Compositions and methods for treatment

Specific 14-3-3θ-derived peptides target and eliminate pathological TDP-43, addressing the molecular mechanisms of ALS and FTD by reducing cytoplasmic accumulation and fragmentation of TDP-43, thereby ameliorating symptoms in these neurodegenerative diseases.

JP2025179158APending Publication Date: 2025-12-09MACQUARIE UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2025146076
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-06-01
Filing Date
2025-09-03
Publication Date
2025-12-09

AI Technical Summary

Technical Problem

There is no cure for neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), which are characterized by TDP-43 pathology, and the molecular mechanisms regulating TDP-43 cytoplasmic shuttling and accumulation in these diseases are unclear, posing a significant clinical challenge.

Method used

Administering specific peptides derived from 14-3-3θ, such as those with the amino acid sequence of SEQ ID NO: 1 or its conservative variants, or nucleic acids encoding these peptides, to target and eliminate pathological TDP-43, thereby reversing functional deficits associated with ALS and FTD.

Benefits of technology

The peptides effectively reduce cytoplasmic accumulation and fragmentation of TDP-43, improving symptoms such as disinhibition, hyperactivity, movement disorders, and muscle weakness in ALS and FTD models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025179158000001
    Figure 2025179158000001
  • Figure 2025179158000002
    Figure 2025179158000002
  • Figure 2025179158000003
    Figure 2025179158000003
Patent Text Reader

Abstract

To provide a pharmaceutical composition for treating or preventing, or ameliorating at least one symptom of, a neurodegenerative disease associated with TDP-43 pathology, and also to provide an isolated peptide and a chimeric molecule suitable for treating and preventing the neurodegenerative disease, and a nucleic acid and a gene construct encoding the peptide and the chimeric molecule.SOLUTION: Provided is a nucleic acid comprising an expression construct encoding a peptide fragment of 14-3-3θ, a conservative variant thereof, or a sequence having at least about 75% identity to a peptide fragment of human 14-3-3θ, wherein the peptide fragment of human 14-3-3θ comprises or consists of an amino acid sequence having a specific sequence.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to compositions and methods for the treatment and prevention of neurodegenerative diseases characterized by or associated with TDP-43 pathology. The disclosure also relates to isolated peptides and chimeric molecules, as well as nucleic acids and genetic constructs encoding the peptides and chimeric molecules, suitable for treating and preventing said neurodegenerative diseases. [Background technology]

[0002] Amyotrophic lateral sclerosis (ALS) is a motor neuron disease that affects motor neurons in both the brain and spinal cord. ALS is a fatal disease characterized by the loss of pyramidal cells in the cerebral motor cortex, prespinal motor neurons, and brainstem motor neurons, resulting in muscle weakness and atrophy. ALS typically progresses rapidly after onset, often resulting in death within a few years.

[0003] Frontotemporal dementia (FTD) is characterized by progressive damage to the frontal and / or temporal lobes of the brain and is associated with a progressive deterioration in decision-making ability, behavior, and language control. FTD is one of the most common forms of presenile dementia, with a median life expectancy of less than 15 years after diagnosis.

[0004] ALS and FTD are both rapidly progressive and fatal neurodegenerative diseases with significant clinical, genetic, and pathological overlap. ALS and FTD are typically classified as either familial (approximately 10% of cases, involving one or more defined gene mutations) or sporadic (approximately 90% of cases, typically with poorly understood etiology). The familial and sporadic forms of the disease are clinically indistinguishable. ALS and FTD are neuropathologically characterized by the deposition of TDP-43 in neurons. While recent studies suggest that cytoplasmic mislocalization of nuclear TDP-43 induces toxic adverse events, including aberrant TDP-43 phosphorylation and fragmentation (Shenouda et al., 2018, Adv Neurobiol 20:239-263), the molecular mechanisms regulating the physiological nucleocytoplasmic shuttling of TDP-43 during mRNA processing and driving its cytoplasmic accumulation in disease remain unclear.

[0005] There is no cure for ALS or FTD. The prognosis is poor and treatments are limited. There is a clear need to develop new methods to treat these debilitating diseases. Summary of the Invention

[0006] This disclosure is based on the abnormal cytoplasmic localization of TDP-43 and our identification of 14-3-3θ as a novel interacting partner of TDP-43 that contributes to the pathogenesis of ALS and FTD. We found that pathological TDP-43 can be targeted and eliminated using specific peptides derived from 14-3-3θ, reversing the functional deficits associated with ALS and FTD.

[0007] A first aspect of the present disclosure provides a method for treating or preventing or ameliorating at least one symptom of a neurodegenerative disease associated with TDP-43 pathology, the method comprising administering to a subject in need thereof an effective amount of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, or a nucleic acid molecule encoding said peptide.

[0008] In certain embodiments, the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). ALS includes familial ALS and sporadic ALS. FTD includes familial FTD and sporadic FTD. At least one symptom may include, for example, disinhibition, hyperactivity, movement disorder, or muscle weakness.

[0009] The amino acid sequence of SEQ ID NO: 1 may be provided within a larger contiguous peptide or polypeptide sequence. In exemplary embodiments, the peptide sequence may comprise or consist of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or a sequence at least about 75% identical to the sequence of SEQ ID NO: 2.

[0010] A nucleic acid molecule encoding the peptide of SEQ ID NO:1 or a conservative variant thereof can comprise the nucleotide sequence of SEQ ID NO:4 or a nucleotide sequence that is at least about 70% identical to the sequence of SEQ ID NO:4.

[0011] A nucleic acid molecule encoding the peptide of SEQ ID NO:2, a conservative variant thereof, or a sequence at least about 75% identical thereto may comprise the nucleotide sequence of SEQ ID NO:5, or a nucleotide sequence at least about 70% identical to the sequence of SEQ ID NO:5.

[0012] In certain embodiments, the peptide comprises or is linked to a protein destabilization domain sequence. In an exemplary embodiment, the protein destabilization domain sequence comprises the rapamycin binding protein FKBP12.

[0013] Thus, in one embodiment, the method comprises administering to the subject a genetic construct encoding a peptide comprising or consisting of the sequence of SEQ ID NO:1 or a conservative variant thereof operably linked to a nucleotide sequence encoding a protein destabilization domain.

[0014] A second aspect of the present disclosure provides use of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, or a nucleic acid molecule encoding said peptide, in the manufacture of a medicament for the treatment or prevention of, or amelioration of at least one symptom of, a neurodegenerative disease associated with TDP-43 pathology.

[0015] A third aspect of the present disclosure provides an isolated peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof.

[0016] The peptide may comprise or consist of the amino acid sequence of SEQ ID NO:2, a conservative variant thereof, or a sequence that is at least about 75% identical to the sequence of SEQ ID NO:2.

[0017] A fourth aspect of the disclosure provides an isolated polynucleotide encoding a peptide of the third aspect.

[0018] The polynucleotide may comprise or consist of the sequence of SEQ ID NO:4 or SEQ ID NO:5, or a polynucleotide at least about 70% identical to the sequence of SEQ ID NO:4 or SEQ ID NO:5.

[0019] In exemplary embodiments of the third and fourth aspects, the peptide or polynucleotide is for use in treating or preventing, or ameliorating at least one symptom of, a neurodegenerative disease associated with TDP-43 pathology.

[0020] A fifth aspect of the present disclosure provides a chimeric molecule comprising a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof linked to a protein destabilization domain sequence.

[0021] A sixth aspect of the present disclosure provides an isolated polynucleotide encoding the chimeric molecule of the fifth aspect.

[0022] In exemplary embodiments of the fifth and sixth aspects, the chimeric molecule or polynucleotide is for use in treating or preventing, or ameliorating at least one symptom of, a neurodegenerative disease associated with TDP-43 pathology.

[0023] A seventh aspect of the present disclosure provides a vector comprising the polynucleotide sequence of the fourth or sixth aspect.

[0024] The vector may be a viral vector. The viral vector may be an AAV vector. Typically, the vector is for administration to a subject for treating or preventing a neurodegenerative disease associated with TDP-43 pathology, or for ameliorating at least one symptom thereof.

[0025] The vector may be designed for introduction into neurons or brain cells and for directing or promoting expression of the encoded peptide or chimeric molecule in the neurons or brain cells.

