A fully human monoclonal antibody against human progranulin

Abstract

Described herein are antibodies, particularly monoclonal antibodies, that specifically bind to human Progranulin and are useful for treating cancer in patients. Methods for their preparation and use are also provided.

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 63 / 313,304, filed February 24, 2022, which is incorporated by reference in its entirety. Technical Field Provided herein are fully human monoclonal antibodies (mAbs). More specifically, described herein are mAbs that specifically bind to human progranulin, also known as GP88. Other names for progranulin include granulin / epithelin precursor, GEP, and acrogranin. [Background technology]

[0002] A promising new therapeutic and diagnostic target for cancer has been identified and is called PCDGF (also known as granulin-epithelin precursor [GEP or GP88] or progranulin). PCDGF (herein referred to as progranulin) is an 88 kDa glycoprotein containing a 20 kDa carbohydrate moiety and a 68 kDa core protein identical to the precursor of epithelin / granulin, a family of six double cysteine-rich polypeptides derived by proteolytic processing of the progranulin precursor (Bhandari, V. et al., Proc Natl Acad Sci USA 89(5): 1715-1719, 1992). The first identified members of this family were the 6 kDa polypeptide growth regulators epithelin 1 and 2 isolated from rat kidney (Shoyab, M., et al., Proc Natl Acad of Sci 87(20): 7912, 1990) or granulin from human granulocyte extracts (Bateman et al. Biochem Biophys Res Commun 173(3): 1161-1168, 1990).

[0003] Cloning of the epithelin and granulin complementary deoxyribonucleic acid (cDNA) showed that it encoded a 63 kDa protein containing a 7.5 kDa cysteine-rich epithelin / granulin repeat, a signal peptide, and several putative glycosylation sites (Bhandari, V. et al., Proc Natl Acad Sci USA 89(5): 1715-1719, 1992). Studies on the biological function of the cloned and expressed precursor suggested that it was biologically inactive (Bhandari, V. et al., 1992 and Plowman, G. et al., J Biol Chem 267(18): 13073-13078, 1992). This led to the hypothesis that the precursor must be processed to a 6 kDa molecular form to acquire biological activity. Based on this hypothesis, the large molecular weight form was defined as the granulin / epithelin precursor or PGRN, now called progranulin. Under normal physiological conditions, progranulin is not secreted but serves as a precursor of mature granulin / epithelin. Studies by the Serrero laboratory reporting the purification of an autocrine growth factor from the culture medium of a highly neoplastic teratocarcinoma PC cell line were the first to demonstrate that the precursor exists physiologically as an 88 kDa glycoprotein with a 17 amino acid signal peptide and a 20 kDa carbohydrate moiety as the biologically active growth factor (Zhou, G. et al., J Biol Chem 268(15): 10863-10869, 1993).Other studies on several cell lines of epithelial or mesenchymal origin (Zanocco-Marani, T., et al., Cancer Res 59(20): 5331-5340, 1999; He, Z. et al., Cancer Research 62(19): 5590, 2002; He, Z. et al., J Mol Med 81(10): 600-612, 2003; Serrero, G, Biochem Biophys Res Commun 308(3): 409-413, 2003) have shown that autocrine production and acquisition of secretion of Progranulin results in unregulated growth in vivo, leading to tumorigenesis, indicating that Progranulin acts as a protumorigenic growth factor.

[0004] Higher expression levels of autocrine progranulin are associated with the most aggressive breast cancer cells. For example, progranulin messenger ribonucleic acid (mRNA) and protein expression are very low in immortalized non-tumorous breast epithelial MCF-10A cells and estrogen receptor positive (ER+) MCF-7 cells. In contrast, more aggressive estrogen receptor negative (ER-) cell lines such as MDA-MB-468, 453 and 231 show a dramatic increase in progranulin levels (Lu, R. et al., Proc Natl Acad Sci USA 97(8): 3993-3998, 2000). Further studies have demonstrated that progranulin mediates the growth-promoting effects of 17-β estradiol (E2) in human breast cancer cells, in which overexpression of progranulin in E2-dependent MCF-7 cells renders the cells E2-independent and resistant to tamoxifen without altering E2 receptor status and E2 responsiveness (Lu, R. et al., Proc Natl Acad Sci USA 98(1): 142-147, 2001). Furthermore, it has been found that tamoxifen-treated mice bearing tumors overexpressing progranulin formed larger tumors than mice not treated with tamoxifen, indicating that ER+ breast cancer cells overexpressing progranulin not only became resistant to the growth-inhibitory effects of tamoxifen, but also responded unfavorably to tamoxifen, leading to stimulation of tumor growth in vivo.In addition to conferring resistance to tamoxifen, there is also data indicating that overexpression of progranulin in ER+ breast cancer cells results in resistance to fulvestrant (FASLODEX), the aromatase inhibitor letrozole, and the chemotherapy drug doxorubicin (Tangkeangsirisin, W. et al., Carcinogenesis 25(9): 1587-1592, 2004; Abrhale; T. et al., BMC Cancer 11: 231, 2011; Tangkeangsirisin, W. et al., Advances in Breast Cancer Research Vol. 3 No. 3: 11, 2014). This latter finding is supported by a study by Kudoh et al. (Kudoh, R. et al., Cancer Research 60(15): 4161, 2000), who identified progranulin as a gene that was significantly (>12-fold) upregulated in doxorubicin-resistant breast cancer cells MCF-7 / D40 by microarray analysis. Progranulin was also upregulated 17-fold in MCF-7 cells treated with doxorubicin for 15 hours. These results indicate that increased progranulin expression in breast cancer is associated with chemotherapy resistance.

[0005] The Progranulin receptor has not been fully cloned, so little is known about it, but the Progranulin-dependent signaling pathway that mediates proliferation and survival has been investigated by several laboratories (Arechavaleta-Velasco, F. et al., Med Oncol 34(12): 194, 2017). For the receptor, specific, time- and temperature-dependent binding of Progranulin to cells has been shown to be saturable. Crosslinking of biotinylated Progranulin to human breast cancer cells using the crosslinker DSS showed the presence of a crosslinking arm with an apparent molecular weight of approximately 190-200 kDa, suggesting an apparent molecular weight of the putative receptor of 100-110 kDa (Xia et al., Biochem Biophys Res Commun 245(2): 539-543, 1998). Cells that did not bind or react to Progranulin did not exhibit such crosslinked protein complexes. The intracellular signaling pathway mediated by progranulin includes the MAPK ERK 1 / 2, PI-3 kinase, and FAK, leading to the activation of the cell cycle regulatory proteins cyclin D1 and cyclin B (Zanocco-Marani, T. et al., Cancer Res 59(20): 5331-5340, 1999; Lu, R. et al., Proc Natl Acad Sci USA 98(1): 142-147, 2001; He, Z. et al., J Mol Med 81(10): 600-612, 2003; Jones, MB et al., Clin Cancer Res 9(1): 44-51, 2003). Progranulin and its receptor have been shown to crosstalk with the Her-2 receptor, but not the EGF receptor, in Her-2-overexpressing breast cancer, leading to phosphorylation of Her-2 and subsequent resistance to Herceptin (Kim, WE et al., Clin Cancer Res 12(14 Pt 1): 4192-4199, 2006).

[0006] Regarding the survival function of progranulin, we investigated its mechanism of action, and found that progranulin blocks the apoptotic effect of tamoxifen by upregulating the expression of bcl-2 and inhibits the angiogenic factors vascular endothelial growth factor (VEGF) and angiogenesis. Progranulin has been shown to potently stimulate the expression of opoetin-2 (Tangkeangsirisin, W., et al., Carcinogenesis 25(9): 1587-1592, 2004). Because Progranulin stimulates VEGF, it was investigated whether Progranulin also stimulates other processes involved in metastasis. When Progranulin was overexpressed or exogenously added in MCF-7 cells, it stimulated migration, matrix metalloproteinase-9 expression, and invasion (Tangkeangsirisin, W. et al., Tangkeangsirisin, W. et al., Cancer Res 64(5): 1737-1743, 2004; Tangkeangsirisin, W. et al., Carcinogenesis 25(9): 1587-1592, 2004). Activation of MMP-2 in addition to MMP-9 has also been reported (He, Z. et al., J Mol Med 81(10): 600-612, 2003). Thus, progranulin stimulates angiogenesis and tumor cell invasion mediated, at least in part, by stimulating the expression of VEGF and matrix metalloproteinases, respectively (He, Z. et al., Cancer Research 62(19): 5590, 2002; He et al., 2003; Tangkeangsirisin, W. et al., Cancer Res 64(5): 1737-1743, 2004; Tangkeangsirisin, W. et al., Carcinogenesis 25(9): 1587-1592, 2004). These data suggest that increased progranulin levels are associated with increased metastasis. Recently, a human / mouse chimeric monoclonal antibody called AG01 that specifically binds to human progranulin was shown to be effective in vivo. AG01 treatment of mice bearing MDA-MB-231 subcutaneous tumors showed a significant reduction in tumor growth rate and tumor weight, whereas body weight and organ mass were unaffected (Guha, R. et al., Breast Cancer Res Treat 186(3): 637-653, 2021). Summary of the Invention

[0007] Thus, there is a need for mAbs, particularly fully human mAbs, against human Progranulin that specifically bind to human Progranulin and are useful for treating human cancers in patients.

