amounts of bisecting GlcNAc and α-2,6-linked sialic acid residues.

[0128] There are four IgG subclasses in humans (IgG1, 2, 3, and 4), named in order of their abundance in serum (IgG1 being the most abundant).

[0129] As used herein, the term "fragment" is intended to refer to fragments of such antibodies that retain target binding ability.

[0130] - CDR (complementarity determining region) - hypervariable regions, - variable domain (Fv), - an IgG or IgM heavy chain (consisting of the VH, CH1, hinge, CH2, and CH3 regions); - an IgG or IgM light chain (consisting of a VL and CL region), and / or - Fab and / or F(ab)2.

[0131] As used herein, the term "derivative" refers to protein constructs that are structurally different but still have some structural relatedness, such as scFv, Fab and / or F(ab)2, as well as dual, tri- or higher specificity antibody constructs, and the common antibody concept, which still retain target binding ability, all of which are described below.

[0132] Other antibody derivatives known to those skilled in the art are diabodies, camelid antibodies, nanobodies, domain antibodies, bivalent homodimers with two chains consisting of scFvs, IgA (two IgG structures linked by a J chain and a secretory component), shark antibodies, antibodies consisting of a New World primate framework and non-New World primate CDRs, dimerization constructs containing CH3+VL+VH, and antibody conjugates (e.g., antibodies or fragments or derivatives linked to toxins, cytokines, radioisotopes, or labels). These types are well described in the literature and can be used by those skilled in the art based on the present disclosure without further inventive effort.

[0133] Methods for producing hybridoma cells are disclosed in Kohler and Milstein (1975).

[0134] Methods for producing and / or selecting chimeric or humanized mAbs are known in the art, for example, US6331415 to Genentech describes the production of chimeric antibodies, while US6548640 to the Medical Research Council describes CDR grafting technology, and US5859205 to Celltech describes the production of humanized antibodies.

[0135] Methods for producing and / or selecting fully human mAbs are known in the art and include the use of transgenic animals immunized with the respective protein or peptide, or the use of suitable display technologies such as yeast display, phage display, B cell display, or ribosome display, where antibodies from a library are screened against human iRhom2 in stationary phase.

[0136] In vitro antibody libraries are disclosed, inter alia, by MorphoSys in US6300064 and by MRC / Scripps / Stratagene in US6248516. Phage display technology is disclosed, for example, by Dyax in US5223409. Transgenic mammalian platforms are described, for example, in EP1480515A2 by TaconicArtemis.

[0137] IgG, IgM, scFv, Fab and / or F(ab)2 are antibody formats well known to those skilled in the art. The relevant validation techniques are available from the respective textbooks.

[0138] As used herein, the term "Fab" refers to an IgG / IgM fragment containing the antigen-binding region, which fragment is composed of one constant and one variable domain from each of the heavy and light chains of the antibody.

[0139] As used herein, the term "F(ab)2" refers to an IgG / IgM fragment consisting of two Fab fragments linked together by disulfide bonds.

[0140] As used herein, the term "scFv" refers to a single-chain variable fragment that is a fusion of the variable regions of the heavy and light chains of an immunoglobulin, connected by a short linker, usually serine (S) or glycine (G). This chimeric molecule retains the specificity of the original immunoglobulin despite the removal of the constant regions and the introduction of a linker peptide.

[0141] Modified antibody formats are, for example, bi- or tri-specific antibody constructs, antibody-based fusion proteins, immunoconjugates, etc. These types are well described in the literature and can be used by the skilled artisan based on the present disclosure to further add activity to the invention.

[0142] As used herein, the term "antibody mimetic" refers to an organic molecule, most often a protein, that specifically binds to a target protein similar to an antibody, but is not structurally related to antibodies. Antibody mimetics are typically artificial peptides or proteins with a molar mass of approximately 3-20 kDa. The definition encompasses, among others, affibody molecules, affilins, affimas, affitins, alphabodies, anticalins, avimers, DARPins, finomers, Kunitz domain peptides, monobodies, and nanoCLAMPs.

[0143] In one or more embodiments, the protein binder is an isolated antibody, or a target-binding fragment or derivative thereof that retains target-binding ability, or an isolated antibody mimetic. In one or more embodiments, the antibody is an engineered or recombinant antibody, or a target-binding fragment or derivative thereof that retains target-binding ability, or an engineered or recombinant antibody mimetic.

[0144] According to one or more embodiments of the invention, the protein binder is an antibody in at least one of the formats selected from the group consisting of IgG, scFv, Fab, (Fab)2.

[0145] According to one embodiment of the present invention, the protein binder does not exhibit cross-reactivity with human iRhom1.

[0146] According to one embodiment of the present invention, the protein binder is a murine antibody, a chimerized antibody, a humanized antibody, or a human antibody.

[0147] According to one embodiment of the present invention, the protein binder is an antibody: a) an antibody comprising a pair of heavy chain / light chain complementarity determining regions (CDRs) comprising a pair of heavy chain / light chain variable domain sequences represented by the following pairs of SEQ ID NOs: 2 and 7, 12 and 17, 22 and 27, 32 and 37, 42 and 47, 52 and 57, 62 and 67, 72 and 77, 82 and 87, 112 and 117, 152 and 157, 162 and 167, and / or 172 and 177; b) an antibody comprising a pair of heavy / light chain complementarity determining regions (CDRs) comprising the following SEQ ID NOs in the order (HCDR1; HCDR2; HCDR3; LCDR1; LCDR2 and LCDR3), - 3,4,5,8,9,10; - 13,14,15,18,19,20; - 23, 24, 25, 28, 29, 30; - 33, 34, 35, 38, 39, 40; - 43, 44, 45, 48, 49, 50; - 53,54,55,58,59,60; - 63,64,65,68,69,70; - 73,74,75,78,79,80; - 83,84,85,88,89,90; - 113,114,115,118,119,120; - 153,154,155,158,159,160; - 163, 164, 165, 168, 169, 170, and / or - 173,174,175,178,179,180; c) an antibody comprising the heavy / light chain complementarity determining regions (CDRs) of b), with the proviso that at least one of the CDRs has up to three amino acid substitutions relative to the respective SEQ ID NO: and / or

[0148] d) An antibody comprising the heavy / light chain complementarity determining regions (CDRs) of b) or c), with the proviso that at least one of the CDRs has a sequence identity of ≧66% to the respective SEQ ID NO:

[0149] Here, the CDRs are embedded in a suitable protein framework such that they can bind to human iRhom2 with sufficient binding affinity and inhibit or reduce TACE / ADAM17 activity.

[0150] As used herein, the term "CDR" or "complementarity-determining region" is intended to refer to the noncontiguous antigen-binding sites found within the variable regions of heavy and light chain polypeptides. These specific regions are described by Kabat et al. (1977), Kabat et al. (1991), Chothia et al. (1987), and MacCallum et al. (1996), where the definitions include overlapping or subsets of amino acid residues when compared with each other. Nevertheless, application of either definition to refer to the CDRs of an antibody or grafted antibody, or variants thereof, is intended to be within the scope of the term as defined and used herein. The amino acid residues encompassing the CDRs defined by each of the above references are set forth below in Table 1 for comparison. Note that because CDR definitions vary from case to case, this numbering may differ from the CDRs actually disclosed in the enclosed sequence listing.

[0151] Definition of CDR [Table 1]

[0152] As used herein, the term "framework" when used in reference to an antibody variable region refers to all amino acid residues outside the CDR regions within the variable region of an antibody. Thus, although the framework of a variable region is approximately 100 to 120 amino acids in length, it is intended to refer only to amino acids outside the CDRs.

[0153] As used herein, the term "capable of binding to target X with sufficient binding affinity" means that each binding domain is capable of binding to target X with sufficient affinity to -4 The following K D It should be understood to mean that the target binds at K D is the equilibrium dissociation constant, k between the protein binder and its antigen off / k on is the ratio of K D and affinity are inversely proportional. D Since the value is related to the protein binder concentration (the amount of protein binder needed for a particular experiment), K D The lower the value (lower the concentration), the higher the affinity of the binding domain. The table below shows typical K values ​​for monoclonal antibodies. D Indicates the range.

[0154] K D Value and molar value [Table 2]

[0155] Preferably, the protein binder has up to two amino acid substitutions, more preferably up to one amino acid substitution.

[0156] Preferably, at least one of the CDRs of the protein binder has ≧67%; ≧68%; ≧69%; ≧70%; ≧71%; ≧72%; ≧73%; ≧74%; ≧75%; ≧76%; ≧77%; ≧78%; ≧79%; ≧80%; ≧81%; ≧82%; ≧83%; ≧84%; ≧85%; ≧86%; ≧87%; ≧88%; ≧89%; ≧90%; ≧91%; ≧92%; ≧93%; ≧94%; ≧95%; ≧96%; ≧97%; ≧98%; ≧99%, most preferably 100% sequence identity to the respective SEQ ID NO.

[0157] As used herein, "percentage of sequence identity" is determined by comparing two optimally aligned biosequences (amino acid sequences or polynucleotide sequences) over a comparison window, where the portions of the corresponding sequences in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence that does not contain additions or deletions due to optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.

[0158] The terms "identical" or percent "identity," with respect to two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same. Two sequences are "substantially identical" if the two sequences have a specified percentage of the same amino acid residues or nucleotides (i.e., at least 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity over a specified region, or, if not specified, the entire sequence of the reference sequence) when compared for maximum correspondence over a comparison window, or over a specified region as measured using one of the sequence comparison algorithms described below, or by manual alignment and visual inspection. The present disclosure provides polypeptides that are substantially identical to the polypeptides exemplified herein. With respect to amino acid sequences, identity or substantial identity can exist over a length of at least 5, 10, 15, or 20 amino acids, optionally at least about 25, 30, 35, 40, 50, 75, or 100 amino acids, optionally at least about 150, 200, or 250 amino acids, or over the entire length of the reference sequence. For shorter amino acid sequences, e.g., sequences of 20 or fewer amino acids, substantial identity exists when one or two amino acid residues are conservatively substituted according to conservative substitutions as defined herein.

[0159] Preferably, at least one of the CDRs comprises: - Affinity maturation - Reduced immunogenicity have been subjected to CDR sequence modifications including: Affinity maturation is the process by which the affinity of a given antibody is increased in vitro. Similar to nature, in vitro affinity maturation is based on the principle of mutation and selection. It has been successfully used to optimize antibodies, antibody fragments, or other peptide molecules such as antibody mimetics. Random mutations within CDRs are introduced using radiation, chemical mutagens, or error-prone PCR. Furthermore, chain shuffling can increase genetic diversity. Two or three rounds of mutation and selection using display methods such as phage display typically result in antibody fragments with affinities in the low nanomolar range. For a discussion of the principles, see Eylenstein et al. (2016) or US20050169925A1, the contents of which are incorporated herein by reference.

[0160] Genetically engineered antibodies comprise the CDR region derived from mouse sequence, together with the necessary framework back mutations in the V region derived from sequence.Therefore, when humanized antibody is administered to patients, CDR itself can cause immunogenic reaction.Methods for reducing the immunogenicity caused by CDR are disclosed in Harding et al. (2010) or US2014227251A1, the contents of which are incorporated herein by reference.

[0161] According to one embodiment of the present invention, the protein binder comprises: a) an antibody having a heavy chain / light chain variable domain (HCVD / LCVD) pair represented by the following pairs of SEQ ID NOs: 2 and 7, 12 and 17, 22 and 27, 32 and 37, 42 and 47, 52 and 57, 62 and 67, 72 and 77, 82 and 87, 112 and 117, 152 and 157, 162 and 167, and / or 172 and 177; b) an antibody having the heavy chain / light chain variable domain (HCVD / LCVD) combination of a) - the HCVD has ≥ 80% sequence identity to each SEQ ID NO; and / or - LCDVD is an antibody having ≥ 80% sequence identity to each SEQ ID NO. c) An antibody that is a heavy chain / light chain variable domain (VD) pair of a) or b), wherein at least one of the HCVDs or LCVDs has up to 10 amino acid substitutions relative to the respective SEQ ID NO: The protein binder is still capable of binding to human iRhom2 with sufficient binding affinity to inhibit or reduce TACE / ADAM17 activity.

[0162] The term "variable domain" as used in reference to an antibody or its heavy or light chain is intended to refer to the portion of an antibody that confers antigen binding on the molecule and is not the constant region. The term is intended to include functional fragments thereof that maintain some of the binding function of the entire variable region. Variable region-binding fragments include, for example, functional fragments of Fab, F(ab)2, Fv, single-chain Fv (scfv), etc. Such functional fragments are well known to those skilled in the art. Thus, the use of these terms in describing functional fragments of heteromeric variable regions is intended to correspond to definitions well known to those skilled in the art. Such terms are described, for example, in Hustone et al. (1993) or Plückthun and Skerra (1990).

[0163] Preferably, the HCVD and / or LCVD have ≧81%; ≧82%; ≧83%; ≧84%; ≧85%; ≧86%; ≧87%; ≧88%; ≧89%; ≧90%; ≧91%; ≧92%; ≧93%; ≧94%; ≧95%; ≧96%; ≧97%; ≧98%; ≧99%; or most preferably ≧100% sequence identity to the respective SEQ ID NO.

[0164] According to one embodiment of the present invention, at least one amino acid substitution is a conservative amino acid substitution.

[0165] As used herein, "conservative amino acid substitutions" have a smaller effect on antibody function than non-conservative substitutions. Although there are various ways to classify amino acids, they are often divided into six major groups based on their structure and the general chemical properties of the R groups.

[0166] In some embodiments, a "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. For example, families of amino acid residues having similar side chains have been defined in the art. These families include amino acids having:

[0167] - basic side chains (lysine, arginine, histidine, etc.), - acidic side chains (aspartic acid, glutamic acid, etc.), - uncharged polar side chains (glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, etc.), - non-polar side chains (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, etc.), - β-branched side chains (threonine, valine, isoleucine, etc.) - Aromatic side chains (tyrosine, phenylalanine, tryptophan, histidine, etc.).

[0168] Other conservative amino acid substitutions can also occur across amino acid side chain families, such as substituting aspartic acid for asparagine to modify the charge of the peptide. Conservative changes can also include the substitution of chemically homologous non-natural amino acids (i.e., a synthetic non-natural hydrophobic amino acid for leucine, a synthetic non-natural aromatic amino acid for tryptophan).

[0169] According to one embodiment of the present invention, the protein binder has at least one of the following: - a target binding affinity for human iRhom2 of ≥ 50% compared to a protein binder according to any one of the preceding claims, and / or - ≥ 50% of the inhibitory or reducing effect of a protein binder according to any one of the preceding claims on TACE / ADAM17 activity.

[0170] As used herein, the term "binding affinity" is intended to mean the strength of binding interaction and thus includes both actual binding affinity and apparent binding affinity. Actual binding affinity is the ratio of the association rate to the dissociation rate. Therefore, conferring or optimizing binding affinity involves altering either or both of these components to achieve a desired level of binding affinity. Apparent affinity can include, for example, the avidity of the interaction. For example, a bivalent heteromeric variable region binding fragment can exhibit modified or optimized binding affinity due to its valency.

[0171] A suitable method for measuring the affinity of a binding agent is through surface plasmon resonance (SPR). This method is based on the phenomenon that occurs when surface plasmon waves are excited at a metal / liquid interface. Light is shone on the side of the surface not in contact with the sample and reflected, and SPR causes a decrease in the reflected light intensity at a specific combination of angle and wavelength. Biomolecular binding events cause a change in the refractive index at the surface, which is detected as a change in the SPR signal. The binding event can be either a binding association or dissociation between a receptor-ligand pair. The change in refractive index can be measured essentially instantaneously, thus allowing the determination of the individual components of the affinity constant. Specifically, the association rate (k on ) and dissociation rate (k off ) allows for accurate measurement.

[0172] k on and k off Measuring k is effective because it allows identification of altered or optimized variable regions. For example, engineered variable regions, or heteromer-binding fragments thereof, may exhibit higher k compared to, for example, variable regions and heteromer-binding fragments that exhibit similar binding affinities. on kon A molecule with a higher k can specifically bind and inhibit its target at a faster rate, resulting in increased efficacy. Similarly, the molecules of the invention have a lower k compared to molecules with similar binding affinities. off It may be more effective to show the value of k off Molecules with slower rates are more potent because, once bound, the molecule dissociates more slowly from its target. Although reference is made to the engineered and optimized variable regions of the invention, including heteromeric variable region binding fragments thereof, the above-described methods for measuring association and dissociation rates are applicable to essentially any protein binder or fragment thereof to identify more effective binding agents for therapy or diagnosis.

[0173] Another suitable method for measuring the affinity of a binding agent from a surface is by FACS / scatchard analysis, see especially Example 10 for a description of each.

[0174] Methods for measuring affinity, including association and dissociation rates, using surface plasmon resonance are well known to those skilled in the art and can be described, for example, in Jonsson and Malmquist, (1992) and Wu et al. (1998). Additionally, one device well known in the art for measuring binding interactions is the BIAcore2000 device, commercially available through Pharmacia Biosensors (Uppsala, Sweden).

[0175] Preferably, the target binding affinity is ≧51%, ≧52%, ≧53%, ≧54%, ≧55%, ≧56%, ≧57%, ≧58%, ≧59%, ≧60%, ≧61%, ≧62%, ≧63%, ≧64%, ≧65%, ≧66%, ≧67%, ≧68%, ≧69%, ≧70%, ≧71%, ≧72%, ≧73%, ≧74%, ≧75%, ≧76%, ≧77%, ≧78%, ≧79%, ≧80%, ≧81%, ≧82%, ≧83%, ≧84%, ≧85%, ≧86%, ≧87%, ≧88%, ≧89%, ≧90%, ≧91%, ≧92%, ≧93%, ≧94%, ≧95%, ≧96%, ≧97%, ≧98%, and most preferably ≧99% compared to that of a reference binding agent.

[0176] As used herein, quantification of the inhibitory or reducing effect on TACE / ADAM17 activity compared to a benchmark binder is determined in a suitable assay for determining TNFα shedding effects, for example, as described in Figure 9 and Example 14.

[0177] According to another aspect of the present invention, there are provided protein binders that bind to and compete for binding with human iRhom2. a) an antibody according to the above description, and / or b) An antibody selected from the group consisting of clones #3, #5, #16, #22, #34, #42, #43, #44, #46, #49, #54, #56, or #57 According to another aspect of the present invention, there are provided protein binders that bind to regions on human iRhom2 that are essentially the same as, or identical to, the following regions: a) an antibody according to the above description, and / or b) An antibody selected from the group consisting of clones #3, #5, #16, #22, #34, #42, #43, #44, #46, #49, #54, #56, or #57.

[0178] Clones #3, #5, #16, #22, #34, #42, #43, #44, #46, #47, #48, #49, #50, #51, #52, #54, #56, or #57 are identified in the sequence listing herein.

[0179] With regard to the format or structure of such a protein binder, the same preferred embodiments as given above apply. In one embodiment, said protein binder is a monoclonal antibody, or a target-binding fragment or derivative thereof that retains the target-binding ability, or an antibody mimetic.

[0180] As used herein, the term "compete for binding" refers to one of the antibodies defined by the sequence, and means that the actual protein binder has the same activity as the sequence-defined protein binder in binding to the same target, or target epitope, or domain, or subdomain, and is a variant of the latter. The binding efficiency (e.g., kinetics or thermodynamics) can be the same as, greater than, or less than the latter efficiency. For example, the equilibrium binding constant for binding to a substrate can be different for the two antibodies.

[0181] Such competition for binding can be suitably measured in competitive binding assays, such as those disclosed in Finco et al. 2011, the contents of which are incorporated herein by reference for purposes of enablement, and their implications for claim interpretation in Deng et al. 2018, the contents of which are incorporated herein by reference for purposes of enablement.

[0182] To test this property, suitable epitope mapping techniques are available and include, inter alia: - X-ray cocrystallography and cryo-electron microscopy (cryo-EM) - Array-based oligo-peptide scanning - Site-directed mutagenesis mapping - High-throughput shotgun mutagenesis and epitope mapping - Hydrogen-Deuterium Exchange - Cross-linking mass spectrometry These methods are disclosed and discussed, inter alia, in Banik et al. (2010) and DeLisser (1999), the contents of which are incorporated herein by reference for purposes of enablement.

[0183] According to another aspect of the invention there is provided a nucleic acid encoding at least one strand of a binding agent according to the above description.

[0184] In one embodiment, at least acids encoding the heavy and light chains, respectively, of a binding agent are provided, where the latter is a monoclonal antibody having at least one light chain and one heavy chain heteromeric stretcher, such acids encoding the heavy and light chains of the binding agent.

[0185] Generally, due to the degeneracy of the genetic code, there are a large number of nucleic acids capable of encoding such a chain. Those skilled in the art are well able to determine whether a given nucleic acid meets the above criteria. On the other hand, those skilled in the art are perfectly able to reverse engineer a suitable nucleic acid encoding a given amino acid sequence based on a codon usage table. To do this, software tools such as "reverse translate" from the online tool "sequence manipulation suite" (https: / / www.bioinformatics.org / sms2 / rev_trans.html) can be used.

[0186] Such nucleic acids can also be used for pharmaceutical purposes, whereby RNA-derived molecules are administered to a patient, and the patient's protein expression machinery expresses the respective binding agent. The mRNA can be delivered, for example, in suitable liposomes, and contains either specific sequences or modified uridine nucleosides to avoid immune responses and / or improve folding and translation efficiency, and sometimes contains cap modifications at the 5' and / or 3' ends to target them to specific cell types.

[0187] Such nucleic acid molecules can be used to transfect an expression host and then express the actual binding agent. In such cases, the molecule may be a cDNA, optionally incorporated into a suitable vector.

[0188] According to another aspect of the present invention, a use (for the manufacture of a medicament) of the protein binder or nucleic acid provided above is provided for the treatment of a human or animal subject diagnosed with, suffering from, or at risk of developing an inflammatory disease, or for the prevention of such a condition.

[0189] To diagnose inflammatory diseases, patients may undergo a physical examination and a medical history. They may look for joint inflammation, joint stiffness, and decreased joint function. Additionally, clinicians may order x-rays and / or blood tests to detect inflammatory markers, such as serum hs-CRP, IL-6, TNF-α, IL-10, erythrocyte sedimentation rate, plasma viscosity, fibrinogen, and / or ferritin, compared with healthy controls.

[0190] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising a protein binder or a nucleic acid according to the above description, and optionally one or more pharmaceutically acceptable excipients.

[0191] According to another aspect of the present invention, there is provided a combination comprising (i) a protein binder or nucleic acid or pharmaceutical composition according to the above description and (ii) one or more therapeutically active compounds.

[0192] According to another aspect of the present invention, there is provided a method of treating or preventing an inflammatory condition, the method comprising administering to a human or animal subject (i) a protein binder as described above, (ii) a nucleic acid as described above, (iii) a pharmaceutical composition as described above, or (iv) a combination as described above, provided in a therapeutically sufficient dose.

[0193] According to one embodiment of the present invention, the inflammatory disease is rheumatoid arthritis (RA). According to another aspect of the present invention there is provided a kit for treatment of parts comprising: a) a protein binder as described above, a nucleic acid as described above, a pharmaceutical composition as described above, or a combination as described above; b) a device for administering the composition, composition or combination, and c) Instructions for use.

[0194] A further embodiment of the present invention relates to antibodies 47, 48, 50, 51 and 52 which the inventors have shown to have particular effects, as shown in the table below (+ means inhibitory effect, - means no inhibitory effect).

[0195] JPEG2025179064000004.jpg41170

[0196] The above table compares the properties of antibodies 47, 48, 50, 51, and 52 of the present invention on LPS-induced TNFα shedding and PMA-induced IL-6R and HB-EGF shedding in THP-1 cells. Antibodies 47, 48, 50, 51, and 52 of the present invention did not exhibit an inhibitory effect on LPS-induced TNFα release in THP-1 cells, while antibodies 47, 48, 50, and 51 of the present invention exhibited an inhibitory effect on PMA-induced IL-6R and HB-EGF release, but antibody 52 of the present invention did not exhibit an inhibitory effect. [Example]

[0197] While the invention has been illustrated and described in detail in the drawings and the foregoing description, such illustration and description are to be considered illustrative or exemplary and not restrictive, and the invention is not limited to the disclosed embodiments. Other variations to the disclosed embodiments can be understood and effected by those skilled in the art in practicing the claimed invention, from a study of the drawings, the disclosure, and the appended claims. In the claims, the word "comprising" does not exclude other elements or steps, and the indefinite article "a" or "an" does not exclude a plurality. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims should not be construed as limiting the scope.

[0198] All amino acid sequences disclosed herein are shown from N-terminus to C-terminus; all nucleic acid sequences disclosed herein are shown 5'->3'.

[0199] Example 1 Construction of expression vectors for immunization A total of eight expression vectors were constructed, three of which encoded different human iRhom2s and the remaining five encoded different mouse iRhom2 variants.

[0200] Gene synthesis was performed at Thermo Fisher Scientific GeneArt GmbH, Regensburg, Germany. Briefly, the submitted DNA sequence was optimized for maximum protein production using GeneOptimizer software. Genes were synthesized using synthetic oligonucleotides and assembled by primer extension-based PCR. The constructs were then cloned into standard cloning vectors and subsequently verified by sequencing. The fragments were subcloned into the pcDNA 3.1(+) expression vector (Thermo Fisher Scientific, USA). Plasmid DNA was purified from the transformed bacteria, and purity and concentration were determined by UV spectroscopy. The final constructs were verified by restriction enzyme mapping and sequencing.

[0201] Figure 1 shows the expression vectors used for immunization, including their designations, descriptions, amino acid sequences relative to the NCBI reference sequence NP_078875.4 for human iRhom2 and the NCBI reference sequence NP_766160.2 for mouse iRhom2, and their respective sequence identification numbers (SEQ ID NOs).

[0202] Example 2 Generation of iRhom2 knockout mice for immunization Due to the high sequence homology between human and mouse iRhom2 proteins (see NCBI reference sequence NP_078875.4 for human iRhom2 and NCBI reference sequence NP_766160.2 for mouse iRhom2), the amino acid sequence identities of extracellular loops 1, 2, 3, and the C-terminal tail of human iRhom2 are calculated to be 89.96%, 100.00%, 100.00%, and 96.97%, respectively), iRhom2 knockout rather than wild-type mice were bred for immunization.

[0203] Briefly, the Rhbdf2tm1b(KOMP)Wtsi mouse strain (Rhbdf2 is an alternative name for iRhom2) was ordered for resuscitation from the KOMP Mouse Biology Program at the University of California, Davis, and three heterozygous male mice became available. These three mice on a C57BL / 6N background (C57BL / 6N-Rhbdf2tm1b(KOMP)Wtsi) were crossed with wild-type female mice on a 129Sv / J genetic background to generate heterozygous offspring. These heterozygous mice were then crossed with each other to generate male and female mice with a conjugated knockout of the Rhbdf2 gene. The resulting conjugated Rhbdf2 knockout mouse colony was further expanded for immunization.

[0204] Example 3 Immunization of mice and serum titer analysis Ten cohorts of 8-12 week old male and female iRhom2 knockout mice (described in Example 2) were genetically immunized with pBT2-8HAX3-vectors encoding hi2-FL-WT, hi2-FL-I186T, hi2-Δ1-242, mi2-FL-WT & mi2-FL-I156T, mi2-Δ1-212, mi2-Δ1-268, hi2-FL-WT & mi2-FL-WT, hi2-Δ1-242 & mi2-Δ1-212, hi2-Δ1-242 & mi2-Δ1-268, and hi2-Δ1-242 & mi2-Δ1-212 & mi2-Δ1-268, respectively. TM Using a Gene Gun System (Biorad, USA), DNA-coated (approximately 5 μg of DNA) nanogold particles were administered in non-overlapping shots to the shaved skin of the animals.

[0205] Four to ten mice per cohort were injected 4 to 9 times every 7 days, and blood (serum) was collected 10 days after the last injection to test for antibody titers.