[0026] Aspects and embodiments of the present disclosure are herein described, by way of non-limiting example only, and with reference to the following figures: [Brief explanation of the drawings]

[0027] [Figure 1] 14-3-3θ interacts with TDP-43. Immunoprecipitation (IP) of 14-3-3θ / TDP-43 complexes from N2A cells (A) and mouse brain (B). Control (ctr) IP confirmed the absence of nonspecific binding. [Figure 2] Coexpression of 14-3-3θ with TDP-43 carrying pathogenic mutations significantly enhanced immunoprecipitation (IP) compared to its non-mutated counterpart (n = 3). ***P < 0.001; **P < 0.01; *P < 0.05. Error bars indicate standard error of the mean (SEM). [Figure 3](A) When expressed alone, the A315T mutant TDP-43 localizes to the nucleus (+MOCK; arrowhead), but when coexpressed with 14-3-3θ, A315T-TDP-43 colocalizes to the cytoplasm (white arrowhead). (B) Coexpression of NLS- or NES-deficient (Δ) TDP-43 with 14-3-3θ exhibits significantly enhanced IP compared to coexpression with the unmutated form (n=3). ****p < 0.0001; *p < 0.05. Error bars indicate SEM. (C) Coexpression of 14-3-3θ relocalizes ΔNES TDP-43 (black arrowhead), which is normally nuclear, into the cytoplasm (white arrowhead). For comparison, the cytoplasmic localization of ΔNLS TDP-43 and the nuclear localization of unmutated TDP-43 were unchanged by 14-3-3θ. [Figure 4] N- and C-terminal truncation mutants of 14-3-3θ immunoprecipitated with TDP-43 unless α-helix 6 (ΔF) was removed. Note that in the absence of α-helices 7–9 (ΔG), 14-3-3θ / TDP-43 immunoprecipitation was enhanced. [Figure 5] Coexpression of 14-3-3θ α-helix 6 alone (14-3-3θ-Fx-V5) immunoprecipitated TDP-43, similar to the GΔ mutant of 14-3-3θ. [Figure 6] Alignment of α-helix 6 of 14-3-3 isoforms corresponding to 14-3-3θ-Fx. Red box, 11 amino acid sequence unique to 14-3-3θ. [Figure 7] (A) AAV-mediated expression of 14-3-3θ-V5 in the hippocampus resulted in insolubility and fragmentation (arrowheads) of TDP-43 in control (ctr) and iTDP-43A315T mice, respectively. Quantification of TDP-43 fragment levels from independent experiments (n=6). ***P < 0.001; *P < 0.05. Error bars indicate standard error. (B) Quantification of hTDP-43-expressing neurons in the hippocampal CA1 region of AAV-vec (vector)- and AAV-14-3-3θ-V5-injected iTDP-43A315T mice. **P < 0.01. Error bars indicate SEM. [Figure 8](A) Amino acids 135-164 of 14-3-3θ, which contains a C-terminal degeneration domain (DD) and an N-terminal V5 tag (DD-θFx), spontaneously degrade when expressed in primary neurons unless stabilized by Shield1 treatment. (B) DD-θFx reduced the levels of co-expressed A315T mutant human (h)TDP-43 in primary neurons (n ​​= 4). Graph: left column, TDP-43; right column, TDP-43 + DD-θFx. **, P < 0.01. Error bars indicate SEM. [Figure 9] (A) Nuclear hTDP-43 in the cortex of vector-injected iTDP-43A315T mice was significantly reduced in DD-θFx-expressing neurons. (B) Reduced TDP-43 levels in iTDP-43A315T brains expressing DD-θFx from birth (n=3). mCherry and V5 confirmed AAV-mediated expression. Note that DD-θFx is higher in iTDP-43A315T than in control mice. Graph: Left column, P0: iTDP-43 + vec; Right column, P0: iTDP-43 + DD-θFx. *, P < 0.05. Error bars indicate SEM. [Figure 10](A) Disinhibition (as reflected by increased open-arm time in the elevated plus maze) of vector-treated iTDP-43A315T mice was significantly reduced in DD-θFx-expressing mice (n = 8). (B) Increased activity (as reflected by longer distance traveled through the open field) of vector-treated iTDP-43A315T mice was significantly reduced in DD-θFx-expressing mice (n = 8). (C) Decreased motor performance (as reflected by shorter time to fall off the rotorod) of vector-treated iTDP-43A315T mice was comparable to that of ctr mice in DD-θFx-expressing mice (n = 8). (D) Decreased grip strength of vector-treated iTDP-43A315T mice was significantly greater in DD-θFx-expressing mice (n = 8). (A)–(D): Column 1, P0: ctr + vec; Column 2, P0: ctr + DD-θFx; Column 3, P0: iTDP-43 + vec; Column 4, P0: iTDP-43 + DD-θFx. vec = vector. ctr = control. ***P < 0.001; **P < 0.01; *P < 0.05; ns, not significant. Error bars indicate SEM. [Figure 11] (A) Decreased levels of transgenic hTDP-43 in iTDP-43A315T mice expressing DD-θFx-V5 compared to mCherry (n=3). Graphs: Left column, iv: iTDP-43 + vec; Right column, iv: iTDP-43 + DD-θFx. vec = vector. *P < 0.05. Error bars indicate SEM. (B) Staining of brains from vec- and DD-θFx-expressing mice showed a decrease in the number of hTDP-43-positive cells in the hippocampus (n=6). Graphs: Left column, iv: iTDP-43 + vec; Right column, iv: iTDP-43 + DD-θFx. vec = vector. **P < 0.01. Error bars indicate SEM. [Figure 12]Disinhibition in vector-treated iTDP-43A315T mice was significantly improved with DD-θFx expression (n=6). First column, iv:ctr + vec; second column, iv:ctr + DD-θFx; third column, iv:iTDP-43 + vec; fourth column, iv:iTDP-43 + DD-θFx. vec = vector. ctr = control. ***P < 0.001; **P < 0.01; *P < 0.05. Error bars indicate standard error of the mean (SEM). [Figure 13] Progressive decline in physical fitness, reflected by decreased reversal wire time (A) and corresponding linear regression slope difference (B), in vector-treated AAV-hTDP-43 mice compared with AAV-hTDP mice injected with AAV-DD-θFx and controls (n=10). B: Column 1, AAV-vec + AAV-vec; Column 2, AAV-vec + AAV-DD-θFx; Column 3, AAV-hTDP-43 + AAV-vec; Column 4, AAV-hTDP-43 + AAV-DD-θFx. *P < 0.05, ****P < 0.0001. Error bars indicate SEM. [Figure 14] Decreased grip strength in AAV-vector-treated AAV-hTDP-43 mice compared with AAV-DD-θFx-injected AAV-hTDP-43 mice (n=7). Column 1: AAV-hTDP-43 + AAV-vec female mice; column 2: AAV-hTDP-43 + AAV-DD-θFx female mice; column 3: AAV-hTDP-43 + AAV-vec male mice; column 4: AAV-hTDP-43 + AAV-DD-θFx male mice. *P < 0.05. Error bars indicate SEM. [Figure 15]Atrophy of the tibialis anterior (TA) muscle, represented by weight loss, was observed in female and male vector-treated AAV-hTDP-43 mice, comparable to AAV-DD-θFx-injected AAV-hTDP mice (n = 3–7). For female and male mice: Column 1, AAV-vec + AAV-vec; Column 2, AAV-vec + AAV-DD-θFx; Column 3, AAV-hTDP-43 + AAV-vec; Column 4, AAV-hTDP-43 + AAV-DD-θFx. *P < 0.05, ***P < 0.001. Error bars indicate SEM. DETAILED DESCRIPTION OF THE INVENTION

[0028] Amino acid and nucleotide sequences are referenced by sequence identification number (SEQ ID NO). Sequences are provided in the Sequence Listing. The amino acid sequence set forth in SEQ ID NO: 1 represents an 11 amino acid motif derived from α-helix 6 (αF) of human 14-3-3θ, and the DNA sequence encoding this motif is set forth in SEQ ID NO: 4. The amino acid sequence set forth in SEQ ID NO: 2 represents a 30 amino acid region derived from αF of human 14-3-3θ, and the DNA sequence encoding this region is set forth in SEQ ID NO: 5. The amino acid sequence of human 14-3-3θ is set forth in SEQ ID NO: 3. Other nucleotide sequences (including primer sequences) used in the studies described in the Examples are set forth in SEQ ID NOs: 6-20.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents, patent applications, published applications and publications, databases, websites, and other published materials mentioned throughout the disclosure are incorporated by reference in their entirety unless otherwise noted. In the event of a plurality of definitions for a term, those in this section prevail. When reference is made to a URL or other such identifier or address, it is understood that such identifiers change and particular information on the Internet may appear and disappear quickly, but that equivalent information may be found by searching the Internet. Reference to an identifier evidences the availability and public dissemination of such information.

[0030] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0031] In the context of this specification, the term "about" is understood to refer to a range of numbers that one of ordinary skill in the art would consider equivalent to the recited value, in the context that achieves the same function or result.

[0032] Unless the context requires otherwise, throughout this specification and the claims that follow, the words "comprises" and variations such as "comprising" will be understood to mean the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of other integers or steps or groups of integers or steps.

[0033] As used herein, the term "operably linked" refers to a functional connection between two elements, regardless of the orientation or distance between the two elements, such that the function of one element is controlled or influenced by the other element. For example, operably linked with respect to a promoter and a nucleic acid sequence means that the transcription and expression of the nucleic acid sequence is under the control of or driven by the promoter. In another example, in the context of the present disclosure, operably linked between two nucleotide sequences can result in a physical connection or coupling between the expressed encoded peptide or polypeptide, thereby forming a chimeric molecule.