[0008] The present invention provides a monoclonal antibody or antigen-binding fragment that binds to progranulin (PGRN or GP88). D Described herein are isolated antibodies or antigen-binding fragments that bind to human progranulin at 100 pM or less. For example, the isolated antibodies or antigen-binding fragments described herein bind to human progranulin at 100 pM or less. D It may bind at 10 pM or less, 1 pM or less, 0.1 pM or less, or 0.01 pM or less. More specifically, the isolated antibodies or antigen-binding fragments described herein also bind to human progranulin at a K as measured by the Octet assay described below, or by any assay available to one of skill in the art. DIt may bind at 0.05 pM or less or 0.4 pM or less. Certain mAbs herein do not compete with chimeric monoclonal antibody mAb AG01 (Guha, R. et al., 2021), which comprises (a) a mouse variable region that specifically binds human Progranulin, and (b) a human constant region. Described herein are isolated antibodies, or antigen-binding fragments thereof, that bind human Progranulin and further compete with mAb 16C11, 10B3, 10C8, or 14A6 as described herein for binding. Described herein are isolated antibodies, or antigen-binding fragments thereof, that bind to the same epitope as mAb 16C11, 10B3, 10C8, or 14A6. In particular, the mAbs herein include anti-human Progranulin antibodies having the amino acid sequences listed in Table 1 (denoted using one-letter abbreviations standard in the art). These variable regions can be linked to an IgG1 / κ isotype constant region. The Chothia and Kabat numbering systems for CDR residues are well known in the art and are further described in Dondelinger, M., et al., Front Immunol 9:2278, 2018, and were used to determine the amino acid sequences shown in Table 1 below. H and V LExemplary cDNA sequences encoding the 10C8, 16C11, 14A6, or 10B3 antibodies (or functional fragments thereof, e.g., CDRs and / or variable regions thereof) are also provided below. The monoclonal antibodies may further comprise the complete heavy and / or light chains of the antibodies set forth in Table 1. In some embodiments, the monoclonal antibodies may comprise the antigen binding domains of such heavy and / or light chains, e.g., the CDRs set forth in Table 1. In some embodiments, the present disclosure provides nucleotide sequences encoding 10C8, 16C11, 14A6, or 10B3 antibodies (or functional fragments thereof, e.g., CDRs and / or variable regions thereof), and / or specific amino acid sequences of equivalents, where equivalent sequences can be readily derived from the amino acid sequences of any of SEQ ID NOs: 1-56 and the information set forth in Table 4, as well as using functional and other assays as disclosed herein and / or otherwise available to one of skill in the art. In some embodiments, the present disclosure also provides expression vectors comprising isolated nucleic acids comprising and / or consisting of such nucleotide sequences (in preferred embodiments, any of SEQ ID NOs: 57-64 or derivatives thereof), as well as host cells (e.g., cell lines) comprising such expression vectors. Described herein are isolated nucleic acids encoding the heavy or light chains of the monoclonal antibodies of the present invention, expression vectors comprising the isolated nucleic acids, and cell lines comprising the expression vectors. Also described herein are methods of treating cancer in a patient by identifying a patient having cancerous cells expressing Progranulin and administering to the patient an antibody or antigen-binding fragment as described herein. A variety of human cancers are known to express Progranulin, including ovarian cancer, breast cancer, multiple myeloma, lung cancer, kidney cancer, prostate cancer, hepatocellular carcinoma, uterine cancer, bladder cancer, biliary tract cancer, esophageal cancer, gastric cancer, laryngeal cancer, brain cancer, leukemia, and glioblastoma. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only, and are not limiting. Additional features will be set forth in part in the description that follows, or may be learned by practice as described herein.The above and other features will become apparent to those of ordinary skill in the art in view of the following description of the illustrative embodiments.

[0009] The accompanying drawings and photographs are incorporated in and constitute a part of this specification, illustrate some embodiments, and together with the detailed description, serve to explain the principles of the present specification. Note that AG01 is the same mAb as c4F10 mentioned in this specification, including the drawings. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 is a bar graph showing flow binding of different anti-Progranulin (PRGN or GP88) mAbs to MDA-MB-231 cells at different mAb concentrations. [Diagram 2] FIG. 2 is a bar graph showing the migration percentage of MDA-MB-231 cells for different anti-Progranulin mAbs. [Diagram 3] Figure 3 is a bar graph showing tumor volume following treatment with certain antibodies in an in vivo tumor growth model, which uses injection of MDA-MB-231 cells into athymic mice. The term "ip" refers to intraperitoneal injection of therapeutic mAbs herein. [Figure 4] FIG. 4 is a line graph showing tumor volume upon treatment of mice with the novel fully human mAb 10C8. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The present disclosure relates to breast cancers, including, but not limited to, triple negative breast cancers (e.g., as exemplified using, for example, the MDA-MB-231 cell line), adenocarcinoma epidermal growth factor receptor (EGF-R) breast cancers (e.g., as exemplified using, for example, the MDA-MB-468 cell line), basal breast cancers (e.g., as exemplified using, for example, the HS578T cell line), estrogen receptor (ER) luminal breast cancers (e.g., as exemplified using, for example, the MCF-7 cell line), ER positive tamoxifen resistant luminal breast cancers (e.g., as exemplified using, for example, the TamR The present invention relates to antibodies, including but not limited to fully human monoclonal antibodies, that can be used to treat cancers such as MCF-7 cell line, letrozole-resistant luminal breast cancer (e.g., ACLRT USM cell line), ovarian cancer, uterine cancer, prostate cancer, bladder cancer (e.g., T24 cell line), kidney cancer, hepatocellular carcinoma, biliary tract cancer, esophageal cancer, colon cancer, gastric cancer, laryngeal cancer, lung cancer (e.g., non-small cell lung cancer (e.g., H1299 cell line), lung adenocarcinoma (e.g., A549 cell line)), brain cancer, myeloma / leukemia, mesothelioma (e.g., MSTO-H11 cell line), epidermoid or squamous cell carcinoma (e.g., A431 cell line). In a preferred embodiment, exemplary cell lines (which can be, for example, cancers) are known and can be shown to express and / or bind Progranulin (GP88) in standard assays, to be bound by the antibodies and / or derivatives of the present disclosure or to have Progranulin (GP8) binding that is inhibited by the antibodies and / or derivatives of the present disclosure, and / or to be responsive to the antibodies and / or derivatives in vitro (e.g., using migration assays) and / or in vivo (e.g., using xenografts).In some embodiments, the present disclosure provides isolated antibodies, one or more antigen-binding fragments thereof, that bind to human Progranulin (GP88) and compete with the antibodies 10C8, 16C11, 14A6, or 10B3 (or functional fragments thereof, e.g., CDRs and / or variable regions thereof) for binding; heavy and light chain variable regions thereof (see Table 1); and / or polypeptides comprising the CDRs of such antibodies (see Table 1); and / or derivatives thereof (e.g., comprising conservative amino acid substitutions (e.g., see Table 4)), all of which are considered equivalent. In particular, the mAbs herein include anti-human Progranulin (GP88) antibodies having the amino acid sequence of each CDR listed in Table 1, or variants thereof as disclosed herein or otherwise recognized by one of skill in the art.

[0012] In a preferred embodiment, the antibody of the present disclosure comprises the following amino acid and nucleotide sequences: Preferred antibodies of the present disclosure may comprise the complementarity determining regions (CDRs) of the 10C8, 16C11, 14A6, or 10B3 antibodies. Table 1 shows the CDRs of the 10C8, 16C11, 14A6, or 10B3 antibodies using the Chothia and Kabat methods. [Table 1] JPEG2025508868000002.jpg149154

[0013] In some embodiments, the present disclosure provides fully human anti-Progranulin antibodies that internalize into cells expressing Progranulin and compete with Trastuzumab for binding to HER2, and methods for using such antibodies for their neutralizing and internalization properties. In preferred embodiments, such antibodies include those referred to herein as 10C8, 16C11, 14A6, or 10B3, and / or CDRs contained by such antibodies (see Table 1); their heavy and light chain variable regions (see Table 1); and / or derivatives thereof (e.g., including conservative amino acid substitutions (see Table 4)). In some embodiments, the present disclosure provides fully human anti-Progranulin antibodies that internalize and do not compete with the antibodies or derivatives disclosed herein for binding to Progranulin, and methods for studying their internalization properties. In preferred embodiments, such antibodies include those referred to herein as 10C8, 16C11, 14A6, or 10B3; those comprising the heavy and light chain variable regions thereof (see Table 1); and / or those comprising the CDRs of Table 1; and / or derivatives thereof (e.g., those comprising conservative amino acid substitutions (see, e.g., Table 4)). These antibodies may further comprise at least a portion (most preferably comprising these CDRs) and / or the complete heavy and / or light chains of an antibody shown in Table 1, and / or derivatives thereof comprising the CDRs shown in Table 1. In some preferred embodiments, such antibodies may have the amino acid sequence of a heavy chain variable ("VH") or light chain variable ("VL") polypeptide (VH or VL "chains," respectively) as set forth below for an antibody shown in Table 1, or an equivalent thereof. In some embodiments, the isolated antibodies, or antigen-binding fragments described herein have a molecular weight of 3.6×10 to human progranulin as measured by the Octet assay described below (see, e.g., the Examples section herein), or by any assay available to one of skill in the art. -9 K to mole (M) DIn some embodiments, the disclosure provides nucleotide sequences encoding specific amino acid sequences of equivalents of the 10C8, 16C11, 14A6, or 10B3 antibodies, which can be readily derived from the information provided in any of the amino acid sequences in Table 1 (i.e., SEQ ID NOs: 1-56) and Table 4, and / or equivalents / derivatives thereof. In preferred embodiments, the 10C8 antibody comprises SEQ ID NOs: 1-3 and 7-9; or SEQ ID NOs: 4-6 and 10-12; and / or SEQ ID NO: 13 and SEQ ID NO: 14; or variants thereof as disclosed herein or otherwise recognized by one of skill in the art. In preferred embodiments, the 16C11 antibody comprises SEQ ID NOs: 15-17 and 21-23; or SEQ ID NOs: 18-20 and 24-26; and / or SEQ ID NO: 27 and SEQ ID NO: 28; or variants thereof as disclosed herein or otherwise recognized by one of skill in the art. In a preferred embodiment, the 14A6 antibody comprises SEQ ID NOs:29-31 and 35-37; or SEQ ID NOs:32-34 and 38-40; and / or SEQ ID NO:41 and SEQ ID NO:42; or variants thereof as disclosed herein or otherwise recognized by those of skill in the art. In a preferred embodiment, the 10B3 antibody comprises SEQ ID NOs:43-45 and 49-51; or SEQ ID NOs:46-48 and 52-54; and / or SEQ ID NO:55 and SEQ ID NO:56; or variants thereof as disclosed herein or otherwise recognized by those of skill in the art.

[0014] In some embodiments, the disclosure also provides expression vectors comprising isolated nucleic acids comprising and / or consisting of such nucleotide sequences (in preferred embodiments, as set forth below, or derivatives thereof), as well as host cells (e.g., cell lines) comprising such expression vectors. In some embodiments, the disclosure also provides methods for using antibodies and / or fragments thereof (e.g., CDRs) (collectively referred to herein as "antibodies" unless otherwise specified) to treat cancers involving Progranulin. In some embodiments, the disclosure also provides methods for treating cancer in a patient by identifying a patient having cancerous cells that express Progranulin and administering to the patient an antibody or antigen-binding fragment as described herein. A variety of human cancers are known to express Progranulin, including, but not limited to, ovarian cancer, breast cancer, multiple myeloma, lung cancer, renal cancer, prostate cancer, hepatocellular carcinoma, uterine cancer, bladder cancer, biliary tract cancer, esophageal cancer, gastric cancer, laryngeal cancer, brain cancer, leukemia, and glioblastoma. Thus, provided herein, in some preferred embodiments, are fully human monoclonal antibodies that specifically bind to human Progranulin (PGRN) and can be used to treat cancer, such as breast cancer.