[0206] Immune responses were assessed by serum antibody titer analysis using the FACS method. Briefly, serum diluted 1:50 in PBS containing 3% FBS was tested on mouse L929 cells stably expressing human iRhom2 using goat F(ab')2 anti-mouse IgG(H+L)-R-phycoerythrin (RPE) conjugate (Dianova, Germany) as the secondary antibody. Parental L929 cells served as a negative control. Tests were performed using an Accuri C6 Plus (BD Biosciences, USA) flow cytometer. Pre-immune serum collected on day 0 of the immunization protocol served as a negative control.

[0207] Four days after the final booster immunization, lymph nodes of selected animals were harvested and lymphocytes were isolated and either used directly or cryopreserved for subsequent fusion.

[0208] Example 4 Lymphocyte collection and fusion for hybridoma generation Fresh or cryopreserved lymph node-derived lymphocytes from 6–15 selected animals were fused with Ag8 mouse myeloma cells to generate hybridoma cells. Fusion and subsequent cell expansion were performed in liquid or semi-solid medium. For fusion and expansion on semi-solid medium plates, IgM depletion and B cell enrichment were performed before plating. Advanced imaging with integrated robotics and data tracking was applied to automatically pick the highest-yielding clones using the CellCelector device (ALS, Germany) for further expansion and testing. For fusion and expansion in liquid medium, IgM depletion and B cell enrichment were not performed.

[0209] The fused cells were plated and grown in 96-well plates in the presence of hypoxanthine-aminopterin-thymidine (HAT) medium.

[0210] Example 5 Screening of hybridoma supernatants to select candidates This example describes an approach for screening hybridoma supernatants. Both functional and binding screens were performed. Therefore, we describe below the screening of hybridoma supernatants to examine their effect on TNFα shedding in THP-1 cells, the generation of murine L929 cells expressing different forms of human iRhom2, and the binding screens in these engineered test systems.

[0211] Functional screening for hybridoma supernatant candidates After 14 days of culture, the supernatants of the hybridoma cells were collected and subjected to functional screening of iRhom2 activity-neutralizing antibodies by ELISA. Because the crucial role of iRhom2 in TACE-mediated release of tumor necrosis factor α (TNFα) from macrophages is well established (McIlwain et al., 2012; Adrain et al., 2012; Siggs et al., 2012), we employed the human TNF-α DuoSet ELISA (R&D Systems, USA) to compare lipopolysaccharide (LPS)-induced release of endogenous TNFα from human THP-1 monocytic cells in the presence and absence of whole DNA immunization-derived hybridoma supernatants.

[0212] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated overnight at 4°C with 100 μl of mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) in TBS at 4 μg / ml per well. On day 2, the capture antibody solution was removed, and the MaxiSorp® plates were blocked with 300 μl of TBS, 1% BSA per well at room temperature for 3 hours. 20,000 THP-1 (American Type Culture Collection, USA) cells were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA) in 80 μl of standard growth medium and preincubated with 20 μl of hybridoma supernatant at 37°C and 5% CO2 for 30 minutes. In the control group, 20 μl of standard growth medium was added instead of hybridoma supernatant. The cells (except for the unstimulated control) were then stimulated with LPS (Sigma-Aldrich, USA) at a final concentration of 50 ng / ml in 300 ng / ml growth medium at 20 μl per well for 2 hours at 37°C and 5% CO2. The 96-well plate was then centrifuged to precipitate the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland). To avoid drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample. Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted to the specified concentration in TBS was added to the plate as a standard reference. Then, 100 μl per well of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added, and the plates were incubated for 2 hours at room temperature, protected from direct light.After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland, Carl Roth), and carefully removing all traces of buffer after the fourth cycle, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again protected from direct light. After washing four times again with 350 μl per well of TBS-T (Carl Roth, Germany) on a 96-head plate washer (Tecan Group, Switzerland), and carefully removing all traces of buffer after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) was added for 1 h incubation at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 PRO (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0213] Figure 2 shows a representative result of these experiments for one 96-well plate demonstrating the effect of hybridoma supernatants derived from DNA immunization on LPS-induced release of TNFα from THP-1 cells. Supernatant collected from the hybridoma cell population in plate number 14, row C, number 2 (14C2), which was the source of antibody 3 as a representative example of the selected candidate, effectively inhibited LPS-induced TNFα shedding in THP-1 cells.

[0214] Generation of cell populations for cell binding FACS analysis To generate a cell line suitable for comparable and reliable antibody binding analysis, L929 (NCTC clone 929) mouse fibroblasts (ATCC, USA) were genetically modified to knock out the mouse iRhom2 gene. The resulting L929 mouse iRhom2 knockout cell line was then transfected with different human iRhom2 constructs to obtain cell line derivatives stably expressing different human iRhom2 proteins, allowing binding analysis of different iRhom2 variants in the same genetic background.

[0215] Briefly, mRhbdf2.3 IVT gRNA (AAGCATGCTATCCTGCTCGC) (SEQ ID NO: 197) was synthesized at Thermo Fisher Scientific GeneArt GmbH, Regensburg, Germany. One day after seeding in 24-well plates, L929 parental cells were transfected with a mixture of gRNA and GeneArt Platinium Cas9 Nucelase (Thermo Fisher Scientific, USA) using Lipofectamine CRISPRMAX Transfection Reagent (Thermo Fisher Scientific, USA) according to the GeneArt CRISPR Nuclease mRNA User Guide (Thermo Fisher Scientific, USA). Three days after transfection, cells were lysed, and DNA was extracted for amplification of specific PCR products using the mRhbdf2.3fwd(TCAATGAGCTCTTTATGGGGCA) (SEQ ID NO: 195) / mRhbdf2.3rev(AAGGTCTCCATCCCCTCAGGTC) (SEQ ID NO: 196) primer pair (Thermo Fisher Scientific, USA). To select positive wells, the GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific, USA) was applied to samples that prominently displayed a single band of the correct size on an Invitrogen 2% E-Gel Size Select agarose gel (Thermo Fisher Scientific, USA). Cleavage assay PCR products were also analyzed on an Invitrogen 2% E-Gel Size Select agarose gel. The polyclonal L929 population identified by limiting dilution was subcloned twice using the Cleavage Detection Kit to identify positive subclones. Therefore, the most promising positive subclone identified in the first round, 1029, was further subcloned in the second round to finally obtain the clone designated 2041.The monoclonal cell population derived from this subclone was designated L929-2041 and was used for subsequent transfection with the human iRhom2 constructs hiR2-Δ242-T7 and hiR2-FL-WT-T7 (following the procedure described in Example 13) to generate two cell lines, L929-2041-hiR2-Δ242-T7 and L929-2041-hiR2-FL-WT-T7, respectively.

[0216] FACS analysis for validation of test system After selection, fluorescence-activated cell sorting (FACS) analysis was performed to confirm the plasma membrane localization of ectopically expressed human iRhom2 variants in genetically engineered mouse L929 cell populations.

[0217] Briefly, mouse L929-2041-EV control cells stably infected with pMSCV empty vector, L929-2041-hiR2-Δ242-T7 cells expressing a human iRhom2 variant lacking amino acids 1–242 and C-terminally tagged with three consecutive copies of the T7 epitope (MASMTGGQQMG), and L929-2041-hiR2-FL-T7 cells expressing the full-length wild-type human iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated approximately 3 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded at 100 μl per well. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm for 3 minutes at 4°C. For primary staining, cells were resuspended in either FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (Merck Millipore, USA) in FACS buffer at 100 μl per well and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl per well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl per well of FACS buffer. Finally, cells were resuspended in 150 μl of FACS buffer per well and incubated with BD Accuri TM C6 Analysis was performed using a Plus flow cytometer (Becton Dickinson, Germany).

[0218] Figure 3 shows representative results from this experiment. Compared to the control sample incubated with anti-mouse IgG secondary antibody alone (gray), co-incubation with anti-T7 tag antibody (black) revealed no background staining of L929-2041-EV control cells (left). On the other hand, anti-T7 tag antibody binding analysis revealed a strong increase in relative fluorescence intensity in L929-2041-hiR2-Δ242-T7 (center) and L929-2041-hiR2-FL-T7 (right) cells. This indicates that both T7-tagged variants of human iRhom2 (Δ242 deletion and full-length wild-type) are localized on the surface of these engineered cell populations, thus demonstrating their suitability as a screening system for antibody binding from hybridoma supernatants.

[0219] Binding screen for candidate selection of hybridoma supernatants The validated L929 cell population was then applied to systematically screen hybridoma supernatants for iRhom2-binding antibodies.

[0220] Briefly, L929-2041-EV control cells, L929-2041-hiR2-Δ242-T7 cells, and L929-2041-hiR2-FL-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5 Cells were seeded at 100 μl / well. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in 100 μl per well of FACS buffer alone (control) or hybridoma supernatant diluted 1:50 in FACS buffer and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, cells were resuspended in 150 μl of FACS buffer per well and incubated with BD Accuri TM C6 Analysis was performed using a Plus flow cytometer (Becton Dickinson, Germany).

[0221] Figure 4 shows representative results from these experiments. Incubation of the applied cell population (black) with the supernatant of hybridoma cell pool 14C2 (the primary material leading to antibody 3 of the present invention), a representative example of a selected candidate, resulted in no background staining of the L929-2041-EV control cells (left). In contrast, a shift in relative fluorescence intensity similar to or even stronger than that observed with the anti-T7 tag antibody was detected in L929-2041-hiR2-Δ242-T7 (center) and L929-2041-hiR2-FL-WT-T7 (left) cells, clearly demonstrating that the antibody from hybridoma supernatant 14C2 recognizes both forms of human iRhom2.

[0222] Example 6 Subcloning of hybridoma cell populations Since most of the hybridoma cell population appeared to be of oligoclonal origin, subcloning was performed using the classical broth dilution method to isolate monoclonal hybridoma cell pools.

[0223] Briefly, cells from oligoclonal hybridoma populations were counted and the dilution factor calculated to end up with an average of two cells per well of a 96-well plate. Cells were diluted appropriately, and wells containing a single cell population were identified by microscopic screening. After expanding these monoclonal hybridoma populations for approximately three weeks, supernatants were collected and compared for their inhibitory effect on LPS-induced release of TNFα from THP-1 cells as described in Example 5.1. Subclones found to significantly inhibit TNFα shedding were expanded and stocked.

[0224] Example 7 Purification of antibodies from monoclonal hybridomas After generation of a monoclonal hybridoma population, antibodies were purified from each hybridoma supernatant using affinity chromatography.

[0225] Briefly, supernatants collected from monoclonal hybridoma cells were loaded onto an equilibrated Protein G Sepharose pre-packed gravity flow column (Protein G GraviTrap TM The antibody was captured by loading the column onto a 1000-well plate (GE Healthcare, UK). The column was then washed once with binding buffer, and the trapped antibody was eluted with elution buffer (both buffers are provided as part of the Ab Buffer Kit; GE Healthcare, UK). The eluted fraction was then desalted using PD Miditrap G-25 columns (GE Healthcare, UK), and the purified sample was concentrated using Amicon Ultra-4 Centrifugal Filter Units (Sigma-Aldrich, USA) with a 30 kDa cutoff. Finally, the concentration of the purified protein was measured using a NanoDrop 2000 / c spectrophotometer (Thermo Fisher Scientific, USA).

[0226] Example 8 Isotyping of purified antibodies of the present invention As a next step, a mouse IgG / IgM ELISA was performed to determine the isotype of the purified antibodies of the present invention. Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated overnight at 4°C with 100 μl / well of 1 μg / ml TBS goat anti-mouse IgG+IgM (H+L) capture antibody (Thermo Fisher Scientific-Aldrich). On day 2, the capture antibody solution was removed, and the MaxiSorp® plates were blocked with 300 μl Pierce protein-free (TBS) blocking buffer (Thermo Fisher Scientific, USA) per well for 2 hours at room temperature. The blocking buffer was then removed, and the plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). Then, 100 μl of TBS was added per well as a blank and negative control, mouse IgG (Thermo Fisher Scientific, USA) and mouse IgM (Sigma-Aldrich, USA) antibodies at the indicated concentrations (1:2 titration starting from 1 μg / ml in TBS) as standard references, mouse IgG (Thermo Fisher Scientific, USA) and mouse IgM (Sigma-Aldrich, USA) antibodies at 3 μg / ml in TBS as positive and specificity controls, and purified antibodies of the present invention at 3 μg / ml in TBS were added to the wells and incubated at room temperature for 2 hours. The plate was then washed four times with 350 μl of TBS-T (Carl Roth, Germany) per well using a 96-head plate washer (Tecan Group, Switzerland). For isotype detection, half of the samples were protected from light and incubated with 100 μl / well of AP-conjugated goat anti-mouse IgM (Sigma-Aldrich, USA) or AP-conjugated goat anti-mouse IgG F(ab')2 fragment (Gianova, Germany) detection antibody diluted 1:5000 in TBS for 1.5 h at room temperature.Each well was washed four times with 350 μl of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland). After the final cycle, all traces of buffer were carefully removed. 100 μl of AttoPhos substrate solution (Promega, USA) was added and incubated for 10 min at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0227] Figure 5 shows the results of this experiment clearly demonstrating that antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 52, 54, 56, 57 of the invention are of the mouse IgG isotype.

[0228] Example 9 CDR sequencing of purified antibodies of the present invention All 18 antibodies of the present invention were sequenced. Total RNA was isolated from hybridoma cells according to the Ambion TRIzol® Reagent (Thermo Fisher Scientific, USA) technical manual. Total RNA was reverse transcribed into cDNA using isotype-specific antisense or universal primers according to the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Japan) technical manual. Heavy and light chain antibody fragments were amplified according to the standard operating procedure (SOP) for rapid amplification of cDNA ends (RACE) from GenScript. The amplified antibody fragments were separately cloned into the pCE2 TA / Blunt-zero standard cloning vector (Vazyme Biotech Co., Ltd., China). Colony PCR was performed to select clones with the correct insert size. A total of five clones for each antibody were sequenced using an Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific, USA).

[0229] Example 10 Affinity determination of purified antibodies of the present invention In this study, the affinity of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention to THP-1 cells, a human monocytic cell line that endogenously expresses iRhom2, was measured by indirect FACS Scatchard analysis.

[0230] Briefly, human THP-1 cells (American Type Culture Collection, USA) were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. The plate was centrifuged at 1,500 rpm for 3 minutes at 4°C to pellet the cells and remove the supernatant. For primary staining, cells were suspended in 100 μl per well of either FACS buffer alone (control) or serial 2-fold dilutions of purified antibodies of the present invention (3, 5, 16, 22, 34, 42, 43, 44, 48, and 50) in FACS buffer, starting at 40 μg / ml (22 concentrations in total), and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany). Prism8 software (GraphPad Software, USA) was used to calculate the KD values ​​of each antibody of the present invention.

[0231] Figure 6 shows representative results from this study, demonstrating that purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the invention had KD values ​​for binding to THP-1 cells in the subnanomolar to low nanomolar range.

[0232] Example 11 Generation of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts For various purposes, particularly the binding studies described in the Examples below, we needed cell lines that express specific iRhom variants of interest at defined levels in a background lacking endogenous iRhom1 or iRhom2 protein. To this end, we established mouse embryonic fibroblasts (MEFs) derived from double knockout mice (DKO) homozygously negative for both mouse iRhom1 and mouse iRhom2 (iRhom1 / 2- / -). This Example describes the mouse strains used to establish iRhom1 / 2- / - DKO MEFs and generate immortalized iRhom1 / 2- / - DKO MEF cell lines.

[0233] Mouse strains used to establish iRhom1 / 2- / - DKO MEFs Briefly, the Rhbdf2tm1b(KOMP)Wtsi mouse strain (C57BL / 6N-Rhbdf2tm1b(KOMP)Wtsi) on a C57BL / 6N background was obtained from the Knockout Mouse Project (KOMP) repository at the University of California, Davis (Rhbdf2 is an alternative name for iRhom2). Heterozygous male Rhbdf2tm1b mice were mated with wild-type female mice on a 129Sv / J genetic background to generate heterozygous offspring with a mixed genetic background (129Sv / J-C57BL / 6N). These heterozygous mice were then mated with each other to generate offspring homozygous for the Rhbdf2 gene deletion (Rhbdf2- / - mice, 129Sv / J-C57BL / 6N). The resulting homozygous Rhbdf2 knockout mouse colony was further expanded by mating Rhbdf- / - males with females to generate sufficient numbers of mice. Homozygous Rhbdf2- / - mice are fertile and have no obvious spontaneous pathological phenotypes.

[0234] Rhbdf1 knockout mice were obtained from the European Conditional Mouse Mutagenesis Program (EUCOMM) of the International Knockout Mouse Consortium (IKMC). The generation of these animals is described in Li et al., PNAS, 2015, doi:10.1073 / pnas.1505649112. Homozygous Rhbdf1- / - mice are fertile and have no obvious spontaneous pathological phenotypes.

[0235] Rhbdf1 and Rhbdf2 DKO mice (Rhbdf1 / 2- / - mice) were generated by crossing Rhbdf1- / - and Rhbdf2- / - mice to generate Rhbdf1+ / Rhbdf2+ / - double heterozygous mice. These were then crossed with Rhbdf2- / - mice to generate Rhbdf1+ / -Rhbdf2- / - animals, which were then crossed with each other to generate E14.5 embryos lacking both Rhbdf genes in the expected Mendelian proportion (1 / 4 of all embryos) for the generation of E13.5 Rhbdf1 / 2- / - DKO MEFs (Rhbdf1 / 2- / - DKO embryos) as described below.

[0236] Generation of immortalized cell lines of iRhom1 / 2- / - DKO MEFs Briefly, pregnant Rhbdf1+ / - Rhbdf2- / - females were sacrificed at E13.5. The uterine horns were removed into a dish containing ice-cold PBS. Using fine-tipped forceps, the embryos were separated from the maternal tissue, and each embryo was removed from the placenta. Each embryo was then dissected with a sharp scalpel, and all internal organs, including the liver, heart, lungs, and intestines, were removed. A 0.5 mm section of the tail was removed and transferred to a 1.5 ml Eppendorf tube for genomic DNA isolation and subsequent PCR genotyping to confirm the correct embryo genotype. The remaining embryonic tissue was then washed once with PBS and transferred to a tissue culture dish containing 2 ml of 0.25% Trypsin / EDTA. The tissue was extensively minced with two sterile scalpels, and the trypsin / cell mixture was incubated at 37°C for 15 min. Trypsinization was stopped by adding FCS-containing growth medium. To generate a single-cell suspension, the mixture was pipetted up and down, first five times with a 10 mL serological pipette, then five times with a 5 mL serological pipette, and finally several times with a fire-polished Pasteur pipette to further dissociate any remaining cell clusters. Cells from one embryo were then plated onto two 10 cm tissue culture plates. The next day, the medium was replaced with fresh medium and the cells were grown until they reached 90% confluence. Finally, the cells were expanded and stocked for future use.

[0237] To immortalize primary Rhbdf1 / 2- / - DKO MEFs, cells were transduced with a retroviral system using the pMSCV expression system (Clontech, USA). Briefly, pMSCV-Zeo-SV40 was generated as follows: the sequence encoding puromycin resistance was removed from the plasmid pMSCV-puro (Clontech, USA) and replaced with the sequence conferring zeocin resistance from the pcDNA3.1(+)Zeo vector (Thermo Fisher Scientific, USA). The retroviral packaging cell line GP2-293 (Clontech, USA) was combined with the envelope vector pVSV-G (Clontech, USA) and the pMSCV-Zeo-SV40 plasmid to generate a retrovirus encoding the SV40 large T-antigen. The virus was filtered and added to primary Rhbdf1 / 2- / - DKO MEFs plated at 50% confluence for 24 hours. Transduced Rhbdf1 / 2- / - DKO MEFs were then grown in growth medium without selection for 24 hours, then shifted to growth medium containing 100 μg / ml Zeocin. Cells were passaged when confluent and stockpiled for future use after 10 passages.

[0238] Example 12 Evaluation of mouse cross-reactivity of purified antibodies of the present invention Next, immortalized iRhom1 / 2- / - DKO MEFs were reconstituted with a tagged form of human iRhom2 to confirm target recognition by each purified antibody of the present invention (described in Example 5) and thereby validate the reconstituted iRhom1 / 2- / - DKO MEFs as an appropriate test system. Furthermore, iRhom1 / 2- / - DKO MEFs stably expressing a tagged form of mouse iRhom2 were generated to measure cross-reactivity of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention with the mouse ortholog of iRhom2.

[0239] Generation of iRhom1 / 2- / - DKO MEFs stably expressing T7-tagged human or mouse iRhom2 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5 Cells were seeded at 1000 kJ / well and incubated overnight at 37°C, 5% CO2. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. Using the calcium phosphate method, cells were transfected with 2 μg / ml of pMSCV (Clontech, USA) empty vector, pMSCV-hiR2-FL-WT-T7 encoding full-length wild-type human iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope (MASMTGGQQMG), or pMSCV-miR2-FL-WT-T7 encoding full-length wild-type mouse iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope, and incubated at 37°C, 5% CO2. After 7 hours, the cell supernatant was replaced with standard growth medium without chloroquine to stop the transfection, and the cells were incubated at 37°C, 5% CO2 for overnight virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated as target cells for retroviral infection in 6-well tissue culture plates (Greiner, Germany) at 1x10 cells per well using standard growth medium. 5The cells were seeded with 1000 cells and further incubated overnight at 37°C and 5% CO2. On day 3, the supernatants of Phoenix-ECO cells releasing pMSCV, pMSCV-hiR2-FL-WT-T7, or pMSCV-miR2-FL-WT-T7 ecosystem viruses were collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / - DKO MEFs, the virus-containing supernatants were added to target cells for 4 hours at 37°C and 5% CO2 for primary infection. Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after another 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was similarly performed. On day 4, the virus-containing cell supernatants were replaced with fresh standard growth medium. From day 5 onwards, cells were cultured in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) to select for immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector, MEF-DKO-hiR2-FL-WT-T7 cells stably expressing the full-length wild-type C-terminus of human iRhom2 tagged with three consecutive copies of the T7 epitope, and MEF-DKO-miR2-FL-WT-T7 cells stably expressing the full-length wild-type C-terminus of mouse iRhom2 tagged with three consecutive copies of the T7 epitope. The expanded cells were stocked for future use.

[0240] FACS analysis for test system validation and antibody characterization Briefly, immortalized MEF-DKO-EV control cells, MEF-DKO-hiR2-FL-WT-T7 cells, and MEF-DKO-miR2-FL-WT-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. The plate was centrifuged at 1,500 rpm at 4°C for 3 minutes to pellet the cells and remove the supernatant. For primary staining, the cells were resuspended in 100 μl per well of FACS buffer alone (control), mouse monoclonal anti-T7 IgG (Merck Millipore, USA) at 3 μg / ml in FACS buffer, or purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention, also at 3 μg / ml in FACS buffer, and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, the cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 hour protected from light. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0241] Figures 7a and 7b show representative results from this experiment. Compared to control samples incubated with anti-mouse IgG secondary antibody alone (Figures 7a & 7b, gray), co-incubation with anti-T7 tag antibody (Figure 7a, black) in MEF-DKO-EV control cells (Figure 7a, left) resulted in almost no background staining. On the other hand, binding analysis of anti-T7 tag antibody in MEF-DKO-hiR2-FL-WT-T7 (Figure 7a, middle) and MEF-DKO-miR2-FL-WT-T7 (Figure 7a, right) cells strongly increased the relative fluorescence intensity. This indicates that ectopically expressed human and mouse iRhom2 variants are localized on the surface of these genetically modified cell populations, thus validating them as a suitable test system for characterizing the antibodies of the present invention. Co-incubation of these cell populations with purified antibody 3 (Figure 7b, black), a representative purified antibody of the present invention, resulted in a strong shift in relative fluorescence intensity while completely eliminating background staining of MEF-DKO-EV control cells (Figure 7b, left). Similar to that observed with the anti-T7 tag antibody, purified antibody 3 of the present invention strongly bound to human iRhom2 variants on MEF-DKO-hiR2-FL-WT-T7 cells (Figure 7b, center), thereby confirming the results described in Example 5 for the supernatants of the corresponding hybridoma pools. On the other hand, no significant binding of purified antibody 3 of the present invention to MEF-DKO-miR2-FL-WT-T7 cells was detected (Figure 7b, right), providing evidence that purified antibody 3 of the present invention does not recognize the mouse iRhom2 variants detected on the cell surface with the anti-T7 tag antibody (Figure 7a, right). Similar results were obtained with purified antibodies 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention, demonstrating that none of these purified antibodies of the present invention cross-reacts with mouse iRhom2.

[0242] Example 13 Evaluation of the binding specificity of the purified antibodies of the present invention Based on the sequence homology between the human iRhom2 protein and its closely related family member, human iRhom1 (see NCBI reference sequence NP_078875.4 for human iRhom2 and NCBI reference sequence NP_071895.3 for human iRhom1; the amino acid sequence identities of extracellular loops 1, 2, and 3 and the C-terminal tail of human iRhom2 versus human iRhom1 are calculated to be 67.4%, 100.00%, 80.00%, and 63.64%, respectively), we next evaluated the binding specificity of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 to human iRhom2 and human iRhom1. To this end, we generated iRhom1 / 2- / - DKO MEFs stably expressing a tagged form of human iRhom1.

[0243] Generation of iRhom1 / 2- / - DKO MEFs stably expressing T7-tagged human iRhom1 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5 Cells were seeded at 1000 s / well and maintained overnight at 37°C and 5% CO2. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. Using the calcium phosphate method, cells were transfected with 2 μg / ml of pMSCV-hiR1-FL-WT-T7 (SEQ ID NO: 189), encoding full-length wild-type human iRhom1 C-terminally tagged with three consecutive copies of the T7 epitope, and incubated at 37°C and 5% CO2. After 7 hours, the cell supernatant was replaced with standard growth medium without chloroquine to stop the transfection, and the cells were incubated at 37°C and 5% CO2 for overnight virus production. In parallel, immortalized iRhom1 / 2- / - DKO MEFs were plated at 1 x 10 per well in a 6-well tissue culture plate (Greiner, Germany) using standard growth medium as target cells for retroviral infection. 5The cells were seeded with pMSCV-hiR1-FL-WT-T7 ecotrophic virus and further incubated overnight at 37°C and 5% CO2. On day 3, the supernatants from Phoenix-ECO cells releasing the pMSCV-hiR1-FL-WT-T7 ecotrophic virus were collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / - DKO MEFs, these supernatants were added to target cells for primary infection at 37°C and 5% CO2 for 4 hours. Simultaneously, Phoenix-ECO cells were reincubated with fresh medium and, after another 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was similarly performed. On day 4, the virus-containing cell supernatants were replaced with fresh standard growth medium. From day 5 onwards, cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) for selection of immortalized MEF-DKO-hiR1-FL-T7 cells stably expressing the full-length wild-type C-terminus of human iRhom1 tagged with three consecutive copies of the T7 epitope. The grown cells were stocked for future use.

[0244] FACS analysis for antibody characterization Briefly, MEF-DKO-miR2-FL-WT-T7 cells, in addition to the immortalized MEF-DKO-EV control cells and MEF-DKO-hiR2-FL-WT-T7 cells (previously described in Example 12), were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. The plate was centrifuged at 1,500 rpm at 4°C for 3 minutes to pellet the cells and remove the supernatant. For primary staining, the cells were resuspended in 100 μl per well of FACS buffer alone (control), mouse monoclonal anti-T7 IgG (Merck Millipore, USA) at 3 μg / ml in FACS buffer, or purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention, also at 3 μg / ml in FACS buffer, and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, the cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 hour protected from light. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0245] Figures 8a and 8b are representative of the results of these analyses. The strong increase in relative fluorescence intensity obtained on MEF-DKO-hiR1-FL-WT-T7 cells using the anti-T7 tag antibody (Figure 8a, left) compared with the staining of MEF-DKO-EV control cells (Figure 8a, left; same as Figure 7a, left) and MEF-DKO-hiR2-FL-WT-T7 cells (Figure 8a, middle; same as Figure 7a, middle) demonstrates that human iRhom1 variants, like human iRhom2 variants, are located on the surface of this engineered cell population, thus validating it as a suitable test system for characterizing the antibodies of the present invention. Among these, antibody 3, a representative example of the purified antibodies of the present invention, was observed to bind to human iRhom2 variants expressed in MEF-DKO-hiR2-FL-WT-T7 cells (Figure 8b, center; identical to Figure 7b, center), but as already shown in Example 12, no significant binding of purified antibody 3 of the present invention to MEF-DKO-hiR1-FL-WT-T7 cells was detected (Figure 8b, right), demonstrating that the human iRhom1 variants, the presence of which was confirmed on the cell surface using an anti-T7 tag antibody (Figure 8a, right), were not recognized by purified antibody 3 of the present invention. Similar results were obtained with purified antibodies 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention, demonstrating that none of these purified antibodies of the present invention recognize human iRhom1.