[0034] The term "optionally" is used herein to mean that a feature described below may or may not be present, or that an event or circumstance described below may or may not occur. Thus, this specification is understood to include and encompass embodiments in which a feature is present, embodiments in which a feature is not present, and embodiments in which an event or circumstance occurs, and embodiments in which it is not present.

[0035] "Peptide" refers to a polymer made up of amino acids linked together by peptide bonds. The term "polypeptide" is also used to refer to such a polymer, and in some instances, polypeptides are longer (i.e., made up of more amino acid residues) than peptides. Nevertheless, the terms "peptide" and "polypeptide" may be used interchangeably herein.

[0036] As used herein, the terms "treat / treating," "treatment / treatment," "prevent," "prevention," and grammatical equivalents refer to any and all uses of treating the described neurodegenerative disease, preventing, delaying, or slowing the establishment of the disease, or otherwise preventing, hindering, slowing, or reversing the progression of the disease. Thus, the terms "treat" and "prevent," etc., should be considered in their broadest context. For example, treatment does not necessarily mean that a patient is treated until complete recovery. When a disease exhibits or is characterized by multiple symptoms, treatment or prevention does not necessarily ameliorate, prevent, hinder, slow, or reverse all of the symptoms, but may prevent, hinder, slow, or reverse one or more of the symptoms.

[0037] As used herein, the term "effective amount" includes within its meaning a non-toxic but sufficient amount or dose of a drug or compound to provide the desired effect.The exact amount or dose required varies from subject to subject, depending on factors such as the animal species being treated, the age, size, weight and general condition of the subject, the severity of the disease or condition being treated, the specific drug being administered, and the method of administration.Therefore, it is impossible to specify an exact "effective amount".However, for any given case, the appropriate "effective amount" can be determined by those skilled in the art using only routine experimentation.

[0038] As used herein, the term "subject" refers to a mammal, including humans, primates, livestock animals (e.g., sheep, pigs, cows, horses, donkeys), laboratory animals (e.g., mice, rabbits, rats, guinea pigs), performance and show animals (e.g., horses, livestock, dogs, cats), companion animals (e.g., dogs, cats), and captive wild animals. Preferably, the mammal is a human or a laboratory animal. Even more preferably, the mammal is a human.

[0039] TDP-43 is a multifunctional RNA / DNA-binding protein encoded by the TARDBP gene. It contains two RNA recognition motifs and a large C-terminal glycine-rich domain (GRD) that mediates protein-protein interactions. The G-rich domain contains the majority of pathogenic TARDBP mutations in familial ALS. However, prior to this invention, little was known about the functional role of TDP-43 interactions in physiology and disease.

[0040] As exemplified herein, the inventors have identified the protein 14-3-3θ as a novel interacting partner of TDP-43. Pathogenic TDP-43 mutants exhibit increased interaction with 14-3-3θ, resulting in cytoplasmic accumulation, insolubility, phosphorylation, and fragmentation of TDP-43, resembling pathological changes in disease. Without wishing to be bound by theory, the inventors suggest that transient interaction with 14-3-3θ may stabilize TDP-43 while it resides in the cytoplasm during RNA shuttling. The inventors further suggest that 14-3-3θ interacts with abnormal TDP-43 conformations, predisposing them to pathological alterations.

[0041] Additionally, as exemplified herein, the inventors demonstrate that the use of a unique peptide sequence derived from 14-3-3θ mediates the removal of pathological TDP-43 from mouse brains and reverses and prevents ALS- and FTD-related symptoms. While exemplified herein in the context of this peptide sequence linked to a protein destabilization domain, the present disclosure contemplates the use of the peptide in the absence of a protein destabilization domain. Without wishing to be bound by theory, the inventors believe that the peptide provides a physiological and / or pathological link between 14-3-3θ and TDP-43. disrupting the catalytic interaction, thereby preventing the toxic downstream effects of the 14-3-3θ / TDP-43 complex. This suggests that...

[0042] In one aspect, the present disclosure provides a method for treating or preventing or ameliorating at least one symptom of a neurodegenerative disease associated with TDP-43 pathology, the method comprising administering to a subject in need thereof a peptide comprising or consisting of the amino acid sequence of SEQ ID NO:1 or a conservative variant thereof, or a nucleic acid molecule encoding said peptide.

[0043] The embodiments of the present disclosure are applicable to the treatment or prevention of any neurodegenerative disease characterized by or otherwise associated with TDP-43 pathology. Typically, such diseases are characterized by or associated with cytoplasmic accumulation of nuclear TDP-43 and abnormal phosphorylation and fragmentation of TDP-43. In certain embodiments, the disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). ALS includes familial ALS and sporadic ALS. FTD includes familial FTD and sporadic FTD.

[0044] Symptoms of neurodegenerative diseases include behavioral and physical disorders characteristic of or associated with the disease.Therefore, according to the present disclosure, administration of peptides or nucleic acid molecules encoding the peptides can improve one or more behavioral or physical deficits characteristic of or associated with neurodegenerative diseases.Such behavioral and physical disorders include disinhibition, hyperactivity, movement disorders and muscle weakness.

[0045] Numerous pathogenic variants of TDP-43 are known to be associated with sporadic or familial ALS and FTD, including, for example, A315T, N345K, M337V, G294A, A382T, and G287S mutations. However, those skilled in the art will recognize that the scope of application of the present disclosure is not limited to the treatment or prevention of neurodegenerative diseases in individuals with one or more of these mutations.

[0046] The peptide RKQTIDNSQGA (SEQ ID NO: 1) for use according to aspects and embodiments of the present disclosure is an 11 amino acid motif present within alpha helix 6 (aF) of human 14-3-3θ (corresponding to amino acid residues 138-148 of wild-type human 14-3-3θ as set forth in SEQ ID NO: 3).

[0047] Conservative variants of the peptide of SEQ ID NO: 1 are also contemplated herein. Conservative variants include one or more conservative amino acid substitutions, which are substitutions or replacements of one amino acid with another amino acid with similar properties, as will be understood by those skilled in the art. For example, the substitution of the neutral amino acid serine (S) with the similarly neutral amino acid threonine (T) is a conservative amino acid substitution. Those skilled in the art can determine appropriate conservative amino acid substitutions that do not eliminate the functional properties of the peptide with respect to TDP-43 interaction.

[0048] Thus, also provided herein is an isolated peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1, or a conservative variant thereof. As used herein, the term "isolated," with reference to a nucleic acid molecule, means substantially free from cellular material and other contaminating proteins from the cell from which the peptide is derived (and thus altered from its native state), or, if chemically synthesized, substantially free from chemical precursors and other chemicals, and thus altered from its native state.

[0049] The peptide of SEQ ID NO: 1 or a conservative variant thereof can be provided within a larger contiguous peptide or polypeptide sequence. A peptide sequence comprising the sequence of SEQ ID NO: 1 typically contains, for example, about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 residues as a contiguous sequence. By way of example, a peptide of SEQ ID NO: 1 for use in accordance with the present disclosure can be provided as part of the αF helix sequence of 14-3-3θ, such as a sequence including amino acids 135-164 (SEQ ID NO: 2) of human 14-3-3θ (SEQ ID NO: 3), or a portion thereof, or a sequence at least about 75% identical thereto. For example, the αF helix sequence including the sequence of SEQ ID NO: 1 can be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids in length.

[0050] In one embodiment, the peptide may comprise or consist of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or a sequence at least about 75% identical to the sequence of SEQ ID NO: 2. The sequence may be about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 2. Thus, also provided herein is an isolated peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or a sequence at least about 75% identical to the sequence of SEQ ID NO: 2.

[0051] A peptide comprising or consisting of the sequence of SEQ ID NO: 1, or a conservative variant thereof, may contain or be linked to one or more other moieties to facilitate another function, such as transport, cell recognition, targeting, or protein destabilization or degradation. For example, the peptide may be linked to or include a cell-targeting moiety that facilitates targeting of the peptide to one or more specific types of cells, such as neurons or other cells of the central nervous system. Also, by way of example, as described further below, the peptide may contain or be linked to a protein destabilization or degradation signal or domain to disrupt stability and / or induce degradation in vivo. The peptide may be linked to one or more other moieties by any method known in the art, including any chemical or recombinant method, resulting in the formation of covalent and / or non-covalent bonds, as appropriate, between the molecule and one or more other moieties. The moieties may be peptide, polypeptide, or protein moieties. Accordingly, the present disclosure further provides chimeric peptides, polypeptides, and proteins comprising the sequence RKQTIDNSQGA (SEQ ID NO: 1), or a conservative variant thereof, linked to a heterologous peptide, polypeptide, or protein. Such chimeric peptides, polypeptides or proteins can have, for example, a length of up to about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1500 or 2000 residues or more.