[0015] Also contemplated herein is the use of combinations of antibodies such as one or more of those described herein with another available to one of skill in the art. For example, in some embodiments, combinations can be identified that provide a statistically significant difference from results (e.g., neutralization assays) obtained using only one or more antibodies without the other antibodies. In some embodiments, combinations exhibit additive and / or preferably synergistic activity. In some embodiments, combinations may include 10C8, 16C11, 14A6, or 10B3 antibodies (or derivatives thereof) with other antibodies and / or conjugates. They may also be combined with chemotherapeutic agents used in standard treatments, some of which are combined with anti-progranulin therapy. The antibodies of such compositions may be different entities, such as two or more different monoclonal antibodies or derivatives thereof, or may be found in the same entity, such as bifunctional antibodies (a single antibody or derivatives thereof that contain multiple binding specificities). Combinations such as those described herein may be combined with one or more other agents that may affect immune cell function, such as antibodies against CTLA-4. Those of skill in the art will recognize that many such combinations may be suitable for use as described herein.

[0016] The term "antibody" as used herein means intact antibodies and any antigen-binding fragment (i.e., "antigen-binding portion") or single chains thereof. Intact antibodies are glycoproteins that contain at least two heavy (H) chains and two light (L) chains interchain-connected by disulfide bonds. Each heavy chain contains a heavy chain variable region (herein referred to as V H The heavy chain constant region is composed of three domains, CH1, CH2, and CH3. Each light chain is composed of a light chain variable region (abbreviated as V L The light chain constant region is composed of one domain, CL. H Area and V L The regions can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs).H and V L is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain the binding domains that interact with antigens. The constant regions of the antibody may mediate the binding of the immunoglobulin to host tissues or various cells of the immune system (e.g., effector cells) and factors including the first component (Clq) of the classical complement system. The term "chimeric antibody" refers to antibody molecules in which (a) the constant region, or a portion thereof, has been altered, substituted or replaced such that the antigen-binding site (variable region) is linked to a constant region of a different or altered class, effector function and / or species, or to an entirely different molecule that confers novel properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, has been altered, substituted or replaced with a variable region of different or altered antigen specificity. For example, a mouse antibody can be modified by replacing its constant region with that from a human immunoglobulin, allowing the chimeric antibody to retain its specificity for antigen recognition while being less antigenic in humans compared to the original mouse antibody.

[0017] The term "isotype" refers to the antibody class (e.g., IgM, IgE, IgG, e.g., IgG1 or IgG4) provided by the heavy chain constant region genes. Isotype also includes modified versions of one of these classes in which modifications have been made to alter Fc function, e.g., to enhance or reduce effector function or binding to an Fc receptor. Isotype also refers to the antibody class (e.g., kappa, lambda) provided by the light chain constant region. An antibody may include an Fc region that contains one or more mutations that affect one or more antibody properties, such as stability, pattern of glycosylation or other modifications, effector cell function, pharmacokinetics, etc. In some embodiments, the antibody has reduced or minimized glycosylation. In some embodiments, the antibody has ablated or reduced effector function. Exemplary Fc mutations include, but are not limited to, (i) human IgG1 Fc region mutations L234A, L235A, G237A, and N297A; (ii) human IgG2 Fc region mutations A330S, P331S, and N297A; and (iii) human IgG4 Fc region mutations S228P, E233P, F234V, L235A, delG236, and N297A (EU numbering). In some embodiments, the human IgG2 Fc region comprises A330S and P331S mutations. In some embodiments, the human IgG4 Fc region comprises S288P mutations. In some embodiments, the human IgG4 Fc region comprises S288P and L235E mutations. Antibodies that target cell surface antigens can elicit immunostimulatory and effector functions associated with engagement of Fc receptors (FcR) on immune cells. There are a number of Fc receptors specific for particular classes of antibodies, including IgG (gamma receptors), IgE (eta receptors), IgA (alpha receptors), and IgM (mu receptors). Binding of the Fc region to cell surface Fc receptors can elicit a number of biological responses, including phagocytosis of antibody-coated particles (antibody-dependent cell-mediated phagocytosis, or ADCP), clearance of immune complexes, lysis of antibody-coated cells by killer cells (antibody-dependent cell-mediated cytotoxicity, or ADCC), and release of inflammatory mediators, placental transfer, and control of immunoglobulin production.Furthermore, when the C1 component of complement binds to an antibody, it can activate the complement system. Complement activation can be important for lysis of cellular pathogens. However, complement activation can also stimulate inflammatory responses and may also be involved in autoimmune hypersensitivity or other immunological diseases. Mutant Fc regions with reduced or eliminated ability to bind to specific Fc receptors are useful for the development of therapeutic antibodies and Fc fusion polypeptide constructs that act by targeting, activating or neutralizing ligand function without damaging or destroying local cells or tissues. An Fc domain monomer refers to a polypeptide chain that includes a second and third antibody constant domain (e.g., CH2 and CH3). In some embodiments, the Fc domain monomer also includes a hinge domain. In some embodiments, the Fc domain monomer is of any immunoglobulin antibody isotype, such as IgG, IgE, IgM, IgA, and IgD. Furthermore, in some embodiments, the Fc domain monomer is of any IgG subtype (e.g., IgG1, IgG2, IgG2a, IgG2b, IgG2c, IgG3, and IgG4). Further mutations in the Fc domain and the biological consequences of those mutations are known in the art and can be applied to the antibodies herein, see, e.g., US Patent Publication No. 20220002434.

[0018] The term "antigen-binding portion" or "antigen-binding fragment" of an antibody, as used herein, refers to one or more fragments of an intact antibody that retain the ability to specifically bind to a given antigen (e.g., human granulin). The antigen-binding function of an antibody may be performed by a fragment of the intact antibody. Examples of binding fragments encompassed within the term antigen-binding portion or antigen-binding fragment of an antibody include Fab fragments, V and V fragments. L , V H , a monovalent fragment consisting of the CL and CH1 domains; F(ab)2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge in the hinge region; V H and the Fd fragment consisting of the CH1 domain; L and V HFv fragment consisting of domains; V H Domain or V L Single domain antibody (dAb) fragments consisting of the V domain (Ward et al., 1989 Nature 341:544-546); as well as isolated complementarity determining regions (CDRs). In addition, the two domains V of the Fv fragment are L and V H are encoded by separate genes, but they can be linked by an artificial peptide linker using recombinant techniques, resulting in V L Area and V H These antibodies can be made as single protein chains (known as single-chain Fvs (scFvs); see, e.g., Bird et al., 1988 Science 242:423-426; and Huston et al., 1988 Proc. Natl. Acad. Sci. 85:5879-5883) in which the regions are paired to form a monovalent molecule. Such single-chain antibodies contain one or more antigen-binding portions or fragments of an antibody. These antibody fragments can be obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as intact antibodies. Antigen-binding fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs, and bis-scFvs (see, e.g., Hollinger and Hudson, 2005, Nature Biotechnology, 23, 9, 1126-1136). Antigen-binding portions of antibodies can be grafted onto polypeptide-based scaffolds such as fibronectin type III (Fn3). (See U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide monobodies.) Antigen-binding fragments consist of a pair of tandem Fv segments (VFv) that form a pair of antigen-binding regions with complementary light chain polypeptides. H -CH1-V H-CH1) (Zapata et al., 1995 Protein Eng. 8(10):1057-1062; and U.S. Patent No. 5,641,870).

[0019] The term "epitope" refers to a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural features as well as specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that the binding to the former is lost in the presence of denaturing solvents, whereas the binding to the latter is not lost. The term "binding specificity" as used herein refers to the ability of an individual antibody binding site to react with (e.g., have affinity for) only one antigenic determinant (e.g., epitope). The term "specifically (or selectively) binds" an antibody (e.g., a human progranulin-binding antibody) refers to a binding reaction that determines the presence of the cognate antigen in a heterogeneous population of proteins and other biologics. The terms "antibody that recognizes an antigen" and "antibody specific for an antigen" are used interchangeably herein with the term "antibody that specifically binds to an antigen". The term "affinity" as used herein refers to the strength of the interaction between an antibody and an antigen at a single antigenic site. Within each antigen site, the variable regions of the antibody "arms" interact with the antigen at multiple sites through weak non-covalent forces; the more interactions, the stronger the affinity. assoc The terms "K" or "Ka", as used herein, are intended to refer to the association rate of a particular antibody-antigen interaction, while the terms "Kdis" or "Kd", as used herein, are intended to refer to the dissociation rate of a particular antibody-antigen interaction. D The term "dissociation constant," as used herein, is intended to refer to the dissociation constant obtained from the ratio of Kd to Ka (i.e., Kd / Ka) and expressed as a molar concentration (M). The K D Values ​​can be determined using methods well established in the art. DMethods for determining K include measuring surface plasmon resonance using a biosensor system such as a Biacore system, or measuring affinity in solution by solution equilibrium titration (SET). As used herein, the term "high affinity" for an antibody or antigen-binding fragment thereof (e.g., a Fab fragment) generally refers to a K D 10 -9 This refers to an antibody or antigen-binding fragment of less than M.