[0246] Example 14 Analysis of the inhibitory effect of the antibody of the present invention on LPS-induced TNFα shedding in vitro In the following test, a TNFα release assay was performed by ELISA to confirm the inhibitory effect of the purified antibody of the present invention on LPS-induced endogenous TNFα release from human THP-1 monocytic cells.

[0247] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well at 4 μg / ml in TBS overnight at 4°C. On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 3 hours at room temperature. Separately, 20,000 THP-1 (American Type Culture Collection, USA) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA) and preincubated for 30 minutes at 37°C, 5% CO2 in 20 μl / well of standard growth medium supplemented with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in a 100 μl sample), 50 μg / ml mouse IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration of 10 μg / ml in a 100 μl sample), or 50 μg / ml purified antibody of the present invention (final concentration of 10 μg / ml in a 100 μl sample). For stimulation controls, 20 μl of standard growth medium without test article was added. Cells (except for the unstimulated control) were then stimulated with 300 ng / ml LPS (Sigma-Aldrich, USA) in growth medium at a final concentration of 50 ng / ml (20 μl per well) for 2 hours at 37°C and 5% CO2. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland), carefully removing any traces of buffer after the fourth wash. Then, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was again incubated at room temperature for 30 minutes, away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0248] Figure 9 shows representative results from this experiment, showing the effect of test articles on LPS-induced TNFα release from THP-1 cells, as absolute values ​​(Figure 9A) and percent inhibition (Figure 9B). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited LPS-induced TNFα release by 96.2%, while the presence of an IgG isotype control did not significantly affect TNFα shedding. In contrast, purified antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention inhibited LPS-induced TNFα release from THP-1 cells by 71.2%, 69.0%, 65.4%, 78.8%, 27.3%, 76.7%, 74.8%, and 32.2%, respectively, at equivalent concentrations. Again, in contrast, the presence of purified antibodies 48 and 50 of the present invention did not significantly affect TNFα shedding, thus compared with the IgG isotype control.

[0249] Example 15 Epitope mapping of the purified antibody of the present invention based on species-specific sequence variations of human iRhom2 Currently, methods for mapping epitopes recognized by antibodies include X-ray cocrystallography, array-based oligopeptide scanning, hydrogen-deuterium exchange, and cross-linking mass spectrometry. Genetic approaches such as site-directed mutagenesis and high-throughput shotgun mutagenesis enable epitope mapping at single amino acid resolution. However, amino acid substitutions at random positions in proteins or with unrelated amino acids carry the risk of altering the protein's conformation or reducing its function, potentially leading to misinterpretation of whether the substituted amino acid contributes to the antibody epitope. To avoid these risks, a generally accepted approach is to replace individual amino acids in a protein with homologous amino acids from a family of structurally related proteins, i.e., orthologs or closely related species. These two points also apply to the purified anti-human iRhom2 antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention, because, as mentioned above, they have been shown not to cross-react with the mouse ortholog (Example 12) and not to bind to the closely related family member human iRhom1 (Example 13).

[0250] Therefore, as a first approach to identify single amino acids that contribute to the binding of our antibodies, we designed a set of plasmids containing 25 human iRhom2 variants with single amino acid substitutions relative to mouse iRhom2. These 25 substitutions reflect the fact that all amino acids in the extracellular portions, i.e., the juxtamembrane domain (JMD), large extracellular loop 1, and the C-terminus, are non-identical between human and mouse iRhom2. The introduction of amino acids at the corresponding positions in mouse iRhom2 instead of amino acids in human iRhom2 resulted in the following variants: hiR2-FL-R441K-T7, hiR2-FL-K443R-T7, hiR2-FL-V459I-T7, hiR2-FL-G481Q-T7, hiR2-FL-L488R-T7, hiR2-FL-L493I-T7, hiR2-FL-D496T-T7, hiR2-FL-H505R-T7, hiR2-FL-Q512L-T7, and hiR2-FL- R513K-T7,hiR2-FL-D528N-T7,hiR2-FL-M534S-T7,hiR2-FL-G540S-T7,hiR2-FL-R543Q-T7,hiR2-FL-T544P-T7,hiR2-FL-G546A-T7,hiR2- FL-A547V-T7, hiR2-FL-R582Q-T7, hiR2-FL-F588L-T7, hiR2-FL-M591I-T7, hiR2-FL-E594K-T7, hiR2-FL-E626D-T7, hiR2-FL-L657I-T7, and hiR2-FL-H835Y-T7 was obtained. When there was no corresponding amino acid in mouse iRhom2, the respective amino acid in human iRhom2 was deleted to give the variant hiR2-FL-P533--T7.

[0251] This example describes the generation of iRhom1 / 2- / - DKO MEF populations expressing 25 mouse iRhom2-related single amino acid substitution variants and their characterization in terms of cell surface localization and functional activity as indicators of proper protein conformation. This is followed by binding analysis of purified antibodies of the present invention to a panel of 25 genetically engineered MEF populations expressing human iRhom2 variants with mouse iRhom2-related single amino acid substitutions, including a variant lacking P533.

[0252] Generation of iRhom1 / 2- / - DKO MEFs stably expressing 25 T7-tagged human iRhom2 variants with single amino acid substitutions related to mouse iRhom2 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5Cells were seeded per well and maintained overnight at 37°C, 5% CO. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The cells were infected with 2 μg / ml of the following vectors: pMSCV-hiR2-FL-R441K-T7, pMSCV-hiR2-FL-K443R-T7, pMSCV-hiR2-FL-V459I-T7, pMSCV-hiR2-FL-G481Q-T7, pMSCV-hiR2-FL-L488R-T7, pMSCV-hiR2-FL-L493I-T7, pMSCV-hiR2-FL-D496T-T7, pMSCV-hiR2-FL-H505R-T7, pMSCV-hiR2-FL-Q512L-T7, and pMSCV-hiR2-FL-H505R-T7, pMSCV-hiR2-FL-Q512L-T7, encoding full-length human iRhom2 single amino acid substitutions C-terminally tagged with three consecutive copies of the T7 epitope (MASMTGGQQMG). R513K-T7,pMSCV-hiR2-FL-D528N-T7,pMSCV-hiR2-FL-P533--T7,pMSCV-hiR2-FL-M534S-T7,pMSCV-hiR2-FL-G54 0S-T7,pMSCV-hiR2-FL-R543Q-T7,pMSCV-hiR2-FL-T544P-T7,pMSCV-hiR2-FL-G546A-T7,pMSCV-hiR2-FL-A547V-T Cells were transfected with pMSCV-hiR2-FL-R582Q-T7, pMSCV-hiR2-FL-F588L-T7, pMSCV-hiR2-FL-M591I-T7, pMSCV-hiR2-FL-E594K-T7, pMSCV-hiR2-FL-E626D-T7, pMSCV-hiR2-FL-L657I-T7, and pMSCV-hiR2-FL-H835Y-T7 and incubated at 37°C, 5% CO. After 7 hours, the transfection was stopped by replacing the cell supernatant with standard growth medium without chloroquine, and the cells were incubated at 37°C, 5% CO for overnight virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated as target cells for retroviral infection in 6-well tissue culture plates (Greiner, Germany) at 1x10 cells per well using standard growth medium. 5The cells were seeded and further incubated at 37°C, 5% CO2 overnight. On the third day, the following cells were transfected: pMSCV-hiR2-FL-R441K-T7, pMSCV-hiR2-FL-K443R-T7, pMSCV-hiR2-FL-V459I-T7, pMSCV-hiR2-FL-G481Q-T7, pMSCV-hiR2-FL-L488R-T7, pMSCV-hiR2-FL-L493I-T7, pMSCV-hiR2-FL-D496T-T7, pMSCV-hiR2-FL-H505R-T7, pMSCV-hiR2-FL-Q512L-T7, pMSCV-hiR2-FL- R513K-T7,pMSCV-hiR2-FL-D528N-T7,pMSCV-hiR2-FL-P533--T7,pMSCV-hiR2-FL-M534S-T7,pMSCV-hiR2-FL-G540S-T 7,pMSCV-hiR2-FL-R543Q-T7,pMSCV-hiR2-FL-T544P-T7,pMSCV-hiR2-FL-G546A-T7,pMSCV-hiR2-FL-A547V-T7,pMSCV Supernatants from Phoenix ECO cells expressing pMSCV-hiR2-FL-R582Q-T7, pMSCV-hiR2-FL-F588L-T7, pMSCV-hiR2-FL-M591I-T7, pMSCV-hiR2-FL-E594K-T7, pMSCV-hiR2-FL-E626D-T7, pMSCV-hiR2-FL-L657I-T7, and pMSCV-hiR2-FL-H835Y-T7 ecotropic viruses were collected and filtered through a 0.45 μm CA filter. 4 μg / ml polybrene (Sigma-Aldrich, USA) was added. After removing the medium from immortalized iRhom1 / 2- / - DKO MEFs, these supernatants were added to target cells for 4 hours at 37°C and 5% CO2. Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after an additional 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was similarly performed. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium.From day 5 onwards, immortalized MEF-DKO-hiR2-FL-R441K-T7, MEF-DKO-hiR2-FL-K443R-T7, MEF-DKO-hiR2-FL-V459I-T7, MEF-DKO-hiR2-FL-G481Q-T7, MEF-DKO-hiR2-FL-L488R-T7, MEF-DKO-hiR2-FL-L493I-T7, MEF-DKO-hiR2-FL-D496T-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-Q512L-T7, and MEF-DKO-hiR2-FL-Q512L-T7 stably expressing full-length human iRhom2 single amino acid substitution variants tagged with three consecutive copies of the T7 epitope at the C-terminus. R513K-T7,MEF-DKO-hiR2-FL-D528N-T7,MEF-DKO-hiR2-FL-P533--T7,MEF-DKO-hiR2-FL-M534S-T7,MEF-DK O-hiR2-FL-G540S-T7,MEF-DKO-hiR2-FL-R543Q-T7,MEF-DKO-hiR2-FL-T544P-T7,MEF-DKO-hiR2-FL-G546A- For selection of T7, MEF-DKO-hiR2-FL-A547V-T7, MEF-DKO-hiR2-FL-R582Q-T7, MEF-DKO-hiR2-FL-F588L-T7, MEF-DKO-hiR2-FL-M591I-T7, MEF-DKO-hiR2-FL-E594K-T7, MEF-DKO-hiR2-FL-E626D-T7, MEF-DKO-hiR2-FL-L657I-T7, and MEF-DKO-hiR2-FL-H835Y-T7 cells, cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) and stocked for future use.

[0253] FACS analysis for test system validation Briefly, immortalized MEF-DKO-hiR2-FL-WT-T7 cells, MEF-DKO-miR2-FL-WT-T7 cells, and MEF-DKO-hiR2-FL-R441K-T7, MEF-DKO-hiR2-FL-K443R-T7, MEF-DKO-hiR2-FL-V459I-T7, MEF-DKO-hiR2-FL-G481Q-T7, MEF-DKO-hiR2-FL-L488R-T7, MEF-DKO-hiR2-FL-L493I-T7, MEF-DKO-hiR2-FL-D496T-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-Q512L ... R513K-T7,MEF-DKO-hiR2-FL-D528N-T7,MEF-DKO-hiR2-FL-P533--T7,MEF-DKO-hiR2-FL-M534S-T7,MEF-DKO-hiR2 -FL-G540S-T7,MEF-DKO-hiR2-FL-R543Q-T7,MEF-DKO-hiR2-FL-T544P-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-h iR2-FL-A547V-T7, MEF-DKO-hiR2-FL-R582Q-T7, MEF-DKO-hiR2-FL-F588L-T7, MEF-DKO-hiR2-FL-M591I-T7, MEF-DKO-hiR2-FL-E594K-T7, MEF-DKO-hiR2-FL-E626D-T7, MEF-DKO-hiR2-FL-L657I-T7, and MEF-DKO-hiR2-FL-H835Y-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 x 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in either FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (Merck Millipore, USA) in FACS buffer at 100 μl per well and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0254] Figure 10a shows representative results from this experiment, exemplified by the human iRhom2 variant hiR2-FL-P533--T7. Binding analysis of the anti-T7 tag antibody (black) and anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 (left), MEF-DKO-miR2-FL-WT-T7 (middle), and MEF-DKO-hiR2-FL-P533--T7 cells (right) revealed a relatively strong increase in relative fluorescence intensity. This indicates that the human iRhom2 variant hiR2-FL-P533--T7 is similarly expressed and localized on the surface of these cells as the human and mouse iRhom2 wild-type variants (left and middle). Similar results were obtained for MEF-DKO-hiR2-FL-R441K-T7,MEF-DKO-hiR2-FL-K443R-T7,MEF-DKO-hiR2-FL-V459I-T7,MEF-DKO-hiR2-FL-G481Q-T7,MEF-DKO-hiR2-FL-L 488R-T7,MEF-DKO-hiR2-FL-L493I-T7,MEF-DKO-hiR2-FL-D496T-T7,MEF-DKO-hiR2-FL-H505R-T7,MEF-DKO-hiR2-FL-Q512L-T7,MEF-DKO-hiR2-FL- R513K-T7,MEF-DKO-hiR2-FL-D528N-T7,MEF-DKO-hiR2-FL-M534S-T7,MEF-DKO-hiR2-FL-G540S-T7, MEF-DKO-hiR2-FL-R543Q-T7,MEF-DKO-hiR2-FL-T544P-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-h Expression and localization of other human iRhom2 full-length single amino acid substitution variants expressed in iR2-FL-A547V-T7, MEF-DKO-hiR2-FL-R582Q-T7, MEF-DKO-hiR2-FL-F588L-T7, MEF-DKO-hiR2-FL-M591I-T7, MEF-DKO-hiR2-FL-E594K-T7, MEF-DKO-hiR2-FL-E626D-T7, MEF-DKO-hiR2-FL-L657I-T7, and MEF-DKO-hiR2-FL-H835Y-T7 cells were also obtained.

[0255] TGFα ELISA for test system validation To test all 25 human iRhom2 variants containing mouse iRhom2-specific single amino acid substitutions or, as in the case of hiR2-FL-P533-, single amino acid deletions, MEF-DKO cell lines stably expressing these variants, generated as described in the preceding Examples, were subjected to TGFα shedding ELISA assays. To demonstrate the functionality of all variants, PMA-induced release of fusion TGFα was assessed, as an indicator of proper folding of these variants. Because the cells used in this assay were rescue variants of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts (described in Example 11), which were rescued by each human iRhom2 variant containing mouse iRhom2-specific single amino acid substitutions or deletions, the stably expressed iRhom2 variants were the only iRhom proteins expressed in these cells and therefore the only iRhoms contributing to TGFα shedding in these cells.

[0256] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 400 ng / ml mouse anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) in TBS overnight at 4°C.MEF-DKO-hiR2-FL-R441K-T7,MEF-DKO-hiR2-FL-K443R-T7,MEF-DKO-hiR2-FL-V459I-T7,MEF-DKO-hiR2-FL-G481Q-T7,MEF-DKO-hiR2-FL-L488 R-T7,MEF-DKO-hiR2-FL-L493I-T7,MEF-DKO-hiR2-FL-D496T-T7,MEF-DKO-hiR2-FL-H505R-T7,MEF-DKO-hiR2-FL-Q512L-T7,MEF-DKO-hiR2-FL- R513K-T7,MEF-DKO-hiR2-FL-D528N-T7,MEF-DKO-hiR2-FL-P533--T7,MEF-DKO-hiR2-FL-M534S-T7,MEF-DKO-hiR2 -FL-G540S-T7,MEF-DKO-hiR2-FL-R543Q-T7,MEF-DKO-hiR2-FL-T544P-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-h iR2-FL-A547V-T7,MEF-DKO-hiR2-FL-R582Q-T7,MEF-DKO-hiR2-FL-F588L-T7,MEF-DKO-hiR2-FL-M591I-T7,MEF-D KO-hiR2-FL-E594K-T7, MEF-DKO-hiR2-FL-E626D-T7, MEF-DKO-hiR2-FL-L657I-T7, and MEF-DKO-hiR2-FL-H835Y-T7 After electroporation of the cells with the hTGFα-FL-WT construct in the pcDNA3.1 vector backbone, approximately 35,000 MEF-DKO cells harboring human iRhom2 variants with mouse iRhom2-specific single amino acid substitutions or deletions were seeded in 100 μl of standard growth medium into each well of an F-bottom 96-well cell culture plate (Thermo Fisher Scientific, USA) using the 4D-Nucleofector System (Lonza, Switzerland). On day 2, the capture antibody solution was removed, and the MaxiSorp® plate was blocked with 300 μl per well of TBS, 1% BSA at room temperature for at least 1 hour.Meanwhile, the cells were washed once with PBS, and then 80 μl of OptiMEM medium (Thermo Fisher Scientific, USA) was added per well.

[0257] The cells (except for the unstimulated control) were then stimulated with 20 μl of PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml per well at 37°C and 5% CO2 for 1 hour. 20 μl of OptiMEM medium was added to the unstimulated control cells. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, after which 70 μl of cell-free supernatant was transferred per sample. Biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was then added at 37.5 ng / ml per well in TBS, and the plates were incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland), carefully removing all traces of buffer after the fourth wash, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated at room temperature for 30 minutes, again away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0258] Figure 10b shows the results of these TGFα release assays, and in contrast to the empty vector (EV) negative control population, in which no PMA-induced TGFα shedding was detected, all 25 human iRhom2 variants with mouse iRhom2-specific single amino acid substitutions or, as in the case of hiR2-FL-P533-, single amino acid deletions were able to induce TGFα shedding with PMA, indicating that they were functionally active and properly folded.

[0259] FACS analysis to characterize the binding of purified antibodies of the invention for epitope mapping purposes Briefly, immortalized MEF-DKO-hiR2-FL-WT-T7 cells, MEF-DKO-miR2-FL-WT-T7 cells, and MEF-DKO-hiR2-FL-R441K-T7, MEF-DKO-hiR2-FL-K443R-T7, MEF-DKO-hiR2-FL-V459I-T7, MEF-DKO-hiR2-FL-G481Q-T7, MEF-DKO-hiR2-FL-L488R-T7, MEF-DKO-hiR2-FL-L493I-T7, MEF-DKO-hiR2-FL-D496T-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-Q512L ... R513K-T7,MEF-DKO-hiR2-FL-D528N-T7,MEF-DKO-hiR2-FL-P533--T7,MEF-DKO-hiR2-FL-M534S-T7,MEF-DKO-hiR2 -FL-G540S-T7,MEF-DKO-hiR2-FL-R543Q-T7,MEF-DKO-hiR2-FL-T544P-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-h iR2-FL-A547V-T7, MEF-DKO-hiR2-FL-R582Q-T7, MEF-DKO-hiR2-FL-F588L-T7, MEF-DKO-hiR2-FL-M591I-T7, MEF-DKO-hiR2-FL-E594K-T7, MEF-DKO-hiR2-FL-E626D-T7, MEF-DKO-hiR2-FL-L657I-T7, and MEF-DKO-hiR2-FL-H835Y-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated approximately 3 x 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in 100 μl per well of either FACS buffer alone (control) or purified antibodies of the present invention (3, 5, 16, 22, 34, 42, 43, 44, 48, and 50) at 3 μg / ml in FACS buffer and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0260] Figure 11a shows representative results from this experiment. This figure shows analytical data from cells expressing the human iRhom2 variant hiR2-FL-P533-T7, an example of the entire panel of 25 human iRhom2 variants with single amino acid substitutions or deletions related to mouse iRhom2. The binding analysis of antibody 3 (black, upper panel), which has the TNFα release inhibitory effect as a representative example of an antibody of the present invention, or antibody 50 (black, lower panel), which does not have the TNFα release inhibitory effect, as well as an anti-mouse IgG secondary antibody (gray), to MEF-DKO-hiR2-FL-WT-T7 cells (left), MEF-DKO-miR2-FL-WT-T7 (middle), and MEF-DKO-hiR2-FL-P533-T7 cells (right). The results indicate that the deletion of the single amino acid proline 533 in human iRhom2 strongly impairs and thus contributes to the binding of antibody 3 of the present invention, which has an inhibitory effect on TNFα release (right, upper panel). In contrast, antibody 50, which does not inhibit TNFα release, does not affect its binding and therefore does not contribute to its effect (right, lower panel). For both antibodies, binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-miR2-FL-WT-T7 (center) served as positive and negative controls, respectively.

[0261] Figure 11b—an extension of Figure 11a—shows a summary of FACS analysis results for the full panel of 25 genetically engineered MEF populations expressing human iRhom2 variants with mouse iRhom2-specific single amino acid substitutions (including a variant deleted for P533) for antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have inhibitory effects on TNFα release, versus antibodies 48 and 50, which also have inhibitory effects on TNFα release. The binding rate of each antibody to wild-type human iRhom2 is represented as 100%. A 30-59% reduction in antibody binding to any variant is represented by light gray cells (marked "1"), a 60-95% loss of binding is represented by gray cells (marked "2"), and a loss of 95% or more of binding is represented by dark gray cells (marked "3"). These data showed that the pattern of amino acid positions involved in the binding of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention (excluding antibody 16 of the present invention), which have the effect of inhibiting TNFα release, to human iRhom2 is different from the pattern of amino acid positions contributing to the binding of antibodies 48 and 50, which do not have the effect of inhibiting TNFα release.

[0262] Example 16 Epitope mapping of the antibody of the present invention based on family member-specific sequence variations in the central region of the large extracellular loop of iRhom2 To complement Example 15, in a second approach, we designed a set of plasmids of 30 human iRhom2 variants with human iRhom1-related single amino acid substitutions to identify single amino acids that contribute to the binding of the antibodies of the invention. These 30 substitutions reflect amino acids in the central region of large extracellular loop 1 that are non-identical between human iRhom2 and human iRhom1. The variants in which amino acids at the corresponding positions in human iRhom1 were introduced instead of amino acids in human iRhom2 were: hiR2-FL-G498A-T7, hiR2-FL-Q502R-T7, hiR2-FL-I509V-T7, hiR2-FL-Q512S-T7, hiR2-FL-R513E-T7, hiR2-FL-K514E-T7, hiR2-FL-D515E-T7, hiR2-FL-E518S-T7, hiR2-FL-T522V-T7, hiR2-FL-F523W-T7, hiR2-FL-Q527P-T7, and hiR2-FL-D518S-T7. 528I--T7,hiR2-FL-D529H-T7,hiR2-FL-T530P-T7,hiR2-FL-G531S-T7,hiR2-FL-P532A-T7,hiR2-FL-S537E-T7,hiR2-FL-D538L-T7,hiR2-FL-L539 A-T7,hiR2-FL-Q541H-T7,hiR2-FL-T544Q-T7,hiR2-FL-S545F-T7,hiR2-FL-A547S-T7,hiR2-FL-T555V-T7,hiR2-FL-E557D-T7,hiR2-FL-A560S-T7 and hiR2-FL-S562E-T7. When there was no corresponding amino acid in human iRhom1, the respective amino acids in human iRhom2 were deleted, resulting in the following variants: hiR2-FL-M534--T7, hiR2-FL-D535--T7, and hiR2-FL-K536--T7.

[0263] This example describes the generation of iRhom1 / 2- / - DKO MEF populations expressing 30 human iRhom1-related single amino acid substitution variants and their characterization in terms of cell surface localization and functional activity as indicators of proper protein conformation. This example then describes the binding analysis of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention to a panel of 30 genetically engineered MEF populations expressing human iRhom2 variants with human iRhom1-related single amino acid substitutions, including variants lacking M534, D535, and K536.

[0264] Generation of iRhom1 / 2- / - DKO MEFs stably expressing 30 T7-tagged human iRhom2 variants with human iRhom1-related single amino acid substitutions Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5Cells were seeded at 1000 kJ / well and incubated overnight at 37°C, 5% CO2. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The calcium phosphate method was applied to the cells, and 2 μg / ml of pMSCV-hiR2-FL-G498A-T7, pMSCV-hiR2-FL-Q502R-T7, pMSCV-hiR2-FL-I509V-T7, pMSCV-hiR2-FL-Q512S-T7, and pMSCV-hiR2-FL-R513 encoding full-length human iRhom2 single amino acid substitutions C-terminally tagged with three consecutive copies of the T7 epitope (MASMTGGQQMG) was added. E-T7,pMSCV-hiR2-FL-K514E-T7,pMSCV-hiR2-FL-D515E-T7,pMSCV-hiR2-FL-E518S-T7,pMSCV-hiR2-FL-T522V-T7,pMS CV-hiR2-FL-F523W-T7,pMSCV-hiR2-FL-Q527P-T7,pMSCV-hiR2-FL-D528I--T7,pMSCV-hiR2-FL-D529H-T7,pMSCV-hiR2 -FL-T530P-T7,pMSCV-hiR2-FL-G531S-T7,pMSCV-hiR2-FL-P532A-T7,pMSCV-hiR2-FL-M534--T7,pMSCV-hiR2-FL-D53 5--T7,pMSCV-hiR2-FL-K536--T7,pMSCV-hiR2-FL-S537E-T7,pMSCV-hiR2-FL-D538L-T7,pMSCV-hiR2-FL-L539A-T7,pM Cells were transfected with SCV-hiR2-FL-Q541H-T7, pMSCV-hiR2-FL-T544Q-T7, pMSCV-hiR2-FL-S545F-T7, pMSCV-hiR2-FL-A547S-T7, pMSCV-hiR2-FL-T555V-T7, pMSCV-hiR2-FL-E557D-T7, pMSCV-hiR2-FL-A560S-T7, and pMSCV-hiR2-FL-S562E-T7 and incubated at 37°C with 5% CO. After 7 hours, the transfection was stopped by replacing the cell supernatant with standard growth medium without chloroquine, and the cells were incubated at 37°C with 5% CO for overnight virus production.In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated as target cells for retroviral infection at 1x10 per well in 6-well tissue culture plates (Greiner, Germany) using standard growth medium. 5The cells were seeded and further incubated at 37°C, 5% CO2 overnight. On the third day, the following cells were transfected: pMSCV-hiR2-FL-G498A-T7, pMSCV-hiR2-FL-Q502R-T7, pMSCV-hiR2-FL-I509V-T7, pMSCV-hiR2-FL-Q512S-T7, pMSCV-hiR2-FL-R513E-T7, pMSCV-hiR2-FL-K514E-T7, pMSCV-hiR2-FL-D515E-T7, and pMSCV-hiR2-FL-E518 S-T7,pMSCV-hiR2-FL-T522V-T7,pMSCV-hiR2-FL-F523W-T7,pMSCV-hiR2-FL-Q527P-T7,pMSCV-hiR2-FL-D528 I--T7,pMSCV-hiR2-FL-D529H-T7,pMSCV-hiR2-FL-T530P-T7,pMSCV-hiR2-FL-G531S-T7,pMSCV-hiR2-FL-P532 A-T7,pMSCV-hiR2-FL-M534--T7,pMSCV-hiR2-FL-D535--T7,pMSCV-hiR2-FL-K536--T7,pMSCV-hiR2-FL-S537 E-T7,pMSCV-hiR2-FL-D538L-T7,pMSCV-hiR2-FL-L539A-T7,pMSCV-hiR2-FL-Q541H-T7,pMSCV-hiR2-FL-T544 Supernatants from Phoenix ECO cells expressing Q-T7, pMSCV-hiR2-FL-S545F-T7, pMSCV-hiR2-FL-A547S-T7, pMSCV-hiR2-FL-T555V-T7, pMSCV-hiR2-FL-E557D-T7, pMSCV-hiR2-FL-A560S-T7, and pMSCV-hiR2-FL-S562E-T7 ecotropic viruses were collected and filtered through a 0.45 μm CA filter. 4 μg / ml polybrene (Sigma-Aldrich, USA) was added. After removing the medium from immortalized iRhom1 / 2- / - DKO MEFs, these supernatants were added to target cells for 4 hours at 37°C and 5% CO2. Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after an additional 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. Similarly, a third, but overnight, infection cycle was performed.On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5 onward, immortalized MEF-DKO-hiR2-FL-G498A-T7, MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-K514E-T7, and MEF-DKO-hiR2-FL-K515E-T7 stably expressed full-length human iRhom2 single amino acid substitutions tagged with three consecutive copies of the T7 epitope at the C-terminus. FL-D515E-T7,MEF-DKO-hiR2-FL-E518S-T7,MEF-DKO-hiR2-FL-T522V-T7,MEF-DKO-hiR2-FL-F523W-T7,MEF-DK O-hiR2-FL-Q527P-T7,MEF-DKO-hiR2-FL-D528I--T7,MEF-DKO-hiR2-FL-D529H-T7,MEF-DKO-hiR2-FL-T530P-T7 ,MEF-DKO-hiR2-FL-G531S-T7,MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR2-FL-M534--T7,MEF-DKO-hiR2-FL-D 535--T7,MEF-DKO-hiR2-FL-K536--T7,MEF-DKO-hiR2-FL-S537E-T7,MEF-DKO-hiR2-FL-D538L-T7,MEF-DKO-hiR For selection of 2-FL-L539A-T7, MEF-DKO-hiR2-FL-Q541H-T7, MEF-DKO-hiR2-FL-T544Q-T7, MEF-DKO-hiR2-FL-S545F-T7, MEF-DKO-hiR2-FL-A547S-T7, MEF-DKO-hiR2-FL-T555V-T7, MEF-DKO-hiR2-FL-E557D-T7, MEF-DKO-hiR2-FL-A560S-T7, and MEF-DKO-hiR2-FL-S562E-T7 cells, cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) and stocked for future use.