[0052] The peptide or conservative variant of SEQ ID NO: 1 can be attached to the C-terminus or N-terminus of an additional peptide, polypeptide, or protein moiety. The component molecules can be conjugated using standard chemical coupling techniques, such as MBS, glutaraldehyde, EDC, or BDB coupling, or can be linked by peptide synthesis or recombinant methods known to those skilled in the art.

[0053] In certain embodiments of the present disclosure, a peptide comprising the sequence of SEQ ID NO: 1 or a conservative variant thereof is linked to or includes a moiety that provides a protein destabilization or degradation signal. In exemplary embodiments, the protein destabilization or degradation signal is provided by a protein destabilization or degradation domain (for convenience, referred to herein as a "destabilization domain"). A "destabilization domain" refers to a protein, polypeptide, or amino acid sequence that, when functionally linked to a peptide, polypeptide, or protein of interest, can disrupt the stability of the peptide, polypeptide, or protein of interest and, in some cases, induce its degradation. Examples of destabilization domains well known to those skilled in the art include ubiquitin, PEST sequences (proline-, glutamic acid-, serine-, and threonine-rich sequences), cyclin destruction boxes, hydrophobic stretches of amino acids, and the rapamycin-binding protein FKBP12 (as found in the pTuner plasmid, Clontech). Suitable destabilization domains can be incorporated into the peptide sequences of the present disclosure or conjugated to the N- or C-terminus of the peptide, with or without a linker. For embodiments in which it is desired to include a destabilization domain, those skilled in the art will understand that any suitable destabilization domain may be used, and that the scope of the present disclosure is not limited by reference to any particular destabilization domain.

[0054] Also provided herein are chimeric peptides, polypeptides, and proteins comprising the peptide of SEQ ID NO: 1, or a conservative variant thereof, conjugated to a protein destabilization domain sequence. Also provided herein are chimeric peptides, polypeptides, and proteins comprising the peptide of SEQ ID NO: 2, a conservative variant thereof, or a sequence at least about 75% identical to the sequence of SEQ ID NO: 2 conjugated to a protein destabilization domain sequence.

[0055] The peptides and polypeptides disclosed herein can be produced using any method known in the art, including chemical synthesis, nucleic acid synthesis, peptide synthesis, and / or recombinant technology. In one example, peptides such as the peptide of SEQ ID NO: 1 are synthesized using the Fmoc-polyamide format of solid-phase peptide synthesis. Other synthesis methods include solid-phase t-Boc synthesis and liquid-phase synthesis. Purification can be performed by any one or a combination of techniques, such as recrystallization, size exclusion chromatography, ion exchange chromatography, hydrophobic interaction chromatography, and reverse-phase high-performance liquid chromatography using, for example, acetonitrile / water gradient separation.

[0056] Alternatively, peptides and polypeptides can be produced using recombinant methods well known in the art. Nucleic acids encoding peptides and polypeptides can be obtained by any suitable method (e.g., RT-PCR or synthesis of oligonucleotides encoding the polypeptides of the present invention). Thus, as further described below, nucleic acid molecules encoding peptides and polypeptides, including the chimeric peptides and polypeptides disclosed herein, are also provided herein. Designing nucleic acid molecules encoding peptides and polypeptides, including the chimeric peptides and polypeptides disclosed herein, is well within the skill of one of ordinary skill in the art.

[0057] Peptide mimetics of the peptide sequences disclosed herein are also contemplated and encompassed by the present disclosure. As used herein, the term "peptidomimetic" refers to a peptide-like molecule that has the ability to interact with the TDP-43 of the peptide on which it is structurally based. Such peptidomimetics include chemically modified peptides, peptide-like molecules containing unnatural amino acids, and peptoids (see, for example, Goodman and Ro, Peptidomimetics for Drug Design, "Burger's Medicinal Chemistry and Drug Discovery," Vol. 1 (ed. ME Wolff; John Wiley & Sons 1995), pages 803-861). A variety of peptidomimetics are known in the art, including, for example, constrained amino acids (e.g., alpha-methylated amino acids, alpha, alpha-dialkylglycines, alpha-, beta-, or gamma-aminocycloalkanecarboxylic acids, alpha, beta-unsaturated amino acids, beta, beta-dimethyl or beta-methyl amino acids, or other amino acid mimetics), non-peptide components that mimic peptide secondary structure (e.g., non-peptidic three-turn mimetics, gamma-turn mimetics, beta-sheet mimetics, or helix mimetics), or amide bond isosteres (e.g., reduced amide bonds, methylene ether bonds, ethylene bonds, thioamide bonds, or other amide isosteres). Methods for identifying peptidomimetics are also well known in the art and include, for example, screening databases containing libraries of potential peptidomimetics.

[0058] The present disclosure also provides isolated nucleic acid molecules encoding the peptides and chimeric peptides described herein, and methods in which the nucleic acid molecules are administered, typically as part of a vector or similar genetic construct, to a subject in need thereof.

[0059] For example, a nucleic acid molecule encoding the peptide of SEQ ID NO: 1 or a conservative variant thereof may comprise the nucleotide sequence set forth in SEQ ID NO: 4, or a sequence having at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence set forth in SEQ ID NO: 4. For example, a nucleic acid molecule encoding the peptide of SEQ ID NO: 2, a conservative variant thereof, or a sequence having at least about 75% identity to the sequence of SEQ ID NO: 2 can comprise the nucleotide sequence set forth in SEQ ID NO: 5, or a sequence having at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 5. The nucleic acid molecule can further comprise the nucleotide sequence of a selected protein destabilization domain operably linked to the above nucleotide sequence such that a chimeric peptide or polypeptide is expressed.

[0060] The present disclosure also provides vectors containing one or more of the nucleotide sequences described herein. Typically, the nucleotide sequence is operably linked to a promoter to enable expression of the peptide or polypeptide. The vector may be an episomal vector (i.e., not integrated into the host cell genome) or a vector that integrates into the host cell genome. The vector may be replication-competent or replication-defective. Exemplary vectors include, but are not limited to, plasmids, cosmids, and viral vectors, such as adeno-associated virus (AAV) vectors, lentiviruses, retroviruses, adenoviruses, herpesviruses, parvoviruses, and hepatitis virus vectors. The selection and design of an appropriate vector is within the ability and discretion of one skilled in the art.

[0061] Provided herein are polynucleotides comprising expression cassettes or expression constructs that can be used for expressing peptides, polypeptides, or chimeric peptides or polypeptides as described herein in a suitable vector for use in gene therapy. Thus, in certain embodiments, the disclosed methods involve administering to a subject in need thereof a vector comprising a nucleotide sequence encoding the peptides and polypeptides disclosed herein, typically operably linked to a heterologous promoter, such that the peptide, polypeptide, or chimeric peptide or polypeptide of interest is expressed in vivo. In certain exemplary embodiments, the vector is a viral vector. As used herein, the term "viral vector" refers to a vector derived from any virus and typically contains at least one element of origin and has the ability to be packaged into recombinant viruses or virions. Viral vectors may have one or more wild-type genes of the virus deleted in whole or in part, but retain functional flanking ITR sequences necessary for virion rescue, replication, and packaging. Thus, viral vectors typically contain at least the sequences required in cis for viral replication and packaging (e.g., functional ITRs). The ITRs need not be wild-type nucleotide sequences but may be modified, for example, by the insertion, deletion, or substitution of nucleotides, so long as the sequences provide for functional rescue, replication, and packaging. The vectors and / or virions can be utilized for the purpose of introducing heterologous sequences into cells, either in vitro or in vivo.

[0062] In certain embodiments, the vector is an AAV vector, i.e., a vector derived from an adeno-associated virus, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or a vector using synthetic or modified AAV capsid proteins, such as those optimized for efficient in vivo transduction of the central nervous system. A recombinant AAV vector refers to a replication-deficient virus containing an AAV capsid shell encapsidating the AAV genome. Typically, one or more wild-type AAV genes, preferably all or part of the REP and / or CAP genes, are deleted from the genome. Functional ITR sequences are required for rescue, replication, and packaging of the vector genome into AAV virions.

[0063] AAV ITRs can be derived from any of several AAV serotypes, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, etc., or can be synthesized. One skilled in the art can make a selection without undue experimentation. AAV ITRs are typically about 145 nucleotides in length, but they need not have a wild-type nucleotide sequence; i.e., they can be modified by nucleotide insertion, deletion, and / or substitution (provided they are functional). Furthermore, the ITRs in a polynucleotide do not necessarily need to be identical or derived from the same AAV serotype or isolate, as long as they function as intended, i.e., assist in the rescue, replication, and packaging of the transgene. The nucleotide sequences of AAV ITRs are well known in the art.