[0020] The term "isolated antibody" refers to an antibody that is substantially free of other antibodies with different antigen specificity (e.g., an isolated antibody that specifically binds to Progranulin is substantially free of antibodies that specifically bind to antigens other than Progranulin). However, an isolated antibody that specifically binds to Progranulin may have cross-reactivity with other antigens, e.g., Progranulin of species other than human. Furthermore, an isolated antibody may be substantially free of other cellular material and / or chemicals. The term "monoclonal antibody" or "monoclonal antibody composition" as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition exhibits a single binding specificity and affinity for a particular epitope. The term "human antibody" as used herein is intended to include antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin. Furthermore, if the antibody contains a constant region, the constant region is also derived from such a human sequence, e.g., human germline or is a variant of human germline. A human antibody may contain amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-directed mutagenesis in vitro or somatic mutations in vivo). The term "human monoclonal antibody" refers to an antibody exhibiting a single binding specificity having variable regions in which both the framework and CDR regions are derived from human sequences. In one embodiment, a human monoclonal antibody is produced by a hybridoma comprising (i) a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, whose genome comprises human heavy chain and light chain transgenes, fused with (ii) an immortalized cell. A "humanized" antibody is an antibody that retains the reactivity of a non-human antibody while being less immunogenic in humans. This can be achieved, for example, by retaining the non-human CDR regions and replacing the remainder of the antibody with their human counterparts (i.e., the constant regions as well as the framework portions of the variable regions).See, e.g., Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855, 1984; Morrison and Oi, Adv. Immunol., 44:65-92, 1988; Verhoeyen et al., Science, 239:1534-1536, 1988; Padlan, Molec. Immun., 28:489-498, 1991; and Padlan, Molec. Immun., 31:169-217, 1994. Other examples of human engineering techniques include, but are not limited to, the Xoma technology disclosed in U.S. Patent No. 5,766,886.

[0021] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those that have been subsequently modified, e.g., hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon bonded to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function similarly to a naturally occurring amino acid.

[0022] The term "conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, conservatively modified variants refer to nucleic acids that code for identical or essentially identical amino acid sequences, or, if the nucleic acid does not code for an amino acid sequence, to essentially identical sequences. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids code for any given protein. For example, the codons GCA, GCC, GCG, and GCU all code for the amino acid alanine. Thus, at any position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such variations of nucleic acids are "silent variations" as one type of conservatively modified variation. Any nucleic acid sequence of the present invention that codes for a polypeptide represents all possible silent variations of that nucleic acid. One of skill in the art will recognize that each codon of a nucleic acid (except AUG, which is normally the only codon for methionine, and TGG, which is normally the codon for tryptophan) can be altered to obtain a functionally identical molecule. Thus, each silent variation of a nucleic acid that codes for a polypeptide is implicit in each described sequence.

[0023] With respect to polypeptide sequences, "conservatively modified variants" include individual substitutions, deletions, or additions to a polypeptide sequence that result in the replacement of an amino acid with a chemically equivalent amino acid. Conservative substitution tables providing functionally equivalent amino acids are well known in the art. Such conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs, and alleles. The following eight groups include amino acids that are conservative substitutions for one another: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine ​​(C), methionine (M) (see, e.g., Creighton, Proteins (1984)). In some embodiments, the term "conservative sequence modifications" is used to refer to amino acid modifications that do not significantly affect or significantly change the binding characteristics of an antibody containing that amino acid sequence.

[0024] Using standard three letter or other abbreviations for amino acids that will be understood by those of skill in the art, amino acid substitutions that are considered to be conservative and non-conservative are shown below in Table 2. [Table 2]

[0025] The term "identical" or 100% "identity" with respect to two or more nucleic acid or polypeptide sequences refers to two or more sequences or subsequences being the same. Two sequences are "substantially identical" if a specified percentage of amino acid residues or nucleotides are identical (i.e., 60% identity over a specified region, or if not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window or specified region, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Optionally, the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) long, or over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) long. For sequence comparison, one sequence is generally a reference sequence to which a test sequence is compared. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence to the reference sequence based on the program parameters. A "comparison window", as used herein, includes reference to any one segment of a number of contiguous positions selected from the group consisting of 20 to 600, usually about 50 to about 200, more usually about 100 to about 150, within which a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods for aligning sequences for comparison are well known in the art.Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443, 1970, the similarity search method of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988, computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, for example, Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (Ringbou ed., 2003)). Two examples of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., Nuc. Acids Res. 25:3389-3402, 1977; and Altschul et al., J. Mol. Biol. 215:403-410, 1990, respectively. Software for performing BLAST analyses is publicly available at the National Center for Biotechnology Information. The algorithm involves first identifying high-scoring sequence pairs (HSPs) by determining whether short words of length W in the query sequence match or meet a certain positive threshold score T when aligned with words of the same length in the database sequences. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.The word hits are extended along each sequence in both directions for as far as the cumulative alignment score can be increased. The cumulative score is calculated using the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0) for nucleotide sequences. For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction is stopped when the cumulative alignment score falls off its maximum achieved value by an amount X, when the accumulation of one or more negative scoring residue alignments causes the cumulative score to fall below zero, or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989) with an alignment (B) of 50, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787, 1993). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which is an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, or less than about 0.01, or less than about 0.001.The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17, 1988) as incorporated into the ALIGN program (version 2.0) using a PAM120 weight trace table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percent identity between two amino acid sequences can also be determined using the algorithm of Needleman and Wunsch (J. Mol, Biol. 48:444-453, 1970) as incorporated into the GAP program of the GCG software package (available at gcg.com) using either a Blossom 62 matrix or a PAM250 matrix with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0026] In addition to the percentage of sequence identity described above, another indicator that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by a first nucleic acid is immunologically cross-reactive with an antibody raised against a polypeptide encoded by a second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, when the two peptides differ only by conservative substitutions. Another indicator that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indicator that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequences.

[0027] The antibodies, or antigen-binding fragments thereof, preferably comprise one or more amino acid sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to at least one of SEQ ID NOs: 1-56 (i.e., the CDR, VH, and / or VL sequences shown in Table 1). In some embodiments, equivalents of the 10C8, 16C11, 14A6, or 10B3 antibodies include derivatives of one or more of the CDRs of the 10C8, 16C11, 14A6, or 10B3 antibodies, preferably including up to three conservative amino acid substitutions (see Table 2) of the CDRs, so long as the derivative retains the ability to bind PGRN (preferably human PGRN (GP88)). In some embodiments, equivalents of the 10C8, 16C11, 14A6, or 10B3 antibodies include one or more derivatives of the VH and / or VL chains of the 10C8, 16C11, 14A6, or 10B3 antibodies that contain up to 10 conservative amino acid substitutions (see Table 2), preferably outside of the CDRs, so long as the derivatives retain the ability to bind to PGRN (preferably huPGRN). In preferred embodiments, any such substitutions do not allow or interfere with conjugation of the antibody to one or more detectable labels, cytotoxic agents, and / or other payloads (e.g., to provide a bispecific antibody).

[0028] The term "nucleic acid" is used interchangeably herein with the term "polynucleotide" and refers to deoxyribonucleotides or ribonucleotides and polymers thereof in single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, natural, and unnatural, have similar binding properties as the reference nucleic acid, and are metabolized similarly to the reference nucleotide. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide nucleic acids (PNAs). Unless otherwise indicated, a particular nucleic acid sequence implicitly encompasses not only the sequence explicitly indicated, but also its conservatively modified variants (e.g., degenerate codon substitutions) and complementary sequences. Specifically, as described in more detail below, degenerate codon substitutions can be achieved by generating sequences in which the 3-position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al., J. Biol. Chem. 260:2605-2608, 1985; and Rossolini et al., Mol. Cell. Probes 8:91-98, 1994).

[0029] In certain embodiments, a nucleic acid molecule encoding one or more antibodies described herein can be inserted into one or more expression vectors, as described in more detail below. In such embodiments, an antibody can be encoded by nucleotides corresponding to its amino acid sequence. The specific combinations of nucleotides (codons) that code for various amino acids (AA) are well known in the art, as described in various references used by those skilled in the art (see, for example, Lewin, B. Genes V, Oxford University Press, 1994). The nucleotide sequences that code for the amino acids of the antibody can be ascertained, for example, by reference to Table 3. Any combination of nucleotides that codes for the antibody can be used in the nucleic acid variant. [Table 3]

[0030] Variable heavy chain (V H ) amino acid sequence and variable light chain (V L Exemplary nucleotide (eg, cDNA) sequences encoding the amino acid sequences are shown below. CAGGTCAGCTGGTGCAGTCTGGCGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTAACCAGCTATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGTCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAATTATGCACAGAAGCTC CAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTATTGTGCGAGAGTTATTATGGTTCGGGGAGTTATTATCCCAATACTATTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG (Sequence number 57 (10C8 V H )); GACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAAAATATTAGTCGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAACTCCTGATCTTTAGGGCATCTAGTTTAGAAACTGGGGTCCCATCAAGGTTCGGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTACACTTTTGGCCAGGGGACCAGGCTGGAGATCAAAC (SEQ ID NO: 58 (10C8 V L )); CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGTTATGCCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAAAAAATACAATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATAGGGGGATAGGTGGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG (SEQ ID NO: 59 (16C11 V H )); GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGTCAGACTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAGCCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCGGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAACAATATTATAGTACTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAACC (SEQ ID NO: 60 (16C11 V L )); CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAACTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTCTATTACTGTGCGAGAGGGCACTCTGTTTCGGGGGGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA (SEQ ID NO: 61 (14A6 V H )); GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCGTGAACAGCTTCTTGAATTGGTATCAGCAGACACCAGGGAAAGCCCCTAAACTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCACCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAC (SEQ ID NO: 62 (14A6 V L )); CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCCTCAGTGGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGACAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTGATAAAAACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATCGAGGAGCAGTGGCTGGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG (SEQ ID NO: 63 (10B3 V H )); and GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAACTCCAACAATAAGAACCTCTTAGCCTGGTTCCGGCAGAAACCGGGACAGCCTCCTAAGTTGCTCATTTACTGGGC GTCTACCCGGGAATCCGGGGTCCCTGACCGGTTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTTCTGTCAGCAATATTATGGTACTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC (Sequence number 64 (10B3 V L )).

[0031] Variations of these nucleotide sequences are also contemplated herein. Compositions comprising them are also contemplated. Such variations encode antibodies or polypeptides comprising CDRs or variants thereof as disclosed herein or recognized by those of skill in the art. Those of skill in the art will understand that nucleotide sequences encoding specific amino acid sequences corresponding to 10C8, 16C11, 14A6, or 10B3 antibodies can be readily derived from the amino acid sequence of any of SEQ ID NOs: 57-64 and the information set forth in Table 3. For example, from the amino acid sequence GYTLTSY (SEQ ID NO: 1) and the information set forth in Table 3, it can be inferred that the amino acid sequence can be encoded by the nucleotide sequence GGC TAC ACC CTG ACC AGC TAC (SEQ ID NO: 65). Those of skill in the art will understand that nucleotide sequences encoding SEQ ID NOs: 1-56 and derivatives thereof can be similarly deduced, and such nucleotide sequences are contemplated herein. The present disclosure also provides an expression vector comprising an isolated nucleic acid comprising and / or consisting of such a nucleotide sequence (in preferred embodiments, any of SEQ ID NOs: 57-64 or derivatives thereof), as well as a host cell (e.g., a cell line) comprising such an expression vector.