[0265] FACS analysis for test system validation Briefly, immortalized MEF-DKO-hiR2-FL-WT-T7 cells, MEF-DKO-hiR1-FL-WT-T7 cells, and MEF-DKO-hiR2-FL-G498A-T7, MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-D515E-T7, MEF-DKO-hiR2-FL-D516E-T7, MEF-DKO-hiR2-FL-D517E-T7, MEF-DKO-hiR2-FL-D518E-T7, MEF-DKO-hiR2-FL-D519E-T7, MEF-DKO-hiR2-FL-D520E-T7, MEF-DKO-hiR2-FL-D521E-T7, MEF-DKO-hiR2-FL-D522E-T7, MEF-DKO-hiR2-FL-D523E-T7, MEF-DKO-hiR2-FL-D524E-T7, MEF-DKO-hiR2-FL-D525E-T7, MEF-DKO-hiR2-FL-D526E-T7, MEF-DKO-hiR2-FL-D527E-T7, MEF-DKO-hiR2-FL-D528E-T7, MEF-DKO-hiR2-FL-D529E-T7, MEF-DKO-hiR2-FL-D529E-T7, MEF-D O-hiR2-FL-E518S-T7,MEF-DKO-hiR2-FL-T522V-T7,MEF-DKO-hiR2-FL-F523W-T7,MEF-DKO-hiR2-FL-Q527P -T7,MEF-DKO-hiR2-FL-D528I--T7,MEF-DKO-hiR2-FL-D529H-T7,MEF-DKO-hiR2-FL-T530P-T7,MEF-DKO-hiR 2-FL-G531S-T7,MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR2-FL-M534--T7,MEF-DKO-hiR2-FL-D535--T7,M EF-DKO-hiR2-FL-K536--T7,MEF-DKO-hiR2-FL-S537E-T7,MEF-DKO-hiR2-FL-D538L-T7,MEF-DKO-hiR2-FL-L 539A-T7,MEF-DKO-hiR2-FL-Q541H-T7,MEF-DKO-hiR2-FL-T544Q-T7,MEF-DKO-hiR2-FL-S545F-T7,MEF-DKO- hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-T555V-T7,MEF-DKO-hiR2-FL-E557D-T7,MEF-DKO-hiR2-FL-A560S-T7 and MEF-DKO-hiR2-FL-S562E-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in either FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (Merck Millipore, USA) in FACS buffer at 100 μl per well and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0266] Figure 12a shows representative results from this experiment, with the human iRhom2 variant hiR2-FL-L539A-T7 shown as an example. Binding analysis of the anti-T7 tag antibody (black) and anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 (left), MEF-DKO-hiR1-FL-WT-T7 (middle), and MEF-DKO-hiR2-FL-L539A-T7 (right) cells revealed a relatively strong increase in relative fluorescence intensity. This indicates that the human iRhom2 variant hiR2-FL-L539A-T7 is similarly expressed and localized on the surface of these cells as human iRhom2 and human iRhom1 wild-type (left and center) cells (right).Similar results were obtained with MEF-DKO-hiR2-FL-G498A-T7, MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-K514E-T7, and MEF-DKO-hiR2-FL-K515E-T7. O-hiR2-FL-D515E-T7,MEF-DKO-hiR2-FL-E518S-T7,MEF-DKO-hiR2-FL-T522V-T7,MEF-DKO-h iR2-FL-F523W-T7,MEF-DKO-hiR2-FL-Q527P-T7,MEF-DKO-hiR2-FL-D528I--T7,MEF-DKO-hiR 2-FL-D529H-T7,MEF-DKO-hiR2-FL-T530P-T7,MEF-DKO-hiR2-FL-G531S-T7,MEF-DKO-hiR2-F L-P532A-T7,MEF-DKO-hiR2-FL-S537E-T7,MEF-DKO-hiR2-FL-D538L-T7,MEF-DKO-hiR2-FL-Q 541H-T7,MEF-DKO-hiR2-FL-T544Q-T7,MEF-DKO-hiR2-FL-S545F-T7,MEF-DKO-hiR2-FL-A547 S-T7,MEF-DKO-hiR2-FL-T555V-T7,MEF-DKO-hiR2-FL-E557D-T7,MEF-DKO-hiR2-FL-A560S-T7 The same results were obtained for the expression and localization of other full-length human iRhom2 single amino acid substitution variants expressed in MEF-DKO-hiR2-FL-S562E-T7 cells, and MEF-DKO-hiR2-FL-M534-T7, MEF-DKO-hiR2-FL-D535-T7, and MEF-DKO-hiR2-FL-K536-T7 cells.

[0267] TGFα ELISA for test system validation To test all 30 human iRhom2 variants with human iRhom1-specific single amino acid substitutions or deletions, as in the case of hiR2-FL-M534-, hiR2-FL-D535-, and hiR2-FL-K536-, we subjected MEF-DKO cell lines stably expressing these variants, generated as described in the above examples, to a TGFα shedding ELISA assay. To demonstrate the functionality of all variants, we assessed PMA-induced release of nuclear-fused TGFα as an indicator of proper folding of these variants. The cells used in this assay were rescue variants of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts (described in Example 11), which were rescued by each human iRhom2 variant with human iRhom1-specific single amino acid substitution or deletion. Therefore, the stably expressed iRhom2 variants are the only iRhom proteins not expressed at all in these cells and therefore the only iRhoms contributing to TGFα shedding in these cells.

[0268] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 400 ng / ml mouse anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) in TBS overnight at 4°C.MEF-DKO-hiR2-FL-G498A-T7,MEF-DKO-hiR2-FL-Q502R-T7,MEF-DKO-hiR2-FL-I509V-T7,MEF-DKO-hiR2-FL-Q51 2S-T7,MEF-DKO-hiR2-FL-R513E-T7,MEF-DKO-hiR2-FL-K514E-T7,MEF-DKO-hiR2-FL-D515E-T7,MEF-DKO-hiR2- FL-E518S-T7,MEF-DKO-hiR2-FL-T522V-T7,MEF-DKO-hiR2-FL-F523W-T7,MEF-DKO-hiR2-FL-Q527P-T7,MEF-DKO -hiR2-FL-D528I--T7,MEF-DKO-hiR2-FL-D529H-T7,MEF-DKO-hiR2-FL-T530P-T7,MEF-DKO-hiR2-FL-G531S-T7, MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR2-FL-M534--T7,MEF-DKO-hiR2-FL-D535--T7,MEF-DKO-hiR2-FL-K53 6--T7,MEF-DKO-hiR2-FL-S537E-T7,MEF-DKO-hiR2-FL-D538L-T7,MEF-DKO-hiR2-FL-L539A-T7,MEF-DKO-hiR2- FL-Q541H-T7,MEF-DKO-hiR2-FL-T544Q-T7,MEF-DKO-hiR2-FL-S545F-T7,MEF-DKO-hiR2-FL-A547S-T7,MEF-DKO -hiR2-FL-T555V-T7,MEF-DKO-hiR2-FL-E557D-T7,MEF-DKO-hiR2-FL-A560S-T7 and MEF-DKO-hiR2-FL-S562E-T7 Cells were electroporated with the hTGFα-FLWT construct in the pcDNA3.F1 vector backbone, and approximately 35,000 MEF-DKO cells harboring human iRhom2 variants with human iRhom1-specific single amino acid substitutions or deletions were plated in 100 μl of standard growth medium in each well of an F-bottom 96-well cell culture plate (Thermo Fisher Scientific, USA) using the 4D-Nucleofector System (Lonza, Switzerland).On day 2, the capture antibody solution was removed, and the MaxiSorp® plate was blocked with TBS, 1% BSA (300 μl per well) at room temperature for at least 1 hour. Meanwhile, the cells were washed once with PBS, and then OptiMEM medium (Thermo Fisher Scientific, USA) (80 μl per well) was added.

[0269] The cells (except for the unstimulated control) were then stimulated with 20 μl of PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml per well at 37°C and 5% CO2 for 1 hour. 20 μl of OptiMEM medium was added to the unstimulated control cells. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, after which 70 μl of cell-free supernatant was transferred per sample. Biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was then added at 37.5 ng / ml per well in TBS, and the plates were incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland), carefully removing all traces of buffer after the fourth wash, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated at room temperature for 30 minutes, again away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0270] Figure 12b shows the results of these TGFα release assays, in contrast to the empty vector (EV) negative control population, in which no PMA-induced shedding of TGFα was detected, indicating that all 30 human iRhom2 variants with human iRhom1-specific single amino acid substitutions or deletions, as in the case of hiR2-FL-M534-, hiR2-FL-D535-, and hiR2-FL-K536-, are functionally active as TGFα shedding is induced by PMA, indicating that these variants are properly folded.

[0271] FACS analysis to characterize the binding of purified antibodies of the invention for epitope mapping purposes Briefly, immortalized MEF-DKO-hiR2-FL-G498A-T7, MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-I509V-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR2-FL-D515E-T7, and MEF-DKO-hiR2-FL-K515E-T7. E-T7,MEF-DKO-hiR2-FL-E518S-T7,MEF-DKO-hiR2-FL-T522V-T7,MEF-DKO-hiR2-FL-F523W-T7,MEF-DKO-hiR2 -FL-Q527P-T7,MEF-DKO-hiR2-FL-D528I--T7,MEF-DKO-hiR2-FL-D529H-T7,MEF-DKO-hiR2-FL-T530P-T7,MEF- DKO-hiR2-FL-G531S-T7,MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR2-FL-M534--T7,MEF-DKO-hiR2-FL-D535- -T7,MEF-DKO-hiR2-FL-K536--T7,MEF-DKO-hiR2-FL-S537E-T7,MEF-DKO-hiR2-FL-D538L-T7,MEF-DKO-hiR2-F L-L539A-T7,MEF-DKO-hiR2-FL-Q541H-T7,MEF-DKO-hiR2-FL-T544Q-T7,MEF-DKO-hiR2-FL-S545F-T7,MEF-DK O-hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-T555V-T7,MEF-DKO-hiR2-FL-E557D-T7,MEF-DKO-hiR2-FL-A560S-T7 and MEF-DKO-hiR2-FL-S562E-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were suspended in 100 μl per well of either FACS buffer alone (control) or purified antibodies of the present invention (3, 5, 16, 22, 34, 42, 43, 44, 48, and 50) at 3 μg / ml in FACS buffer and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0272] Figure 13a shows representative results from this experiment. For example, the analysis data for cells expressing the human iRhom2 variant hiR2-FL-L539A-T7 are shown for a panel of 30 human iRhom2 variants with single amino acid substitutions or deletions related to human iRhom1. Binding analysis of antibody 3 (black, upper panel), a representative example of an antibody of the present invention with TNFα release inhibitory activity, or antibody 50 (black, lower panel), which does not have TNFα release inhibitory activity, and an anti-mouse IgG secondary antibody (gray) to MEF-DKO-hiR2-FL-WT-T7 cells (left), MEF-DKO-hiR1-FL-WT-T7 (middle), and MEF-DKO-hiR2-FL-L539A-T7 cells (right) demonstrates that substituting the single amino acid leucine 539 of human iRhom2 with alanine strongly impairs the TNFα release inhibitory activity of antibody 3 of the present invention, thus contributing to binding (right, upper panel). On the other hand, it has no inhibitory effect on TNFα release and therefore does not contribute to the binding of antibody 50 (right, lower panel). For both antibodies, binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR1-FL-WT-T7 (center) was used as a positive and negative control, respectively.

[0273] Figure 13b—an extension of Figure 13a—summarizes the results of FACS analysis of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which inhibit TNFα release, and antibodies 48 and 50, which do not inhibit TNFα release, for a full panel of 30 genetically engineered MEF populations expressing human iRhom2 variants with human iRhom1-specific single amino acid substitutions (including variants lacking M534, D535, and K536). The binding rate of each antibody to wild-type human iRhom2 is set to 100%. A 30-59% reduction in antibody binding to any variant is indicated by light gray cells (marked "1"), a 60-95% loss of binding is indicated by gray cells (marked "2"), and a loss of 95% or more of binding is indicated by dark gray cells (marked "3"). These data revealed that the pattern of amino acid positions associated with the binding of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have the effect of inhibiting TNFα release, to human iRhom2 (excluding antibody 16 of the present invention) is different from the pattern of amino acid positions contributing to the binding of antibodies 48 and 50, which do not have the effect of inhibiting TNFα release.

[0274] Example 17 Analysis of the inhibitory effect of the antibody of the present invention on LPS-induced TNFα shedding in vitro In contrast to Example 14, in which purified antibodies of the invention derived from hybridoma supernatants were tested in a TNFα release assay by ELISA, in this analysis, recombinantly produced antibodies of the invention were used to test their inhibitory effect on LPS-induced endogenous TNFα release from human THP-1 monocytic cells.

[0275] For recombinant antibody production, target DNA sequences were designed, optimized, and synthesized. The complete sequences were subcloned into the pcDNA3.4 vector (Thermo Fisher Scientific, USA), and transfection-grade plasmids were prepared for expression in Expi293F (Thermo Fisher Scientific, USA) cells. Expi293F cells were cultured in serum-free Expi293F™ Expression Medium (Thermo Fisher Scientific, USA) in Erlenmeyer flasks (Corning Inc, USA) at 37°C and 8% CO2 on an orbital shaker (VWR Scientific, Germany). One day before transfection, cells were seeded at the appropriate density into new Erlenmeyer flasks. On the day of transfection, DNA and transfection reagent were mixed at the optimal ratio and added to the flask containing the cells ready for transfection. Recombinant plasmids encoding the target proteins were transiently transfected into suspension Expi293F cell cultures. The cell culture supernatant collected 6 days after transfection was used for purification. The cell culture broth was centrifuged and filtered. The filtered cell culture supernatant was purified using HiTrap MabSelect SuRe (GE Healthcare, UK), MabSelect SuRe TM The protein was loaded onto an LX (GE Healthcare, UK) or RoboColumn Eshmuno A (Merck Millipore, USA) affinity purification column at an appropriate flow rate. After washing and elution with the appropriate buffer, the eluted fractions were pooled and buffer-exchanged into the final formulation buffer. The purified protein was analyzed by SDS-PAGE to determine its molecular weight and purity. Finally, the concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

[0276] The ELISA-based TNFα release assay used in this example is identical to that described in Example 14.

[0277] Figure 14 shows representative results from this experiment, showing the effect of test articles on LPS-induced TNFα release from THP-1 cells, both in absolute numbers (Figure 14A) and as percent inhibition (Figure 14B). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited LPS-induced TNFα release by 96.2%, while the presence of an IgG isotype control did not significantly affect TNFα shedding. In contrast, equivalent concentrations of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 49, 54, 56, and 57 of the present invention inhibited LPS-induced TNFα release from THP-1 cells by 59.9%, 70.5%, 70.7%, 78.4%, 73.8%, 75.9%, 78.5%, 73.2%, 36.1%, 59.9%, 67.9%, 65.8%, and 59.7%, respectively. Again, in contrast, and thus compared to the IgG isotype control, the presence of purified antibodies 47, 48, 50, 51, and 52 of the present invention does not significantly affect TNFα shedding.

[0278] Example 18 Evaluation of cross-reactivity of the antibodies of the present invention with different species Next, we generated iRhom1 / 2- / - DKO MEFs stably expressing tagged forms of iRhom2 from rhesus monkeys, cynomolgus monkeys, dogs, or rabbits to measure cross-reactivity of the antibodies with their respective orthologs of iRhom2. We also generated iRhom1 / 2- / - DKO MEFs stably expressing tagged forms of iRhom1 from rhesus monkeys, cynomolgus monkeys, dogs, or rabbits to confirm the specificity for iRhom2 versus iRhom1 in these species.

[0279] Generation of iRhom1 / 2- / - DKO MEFs stably expressing T7-tagged rhesus, cynomolgus, dog, or rabbit iRhom2. Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5Cells were seeded per well and maintained overnight at 37°C, 5% CO. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. Using the calcium phosphate method, cells were transfected with 2 μg / ml of pMSCV (Clontech, USA) empty vector, pMSCV-rhesus-iR2-FL-WT-T7 encoding full-length wild-type rhesus iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope, pMSCV-cyno-iR2-FL-WT-T7 encoding full-length wild-type cyno iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope, pMSCV-dog-iR2-FL-WT-T7 encoding full-length wild-type dog iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope, or pMSCV-rabbit-iR2-FL-WT-T7 encoding full-length wild-type rabbit iRhom2 C-terminally tagged with three consecutive copies of the T7 epitope. The transfected cells were incubated at 37°C in 5% CO2. After 7 hours, the transfection was stopped by replacing the cell supernatant with standard growth medium without chloroquine, and the cells were incubated at 37°C, 5% CO2 for overnight virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated at 1x10 per well in a 6-well tissue culture plate (Greiner, Germany) using standard growth medium as target cells for retroviral infection. 5The cells were seeded with iRhom1 / 2- / - DKO MEFs and incubated overnight at 37°C and 5% CO2. On day 3, the supernatants of Phoenix ECO cells expressing pMSCV, pMSCV-rhesus-iR2-FL-WT-T7, pMSCV-cyno-iR2-FL-WT-T7, pMSCV-dog-iR2-FL-WT-T7, or pMSCV-rabbit-iR2-FL-WT-T7 ecotropic viruses were collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / - DKO MEFs, the virus-containing supernatants were added to target cells and allowed to infect for 4 hours at 37°C and 5% CO2. Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after an additional 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was similarly performed. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5 onwards, 2 mg / ml Genetin was used to select for immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector, pMSCV-rhesus-iR2-FL-WT-T7 cells stably expressing the full-length wild-type C-terminus of rhesus iRhom2 tagged with three consecutive copies of the T7 epitope, pMSCV-cyno-iR2-FL-WT-T7 cells stably expressing the full-length wild-type C-terminus of cyno iRhom2 tagged with three consecutive copies of the T7 epitope, pMSCV-dog-iR2-FL-WT-T7 cells stably expressing the full-length wild-type C-terminus of canine iRhom2 tagged with three consecutive copies of the T7 epitope, or pMSCV-rabbit-iR2-FL-WT-T7 cells stably expressing the full-length wild-type C-terminus of rabbit iRhom2 tagged with three consecutive copies of the T7 epitope. Cells were grown in the presence of HCl (G418, Thermo Fisher Scientific, USA). The expanded cells were stocked for future use. In parallel, iRhom1 / 2- / - DKO MEFs stably expressing tagged forms of iRhom1 from rhesus, cynomolgus, dog, and rabbit were generated in a similar manner.

[0280] FACS analysis for test system validation and antibody characterization Briefly, immortalized MEF-DKO-EV control cells, MEF-DKO-rhesus-iR2-FL-WT-T7 cells, MEF-DKO-cyno-iR2-FL-WT-T7 cells, MEF-DKO-dog-iR2-FL-WT-T7 cells, and MEF-DKO-rabbit-iR2-FL-WT-T7 cells, as well as their respective iRhom1 counterparts, were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 3 × 10 cells in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5 Cells were seeded at 2000 x g / well. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in 100 μl per well of either FACS buffer alone (control), mouse monoclonal anti-T7 IgG (Merck Millipore, USA) at 3 μg / ml in FACS buffer, or one of the antibodies of the present invention at 3 μg / ml in FACS buffer, and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0281] Figures 18a, 18b, 18c & 18d are representative results of this experiment. Compared to control samples incubated with secondary antibody only (18a, 18b, 18c & 18d, grey), MEF-DKO-rhesus-iR2-FL-WT-T7 cells, MEF-DKO-cyno-iR2-FL-WT-T7 cells, MEF-DKO-dog-iR2-FL-WT-T7 cells and MEF-DKO-rabbit-iR2-FL-WT-T7 cells were stained with IgG. The relative fluorescence intensity on the cells was strongly shifted, demonstrating that antibody 16 of the present invention, as a representative example of antibodies 3, 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 54, 56, and 57, binds strongly to the rhesus iRhom2 variant (Figure 18a, black, right), cynomolgus iRhom2 variant (Figure 18b, black, right), dog iRhom2 variant (Figure 18c, black, right), and rabbit iRhom2 variant (Figure 18d, black, right), respectively. On the other hand, antibody 16 of the present invention, which is a representative example of the antibodies of the present invention (excluding antibody 52), did not detectably bind to MEF-DKO-rhesus-iR1-FL-WT-T7 cells, MEF-DKO-cyno-iR1-FL-WT-T7 cells, MEF-DKO-dog-iR1-FL-WT-T7 cells, or MEF-DKO-rabbit-iR1-FL-WT-T7 cells, providing evidence that rhesus iRhom1 variants (Figure 18a, black, left), cynomolgus iRhom1 variants (Figure 18b, black, left), dog iRhom1 variants (Figure 18c, black, left), and rabbit iRhom1 variants (Figure 18d, black, left), respectively, are not recognized by antibody 16 of the present invention. The aforementioned cross-reactivity to different iRhom2 orthologs and the specificity for iRhom2 versus iRhom1 in these species are depicted in each figure for both the murine (upper panel) and chimeric (lower panel) versions of antibody 16.

[0282] Example 19 Evaluation of mouse cross-reactivity of purified antibodies of the present invention In addition to Example 12, where a T7-tagged iRhom variant is described, immortalized iRhom1 / 2- / - DKO MEFs were reconstituted with a FLAG-tagged form of human iRhom2 to confirm target recognition by the antibodies of the present invention. Furthermore, to measure cross-reactivity of the antibodies of the present invention with the mouse ortholog of iRhom2, iRhom1 / 2- / - DKO MEFs stably expressing a FLAG-tagged form of mouse iRhom2 were generated.

[0283] We generated iRhom1 / 2- / - DKO MEFs stably expressing FLAG-tagged human or mouse iRhom2. Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5 Cells were seeded at 1000 kJ / well and incubated overnight at 37°C, 5% CO2. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. Using the calcium phosphate method, cells were transfected with 2 μg / ml of pMSCV (Clontech, USA) empty vector, pMSCV-hiR2-FL-WT-FLAG encoding full-length wild-type human iRhom2 C-terminally tagged with a triple-FLAG epitope (DYKDHDGDYKDHDIDYKDDDDK), or pMSCV-miR2-FL-WT-FLAG encoding full-length wild-type mouse iRhom2 C-terminally tagged with a triple-FLAG epitope (DYKDHDGDYKDHDIDYKDDDDK). The cells were then incubated at 37°C, 5% CO2. After 7 hours, the cell supernatant was replaced with standard growth medium without chloroquine to terminate the transfection. The cells were then incubated at 37°C, 5% CO2 for overnight virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated as target cells for retroviral infection in 6-well tissue culture plates (Greiner, Germany) at 1x10 cells per well using standard growth medium. 5The cells were seeded with 1000 cells and further incubated overnight at 37°C and 5% CO2. On day 3, the supernatant of Phoenix ECO cells releasing pMSCV, pMSCV-hiR2-FL-WT-FLAG, or pMSCV-miR2-FL-WT-FLAG ecotropic viruses was collected, filtered through a 0.45 μm CA filter, and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA). After removing the medium from the immortalized iRhom1 / 2- / - DKO MEFs, the virus-containing supernatant was added to target cells for 4 hours at 37°C and 5% CO2 for primary infection. Simultaneously, Phoenix-ECO cells were reincubated with fresh medium and, after another 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was similarly performed. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5 onwards, cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) to select for immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector, MEF-DKO-hiR2-FL-WT-FLAG cells stably expressing full-length wild-type human iRhom2 C-terminally tagged with triple-FLAG epitopes, and MEF-DKO-miR2-FL-WT-FLAG cells stably expressing full-length wild-type mouse iRhom2 C-terminally tagged with triple-FLAG epitopes. The grown cells were stocked for future use.

[0284] FACS analysis for test system validation and antibody characterization Briefly, immortalized MEF-DKO-EV control cells, MEF-DKO-hiR2-FL-WT-FLAG cells, and MEF-DKO-miR2-FL-WT-FLAG cells were harvested with 10 mM EDTA in PBS, washed, and resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide) at approximately 3 × 10 cells per well. 5Cells were seeded into Nunc U-bottom 96-well plates (Thermo Fisher Efficiency, USA). To pellet the cells and remove the supernatant, the plates were centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in 100 μl per well of either FACS buffer alone (control), mouse monoclonal anti-FLAG IgG (Sigma-Aldrich, USA) at 3 μg / ml in FACS buffer, or one of the antibodies of the present invention at 3 μg / ml in FACS buffer, and incubated on ice for 1 hour. The plates were then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl per well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 hour protected from light. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0285] Figures 19a and 19b show representative results from this experiment. Compared with control samples incubated with anti-mouse IgG secondary antibody alone (19a & 19b, gray), co-incubation with anti-FLAG tag antibody (Figure 19a, black) eliminated background staining in MEF-DKO-EV control cells (Figure 19a, left). Meanwhile, binding analysis of anti-FLAG tag antibody in MEF-DKO-hiR2-FL-WT-FLAG (Figure 19a, middle) and MEF-DKO-miR2-FL-WT-FLAG (Figure 19a, right) cells revealed a strong increase in relative fluorescence intensity. This indicates that ectopically expressed human and mouse iRhom2 orthologs are localized on the surface of these engineered cell populations, thus validating them as a suitable test system for evaluating the properties of the antibodies of the present invention. Co-incubation of these cell populations with antibody 3 (Figure 19b, black), a representative example of an antibody of the present invention, did not result in any background staining of MEF-DKO-EV control cells (Figure 19b, left). Meanwhile, a strong shift in relative fluorescence intensity in MEF-DKO-hiR2-FL-WT-FLAG cells, similar to that observed with the anti-FLAG tag antibody, indicates that antibody 3 of the present invention strongly binds to human iRhom2 (Figure 19b, center). On the other hand, no significant binding of antibody 3 of the present invention to MEF-DKO-miR2-FL-WT-FLAG cells was detected (Figure 19b, right), providing evidence that antibody 3 of the present invention does not recognize mouse iRhom2, whose presence on the cell surface was confirmed with the anti-FLAG tag antibody (Figure 19a, right). Similar results were obtained with antibodies 5, 16, 22, 34, 42, 43, 44, 46, 47, 48, 49, 50, 51, 54, 56 and 57 of the present invention, demonstrating that none of these antibodies of the present invention cross-react with mouse iRhom2.