[0064] Vectors for use according to the present disclosure may also include transcription enhancers, translation signals, and transcription and translation termination signals. Examples of transcription termination signals include, but are not limited to, polyadenylation signal sequences such as bovine growth hormone (BGH) poly(A), SV40 late poly(A), rabbit beta-globin (RBG) poly(A), thymidine kinase (TK) poly(A) sequence, and any variants thereof. In some embodiments, a transcription termination region is located downstream of the posttranscriptional regulatory element. In some embodiments, the transcription termination region is a polyadenylation signal sequence.

[0065] The vector for use according to the present disclosure may also include various post-transcriptional regulatory elements. In some embodiments, the post-transcriptional regulatory element may be a viral post-transcriptional regulatory element. Non-limiting examples of viral post-transcriptional regulatory elements include woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), hepatitis B virus post-transcriptional regulatory element (HBVPRE), RNA transport element, and any variant thereof.

[0066] The present disclosure contemplates delivery of peptides, polypeptides, polynucleotides, and vectors to a subject in need of treatment by any suitable means, typically in the form of a pharmaceutical composition, which may include one or more pharmaceutically acceptable carriers, excipients, or diluents. Such compositions may be administered by any convenient or appropriate route, such as parenterally (e.g., intraperitoneally, subcutaneously, intraarterially, intravenously, intramuscularly), orally (including sublingually), nasally, or topically. In situations where an appropriate concentration of a molecule needs to be delivered directly to the site in the body to be treated, administration may be local rather than systemic. Local administration offers the ability to deliver very high local concentrations of molecules to the required site, and is therefore suitable for achieving the desired therapeutic or prophylactic effect while avoiding exposure of other organs of the body to the vectors and molecules, thereby potentially reducing side effects.

[0067] It is understood that the specific dosage level of the compositions of the present invention for any particular subject will depend on various factors, including, for example, the activity of the specific agent used, the age, body weight, general health and diet of the individual being treated, the time of administration, the rate of excretion, and any combination with other treatments or therapies. Single or multiple administrations can be used, with the dosage level and pattern being selected by the treating physician. A wide range of dosages can be applied. For example, approximately 0.1 mg to approximately 1 mg of agent can be administered per kg of body weight per day, taking into account the patient. Dosage regimens may be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily, weekly, monthly, or at other appropriate intervals, or the dosage can be proportionally reduced as indicated by the exigencies of the situation.

[0068] Examples of pharmaceutically acceptable carriers or diluents are demineralized or distilled water; physiological saline; vegetable oils such as arachis oil, safflower oil, olive oil, cottonseed oil, corn oil, sesame oil, groundnut oil or coconut oil; silicone oils including polysiloxanes, for example, methylpolysiloxanes, phenylpolysiloxanes, and methylphenylpolysiloxanes; volatile silicones; mineral oils such as liquid paraffin, soft paraffin or squalane; cellulose derivatives such as methylcellulose, ethylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose or hydroxypropylmethylcellulose; lower alkanols, for example, ethanol or isopropanol; lower aralkanols; lower polyalkylene glycols or lower alkylene glycols, for example, polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3-butylene glycol or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate; polyvinylpyridone; agar; carrageenan; gum tragacanth, gum arabic, and petroleum jelly. Typically, the carrier or carriers form 10 to 99.9% by weight of the composition.

[0069] The present invention contemplates combination therapy, in which the peptides, polypeptides, polynucleotides, and vectors described herein are co-administered with other suitable drugs that can promote the desired therapeutic or preventive results. "Co-administered" refers to simultaneous administration in the same formulation or in two different formulations via the same or different routes, or sequential administration via the same or different routes. "Sequential" administration refers to a time difference of seconds, minutes, hours, or days between the administration of the drugs. Administration can be in any order.

[0070] Reference herein to any prior publication (or information derived therefrom) or known matter is not, and should not be, considered an acknowledgement or admission, or any form of suggestion, that the prior publication (or information derived therefrom) or known matter forms part of the common general knowledge in the field of endeavor to which this invention pertains.

[0071] The present disclosure will now be described with reference to the following specific examples, which should not be construed as in any way limiting the scope of the disclosure. [Example]

[0072] The following examples are illustrative of the present disclosure and should not be construed as limiting in any way the general nature of the disclosure of the present description throughout this specification.

[0073] General method

[0074] Bacterial two-hybrid screening. The BacterioMatch II two-hybrid system was performed according to the manufacturer's instructions (Chem-Agilent). Briefly, the carboxyl-terminal portion of human TDP-43 (corresponding to amino acids 259–415 of the human TDP-43 sequence in UniProt accession number Q13148) was cloned into the pBT(bait) vector and used to identify interacting partners from a human brain cDNA pTRG plasmid library. Detection of protein-protein interaction partners was based on transcriptional activation of the HIS3 reporter gene, and positive results were further verified by a secondary streptomycin resistance reporter. All growth and transformation was performed using chemically competent cells provided in the kit. Colonies were visualized for imaging by incubating growth plates containing 2% TTC / PBS (Sigma) at 37°C for 10 min.

[0075] Cloning. Point mutations and truncation mutants were generated by standard site-directed mutagenesis (Ittner et al., 2005, Biochemistry 44: 5749-5754). Knockdown of 14-3-3θ was performed using 14-3-3θ MISSION shRNA lentivirus (Sigma-Aldich) with the sequence CCGGCAGTTGCTTAGAGACAACCTACTCGAGTAGTTGTCTAAGCAACTGTTTTTG (SEQ ID NO: 6). Stable overexpression of 14-3-3θ (C-terminal V5-tag) in SH-SY5Y cells was achieved using lentivirus (cloning vector pLenti6 / Ubc; Life Technologies). All 14-3-3 isoforms were cloned with a C-terminal myc tag into pcDNA3.1 / myc (Life Technologies). , TDP-43 wild-type / mutants were cloned with a C-terminal V5 tag into pcDNA3.1 / V5 (Life Technologies) and immunoprecipitation was performed.

[0076] Adeno-associated virus (AAV) 14-3-3θ (V5-tagged) was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (Addgene, #50465) as a backbone, with EGFP removed. The same vector or a variant for mCherry expression was used as a control. Packaging of the rAAV9 vector was performed as previously described (Bi et al., 2017, Nat Commun 8: 473) using the capsid AAV9.PHP.B (Deverman et al., 2016, Nat Biotechnol 34:204-209). 2 μl of rAAV (1 × 10 13 Viral genomes / ml) were injected into 3-month-old wild-type or iTDP-43 A315T The rAAV was injected into the hippocampus (-1.94 mm AP, 1.6 mm ML, 1.8 mm DV from λ) of mice (Ke et al., 2015, Acta Neuropathol 130:661-678). For spinal injections, 1 ul of rAAV (1 x 10 13 The virus genomes (10 ...

[0077] Immunoprecipitation. Immunoprecipitation was performed as previously described (Ittner et al., 2009, J Biol Chem 284: 20909-20916). Briefly, 293T HEK cells were cotransfected with TDP-43 variants and / or 14-3-3 isoforms / variants in pcDNA3.1 / V5. Cells were lysed in RIPA buffer. Equal amounts of protein were incubated overnight with 1 μl of V5 antibody (Life Technologies) and precipitated using magnetic protein G beads (Life Technologies). Coimmunoprecipitation was further confirmed by Western blot using Myers-Barre bodies.

[0078] Western blotting. Western blotting was performed as previously described (Ke et al., 2012, PLoS One 7: e35678). The primary antibodies used for immunoblotting were human TDP-43, c-terminal TDP-43, pan-TDP-43 (Proteintech), 14-3-3θ (Abcam), V5, myc (Life Technologies), phospho-TDP-43 S409 / 410 (Cosmobio), and GAPDH (Merck-Millipore).

[0079] Cell culture and staining. All immunoprecipitation experiments were performed in 293T HEK cells. Cells were maintained in DMEM containing 10% fetal bovine serum (FBS) according to standard protocols. SH-SY5Y cells were maintained in DMEM / F-12 containing 10% FBS and used for 14-3-3θ overexpression or knockdown. Stable overexpression and knockdown of 14-3-3θ was achieved by lentiviral transduction. For immunocytochemistry, cells were fixed in 4% PFA and blocked with 3% heat-inactivated goat serum / 2% BSA. Antibodies used were V5 (Sigma), myc (Life Technologies), and secondary Alexa Fluor 488 and 555 (Life Technologies). Coverslips were mounted with Immun-Mount (Southern Biotech).

[0080] Microscopy. All cell culture fluorescence images were taken using either a BX51 epifluorescence or a confocal FV10i microscope (Olympus).