[0032] The term "operably linked" refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. In general, the term refers to the functional relationship between a transcriptional regulatory sequence and a transcribed sequence. For example, a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or regulates the transcription of the coding sequence in an appropriate host cell or other expression system. Generally, promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous with the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences, such as enhancers, need not be physically contiguous or adjacent to the coding sequences whose transcription they enhance. As used herein, the term "optimized" means that the nucleotide sequence has been modified to encode an amino acid sequence using codons that are preferred in the production cell or organism, typically a eukaryotic cell, such as a Pichia cell, a Chinese hamster ovary cell (CHO) or a human cell. An optimized nucleotide sequence is engineered to retain, completely or as much as possible, the amino acid sequence originally encoded by the starting nucleotide sequence, also known as the "parent" sequence. In the present specification, optimized sequences are engineered to have codons that are preferred in mammalian cells. However, optimized expression of these sequences in other eukaryotic or prokaryotic cells is also envisioned herein. The amino acid sequence encoded by an optimized nucleotide sequence can also be said to be optimized.

[0033] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of a corresponding naturally occurring amino acid, as well as to natural and non-natural amino acid polymers. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof. The term "recombinant human antibody", as used herein, includes any human antibody prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from animals (e.g., mice) that are transgenic or transchromosomal for human immunoglobulin genes or hybridomas prepared therefrom, antibodies isolated from host cells transformed to express a human antibody, e.g., from transfectants, antibodies isolated from recombinant, combinatorial human antibody libraries, and antibodies prepared, expressed, created or isolated by any other means, including splicing all or a portion of a human immunoglobulin gene sequence to other DNA sequences. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or in vivo somatic mutagenesis, in the case of using animals transgenic for human Ig sequences) so that the V and VD of the recombinant antibody can be determined. H Area and V L The amino acid sequence of the region is similar to that of the human germline V H and V L These are sequences that are derived from and related to the sequence, but that do not naturally occur within the human antibody germline repertoire in vivo.

[0034] The term "recombinant host cell" (or simply "host cell") or "cell line" refers to a cell into which a recombinant expression vector has been introduced. It is to be understood that such terms are intended to refer not only to the particular subject cell but also to the progeny of such a cell. Because certain modifications may occur in successive generations due to mutations or environmental influences, such progeny may not actually be identical to the parent cell, but are still included within the scope of the term "host cell" or "cell line" as used herein. The term "subject" includes humans and non-human animals. Non-human animals include all vertebrates (e.g., mammals and non-mammals), such as non-human primates (e.g., cynomolgus monkeys), sheep, dogs, cows, chickens, amphibians, and reptiles. Unless otherwise indicated, the terms "patient" and "subject" are used interchangeably herein.

[0035] As used herein, the term "treatment" of any disease or disorder (e.g., breast cancer) refers, in one embodiment, to ameliorating the disease or disorder (i.e., slowing or halting or alleviating the onset of the disease or at least one clinical symptom thereof). In another embodiment, "treatment" refers to alleviating or improving at least one physical parameter, including one that may not be discernible by the patient. In yet another embodiment, "treatment" refers to modulating the disease or disorder physically (e.g., stabilization of discernible symptoms), physiologically (e.g., stabilization of physical parameters), or both. In yet another embodiment, "treatment" refers to preventing or delaying the onset or development or progression of the disease or disorder. "Prevention" with respect to the indications described herein, including conditions or disorders associated with cancers that express progranulin.

[0036] The term "vector" is intended to refer to a polynucleotide molecule capable of transporting another polynucleotide to which it is linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, such as an adeno-associated virus vector (AAV, or AAV2), into which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. In addition, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids. As the plasmid is the most commonly used form of vector, "plasmid" and "vector" can be used interchangeably herein. However, it is intended to include other forms of expression vectors that serve equivalent functions, such as viral vectors (eg, replication defective retroviruses, adenoviruses and adeno-associated viruses).

[0037] An antibody can be linked to a drug to form an antibody-drug conjugate (ADC). In general, an ADC includes a linker between the drug and the antibody. The linker can be a degradable linker or a non-degradable linker. Degradable linkers are generally easily degraded in the intracellular environment, for example, the linker is degraded at the target site to release the drug from the antibody. Suitable degradable linkers include enzymatically degradable linkers, such as peptidyl-containing linkers that can be degraded by intracellular proteases (such as lysosomal or endosomal proteases), or sugar linkers, such as glucuronide-containing linkers that can be degraded by glucuronidase. Peptidyl linkers include dipeptides such as valine-citrulline, phenylalanine-lysine, or valine-alanine. Other suitable degradable linkers include, for example, pH-sensitive linkers (e.g., linkers that are hydrolyzed at a pH below 5.5, such as hydrazone linkers) and linkers that degrade under reducing conditions (e.g., disulfide bond linkers).Non-degradable linkers generally release the drug under conditions where the antibody is hydrolyzed by proteases.

[0038] The linker has a reactive group that can react with a specific amino acid residue until it is linked to the antibody, and the linkage is achieved by the reactive group. Sulfhydryl-specific reactive groups are preferred, such as maleimide compounds, halogenated amides (such as iodine, bromine, or chloro); halogenated esters (such as iodine, bromine, or chloro); halogenated methyl ketones (such as iodine, bromine, or chloro), benzyl halides (such as iodine, bromine, or chloro); vinyl sulfones, pyridyl disulfides; mercury derivatives such as 3,6-di-(mercurymethyl)dioxane, where the counterion is acetate, chloride, or nitrate; and polymethylene dimethyl sulfide thiosulfonate. The linker may include, for example, a maleimide linked to the antibody via thiosuccinimide. The drug may be any cytotoxic or immunosuppressive drug that inhibits cell proliferation. In some embodiments, the linker links the antibody to the drug, and the drug has a functional group that can be bound to the linker. For example, the drug may have an amino, carboxyl, sulfhydryl, hydroxyl, or ketone group that can form a bond with the linker. If the drug is directly linked to the linker, the drug will have a reactive group until it is linked to the antibody. Useful drug categories include, for example, antitubulin drugs, DNA minor groove binding agents, DNA replication inhibitors, alkylating agents, antibiotics, antifolates, antimetabolites, chemotherapy sensitizers, topoisomerase inhibitors, vinca alkaloids, and the like. Exemplary cytotoxic drugs include, for example, auristatins, camptothecins, duocarmycins, etoposide, maytansine and maytansinoids (e.g., DM1 and DM4), taxanes, benzodiazepines or benzodiazepine-containing drugs (e.g., pyrrolo[1,4]benzodiazepines (PBDs), indolinobenzodiazepines and oxazolidinobenzodiazepines, and vinca alkaloids.

[0039] As described herein, drug-linkers can be used to form ADCs in a simple one-step process. In other embodiments, bifunctional linker compounds can be used to form ADCs in two-step or multi-step processes. For example, a cysteine ​​residue is reacted with a reactive moiety on the linker in a first step, and a functional group on the linker is reacted with the drug in a second step to form the ADC. In general, the functional group on the linker is selected to facilitate specific reaction with an appropriate reactive group on the drug component. As a non-limiting example, an azide-based moiety can be used to react specifically with a reactive alkynyl group on the drug component. The drug is covalently attached to the linker by a 1,3-dipolar cycloaddition between the azide and the alkynyl group. Other useful functional groups include, for example, ketones and aldehydes (suitable for reacting with hydrazides and alkoxyamines), phosphines (suitable for reacting with azides); isocyanates and isothiocyanates (suitable for reacting with amines and alcohols); and activated esters such as N-hydroxysuccinimide esters (suitable for reacting with amines and alcohols). These linking strategies, and others such as those described in "Bioconjugation Technology", 2nd Edition (Elsevier), are well known to those of skill in the art. One of skill in the art will appreciate that when complementary pairs of reactive functional groups are selected for selective reaction between a drug moiety and a linker, each member of the complementary pair can be used for both the linker and the drug.

[0040] These antibodies can be used as a treatment for cancer (e.g., breast cancer, including triple-negative breast cancer [TNBC]) or other diseases that show elevated Progranulin expression. Triple-negative breast cancer is when the cancer cells do not have receptors for estrogen, progesterone and HER2 proteins. By the term "neutralizing", it is understood that the antibody has the ability to inhibit or block any biological activity of Progranulin that leads to tumorigenesis, including the ability to stimulate cell proliferation or induce tumor growth in experimental animals and humans. An effective amount of anti-Progranulin antibody is administered to a mammal, including a human, by various routes.

[0041] In some preferred embodiments, the present disclosure provides an isolated monoclonal antibody, such as a human monoclonal antibody, that binds to PGRN (preferably hu PGRN), preferably the antibody 10C8, 16C11, 14A6, or 10B3 (can be used in combination). In some preferred embodiments, the antibody is derived from a human antibody, human IgG, human IgG1, human IgG2, human IgG2a, human IgG2b, human IgG3, human IgG4, human IgM, human IgA, human IgA1, human IgA2, human IgD, human IgE, dog antibody, dog IgGA, dog IgGB, dog IgGC, dog IgGD, chicken antibody, chicken IgA, chicken IgD, chicken IgE, chicken IgG, chicken IgM, chicken IgY, goat antibody, goat IgG, mouse antibody, mouse IgG, pig antibody, rat antibody, llama antibody, alpaca antibody, shark antibody, and camel antibody. In some preferred embodiments, the present disclosure optionally comprises F ab , F ab2 , Fab' single chain antibody, F v The present invention provides a derivative of the antibody disclosed herein, which is selected from the group consisting of: single chain, monospecific antibody, bispecific antibody, trimeric antibody, multispecific antibody, multivalent antibody, chimeric antibody, dog-human chimeric antibody, dog-mouse chimeric antibody, dog Fc-containing antibody, humanized antibody, human antibody, caninized antibody, CDR-grafted antibody, shark antibody, and nanobody.

