Oncolytic viruses and their uses

Abstract

This application relates to the technical field of biomedicine, and specifically discloses oncolytic viruses and their applications. [Solution] The oncolytic virus comprises an M protein, and the M protein comprises amino acid substitutions at one or more of the 32nd, 33rd, 49th, 54th, 133rd, and 225th positions compared to the amino acid sequence shown in SEQ ID NO: 1. The present application also relates to an expression vector for the oncolytic virus, a virus-producing cell that produces the oncolytic virus, a pharmaceutical composition comprising the oncolytic virus, and a preparation method and use of the oncolytic virus, the oncolytic virus expression vector, the virus-producing cell, and / or the pharmaceutical composition. The present application can effectively improve the safety and cure rate of the oncolytic virus.

Description

[Technical field]

[0001] The present application relates to the field of biomedicine, and more specifically, to oncolytic viruses and their applications. [Background technology]

[0002] Oncolytic viruses are tumor-killing viruses with replication capability, and are currently accepted by the public as an important field of tumor immunotherapy. Oncolytic viruses specifically target the infected tumor cells, for example, by inactivating or deleting tumor suppressor genes in tumor cells, selectively infecting tumor cells, and after infecting tumor cells, oncolytic viruses replicate in large quantities in tumor cells, and finally destroy tumor cells, thus killing tumor cells. At the same time, oncolytic viruses can also provide the immune stimulating signals necessary to strengthen the host's own anti-cancer response, attracting more immune cells to continue killing the remaining tumor cells.

[0003] Oncolytic viruses have good potential applications in the field of tumor immunotherapy, but wild-type oncolytic viruses can always cause problems such as inflammation of the nervous system of the body, and there is still a large pathogenic risk in the process of using wild-type viruses to infect tumor cells.Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated oncolytic viruses.The attenuated oncolytic viruses are used in clinical applications, thereby reducing the pathogenic risk of oncolytic viruses and improving the safety of oncolytic viruses.

[0004] However, in the process of modifying oncolytic virus, wild-type oncolytic virus can be randomly modified with gene modification to reduce its toxicity, but modified oncolytic virus may have low cure rate, and modified oncolytic virus cannot be packaged, which is disadvantageous to promote the clinical application of oncolytic virus.Therefore, provide a modified oncolytic virus with good safety performance and high cure rate, which has important scientific research value and application significance in the field of tumor immunotherapy. Summary of the Invention

[0005] In order to improve the safety and cure rate of oncolytic viruses, the present application provides oncolytic viruses and their uses.

[0006] In a first aspect, the present application provides an oncolytic virus, which employs the following technical solutions:

[0007] An oncolytic virus comprising an M protein, the M protein comprising amino acid substitutions at one or more of positions 32, 33, 49, 54, 133, and 225 compared to the amino acid sequence shown in SEQ ID NO:1.

[0008] In some specific embodiments, the amino acid substitution in the M protein comprises an asparagine to serine mutation at position 32 (N32S), and / or a methionine to alanine mutation at position 33 (M33A), and / or an asparagine to aspartic acid mutation at position 49 (N49D), and / or a histidine to tyrosine mutation at position 54 (H54Y), and / or an alanine to threonine mutation at position 133 (A133T), and / or a valine to isoleucine mutation at position 225 (V225I).

[0009] Furthermore, the M protein further comprises amino acid substitutions at one or more of positions 21, 51, 111, 221 and 226.

[0010] In some specific embodiments, the amino acid substitution in the M protein further comprises a glycine to glutamic acid mutation at position 21 (G21E), and / or the amino acid substitution in the M protein comprises a methionine to arginine mutation at position 51 (M51R), and / or a methionine to alanine mutation at position 51 (M51A), and / or a leucine to alanine mutation at position 111 (L111A), and / or a valine to phenylalanine mutation at position 221 (V221F), and / or a serine to arginine mutation at position 226 (S226R).

[0011] In one specific embodiment, the M protein amino acid substitution comprises a glycine to glutamic acid mutation at position 21 (G21E).

[0012] In one specific embodiment, the amino acid substitution in the M protein comprises an asparagine to serine mutation at position 32 (N32S).

[0013] In one specific embodiment, the M protein amino acid substitution comprises a methionine to alanine mutation at position 33 (M33A).

[0014] In one specific embodiment, the M protein amino acid substitution comprises an asparagine to aspartic acid mutation at position 49 (N49D).

[0015] In one specific embodiment, the M protein amino acid substitution comprises a histidine to tyrosine mutation at position 54 (H54Y).

[0016] In one specific embodiment, the M protein amino acid substitution comprises a leucine to alanine mutation at position 111 (L111A).

[0017] In one specific embodiment, the M protein amino acid substitution comprises an alanine to threonine mutation at position 133 (A133T).

[0018] In one specific embodiment, the M protein amino acid substitution comprises a valine to isoleucine mutation at position 225 (V225I).

[0019] In one specific embodiment, the M protein amino acid substitution comprises a methionine to arginine mutation at position 51 (M51R).

[0020] In one specific embodiment, the M protein amino acid substitution comprises a methionine to alanine mutation at position 51 (M51A).

[0021] In one specific embodiment, the M protein amino acid substitution comprises a valine to phenylalanine mutation at position 221 (V221F).

[0022] In one specific embodiment, the M protein amino acid substitution comprises a serine to arginine mutation at position 226 (S226R).

[0023] In one specific embodiment, the M protein amino acid substitution comprises a serine to glycine mutation at position 226 (S226G).

[0024] In one specific embodiment, the M protein has a G21E amino acid substitution.

[0025] In one specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S.

[0026] In one specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A.

[0027] In one specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D.

[0028] In one specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, H54Y.

[0029] In one specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, H54Y, L111A.

[0030] In a specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, H54Y, L111A, A133T.

[0031] In a specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, H54Y, L111A, A133T, V225I.

[0032] In a specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V225I.

[0033] In a specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I.

[0034] In a specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, S226R.

[0035] In a specific embodiment, the M protein has the following amino acid substitutions: N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, S226R.

[0036] In a specific embodiment, the M protein has the following amino acid substitutions: M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, S226R.

[0037] In a specific embodiment, the M protein has the following amino acid substitutions: N49D, M51R, H54Y, L111A, A133T, V221F, V225I, S226R.

[0038] In a specific embodiment, the M protein has the following amino acid substitutions: M51R, H54Y, L111A, A133T, V221F, V225I, S226R.

[0039] In one specific embodiment, the M protein has the following amino acid substitutions: H54Y, L111A, A133T, V221F, V225I, S226R.

[0040] In one specific embodiment, the M protein has the following amino acid substitutions: L111A, A133T, V221F, V225I, S226R.

[0041] In one specific embodiment, the M protein has the following amino acid substitutions: A133T, V221F, V225I, S226R.

[0042] In one specific embodiment, the M protein has the following amino acid substitutions: V221F, V225I, S226R.

[0043] In one specific embodiment, the M protein has the following amino acid substitutions: V225I, S226R.

[0044] In one specific embodiment, the M Protein has an amino acid substitution of S226R.

[0045] In one specific embodiment, the M protein has the following amino acid substitutions: N32S, N49D, H54Y, V225I.

[0046] In one specific embodiment, the M protein has the following amino acid substitutions: N32S, N49D, H54Y, V225I, S226G.

[0047] In a specific embodiment, the M protein has the following amino acid substitutions: N32S, N49D, M51R, H54Y, V221F, V225I, S226R.

[0048] In a specific embodiment, the M protein has the following amino acid substitutions: N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R.

[0049] In a specific embodiment, the M protein has the following amino acid substitutions: N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0050] In a specific embodiment, the M protein has the following amino acid substitutions: N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0051] In a specific embodiment, the M protein has the following amino acid substitutions: G21E, N32S, N49D, M51A, H54Y, L111A, V225I, S226R.

[0052] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:2.

[0053] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:3.

[0054] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:4.

[0055] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:5.

[0056] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:6.

[0057] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:7.

[0058] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:8.

[0059] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:9.

[0060] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:10.

[0061] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:11.

[0062] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:12.

[0063] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:13.

[0064] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:14.

[0065] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:15.

[0066] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:16.

[0067] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:17.

[0068] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:18.

[0069] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:19.

[0070] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:20.

[0071] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:21.

[0072] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:22.

[0073] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:23.

[0074] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:24.

[0075] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:25.

[0076] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:26.

[0077] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:27.

[0078] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:28.

[0079] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:29.

[0080] In one specific embodiment, the M Protein comprises the amino acid sequence set forth in SEQ ID NO:30.

[0081] An oncolytic virus comprising the M protein, the oncolytic virus further comprising a G protein, the G protein comprising amino acid substitutions at one or more of positions 438, 453, 471 and 487 compared to the amino acid sequence shown in SEQ ID NO:31.

[0082] In some specific embodiments, the G protein further comprises an amino acid substitution at one or more of positions 53, 141, 172, 217, 232, 331, 371, or 436.

[0083] In some specific embodiments, the amino acid substitution in the G protein is a valine to isoleucine mutation at position 53 (V53I), and / or an alanine to valine mutation at position 141 (A141V), and / or an aspartic acid to tyrosine mutation at position 172 (D172Y), and / or a lysine to glutamic acid mutation at position 217 (K217E), and / or an aspartic acid to glycine mutation at position 232 (D232G), and / or a valine to alanine mutation at position 331. (V331A), and / or a valine to glutamic acid mutation at position 371 (V371E), and / or a glycine to aspartic acid mutation at position 436 (G436D), and / or a threonine to serine mutation at position 438 (T438S), and / or a phenylalanine to leucine mutation at position 453 (F453L), and / or a threonine to isoleucine mutation at position 471 (T471I), and / or a tyrosine to histidine mutation at position 487 (Y487H).

[0084] In one specific embodiment, the amino acid substitution in the G protein comprises a valine to isoleucine mutation at position 53 (V53I).

[0085] In one specific embodiment, the amino acid substitution in the G protein comprises an alanine to valine mutation at position 141 (A141V).

[0086] In one specific embodiment, the amino acid substitution in the G protein comprises an aspartic acid to tyrosine mutation at position 172 (D172Y).

[0087] In one specific embodiment, the amino acid substitution in the G protein comprises a lysine to glutamic acid mutation at position 217 (K217E).

[0088] In one specific embodiment, the amino acid substitution in the G protein comprises an aspartic acid to glycine mutation at position 232 (D232G).

[0089] In one specific embodiment, the amino acid substitution in the G protein comprises a valine to alanine mutation at position 331 (V331A).

[0090] In one specific embodiment, the amino acid substitution in the G protein comprises a valine to glutamic acid mutation at position 371 (V371E).

[0091] In one specific embodiment, the amino acid substitution in the G protein comprises a glycine to aspartic acid mutation at position 436 (G436D).