[0081] In vitro complex assay. HEK293T cells were transfected with full-length wild-type TDP-43, TDP-43 carrying the F147L / F149L double mutation (both C-terminally V5-tagged), or 14-3-3θ (polyhistidine-tagged). Cells transfected with TDP-43 constructs were lysed in immunoprecipitation buffer (IPB) (20 mM Tris-HCl (pH 7.8), 150 mM sodium chloride, 0.1% (v / v) NP-40) supplemented with EDTA-free complete protease inhibitor cocktail (Roche), and V5-tagged TDP-43 was IPed with mouse anti-v5 antibody (Life Technologies) as described above. The lysate was then washed twice with IPB and twice with DNase / RNase buffer (DRB) (10 mM Tris-HCl (pH 7.6), 2.5 mM MgCl2, and 0.5 mM CaCl2) and reconstituted in DRB. 14-3-3θ-HIS-transfected cells were lysed in IPB and purified via TALON resin (Clontech Laboratories). Briefly, the lysate was incubated with TALON resin for 2 h at 4 °C, washed three times with IPB, and eluted with in vitro interaction buffer (IVIB) (20 mM Tris-HCl (pH 7.8), 0.1 M sodium chloride, 20% (v / v) glycerol, 5 mM MgCl2, 5 mM CaCl2, 0.1% (v / v) NP-40, 1 mM EDTA, 0.1 mM DTT, and 0.2 mM PMSF). For RNA and DNA digestion, magnetic bead suspensions containing bound V5-tagged TDP-43 were incubated with either DNase, RNase, or buffer (control) at 37°C for 10 minutes. After digestion, all reaction mixtures were washed once with ice-cold IPB and resuspended in IVIB. Purified TDP-43 and 14-3-3θ were then incubated for 2 hours at 4°C for in vitro interaction. Reactions were washed as per standard IP and eluted in 4x sample buffer for Western blot analysis.

[0082] Quantitative PCR. RNA purification and quantitative PCR were performed as previously described (Bi et al., 2017, Nat Commun 8: 473). Briefly, RNA was extracted from mouse cortical brain tissue using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. To remove contaminating genomic DNA, on-column DNA digestion was performed using RNase-free DNase I (Qiagen). cDNA was synthesized from 2.5 μg of total RNA using a second-strand cDNA synthesis kit (Invitrogen). mRNA levels were determined by quantitative PCR using Fast SYBR green reaction mix (Invitrogen) and gene-specific primer pairs on an Mx3000 real-time PCR cycler (Stratagene). Levels were expressed as fold changes of the housekeeping gene Gapdh and converted to fold differences compared to control tissue. These primers were used (5' to 3'):

[0083] 14-3-3θ (F): GCTAAAACGGCTTTTGATGAGG (SEQ ID NO: 7); (R): GTGCCCTGGATGCCTTTAGTT (SEQ ID NO: 8) 14-3-3β (F): CTCCAGTCCTCCGCGAAAAT (SEQ ID NO: 9); (R): GAGAGTTCGTGTCCCTGCTC (SEQ ID NO: 10) 14-3-3γ (F): GGCGGTCTTCGGTTTCCTTC (SEQ ID NO: 11); (R): GTTCAGCTCGGTCACGTTCTT (SEQ ID NO: 12) 14-3-3ε (F): CGCACCCCATTCGTTTAGG (SEQ ID NO: 13); (R): ATTCTGCTCTTCACCATCACC (SEQ ID NO: 14) 14-3-3ζ (F): CTACGATCACGTCCAACCCG (SEQ ID NO: 15); (R): GTCAAACGCTTCTGGCTGC (SEQ ID NO: 16) 14-3-3σ (F): ACAACCTGACACTGTGGACG (SEQ ID NO: 17); (R): CCTTTGGAGCAAGAACAGCG (SEQ ID NO: 18) Gapdh (F): GTGAAGGTCGGTGTGAAC (SEQ ID NO: 19); (R): ATCTCCACTTTGCCACTGCAA (SEQ ID NO: 20)

[0084] Mouse iTDP-43 A315T Mice have been previously described (Ke et al., 2015, Acta Neuropathol 130: 661-678). These mutants constitutively expressed human A315T-altered TDP-43 under the control of a doxycycline-controllable (Tet-OFF) promoter in the central nervous system. Mice were group-housed with a 12-hour light / dark cycle and free access to food and water. Time-mated C57Bl / 6 mice were obtained from ARC Perth. All animal experiments were approved by the Macquarie University Animal Ethics Committee.

[0085] Motor testing - Wire testing was performed as previously described (van Hummel et al., 2018, Am J Pathol 188: 1447-1456). Briefly, mice were placed on a wire mesh, inverted, and the latency to fall off was recorded. Grip strength was measured using a grip strength meter (Chatillon, AMETEK) as previously described (Am J Pathol 188, 1447-1456).

[0086] Immunohistochemistry. Staining of paraffin tissue sections, including antigen retrieval, has been previously described (van Eersel et al., 2015, Neuropathology and Applied Neurobiology 41: 906–925). Primary antibodies used for staining were against human TDP-43, pan-TDP-43 (ProteinTech), NeuN, mCherry, EGFP (Abcam), and V5 (Sigma). Secondary antibodies used were conjugated to Alexa-Fluor 488, 555, and 647 (Life Technologies).

[0087] Statistical analysis. Statistical analysis was performed using GraphPad Prism 6.0. Student's t-test was used for two-group comparisons, and ANOVA was used for multiple-group comparisons.

[0088] Example 1 – Identification of novel interaction partners of TDP-43

[0089] To identify novel interacting partners of the C-terminal glycine-rich domain (GRD) of TDP-43, we performed a bacterial two-hybrid screen as described above. The best candidate identified (11 of 65 hits) was 14-3-3θ (encoded by the YWHAQ gene), a member of the 14-3-3 scaffolding protein family. Co-immunoprecipitation from mouse N2a cells and mouse brain confirmed the interaction between endogenous 14-3-3θ and TDP-43 (Figure 1).

[0090] To test whether the 14-3-3θ / TDP-43 interaction is disease-related, we coexpressed 14-3-3θ with TDP-43 mutants in 293T HEK cells. Surprisingly, 14-3-3θ significantly interacted with TDP-43 mutants associated with pathogenic mutations, including the A315T mutation, a pathogenic variant associated with familial ALS and FTD (see Figure 2). Coexpression of 14-3-3θ with TDP-43-A315T resulted in significant cytoplasmic colocalization (Figure 3A). Nuclear localization (NLS) and nuclear export (NES) sequences mediate the predominant nuclear localization of TDP-43. Interestingly, 14-3-3θ exhibited strong interactions with both the NES-deleted (ΔNES) and NLS-deleted (ΔNLS) mutants of TDP-43 (Figure 3B). The cytoplasmic localization of TDP-43-ΔNLS and the nuclear localization of non-mutant TDP-43 were unaltered by 14-3-3θ, whereas TDP-43-ΔNES, when expressed in cells, was strictly localized to the nucleus and formed nuclear aggregates (Winton et al., 2008, J Biol Chem 283:13302-13309) and, when cotransfected with 14-3-3θ, was found almost exclusively in the cytoplasm (Figure 3C).

[0091] The above findings demonstrate that we have identified a novel interaction between 14-3-3θ and TDP-43, with enhanced complex formation that drives the cytoplasmic localization of TDP-43 mutants, including pathogenic mutants.

[0092] We then tested all 14-3-3 isoforms for potential interactions with TDP-43 by co-immunoprecipitation. TDP-43 was shown to interact more strongly with the 14-3-3η, 14-3-3γ, and 14-3-3σ isoforms than with the 14-3-3θ isoforms, but showed no apparent interaction with the 14-3-3ε, 14-3-3ζ, or 14-3-3β isoforms (data not shown). The 14-3-3σ and 14-3-3ζ isoforms are not abundant in neurons. More importantly, compared with wild-type TDP-43, only the 14-3-3θ isoform exhibited significantly stronger interactions with the TDP-43-A315T and especially the TDP-43-ΔNES mutant, whereas the other interacting isoforms did not exhibit enhanced interactions (in fact, 14-3-3σ interacted less with TDP-43-ΔNES) (data not shown). Thus, only the interaction with 14-3-3θ was altered in the pathogenic TDP-43 mutant.

[0093] Example 2 - Interaction motifs in 14-3-3θ that mediate binding to TDP-43

[0094] 14-3-3 dimers typically interact with phosphorylated interacting partners. In contrast, in the case of TDP-43, we found that a phosphomimetic mutant of TDP-43 interacted less with 14-3-3θ, supporting a non-canonical interaction (data not shown).

[0095] Structurally, 14-3-3θ has nine α-helices (see Figure 4), with helices αC, αE, αG, and αI contributing to canonical partner binding in the 14-3-3θ dimer. To identify the interaction motif in 14-3-3θ that mediates TDP-43 binding, we truncated 14-3-3θ stepwise and revealed that this interaction is mediated by the sixth α-helix (αF) of 14-3-3θ (Figure 4).