[0042] In some preferred embodiments, the present disclosure includes an immobilized detectable label, optionally the detectable label is fluorescein, DyLight, Cy3, Cy5, FITC, HiLyte Fluor 555, HiLyte Fluor 647, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein, 5-FAM, hydroxytryptamine, 5-hydroxytryptamine (5-HAT), 6-carboxyfluorescein (6-FAM), FITC, 6-carboxy-1,4-dichloro-2',7'-dichlorofluorescein (TET), 6-carboxy-1,4-dichloro-2',4',5',7'-tetrachlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-Dimethoxyfluorescein (6-JOE), Alexa Fluor, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 635, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, BODIPY fluorophores, BODIPY 492 / 515, BODIPY 493 / 503, BODIPY 500 / 510, BODIPY 505 / 515, BODIPY 530 / 550, BODIPY 542 / 563, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650-X, BODIPY 650 / 665-X, BODIPY 665 / 676, FL, FL ATP, FI-ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE, Rhodamine, Rhodamine 110, Rhodamine 123, Rhodamine B, Rhodamine B 200, Rhodamine BB, Rhodamine BG, Rhodamine B Extra, 5-Carboxytetramethylrhodamine (5-TAMRA), 5 Derivatives of the antibodies disclosed herein are provided that are selected from the group consisting of GLD, 6-carboxyrhodamine 6G, Lissamine, Lissamine rhodamine B, Phallicidine, Phalloidin, Rhodamine Red, Rhod-2,6-carboxy-X-rhodamine (ROX), Carboxy-X-rhodamine (5-ROX), Sulforhodamine B can C, Sulforhodamine G Extra, 6-carboxytetramethylrhodamine (TAMRA), Tetramethylrhodamine (TRITC), Rhodamine WT, Texas Red, and Texas Red-X.

[0043] In some preferred embodiments, the present disclosure provides a derivative of an antibody disclosed herein comprising an effector moiety linked thereto, optionally selected from the group consisting of a cytotoxic drug, a toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and a radiochemical, and optionally a cleavable linker disposed between the antibody and the effector moiety, which releases the effector moiety into or within a cell. In some preferred embodiments, the present disclosure provides an isolated polynucleotide encoding an antibody of the present disclosure, optionally wherein the nucleic acid sequence is disclosed herein, as well as an expression vector and a host cell comprising the same. In some preferred embodiments, the present disclosure provides a composition comprising at least an antibody or derivative disclosed herein; at least one isolated polynucleotide encoding such an antibody or derivative; or at least one expression vector comprising such a polynucleotide; and / or at least one host cell comprising such a polynucleotide and / or expression vector; or a combination thereof; and a pharmaceutically acceptable carrier.

[0044] In some preferred embodiments, the present disclosure provides methods for detecting PGRN on cells, comprising contacting a test biological sample with an antibody or derivative of the present disclosure and detecting antibody bound to the biological sample or a component thereof. In some embodiments, these methods comprise comparing the amount of binding to the test biological sample or a component thereof with the amount of binding to a control biological sample or a component thereof, where an increase in binding to the test biological sample or a component thereof compared to the control biological sample or a component thereof indicates the presence of cells expressing PGRN (preferably hu PGRN) in the test biological sample (e.g., the test biological sample is a mammalian cell, tissue, or blood). The method can be an in vivo method or an in vitro method.

[0045] In some preferred embodiments, the disclosure provides a method for treating, preventing and / or ameliorating cancer in a mammal, comprising administering to said mammal at least one effective dose of a pharmaceutical composition comprising an antibody or derivative of the disclosure. In some embodiments, the disclosure provides such an antibody comprising a cytotoxic effector moiety conjugated thereto, optionally said effector moiety being selected from the group consisting of a cytotoxic drug, a toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and a radiochemical. In some embodiments, such an antibody can comprise a cleavable linker disposed between the antibody and the effector moiety, said cleavable linker releasing the effector moiety into or within the cell. In some such embodiments, the antibody is administered as an antibody-drug conjugate. In some embodiments, multiple doses are administered to the animal, and / or the antibody is administered at a dosage of about 1-50 mg / kg.

[0046] The antibodies (e.g., polypeptides) and nucleic acids described herein may also be combined with one or more pharma- ceutically acceptable carriers prior to administration to a host. A pharma- ceutically acceptable carrier is a material that is not biologically or otherwise undesirable, e.g., the material may be administered to a subject without causing any undesirable biological effects or adversely interacting with any of the other components of the pharmaceutical composition in which it is contained. As is well known to those skilled in the art, the carrier will naturally be selected to minimize degradation of the active ingredient and to minimize adverse side effects in the subject. Suitable pharmaceutical carriers and their formulations are described, for example, in Remington's: The Science and Practice of Pharmacy, 21st Edition, edited by David B. Troy, Lippicott Williams & Wilkins (2005). Generally, an appropriate amount of a pharma- ceutical acceptable salt is used in the formulation to render the formulation isotonic. Examples of pharma- ceutical acceptable carriers include, but are not limited to, sterile water, saline, buffered solutions such as Ringer's solution, and dextrose solution. The pH of the solution is generally about 5 to about 8 or about 7 to about 7.5. Other carriers include sustained release formulations such as semipermeable matrices of solid hydrophobic polymers containing the polypeptide or fragments thereof. The matrices may be in the form of shaped articles, e.g., films, liposomes, or microparticles. It will be apparent to one of skill in the art that certain carriers may be more preferred depending, for example, on the route of administration and the concentration of the composition being administered. The carrier is one suitable for administration of the polypeptide and / or fragments thereof to humans or other subjects. In addition to the immunogenic polypeptide, the pharmaceutical composition may also include carriers, thickeners, diluents, buffers, preservatives, surfactants, adjuvants, immunostimulants. The pharmaceutical composition may also include one or more active ingredients, such as antibacterial agents, anti-inflammatory agents, and anesthetic agents. The pharmaceutical composition may be administered orally, parenterally, by inhalation spray, rectally, intranodally, or topically in unit dosage forms containing conventional pharma-ceutically acceptable carriers, adjuvants, and vehicles.The term "pharmaceutical acceptable carrier" or "physiologically acceptable carrier" as used herein refers to one or more formulation materials suitable for achieving or facilitating the delivery of a nucleic acid, a polypeptide, or a peptide as a pharmaceutical composition. A "pharmaceutical composition" is a composition that contains a therapeutically effective amount of a nucleic acid or a polypeptide. The terms "effective amount" and "therapeutically effective amount" each refer to the amount of an antibody, a nucleic acid, etc., used to find an optional therapeutic effect (e.g., elimination of PGRN-expressing cells, e.g., cancerous PGRN-expressing cells).

[0047] Also provided are methods for treating one or more disease conditions (e.g., cancer) in a mammalian host, comprising administering to said mammal at least one or more effective amounts of one or more of the antibodies (and / or derivatives thereof) described herein. In some embodiments, the antibody is a monoclonal antibody or fragment or derivative thereof that includes one or more combinations of the CDRs and / or variable regions of antibodies 10C8, 16C11, 14A6, or 10B3; an amino acid sequence as shown in Table 1 and / or encoded by a nucleotide sequence disclosed herein or as would be recognized by one of skill in the art; and / or substituted derivatives and / or fragments thereof; and in some embodiments, conservative substitution variants thereof. The one or more antibodies may be administered at a dosage of about 1 to about 50 mg / kg, about 1 to about 30 mg / kg, or about 5 to about 30 mg / kg (e.g., about any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, or 40 mg / kg). In certain embodiments, the one or more antibodies may be administered (e.g., intradermally, intravenously, orally, rectally) to the mammal one or more times at about 10 mg / kg. When multiple doses are administered, the doses may include about the same or different amounts of antibody in each administration. The administrations may also be separated in time from one another by the same or different intervals. For example, administration can be separated by about 6, 12, 24, 36, 48, 60, 72, 84, or 96 hours, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1.5 years, 2 years, 3 years, 4 years, 5 years, or any time period before, after, and / or between any of these periods. In some embodiments, the antibody may be administered together with other agents (e.g., anti-infectives and / or chemotherapeutic agents). Such other agents may be administered at about the same time as the antibody or at different times and / or frequencies. Other embodiments of such methods may also be suitable, as can be readily determined by one of skill in the art.