[0092] In one specific embodiment, the amino acid substitution in the G protein comprises a threonine to serine mutation at position 438 (T438S).

[0093] In one specific embodiment, the amino acid substitution in the G protein comprises a phenylalanine to leucine mutation at position 453 (F453L).

[0094] In one specific embodiment, the amino acid substitution in the G protein comprises a threonine to isoleucine mutation at position 471 (T471I).

[0095] In one specific embodiment, the amino acid substitution in the G protein comprises a tyrosine to histidine mutation at position 487 (Y487H).

[0096] In one specific embodiment, the G protein has an amino acid substitution of V53I.

[0097] In one specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V.

[0098] In one specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y.

[0099] In one specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E.

[0100] In one specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G.

[0101] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A.

[0102] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A, V371E.

[0103] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D.

[0104] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S.

[0105] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L.

[0106] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I.

[0107] In a specific embodiment, the G protein has the following amino acid substitutions: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0108] In a specific embodiment, the G protein has the following amino acid substitutions: A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0109] In a specific embodiment, the G protein has the following amino acid substitutions: D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0110] In a specific embodiment, the G protein has the following amino acid substitutions: K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0111] In a specific embodiment, the G protein has the following amino acid substitutions: D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0112] In a specific embodiment, the G protein has the following amino acid substitutions: V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0113] In a specific embodiment, the G protein has the following amino acid substitutions: V371E, G436D, T438S, F453L, T471I, Y487H.

[0114] In a specific embodiment, the G protein has the following amino acid substitutions: G436D, T438S, F453L, T471I, Y487H.

[0115] In a specific embodiment, the G protein has the following amino acid substitutions: T438S, F453L, T471I, Y487H.

[0116] In one specific embodiment, the G protein has the following amino acid substitutions: F453L, T471I, Y487H.

[0117] In one specific embodiment, the G protein has the following amino acid substitutions: T471I, Y487H.

[0118] In one specific embodiment, the G protein has an amino acid substitution of Y487H.

[0119] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:32.

[0120] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:33.

[0121] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:34.

[0122] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:35.

[0123] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:36.

[0124] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:37.

[0125] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:38.

[0126] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:39.

[0127] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:40.

[0128] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:41.

[0129] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:42.

[0130] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:43.

[0131] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:44.

[0132] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:45.

[0133] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:46.

[0134] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:47.

[0135] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:48.

[0136] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:49.

[0137] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:50.

[0138] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:51.

[0139] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:52.

[0140] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:53.

[0141] In one specific embodiment, the G protein comprises the amino acid sequence set forth in SEQ ID NO:54.

[0142] An oncolytic virus comprising the above-mentioned M protein, or the M protein and the G protein, said oncolytic virus further comprising an N protein, said N protein comprising amino acid substitutions at one or more of positions 14, 155, and 353 compared to the amino acid sequence shown in SEQ ID NO:55.

[0143] In some specific embodiments, the amino acid substitution in the N protein comprises an isoleucine to valine mutation at position 14 (I14V), and / or an arginine to lysine mutation at position 155 (R155K), and / or a serine to asparagine mutation at position 353 (S353N).

[0144] In one specific embodiment, the amino acid substitution in the N protein comprises an isoleucine to valine mutation at position 14 (I14V).

[0145] In one specific embodiment, the amino acid substitution in the N protein comprises an arginine to lysine mutation at position 155 (R155K).

[0146] In one specific embodiment, the amino acid substitution in the N protein comprises a serine to asparagine mutation at position 353 (S353N).

[0147] In one specific embodiment, the N protein has an amino acid substitution of I14V.

[0148] In one specific embodiment, the N protein has the following amino acid substitutions: I14V, R155K.

[0149] In a specific embodiment, the N protein has the following amino acid substitutions: I14V, R155K, S353N.

[0150] In one specific embodiment, the N protein has the following amino acid substitutions: R155K, S353N.

[0151] In one specific embodiment, the N protein has an amino acid substitution of S353N.

[0152] In one specific embodiment, the N protein comprises the amino acid sequence set forth in SEQ ID NO:56.

[0153] In a specific embodiment, the N protein comprises the amino acid sequence set forth in SEQ ID NO:57.

[0154] In a specific embodiment, the N protein comprises the amino acid sequence set forth in SEQ ID NO:58.

[0155] In a specific embodiment, the N protein comprises the amino acid sequence set forth in SEQ ID NO:59.

[0156] In a specific embodiment, the N protein comprises the amino acid sequence set forth in SEQ ID NO:60.

[0157] An oncolytic virus comprising the above-mentioned M protein, or the M protein and the G protein, or the M protein, the G protein and the N protein, or the M protein and the N protein, said oncolytic virus further comprising a P protein, said P protein comprising amino acid substitutions at one or more of positions 50, 76, 99, 126, 140, 151, 168, 170, 189, and 237 compared to the amino acid sequence shown in SEQ ID NO: 61.

[0158] In some specific embodiments, the amino acid substitution in the P protein is an arginine to lysine mutation at position 50 (R50K), and / or a valine to alanine mutation at position 76 (V76A), and / or an asparagine to glutamic acid mutation at position 99 (D99E), and / or a leucine to serine mutation at position 126 (L126S), and / or a leucine to serine mutation at position 140 (L126S). 140S), and / or a histidine to tyrosine mutation at position 151 (H151Y), and / or an isoleucine to methionine mutation at position 168 (I168M), and / or a lysine to glutamic acid mutation at position 170 (K170E), and / or a tyrosine to serine mutation at position 189 (Y189S), and / or an asparagine to aspartic acid mutation at position 237 (N237D).

[0159] In one specific embodiment, the amino acid substitution in the P protein comprises an arginine to lysine mutation at position 50 (R50K).

[0160] In one specific embodiment, the amino acid substitution in the P protein comprises a valine to alanine mutation at position 76 (V76A).

[0161] In one specific embodiment, the amino acid substitution in the P protein comprises an asparagine to glutamic acid mutation at position 99 (D99E).

[0162] In one specific embodiment, the amino acid substitution in the P protein comprises a leucine to serine mutation at position 126 (L126S).

[0163] In one specific embodiment, the amino acid substitution in the P protein comprises a leucine to serine mutation at position 140 (L140S).

[0164] In one specific embodiment, the amino acid substitution in the P protein comprises a histidine to tyrosine mutation at position 151 (H151Y).

[0165] In one specific embodiment, the amino acid substitution in the P protein comprises an isoleucine to methionine mutation at position 168 (I168M).

[0166] In one specific embodiment, the amino acid substitution in the P protein comprises a lysine to glutamic acid mutation at position 170 (K170E).

[0167] In one specific embodiment, the amino acid substitution in the P protein comprises a tyrosine to serine mutation at position 189 (Y189S).

[0168] In one specific embodiment, the amino acid substitution in the P protein comprises an asparagine to aspartic acid mutation at position 237 (N237D).

[0169] In one specific embodiment, the P protein has an amino acid substitution of R50K.

[0170] In one specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A.

[0171] In one specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E.

[0172] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S.

[0173] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S, L140S.

[0174] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S, L140S, H151Y.

[0175] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S, L140S, H151Y, I168M.

[0176] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E.

[0177] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S.

[0178] In a specific embodiment, the P protein has the following amino acid substitutions: R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

[0179] In a specific embodiment, the P protein has the following amino acid substitutions: V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

[0180] In a specific embodiment, the P protein has the following amino acid substitutions: D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

[0181] In a specific embodiment, the P protein has the following amino acid substitutions: L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

[0182] In a specific embodiment, the P protein has the following amino acid substitutions: L140S, H151Y, I168M, K170E, Y189S, N237D.

[0183] In a specific embodiment, the P protein has the following amino acid substitutions: H151Y, I168M, K170E, Y189S, N237D.

[0184] In a specific embodiment, the P protein has the following amino acid substitutions: I168M, K170E, Y189S, N237D.

[0185] In a specific embodiment, the P protein has the following amino acid substitutions: K170E, Y189S, N237D.

[0186] In one specific embodiment, the P protein has the following amino acid substitutions: Y189S, N237D.

[0187] In one specific embodiment, the P protein has the following amino acid substitution: N237D.

[0188] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:62.

[0189] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:63.

[0190] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:64.

[0191] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:65.

[0192] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:66.

[0193] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:67.

[0194] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:68.

[0195] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:69.

[0196] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:70.

[0197] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:71.

[0198] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:72.

[0199] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:73.

[0200] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:74.

[0201] In a specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:75.

[0202] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:76.

[0203] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:77.

[0204] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:78.

[0205] In one specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:79.

[0206] In a specific embodiment, the P protein comprises the amino acid sequence set forth in SEQ ID NO:80.

[0207] An oncolytic virus comprising the above-mentioned M protein, or M protein and G protein, or M protein, G protein and N protein, or M protein, G protein, N protein and P protein, or M protein and N protein, or M protein and P protein, or M protein, G protein and P protein, or M protein, N protein and P protein, said oncolytic virus further comprising an L protein, said L protein comprising amino acid substitutions at one or more of positions 87 and 487 compared to the amino acid sequence shown in SEQ ID NO: 81.

[0208] In some specific embodiments, the amino acid substitution in the L protein comprises a serine to proline mutation at position 87 (S87P) and / or an isoleucine to threonine mutation at position 487 (I487T).

[0209] In one specific embodiment, the amino acid substitution in the L protein comprises a serine to proline mutation at position 87 (S87P).

[0210] In one specific embodiment, the amino acid substitution in the L protein comprises an isoleucine to threonine mutation at position 487 (I487T).

[0211] In one specific embodiment, the L protein has an amino acid substitution of S87P.

[0212] In one specific embodiment, the L protein has the following amino acid substitutions: S87P, I487T.

[0213] In one specific embodiment, the L protein has the amino acid substitution I487T.

[0214] In one specific embodiment, the L protein comprises the amino acid sequence set forth in SEQ ID NO:82.

[0215] In one specific embodiment, the L protein comprises the amino acid sequence set forth in SEQ ID NO:83.

[0216] In one specific embodiment, the L protein comprises the amino acid sequence set forth in SEQ ID NO:84.

[0217] In some specific embodiments, the oncolytic virus is derived from a baculovirus by site-directed mutagenesis.

[0218] In some specific embodiments, the oncolytic virus is obtained by site-specific mutagenesis based on the Vesicular Stomatitis Virus (abbreviated as "VSV").

[0219] In some specific embodiments, the oncolytic virus is derived from the VSV virus Indiana MuddSummer subtype by site-directed mutagenesis.

[0220] In some specific embodiments, the oncolytic virus contains or expresses an exogenous target protein.