[0096] We generated a construct containing only α-helix 6 (αF) of 14-3-3θ (the 30-amino acid sequence shown in SEQ ID NO: 2; corresponding to amino acids 135–164 of the wild-type human TDP-43 sequence) and designated this construct "Fx." Expression of Fx coprecipitated TDP-43 (Figure 5), but failed to pull down the known 14-3-3θ interacting partners YES-associated protein (YAP) and FOXO1 (data not shown), further supporting a non-canonical interaction between 14-3-3θ and TDP-43. α-helix 6 (αF) of 14-3-3θ is located on the opposite face of the 14-3-3θ dimer and contains a 10-amino acid motif not present in other 14-3-3 isoforms (Figure 6), distinct from the canonical central interaction site, which may explain its non-conventional interaction with TDP-43.

[0097] Example 3 - Effect of increasing 14-3-3θ expression in vivo

[0098] To study the effects of increased 14-3-3θ levels in vivo, we used adeno-associated virus (AAV) to transfect 3-month-old non-transgenic mice and iTDP-43 A315T We expressed 14-3-3θ in the hippocampus of mice. Increased neuronal 14-3-3θ levels led to the accumulation of insoluble TDP-43 debris in non-transgenic mice, and iTDP-43 A315T In addition, AAV-14-3-3θ-injected iTDP-43 accumulated more in mice than in controls (Figure 7A). A315T Mice showed a substantial loss of hTDP-43-expressing hippocampal neurons compared to controls (Figure 7B). Thus, increased 14-3-3θ levels in vivo led to disease-like insolubility and fragmentation of endogenous and transgenic TDP-43, leading to the loss of iTDP-43. A315T This further exacerbated the neuropathological phenotype in mice.

[0099] We also tested whether long-term AAV-mediated overexpression of 14-3-3θ in the spinal cord of naive C57Bl / 6 mice resulted in altered endogenous TDP-43 and functional deficits. Histopathological analysis of spinal cords 10 months after 14-3-3θ overexpression revealed cytoplasmic accumulation of TDP-43 in 14-3-3θ-overexpressing anterior horn motor neurons, whereas non-expressing or GFP control cells exhibited only nuclear TDP-43 (data not shown). Thus, chronically elevated 14-3-3θ levels impaired TDP-43 localization in motor neurons and resulted in functional motor deficits.

[0100] Example 4 – 14-3-3θ-Fx targets pathological TDP-43 degradation

[0101] The unique interaction between 14-3-3θ and TDP-43 and the preference of 14-3-3θ for aberrant forms of TDP-43 prompted us to explore whether 14-3-3θ could be used to therapeutically target pathological TDP-43. We designed a construct containing 14-3-3θ-Fx (Example 2) fused to a C-terminal degradation domain (DD) from the PTuner plasmid (Clonetech) and an N-terminal V5 tag for detection (referred to herein as "DD-θFx"). DD-θFx was shown to accumulate in primary neurons only in the presence of the stabilizing compound Shield1, confirming efficient DD-induced degradation in neurons (Figure 8A). Coexpression of DD-θFx with A315T mutant human TDP-43 (hTDP-43) in neurons significantly reduced the levels of hTDP-43, consistent with induced degradation (Figure 8B). Furthermore, iTDP-43 A315T AAV-mediated expression of DD-θFx in mouse brain resulted in the mutually exclusive expression of recombinant hTDP-43 relative to DD-θFx (Figure 9A) and reduced TDP-43 levels (Figure 9B). This suggests clearance of transgenic hTDP-43 via DD-θFx degradation. DD-θFx turnover is responsible for the iTDP-43 clearance. A315T higher in control mice than in control mice, possibly due to iTDP-43 A315TThis is thought to be due to the presence of TDP-43 aggregates in mice. A315T Functional assessment of mice injected with control vector iTDP-43 A315T Compared to mice, DD-θFx showed less disinhibition, less hyperactivity, reduced motor impairment, and increased muscle strength (Figure 10). Therefore, DD-θFx induces targeted degradation of pathogenic TDP-43 in neurons, resulting in iTDP-43 A315T Prevented defects in mice.

[0102] We then used the neurotrophic AAV serotype, AAV.PHP.B (Deverman et al., 2016, Nat Biotechnol 34:204-209), to inoculate 3-month-old iTDP-43 mice with established defects. A315T Systemic delivery of DD-θFx (or control) to central nervous system neurons in mice was demonstrated. Western blot analysis revealed that DD-θFx-expressing iTDP-43 A315T We confirmed a reduction in hTDP-43 in mice compared to controls (Figure 11A). This resulted in comparable and reproducible DD-θFx and control vector expression patterns throughout the central nervous system within 2 weeks (Figure 11B). Importantly, a 32.6 ± 6.6% reduction in hTDP-43-expressing neurons was observed without obvious cell loss. Furthermore, DD-θFx colocalized with hTDP-43 in the remaining neurons, many of which showed only weak transgenic TDP-43 staining. Next, we investigated the effects of iTDP-43 on the expression of DD-θFx in 3.5-month-old mice. A315T Mice (i.e., 2 weeks after DD-θFx AAV delivery) were functionally evaluated. At this age, untreated iTDP-43 A315T Mice show significant impairments (Ke et al., 2015 Acta Neuropathol 130:661-678). In particular, DD-θFx expression is associated with iTDP-43 A315T Expression of the control vector improved the disinhibition of iTDP-43 in these tasks (Figure 12). A315TDD-θFx did not affect the performance of control mice. Taken together, neuronal DD-θFx expression is associated with iTDP-43 A315T "This reduced TDP-43 levels in mice and reversed established functional deficits. These data suggest that specific interacting peptides can be used to target and eliminate pathological TDP-43, potentially providing a novel approach to treating ALS and FTD."

[0103] Example 5 - DD-θFx prevented the defects induced by expression of human wild-type TDP-43 in mice

[0104] We then investigated the effects of DD-θFx expression in a mouse model of sporadic ALS based on AAV-mediated expression of non-mutant hTDP-43 in CNS neurons. We used the neurotropic AAV9 serotype, AAV.PHP.B, to enable systemic delivery and uniform expression in CNS neurons via temporal vein injection in naive newborn C57B1 / 6 mice (Deverman et al., 2016, Nat Biotechnol 34:204-209). The effects of DD-θFx were examined by co-injection at birth (AAV-DD-θFx) in mice injected with either native hTDP-43 (AAV-hTDP-43) or the AAV vector alone (AAV-ctr).

[0105] Up to 10 weeks of age, AAV-hTDP-43 and AAV-ctr mice demonstrated comparable performance on the reversal wire test every other week (Figure 13), suggesting comparable strength. Thereafter, performance on the reversal wire test progressively declined in mice administered AAV-hTDP-43, a decline that was completely prevented when mice were co-treated with AAV-DD-θFx at birth (Figure 13). This result was supported by direct assessment of grip strength, which showed a significant decrease in grip strength in male AAV-hTDP-43 mice compared with AAV-ctr mice, a decrease that was prevented by co-treatment with DD-θFx (Figure 14). A similar trend was observed in female mice. Furthermore, tibialis anterior muscle weights were significantly reduced in 19-week-old female and male AAV-hTDP-43 mice compared with their respective controls (Figure 15). These results demonstrate that DD-θFx prevents the deficits induced by expression of non-mutant TDP-43 in mice. [Explanation of symbols]

[0106] [Figure 1] Input: N2a cells: N2a cells mouse brain: mouse brain [Figure 2] Input: Fold of IP: Multiple of IP [Figure 3] Fold of IP: Multiple of IP MOCK: Mock [Figures 4 and 5] Input: [Figure 7] control: Control Extraction: Extraction TDP-43 fragments relative to full-length: TDP-43 fragments relative to full-length neurons [Figures 8, 9, 11] rel hTDP-43 levels: Relative hTDP-43 levels [Figure 10] Time in Arm (s): Time in arm (s) closed: closed open: open Distance Traveled (m): Traveled distance (m) Time till fall (s): Time until fall (s) Peak Force (N): Maximum force (N) [Figure 12] neurons Time in Area (s): Time in Area (s) closed: closed open: open [Figure 13] Time on Wire (s): Time on Wire (s) Days pi: Days after injection Linear Regression Slope (>= Day 10 pi): Linear regression slope (≥ 10 days post-injection) [Figure 14] Grip Strength: Grip strength [Figure 15] TA Muscle Weight (mg): TA Muscle Weight