[0048] In some preferred embodiments, the disclosure provides a) a heavy chain variable region comprising the CDR sequences of SEQ ID NOs: 1, 2, and 3, respectively, and a light chain variable region comprising the CDR sequences of SEQ ID NOs: 4, 5, and 6; b) a heavy chain variable region comprising the CDR sequences of SEQ ID NOs: 7, 8, and 9, respectively, and a light chain variable region comprising the CDR sequences of SEQ ID NOs: 10, 11, and 12; and c) a heavy chain variable region comprising the CDR sequences of SEQ ID NOs: 13, 14, and 15, respectively, and a light chain variable region comprising the CDR sequences of SEQ ID NOs: 16, 17, and 18. d) heavy chain variable regions comprising the CDR sequences of SEQ ID NOs: 19, 20, and 21, respectively, and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 22, 23, and 24, respectively; e) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 1 to 3 and 7 to 9, respectively; f) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 4 to 6 and 10 to 12, respectively; g) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 13 and 14, respectively; h) CDR sequences of SEQ ID NOs: 15 to 17 and 21 to 23, respectively. i) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 18 to 20 and 24 to 26, respectively; j) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 27 and 28, respectively; k) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 29 to 31 and 35 to 37, respectively; l) heavy chain variable regions and light chain variable regions comprising the CDR sequences of SEQ ID NOs: 32 to 34 and 38 to 40, respectively; m) heavy chain variable regions comprising the CDR sequences of SEQ ID NOs: 41 and 42, respectively. The present invention provides an isolated antibody or an antigen-binding fragment thereof, which specifically binds to human Progranulin, comprising: a heavy chain variable region and a light chain variable region comprising the CDR sequences of SEQ ID NOs: 43 to 45 and 49 to 51, respectively; n) a heavy chain variable region and a light chain variable region comprising the CDR sequences of SEQ ID NOs: 43 to 45 and 49 to 51, respectively; o) a heavy chain variable region and a light chain variable region comprising the CDR sequences of SEQ ID NOs: 46 to 48 and 52 to 54, respectively; p) a heavy chain variable region and a light chain variable region comprising SEQ ID NO: 55 and SEQ ID NO: 56, respectively; or a derivative of any one of a) to p).In some preferred embodiments, the disclosure provides an isolated antibody or antigen-binding fragment thereof comprising: a) a heavy chain variable region comprising SEQ ID NO:25 and a light chain variable region comprising SEQ ID NO:27, respectively; b) a heavy chain variable region comprising SEQ ID NO:29 and a light chain variable region comprising SEQ ID NO:31, respectively; c) a heavy chain variable region comprising SEQ ID NO:33 and a light chain variable region comprising SEQ ID NO:35, respectively; or d) a heavy chain variable region comprising SEQ ID NO:37 and a light chain variable region comprising SEQ ID NO:39, respectively. In some preferred embodiments, the antibody is internalized in cells expressing hu PGRN in vitro and / or in vivo. In some preferred embodiments, the antibody competes with trastuzumab for binding to the hu PGRN receptor on cells. In some preferred embodiments, the antibody does not compete with trastuzumab for binding to the hu PGRN receptor on cells. In some preferred embodiments, the antibody is 10C8, 16C11, 14A6, and 10B3, or derivatives thereof. In some preferred embodiments, the disclosure provides such combinations of antibodies. In some preferred embodiments, the antibody is an isolated monoclonal antibody. In some preferred embodiments, the antibody is a human monoclonal antibody. In some preferred embodiments, the antibody is derived from a human antibody, human IgG, human IgG1, human IgG2, human IgG2a, human IgG2b, human IgG3, human IgG4, human IgM, human IgA, human IgA1, human IgA2, human IgD, human IgE, dog antibody, dog IgGA, dog IgGB, dog IgGC, dog IgGD, chicken antibody, chicken IgA, chicken IgD, chicken IgE, chicken IgG, chicken IgM, chicken IgY, goat antibody, goat IgG, mouse antibody, mouse IgG, pig antibody, rat antibody, llama antibody, alpaca antibody, shark antibody, and camel antibody. In some preferred embodiments, the antibody derivative is F. ab , F ab2 , Fab' single chain antibody, F v, single chain, monospecific antibody, bispecific antibody, trimeric antibody, multispecific antibody, multivalent antibody, chimeric antibody, dog-human chimeric antibody, dog-mouse chimeric antibody, antibody containing canine Fc, humanized antibody, human antibody, caninized antibody, CDR-grafted antibody, shark antibody, and nanobody. In some preferred embodiments, the antibody or derivative comprises an immobilized detectable label, optionally the detectable label is fluorescein, DyLight, Cy3, Cy5, FITC, HiLyte Fluor 555, HiLyte Fluor 647, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein, 5-FAM, hydroxytryptamine, 5-hydroxytryptamine (5-HAT), 6-carboxyfluorescein (6-FAM), FITC, 6-carboxy-1,4-dichloro-2',7'-dichloro-fluorescein (TET), 6-carboxy-1,4-dichloro-2',4',5',7'-tetra-chlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-Dimethoxy-Fluorescein (6-JOE), Alexa Fluor, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 635, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, BODIPY fluorophores, BODIPY 492 / 515, BODIPY 493 / 503, BODIPY 500 / 510, BODIPY 505 / 515, BODIPY 530 / 550, BODIPY 542 / 563, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650-X, BODIPY 650 / 665-X, BODIPY 665 / 676, FL, FL ATP, FI-ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE, Rhodamine, Rhodamine 110, Rhodamine 123, Rhodamine B, Rhodamine B 200, Rhodamine BB, Rhodamine BG, Rhodamine B Extra, 5-Carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-carboxyrhodamine 6G, Lissamine, Lissamine rhodamine B, Phallicidine, Phalloidin, Rhodamine Red, Rhod-2,The antibody or derivative may comprise an effector moiety linked thereto, optionally selected from the group consisting of a cytotoxic drug, a toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and a radiochemical. In some preferred embodiments, the antibody or derivative may comprise a cleavable linker disposed between the antibody and the effector moiety, the cleavable linker releasing the effector moiety into or within a cell. In some preferred embodiments, the present disclosure provides an isolated polynucleotide encoding an antibody disclosed herein, optionally having at least one nucleic acid sequence of SEQ ID NOs: 57-64. In some preferred embodiments, the polynucleotide may be an expression vector comprising one or more such polynucleotides. In some preferred embodiments, the disclosure provides a host cell comprising the isolated polynucleotide and / or expression vector. In some preferred embodiments, the disclosure provides a composition comprising at least any such antibody and / or derivative; at least one isolated polynucleotide encoding them; at least one expression vector comprising and / or encoding them; and / or at least one host cell comprising them; or any combination thereof; and a pharma- ceutically acceptable carrier.

[0049] In some preferred embodiments, the present disclosure provides a method for detecting hu PGRN (GP88) on a cell, comprising contacting a test biological sample with an antibody or derivative of the present disclosure and detecting it bound to the biological sample or a component thereof. In some preferred embodiments, the cell may be selected from the group consisting of breast cancer, adenocarcinoma epidermal growth factor receptor (EGF-R) breast cancer, basal breast cancer, estrogen receptor (ER) luminal breast cancer, ER positive tamoxifen resistant luminal breast cancer, letrozole resistant luminal breast cancer, biliary tract cancer, bladder cancer, brain cancer, glioblastoma, colon cancer, epidermoid carcinoma, squamous cell carcinoma, esophageal cancer, gastric cancer, hepatocellular carcinoma, renal cancer, laryngeal cancer, lung cancer, non-small cell lung cancer, lung adenocarcinoma, mesothelioma, myeloma / leukemia, ovarian cancer, prostate cancer, and uterine cancer cells. In some preferred embodiments, these methods may include comparing the amount of binding to a test biological sample or a component thereof with a biological sample or component thereof, where increased binding to the test biological sample or component thereof compared to the control biological sample or component thereof indicates the presence of cells expressing PGRN in the test biological sample. In some preferred embodiments, the test biological sample may be a mammalian cell, tissue, or blood. In some preferred embodiments, the method is an in vivo method or an in vitro method.

[0050] In some preferred embodiments, the present disclosure provides a method of treating, preventing and / or ameliorating cancer in a mammal, comprising administering to said mammal at least one effective dose of a pharmaceutical composition comprising an antibody or derivative of the present disclosure. In some preferred embodiments, the cancer is selected from the group consisting of breast cancer, adenocarcinoma epidermal growth factor receptor (EGF-R) breast cancer, basal breast cancer, estrogen receptor (ER) luminal breast cancer, ER positive tamoxifen resistant luminal breast cancer, letrozole resistant luminal breast cancer, biliary tract cancer, bladder cancer, brain cancer, glioblastoma, colon cancer, epidermoid carcinoma, squamous cell carcinoma, esophageal cancer, gastric cancer, hepatocellular carcinoma, renal cancer, laryngeal cancer, lung cancer, non-small cell lung cancer, lung adenocarcinoma, mesothelioma, myeloma / leukemia, ovarian cancer, prostate cancer, and uterine cancer. In some preferred embodiments, the antibody comprises a cytotoxic effector moiety attached thereto, optionally the effector moiety is selected from the group consisting of a cytotoxic drug, a toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and a radiochemical. In some preferred embodiments, the antibody further comprises a cleavable linker disposed between the antibody and the effector moiety, the cleavable linker releasing the effector moiety into or within the cell. In some preferred embodiments, the antibody is administered as an antibody-drug conjugate. In some preferred embodiments, multiple doses are administered to the animal and / or the antibody is administered at a dosage of about 1-50 mg / kg.

[0051] In some preferred embodiments, the disclosure provides a kit for detecting expression of hu PGRN in or on a cell, comprising an antibody or derivative according to any one of the preceding claims and instructions for use. In some preferred embodiments, the cell is selected from the group consisting of breast cancer, adenocarcinoma epidermal growth factor receptor (EGF-R) breast cancer, basal breast cancer, estrogen receptor (ER) luminal breast cancer, ER positive tamoxifen resistant luminal breast cancer, letrozole resistant luminal breast cancer, biliary tract cancer, bladder cancer, brain cancer, glioblastoma, colon cancer, epidermoid carcinoma, squamous cell carcinoma, esophageal cancer, gastric cancer, hepatocellular carcinoma, renal cancer, laryngeal cancer, lung cancer, non-small cell lung cancer, lung adenocarcinoma, mesothelioma, myeloma / leukemia, ovarian cancer, prostate cancer, and uterine cancer cells. In some preferred embodiments, the antibody or derivative is in lyophilized form. EXAMPLES

[0052] The following examples relate to the monoclonal antibodies described herein. Example 1. Discovery and isolation of high affinity fully human monoclonal antibodies against human progranulin Immune induction of humanized mouse TC-mAb™ with human recombinant his-tagged full-length progranulin. The characteristics of these mice have been published (Moriwaki, A. et al., Exp Cell Res 390(2): 111914, 2020). Human Ab-producing Tc mice (TC-mAb mice) stably maintain mouse-derived engineered chromosomes containing all human Ig heavy and kappa chain loci in a mouse Ig knockout background. Transchromosomic (Tc) mice carrying minichromosomes with human immunoglobulin (Ig) loci can contribute to the development of fully human therapeutic monoclonal antibodies (Abs) when immunized with an antigen of interest. In this case, TC-mAb mice were immunized with human recombinant progranulin. The titers of immunized mouse sera were confirmed by EIA (progranulin EIA) using human progranulin immobilized on nickel plates with HRP-conjugated goat anti-human Fc secondary antibody. The mouse with the highest anti-Progranulin titer was used to harvest splenic and lymph node B cells that had been fused by electroporation with mouse myeloma HL-1 cells. The fused hybridomas were seeded as single cells in semi-solid hybridoma culture medium D in 10 cm tissue culture plates. After 11 days, 1,726 single hybridoma clones were picked from the semi-solid medium plates and transferred to 96-well dishes in hybridoma culture medium E (one clone per well). After 3 days, the culture medium of the hybridoma clones was assayed by Progranulin EIA. This assay yielded a large number of clones. 184 clones showed OD 650 The OD of 387 clones was greater than 3.0. 650 The OD of clone 423 was 3.0 to 2.0. 650 OD of 2.0 to 1.0, 334 clones were 650 The OD was 1 to 0.5. 650The top 184 clones with >3.0 were transferred to 48-well plates for confirmatory screening by Progranulin EIA as described above. 170 clones were confirmed as strong positives. These clones were seeded in 6-well plates in duplicate in medium E. The cells were cryopreserved in appropriate culture conditions for long-term storage in liquid nitrogen, and the culture medium containing the secreted Ig was collected and stored for future evaluation and selection of the desired hybridomas. From these clones, 120 antibody-producing clones were prepared.