[0221] In some specific embodiments, the oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding an M protein having the amino acid substitution, and / or a nucleic acid sequence encoding a G protein having the amino acid substitution, and / or a nucleic acid sequence encoding an N protein having the amino acid substitution, and / or a nucleic acid sequence encoding a P protein having the amino acid substitution, and / or a nucleic acid sequence encoding an L protein having the amino acid substitution.

[0222] In some specific embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the exogenous target protein.

[0223] In some specific embodiments, the nucleic acid sequence of the nucleic acid molecule encoding the exogenous target protein is between the nucleic acid sequence encoding the M protein having the amino acid substitution, and / or the nucleic acid sequence encoding the G protein having the amino acid substitution, and / or the nucleic acid sequence encoding the N protein having the amino acid substitution, and / or the nucleic acid sequence encoding the P protein having the amino acid substitution, and / or the nucleic acid sequence encoding the L protein having the amino acid substitution.

[0224] In a second aspect, the present application provides an oncolytic virus expression vector, which employs the following technical solutions:

[0225] An oncolytic virus expression vector, said oncolytic virus expression vector capable of producing any one of the oncolytic viruses described in the present application.

[0226] In a third aspect, the present application provides a virus-producing cell, which employs the following technical solutions:

[0227] A virus-producing cell, said virus-producing cell being capable of producing any one of the oncolytic viruses described in the present application.

[0228] In a fourth aspect, the present application provides a pharmaceutical composition, which employs the following technical solutions:

[0229] A pharmaceutical composition comprising an oncolytic virus according to any one of the present applications, and optionally a pharma- ceutically acceptable carrier.

[0230] In a fifth aspect, the present application provides a method for preparing the oncolytic virus, oncolytic virus expression vector, virus-producing cell and / or pharmaceutical composition described above.

[0231] In a sixth aspect, the present application provides the use of an oncolytic virus, an oncolytic virus expression vector, a virus-producing cell and / or a pharmaceutical composition as described above in the preparation of a medicament for the prevention and / or treatment of a disease and / or condition.

[0232] In some specific embodiments, the oncolytic viruses, oncolytic virus expression vectors, virus-producing cells and / or pharmaceutical compositions are used in methods for the slow and continuous killing of abnormally proliferating cells.

[0233] In some specific embodiments, the disease and / or condition comprises abnormally proliferating cells from tumor cells or tumor tissue associated cells, preferably, the tumor cells are cancer cells, more preferably, the cancer cells are metastatic cancer cells.

[0234] In some specific embodiments, the tumor comprises a solid tumor and / or a blood tumor.

[0235] In summary, the present application has the following beneficial effects:

[0236] The oncolytic viruses provided in the present application have good infectivity and in vitro killing ability in abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells and Hela cells, and are difficult to be eliminated in LLC cells, 4T1 cells, MC38 cells and Hela cells. The oncolytic viruses provided in the present application have low infectivity and in vitro killing ability in normal MEF cells, and are easy to be eliminated in normal MEF cells. Therefore, the oncolytic viruses provided in the present application are often used to infect and kill cells of tumors, cancers, etc., and are easy to be eliminated in cells of tumors, cancers, etc., which further improves the cure rate of oncolytic viruses in cells of tumors, cancers, etc., while the oncolytic viruses provided above do not damage normal cells, and are easier to be eliminated when in normal cells, which further ensures the safety of normal cells. [Brief description of the drawings]

[0237] [Figure 1] FIG. 1 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to LLC cells. [Diagram 2] FIG. 2 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to 4T1 cells. [Diagram 3] FIG. 3 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to MC38 cells. [Figure 4] FIG. 4 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to HeLa cells. [Diagram 5] FIG. 5 shows the results of detecting the ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to infect MEF cells. [Figure 6] FIG. 6 shows the results of detecting the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on LLC cells. [Figure 7]FIG. 7 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on 4T1 cells. [Figure 8] FIG. 8 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on MC38 cells. [Figure 9] FIG. 9 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on HeLa cells. [Figure 10] FIG. 10 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on MEF cells. [Figure 11] FIG. 11 shows the situation in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells. [Figure 12] FIG. 12 shows the state in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in 4T1 cells. [Figure 13] FIG. 13 shows the situation in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in MC38 cells. [Figure 14] FIG. 14 shows the state in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in HeLa cells. [Figure 15] FIG. 15 shows the situation in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.

[0238] In the above-mentioned figure, number 0 on the horizontal axis represents the wild-type oncolytic virus, and numbers 1 to 79 on the horizontal axis represent the oncolytic viruses prepared in Preparation Examples 1 to 79, respectively.

[0239] Vertical axis Log 10 TCID50 represents the TCID50 value calculated by the Karber method, and Log10 The higher the TCID50 value, the better the oncolytic virus's ability to infect the cells, and Log 10 A lower TCID50 value indicates a lower ability of the oncolytic virus to infect the cells.

[0240] Vertical axis OD 570 represents the OD value of the cells, and OD 570 The higher the OD value, the lower the killing ability of the oncolytic virus to the cell. 570 The smaller the value, the better the killing ability of the oncolytic virus to the cell.

[0241] The IFN-β level on the vertical axis represents the expression status of the IFN-β gene, and a higher IFN-β level value indicates that the oncolytic virus has a weaker reproductive ability in the cell and is more likely to be removed, whereas a lower IFN-β level value indicates that the oncolytic virus has a stronger reproductive ability in the cell and is more likely to be removed.

[0242] Those skilled in the art can easily understand other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are described and explained. As those skilled in the art will understand, depending on the content of the present application, those skilled in the art can modify the specific embodiments disclosed without departing from the spirit and scope of the invention related to the present application. Correspondingly, the drawings and description of the present application are illustrative only and not restrictive. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0243] Hereinafter, the embodiments of the present invention will be described with reference to specific examples, but those skilled in the art will be able to easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Term definition

[0244] In the present application, the term "oncolytic virus" generally refers to a virus that can replicate in and kill tumor cells. Oncolytic viruses include, but are not limited to, vesicular stomatitis virus (abbreviated as "VSV virus"), poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echotype enterovirus, coxsackievirus, Newcastle disease virus, and Malabar virus. In some embodiments, the oncolytic virus is modified to improve selectivity for tumor cells. In some embodiments, the oncolytic virus is modified to reduce immunogenicity. In some embodiments, the oncolytic virus of the present application is a VSV virus. In some embodiments, the VSV virus is a mutant of the VSV virus Indiana MuddSummer subtype strain. In some embodiments, site-specific genetic mutations may be made to the M protein, and / or the G protein, and / or the N protein, and / or the P protein, and / or the L protein of the VSV virus.

[0245] In some embodiments, the oncolytic virus described in the present application is a genetically modified oncolytic virus, for example, modified in one or more genes to improve its tumor selectivity and / or replicate preferentially in dividing cells. The genetic modification may be a modification of a gene involved in the process of DNA replication, nucleic acid metabolism, host tropism, surface attachment, toxicity, lysis and spread, or may be a modification incorporating an exogenous gene. The exogenous gene may include an exogenous immunomodulatory gene, an exogenous screening gene, an exogenous reporter gene, etc. The modified oncolytic virus is an oncolytic virus modified at the amino acid level, for example, an insertion, deletion, or substitution of one or more amino acids.

[0246] In the present application, the term "M protein" generally means the VSV virus matrix protein. M protein is an important virulence factor of the VSV virus and is also a protein known to interfere with the innate immune response of mice in the VSV virus. The term "M protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the wild-type VSV virus Indiana MuddSummer subtype M protein may comprise the amino acid sequence shown in SEQ ID NO: 1. In the present application, the M protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO: 2-29.

[0247] In the present application, the term "G protein" generally refers to the glycoprotein of the water VSV virus, also referred to as the envelope protein. The term "G protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the wild-type VSV virus Indiana MuddSummer subtype G protein may comprise the amino acid sequence shown in SEQ ID NO: 31. In the present application, the G protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO: 32-54.

[0248] In the present application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the wild-type VSV virus Indiana MuddSummer subtype N protein may comprise the amino acid sequence shown in SEQ ID NO: 55. In the present application, the N protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO: 56-60.

[0249] In the present application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the wild-type VSV virus Indiana MuddSummer subtype P protein may comprise the amino acid sequence shown in SEQ ID NO: 61. In the present application, the P protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO: 62-80. In the present application, the term "L protein" generally refers to the VSV virus RNA polymerase protein. The L gene of the VSV virus encodes the RNA poly E protein. The term "L protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the wild-type VSV virus Indiana MuddSummer subtype L protein may comprise the amino acid sequence shown in SEQ ID NO: 81. In the present application, the L protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO: 82-84.

[0250] In the present application, the expression of a protein mutation site is usually expressed as "amino acid + amino acid site number + (mutated amino acid)". In the present application, the mutation includes, but is not limited to, addition, substitution, deletion and / or removal of amino acids. For example, the term "M51R" usually means a mutation from methionine M to arginine R at the 51st site.

[0251] In the present application, the term "amino acid substitution" generally refers to the replacement of one amino acid residue present in a parent sequence with another amino acid residue. The amino acid in the parent sequence may be replaced, for example, by chemical peptide synthesis or recombinant methods known to those skilled in the art. Thus, "substitution at xx position" generally refers to the replacement of the amino acid present at xx position with an alternative amino acid residue. In the present application, said amino acid substitution may include amino acid mutation.

[0252] In this application, the term "mutation" generally refers to a change in the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes may include amino acid substitutions, deletions, deletions, insertions, additions, truncations, or processing or truncation of a protein.

[0253] In the present application, the term "nucleic acid molecule" generally refers to any length of nucleotides. In the present application, the term "nucleic acid molecule" can code for a protein contained in the oncolytic virus. In the present application, the nucleic acid molecule can include DNA and / or RNA. In some cases, the RNA can include single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA can include sense RNA, anti-sense RNA, or ambisense RNA.

[0254] In the present application, the term "expression vector" generally refers to a nucleic acid carrier. Under appropriate conditions, it can generally express a target gene and / or a target protein. In some embodiments of the present application, the expression vector comprises one or more component nucleic acid molecules for expressing a virus (e.g., an oncolytic virus). For example, the expression vector comprises at least one viral genome element and can be packaged into a virus or packaged as a viral particle.

[0255] In the present application, the term "virus-producing cell" generally refers to a cell, cell line or cell culture that may contain or already contains a nucleic acid molecule or expression vector described in the present application, or that is capable of expressing an oncolytic virus described in the present application. The cell may comprise the progeny of a single host cell. The cell may be obtained by using in vitro transfection of an expression vector described in the present application.

[0256] In the present application, the term "pharmaceutical composition" refers to a formulation that is in a form that is acceptable for effecting the biological activity of the active ingredient and does not contain additional ingredients that are unacceptably toxic to the subject to which it is administered. In certain embodiments, these formulations may include an active pharmaceutical ingredient and a pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical product includes a pharmaceutical product for parenteral, transdermal, intraluminal, intraarterial, intrathecal and / or intranasal administration or for direct injection into tissue. The pharmaceutical product may be administered in different ways, such as, for example, intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration.