[0107] [Item 1] A method for treating or preventing, or ameliorating at least one symptom of, a neurodegenerative disease associated with TDP-43 pathology, comprising administering to a subject in need thereof an effective amount of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, or a nucleic acid molecule encoding said peptide. [Item 2] 2. The method of claim 1, wherein the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). [Item 3] 3. The method of claim 1 or 2, wherein the at least one symptom comprises disinhibition, hyperactivity, movement disorders, or muscle weakness. [Item 4] 4. The method of any one of claims 1 to 3, wherein the amino acid sequence of SEQ ID NO: 1 is provided within a larger contiguous peptide or polypeptide sequence. [Item 5] The method of any one of claims 1 to 4, wherein the nucleic acid molecule encoding the peptide of SEQ ID NO: 1 or a conservative variant thereof comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least about 70% identical to the sequence of SEQ ID NO: 4. [Item 6] 6. The method of any one of claims 1 to 5, wherein the peptide or polypeptide sequence comprises or consists of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or a sequence that is at least about 75% identical to the sequence of SEQ ID NO: 2. [Item 7] 7. The method of any one of claims 1 to 6, comprising administering a nucleic acid molecule encoding a peptide or polypeptide sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or a sequence at least about 75% identical to the sequence of SEQ ID NO: 2. [Item 8] 8. The method of claim 7, wherein the nucleic acid molecule encoding the peptide of SEQ ID NO: 2, a conservative variant thereof, or a sequence at least about 75% identical thereto, comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence at least about 70% identical to the sequence of SEQ ID NO: 5. [Item 9] 9. The method of claim 1, wherein the peptide comprises or is linked to a protein destabilization domain sequence. [Item 10] 10. The method of claim 9, wherein the protein destabilization domain sequence comprises the rapamycin binding protein FKBP12. [Item 11] 11. The method of any one of claims 1 to 10, comprising administering to a subject a genetic construct encoding a peptide comprising or consisting of the sequence of SEQ ID NO: 1 or a conservative variant thereof, operably linked to a nucleotide sequence encoding a protein destabilization domain. [Item 12] Use of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, or a nucleic acid molecule encoding said peptide, in the manufacture of a medicament for the treatment or prevention of a neurodegenerative disease associated with TDP-43 pathology, or the amelioration of at least one symptom thereof. [Item 13] An isolated peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof. [Item 14] 14. The peptide of claim 13, comprising or consisting of the amino acid sequence of SEQ ID NO:2, a conservative variant thereof, or a sequence at least about 75% identical to the sequence of SEQ ID NO:2. [Item 15] 15. The peptide of claim 13 or 14 for use in the treatment or prevention of a neurodegenerative disease associated with TDP-43 pathology, or amelioration of at least one symptom thereof. [Item 16] 15. An isolated polynucleotide encoding the peptide of claim 13 or 14. [Item 17] 16. The polynucleotide of claim 15, comprising or consisting of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5, or a polynucleotide at least about 70% identical to the sequence of SEQ ID NO: 4 or SEQ ID NO: 5. [Item 18] No original text [Item 19] A chimeric molecule comprising a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof linked to a protein destabilization domain sequence. [Item 20] 20. An isolated polynucleotide encoding the chimeric molecule of claim 19. [Item 21] 21. A method for treating or preventing, or ameliorating at least one symptom of, a neurodegenerative disease associated with TDP-43 pathology, comprising administering to a subject in need thereof an effective amount of the chimeric molecule of claim 20, or a polynucleotide encoding said chimeric molecule. [Item 22] 21. A vector comprising the polynucleotide sequence of claim 16, 17 or 20. [Item 23] 23. The vector of claim 22, wherein the vector is an AAV vector. [Item 24] 24. A method for treating or preventing a neurodegenerative disease associated with TDP-43 pathology, or ameliorating at least one symptom thereof, comprising administering to a subject in need thereof an effective amount of the vector of claim 22 or 23.

Claims

1. A nucleic acid comprising an expression construct encoding a peptide fragment of 14-3-3θ, a conservative variant thereof, or a sequence at least about 75% identical to a peptide fragment of human 14-3-3θ, wherein the peptide fragment of human 14-3-3θ comprises or consists of the amino acid sequence of SEQ ID NO:

1.

2. The nucleic acid of claim 1, wherein (i) the peptide fragment of human 14-3-3θ comprises or consists of SEQ ID NO: 1 within the contiguous amino acid sequence of human 14-3-3θ; and / or (ii) the peptide fragment consists of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 residues; and / or (iii) The peptide fragment of human 14-3-3θ comprises or consists of the amino acid sequence of α-helix 6 (αF) of human 14-3-3θ.

3. The nucleic acid of claim 1, wherein the peptide fragment of human 14-3-3θ comprises or consists of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or an amino acid sequence that is at least about 75% identical to the amino acid sequence of SEQ ID NO:

2.

4. The nucleic acid of claim 3, wherein the peptide fragment of human 14-3-3θ comprises or consists of an amino acid sequence that is at least about 75% identical to the amino acid sequence of SEQ ID NO: 2, and wherein the variants are not included within the sequence of SEQ ID NO:

1.

5. The nucleic acid of claim 1, wherein the peptide fragment consists of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO:

2.

6. 2. The nucleic acid of claim 1, wherein the expression construct comprises a nucleotide sequence comprising or consisting of SEQ ID NO:4 or SEQ ID NO:5, or a nucleotide sequence at least 70% identical to SEQ ID NO:4 or SEQ ID NO:

5.

7. The nucleic acid of claim 1, wherein the expression construct further encodes a protein destabilization domain sequence.

8. 8. The nucleic acid of claim 7, wherein: a protein destabilization domain sequence is linked to the peptide fragment; and / or The expression construct comprises a nucleotide sequence encoding a peptide fragment operably linked to a nucleotide sequence encoding a protein destabilization domain sequence.

9. 8. The nucleic acid of claim 7, wherein the protein destabilization domain sequence comprises the rapamycin-binding protein FKBP12, ubiquitin, a PEST (proline-, glutamic acid-, serine- and threonine-rich) sequence, a cyclin destruction box and / or a hydrophobic stretch of amino acids.

10. 10. The nucleic acid of claim 9, wherein the protein destabilization domain sequence comprises the rapamycin binding protein FKBP12.

11. 2. The nucleic acid of claim 1, wherein the expression construct is flanked by 5' adeno-associated virus (AAV) inverted terminal repeat (ITR) sequences and / or 3' AAV ITR sequences.

12. A nucleic acid comprising an expression construct encoding a chimeric molecule, a peptide fragment of 14-3-3θ, a conservative variant thereof, or comprising or consisting of a sequence at least about 75% identical to a peptide fragment of human 14-3-3θ, wherein the fragment of human 14-3-3θ comprises or consists of the amino acid sequence of SEQ ID NO:1; It is linked to a protein destabilization domain.

13. An isolated peptide comprising a peptide fragment of 14-3-3θ, a conservative variant thereof, or a sequence at least about 75% identical to a peptide fragment of human 14-3-3θ, wherein the fragment of human 14-3-3θ comprises or consists of the amino acid sequence of SEQ ID NO:

1.

14. a peptide fragment of 14-3-3θ, a conservative variant thereof, or a sequence at least about 75% identical to a peptide fragment of human 14-3-3θ, wherein the fragment of human 14-3-3θ comprises or consists of the amino acid sequence of SEQ ID NO:1; linked to a protein destabilization domain, Chimeric molecules.

15. A vector comprising the nucleic acid of any one of claims 1 to 12.

16. 16. The vector of claim 15, wherein the vector is a plasmid or a viral vector.

17. 17. The vector of claim 16, wherein the viral vector is a recombinant adeno-associated viral (rAAV) vector.

18. The vector of claim 17, wherein the rAAV vector is an rAAV9 vector.

19. Recombinant adeno-associated viruses (rAAVs), including: (i) capsid proteins; and (ii) A nucleic acid according to any one of claims 1 to 12.

20. 20. The rAAV of claim 19, wherein the capsid protein is capable of crossing the blood-brain barrier.

21. The rAAV of claim 19, which transduces neurons in the central nervous system.

22. The rAAV of claim 20, wherein the capsid protein is an AAV9 capsid protein.

23. A composition comprising the rAAV of claim 20.

24. 13. An isolated host cell comprising a nucleic acid according to any one of claims 1 to 12.

25. 21. A pharmaceutical composition for treating or preventing a neurodegenerative disease associated with TDP-43 pathology, or ameliorating at least one symptom thereof, comprising the rAAV of claim 20, thereby treating or preventing a neurodegenerative disease associated with TDP-43 pathology, or ameliorating at least one symptom thereof.

26. 26. The pharmaceutical composition of claim 25, wherein the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

27. 26. The pharmaceutical composition of claim 25, wherein the at least one symptom comprises disinhibition, hyperactivity, movement disorders, or muscle weakness.

28. A pharmaceutical composition for reducing the level of TDP-43 in neurons of a subject, comprising the rAAV of claim 20, thereby reducing the level of TDP-43 in the neurons of the subject.

Citation Information

Patent Citations

  • Use of 14-3-3-Proteins in Treatment and Prevention of Neurodegeneration

    US20110183341A1

  • Combinations of aggregating proteins and molecular chaperone proteins for the treatment of proteinopathies or conformational diseases

    US20160220649A1

  • Genetic switches for the detection of fusion proteins

    WO2004050870A2

  • A method of modulating protein 14-3-3 functionality by facilitating or inhibiting phosphorylation

    WO2011120082A1