[0286] Example 20 Evaluation of the binding specificity of the antibodies of the present invention in cell lines endogenously expressing iRhom2 In this study, the binding specificity of hybridoma supernatants leading to antibody 16 of the present invention, which is a representative example of antibodies 3, 16, 22, and 42 of the present invention, and antibody 16 of the present invention, which is a representative example of antibodies 16, 22, and 42 of the present invention, was analyzed in cell lines that endogenously express iRhom2. Tests were performed on RPMI-8226 cells, a human B lymphocyte cell line that endogenously expresses iRhom2 but is negative for endogenous iRhom1, THP-1 cells, a human monocytic cell line that endogenously expresses both iRhom2 and iRhom1, and RH-30 cells, a human fibroblast cell line that is negative for endogenous iRhom2 but endogenously expresses iRhom1.

[0287] Briefly, human RPMI-8226 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Germany), THP-1 cells (American Type Culture Collection, USA), and RH-30 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Germany) were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 2 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Plates were seeded at 100 μl per well. To pellet the cells and remove the supernatant, plates were centrifuged at 1,500 rpm and 4°C for 3 minutes. For primary staining, cells were resuspended in 100 μl per well of either FACS buffer alone (control), a 1:60 dilution of hybridoma supernatant, primary material leading to antibodies 3, 16, 22, and 42 of the present invention in FACS buffer, or 3 μg / ml of antibodies 16, 22, and 42 of the present invention in FACS buffer and incubated on ice for 1 hour. Plates were then centrifuged at 1,500 rpm and 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl per well of PE-conjugated goat anti-mouse IgG F(ab')2 or goat anti-human IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 hour protected from light. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0288] Figures 20a and 20b are representative results from this study. Compared to control samples incubated with secondary antibody only (20a and 20b, gray), co-incubation of both RPMI-8226 and THP-1 cells, which endogenously express iRhom2, with hybridoma supernatants linked to antibody 16, a representative example of antibodies 3, 16, 22, and 42 of the present invention (20a, left & right). Figure 20b, left & middle, black (Figure 20b, left & middle, black) or antibody 16, a representative example of antibodies 16, 22, and 42 of the present invention, resulted in a strong shift in relative fluorescence intensity in both cell lines, demonstrating strong binding of both the primary material linked to antibody 16 and antibody 16 of the present invention to two human cell lines endogenously positive for iRhom2. In contrast, no binding was detected to RH-30 cells, which do not express iRhom2, by the primary material leading to antibody 16, which is representative of antibodies 3, 16, 22, and 42 of the present invention (Figure 20a, right, black) or antibody 16, which is representative of antibodies 16, 22, and 42 of the present invention (Figure 20b, right, black), providing evidence that endogenously expressed iRhom2 is specifically recognized by both the primary material leading to antibody 16 of the present invention and antibody 16 of the present invention. The aforementioned specificity of iRhom2 versus iRhom1 for endogenously expressed proteins is depicted in Figure 20b for both the mouse version (upper panel) and the chimeric version (lower panel) of antibody 16.

[0289] Example 21 iRhom2: Epitope mapping of the antibody of the present invention based on family member-specific sequence mutations in the N-terminal central region of the large extracellular loop To complement Examples 15 and 16, in a third approach, we designed a set of plasmids of 23 human iRhom2 variants with single amino acid substitutions relative to human iRhom1 to identify single amino acids that contribute to the binding of the antibodies of the invention. These 23 substitutions reflect amino acids at the N-terminus of the central region of the large extracellular loop 1 that are non-identical between human iRhom2 and human iRhom1. The variants in which amino acids at the corresponding positions in human iRhom1 were introduced instead of amino acids in human iRhom2 were hiR2-FL-A431S-T7, hiR2-FL-V434E-T7, hiR2-FL-T436V-T7, hiR2-FL-Q437D-T7, hiR2-FL-L438S-T7, hiR2-FL-S448N-T7, hiR2-FL-I452V-T7, hiR2-FL-I464E-T7, hiR2-FL-D465A-T7, hiR2-FL-I477M-T7, and hiR2-FL-I477M-T7. 2-FL-K479Q-T7,hiR2-FL-G481P-T7,hiR2-FL-I483V-T7,hiR2-FL-E484H-T7,hiR2-FL-Q485S-T7,hiR2-FL-L486F-T7,hiR2-FL-V487 I-T7, hiR2-FL-R489S-T7, hiR2-FL-E490A-T7, hiR2-FL-D492E-T7, hiR2-FL-L493R-T7, hiR2-FL-R495K-T7 and hiR2-FL-D496H-T7.

[0290] This example describes the generation of iRhom1 / 2- / - DKO MEF populations expressing 23 human iRhom1-related single amino acid substitution variants and their characterization in terms of cell surface localization and functional activity as indicators of proper protein conformation. Binding analysis of purified antibodies of the present invention to a panel of 23 genetically engineered MEF populations expressing human iRhom2 variants with human iRhom1-related single amino acid substitutions is then described.

[0291] Generation of iRhom1 / 2- / DKO MEFs stably expressing 23 T7-tagged human iRhom2 variants with single amino acid substitutions related to human iRhom1 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5Cells were seeded at 1000 x g / well and incubated overnight at 37°C with 5% CO2. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The calcium phosphate method was applied to the cells, and 2 μg / ml of human iRhom2, tagged at the C-terminus with three consecutive copies of the T7 epitope (MASMTGGQQMG), was added to the cells. pMSCV-hiR2-FL-A431S-T7, pMSCV-hiR2-FL-V434E-T7, pMSCV-hiR2-FL-T436V-T7, pMSCV-hiR2-FL-Q437D-T7, pMSCV-hiR2-FL-L438S-T7, pMSCV-hiR2-FL-S448N-T7, pMSCV-hiR2-FL-I452V-T7, pMSCV-hiR2-FL-I464E-T7, pMSCV-hiR2-FL-D465A-T7, pMSCV-hiR2-FL-I477M-T7, pMSCV-hiR2-FL-K479Q-T7, and pMSCV-hiR2-FL-F encode full-length single amino acid substitution mutants. The cells were transfected with L-G481P-T7, pMSCV-hiR2-FL-I483V-T7, pMSCV-hiR2-FL-E484H-T7, pMSCV-hiR2-FL-Q485S-T7, pMSCV-hiR2-FL-L486F-T7, pMSCV-hiR2-FL-V487I-T7, pMSCV-hiR2-FL-R489S-T7, pMSCV-hiR2-FL-E490A-T7, pMSCV-hiR2-FL-D492E-T7, pMSCV-hiR2-FL-L493R-T7, pMSCV-hiR2-FL-R495K-T7, and pMSCV-hiR2-FL-D496H-T7, and then incubated at 37°C in 5% CO2. After 7 hours, the transfection was stopped by replacing the cell supernatant with standard growth medium without chloroquine, and the cells were incubated at 37°C, 5% CO2 for overnight virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated at 1x10 per well in a 6-well tissue culture plate (Greiner, Germany) using standard growth medium as target cells for retroviral infection. 5The cells were seeded and further incubated overnight at 37°C and 5% CO2. On day 3, pMSCV-hiR2-FL-A431S-T7,pMSCV-hiR2-FL-V434E-T7,pMSCV-hiR2-FL-T436V-T 7,pMSCV-hiR2-FL-Q437D-T7,pMSCV-hiR2-FL-L438S-T7,pMSCV-hiR2-FL-S448N-T7,p MSCV-hiR2-FL-I452V-T7,pMSCV-hiR2-FL-I464E-T7,pMSCV-hiR2-FL-D465A-T7,pMSC V-hiR2-FL-I477M-T7,pMSCV-hiR2-FL-K479Q-T7,pMSCV-hiR2-FL-G481P-T7,pMSCV-h Supernatants from Phoenix ECO cells that released the iR2-FL-I483V-T7, pMSCV-hiR2-FL-E484H-T7, pMSCV-hiR2-FL-Q485S-T7, pMSCV-hiR2-FL-L486F-T7, pMSCV-hiR2-FL-V487I-T7, pMSCV-hiR2-FL-R489S-T7, pMSCV-hiR2-FL-E490A-T7, pMSCV-hiR2-FL-D492E-T7, pMSCV-hiR2-FL-L493R-T7, pMSCV-hiR2-FL-R495K-T7, and pMSCV-hiR2-FL-D496H-T7 ecotropic viruses were collected and diluted to 0.45 μm. After removing the medium from immortalized iRhom1 / 2- / - DKO MEFs, which had been filtered through a CA filter and supplemented with 4 μg / ml polybrene (Sigma-Aldrich, USA), these supernatants were added to target cells for 4 hours at 37°C and 5% CO2 for primary infection. Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after another 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was performed in a similar manner. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium.From day 5 onwards, human iRhom2 tagged with three consecutive copies of the T7 epitope at the C-terminus Immortalized MEF-DKO-hiR2 stably expressing full-length single amino acid substitutions: MEF-DKO-hiR2-FL-A431S-T7, MEF-DKO-hiR2-FL-V434E-T7, MEF-DKO-hiR2-FL-T436V-T7, MEF-DKO-hiR2-FL-Q437D-T7, MEF-DKO-hiR2-FL-L438S-T7, MEF-DKO-hiR2-FL-S448N-T7, MEF-DKO-hiR2-FL-I452V-T7, MEF-DKO-hiR2-FL-I464E-T7, MEF-DKO-hiR2-FL-D465A-T7, MEF-DKO-hiR2-FL-I477M-T7, and MEF-DKO-hiR2 -FL-K479Q-T7,MEF-DKO-hiR2-FL-G481P-T7,MEF-DKO-hiR2-FL-I483V-T7,MEF-DKO- hiR2-FL-E484H-T7,MEF-DKO-hiR2-FL-Q485S-T7,MEF-DKO-hiR2-FL-L486F-T7,MEF-D KO-hiR2-FL-V487I-T7,MEF-DKO-hiR2-FL-R489S-T7,MEF-DKO-hiR2-FL-E490A-T7,ME F-DKO-hiR2-FL-D492E-T7,MEF-DKO-hiR2-FL-L493R-T7,MEF-DKO-hiR2-FL-R495K-T7 To select for MEF-DKO-hiR2-FL-D496H-T7 cells, the cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) and stored for future use.

[0292] FACS analysis for test system validation Briefly, immortalized MEF-DKO-hiR2-FL-WT-T7 cells and MEF-DKO-hiR2-FL-A431S-T7, MEF-DKO-hiR2-FL-V434E-T7, MEF-DKO-hiR2-FL-T436V-T7, MEF-DKO-hiR2-FL-Q437D-T7, MEF-DKO-hiR2-FL-L438S-T7, MEF-DKO-hiR2-FL-S448N-T7, MEF-DKO-hiR2-FL-I452V-T7, MEF-DKO-hiR2-FL-I464E-T7, MEF-DKO-hiR2-FL-D465A-T7, MEF-DKO-hiR2-FL-I477M-T7, MEF- DKO-hiR2-FL-K479Q-T7,MEF-DKO-hiR2-FL-G481P-T7,MEF-DKO-hiR2-FL-I483V-T7,ME F-DKO-hiR2-FL-E484H-T7,MEF-DKO-hiR2-FL-Q485S-T7,MEF-DKO-hiR2-FL-L486F-T7,M MEF-DKO-hiR2-FL-V487I-T7, MEF-DKO-hiR2-FL-R489S-T7, MEF-DKO-hiR2-FL-E490A-T7, MEF-DKO-hiR2-FL-D492E-T7, MEF-DKO-hiR2-FL-L493R-T7, MEF-DKO-hiR2-FL-R495K-T7, and MEF-DKO-hiR2-FL-D496H-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 1 x 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in either FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (Merck Millipore, USA) in FACS buffer at 100 μl per well and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0293] Figure 21a shows representative results from this experiment, with the human iRhom2 variant hiR2-FL-S448N-T7 as an example. Binding analysis of the anti-T7 tag antibody (black) and anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-S448N-T7 cells (right) revealed a relatively strong increase in relative fluorescence intensity. This indicates that the human iRhom2 variant hiR2-FL-S448N-T7 is expressed and localized on the cell surface in a similar manner to human iRhom2 wild-type cells (left) (right). Similar results were obtained for MEF-DKO-hiR2-FL-A431S-T7,MEF-DKO-hiR2-FL-V434E-T7,MEF-DKO-hiR2-FL-T436V-T7,MEF-DKO-hiR2-FL-Q437D-T7,MEF-DKO-hiR2-FL-L438S-T7, MEF-DKO-hiR2-FL-I452V-T7,MEF-DKO-hiR2-FL-I464E-T7,MEF-DKO-hiR2-FL-D465A-T7,MEF-DKO-hiR2-FL-I477M-T7,MEF-DKO-hiR2-FL-K479Q-T7,MEF-DKO- hiR2-FL-G481P-T7,MEF-DKO-hiR2-FL-I483V-T7,MEF-DKO-hiR2-FL-E484H-T7,MEF-DKO-hiR2-FL-Q485S-T7,MEF-DKO-hiR2-FL-L486F-T7,MEF-DKO-hiR2-FL- V487I-T7,MEF-DKO-hiR2-FL-R489S-T7,MEF-DKO-hiR2-FL-E490A-T7,MEF-DKO-hiR2-FL-D492E-T7,MEF-DKO-hiR2-FL-L493R-T7,MEF-DKO-hiR2-FL-R495K-T7 The expression and localization of other full-length human iRhom2 single amino acid substitution variants expressed in MEF-DKO-hiR2-FL-D496H-T7 cells was also obtained.

[0294] TGFα ELISA for test system validation To test all 23 human iRhom2 variants with human iRhom1-specific single amino acid substitutions, we subjected MEF-DKO cell lines stably expressing each of these variants, generated as described in the previous examples, to a TGFα shedding ELISA assay. To demonstrate the functionality of all variants, we assessed PMA-induced release of nuclear TGFα as an indicator of proper folding of these variants. The cells used in this assay were rescue variants of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts (described in Example 11), which were rescued by each human iRhom2 variant with a human iRhom1-specific single amino acid substitution or deletion. Therefore, the stably expressed iRhom2 variant is the only iRhom protein not expressed at all in these cells and therefore the only iRhom contributing to TGFα shedding in these cells.

[0295] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated overnight at 4°C with 100 μl per well of mouse anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) at 400 ng / ml in TBS. Following incubation with MEF-DKO-hiR2-FL-A431S-T7, MEF-DKO-hiR2-FL-V434E-T7, MEF-DKO-hiR2-FL-T436V-T7, MEF-DKO-hiR2-FL-Q437D-T7, MEF-DKO-hiR2-FL-L438S-T7, and MEF-DKO-hiR2-FL-S448N-T7. MEF-DKO-hiR2-FL-I452V-T7,MEF-DKO-hiR2-FL-I464E-T7,MEF-DKO-hiR2-FL-D465A-T7,MEF-DKO-hiR2-FL-I477M-T7 ,MEF-DKO-hiR2-FL-K479Q-T7,MEF-DKO-hiR2-FL-G481P-T7,MEF-DKO-hiR2-FL-I483V-T7,MEF-DKO-hiR2-FL-E484H-T7 ,MEF-DKO-hiR2-FL-Q485S-T7,MEF-DKO-hiR2-FL-L486F-T7,MEF-DKO-hiR2-FL-V487I-T7,MEF-DKO-hiR2-FL-R489S-T7 ,MEF-DKO-hiR2-FL-E490A-T7,MEF-DKO-hiR2-FL-D492E-T7,MEF-DKO-hiR2-FL-L493R-T7,MEF-DKO-hiR2-FL-R495K-T7 and MEF-DKO-hiR2-FL-D496H-T7 cells were electroporated with the hTGFα-FL-WT construct in the pcDNA3.1 vector backbone, and then approximately 35,000 MEF-DKO cells harboring human iRhom2 variants with human iRhom1-specific single amino acid substitutions or deletions were seeded in 100 μl of standard growth medium in each well of an F-bottom 96-well cell culture plate (Thermo Fisher Scientific, USA) using the 4D-Nucleofector System (Lonza, Switzerland).On day 2, the capture antibody solution was removed, and the MaxiSorp® plate was blocked with TBS, 1% BSA (300 μl per well) at room temperature for at least 1 hour. Meanwhile, the cells were washed once with PBS, and then OptiMEM medium (Thermo Fisher Scientific, USA) (80 μl per well) was added.

[0296] The cells (except for the unstimulated control) were then stimulated with 20 μl of PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml per well at 37°C and 5% CO2 for 1 hour. 20 μl of OptiMEM medium was added to the unstimulated control cells. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, after which 70 μl of cell-free supernatant was transferred per sample. Biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was then added at 37.5 ng / ml per well in TBS, and the plates were incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland), carefully removing all traces of buffer after the fourth wash, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated at room temperature for 30 minutes, again away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0297] Figure 21b shows the results of these TGFα release assays, and in contrast to the empty vector (EV) negative control population, in which PMA-induced TGFα shedding was undetectable, all 23 human iRhom2 variants with human iRhom1-specific single amino acid substitutions were functionally active and capable of PMA-induced TGFα shedding, indicating that these variants are properly folded.

[0298] FACS analysis to characterize the binding of purified antibodies of the invention for epitope mapping purposes Briefly, immortalized MEF-DKO-hiR2-FL-A431S-T7, MEF-DKO-hiR2-FL-V434E-T7, MEF-DKO-hiR2-FL-T436V-T7, MEF-DKO-hiR2-FL-Q437D-T7, MEF-DKO-hiR2-FL-L438S-T7, MEF-DKO-hiR2-FL-S448N-T7, MEF-DKO-hiR2-FL-I452V-T7, MEF-DKO-hiR2-FL-I464E-T7, MEF-DKO-hiR2-FL-D465A-T7, MEF-DKO-hiR2-FL-I477M-T7, and MEF-DKO-hiR2-FL-K437D-T7. 479Q-T7,MEF-DKO-hiR2-FL-G481P-T7,MEF-DKO-hiR2-FL-I483V-T7,MEF-DKO-hiR2 -FL-E484H-T7,MEF-DKO-hiR2-FL-Q485S-T7,MEF-DKO-hiR2-FL-L486F-T7,MEF-DKO- hiR2-FL-V487I-T7,MEF-DKO-hiR2-FL-R489S-T7,MEF-DKO-hiR2-FL-E490A-T7,MEF -DKO-hiR2-FL-D492E-T7,MEF-DKO-hiR2-FL-L493R-T7,MEF-DKO-hiR2-FL-R495K-T7 and MEF-DKO-hiR2-FL-D496H-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 1 × 10 per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were suspended in 100 μl per well of either FACS buffer alone (control) or purified antibodies of the present invention (3, 5, 16, 22, 34, 42, 43, 44, 48, and 50) at 3 μg / ml in FACS buffer and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0299] Figure 22a shows representative results from this experiment. For example, analytical data for cells expressing the human iRhom2 variant hiR2-FL-S448N-T7 are shown for the entire panel of 23 human iRhom2 variants with a single amino acid substitution related to human iRhom1. Binding analysis of antibody 5 (black, upper panel), which has a TNFα release inhibitory effect, or antibody 50 (black, lower panel), which does not have a TNFα release inhibitory effect, as well as an anti-mouse secondary antibody (gray), in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-S448N-T7 cells (right) demonstrated that the substitution of the single amino acid serine 448 in human iRhom2 with asparagine does not impair and therefore does not contribute to the binding of antibody 5 of the present invention, which has an inhibitory effect on TNFα release. Similarly, it does not have an inhibitory effect on TNFα release, and therefore does not contribute to the binding of antibody 50 (right, lower panel). For both antibodies, binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) served as a positive control.

[0300] Figure 22b—an extension of Figure 22a—summarizes the results of FACS analysis of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have an inhibitory effect on TNFα release, versus antibodies 48 and 50, which have no inhibitory effect on TNFα release, for the entire panel of 23 genetically engineered MEF populations expressing human iRhom2 variants with single amino acid substitutions specific to human iRhom1. The binding rate of each antibody to wild-type human iRhom2 is set to 100%. A 30-59% reduction in antibody binding to any variant is indicated by light gray cells (marked "1"), a 60-95% loss of binding is indicated by gray cells (marked "2"), and a loss of 95% or more of binding is indicated by dark gray cells (marked "3"). These data revealed that none of the iRhom1-specific single amino acid substitutions analyzed by this approach are related to the binding of the present antibodies 3, 5, 16, 22, 34, 42, 43, and 44, which have the TNFα release inhibitory effect, to human iRhom2. On the other hand, some of them contribute to the binding of antibodies 48 and 50, which do not have the TNFα release inhibitory effect.

[0301] Example 22 Epitope mapping of the antibodies of the present invention based on family member-specific sequence mutations of iRhom2 in the C-terminus, loop 5 and C-terminus of the central region of the large extracellular loop

[0302] To complement Examples 15 and 16, and to complement Example 21 above, a set of 33 human iRhom2 variants with single amino acid substitutions relative to human iRhom1 was designed in a fourth approach to identify single amino acids that contribute to the binding of the antibodies of the present invention. These 33 substitutions reflect the fact that the amino acids at the C-terminus, loop 5, and C-terminus of the central region of the large extracellular loop 1 are non-identical between human iRhom2 and human iRhom1. The variants in which the amino acids at the corresponding positions in human iRhom1 were introduced in place of the amino acids in human iRhom2 are listed as hiR2-FL-G563D-T7, hiR2-FL-A564P-T7, hiR2-FL-I566E-T7, hiR2-FL-D569E-T7, hiR2-FL-E579K-T7, hiR2-FL-Q580N-T7, and hiR2-FL-G563D-T7. R2-FL-A581S-T7,hiR2-FL-R582A-T7,hiR2-FL-S583G-T7,hiR2-FL-G587N-T7,hiR2-FL-F58 8H-T7,hiR2-FL-L589P-T7,hiR2-FL-E594V-T7,hiR2-FL-K596T-T7,hiR2-FL-S607R-T7,hiR 2-FL-T612S-T7,hiR2-FL-E617D-T7,hiR2-FL-H620R-T7,hiR2-FL-L636M-T7,hiR2-FL-K638 D-T7,hiR2-FL-I771F-T7,hiR2-FL-I825V-T7,hiR2-FL-I828V-T7,hiR2-FL-N829R-T7,hiR2 -FL-W830C-T7,hiR2-FL-P831E-T7,hiR2-FL-I833C-T7,hiR2-FL-H835F-T7,hiR2-FL-F839I -T7, hiR2-FL-S843D-T7, hiR2-FL-Q853A-T7, hiR2-FL-V854Q-T7 and hiR2-FL-R844K-T7.

[0303] This example describes the generation of iRhom1 / 2-DKO MEF populations expressing 33 human iRhom1-related single amino acid substitution variants and their characterization in terms of cell surface localization and functional activity as indicators of proper protein conformation. Binding analysis of purified antibodies of the present invention to a panel of 33 genetically engineered MEF populations expressing human iRhom2 variants with human iRhom1-related single amino acid substitutions is then described.

[0304] Generation of iRhom1 / 2- / - DKO MEFs stably expressing 33 T7-tagged human iRhom2 variants with single amino acid substitutions related to human iRhom1 Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5Cells were seeded per well and maintained overnight at 37°C, 5% CO. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The cells were transfected with 2 μg / ml of pMSCV hiR2-FL-G563D-T7, pMSCV hiR2-FL-A564P-T7, pMSCV hiR2-FL-I566E-T7, pMSCV hiR2-FL-D569E-T7, pMSCV hiR2-FL-E579K-T7, pMSCV hiR2-FL-Q580N-T7, pMSCV hiR2-FL-A581S-T7, pMSCV hiR2-FL-R582A-T7, pMSCV hiR2-FL-S583G-T7, and pMSCV hiR2-FL-S583G-T7, encoding full-length human iRhom2 single amino acid substitutions C-terminally tagged with three consecutive copies of the T7 epitope (MASMTGGQQMG). hiR2-FL-G587N-T7,pMSCV hiR2-FL-F588H-T7,pMSCV hiR2-FL-L589P-T7,pMSCV hiR2-FL-E594V-T7,pMSCV hiR2-FL-K596T-T7,pMSCV hiR2-FL-S607R-T7,pMSCV hiR2-FL-T612S-T7,pMSCV hiR2-FL-E617D-T7,pMSCV hiR2-FL-H620R-T7,pMSCV hiR2-FL-L636M-T7,pMSCV hiR2-FL-K638D-T7,pMSCV hiR2-FL-I771F-T7,pMSCV The cells were transfected with hiR2-FL-I825V-T7, pMSCV hiR2-FL-I828V-T7, pMSCV hiR2-FL-N829R-T7, pMSCV hiR2-FL-W830C-T7, pMSCV hiR2-FL-P831E-T7, pMSCV hiR2-FL-I833C-T7, pMSCV hiR2-FL-H835F-T7, pMSCV hiR2-FL-F839I-T7, pMSCV hiR2-FL-S843D-T7, pMSCV hiR2-FL-Q853A-T7, pMSCV hiR2-FL-V854Q-T7, and pMSCV hiR2-FL-R844K-T7 and incubated at 37°C in 5% CO2.After 7 hours, the cell supernatant was replaced with standard growth medium without chloroquine to stop the transfection, and the cells were incubated at 37°C, 5% CO2 for overnight virus production. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated at 1x10 per well in a 6-well tissue culture plate (Greiner, Germany) using standard growth medium as target cells for retroviral infection. 5The cells were seeded and further incubated overnight at 37°C and 5% CO2. On day 3, pMSCV hiR2-FL-G563D-T7,pMSCV hiR2-FL-A564P-T7,pMSCV hiR2-FL-I566E-T7,pMSCV hiR2-FL-D569E-T7,pMSCV hiR2-FL-E579K-T7,pMSCV hiR2-FL-Q580N-T7,pMSCV hiR2-FL-A581S-T7,pMSCV hiR2-FL-R582A-T7,pMSCV hiR2-FL-S583G-T7,pMSCV hiR2-FL-G587N-T7,pMSCV hiR2-FL-F588H-T7,pMSCV hiR2-FL-L589P-T7,pMSCV hiR2-FL-E594V-T7,pMSCV hiR2-FL-K596T-T7,pMSCV hiR2-FL-S607R-T7,pMSCV hiR2-FL-T612S-T7,pMSCV hiR2-FL-E617D-T7,pMSCV hiR2-FL-H620R-T7,pMSCV hiR2-FL-L636M-T7,pMSCV hiR2-FL-K638D-T7,pMSCV hiR2-FL-I771F-T7,pMSCV hiR2-FL-I825V-T7,pMSCV hiR2-FL-I828V-T7,pMSCV hiR2-FL-N829R-T7,pMSCV The supernatants from Phoenix ECO cells that released the ecotropic viruses hiR2-FL-W830C-T7, pMSCV hiR2-FL-P831E-T7, pMSCV hiR2-FL-I833C-T7, pMSCV hiR2-FL-H835F-T7, pMSCV hiR2-FL-F839I-T7, pMSCV hiR2-FL-S843D-T7, pMSCV hiR2-FL-Q853A-T7, pMSCV hiR2-FL-V854Q-T7, and pMSCV hiR2-FL-R844K-T7 were collected and filtered through a 0.45 μm CA filter. 4 μg / ml of polybrene (Sigma-Aldrich, USA) was added. After removing the medium from the immortalized iRhom1 / 2- / -DKO MEFs, these supernatants were added to the target cells and primary infected for 4 hours at 37°C, 5% CO2.Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after an additional 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. A third, but overnight, infection cycle was similarly performed. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium.From day 5 onwards, immortalized MEF-DKO hiR2-FL-G563D-T7, MEF-DKO hiR2-FL-A564P-T7, MEF-DKO hiR2-FL-I566E-T7, MEF-DKO hiR2-FL-D569E-T7, MEF-DKO hiR2-FL-E579K-T7, MEF-DKO hiR2-FL-Q580N-T7, MEF-DKO hiR2-FL-A581S-T7, MEF-DKO hiR2-FL-R582A-T7, MEF-DKO hiR2-FL-S583G-T7, MEF-DKO hiR2-FL-G587N-T7,MEF-DKO hiR2-FL-F588H-T7,MEF-DKO hiR2-FL-L589P-T7,MEF-DKO hiR2-FL-E594V-T7,MEF-DKO hiR2-FL-K596T-T7,MEF-DKO hiR2-FL-S607R-T7,MEF-DKO hiR2-FL-T612S-T7,MEF-DKO hiR2-FL-E617D-T7,MEF-DKO hiR2-FL-H620R-T7,MEF-DKO hiR2-FL-L636M-T7,MEF-DKO hiR2-FL-K638D-T7,MEF-DKO hiR2-FL-I771F-T7,MEF-DKO hiR2-FL-I825V-T7,MEF-DKO hiR2-FL-I828V-T7,MEF-DKO hiR2-FL-N829R-T7,MEF-DKO hiR2-FL-W830C-T7,MEF-DKO hiR2-FL-P831E-T7,MEF-DKO hiR2-FL-I833C-T7,MEF-DKO hiR2-FL-H835F-T7,MEF-DKO hiR2-FL-F839I-T7,MEF-DKO hiR2-FL-S843D-T7,MEF-DKO hiR2-FL-Q853A-T7,MEF-DKO hiR2-FL-V854Q-T7 To select for MEF-DKO hiR2-FL-R844K-T7 cells, the cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA) and stored for future use.