[0257] In this application, the term "prevention" generally means to prevent the occurrence, development, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term "treatment" generally means to eliminate or improve a disease or one or more symptoms associated with a disease. In some embodiments, treatment generally means administering one or more drugs to a patient suffering from the disease to eliminate or ameliorate the disease. In some embodiments, "treatment" may be the pharmaceutical composition and / or pharmaceutical product administered after the onset of symptoms of a particular disease, with or without other drugs. For example, the pharmaceutical composition and / or pharmaceutical product described in this application is used to prevent the occurrence, development, recurrence, and / or progression of a tumor.

[0258] In this application, the term "tumor" generally refers to any new pathological tissue growth. Tumors can be benign or malignant. In this application, said tumors can be solid tumors and / or hematologic tumors. For research, these tissues can be isolated from readily available sources by methods well known to those skilled in the art.

[0259] The present application provides an oncolytic virus obtained by mutating sites in the amino acid sequences of the M protein, G protein, N protein, P protein, and L protein of a wild-type VSV virus, specifically, the Indiana strain of VSV virus and the Indiana MuddSummer subtype strain of VSV virus. The amino acid sequence of the M protein is shown in SEQ ID NO: 1, the amino acid sequence of the G protein is shown in SEQ ID NO: 31, the amino acid sequence of the N protein is shown in SEQ ID NO: 55, the amino acid sequence of the P protein is shown in SEQ ID NO: 61, and the amino acid sequence of the L protein is shown in SEQ ID NO: 81. In the present application, the M protein, G protein, N protein, P protein, and L protein can all be modified. The present application modifies said VSV virus as follows to obtain an oncolytic virus.

[0260] An oncolytic virus, the oncolytic virus comprising an M protein, the M protein comprising amino acid substitutions at one or more of positions 32, 33, 49, 54, 133, and 225, compared to the amino acid sequence set forth in SEQ ID NO: 1. The M protein further comprises amino acid substitutions at one or more of positions 21, 51, 111, 221, and 226.

[0261] The amino acid substitution in the M protein includes an asparagine to serine mutation at position 32 (N32S), and / or a methionine to alanine mutation at position 33 (M33A), and / or an asparagine to aspartic acid mutation at position 49 (N49D), and / or a histidine to tyrosine mutation at position 54 (H54Y), and / or an alanine to threonine mutation at position 133 (A133T), and / or a valine to isoleucine mutation at position 225 (V225I), The amino acid substitution further comprises a glycine to glutamic acid mutation at position 21 (G21E), and / or the amino acid substitutions in said M protein comprise a methionine to arginine mutation at position 51 (M51R), and / or a methionine to alanine mutation at position 51 (M51A), and / or a leucine to alanine mutation at position 111 (L111A), and / or a valine to phenylalanine mutation at position 221 (V221F), and / or a serine to arginine mutation at position 226 (S226R).

[0262] In the present application, the M protein may comprise an amino acid mutation at position 21.

[0263] In the present application, the M protein may comprise amino acid mutations at the 21st and 32nd positions.

[0264] In the present application, the M protein may comprise amino acid mutations at positions 21, 32 and 33.

[0265] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33 and 49.

[0266] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49 and 54.

[0267] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49, 54 and 111.

[0268] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49, 54, 111 and 133.

[0269] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49, 54, 111, 133 and 225.

[0270] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49, 51, 54, 111, 133 and 225.

[0271] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49, 51, 54, 111, 133, 221 and 225.

[0272] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 33, 49, 51, 54, 111, 133, 221, 225 and 226.

[0273] In the present application, the M protein may comprise amino acid mutations at positions 32, 33, 49, 51, 54, 111, 133, 221, 225 and 226.

[0274] In the present application, the M protein may comprise amino acid mutations at positions 33, 49, 51, 54, 111, 133, 221, 225 and 226.

[0275] In the present application, the M protein may comprise amino acid mutations at positions 49, 51, 54, 111, 133, 221, 225 and 226.

[0276] In the present application, the M protein may comprise amino acid mutations at positions 51, 54, 111, 133, 221, 225 and 226.

[0277] In the present application, the M protein may comprise amino acid mutations at positions 54, 111, 133, 221, 225 and 226.

[0278] In the present application, the M protein may comprise amino acid mutations at positions 111, 133, 221, 225 and 226.

[0279] In the present application, the M protein may comprise amino acid mutations at positions 133, 221, 225 and 226.

[0280] In the present application, the M protein may comprise amino acid mutations at positions 221, 225 and 226.

[0281] In the present application, the M protein may comprise amino acid mutations at positions 225 and 226.

[0282] In the present application, the M protein may comprise an amino acid mutation at position 226.

[0283] In the present application, the M protein may comprise amino acid mutations at positions 32, 49, 54 and 225.

[0284] In the present application, the M protein may comprise amino acid mutations at positions 32, 49, 54, 225 and 226.

[0285] In the present application, the M protein may comprise amino acid mutations at positions 32, 49, 51, 54, 221, 225 and 226.

[0286] In the present application, the M protein may comprise amino acid mutations at positions 32, 33, 49, 51, 54, 221, 225 and 226.

[0287] In the present application, the M protein may comprise amino acid mutations at positions 32, 49, 51, 54, 133, 221, 225 and 226.

[0288] In the present application, the M protein may comprise amino acid mutations at positions 32, 33, 49, 51, 54, 133, 221, 225 and 226.

[0289] In the present application, the M protein may comprise amino acid mutations at positions 21, 32, 49, 51, 54, 111, 225 and 226.

[0290] In the present application, the M Protein may also contain amino acid substitutions at other positions.

[0291] The oncolytic virus further comprises a G protein, the G protein comprising amino acid substitutions at one or more of positions 438, 453, 471 and 487 compared to the amino acid sequence set forth in SEQ ID NO:31.

[0292] In the present application, the amino acid substitution in the G protein is a valine to isoleucine mutation at position 53 (V53I), and / or an alanine to valine mutation at position 141 (A141V), and / or an aspartic acid to tyrosine mutation at position 172 (D172Y), and / or a lysine to glutamic acid mutation at position 217 (K217E), and / or an aspartic acid to glycine mutation at position 232 (D232G), and / or a valine to alanine mutation at position 331 (V331A), ), and / or a valine to glutamic acid mutation at position 371 (V371E), and / or a glycine to aspartic acid mutation at position 436 (G436D), and / or a threonine to serine mutation at position 438 (T438S), and / or a phenylalanine to leucine mutation at position 453 (F453L), and / or a threonine to isoleucine mutation at position 471 (T471I), and / or a tyrosine to histidine mutation at position 487 (Y487H). For example, the G protein comprises the amino acid sequence set forth in SEQ ID NO:43.

[0293] In the present application, the G protein may comprise an amino acid mutation at position 53.

[0294] In the present application, the G protein may comprise amino acid mutations at positions 53 and 141.

[0295] In the present application, the G protein may comprise amino acid mutations at positions 53, 141 and 172.

[0296] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172 and 217.

[0297] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217 and 232.

[0298] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232 and 331.

[0299] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232, 331 and 371.

[0300] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371 and 436.

[0301] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436 and 438.

[0302] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438 and 453.

[0303] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438, 453 and 471.

[0304] In the present application, the G protein may include amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0305] In the present application, the G protein may include amino acid mutations at positions 141, 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0306] In the present application, the G protein may include amino acid mutations at positions 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0307] In the present application, the G protein may include amino acid mutations at positions 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0308] In the present application, the G protein may include amino acid mutations at the 232, 331, 371, 436, 438, 453, 471 and 487 positions.

[0309] In the present application, the G protein may include amino acid mutations at the 331, 371, 436, 438, 453, 471 and 487 positions.

[0310] In the present application, the G protein may include amino acid mutations at the 371, 436, 438, 453, 471 and 487 positions.

[0311] In the present application, the G protein may include amino acid mutations at positions 436, 438, 453, 471 and 487.

[0312] In the present application, the G protein may comprise amino acid mutations at positions 438, 453, 471 and 487.

[0313] In the present application, the G protein may comprise amino acid mutations at positions 453, 471 and 487.

[0314] In the present application, the G protein may contain amino acid mutations at positions 471 and 487.

[0315] In the present application, the G protein may comprise an amino acid mutation at position 487.

[0316] In the present application, the G protein may also contain amino acid substitutions at other positions.

[0317] In one embodiment, the G protein comprises at least one or more amino acid substitutions in a conserved area. For example, the conserved area may comprise amino acids 437-461 of the G protein. In one embodiment, the G protein comprises at least one or more amino acid substitutions in a cleavage area of ​​the cytoplasmic domain. For example, the cleavage area of ​​the cytoplasmic domain may comprise amino acids 483-511 of the G protein.

[0318] In the present application, the G protein may comprise at least amino acid substitutions at positions 438, 453, 471 and 487.

[0319] The oncolytic virus further comprises an N protein, the N protein comprising amino acid substitutions at one or more of positions 14, 155, and 353 compared to the amino acid sequence set forth in SEQ ID NO:55.

[0320] In the present application, the amino acid substitutions in the N protein include an isoleucine to valine mutation at position 14 (I14V), and / or an arginine to lysine mutation at position 155 (R155K), and / or a serine to asparagine mutation at position 353 (S353N). For example, the N protein comprises the amino acid sequence set forth in SEQ ID NO:58.

[0321] In the present application, the N protein may comprise an amino acid mutation at position 14.

[0322] In the present application, the N protein may comprise amino acid mutations at positions 14 and 155.

[0323] In the present application, the N protein may comprise amino acid mutations at positions 14, 155 and 353.

[0324] In the present application, the N protein may comprise amino acid mutations at positions 155 and 353.

[0325] In the present application, the N protein may comprise an amino acid mutation at position 353.

[0326] In the present application, the N protein may also contain amino acid substitutions at other positions.

[0327] The oncolytic virus further comprises a P protein, which comprises amino acid substitutions at one or more of positions 50, 76, 99, 126, 140, 151, 168, 170, 189, and 237 compared to the amino acid sequence set forth in SEQ ID NO:61.

[0328] In the present application, the amino acid substitution of the P protein is an arginine to lysine mutation at position 50 (R50K), and / or a valine to alanine mutation at position 76 (V76A), and / or an asparagine to glutamic acid mutation at position 99 (D99E), and / or a leucine to serine mutation at position 126 (L126S), and / or a leucine to serine mutation at position 140 (L140S), and / or a histidine to tyrosine mutation at position 151 (H151Y), and / or an isoleucine to methionine mutation at position 168 (I168M), and / or a lysine to glutamic acid mutation at position 170 (K170E), and / or a tyrosine to serine mutation at position 189 (Y189S), and / or an asparagine to aspartic acid mutation at position 237 (N237D). For example, the P protein comprises the amino acid sequence set forth in SEQ ID NO:71.

[0329] In the present application, the P protein may comprise an amino acid mutation at position 50.

[0330] In the present application, the P protein may comprise amino acid mutations at positions 50 and 76.

[0331] In the present application, the P protein may comprise amino acid mutations at positions 50, 76 and 99.

[0332] In the present application, the P protein may comprise amino acid mutations at positions 50, 76, 99 and 126.

[0333] In the present application, the P protein may comprise amino acid mutations at the 50th, 76th, 99th, 126th and 140th positions.

[0334] In the present application, the P protein may include amino acid mutations at the 50th, 76th, 99th, 126th, 140th and 151st positions.

[0335] In the present application, the P protein may include amino acid mutations at the 50th, 76th, 99th, 126th, 140th, 151st and 168th positions.

[0336] In the present application, the P protein may include amino acid mutations at the 50th, 76th, 99th, 126th, 140th, 151st, 168th and 170th positions.

[0337] In the present application, the P protein may include amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168, 170 and 189.

[0338] In the present application, the P protein may include amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168, 170, 189 and 237.

[0339] In the present application, the P protein may include amino acid mutations at positions 76, 99, 126, 140, 151, 168, 170, 189 and 237.

[0340] In the present application, the P protein may include amino acid mutations at positions 99, 126, 140, 151, 168, 170, 189 and 237.

[0341] In the present application, the P protein may include amino acid mutations at the 126, 140, 151, 168, 170, 189 and 237 positions.

[0342] In the present application, the P protein may include amino acid mutations at the 140, 151, 168, 170, 189 and 237 positions.

[0343] In the present application, the P protein may include amino acid mutations at the 151, 168, 170, 189 and 237 positions.

[0344] In the present application, the P protein may comprise amino acid mutations at positions 168, 170, 189 and 237.

[0345] In the present application, the P protein may comprise amino acid mutations at positions 170, 189 and 237.

[0346] In the present application, the P protein may comprise amino acid mutations at positions 189 and 237.

[0347] In the present application, the P protein may comprise an amino acid mutation at position 237.

[0348] In the present application, the P protein may also contain amino acid substitutions at other positions.

[0349] The oncolytic virus further comprises an L protein, the L protein comprising an amino acid substitution at one or more of positions 87 and 487 compared to the amino acid sequence set forth in SEQ ID NO: 81. For example, the L protein comprises the amino acid sequence set forth in SEQ ID NO: 83.

[0350] In the present application, the amino acid substitutions in the L protein include a serine to proline mutation at position 87 (S87P) and / or an isoleucine to threonine mutation at position 487 (I487T).

[0351] In the present application, the P protein may comprise an amino acid mutation at position 87.

[0352] In the present application, the P protein may comprise amino acid mutations at positions 87 and 487.

[0353] In the present application, the P protein may comprise an amino acid mutation at position 487.

[0354] In the present application, the P protein may also contain amino acid substitutions at other positions.

[0355] The oncolytic virus may comprise a nucleic acid molecule and an exogenous target protein, wherein the nucleic acid molecule comprises a nucleic acid sequence encoding an M protein having the amino acid substitution, and / or a nucleic acid sequence encoding a G protein having the amino acid substitution, and / or a nucleic acid sequence encoding an N protein having the amino acid substitution, and / or a nucleic acid sequence encoding a P protein having the amino acid substitution, and / or a nucleic acid sequence encoding an L protein having the amino acid substitution.

[0356] Furthermore, the nucleic acid molecule comprises a nucleic acid sequence encoding the exogenous target protein, wherein the nucleic acid sequence encoding the exogenous target protein is between a nucleic acid sequence encoding an M protein having the amino acid substitution, and / or a nucleic acid sequence encoding a G protein having the amino acid substitution, and / or a nucleic acid sequence encoding an N protein having the amino acid substitution, and / or a nucleic acid sequence encoding a P protein having the amino acid substitution, and / or a nucleic acid sequence encoding an L protein having the amino acid substitution.

[0357] In the present application, the oncolytic virus described in the present application can be obtained by a virus packaging process and a virus rescue process. A specific process may include infecting and inoculating BSR-T7 cells with poxvirus vTF7-3 expressing T7 RNA polymerase, and carrying out lipofectamine transfection with expression plasmids and backbone plasmids cloning VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.

[0358] The present application further provides oncolytic virus expression vectors, virus-producing cells and pharmaceutical compositions.

[0359] The oncolytic virus expression vector may contain a nucleic acid sequence encoding an M protein and a G protein of the oncolytic virus, and the oncolytic virus expression vector may further contain a nucleic acid sequence encoding an N protein, a P protein and an L protein of the oncolytic virus.

[0360] The virus-producing cells are capable of producing the oncolytic viruses described above, and may include BSR-T7 cells, Vero cells, 293 cells, MRC-5 cells, and WI38 cells.

[0361] The pharmaceutical composition comprises an oncolytic virus as described above, and optionally a pharma- ceutically acceptable carrier.

[0362] In certain embodiments, the pharmaceutical composition may include a suitable formulation of one or more (pharmaceutical effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or preservatives. Acceptable components of pharmaceutical compositions are preferably non-toxic to subjects at the dosages and concentrations used. Pharmaceutical compositions of the present application include, but are not limited to, liquid, frozen and lyophilized compositions.

[0363] In certain embodiments, the pharma- ceutically acceptable carrier includes any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents compatible with pharmaceutical administration, and are typically safe and non-toxic.

[0364] The pharmaceutical composition comprises an oncolytic virus as described above, and optionally other pharma- ceutically acceptable agents.

[0365] The pharmaceutical compositions may be used in combination treatment of diseases, including, but not limited to, the treatment of tumors.

[0366] In some embodiments, the pharmaceutical composition comprises a drug product for parenteral, transdermal, intraluminal, intraarterial, intravenous, intrathecal and / or intranasal administration or for direct injection into tissue. For example, the pharmaceutical composition can be administered to a patient or subject by infusion or injection. In some embodiments, the pharmaceutical composition can be administered in different ways, for example, intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. In some embodiments, the pharmaceutical composition can be administered without interruption. The uninterrupted (or continuous) administration can be achieved by metering the flow of therapeutic agent into the patient's body by a miniature pump system worn by the patient, as described in WO2015 / 036583.

[0367] The present application also provides a method for preparing the oncolytic virus described above, which may include a method for preparing an oncolytic virus expression vector, a virus-producing cell, and / or a pharmaceutical composition. Any method suitable for producing oncolytic viruses can be used to produce the oncolytic virus of the present application. For example, a poxvirus expressing T7 RNA polymerase is added to a cell for transfection, a plasmid expressing the oncolytic virus N protein, L protein, and P protein and a backbone plasmid are added to the cell for transfection, and the oncolytic virus of the present application is obtained through a virus rescue process.

[0368] The present application further provides the use of the above-mentioned oncolytic viruses, oncolytic virus expression vectors, virus-producing cells and / or pharmaceutical compositions in the preparation of a medicament for preventing and / or treating a disease and / or condition.

[0369] The oncolytic virus provided in the present application is mutated specifically at the amino acid sites on the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, thereby further improving the infectivity of the oncolytic virus to abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. At the same time, the oncolytic virus prepared above has low infectivity to normal cells and normal MEF cells, which indicates that the oncolytic virus prepared in the present application can be well used to infect cells such as tumors and cancers, and at the same time, it does not damage normal cells, and has the potential for wide application.

[0370] The oncolytic virus provided in the present application is specifically mutated in the amino acid sites on the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, thereby further improving the oncolytic virus's ability to infect abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. The oncolytic virus is further improved in vitro killing ability of LLC cells, 4T1 cells, MC38 cells, and Hela cells. At the same time, the prepared oncolytic virus has little effect on normal MEF cells, indicating that the prepared oncolytic virus in the present application can be well used to damage and kill abnormal cells such as tumors and cancers, without damaging normal cells.

[0371] The oncolytic virus provided in the present application is difficult to be eliminated in abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells and Hela cells. Relatively speaking, wild-type oncolytic virus is more easily eliminated in LLC cells, MC38 cells and Hela cells. The oncolytic virus provided in the present application is site-specifically mutated in the amino acids on the M protein, G protein, N protein, P protein and L protein of the oncolytic virus, respectively, so that the oncolytic virus is more difficult to be eliminated in LLC cells, 4T1 cells, MC38 cells and Hela cells, which further ensures that the oncolytic virus can further exert its infection and killing ability in LLC cells, 4T1 cells, MC38 cells and Hela cells; at the same time, the oncolytic virus provided in the present application is more easily eliminated in normal MEF cells, which further ensures the safety of normal MEF cells, thereby improving the safety of the oncolytic virus.

[0372] Hereinafter, the present application will be described in more detail with reference to Preparation Examples 1 to 80, Examples 1 to 3, and Figures 1 to 15. Preparation Example Preparation Examples 1-29

[0373] In Preparation Examples 1 to 29, oncolytic viruses are provided, and the difference between them is mainly the site of amino acid site-specific mutation on the M protein of the wild-type oncolytic virus. The construction method of the oncolytic virus corresponding to each Preparation Example is specifically as follows. (1) Plasmid construction

[0374] Using the pRV-core plasmid (BioVector NTCC Plasmid Carrier Bacterial Cell Genetic Storage Center) as a template, introduce the mutation sites shown in Table 1 by PCR technology. The pRV-core plasmid is subjected to PCR with primers carrying each mutation element, and then the PCR product is subjected to 1% agarose gel electrophoresis, and the agarose gel is recovered by a gel recovery kit, thereby obtaining the plasmids with different mutation sites of the M protein, and obtaining the constructed plasmid pRV-core Mut.

[0375] Table 1. Mutation table of M protein of oncolytic virus in Preparation Examples 1 to 29 JPEG2025503188000001.jpg232148(2) Virus Rescue

[0376] The constructed plasmid pRV-core Mut was transfected into BSR-T7 cells (purchased from ATCC (American Type Culture Collection)) by cell transfection technology using a calcium phosphate transfection kit (Thermo Fisher Scientific).