[0305] FACS analysis for test system validation Briefly, immortalized MEF-DKO-hiR2-FL-WT-T7 cells and MEF-DKO hiR2-FL-G563D-T7, MEF-DKO hiR2-FL-A564P-T7, MEF-DKO hiR2-FL-I566E-T7, MEF-DKO hiR2-FL-D569E-T7, MEF-DKO hiR2-FL-E579K-T7, MEF-DKO hiR2-FL-Q580N-T7, MEF-DKO hiR2-FL-A581S-T7, MEF-DKO hiR2-FL-R582A-T7, MEF-DKO hiR2-FL-S583G-T7, MEF-DKO hiR2-FL-G587N-T7, MEF-DKO hiR2-FL-F588H-T7,MEF-DKO hiR2-FL-L589P-T7,MEF-DKO hiR2-FL-E594V-T7,MEF-DKO hiR2-FL-K596T-T7,MEF-DKO hiR2-FL-S607R-T7,MEF-DKO hiR2-FL-T612S-T7,MEF-DKO hiR2-FL-E617D-T7,MEF-DKO hiR2-FL-H620R-T7,MEF-DKO hiR2-FL-L636M-T7,MEF-DKO hiR2-FL-K638D-T7,MEF-DKO hiR2-FL-I771F-T7,MEF-DKO hiR2-FL-I825V-T7,MEF-DKO hiR2-FL-I828V-T7,MEF-DKO hiR2-FL-N829R-T7,MEF-DKO hiR2-FL-W830C-T7,MEF-DKO hiR2-FL-P831E-T7,MEF-DKO hiR2-FL-I833C-T7,MEF-DKO hiR2-FL-H835F-T7,MEF-DKO hiR2-FL-F839I-T7,MEF-DKO hiR2-FL-S843D-T7,MEF-DKO hiR2-FL-Q853A-T7,MEF-DKO hiR2-FL-V854Q-T7 and MEF-DKO hiR2-FL-R844K-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 1 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA).5 Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in either FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (Merck Millipore, USA) in FACS buffer at 100 μl per well and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0306] Figure 23a shows representative results from this experiment, exemplified for the human iRhom2 variant hiR2-FL-I566E-T7. Binding analysis of the anti-T7 tag antibody (black) and anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-I566E-T7 cells (right) revealed a relatively strong increase in relative fluorescence intensity. This indicates that the human iRhom2 variant hiR2-FL-I566E-T7 is expressed and localized on the surface of these cells in a similar manner to human iRhom2 wild-type cells (left) (right).Similar results were obtained for MEF-DKO hiR2-FL-G563D-T7,MEF-DKO hiR2-FL-A564P-T7,MEF-DKO hiR2-FL-D569E-T7,MEF-DKO hiR2-FL-E579K-T7,MEF-DKO hiR2-FL-Q580N-T7,MEF-DKO hiR2-FL-A581S-T7,MEF-DKO hiR2-FL-R582A-T7,MEF-DKO hiR2-FL-S583G-T7,MEF-DKO hiR2-FL-G587N-T7,MEF-DKO hiR2-FL-F588H-T7,MEF-DKO hiR2-FL-L589P-T7,MEF-DKO hiR2-FL-E594V-T7,MEF-DKO hiR2-FL-K596T-T7,MEF-DKO hiR2-FL-S607R-T7,MEF-DKO hiR2-FL-T612S-T7,MEF-DKO hiR2-FL-E617D-T7,MEF-DKO hiR2-FL-H620R-T7,MEF-DKO hiR2-FL-L636M-T7,MEF-DKO hiR2-FL-K638D-T7,MEF-DKO hiR2-FL-I771F-T7,MEF-DKO hiR2-FL-I825V-T7,MEF-DKO hiR2-FL-I828V-T7,MEF-DKO Expression and localization of other full-length human iRhom2 single amino acid substitution variants expressed in hiR2-FL-N829R-T7, MEF-DKO hiR2-FL-W830C-T7, MEF-DKO hiR2-FL-P831E-T7, MEF-DKO hiR2-FL-I833C-T7, MEF-DKO hiR2-FL-H835F-T7, MEF-DKO hiR2-FL-F839I-T7, MEF-DKO hiR2-FL-S843D-T7, MEF-DKO hiR2-FL-Q853A-T7, MEF-DKO hiR2-FL-V854Q-T7, and MEF-DKO hiR2-FL-R844K-T7 cells were also obtained.

[0307] TGFα ELISA for test system validation To test all 33 human iRhom2 variants with human iRhom1-specific single amino acid substitutions, we subjected MEF-DKO cell lines stably expressing these variants, generated as described in the previous examples, to TGFα shedding ELISA assays. To demonstrate the functionality of all variants, we assessed PMA-induced release of nuclear-fused TGFα as an indicator of proper folding of these variants. The cells used in this assay were rescue variants of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts (described in Example 11) and were rescued by each human iRhom2 variant with human iRhom1-specific single amino acid substitution or deletion. Therefore, the stably expressed iRhom2 variants were the only iRhom proteins expressed in these cells and therefore likely the only iRhoms contributing to TGFα shedding in these cells.

[0308] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 400 ng / ml mouse anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) in TBS overnight at 4°C. MEF-DKO hiR2-FL-G563D-T7,MEF-DKO hiR2-FL-A564P-T7,MEF-DKO hiR2-FL-I566E-T7,MEF-DKO hiR2-FL-D569E-T7,MEF-DKO hiR2-FL-E579K-T7,MEF-DKO hiR2-FL-Q580N-T7,MEF-DKO hiR2-FL-A581S-T7,MEF-DKO hiR2-FL-R582A-T7,MEF-DKO hiR2-FL-S583G-T7,MEF-DKO hiR2-FL-G587N-T7,MEF-DKO hiR2-FL-F588H-T7,MEF-DKO hiR2-FL-L589P-T7,MEF-DKO hiR2-FL-E594V-T7,MEF-DKO hiR2-FL-K596T-T7,MEF-DKO hiR2-FL-S607R-T7,MEF-DKO hiR2-FL-T612S-T7,MEF-DKO hiR2-FL-E617D-T7,MEF-DKO hiR2-FL-H620R-T7,MEF-DKO hiR2-FL-L636M-T7,MEF-DKO hiR2-FL-K638D-T7,MEF-DKO hiR2-FL-I771F-T7,MEF-DKO hiR2-FL-I825V-T7,MEF-DKO hiR2-FL-I828V-T7,MEF-DKO hiR2-FL-N829R-T7,MEF-DKO hiR2-FL-W830C-T7,MEF-DKO hiR2-FL-P831E-T7,MEF-DKO hiR2-FL-I833C-T7,MEF-DKO hiR2-FL-H835F-T7,MEF-DKO hiR2-FL-F839I-T7,MEF-DKO hiR2-FL-S843D-T7,MEF-DKO hiR2-FL-Q853A-T7,MEF-DKO hiR2-FL-V854Q-T7 and MEF-DKO pcDNA3 to hiR2-FL-R844K-T7 cells.After electroporation of the one-vector backbone hTGFα-FL-WT construct, approximately 35,000 MEF-DKO cells harboring human iRhom2 variants with human iRhom1-specific single amino acid substitutions or deletions were seeded in 100 μl of standard growth medium into each well of an F-bottom 96-well cell culture plate (Thermo Fisher Scientific, USA) using the 4D-Nucleofector System (Lonza, Switzerland). On day 2, the capture antibody solution was removed, and the MaxiSorp® plate was blocked with TBS, 1% BSA at 300 μl per well for at least 1 hour at room temperature. Meanwhile, the cells were washed once with PBS, and then 80 μl of OptiMEM medium (Thermo Fisher Scientific, USA) was added per well.

[0309] The cells (except for the unstimulated control) were then stimulated with 20 μl of PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml per well at 37°C and 5% CO2 for 1 hour. 20 μl of OptiMEM medium was added to the unstimulated control cells. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, after which 70 μl of cell-free supernatant was transferred per sample. Biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was then added at 37.5 ng / ml per well in TBS, and the plates were incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland), carefully removing all traces of buffer after the fourth wash, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated at room temperature for 30 minutes, again away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0310] Figure 23b shows that in contrast to the empty vector (EV) negative control population, in which no PMA-induced shedding of TGFα was detected, all 33 human iRhom2 variants with human iRhom1-specific single amino acid substitutions were shown to be functionally active, as they were able to induce TGFα shedding by PMA, indicating that these variants were properly folded.

[0311] FACS analysis to characterize the binding of purified antibodies of the invention for epitope mapping purposes Briefly, immortalized MEF-DKO hiR2-FL-G563D-T7, MEF-DKO hiR2-FL-A564P-T7, MEF-DKO hiR2-FL-I566E-T7, MEF-DKO hiR2-FL-D569E-T7, MEF-DKO hiR2-FL-E579K-T7, MEF-DKO hiR2-FL-Q580N-T7, MEF-DKO hiR2-FL-A581S-T7, MEF-DKO hiR2-FL-R582A-T7, MEF-DKO hiR2-FL-S583G-T7, MEF-DKO hiR2-FL-G587N-T7, MEF-DKO hiR2-FL-F588H-T7, MEF-DKO hiR2-FL-L589P-T7,MEF-DKO hiR2-FL-E594V-T7,MEF-DKO hiR2-FL-K596T-T7,MEF-DKO hiR2-FL-S607R-T7,MEF-DKO hiR2-FL-T612S-T7,MEF-DKO hiR2-FL-E617D-T7,MEF-DKO hiR2-FL-H620R-T7,MEF-DKO hiR2-FL-L636M-T7,MEF-DKO hiR2-FL-K638D-T7,MEF-DKO hiR2-FL-I771F-T7,MEF-DKO hiR2-FL-I825V-T7,MEF-DKO hiR2-FL-I828V-T7,MEF-DKO hiR2-FL-N829R-T7,MEF-DKO hiR2-FL-W830C-T7,MEF-DKO hiR2-FL-P831E-T7,MEF-DKO hiR2-FL-I833C-T7,MEF-DKO hiR2-FL-H835F-T7,MEF-DKO hiR2-FL-F839I-T7,MEF-DKO hiR2-FL-S843D-T7,MEF-DKO hiR2-FL-Q853A-T7,MEF-DKO hiR2-FL-V854Q-T7 and MEF-DKO hiR2-FL-R844K-T7 cells at 10 mM in PBS They were harvested with EDTA, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 1 × 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were suspended in 100 μl per well of either FACS buffer alone (control) or purified antibodies of the present invention (3, 5, 16, 22, 34, 42, 43, 44, 48, and 50) at 3 μg / ml in FACS buffer and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0312] Figure 24a shows representative results from this experiment. For example, analytical data for cells expressing the human iRhom2 variant hiR2-FL-I566E-T7 are shown for the entire panel of 33 human iRhom2 variants with a single amino acid substitution related to human iRhom1. Binding analysis of antibody 5 (black, upper panel), which has the TNFα release inhibitory effect as a representative example of the antibody of the present invention, or antibody 50 (black, lower panel), which does not have the TNFα release inhibitory effect, and an anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-I566E-T7 cells (right) demonstrated that substitution of the single amino acid isoleucine 566 in human iRhom2 with glutamic acid abolished the strong binding of antibody 5 of the present invention, which has the TNFα release inhibitory effect, and therefore contributed to its binding. However, it did not inhibit TNFα release and therefore did not contribute to the binding of antibody 50 (right, lower panel). For both antibodies, binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) served as a positive control.

[0313] Figure 24b—an extension of Figure 24a—summarizes the results of FACS analysis of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have an inhibitory effect on TNFα release, and antibodies 48 and 50, which have no inhibitory effect on TNFα release, for the entire panel of 33 genetically engineered MEF populations expressing human iRhom2 variants with human iRhom1-specific single amino acid substitutions. The binding rate of each antibody to wild-type human iRhom2 is set to 100%. A 30-59% reduction in antibody binding to any variant is indicated by light gray cells (marked "1"), a 60-95% loss of binding is indicated by gray cells (marked "2"), and a loss of 95% or more of binding is indicated by dark gray cells (marked "3"). These data revealed that the pattern of amino acid positions involved in the binding of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have the effect of inhibiting TNFα release, to human iRhom2 (excluding antibody 16 of the present invention), is different from the pattern of amino acid positions contributing to the binding of antibodies 48 and 50, which do not have the effect of inhibiting TNFα release.

[0314] Example 23 Epitope mapping of the antibodies of the present invention based on alanine substitutions in the central region of the large extracellular loop To complement Examples 15 and 16 and the above-described Examples 21 and 22, a set of 91 human iRhom2 variants with single amino acid substitutions to alanine was designed in a fifth approach to identify single amino acids that contribute to the binding of the antibodies of the present invention. The variants, in which the amino acid at the corresponding position in human iRhom1 was introduced instead of the amino acid in human iRhom2, were: hiR2-FL-N503A-T7, hiR2-FL-D504A-T7, hiR2-FL-H505A-T7, hiR2-FL-S506A-T7, hiR2-FL-G507A-T7, hiR2-FL-C508A-T7, hiR2-FL-I509A-T7, hiR2-FL-Q510A-T7, hiR2-FL-T511A-T7, and hiR2-FL-Q512A-T7. -T7,hiR2-FL-R513A-T7,hiR2-FL-K514A-T7,hiR2-FL-D515A-T7,hiR2-FL-C516A-T7,hiR2-FL-S517A-T7,hiR2-FL-E518A-T7,hi R2-FL-T519A-T7,hiR2-FL-L520A-T7,hiR2-FL-A521S-T7,hiR2-FL-T522A-T7,hiR2-FL-F523A-T7,hiR2-FL-V524A-T7,hiR2-FL-K 525A-T7,hiR2-FL-W526A-T7,hiR2-FL-Q527A-T7,hiR2-FL-D528A-T7,hiR2-FL-D529A-T7,hiR2-FL-T530A-T7,hiR2-FL-G531A-T 7,hiR2-FL-P532A-T7,hiR2-FL-P533A-T7,hiR2-FL-M534A-T7,hiR2-FL-D535A-T7,hiR2-FL-K536A-T7,hiR2-FL-S537A-T7,hiR2 -FL-D538A-T7,hiR2-FL-L539A-T7,hiR2-FL-G540A-T7,hiR2-FL-Q541A-T7,hiR2-FL-K542A-T7,hiR2-FL-R543A-T7,hiR2-FL-T5 44A-T7,hiR2-FL-S545A-T7,hiR2-FL-G546A-T7,hiR2-FL-A547S-T7,hiR2-FL-V548A-T7,hiR2-FL-C549A-T7,hiR2-FL-H550A-T7,hiR2-FL-Q551A-T7,hiR2-FL-D552A-T7,hiR2-FL-P553A-T7,hiR2-FL-R554A-T7,hiR2-FL-T555A-T7,hiR2-FL -C556A-T7,hiR2-FL-E557A-T7,hiR2-FL-E558A-T7,hiR2-FL-P559A-T7,hiR2-FL-A560S-T7,hiR2-FL-S561A- T7,hiR2-FL-S562A-T7,hiR2-FL-G563A-T7,hiR2-FL-A564S-T7,hiR2-FL-H565A-T7,hiR2-FL-I566A-T7,hiR2 -FL-W567A-T7,hiR2-FL-P568A-T7,hiR2-FL-D569A-T7,hiR2-FL-D570A-T7,hiR2-FL-I571A-T7,hiR2-FL-T57 2A-T7,hiR2-FL-K573A-T7,hiR2-FL-W574A-T7,hiR2-FL-P575A-T7,hiR2-FL-I576A-T7,hiR2-FL-C577A-T7,hiR2-FL-T578A-T7,hiR2-FL-E579A-T7,hiR2-FL-Q580A-T7,hiR2-FL-A581S-T7,hiR2-FL-R582A-T7,hiR2-FL- S583A-T7,hiR2-FL-N584A-T7,hiR2-FL-H585A-T7,hiR2-FL-T586A-T7,hiR2-FL-G587A-T7,hiR2-FL-F588A-T7,hiR2-FL-L589A-T7,hiR2-FL-H590A-T7,hiR2-FL-M591A-T7,hiR2-FL-D592A-T7, およびhiR2-FL-C593A-T7である。

[0315] This example describes the generation of iRhom1 / 2- / - DKO MEF populations expressing 91 single alanine amino acid substitution variants and their characterization in terms of cell surface localization and functional activity as indicators of proper protein conformation. This is followed by binding analysis of purified antibodies 3, 5, 16, 22, 34, 42, 43, 44, 48, and 50 of the present invention to a panel of 91 engineered MEF populations expressing human iRhom2 variants with single amino acid substitutions to alanine.

[0316] Generation of iRhom1 / 2- / - DKO MEFs stably expressing 91 T7-tagged human iRhom2 variants with single amino acid substitutions to alanine Briefly, on day 1, Phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8x10 cells per well in a 6-well tissue culture plate (Greiner, Germany) in standard growth medium. 5Cells were seeded at 1000 x g / well and incubated overnight at 37°C with 5% CO2. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25 μM. The calcium phosphate method was applied to the cells, and 2 μg / ml of human iRhom2 (iRhom2) tagged at the C-terminus with three consecutive copies of the T7 epitope (MASMTGGQQMG) was added. pMSCV-hiR2-FL-N503A-T7, pMSCV-hiR2-FL-D504A-T7, pMSCV-hiR2-FL-H505A-T7, pMSCV-hiR2-FL-S506A-T7, pMSCV-hiR2-FL-G507A-T7, pMSCV-hiR2-FL-C508A-T7, pMSCV-hiR2-FL-I509A-T7, pMSCV-hiR2-FL-Q510A-T7, and pMSCV-hiR2-FL-N503A-T7 encode full-length single amino acid substitutions. -FL-T511A-T7,pMSCV-hiR2-FL-Q512A-T7,pMSCV-hiR2-FL-R513A-T7,pMSCV-hiR2-FL-K514A-T7,pMSCV-hiR2-FL-D515A-T7, pMSCV-hiR2-FL-C516A-T7,pMSCV-hiR2-FL-S517A-T7,pMSCV-hiR2-FL-E518A-T7,pMSCV-hiR2-FL-T519A-T7,pMSCV-hiR2-FL- L520A-T7,pMSCV-hiR2-FL-A521S-T7,pMSCV-hiR2-FL-T522A-T7,pMSCV-hiR2-FL-F523A-T7,pMSCV-hiR2-FL-V524A-T7,pMSC V-hiR2-FL-K525A-T7,pMSCV-hiR2-FL-W526A-T7,pMSCV-hiR2-FL-Q527A-T7,pMSCV-hiR2-FL-D528A-T7,pMSCV-hiR2-FL-D529 A-T7,pMSCV-hiR2-FL-T530A-T7,pMSCV-hiR2-FL-G531A-T7,pMSCV-hiR2-FL-P532A-T7,pMSCV-hiR2-FL-P533A-T7,pMSCV-hiR 2-FL-M534A-T7,pMSCV-hiR2-FL-D535A-T7,pMSCV-hiR2-FL-K536A-T7,pMSCV-hiR2-FL-S537A-T7,pMSCV-hiR2-FL-D538A-T7,pMSCV-hiR2-FL-L539A-T7,pMSCV-hiR2-FL-G540A-T7,pMSCV-hiR2-FL-Q541A-T7,pMSCV-hiR2-FL-K542A-T7,pMSCV-hiR2-FL-R543A-T7,pMSCV-hiR2-FL-T544A-T7,pMSCV-hiR2-FL-S545A-T7,pMSCV-hiR2-FL-G546A-T7,pMSCV-hiR2-FL-A547S-T7,pMSCV-hiR2-FL-V548A-T7,pMSCV-hiR2-FL-C54 9A-T7,pMSCV-hiR2-FL-H550A-T7,pMSCV-hiR2-FL-Q551A-T7,pMSCV-hiR2-FL-D552A-T7,pMSCV-hiR2-FL-P553A-T7,pMSCV-hiR2-FL-R554A-T7,pMSCV-hiR2-FL-T555A-T7,pMSCV-hiR2-FL-C556A-T7,pMSCV-hiR2-FL-E557A-T7,pMSCV-hiR2-FL-E558A-T7,pMSCV-hiR2-FL-P559A-T7,pMSCV-hiR2- FL-A560S-T7,pMSCV-hiR2-FL-S561A-T7,pMSCV-hiR2-FL-S562A-T7,pMSCV-hiR2-FL-G563A-T7,pMSCV-hiR2-FL-A564S-T7,pMSCV-hiR2-FL-H565A-T7,pMSCV-hiR2-FL-I566A-T7,pMSCV-hiR2-FL-W567A-T7,pMSCV-hiR2-FL-P568A-T7,pMSCV-hiR2-FL-D569A-T7,pMSCV-hiR2-FL-D570A-T7,pMSCV -hiR2-FL-I571A-T7,pMSCV-hiR2-FL-T572A-T7,pMSCV-hiR2-FL-K573A-T7,pMSCV-hiR2-FL-W574A-T7,pMSCV-hiR2-FL-P575A-T7,pMSCV-hiR2-FL-I576A-T7,pMSCV-hiR2-FL-C577A-T7,pMSCV-hiR2-FL-T578A-T7,pMSCV-hiR2-FL-E579A-T7,pMSCV-hiR2-FL-Q580A-T7,pMSCV-hiR2-FL-A581S-T7,pMSCV-hiR2-FL-R582A-T7,pMSCV-hiR2-FL-S583A-T7,pMSCV-hiR2-FL-N584A-T7,pMSCV-hiR2-FL-H585A-T7,pMSCV-hiR2-FL-T586A-T7,pMSCV-hiR2- FL-G587A-T7,pMSCV-hiR2-FL-F588A-T7,pMSCV-hiR2-FL-L589A-T7,pMSCV-hiR2-FL-H590A-T7,pMSCV-hiR2-FL-M591A-T7,pMSCV-hiR2-FL-D592A-T7 and pMSCV-hiR2-FL-C593A-T7 was transfected and incubated at 37°C and 5% CO2. After 7 hours, the transfection was stopped by replacing the cell supernatant with standard growth medium without chloroquine, and the cells were incubated at 37°C, 5% CO2, to allow for virus production overnight. In parallel, immortalized iRhom1 / 2- / -DKO MEFs were plated as target cells for retroviral infection in 6-well tissue culture plates (Greiner, Germany) at 1x10 cells per well using standard growth medium. 5pMSCV-hiR2-FL-N503A-T7,pMSCV-h iR2-FL-D504A-T7,pMSCV-hiR2-FL-H505A-T7,pMSCV-hiR2-FL-S506A-T7, pMSCV-hiR2-FL-G507A-T7,pMSCV-hiR2-FL-C508A-T7,pMSCV-hiR2-FL-I509A-T7,pMSCV-hiR2-FL-Q510A-T7,pMSCV-hiR2-FL-T511A-T7,pMSCV-hiR2 -FL-Q512A-T7,pMSCV-hiR2-FL-R513A-T7,pMSCV-hiR2-FL-K514A-T7,pMSCV-hiR2-FL-D515A-T7,pMSCV-hiR2-FL-C516A-T7,pMSCV-hiR2-FL-S517A- PMSCV-h iR2-FL-F523A-T7, pMSCV-hiR2-FL-V524A-T7, pMSCV-hiR2-FL-K525A-T7, pMSCV-hiR2-FL-W526A-T7, pMSCV-hiR2-FL-Q527A-T7, pMSCV-hiR2-FL-D528A-T7, pMSCV-hiR2-FL-D529A-T7, pMSCV-hiR2-FL-T530A-T7, pMSCV-hiR2-FL-G531A-T7, pMSCV-hiR2-FL-P532A-T7, pMSCV-hiR2-FL-P533A-T7, pMS CV-hiR2-FL-M534A-T7,pMSCV-hiR2-FL-D535A-T7,pMSCV-hiR2-FL-K536A-T7,pMSCV-hiR2-FL-S537A-T7,pMSCV-hiR2-FL-D538A-T7,pMSCV-hiR2-FL -L539A-T7,pMSCV-hiR2-FL-G540A-T7,pMSCV-hiR2-FL-Q541A-T7,pMSCV-hiR2-FL-K542A-T7,pMSCV-hiR2-FL-R543A-T7,pMSCV-hiR2-FL-T544A-T7,pMSCV-hiR2-FL-S545A-T7,pMSCV-hiR2-FL-G546A-T7,pMSCV-hiR2-FL-A547S-T7,pMSCV-hiR2-FL-V548A-T7,pMSCV-hiR2-FL-C549A-T7,pMSCV-hiR2-FL-H550A-T7,pMSCV-hiR2-FL-Q551A-T7,pMSCV-hiR2-FL-D552A-T7,pMSCV-hiR2-FL-P553A-T7,pMSCV-hiR2-FL-R554A-T7,pMSCV-hiR2-FL-T55 5A-T7,pMSCV-hiR2-FL-C556A-T7,pMSCV-hiR2-FL-E557A-T7,pMSCV-hiR2-FL-E558A-T7,pMSCV-hiR2-FL-P559A-T7,pMSCV-hiR2-FL-A560S-T7,pM SCV-hiR2-FL-S561A-T7,pMSCV-hiR2-FL-S562A-T7,pMSCV-hiR2-FL-G563A-T7,pMSCV-hiR2-FL-A564S-T7,pMSCV-hiR2-FL-H565A-T7,pMSCV-hiR2-FL-H565A-T7 FL-I566A-T7,pMSCV-hiR2-FL-W567A-T7,pMSCV-hiR2-FL-P568A-T7,pMSCV-hiR2-FL-D569A-T7,pMSCV-hiR2-FL-D570A-T7,pMSCV-hiR2-FL-I571A-T7,pMSCV-hiR2-FL-T572A-T7,pMSCV-hiR2-FL-K573A-T7,pMSCV-hiR2-FL-W574A-T7,pMSCV-hiR2-FL-P575A-T7,pMSCV-hiR2-FL-I576A-T7,pMSCV -hiR2-FL-C577A-T7,pMSCV-hiR2-FL-T578A-T7,pMSCV-hiR2-FL-E579A-T7,pMSCV-hiR2-FL-Q580A-T7,pMSCV-hiR2-FL-A581S-T7,pMSCV-hiR2-FL-R582A-T7,pMSCV-hiR2-FL-S583A-T7,pMSCV-hiR2-FL-N584A-T7,pMSCV-hiR2-FL-H585A-T7,pMSCV-hiR2-FL-T586A-T7,pMSCV-hiR2-FL-G587A-T7,Supernatants from Phoenix ECO cells expressing pMSCV-hiR2-FL-F588A-T7, pMSCV-hiR2-FL-L589A-T7, pMSCV-hiR2-FL-H590A-T7, pMSCV-hiR2-FL-M591A-T7, pMSCV-hiR2-FL-D592A-T7, and pMSCV-hiR2-FL-C593A-T7 ecotropic viruses were collected and filtered through a 0.45 μm CA filter. 4 μg / ml polybrene (Sigma-Aldrich, USA) was added. After removing the medium from immortalized iRhom1 / 2- / - DKO MEFs, these supernatants were added to target cells for 4 hours at 37°C and 5% CO2. Concurrently, Phoenix-ECO cells were reincubated with fresh medium and, after an additional 4 hours, filtered and used for a second round of infection of each target cell population, again in the presence of 4 μg / ml polybrene. Similarly, a third, but overnight, infection cycle was performed. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5 onward, human iRhom2 tagged with three consecutive copies of the T7 epitope at the C-terminus was used. Stably expressing full-length single amino acid substitution mutants, immortalized MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, and MEF-DKO-hiR2-FL-T511A-T7. MEF-DKO-hiR2-FL-Q512A-T7,MEF-DKO-hiR2-FL-R513A-T7,MEF-DKO-hiR2-FL-K514A-T7,MEF-DKO-hiR2-FL-D515A-T7,MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7,MEF-DKO-hiR2-FL-E518A-T7,MEF-DKO-hiR2-FL-T519A-T7,MEF-DKO-hiR2-FL-L520A-T7,MEF-DKO-hiR2-FL-A521S-T7,MEF-DKO-hiR2-FL-T522A-T7,MEF-DKO-hiR2-FL-F523A-T7,MEF-DKO-hiR2-FL-V524A-T7,MEF-DKO-hiR2-FL-K525A-T7,MEF-DKO-hiR2-FL-W526A-T7,MEF-DKO-hiR2-FL-Q527A-T7,MEF-DKO-hiR2-FL-D528A-T7,MEF-DKO-hiR2-FL-D529A-T7,MEF-DKO-hiR2-FL-T530A-T7,MEF-DKO-hiR2-FL-G531A-T7,MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR2-FL-P533A-T7,MEF-DKO-hiR2-FL-M534A-T7,MEF-DKO-hiR2-FL-D535A-T7,MEF-DKO-hiR2-FL-K536A-T7,MEF-DKO-hiR2-FL-S537A-T7,MEF-DKO-hiR2-FL-D538A-T7,MEF-DKO-hiR2-FL-L539A-T7,MEF-DKO-hiR2-FL-G540A-T7,MEF-DKO-hiR2-FL-Q541A-T7,MEF-DKO-hiR2-FL-K542A-T7,MEF-DKO-hiR2-FL-R543A-T7,MEF-DKO-hiR2-FL-T544A-T7,MEF-DKO-hiR2-FL-S545A-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-V548A-T7,MEF-DKO-hiR2-FL-C549A-T7,MEF-DKO-hiR2-FL-H550A-T7,MEF-DKO-hiR2-FL-Q551A-T7,MEF-DKO-hiR2-FL-D552A-T7,MEF-DKO-hiR2-FL-P553A-T7,MEF-DKO-hiR2-FL-R554A-T7,MEF-DKO-hiR2-FL-T555A-T7,MEF-DKO-hiR2-FL-C556A-T7,MEF-DKO-hiR2-FL-E557A-T7,MEF-DKO-hiR2-FL-E558A-T7,MEF-DKO-hiR2-FL-P559A-T7,MEF-DKO-hiR2-FL-A560S-T7,MEF-DKO-hiR2-FL-S561A-T7,MEF-DKO-hiR2-FL-S562A-T7,MEF-DKO-hiR2-FL-G563A-T7,MEF-DKO-hiR2-FL-A564S-T7,MEF-DKO-hiR2-FL-H565A -T7,MEF-DKO-hiR2-FL-I566A-T7,MEF-DKO-hiR2-FL-W567A-T7,MEF-DKO-hiR2-FL-P568A-T7,MEF-DKO-hiR2-FL-D5 69A-T7,MEF-DKO-hiR2-FL-D570A-T7,MEF-DKO-hiR2-FL-I571A-T7,MEF-DKO-hiR2-FL-T572A-T7,MEF-DKO-hiR2-FL -K573A-T7,MEF-DKO-hiR2-FL-W574A-T7,MEF-DKO-hiR2-FL-P575A-T7,MEF-DKO-hiR2-FL-I576A-T7,MEF-DKO-hiR2 -FL-C577A-T7,MEF-DKO-hiR2-FL-T578A-T7,MEF-DKO-hiR2-FL-E579A-T7,MEF-DKO-hiR2-FL-Q580A-T7,MEF-DKO- hiR2-FL-A581S-T7,MEF-DKO-hiR2-FL-R582A-T7,MEF-DKO-hiR2-FL-S583A-T7,MEF-DKO-hiR2-FL-N584A-T7,MEF-D For selection of KO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587A-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, and MEF-DKO-hiR2-FL-C593A-T7 cells, cells were grown in the presence of 2 mg / ml Genetin (G418, Thermo Fisher Scientific, USA). The grown cells were stocked for future use.