[0377] The four plasmids were mixed according to the mass ratio of pRV-core Mut, pP, pN, and pL of 10:5:4:1, so that the total amount of plasmid was 5 μg. The plasmids were diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific) and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) were added to obtain a transfection plasmid premix solution, where pP (plasmid carrying baculovirus phosphoprotein gene), pN (plasmid carrying baculovirus nucleoprotein gene), and pL (plasmid carrying baculovirus polymerase protein gene), and the parent carriers corresponding to the three plasmids pN, pP, and pL were all pCAGGS (purchased from ATCC); Dilute 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) with 200 μl of opti-MEM medium to obtain the LTX mixture. Plasmid transfection was performed according to the method described in the Lipofectamine LTX instruction manual. After 6 hours, BSR-T7 cells were washed twice with PBS and then inoculated into DMEM medium (Thermo Fisher Scientific) containing 10% fetal bovine serum and cultured for 3 days. The cell supernatant obtained by culturing BSR-T7 cells is transferred to Vero cells (Thermo Fisher Scientific), which are then cultured for three days at 37°C. The green fluorescence within the cells is observed using a fluorescence microscope to identify the state of virus rescue. The rescued mutant baculovirus library is then passaged through Vero cells, and monoclonal virus strains are picked from the constructed plaque screening system.

[0378] (3) M protein gene sequencing: Viral genomic RNA was extracted using a Trizol kit, reverse transcription was performed using random primers, and PCR was performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence. The primer sequences are as follows: PF: ATGAGTTCCTTAAAGAA; PR: TCATTTGAAGTGG.

[0379] The products were recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1. Preparation Examples 30-52

[0380] In Preparation Examples 30 to 52, oncolytic viruses are provided, and the difference between them is mainly the amino acid site-specific mutation sites on the M protein and G protein of the wild-type oncolytic virus. Here, the mutation site of the M protein is the same as the corresponding mutation site in Preparation Example 24, and the mutation site of the G protein is shown in Table 2.

[0381] The method for constructing the oncolytic virus provided in the above Preparation Example is different from the method for constructing in Preparation Example 11 in that: introducing the mutation sites shown in Table 2 into the plasmid constructed in step (1) using PCR techniques; Step (3) is the determination of the G protein gene sequence. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the G protein gene sequence. The primer sequences are as follows: PF: ATGAAGTGCCTTTTGTACTTAG; PR: TTACTTTCCAAGTCGGTTCATCT.

[0382] The products were recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0383] Table 2. Mutation table of G protein of oncolytic virus in Preparation Examples 30 to 52 JPEG2025503188000002.jpg187148 Preparation example 53~57

[0384] In Preparation Examples 53 to 57, oncolytic viruses are provided, and the difference between them is mainly the amino acid site-specific mutation sites on the M protein, G protein, and N protein of the wild-type oncolytic virus. Here, the mutation sites of the M protein and G protein are the same as the corresponding mutation sites in Preparation Example 41, and the mutation site of the N protein is shown in Table 3.

[0385] The oncolytic virus construction method provided in the above Preparation Example is different from the construction method in Preparation Example 41 in that: introducing the mutation sites shown in Table 3 in the plasmid constructed in step (1) using PCR techniques; Step (3) is the determination of the N protein gene sequence. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the N protein gene sequence. The primer sequences are as follows: PF: ATGTCTGTTACAGTCAAGAG; PR: TCATTTGTCAAATTCTGACTT.

[0386] The products were recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0387] Table 3 Mutation table of N protein of oncolytic virus in preparation examples 53 to 57 JPEG2025503188000003.jpg35148 Preparation example 58~76

[0388] In Preparation Examples 58 to 76, oncolytic viruses are provided, and the difference between them is mainly the amino acid site-specific mutation sites on the M protein, G protein, N protein, and P protein of the wild-type oncolytic virus. Here, the mutation sites of the M protein, G protein, and N protein are the same as the corresponding mutation sites in Preparation Example 55, and the mutation site of the P protein is shown in Table 3.

[0389] The oncolytic virus construction method provided in the above Preparation Example has the following differences from the construction method in Preparation Example 55: introducing the mutation sites shown in Table 4 in the plasmid constructed in step (1) using PCR techniques; Step (3) is the determination of the P protein gene sequence. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the P protein gene sequence. The primer sequences are as follows: PF: ATGGATAATCTCACAAAAGTTCG; PR: CTACAGAGAATATTTGACTCTCG.

[0390] The products were recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 4.

[0391] Table 4 Mutation table of P protein of oncolytic virus in preparation examples 58 to 76 JPEG2025503188000004.jpg142148 Preparation examples 77-79

[0392] In Preparation Examples 77 to 79, oncolytic viruses are provided, and the difference between them is mainly the amino acid site-specific mutation sites on the M protein, G protein, N protein, P protein, and L protein of the wild-type oncolytic virus. Here, the mutation sites of the M protein, G protein, N protein, and P protein are the same as the corresponding mutation sites in Preparation Example 67, and the mutation site of the L protein is shown in Table 5.

[0393] The method for constructing the oncolytic virus provided in the above Preparation Example is different from the method for constructing in Preparation Example 67 in that: introducing the mutation sites shown in Table 5 in the plasmid constructed in step (1) using PCR techniques; Step (3) is the determination of the L protein gene sequence. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the L protein gene sequence. The primer sequences are as follows: PF: ATGGAAGTCCACGATTTTGAGA; PR: TTAATCTCTCCAAGAGTTTTCCT.

[0394] The products were recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 5.

[0395] Table 5 Mutation table of L protein of oncolytic virus in preparation examples 77 to 79 JPEG2025503188000005.jpg24148 Preparation example 80

[0396] This preparation example provides a packaging process for an oncolytic virus prepared by any one of the above preparation examples 1 to 79, and specifically includes the following steps: 1) BSR-T7 cells (purchased from ATCC) were inoculated with the poxvirus vTF7-3 (BioVector NTCC Plasmid Carrier Cell Gene Storage Center) expressing T7 RNA polymerase to infect the cells.

[0397] Specific process: BSR-T7 cells were plated in a 6-well plate, with the number of cells per well set at 3 × 10 5 After 14-16 hours of infection, the poxvirus vTF7-3 expressing T7 RNA polymerase was added to the BSR-T7 cells, and the infection of the BSR-T7 cells with the poxvirus vTF7-3 was performed. After 6 hours of infection, the BSR-T7 cells were rinsed once with DPBS buffer (Thermo Fisher Scientific) and transfection was performed. 2) Transfection process

[0398] Specifically, the process includes the following steps: pRV-core Mut, pP, pN, and pL are mixed according to a mass ratio of 10:5:4:1, so that the total amount of plasmid is 5 μg; 200 μl opti-MEM medium (Thermo Fisher Scientific) is used to dilute the plasmid, and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) is added to obtain a transfection plasmid premix solution, where pP (plasmid carrying baculovirus phosphoprotein gene), pN (plasmid carrying baculovirus nucleoprotein gene), and pL (plasmid carrying baculovirus polymerase protein gene) are the plasmids corresponding to the three plasmids pN, pP, and pL, which are all pCAGGS (purchased from ATCC); Dilute 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) with 200 μl of opti-MEM medium to obtain the LTX mixture. 200 μl of the LTX mixture and 200 μl of the transfection plasmid premix were mixed and incubated at room temperature for 15 minutes to obtain an LTX-DNA mixture. In step 1), the DPBS buffer in the 6-well plate is replaced with Opti-MEM medium, the LTX-DNA mixture is added to the 6-well plate in which the BSR-T7 cells are cultured, the 6-well plate is gently shaken to distribute the LTX-DNA mixture evenly in the 6-well plate, and the transfection is carried out for 6 to 8 hours. After that, the transfection reagent is aspirated, and 3 ml of fresh complete medium (Thermo Fisher Scientific) is added. After 72 hours, the cell supernatant of the BSR-T7 cells is obtained, and filtered using a 0.22 μm filter to obtain the corresponding oncolytic viruses of Preparation Examples 1 to 79. Working Example Example 1

[0399] In this example, the oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 79 are used to test and detect their infectivity to different cells.

[0400] The detection method was the TCID50 detection method, that is, 200 pfu each of Preparations 1 to 79 and the wild-type oncolytic virus was added to the culture medium of different cells, and half of the tissue culture infective dose (TCID50) produced by each oncolytic virus was detected.

[0401] The cells detected included LLC cells (mouse lung cancer cell line), 4T1 cells (mouse breast cancer cell line), MC38 cells (mouse colon cancer cell line), Hela cells (human cervical cancer cell line), and MEF cells (human fibroblast cell line).

[0402] Specific detection methods include: (1) Add 3 mL of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to a 6-well culture plate, and add 4 × 10 cells. 5 The cells / well were then cultured in a 6-well culture plate at 37°C and 5% CO2 for 16 hours, with a total of 6 wells, including 2 wells for MEF cells. (2) 200 pfu of the oncolytic virus prepared in the Preparation Example was added to each well of a 6-well culture plate. After 24 hours, 100 μl of the supernatant from the MEF cells and each Vero cell was taken and added to the wells of a 96-well culture plate. The amount of each cell was adjusted to 1 × 10 4 The cells / ml were then cultured in a 96-well culture plate at 37°C and 5% CO2 for 16 hours. (3) In a 1.5 ml EP tube, serially dilute the supernatant obtained in step (2) by 10-fold, -1 From 10 -11 There were a total of 11 titers, and the diluted supernatants were inoculated into 96-well culture plates, one row per dilution, for a total of 8 wells, with 100 μl inoculated per well. (4) After 48 hours, the fluorescence state of the cells in each well is observed. If fluorescence is present, the well is recorded as infected, and the TCID50 is calculated according to the Karber method.

[0403] The detection results are shown in Figures 1 to 5. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axis 1 to 79 represent the oncolytic viruses prepared in Preparation Examples 1 to 79, respectively, and the vertical axis Log 10 TCID50 represents the TCID50 value calculated by the Karber method, and Log 10 The higher the TCID50 value, the better the oncolytic virus's ability to infect the cells, and Log 10 A lower TCID50 value indicates a lower ability of the oncolytic virus to infect the cells.

[0404] FIG. 1 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to LLC cells. FIG. 2 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to 4T1 cells. FIG. 3 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to MC38 cells. FIG. 4 shows the results of detecting the infectivity of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to HeLa cells. FIG. 5 shows the results of detecting the ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus to infect MEF cells.

[0405] As can be seen from the above figures, the oncolytic viruses prepared in Preparation Examples 1 to 79 of the present application all have good infectivity to LLC cells, 4T1 cells, MC38 cells and Hela cells, and in particular, the infectivity of the oncolytic viruses provided in Preparation Examples 77 to 79 to LLC cells, 4T1 cells, MC38 cells and Hela cells reaches that of wild-type oncolytic viruses. At the same time, the oncolytic viruses prepared above, especially those provided in Preparation Examples 77 to 79, all have low infectivity to MEF cells, which indicates that the oncolytic viruses prepared in the present application can be well used to infect cells of tumors, cancers, etc., without damaging normal cells, and have the potential for wide application. Example 2

[0406] In this example, the oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 79 were used to perform in vitro killing tests on different cells.

[0407] The detection method was the MTT detection method, that is, 200 pfu each of Preparation Examples 1 to 79 and the wild-type oncolytic virus was added to the culture medium of different cells, and after 24 hours, the cell activity was detected by the MTT detection method.