[0317] FACS analysis for test system validation Briefly described, immortalized MEF-DKO-hiR2-FL-WT-T7 cells and MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513A-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7, MEF-DKO-hiR2-FL-T522A-T7, MEF-DKO-hiR2-FL-F523A-T7, MEF-DKO-hiR2-FL-V524A-T7, MEF-DKO-hiR2-FL-K525A-T7, MEF-DKO-hiR2-FL-W526A-T7, MEF-DKO-hiR2-FL-Q527A-T7, MEF-DKO-hiR2-FL-D528A-T7, MEF-DKO-hiR2-FL-D529A-T7, MEF-DKO-hiR2-FL-T530A-T7, MEF-DKO-hiR2-FL-G531A-T7, MEF-DKO-hiR2-FL-P532A-T7, MEF-DKO-hiR2-FL-P533A-T7, MEF-DKO-hiR2-FL-M534A-T7, MEF-DKO-hiR2-FL-D535A-T7, MEF-DKO-hiR2-FL-K536A-T7, MEF-DKO-hiR2-FL-S537A-T7, MEF-DKO-hiR2-FL-D538A-T7, MEF-DKO-hiR2-FL-L539A-T7, MEF-DKO-hiR2-FL-G540A-T7,MEF-DKO-hiR2-FL-Q541A-T7,MEF-DKO-hiR2-FL-K542A-T7,MEF-DKO-hiR2-FL-R543A-T7,MEF-DKO-hiR2-FL-T544A-T7,MEF-DKO-hiR2-FL-S545A-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-V548A-T7,MEF-DKO-hiR2-FL-C549A-T7,MEF-DKO-hiR2-FL-H550A-T7,MEF-DKO-hiR2-FL-Q551A-T7,MEF-DKO-hiR2-FL-D552A-T7,MEF-DKO-hiR2-FL-P553A-T7,MEF-DKO-hiR2-FL-R554A-T7,MEF-DKO-hiR2-FL-T555A-T7,MEF-DKO-hiR2-FL-C556A-T7,MEF-DKO-hiR2-FL-E557A-T7,MEF-DKO-hiR2-FL-E558A-T7,MEF-DKO-hiR2-FL-P559A-T7,MEF-DKO-hiR2-FL-A560S-T7,MEF-DKO-hiR2-FL-S561A-T7,MEF-DKO-hiR2-FL-S562A-T7,MEF-DKO-hiR2-FL-G563A-T7,MEF-DKO-hiR2-FL-A564S-T7,MEF-DKO-hiR2-FL-H565A-T7,MEF-DKO-hiR2-FL-I566A-T7,MEF-DKO-hiR2-FL-W567A-T7,MEF-DKO-hiR2-FL-P568A-T7,MEF-DKO-hiR2-FL-D569A-T7,MEF-DKO-hiR2-FL-D570A-T7,MEF-DKO-hiR2-FL-I571A-T7,MEF-DKO-hiR2-FL-T572A-T7,MEF-DKO-hiR2-FL-K573A-T7,MEF-DKO-hiR2-FL-W574A-T7,MEF-DKO-hiR2-FL-P575A-T7,MEF-DKO-hiR2-FL-I576A-T7,MEF-DKO-hiR2-FL-C577A-T7,MEF-DKO-hiR2-FL-T578A-T7,MEF-DKO-hiR2-FL-E579A-T7,MEF-DKO-hiR2-FL-Q580A-T7,MEF-DKO-hiR2-FL-A581S-T7,MEF-DKO-hiR2-FL-R582A-T7,MEF-DKO-hiR2-FL-S583A-T7,MEF-DKO -hiR2-FL-N584A-T7,MEF-DKO-hiR2-FL-H585A-T7,MEF-DKO-hiR2-FL-T586A-T7,MEF-DKO-hiR2-F L-G587A-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, and MEF-DKO-hiR2-FL-C593A-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 1 x 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5 Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were resuspended in either FACS buffer alone (control) or 3 μg / ml mouse monoclonal anti-T7 IgG (Merck Millipore, USA) in FACS buffer at 100 μl per well and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl of FACS buffer per well. For secondary staining, cells were spun down and resuspended in 100 μl of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0318] Figure 25a shows representative results from this experiment, exemplified for the human iRhom2 variant hiR2-FL-K536A-T7. Binding analysis of the anti-T7 tag antibody (black) and anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-K536A-T7 cells (right) revealed a relatively strong increase in relative fluorescence intensity. This indicates that the human iRhom2 variant hiR2-FL-K536A-T7 is expressed and localized on the surface of these cells in a similar manner to human iRhom2 wild-type cells (left) (right). Similar results were obtained for MEF-DKO-hiR2-FL-N503A-T7,MEF-DKO-hiR2-FL-H505A-T7,MEF-DKO-hiR2-FL-S506A-T7,MEF-DK O-hiR2-FL-I509A-T7,MEF-DKO-hiR2-FL-T511A-T7,MEF-DKO-hiR2-FL-Q512A-T7,MEF-DKO-hiR2-FL-R51 3A-T7,MEF-DKO-hiR2-FL-K514A-T7,MEF-DKO-hiR2-FL-D515A-T7,MEF-DKO-hiR2-FL-S517A-T7,MEF-DKO -hiR2-FL-E518A-T7,MEF-DKO-hiR2-FL-T519A-T7,MEF-DKO-hiR2-FL-L520A-T7,MEF-DKO-hiR2-FL-A521S -T7,MEF-DKO-hiR2-FL-T522A-T7,MEF-DKO-hiR2-FL-V524A-T7,MEF-DKO-hiR2-FL-K525A-T7,MEF-DKO-h iR2-FL-W526A-T7,MEF-DKO-hiR2-FL-Q527A-T7,MEF-DKO-hiR2-FL-D528A-T7,MEF-DKO-hiR2-FL-D529A-T 7,MEF-DKO-hiR2-FL-T530A-T7,MEF-DKO-hiR2-FL-G531A-T7,MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR 2-FL-P533A-T7,MEF-DKO-hiR2-FL-M534A-T7,MEF-DKO-hiR2-FL-D535A-T7,MEF-DKO-hiR2-FL-K536A-T7,MEF-DKO-hiR2-FL-S537A-T7,MEF-DKO-hiR2-FL-D538A-T7,MEF-DKO-hiR2-FL-L539A-T7,MEF-DKO-hiR2-FL-G540A-T7,MEF-DKO-hiR2-FL-Q541A-T7,MEF-DKO-hiR2-FL-K542A-T7,MEF-DKO-hiR2-FL-R543A-T7,MEF-DKO-hiR2-FL-T544A-T7,MEF-DKO-hiR2-FL-S545A-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-V548A-T7,MEF-DKO-hiR2-FL-H550A-T7,MEF-DKO-hiR2-FL-Q551A-T7,MEF-DKO-hiR2-FL-P553A-T7,MEF-DKO-hiR2-FL-R554A-T7,MEF-DKO-hiR2-FL-T555A-T7,MEF-DKO-hiR2-FL-E557A-T7,MEF-DKO-hiR2-FL-E558A-T7,MEF-DKO-hiR2-FL-P559A-T7,MEF-DKO-hiR2-FL-A560S-T7,MEF-DKO-hiR2-FL-S561A-T7,MEF-DKO-hiR2-FL-S562A-T7,MEF-DKO-hiR2-FL-G563A-T7,MEF-DKO-hiR2-FL-A564S-T7,MEF-DKO-hiR2-FL-H565A-T7,MEF-DKO-hiR2-FL-I566A-T7,MEF-DKO-hiR2-FL-P568A-T7,MEF-DKO-hiR2-FL-D569A-T7,MEF-DKO-hiR2-FL-D570A-T7,MEF-DKO-hiR2-FL-I571A-T7,MEF-DKO-hiR2-FL-T572A-T7,MEF-DKO-hiR2-FL-K573A-T7,MEF-DKO-hiR2-FL-P575A-T7,MEF-DKO-hiR2-FL-I576A-T7,MEF-DKO-hiR2-FL-T578A-T7,MEF-DKO-hiR2-FL-E579A-T7,MEF-DKO-hiR2-FL-Q580A-T7,MEF-DKO-hiR2-FL-A581S-T7,MEF-DKO-hiR2-FL-R582A-T7,Expression and localization of other human iRhom2 full-length single amino acid substitution variants expressed in MEF-DKO-hiR2-FL-S583A-T7, MEF-DKO-hiR2-FL-N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587A-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, and MEF-DKO-hiR2-FL-D592A-T7 cells were also obtained. Furthermore, the decrease in relative fluorescence intensity, and therefore the decrease in expression levels on the cell surface, of these cells was observed in MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-C516A-T7, and MEF-DKO-hiR2-FL-C517A-T7. The full-length human iRhom2 single amino acid substitution fragments were obtained for the expression in hiR2-FL-F523A-T7, MEF-DKO-hiR2-FL-C549A-T7, MEF-DKO-hiR2-FL-D552A-T7, MEF-DKO-hiR2-FL-C556A-T7, MEF-DKO-hiR2-FL-W567A-T7, MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR2-FL-C577A-T7, and MEF-DKO-hiR2-FL-C593A-T7 cells.

[0319] TGFα ELISA for test system validation To test all 91 human iRhom2 variants with human iRhom1-specific single amino acid substitutions, we subjected MEF-DKO cell lines stably expressing these variants, generated as described in the previous examples, to a TGFα shedding ELISA assay. To demonstrate the functionality of all variants, we assessed PMA-induced release of nuclear TGFα as an indicator of proper folding of these variants. The cells used in this assay were rescue variants of iRhom1 / 2- / - double knockout mouse embryonic fibroblasts (described in Example 11), which were rescued by each human iRhom2 variant with a human iRhom1-specific single amino acid substitution or deletion. Therefore, the stably expressed iRhom2 variants are the only iRhom proteins not expressed at all in these cells and therefore the only iRhoms contributing to TGFα shedding in these cells.

[0320] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 400 ng / ml mouse anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) in TBS overnight at 4°C. MEF-DKO-hiR2-FL-N503A-T7,MEF-DKO-hiR2-FL-D504A-T7,MEF-DKO-hiR2-FL-H505A-T7,MEF-DKO-hiR2-FL-S506A-T7,MEF -DKO-hiR2-FL-G507A-T7,MEF-DKO-hiR2-FL-C508A-T7,MEF-DKO-hiR2-FL-I509A-T7,MEF-DKO-hiR2-FL-Q510A-T7,MEF-DK O-hiR2-FL-T511A-T7,MEF-DKO-hiR2-FL-Q512A-T7,MEF-DKO-hiR2-FL-R513A-T7,MEF-DKO-hiR2-FL-K514A-T7,MEF-DKO-h iR2-FL-D515A-T7,MEF-DKO-hiR2-FL-C516A-T7,MEF-DKO-hiR2-FL-S517A-T7,MEF-DKO-hiR2-FL-E518A-T7,MEF-DKO-hiR2 -FL-T519A-T7,MEF-DKO-hiR2-FL-L520A-T7,MEF-DKO-hiR2-FL-A521S-T7,MEF-DKO-hiR2-FL-T522A-T7,MEF-DKO-hiR2-FL -F523A-T7,MEF-DKO-hiR2-FL-V524A-T7,MEF-DKO-hiR2-FL-K525A-T7,MEF-DKO-hiR2-FL-W526A-T7,MEF-DKO-hiR2-FL-Q5 27A-T7,MEF-DKO-hiR2-FL-D528A-T7,MEF-DKO-hiR2-FL-D529A-T7,MEF-DKO-hiR2-FL-T530A-T7,MEF-DKO-hiR2-FL-G531A -T7,MEF-DKO-hiR2-FL-P532A-T7,MEF-DKO-hiR2-FL-P533A-T7,MEF-DKO-hiR2-FL-M534A-T7,MEF-DKO-hiR2-FL-D535A-T7,MEF-DKO-hiR2-FL-K536A-T7,MEF-DKO-hiR2-FL-S537A-T7,MEF-DKO-hiR2-FL-D538A-T7,MEF-DKO-hiR2-FL-L539A-T7,MEF-DKO-hiR2-FL-G540A-T7,MEF-DKO-hiR2-FL-Q541A-T7,MEF-DKO-hiR2-FL-K542A-T7,MEF-DKO-hiR2-FL-R543A-T7,MEF-DKO-hiR2-FL-T544A-T7,MEF-DKO-hiR2-FL-S545A-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-V548A-T7,MEF-DKO-hiR2-FL-C549A-T7,MEF-DKO-hiR2-FL-H550A-T7,MEF-DKO-hiR2-FL-Q551A-T7,MEF-DKO-hiR2-FL-D552A-T7,MEF-DKO-hiR2-FL-P553A-T7,MEF-DKO-hiR2-FL-R554A-T7,MEF-DKO-hiR2-FL-T555A-T7,MEF-DKO-hiR2-FL-C556A-T7,MEF-DKO-hiR2-FL-E557A-T7,MEF-DKO-hiR2-FL-E558A-T7,MEF-DKO-hiR2-FL-P559A-T7,MEF-DKO-hiR2-FL-A560S-T7,MEF-DKO-hiR2-FL-S561A-T7,MEF-DKO-hiR2-FL-S562A-T7,MEF-DKO-hiR2-FL-G563A-T7,MEF-DKO-hiR2-FL-A564S-T7,MEF-DKO-hiR2-FL-H565A-T7,MEF-DKO-hiR2-FL-I566A-T7,MEF-DKO-hiR2-FL-W567A-T7,MEF-DKO-hiR2-FL-P568A-T7,MEF-DKO-hiR2-FL-D569A-T7,MEF-DKO-hiR2-FL-D570A-T7,MEF-DKO-hiR2-FL-I571A-T7,MEF-DKO-hiR2-FL-T572A-T7,MEF-DKO-hiR2-FL-K573A-T7,MEF-DKO-hiR2-FL-W574A-T7,MEF-DKO-hiR2-FL-P575A-T7,MEF-DKO-hiR2-FL-I576A-T7,MEF-DKO-hiR2-FL-C577A-T7,MEF-DKO-hiR2-FL-T578A-T7,MEF-DKO-hiR2-FL-E579A-T7,MEF-DKO-hiR2-FL-Q580A -T7,MEF-DKO-hiR2-FL-A581S-T7,MEF-DKO-hiR2-FL-R582A-T7,MEF-DKO-hiR2-FL-S583A-T7,MEF-DKO-hiR2-FL-N584A-T7,MEF-DKO-hiR2-FL-H 585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587A-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7 and MEF-DKO-hiR2-FL-C593A-T7 cells were transfected with hTGFα-FL-WT in the pcDNA3.1 vector backbone. After electroporation of the constructs, approximately 35,000 MEF-DKO cells harboring human iRhom2 variants with human iRhom1-specific single amino acid substitutions or deletions were seeded in 100 μl of standard growth medium into each well of an F-bottom 96-well cell culture plate (Thermo Fisher Scientific, USA) using the 4D-Nucleofector System (Lonza, Switzerland). On day 2, the capture antibody solution was removed, and the MaxiSorp® plate was blocked with TBS, 1% BSA, 300 μl per well, at room temperature for at least 1 hour. Meanwhile, the cells were washed once with PBS, and then 80 μl of OptiMEM medium (Thermo Fisher Scientific, USA) was added per well.

[0321] The cells (except for the unstimulated control) were then stimulated with 20 μl of PMA (Sigma-Aldrich, USA) at a final concentration of 25 ng / ml per well at 37°C and 5% CO2 for 1 hour. 20 μl of OptiMEM medium was added to the unstimulated control cells. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, after which 70 μl of cell-free supernatant was transferred per sample. Biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) was then added at 37.5 ng / ml per well in TBS, and the plates were incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland), carefully removing all traces of buffer after the fourth wash, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated at room temperature for 30 minutes, again away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0322] Figure 25b shows the results from these TGFα release assays. In contrast to the empty vector (EV) negative control population, which showed no detectable PMA-induced TGFα shedding, 83 of the 91 human iRhom2 variants with single amino acid substitutions to alanine were functionally active, indicating that these variants were properly folded, as TGFα shedding could be induced by PMA. The human iRhom2 variants hi2-FL-WT-3xT7-C516A, hiR2-FL-F523A-T7, hiR2-FL-C549A-T7, hiR2-FL-D552A-T7, hiR2-FL-C556A-T7, hiR2-FL-W567A-T7, HiR2-FL-W574A-T7, and hiR2-FL-C577A-T7 showed no or minimal function and were therefore excluded from further analysis.

[0323] FACS analysis to characterize the binding of purified antibodies of the invention for epitope mapping purposes Briefly described, immortalized MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513A-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7, MEF-DKO-hiR2-FL-T522A-T7, MEF-DKO-hiR2-FL-V524A-T7, MEF-DKO-hiR2-FL-K525A-T7, MEF-DKO-hiR2-FL-W526A-T7, MEF-DKO-hiR2-FL-Q527A-T7, MEF-DKO-hiR2-FL-D528A-T7, MEF-DKO-hiR2-FL-D529A-T7, MEF-DKO-hiR2-FL-T530A-T7, MEF-DKO-hiR2-FL-G531A-T7, MEF-DKO-hiR2-FL-P532A-T7, MEF-DKO-hiR2-FL-P533A-T7, MEF-DKO-hiR2-FL-M534A-T7, MEF-DKO-hiR2-FL-D535A-T7, MEF-DKO-hiR2-FL-K536A-T7, MEF-DKO-hiR2-FL-S537A-T7, MEF-DKO-hiR2-FL-D538A-T7, MEF-DKO-hiR2-FL-L539A-T7, MEF-DKO-hiR2-FL-G540A-T7, MEF-DKO-hiR2-FL-Q541A-T7, MEF-DKO-hiR2-FL-K542A-T7, MEF-DKO-hiR2-FL-R543A-T7,MEF-DKO-hiR2-FL-T544A-T7,MEF-DKO-hiR2-FL-S545A-T7,MEF-DKO-hiR2-FL-G546A-T7,MEF-DKO-hiR2-FL-A547S-T7,MEF-DKO-hiR2-FL-V548A-T7,MEF-DKO-hiR2-FL-H550A-T7,MEF-DKO-hiR2-FL-Q551A-T7,MEF-DKO-hiR2-FL-P553A-T7,MEF-DKO-hiR2-FL-R554A-T7,MEF-DKO-hiR2-FL-T555A-T7,MEF-DKO-hiR2-FL-E557A-T7,MEF-DKO-hiR2-FL-E558A-T7,MEF-DKO-hiR2-FL-P559A-T7,MEF-DKO-hiR2-FL-A560S-T7,MEF-DKO-hiR2-FL-S561A-T7,MEF-DKO-hiR2-FL-S562A-T7,MEF-DKO-hiR2-FL-G563A-T7,MEF-DKO-hiR2-FL-A564S-T7,MEF-DKO-hiR2-FL-H565A-T7,MEF-DKO-hiR2-FL-I566A-T7,MEF-DKO-hiR2-FL-P568A-T7,MEF-DKO-hiR2-FL-D569A-T7,MEF-DKO-hiR2-FL-D570A-T7,MEF-DKO-hiR2-FL-I571A-T7,MEF-DKO-hiR2-FL-T572A-T7,MEF-DKO-hiR2-FL-K573A-T7,MEF-DKO-hiR2-FL-P575A-T7,MEF-DKO-hiR2-FL-I576A-T7,MEF-DKO-hiR2-FL-T578A-T7,MEF-DKO-hiR2-FL-E579A-T7,MEF-DKO-hiR2-FL-Q580A-T7,MEF-DKO-hiR2-FL-A581S-T7,MEF-DKO-hiR2-FL-R582A-T7,MEF-DKO-hiR2-FL-S583A-T7,MEF-DKO-hiR2-FL-N584A-T7,MEF-DKO-hiR2-FL-H585A-T7,MEF-DKO-hiR2-FL-T586A-T7,MEF-DKO-hiR2-FL-G587A-T7,MEF-DKO-hiR2-FL-F588A-T7,MEF-DKO-hiR2-FL-L589A-T7,MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, and MEF-DKO-hiR2-FL-C593A-T7 cells were harvested with 10 mM EDTA in PBS, washed, resuspended in FACS buffer (PBS, 3% FBS, 0.05% sodium azide), and plated at approximately 1 x 10 cells per well in a Nunc U-bottom 96-well plate (Thermo Fisher Scientific, USA). 5 Cells were seeded onto the plate. To pellet the cells and remove the supernatant, the plate was centrifuged at 1,500 rpm at 4°C for 3 minutes. For primary staining, cells were suspended in 100 μl per well of either FACS buffer alone (control) or purified antibodies of the present invention (3, 5, 16, 22, 34, 42, 43, 44, 48, and 50) at 3 μg / ml in FACS buffer and incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm at 4°C for 3 minutes and washed twice with 200 μl per well of FACS buffer. For secondary staining, cells were spun down and resuspended in 100 μl / well of PE-conjugated goat anti-mouse IgG F(ab')2 detection fragment (Dianova, Germany) diluted 1:100 in FACS buffer. Protected from light, the cell suspension was incubated on ice for 1 hour. The plate was then centrifuged at 1,500 rpm for 3 minutes at 4°C and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD Accuri™ C6 Plus flow cytometer (Becton Dickinson, Germany).

[0324] Figure 26a shows representative results from this experiment. For example, analytical data from cells expressing the human iRhom2 variant hiR2-FL-K536A-T7 are shown for the entire panel of 83 functional human iRhom2 variants with a single amino acid substitution to alanine. Binding analysis of antibody 5 (black, upper panel), which inhibits TNFα release, or antibody 50 (black, lower panel), which does not, as representative examples of antibodies of the present invention, and an anti-mouse IgG secondary antibody (gray) in MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR2-FL-K536A-T7 cells (right) demonstrates that the substitution of the single amino acid lysine 536 in human iRhom2 with alanine strongly impairs the binding of antibody 5 (right, upper panel), which inhibits TNFα release. On the other hand, it does not inhibit TNFα release and therefore does not contribute to the binding of antibody 50 (right, lower panel). For both antibodies, binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) served as a positive control.

[0325] Figure 26b—an extension of Figure 26a—summarizes the results of FACS analysis of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have an inhibitory effect on TNFα release, and antibodies 48 and 50, which have no inhibitory effect on TNFα release, for the entire panel of 83 genetically engineered functional MEF populations expressing human iRhom2 variants with single amino acid substitutions to alanine. The binding rate of each antibody to wild-type human iRhom2 is set to 100%. A 30-59% reduction in antibody binding to any variant is indicated by light gray cells (marked "1"), a 60-95% loss of binding is indicated by gray cells (marked "2"), and a loss of 95% or more of binding is indicated by dark gray cells (marked "3"). These data revealed a pattern of amino acid positions associated with the binding of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention, which have the effect of inhibiting TNFα release, to human iRhom2, which was different from the pattern of amino acid positions contributing to the binding of antibodies 48 and 50, which do not have the effect of inhibiting TNFα release.

[0326] Example 24 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced TNFα shedding in vitro In contrast to Examples 14 and 17, which examined the inhibitory effect of antibodies of the invention on LPS-induced release of endogenous TNFα from human THP-1 cells, in this analysis, recombinant mouse antibodies of the invention were used to examine the inhibitory effect of PMA-induced release of endogenous TNFα from human monocytic U-937 cells.

[0327] The production of the recombinant antibody substance used in this example was the same as that described in Example 17. The TNFα release assay by ELISA used in this example is described below.

[0328] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well at 4 μg / ml in TBS overnight at 4°C. On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 1% BSA in TBS at 300 μl per well for 1–2 hours at room temperature. Separately, 80,000 U-937 (European Collection of Authenticated Cell Cultures, UK) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA). 20 μl of standard growth medium per well was added with 50 μM Batimastat (BB94, Abcam) as a positive control (final concentration: 10 μM in 100 μl sample volume), 5 μg / ml mouse IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration: 1 μg / ml in 100 μl sample volume), or 5 μg / ml of the antibody of the present invention (final concentration: 1 μg / ml in 100 μl sample volume), and the cells were preincubated at 37°C and 5% CO for 30 minutes. For stimulation controls, 20 μl of standard growth medium without the test product was added. The cells (except for the unstimulated control) were then stimulated with 150 ng / ml PMA (Sigma-Aldrich, USA) in growth medium (20 μl / well) for a final concentration of 25 ng / ml at 37°C and 5% CO for 1 hour. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland).To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample. Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct sunlight. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again out of direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well, and the plates were incubated for 1 h at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0329] Figure 27 shows representative results from this experiment, showing the effect of test articles on PMA-induced TNFα release from U-937 cells, as absolute values ​​(Figure 27a) and percent inhibition (Figure 27b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited PMA-induced TNFα release by 100.1%, while the presence of an IgG isotype control had no significant effect on TNFα shedding. In contrast, equivalent concentrations of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention inhibited PMA-induced TNFα release from U-937 cells by 65.9%, 63.6%, 91.6%, 86.1%, 68.6%, 94.5%, 78.3%, and 76.5%, respectively.

[0330] Example 25 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced TNFα shedding in vitro To complement Example 24 above, an ELISA-based TNFα release assay was performed to examine the inhibitory effect of antibodies of the invention on PMA-induced release of endogenous TNFα from human U-937 cells, except that this analysis was performed on both recombinantly produced murine and recombinantly produced chimeric antibodies of the invention.

[0331] For recombinant antibody production, target DNA sequences were designed, optimized, and synthesized. The complete sequences were subcloned into the pcDNA3.4 vector (Thermo Fisher Scientific, USA) for mouse material and the pTT5 vector (Thermo Fisher Scientific, USA) for chimeric material. The transfection-grade plasmids were then prepared and expressed in Expi293F (Thermo Fisher Scientific, USA) for mouse material and CHO-3E7 or HD CHO-S (Thermo Fisher Scientific, USA) for chimeric material. Expi293F cells were grown in serum-free Expi293F™ Expression Medium (Thermo Fisher Scientific, USA), and CHO cells were grown in serum-free FreeStyle™.TM Cells were grown in CHO Expression Medium (Thermo Fisher Scientific, USA) in Erlenmeyer flasks (Corning Inc, USA) at 37°C, 5-8% CO2 on an orbital shaker (VWR Scientific, Germany). One day before transfection, cells were seeded at the appropriate density into new Erlenmeyer flasks. On the day of transfection, DNA and transfection reagent were mixed at the optimal ratio and added to the flask containing the cells ready for transfection. Recombinant plasmids encoding the target proteins were transiently transfected into Expi293F cell cultures for mouse material and into CHO cell cultures for chimeric material. Cell culture supernatants harvested 6 days after transfection were used for purification. The cell culture broth was centrifuged and filtered. The filtered cell culture supernatant was then transferred to HiTrap MabSelect SuRe (GE Healthcare, UK) or MabSelect SuRe. TM The protein was loaded onto an LX (GE Healthcare, UK) or RoboColumn Eshmuno A (Merck Millipore, USA) affinity purification column at an appropriate flow rate. After washing and elution with the appropriate buffer, the eluted fractions were pooled and buffer-exchanged into the final formulation buffer. The purified protein was analyzed by SDS-PAGE to determine its molecular weight and purity. Finally, the concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

[0332] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well at 4 μg / ml in TBS overnight at 4°C. On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 1% BSA in TBS at 300 μl per well for 1–2 hours at room temperature. Separately, 80,000 U-937 (European Collection of Authenticated Cell Cultures, UK) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA). 20 μl of standard growth medium per well was preincubated at 37°C, 5% CO for 30 minutes with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in a 100 μl sample), 15 μg / ml mouse or human IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration of 3 μg / ml in a 100 μl sample), or 15 μg / ml of an antibody of the present invention (final concentration of 3 μg / ml in a 100 μl sample). For stimulation controls, 20 μl of standard growth medium without the test article was added. The cells (except for the unstimulated control) were then stimulated with 150 ng / ml PMA (Sigma-Aldrich, USA) in growth medium (20 μl / well) for a final concentration of 25 ng / ml at 37°C and 5% CO for 1 hour. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland).To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample. Additionally, 100 μl of recombinant human TNFα protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TNFα detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct sunlight. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again out of direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well, and the plates were incubated for 1 h at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0333] Figure 28 shows representative results from this experiment, showing the effect of test articles on PMA-induced TNFα release from U-937 cells, as absolute values ​​(Figure 28a) and percent inhibition (Figure 28b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited PMA-induced TNFα release by 98.7%, while the presence of mouse or human IgG isotype controls did not significantly affect TNFα shedding. In contrast, equivalent concentrations of the murine antibodies m16, m22, m34, m42, and m44 of the present invention were found to inhibit PMA-induced TNFα release from U-937 cells by 91.9%, 93.1%, 79.9%, 94.1%, and 86.3%, respectively. In high comparison with the results obtained with the murine antibodies of the present invention, equivalent concentrations of the chimeric antibodies ch16, ch22, ch34, ch42 and ch44 of the present invention were found to inhibit PMA-induced TNFα release from U-937 cells by 93.7%, 96.5%, 87.4%, 96.5% and 89.2%, respectively.

[0334] Example 26 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced interleukin 6 receptor (IL-6R) shedding in vitro In the following study, an ELISA-based IL-6R release assay was performed to analyze the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous IL-6R from human THP-1 monocytic cells.

[0335] The recombinant antibody substance used in this example was produced in the same manner as described in Example 17. The IL-6R release assay by ELISA used in this example is described below.

[0336] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 2 μg / ml mouse anti-human IL-6R capture antibody (provided as part of the DuoSet ELISA kit) in TBS for 7 hours at room temperature on day 1. The capture antibody solution was removed, and the MaxiSorp® plates were blocked with 300 μl per well of 1% BSA in TBS for 1.5 hours at room temperature. Separately, 40,000 THP-1 (American Type Culture Collection, USA) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA). 20 μl of standard growth medium per well was added with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration: 10 μM in a 100 μl sample), 5 μg / ml mouse IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration: 1 μg / ml in a 100 μl sample), or 5 μg / ml of an antibody of the present invention (final concentration: 1 μg / ml in a 100 μl sample). The cells were preincubated at 37°C and 5% CO for 30 minutes. For stimulation controls, 20 μl of standard growth medium without the test product was added. The cells (except for the unstimulated control) were then stimulated with 150 ng / ml PMA (Sigma-Aldrich, USA) in growth medium (20 μl / well) for a final concentration of 25 ng / ml at 37°C and 5% CO for 1 hour. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland).To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample. Additionally, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) at 100 ng / ml in TBS was added to each well, and the plate was incubated at room temperature for 2 hours, away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again out of direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well, and the plates were incubated for 1 h at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0337] Figures 29a and 29b show representative results from this experiment, showing the effect of test articles on PMA-induced IL-6R release from THP-1 cells, expressed as absolute values ​​(Figure 29a) and percent inhibition (Figure 29b). Batimastat (BB94), a metalloprotease inhibitor, served as a positive control and inhibited PMA-induced IL-6R release by 88.6%, while the presence of an IgG isotype control did not significantly affect IL-6R shedding. In contrast, equivalent concentrations of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention inhibited PMA-induced IL-6R release from THP-1 cells by 46.7%, 64.1%, 72.5%, 67.4%, 71.1%, 85.9%, 72.9%, and 73.0%, respectively.

[0338] Example 27 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced interleukin 6 receptor (IL-6R) shedding in vitro To complement the above-mentioned Example 26, an ELISA-based IL-6R release assay was performed to verify the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous IL-6R from human U-937 cells.

[0339] The recombinant antibody substance used in this example was produced in the same manner as described in Example 17. The IL-6R release assay by ELISA used in this example is described below.

[0340] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 2 μg / ml mouse anti-human IL-6R capture antibody (provided as part of the DuoSet ELISA kit) in TBS overnight at 4°C. On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 300 μl per well of 1% BSA in TBS at room temperature for 1-2 hours. Separately, 80,000 U-937 (European Collection of Authenticated Cell Cultures, UK) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA). 20 μl of standard growth medium per well was added with 50 μM Batimastat (BB94, Abcam) as a positive control (final concentration: 10 μM in 100 μl sample volume), 5 μg / ml mouse IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration: 1 μg / ml in 100 μl sample volume), or 5 μg / ml of the antibody of the present invention (final concentration: 1 μg / ml in 100 μl sample volume), and the cells were preincubated at 37°C and 5% CO for 30 minutes. For stimulation controls, 20 μl of standard growth medium without the test product was added. The cells (except for the unstimulated control) were then stimulated for 1 hour at 37°C and 5% CO2 with 20 μl per well of PMA (Sigma-Aldrich, USA) at a final concentration of 62.5 ng / ml in growth medium at 375 ng / ml. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland).To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample. Additionally, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct sunlight. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again out of direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well, and the plates were incubated for 1 h at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0341] Figure 30 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of IL-6R from U-937 cells, expressed as absolute values ​​(Figure 30a) and percent inhibition (Figure 30b). Batimastat (BB94), a metalloprotease inhibitor, served as a positive control and inhibited PMA-induced IL-6R release by 86.6%, while the presence of an IgG isotype control had no significant effect on IL-6R shedding. In contrast, equivalent concentrations of antibodies 3, 5, 16, 22, 34, 42, 43, and 44 of the present invention inhibited PMA-induced release of IL-6R from U-937 cells by 61.8%, 67.0%, 77.7%, 74.5%, 69.3%, 80.8%, 76.1%, and 71.8%, respectively.

[0342] Example 28 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced IL-6R shedding in vitro To complement the above-mentioned Example 27, an ELISA-based IL-6R release assay was performed to verify the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous IL-6R from human U-937 cells. However, this analysis was performed on both the recombinantly produced murine antibody and the recombinantly produced chimeric antibody of the present invention.

[0343] The recombinant antibody substance used in this example was produced in the same manner as described in Example 25. The IL-6R release assay by ELISA used in this example is described below.

[0344] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of mouse anti-human IL-6R capture antibody (provided as part of the DuoSet ELISA kit) at 2 μg / ml in TBS for 7 hours at room temperature. The capture antibody solution was removed, and the MaxiSorp® plates were blocked with 300 μl per well of 1% BSA in TBS for 1 hour at room temperature. Separately, 80,000 U-937 (European Collection of Authenticated Cell Cultures, UK) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA). 20 μl of standard growth medium per well was preincubated at 37°C, 5% CO for 30 minutes with 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration of 10 μM in a 100 μl sample), 15 μg / ml mouse or human IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration of 3 μg / ml in a 100 μl sample), or 15 μg / ml of an antibody of the present invention (final concentration of 3 μg / ml in a 100 μl sample). For stimulation controls, 20 μl of standard growth medium without the test article was added. The cells (except for the unstimulated control) were then stimulated for 1 hour at 37°C and 5% CO2 with 20 μl per well of PMA (Sigma-Aldrich, USA) at a final concentration of 62.5 ng / ml in growth medium at 375 ng / ml. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland).To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample. Additionally, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) at 50 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct sunlight. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plates were incubated for 30 min at room temperature, again out of direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After the fourth wash, all traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well, and the plates were incubated for 1 h at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0345] Figure 31 shows representative results from this experiment, showing the effect of test articles on PMA-induced IL-6R release from U-937 cells, expressed as absolute numbers (Figure 31a) and percent inhibition (Figure 31b). Batimastat (BB94), a metalloprotease inhibitor, served as a positive control and inhibited PMA-induced IL-6R release by 91.6%, while the presence of mouse or human IgG isotype controls did not significantly affect IL-6R shedding. In contrast, equivalent concentrations of the murine antibodies m16, m22, m34, m42, and m44 of the present invention inhibited PMA-induced IL-6R release from U-937 cells by 77.4%, 79.0%, 74.6%, 84.4%, and 82.0%, respectively. Similar to the results obtained with the murine antibodies of the present invention, equivalent concentrations of chimeric antibodies ch16, ch22, ch34, ch42 and ch44 of the present invention inhibit PMA-induced IL-6R release from U-937 cells by 84.3%, 85.6%, 82.8%, 91.8% and 85.2%, respectively.

[0346] Example 29 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced in vitro shedding of heparin-binding EGF-like growth factor (HB-EGF) In the following study, an ELISA-based HB-EGF release assay was performed to analyze the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous HB-EGF from human THP-1 monocytic cells.

[0347] The recombinant antibody substance used in this example was produced in the same manner as described in Example 25. The HB-EGF release assay by ELISA used in this example is described below.

[0348] Briefly, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of 2 μg / ml rat anti-human HB-EGF capture antibody (provided as part of the DuoSet ELISA kit) in TBS for 7 hours at room temperature on day 1. The capture antibody solution was removed, and the MaxiSorp® plates were blocked with 300 μl per well of 1% BSA in TBS for 3 hours at room temperature. Separately, 80,000 THP-1 (American Type Culture Collection, USA) cells were seeded in 80 μl of standard growth medium into each well of a Greiner CELLSTAR V-bottom 96-well plate (Thermo Fisher Scientific, USA). 20 μl per well of standard growth medium containing 50 μM Batimastat (BB94, Abcam, UK) as a positive control (final concentration: 10 μM in the resulting 100 μl sample volume), 15 μg / ml of mouse or human IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration: 3 μg / ml in the resulting 100 μl sample volume), or 15 μg / ml of an antibody of the present invention (final concentration: 3 μg / ml in the resulting 100 μl sample volume) were added and pre-incubated at 37°C, 5% CO for 30 minutes. For stimulation controls, 20 μl of standard growth medium without test article was added. The cells (except for the unstimulated control) were then stimulated with 150 ng / ml PMA (Sigma-Aldrich, USA) in growth medium (20 μl / well) for 6 hours at 37°C and 5% CO2 for a final concentration of 25 ng / ml. The 96-well plate was then centrifuged to pellet the cells. In parallel, the blocking buffer was removed from the MaxiSorp® plate, and the plate was washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, after which 70 μl of cell-free supernatant was transferred per sample.Additionally, 100 μl of recombinant human HB-EGF protein (provided as part of the DuoSet ELISA kit) diluted in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human HB-EGF detection antibody (included in the DuoSet ELISA kit) at 50 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland), carefully removing any traces of buffer after the fourth wash. Then, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was again incubated at room temperature for 30 minutes, away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0349] Figure 32 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of HB-EGF from THP-1 cells, as absolute numbers (Figure 32a) and percent inhibition (Figure 32b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited PMA-induced HB-EGF release by 98.9%, while the presence of mouse or human IgG isotype controls was found to have no significant effect on HB-EGF shedding. In contrast, equivalent concentrations of the murine antibodies m16, m22, m34, m42, and m44 of the present invention inhibited PMA-induced HB-EGF release from THP-1 cells by 71.9%, 77.7%, 64.2%, 76.6%, and 67.5%, respectively. Similar to the results obtained with the murine antibodies of the present invention, equivalent concentrations of chimeric antibodies ch16, ch22, ch34, ch42 and ch44 of the present invention inhibit PMA-induced HB-EGF release from THP-1 cells by 73.6%, 81.9%, 76.1%, 80.8% and 70.7%, respectively.

[0350] Example 30 Analysis of the inhibitory effect of the antibody of the present invention on PMA-induced HB-EGF shedding in vitro To complement Example 29 above, an ELISA-based HB-EGF release assay was performed to examine the inhibitory effect of antibodies of the present invention on PMA-induced release of endogenous HB-EGF from human U-937 cells.

[0351] The production of the recombinant antibody material used in this example was the same as that described in Example 25. The ELISA-based HB-EGF release assay used in this example was identical to that described in Example 30, with the only difference being that U-937 (European Collection of Authenticated Cell Cultures, UK) cells were used instead of THP-1 (American Type Culture Collection, USA) cells.

[0352] Figure 33 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of HB-EGF from U-937 cells, expressed as absolute numbers (Figure 33a) and percent inhibition (Figure 33b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control and inhibited PMA-induced HB-EGF release by 100.1%, while the presence of mouse or human IgG isotype controls was found to have no significant effect on HB-EGF shedding. In contrast, equivalent concentrations of the murine antibodies m16, m22, m34, m42, and m44 of the present invention inhibited PMA-induced HB-EGF release from U-937 cells by 99.6%, 101.3%, 98.2%, 103.5%, and 100.5%, respectively. Similar to the results obtained with the murine antibodies of the present invention, equivalent concentrations of chimeric antibodies ch16, ch22, ch34, ch42 and ch44 of the present invention inhibited PMA-induced HB-EGF release from U-937 cells by 100.8%, 103.2%, 98.1%, 103.0% and 99.2%, respectively.

[0353] Example 31 In vitro analysis of the inhibitory effect of the antibody of the present invention on PMA-induced TGFα (Transforming Growth Factor α) shedding In the following study, an ELISA-based TGFα release assay was performed to analyze the inhibitory effect of the antibodies of the present invention on PMA-induced release of endogenous TGFα from human PC3 prostate cancer cells.

[0354] The recombinant antibody substance used in this example was produced in the same manner as described in Example 17. The TGFα release assay by ELISA used in this example is described below.

[0355] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with 100 μl per well of goat anti-human TGFα capture antibody (provided as part of the DuoSet ELISA kit) at 0.4 μg / ml in TBS overnight at 4° C. On day 2, the capture antibody solution was removed and the MaxiSorp® plates were blocked with 300 μl per well of TBS, 1% BSA for 3 hours at room temperature. Meanwhile, 100,000 PC3 (European Collection of Authenticated Cell Cultures, UK) cells were seeded in 80 µl of standard growth medium into each well of an F-bottom 96-well cell culture plate (Corning, USA) and pre-incubated for 30 minutes at 37°C, 5% CO2 with 20 µl / well OptiMEM medium containing 50 µM Batimastat (BB94, Abcam, UK) as a positive control (final concentration: 10 µM in 100 µl sample volume), 5 µg / ml mouse IgG antibody (Thermo Fisher Scientific, USA) as an isotype control (final concentration: 1 µg / ml in 100 µl sample volume), or 5 µg / ml of the antibody of the present invention (final concentration: 1 µg / ml in 100 µl sample volume). For stimulation controls, 20 µl of OptiMEM medium without test article was added. Cells (except for the unstimulated control) were then stimulated for 2 hours at 37°C and 5% CO2 with 20 μl per well of 150 ng / ml PMA (Sigma-Aldrich, USA) in OptiMEM (final concentration: 25 ng / ml). In parallel, the blocking buffer was removed from the MaxiSorp® plates, and the plates were washed four times with 350 μl per well of TBS-T (Carl Roth, Germany) in a 96-head plate washer (Tecan Group, Switzerland). To prevent drying, 30 μl of TBS was immediately added to each well of the MaxiSorp® plate, followed by the transfer of 70 μl of cell-free supernatant per sample.Additionally, 100 μl of recombinant human TGFα protein (provided as part of the DuoSet ELISA kit) diluted to a specified concentration in TBS was added to the plate as a standard reference. Then, 100 μl of biotinylated goat anti-human TGFα detection antibody (provided as part of the DuoSet ELISA kit) at 37.5 ng / ml in TBS was added per well, and the plate was incubated at room temperature for 2 hours, away from direct light. After washing four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland), carefully removing any traces of buffer after the fourth wash. Then, 100 μl of streptavidin-AP (R&D Systems, USA) diluted 1:10,000 in TBS was added to each well, and the plate was again incubated at room temperature for 30 minutes, away from direct light. Plates were washed four times with 350 μl TBS-T (Carl Roth, Germany) per well in a 96-head plate washer (Tecan Group, Switzerland). After four cycles, traces of buffer were carefully removed. 100 μl AttoPhos substrate solution (Promega, USA) was added per well and incubated for 1 hour at room temperature in the dark. Fluorescence from each well was collected using an infinite M1000 (Tecan Group, Switzerland) microplate reader at an excitation wavelength of 435 nm and an emission wavelength of 555 nm.

[0356] Figure 34 shows representative results from this experiment, showing the effect of test articles on PMA-induced release of TGFα from PC3 cells, as absolute numbers (Figure 34a) and percent inhibition (Figure 34b). Batimastat (BB94), a small molecule inhibitor of metalloproteases, served as a positive control, inhibiting PMA-induced TGFα release by 99.1%, while the presence of an IgG isotype control did not significantly affect TGFα shedding. Similarly, no significant effect on TGFα shedding was detected in the presence of equivalent concentrations of antibodies 3, 5, and 34 of the invention. Furthermore, only very modest effects on TGFα shedding were detected in the presence of equivalent concentrations of antibodies 16, 22, 42, 43, and 44 of the invention, inhibiting PMA-induced release of TGFα from PC3 cells by 13.9%, 12.7%, 14.3%, 12.4%, and 14.1%, respectively.

[0357] Example 32 Analysis of the inhibitory effect of the antibody of the present invention on in vitro LPS-induced TNFα shedding in primary human tissue from healthy donors In the following test, a TNFα release assay was performed by ELISA using peripheral blood mononuclear cells (PBMCs) to analyze the inhibitory effect of the antibodies of the present invention on LPS-induced release of endogenous TNFα from primary human material obtained from healthy donors.

[0358] The production of the recombinant antibody substance used in this example was the same as that described in Example 17. The TNFα release assay by ELISA used in this example is described below.

[0359] Briefly, on day 1, Nunc black MaxiSorp® 96-well plates (Thermo Fisher Scientific, USA) were coated with mouse anti-human TNFα capture antibody (provided as part of the DuoSet ELISA kit) at 100 μl per well at 4 μg / ml in TBS overnight at 4° C. On day 2, the captu...

Claims

1. A protein binder that, when bound to human iRhom2, binds within at least the loop 1 region thereof.

2. 2. The protein binder of claim 1, which binds to human iRhom2 within a region spanning at least W526 (and inclusive) to I566 (and inclusive).

3. 3. A protein binder according to claim 1 or 2, which binds to a stretch of human iRhom2 comprising at least one residue selected from the group comprising W526; Q527; P532; P533; M534; D535; K536; S537; L539; K542; R543; T544; G546; R554; E557; S561; S562 and / or I566.

4. 10. The protein binder of any one of the preceding claims, which inhibits and / or reduces TACE / ADAM17 activity when bound to human iRhom2.

5. 2. The protein binder of claim 1, wherein the inhibition or reduction of TACE / ADAM17 activity is caused by interference with iRhom2-mediated TACE / ADAM17 activation.

6. When bound to human iRhom2, - inhibit or reduce induced TNFα shedding, and / or - inhibit or reduce induced IL-6R shedding, and / or - inhibit or reduce induced HB-EGF shedding, A protein binder according to any one of the preceding claims.

7. The human iRhom2 to which the protein binder binds is a) the amino acid sequence set forth in SEQ ID NO: 181, or b) an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 181, provided that said sequence maintains iRhom2 activity. Including, A protein binder according to any one of the preceding claims.

8. 10. The protein binder of any one of the preceding claims, which is a monoclonal antibody, or a target-binding fragment or derivative thereof that retains target-binding ability, or an antibody mimetic.

9. IgG, scFv, Fab, or (Fab) 2 10. The protein binder of claim 1, which is an antibody of at least one type selected from the group consisting of:

10. 10. The protein binder of claim 1, which does not cross-react with human iRhom1.

11. the protein binder is a) an antibody comprising a pair of heavy chain / light chain complementarity determining regions (CDRs) comprising a pair of heavy chain / light chain variable domain sequences represented by the following pairs of SEQ ID NOs: 2 and 7, 12 and 17, 22 and 27, 32 and 37, 42 and 47, 52 and 57, 62 and 67, 72 and 77, 82 and 87, 112 and 117, 152 and 157, 162 and 167, and / or 172 and 177; b) an antibody comprising a pair of heavy / light chain complementarity determining regions (CDRs) comprising the following SEQ ID NOs in this order: (HCDR1; HCDR2; HCDR3; LCDR1; LCDR2 and LCDR3); - 3、4、5、8、9、10; - 13、14、15、18、19、20; - 23、24、25、28、29、30; - 33、34、35、38、39、40; - 43、44、45、48、49、50; - 53、54、55、58、59、60; - 63、64、65、68、69、70; - 73、74、75、78、79、80; - 83、84、85、88、89、90; - 113、114、115、118、119、120; - 153、154、155、158、159、160; 163, 164, 165, 168, 169, 170, and / or - 173、174、175、178、179、180; c) an antibody comprising the heavy / light chain complementarity determining regions (CDRs) of b), with the proviso that at least one of the CDRs has up to three amino acid substitutions relative to the respective SEQ ID NO: and / or d) an antibody comprising the heavy chain / light chain complementarity determining regions (CDRs) of b) or c), wherein at least one of the CDRs has a sequence identity of 66% or more to the respective SEQ ID NOs; The protein binder of any one of claims 8 to 10, wherein the CDRs are embedded in a suitable protein framework such that the binder is capable of binding to human iRhom2 with sufficient binding affinity and inhibiting or reducing TACE / ADAM17 activity.

12. 12. The protein binder of any one of claims 8 to 11, comprising: a) heavy chain / light chain variable domain (HCVD / LCVD) pairs represented by the following SEQ ID NOs: 2 and 7, 12 and 17, 22 and 27, 32 and 37, 42 and 47, 52 and 57, 62 and 67, 72 and 77, 82 and 87, 112 and 117, 152 and 157, 162 and 167, and / or 172 and 177; b) the heavy chain / light chain variable domain (HCVD / LCVD) pair of a), provided that - HCVD has 80% or more sequence identity to each SEQ ID NO: and / or - LCDVD has 80% or more sequence identity to each SEQ ID NO; c) A pair of heavy / light chain variable domains (VDs) of a) or b), wherein at least one of the HCVD or LCVD heavy / light chain variable domains (VDs) has up to 10 amino acid substitutions relative to the respective SEQ ID NOs; The protein binder binds to human iRhom2 with sufficient binding affinity and is still capable of inhibiting or reducing TACE / ADAM17 activity.

13. The protein binder of any one of claims 8 to 12, wherein at least one amino acid substitution is a conservative amino acid substitution.

14. 10. A protein binder according to any one of the preceding claims, having at least one of the following: - a target binding affinity for human iRhom2 of 50% or more compared to a protein binder according to any one of the preceding claims, and / or - 50% or more of the inhibitory or reducing effect on TACE / ADAM17 activity of a protein binder according to any one of the preceding claims.

15. binds to human iRhom2, a) an antibody according to any one of claims 8 to 14, or b) An antibody selected from the group consisting of clones #3, #5, #16, #22, #34, #42, #43, #44, #46, #49, #54, #56, or #57. and protein binders that compete for binding with iRhom2.

16. On human iRhom2, a) an antibody according to any one of claims 8 to 14, or b) An antibody selected from the group consisting of clones #3, #5, #16, #22, #34, #42, #43, #44, #46, #49, #54, #56, or #57. and a protein binder that binds to essentially the same or the same region as the

17. A nucleic acid encoding at least one strand of a binding agent according to any one of the preceding claims.

18. - have been diagnosed with an inflammatory disease, - suffer from an inflammatory disease, or - at risk of developing inflammatory diseases, Use (for the manufacture of a medicament) of a protein binder according to any one of claims 1 to 16 for the treatment or prophylaxis of a human or animal subject.

19. A pharmaceutical composition comprising a protein binder according to any one of claims 1 to 16 or a nucleic acid according to claim 17, and optionally one or more pharmaceutically acceptable excipients.

20. (i) a protein binder according to any one of claims 1 to 16, a nucleic acid according to claim 17, or a pharmaceutical composition according to claim 19; (ii) one or more therapeutically active compounds and combinations including.

21. 20. A method for treating or preventing an inflammatory condition, comprising administering to a human or animal subject a therapeutically sufficient dose of (i) a protein binder according to any one of claims 1 to 16, (ii) a nucleic acid according to claim 17, (iii) a pharmaceutical composition according to claim 19, or (iii) a combination according to claim 20.

22. 22. The use according to claim 18 or the method according to claim 21, wherein the inflammatory condition is rheumatoid arthritis (RA).

23. Parts treatment kit including: a) a protein binder according to any one of claims 1 to 16, a nucleic acid according to claim 17, a pharmaceutical composition according to claim 19, or a combination according to claim 20, b) a device for administering the composition, composition or combination, and c) Instructions for use.