[0408] The cells detected included LLC cells, 4T1 cells, MC38 cells, HeLa cells, and MEF cells.

[0409] Specific detection methods include: (1) Add 100 μl of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to a 96-well culture plate to obtain a cell volume of 1 × 10 4 Allow to reach 100 cells / well and incubate the 96-well culture plate at 37°C and 5% CO2 for 16 hours. (2) The oncolytic viruses prepared in the Preparation Examples are diluted to MOI (multiplicity of infection) of 0.001, 0.01, 0.1, and 1.0, and the oncolytic viruses of each dilution gradient are inoculated into the 96-well culture plate of step (1), 4 wells are inoculated for each dilution gradient, 100 μl is inoculated per well, and the 96-well culture plate is cultured under circular conditions of 37°C and 5% CO2 for 40 hours. (3) Remove the cell supernatant from the 96-well culture plate in step (2), add fresh medium and MTT solution to the 96-well culture plate at a volume of 20 μL / well, and culture the 96-well culture plate at 37° C. and 5% CO2 for 4 hours; (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the rotation speed to 2500 rpm / min, gently aspirate the supernatant using a 1 mL disposable sterile syringe, and add DMSO to each well of the 96-well culture plate in an amount of 100 ul / well, and place it at 37°C for 10 minutes. Shake for 2 minutes and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm using a multi-function microplate reader.

[0410] The detection results are shown in Figures 6 to 10. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axis 1 to 79 represent the oncolytic viruses prepared in Preparation Examples 1 to 79, respectively, and the vertical axis represents OD 570 represents the OD value of the cells, and OD 570 The higher the OD value, the lower the killing ability of the oncolytic virus to the cell. 570 The smaller the value, the better the killing ability of the oncolytic virus to the cell.

[0411] FIG. 6 shows the results of detecting the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on LLC cells. FIG. 7 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on 4T1 cells. FIG. 8 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on MC38 cells. FIG. 9 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on HeLa cells. FIG. 10 shows the results of detection of the in vitro killing ability of the oncolytic virus prepared in the present application and the wild-type oncolytic virus on MEF cells.

[0412] As can be seen from the above figures, the oncolytic viruses prepared in Preparation Examples 1 to 79 of the present application all have good in vitro killing ability against LLC cells, 4T1 cells, MC38 cells and Hela cells, and in particular, the oncolytic viruses provided in Preparation Examples 77 to 79 have in vitro killing ability against LLC cells, 4T1 cells, MC38 cells and Hela cells that exceeds that of wild-type oncolytic viruses. At the same time, the above prepared oncolytic viruses have almost no killing effect on MEF cells, which indicates that the oncolytic viruses prepared in the present application can be well used to damage and kill abnormal cells such as tumors and cancers, without damaging normal cells. Wild-type oncolytic viruses have good in vitro killing ability against LLC cells, MC38 cells and 4T1 cells, but they also damage and kill MEF cells significantly while damaging and killing the above cells, limiting the clinical application of wild-type oncolytic viruses. Therefore, the modification of wild-type oncolytic viruses according to the present application ensures the safety of oncolytic viruses to normal cells, while also ensuring the killing ability of oncolytic viruses to tumor and cancer cells, and has the potential for broad clinical application. Example 3

[0413] In this example, test detection is performed on the oncolytic viruses prepared in Preparation Examples 1 to 79 and the wild-type oncolytic virus inducing the expression of IFN-β in different cells.

[0414] The detection indicator is the expression status of gene IFN-β in different cells. Gene IFN-β is a soluble glycoprotein gene produced by cells, which has a wide range of antiviral, antitumor and immunomodulatory effects. The expression status of gene IFN-β can determine the cell's ability to eliminate oncolytic viruses. When the expression of gene IFN-β is high, it indicates that oncolytic viruses are easily eliminated in cells, and when the expression of gene IFN-β is low, it indicates that oncolytic viruses are difficult to eliminate in cells.

[0415] The cells detected included LLC cells, 4T1 cells, MC38 cells, HeLa cells, and MEF cells.

[0416] Specific detection methods include: (1) Add 100 μl of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to a 96-well culture plate to obtain a cell volume of 1 × 10 4 Allow to reach 100 cells / well and incubate the 96-well culture plate at 37°C and 5% CO2 for 16 hours. (2) The oncolytic viruses prepared in the Preparation Examples are diluted to MOIs (multiplicity of infection) of 0.001, 0.01, 0.1, and 1.0, and the oncolytic viruses of each dilution gradient are inoculated into the 96-well culture plate of step (1), 4 wells are inoculated for each dilution gradient, and 100 μl is inoculated per well. The 96-well culture plate is cultured under circular conditions at 37°C and 5% CO2 for 40 hours. (3) Each set of cells cultured and obtained in step (2) is disrupted, total RNA is extracted from each cell using TRIzol (Invitrogen), reverse transcribed into cDNA using the PrimeScript RT Reagent Kit with DNA Eraser (Takara) reverse transcription kit, stained with LightCycler 480SYBR Green I Master (Roche) dye, and the Ct value of each gene is detected using a LightCycler 480 quantitative PCR instrument. The relative expression level of the target gene IFN-β is calculated using the ΔΔCt method.

[0417] The detection results are shown in Figures 11 to 15. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axes 1 to 79 represent the oncolytic viruses prepared in Preparation Examples 1 to 79, respectively, and the vertical axis IFN-β level represents the expression state of the IFN-β gene, with a higher IFN-level value indicating a weaker reproduction ability of the oncolytic virus within the cell and easier removal, and a lower IFN-β level value indicating a stronger reproduction ability of the oncolytic virus within the cell and harder removal.

[0418] FIG. 11 shows the situation in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells. FIG. 12 shows the state in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in 4T1 cells. FIG. 13 shows the situation in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in MC38 cells. FIG. 14 shows the state in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in HeLa cells. FIG. 15 shows the situation in which the oncolytic virus prepared in the present application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.

[0419] As can be seen from the above figures, the oncolytic viruses and wild-type oncolytic viruses provided in Preparation Examples 1 and 21 of the present application have weak reproduction ability in LLC cells, 4T1 cells, MC38 cells and Hela cells, and are easily eliminated. Relatively speaking, the oncolytic viruses provided in Preparation Examples 2-20 and 22-79 are more difficult to eliminate in LLC cells, 4T1 cells, MC38 cells and Hela cells. In particular, the oncolytic viruses provided in Preparation Examples 77-79 are more difficult to eliminate in LLC cells, 4T1 cells, MC38 cells and Hela cells, which further ensures that the oncolytic viruses can better exert their infection and killing abilities in LLC cells, 4T1 cells, MC38 cells and Hela cells. At the same time, the oncolytic viruses provided in the present application are more easily eliminated in MEF cells, which further ensures the safety of MEF cells, thereby improving the safety of the oncolytic viruses.

[0420] The specific examples are merely illustrative of the present application and do not limit the present application. After reading this specification, a person skilled in the art may make amendments to the present examples as necessary without making any creative contribution thereto, but as long as they are within the scope of the claims of this application, they shall be protected by the Patent Law.

Claims

1. An oncolytic virus, The oncolytic virus includes an M protein, and the M protein includes amino acid substitutions at one or more of the following positions: 32, 33, 49, 54, 133, and 225, compared to the amino acid sequence shown in SEQ ID NO:

1. An oncolytic virus characterized by:

2. The amino acid substitutions in the M protein include an asparagine to serine mutation at position 32 (N32S), and / or a methionine to alanine mutation at position 33 (M33A), and / or an asparagine to aspartic acid mutation at position 49 (N49D), and / or a histidine to tyrosine mutation at position 54 (H54Y), and / or an alanine to threonine mutation at position 133 (A133T), and / or a valine to isoleucine mutation at position 225 (V225I). The oncolytic virus according to claim 1 .

3. The M protein further comprises an amino acid substitution at one or more of positions 21, 51, 111, 221, and 226. The oncolytic virus according to claim 2 .

4. The amino acid substitutions in the M protein further comprise a glycine to glutamic acid mutation at position 21 (G21E), and / or the amino acid substitutions in the M protein comprise a methionine to arginine mutation at position 51 (M51R), and / or a methionine to alanine mutation at position 51 (M51A), and / or a leucine to alanine mutation at position 111 (L111A), and / or a valine to phenylalanine mutation at position 221 (V221F), and / or a serine to arginine mutation at position 226 (S226R). The oncolytic virus according to claim 3 .

5. The amino acid substitution in the M protein is selected as any one of the following: 1) the amino acid substitutions in the M protein include G21E and N32S; 2) the amino acid substitutions in the M protein include G21E, N32S, and M33A; 3) the amino acid substitutions in the M protein include G21E, N32S, M33A, and N49D; 4) the amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, and H54Y; 5) the amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, H54Y, and L111A; 6) the amino acid substitutions in the M protein are G21E, N32S, M33A, N49D, H54Y, L111A, A133T; 7) the amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, A133T, and V225I; 8) the amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, and V225I; 9) The amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, and V225I; 10) the amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 11) The amino acid substitutions in the M protein include N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 12) The amino acid substitutions in the M protein include M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 13) The amino acid substitutions in the M protein include N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 14) The amino acid substitutions in the M protein include M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 15) The amino acid substitutions in the M protein include H54Y, L111A, A133T, V221F, V225I, and S226R; 16) The amino acid substitutions in the M protein include L111A, A133T, V221F, V225I, and S226R; 17) The amino acid substitutions of the M protein include A133T, V221F, V225I, and S226R; 18) The amino acid substitutions in the M protein include V221F, V225I, and S226R; 19) The amino acid substitutions of the M protein include V225I and S226R; 20) The amino acid substitution in the M protein comprises S226R; 21) The amino acid substitutions of the M protein include N32S, N49D, H54Y, and V225I; 22) The amino acid substitutions of the M protein include N32S, N49D, H54Y, V225I, and S226G; 23) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; 24) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; 25) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; 26) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; 27) The amino acid substitutions in the M protein include G21E, N32S, N49D, M51A, H54Y, L111A, V225I, and S226R.

5. An oncolytic virus according to any one of claims 1 to 4.

6. The amino acid substitutions in the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R. The oncolytic virus according to claim 5 .

7. The M protein comprises the amino acid sequence shown in SEQ ID NO:

12. The oncolytic virus according to claim 5 .

8. An oncolytic virus, The oncolytic virus further comprises a G protein, the G protein comprising one or more amino acid substitutions at positions 438, 453, 471, and 487 compared to the amino acid sequence shown in SEQ ID NO:

31. An oncolytic virus characterized by:

9. The G protein further comprises an amino acid substitution at one or more of the following positions: 53, 141, 172, 217, 232, 331, 371, and 436. The oncolytic virus according to claim 8.

10. The amino acid substitution of the G protein is a valine to isoleucine mutation at position 53 (V53I), and / or an alanine to valine mutation at position 141 (A141V), and / or an aspartic acid to tyrosine mutation at position 172 (D172Y), and / or a lysine to glutamic acid mutation at position 217 (K217E), and / or an aspartic acid to glycine mutation at position 232 (D232G), and / or a valine to alanine mutation at position 331 (V331A), and / or a valine to glutamic acid mutation at position 371 (V371E), and / or a glycine to aspartic acid mutation at position 436 (G436D), and / or a threonine to serine mutation at position 438 (T438S), and / or a phenylalanine to leucine mutation at position 453 (F453L), and / or a threonine to isoleucine mutation at position 471 (T471I), and / or a tyrosine to histidine mutation at position 487 (Y487H). The oncolytic virus according to claim 8 or 9.

11. The G protein amino acid substitution is selected as any one of the following: 1) the amino acid substitution in the G protein comprises V53I; 2) the amino acid substitutions in the G protein include V53I and A141V; 3) the amino acid substitutions of the G protein include V53I, A141V, and D172Y; 4) the amino acid substitutions of the G protein include V53I, A141V, D172Y, and K217E; 5) the amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, and D232G; 6) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, and V331A; 7) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, and V371E; 8) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, and G436D; 9) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, and T438S; 10) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, and F453L; 11) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, and T471I; 12) The amino acid substitutions of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 13) The amino acid substitutions of the G protein include A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 14) The amino acid substitutions of the G protein include D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 15) The amino acid substitutions of the G protein include K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 16) The amino acid substitutions of the G protein include D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 17) The amino acid substitutions of the G protein include V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 18) The amino acid substitutions of the G protein include V371E, G436D, T438S, F453L, T471I, and Y487H; 19) The amino acid substitutions of the G protein include G436D, T438S, F453L, T471I, and Y487H; 20) The amino acid substitutions of the G protein include T438S, F453L, T471I, and Y487H; 21) The amino acid substitutions of the G protein include F453L, T471I, and Y487H; 22) The amino acid substitutions of the G protein include T471I and Y487H; 23) The amino acid substitution of the G protein includes Y487H. The oncolytic virus according to claim 10 .

12. The amino acid substitutions in the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H. The oncolytic virus of claim 11.

13. The G protein comprises the amino acid sequence set forth in SEQ ID NO:

43. The oncolytic virus of claim 11.

14. An oncolytic virus, The oncolytic virus comprises an M protein according to any one of claims 1 to 7 or an M protein and a G protein according to any one of claims 8 to 13, and further comprises an N protein, the N protein comprising amino acid substitutions at one or more of positions 14, 155, and 353 compared to the amino acid sequence shown in SEQ ID NO:

55. An oncolytic virus characterized by:

15. The amino acid substitutions in the N protein include an isoleucine to valine mutation at position 14 (I14V), and / or an arginine to lysine mutation at position 155 (R155K), and / or a serine to asparagine mutation at position 353 (S353N). The oncolytic virus of claim 14.

16. The amino acid substitution in the N protein is selected from any one of the following: 1) the amino acid substitution in the N protein comprises I14V; 2) the amino acid substitutions in the N protein include I14V and R155K; 3) the amino acid substitutions in the N protein include I14V, R155K, and S353N; 4) the amino acid substitutions of the N protein include R155K and S353N; 5) The amino acid substitution in the N protein includes S353N.

16. An oncolytic virus according to claim 14 or 15.

17. The amino acid substitutions in the N protein include I14V, R155K, and S353N. The oncolytic virus of claim 16.

18. The N protein comprises the amino acid sequence set forth in SEQ ID NO:

58. The oncolytic virus of claim 16.

19. An oncolytic virus, The oncolytic virus comprises an M protein according to any one of claims 1 to 7, an M protein and a G protein according to any one of claims 8 to 13, or an M protein, a G protein, and an N protein according to any one of claims 14 to 18, and further comprises a P protein, wherein the P protein comprises amino acid substitutions at one or more of the following positions compared to the amino acid sequence shown in SEQ ID NO:61: positions 50, 76, 99, 126, 140, 151, 168, 170, 189, and 237. An oncolytic virus characterized by:

20. The amino acid substitutions in the P protein include an arginine to lysine mutation at position 50 (R50K), and / or a valine to alanine mutation at position 76 (V76A), and / or an asparagine to glutamic acid mutation at position 99 (D99E), and / or a leucine to serine mutation at position 126 (L126S), and / or a leucine to serine mutation at position 140 (L140S), and and / or a histidine to tyrosine mutation at position 151 (H151Y), and / or an isoleucine to methionine mutation at position 168 (I168M), and / or a lysine to glutamic acid mutation at position 170 (K170E), and / or a tyrosine to serine mutation at position 189 (Y189S), and / or an asparagine to aspartic acid mutation at position 237 (N237D).

20. The oncolytic virus of claim 19.

21. The amino acid substitution in the P protein is selected as any one of the following: 1) the amino acid substitution in the P protein comprises R50K; 2) the amino acid substitutions of the P protein include R50K and V76A; 3) the amino acid substitutions of the P protein include R50K, V76A, and D99E; 4) the amino acid substitutions of the P protein include R50K, V76A, D99E, and L126S; 5) the amino acid substitutions of the P protein include R50K, V76A, D99E, L126S, and L140S; 6) the amino acid substitutions of the P protein include R50K, V76A, D99E, L126S, L140S, and H151Y; 7) The amino acid substitutions of the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, and I168M; 8) The amino acid substitutions of the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, I168M, and K170E; 9) The amino acid substitutions of the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, and Y189S; 10) The amino acid substitutions of the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 11) The amino acid substitutions of the P protein include V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 12) The amino acid substitutions of the P protein include D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 13) The amino acid substitutions of the P protein include L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 14) The amino acid substitutions of the P protein include L140S, H151Y, I168M, K170E, Y189S, and N237D; 15) The amino acid substitutions of the P protein include H151Y, I168M, K170E, Y189S, and N237D; 16) The amino acid substitutions of the P protein include I168M, K170E, Y189S, and N237D; 17) The amino acid substitutions of the P protein include K170E, Y189S, and N237D; 18) The amino acid substitutions of the P protein include Y189S and N237D; 19) The amino acid substitution of the P protein includes N237D.

21. The oncolytic virus according to claim 19 or 20.

22. The amino acid substitutions in the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D. The oncolytic virus of claim 21.

23. The P protein comprises the amino acid sequence set forth in SEQ ID NO:

71. The oncolytic virus of claim 21.

24. An oncolytic virus, The oncolytic virus comprises an M protein according to any one of claims 1 to 7, an M protein and a G protein according to any one of claims 8 to 13, an M protein, a G protein and an N protein according to any one of claims 14 to 18, or an M protein, a G protein, an N protein and a P protein according to any one of claims 19 to 23, and further comprises an L protein, wherein the L protein comprises an amino acid substitution at one or more of the 87th position and the 487th position compared to the amino acid sequence shown in SEQ ID NO:

81. An oncolytic virus characterized by:

25. The amino acid substitutions in the L protein include a serine to proline mutation at position 87 (S87P) and / or an isoleucine to threonine mutation at position 487 (I487T). The oncolytic virus of claim 24.

26. The amino acid substitution in the L protein is selected from any one of the following: 1) the amino acid substitution in the L protein comprises S87P; 2) the amino acid substitutions in the L protein include S87P and I487T; 3) The amino acid substitution in the L protein includes I487T.

26. An oncolytic virus according to claim 24 or 25.

27. The amino acid substitutions in the L protein include S87P and I487T. The oncolytic virus of claim 26.

28. The N protein comprises the amino acid sequence set forth in SEQ ID NO:

83. The oncolytic virus of claim 26.

29. The oncolytic virus includes a baculovirus.

29. An oncolytic virus according to any one of claims 1 to 28.

30. The oncolytic virus includes vesicular stomatitis virus.

30. An oncolytic virus according to any one of claims 1 to 29.

31. The oncolytic virus includes the VSV virus Indiana MuddSummer subtype.

31. An oncolytic virus according to any one of claims 1 to 30.

32. The oncolytic virus contains or expresses an exogenous target protein.

32. An oncolytic virus according to any one of claims 1 to 31.

33. The oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding an M protein having the amino acid substitution, and / or a nucleic acid sequence encoding a G protein having the amino acid substitution, and / or a nucleic acid sequence encoding an N protein having the amino acid substitution, and / or a nucleic acid sequence encoding a P protein having the amino acid substitution, and / or a nucleic acid sequence encoding an L protein having the amino acid substitution.

33. An oncolytic virus according to any one of claims 1 to 32.

34. The nucleic acid molecule comprises a nucleic acid sequence encoding the exogenous target protein. The oncolytic virus of claim 33.

35. Among the nucleic acid molecules, the nucleic acid sequence encoding the exogenous target protein is between the nucleic acid sequence encoding the M protein having the amino acid substitution, and / or the nucleic acid sequence encoding the G protein having the amino acid substitution, and / or the nucleic acid sequence encoding the N protein having the amino acid substitution, and / or the nucleic acid sequence encoding the P protein having the amino acid substitution, and / or the nucleic acid sequence encoding the L protein having the amino acid substitution. The oncolytic virus of claim 34.

36. An oncolytic virus expression vector, comprising: The oncolytic virus expression vector is capable of expressing the oncolytic virus of any one of claims 1 to 35. An oncolytic virus expression vector comprising:

37. 1. A virus-producing cell, comprising: The virus-producing cell is capable of producing an oncolytic virus according to any one of claims 1 to 35. A virus-producing cell characterized by:

38. 1. A pharmaceutical composition comprising: The pharmaceutical composition comprises an oncolytic virus according to any one of claims 1 to 35, and optionally a pharma- ceutically acceptable carrier. A pharmaceutical composition comprising:

39. A method for preparing an oncolytic virus according to any one of claims 1 to 35, an oncolytic virus expression vector according to claim 36, a virus-producing cell according to claim 37 and / or a pharmaceutical composition according to claim 38.

40. Use of an oncolytic virus according to any one of claims 1 to 35, an oncolytic virus expression vector according to claim 36, a virus-producing cell according to claim 37 and / or a pharmaceutical composition according to claim 38 in the preparation of a medicament for the prevention and / or treatment of a disease and / or condition.

41. The oncolytic virus, the oncolytic virus expression vector, the virus-producing cell and / or the pharmaceutical composition are used in a method for continuously killing abnormally proliferating cells.

41. Use according to claim 40.

42. The abnormally proliferative cells are selected from tumor cells or tumor tissue associated cells.

42. Use according to claim 41 .

43. The tumor includes a solid tumor or a blood tumor.

43. Use according to claim 42.

Images