[0053] Example 2. Further antigen-binding characterization and selection of anti-Progranulin monoclonal antibody clones In vitro proliferation assay Culture media from selected clones were assayed for their ability to inhibit proliferation of TNBC cells MDA-MB-231 by inhibiting phosphorylation of ERK1 / 2 (p-ERK1 / 2) and AKT (p-AKT), which are well-known signaling molecules in the proliferation survival pathway of cells, including cancer cells. This assay has been described in Guha et al., 2021. Using this assay, it was shown that addition of AG01 dose-dependently inhibited phosphorylation of ERK1 / 2 (MAP kinase or MAPK) and the survival signaling molecule p-AKT. All human hybridoma clones that were positive for binding to progranulin by EIA were examined in this signaling molecule phosphorylation assay using MDA-MB-231 triple-negative breast cancer cells. Based on these assays, 45 clones showed inhibitory activity against p-ERK1 / 2, p-ACT or both at levels greater than 50% compared to control cells treated with human IgG as a control. By repeating the assay, the number of clones showing inhibition of p-ERK1 / 2 was further narrowed down to 38. The results are shown in Table 4. [Table 4-1] [Table 4-2] [Table 4-3]

[0054] Clones that produced antibodies that inhibited pERK1 / 2 and / or p-AKT by more than 50% are highlighted in gray. Next, the ability of these 45 clones to inhibit Progranulin binding to MDA-MB-231 cells in a dose-dependent manner was examined.

[0055] Progranulin Binding by Flow Cytometry Binding assays were performed on an INTELLICYT flow cytometer using the instructions contained herein. Additional binding assays were also performed, including the ability of anti-Progranulin antibodies to inhibit Progranulin binding to two cell lines, human embryonic kidney HEK-293 and TNBC MDA-MB-231, as well as several other cancer cells, such as the non-small cell carcinoma cell line H1299. Of the 45 mAbs assayed, 11 clones (shown in bold in Table 5) produced antibodies that were able to inhibit Progranulin binding in a dose-dependent manner. [Table 5]

[0056] Some antibodies that could block p-ERK1 / 2 in in vitro assays had little activity in inhibiting Progranulin binding or even stimulated Progranulin binding to cells. After further selection by combining several assays, four antibodies were examined. Figure 1 shows that human anti-Progranulin antibodies dose-dependently inhibited Progranulin binding to TNBC MDA-MB-231 cells with higher activity than AG01, except for 14A6, whose addition led to increased Progranulin binding in this assay.

[0057] Determination of binding affinity by Octet The binding of selected fully human antibodies to Progranulin was characterized using OctetRed96 BLI technology. The method is briefly described below. The assay was performed at 25°C. Preconditioning of the anti-human Fc capture (AHC) sensor before hydration (1 h) was performed by immersing the sensor in regeneration buffer followed by neutralization buffer (PBS) for three cycles. Anti-Progranulin was captured on the preconditioned biosensor with mAbs 20 μg / ml for 360 s. The sensor was then immersed in baseline buffer (PBS) similar to the Progranulin dilutions. The sensor was then immersed in Progranulin-containing wells for 420 s as indicated. The dissociation step was performed in assay buffer (PBS) for 600 s. K D is calculated by using the above experimental conditions. on and K. off The K of selected mAbs is shown in Table 6. D In particular, mAbs 16C11, 10B3, 10C8 and 14A6 show -9 K less than M D 10C8 has KD 4 x 10 -12 These four mAbs were determined to contain the IgG1 / κ isotype based on Iso-Gold Rapid Isotyping. [Table 6]

[0058] Monoclonal antibody binding to the AG01 epitope As a way to determine whether these mAbs have epitopes similar or overlapping with that of mAb AG01, experiments were performed to determine whether any of the selected fully human antibodies compete with AG01 for binding to Progranulin. This was done using Bio-Layer Interferometry on OctetRed96 according to the method described in Dafferner, A. et al., Chem Res Toxicol 30:1897-1910, 2017. Each clone was examined for simultaneous tandem binding of AG01, the test monoclonal, and Progranulin on OctetRed96. The assay was essentially performed by capturing AG01 on the AHC sensor or Progranulin on the HIS1K sensor, and the pairing or blocking ability of the test antibodies was tested. The results show that the four selected fully human Progranulin antibody clones bind to Progranulin previously occupied by AG01 without any interference. These data indicate that the four selected antibodies 16C11, 11C8, 10B3 and 14A6 bind to epitopes distinct from the epitope bound by AGO1. These results were confirmed using detailed surface plasmon resonance analysis of AGO1 and mAb 16C11 by Biacore using the method described by Myszka, D. et al. (Biophys J 75:583-59, 1998).

[0059] Example 3: Functional activity of anti-progranulin monoclonal antibodies Migration assay We followed the migration assay described in Guha et al., 2021. Eleven clones were examined in a transwell chamber migration assay to select the clone that best inhibited TNBC MDA-MB-231 cell migration in a dose-dependent manner compared to AG01 as a positive control. Six clones were further retained for their ability to dose-dependently inhibit MDA-MB-231 cell migration. The results in Figure 2 show that these mAbs can inhibit MDA-MB-231 cell migration at a similar, if not higher, level than AG01. Notably, the addition of fully human mAbs at 10 μg / ml inhibited MDA-MB-231 cell migration by 30–50%, whereas AG01 required a concentration of 50 μg / ml for a similar degree of migration inhibition (Guha et al., 2021).

[0060] Example 4: Effect of anti-progranulin monoclonal antibody on in vivo tumor formation Next, these mAbs with the highest affinity (16C11, 10C8, 10B3, and 14A6) were tested for their ability to inhibit tumor growth of MDA-MB-231 cells injected subcutaneously in the flank of female athymic nude mice in vivo. It has been shown that progranulin expression is associated with enhanced tumor formation (Tangkeangsirisin, Hayashi et al., 2004), and mice bearing TNBC tumors showed tumor growth inhibition when treated with the anti-progranulin antibody AG01 (Guha, et al., 2021). Therefore, using the method described in Guha, et al., 2021, we investigated the ability of fully human anti-progranulin antibodies to inhibit tumor growth of the TNBC cell line MDA-MB-231. Three antibodies were tested in these nude mice. All antibodies were assayed at a concentration of 5 mg / kg. Athymic female mice were injected with 10 6 MDA-MB-231 cells were injected subcutaneously. 3 When the mice reached 100 mg / kg, they were randomized into various test groups, 7 mice per group. Antibodies were injected intraperitoneally twice a week at a dose of 5 mg / kg. Tumor size was measured twice a week before antibody injections using calipers, and tumor volume was calculated from tumor dimensions. Figure 3 shows the effect of intraperitoneal injection of fully human antibodies on tumor volume determined on day 25 of treatment, compared to the AG01 positive control and human IgG negative control. The data show that the selected antibodies showed varying degrees of tumor inhibition compared to AG01, which was used as a positive control. These data indicate that the four selected antibodies are able to inhibit tumor growth of TNBC cell lines with equal or greater efficacy than mAb A01. Based on these data and the binding data of mAb 10C8, further comparison of the antitumor activity of mAb 10C8 and AGO1 was performed throughout the course of treatment. The graph in Figure 4 shows the tumor growth inhibition by 10C8 throughout the treatment period. 10C8 has twice the tumor inhibitory activity of AGO1 at the same dose of 5 mg / kg (P<0.006). Tumor growth was inhibited by 50% when 10C8 was injected twice a week compared to human IgG as a control.

[0061] Other embodiments will be apparent to one skilled in the art from consideration of the specification and instruction provided herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the present invention being indicated by the following claims.

Claims

1. a) a heavy chain variable (VH) region comprising the CDR sequences of SEQ ID NOs: 1, 2, and 3, and a light chain variable (VL) region comprising the CDR sequences of SEQ ID NOs: 4, 5, and 6, respectively; b) a heavy chain variable (VH) region comprising the CDR sequences of SEQ ID NOs: 7, 8, and 9, and a light chain variable (VL) region comprising the CDR sequences of SEQ ID NOs: 10, 11, and 12, respectively; c) a heavy chain variable (VH) region comprising the CDR sequences of SEQ ID NOs: 13, 14, and 15, and a light chain variable (VL) region comprising the CDR sequences of SEQ ID NOs: 16, 17, and 18, respectively; d) a heavy chain variable (VH) region comprising the CDR sequences of SEQ ID NOs: 19, 20, 21 and a light chain variable (VL) region comprising the CDR sequences of SEQ ID NOs: 22, 23, and 24, respectively; e) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 1-3 and 7-9, respectively; f) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 4-6 and 10-12, respectively; g) a heavy chain variable (VH) region and a light chain variable (VL) region comprising SEQ ID NO: 13 and SEQ ID NO: 14, respectively; h) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 15-17 and 21-23, respectively; i) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 18-20 and 24-26, respectively; j) a heavy chain variable (VH) region and a light chain variable (VL) region comprising SEQ ID NO:27 and SEQ ID NO:28, respectively; k) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 29-31 and 35-37, respectively; l) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 32-34 and 38-40, respectively; m) a heavy chain variable (VH) region and a light chain variable (VL) region comprising SEQ ID NO: 41 and SEQ ID NO: 42, respectively; n) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 43-45 and 49-51, respectively; o) heavy chain variable (V H ) and light chain variable (V L ) regions comprising the CDR sequences of SEQ ID NOs: 46-48 and 52-54, respectively; p) a heavy chain variable (VH) region and a light chain variable (VL) region comprising SEQ ID NO: 55 and SEQ ID NO: 56, respectively; or a derivative of any one of a) to p).

1. An isolated antibody or antigen-binding fragment thereof comprising:

2. a) a heavy chain variable (VH) region comprising SEQ ID NO:25 and a light chain variable (VL) region comprising SEQ ID NO:27; b) a heavy chain variable (VH) region comprising SEQ ID NO:29 and a light chain variable (VL) region comprising SEQ ID NO:31; c) a heavy chain variable (VH) region comprising SEQ ID NO: 33 and a light chain variable (VL) region comprising SEQ ID NO: 35; or d) a heavy chain variable (VH) region comprising SEQ ID NO: 37 and a light chain variable (VL) region comprising SEQ ID NO: 39; 2. The isolated antibody or antigen-binding fragment thereof of claim 1, comprising:

3. The antibody of claim 1 , which is internalized by cells expressing hu PGRN in vitro and / or in vivo.

4. The antibody of claim 1 , which competes with trastuzumab for binding to the hu PGRN receptor on the cell.

5. 2. The antibody of claim 1, selected from the group consisting of antibodies 10C8, 16C11, 14A6, and 10B3.

6. The antibody of claim 1 , which does not compete with trastuzumab for binding to the hu PGRN receptor on the cell.

7. 7. The antibody of claim 6, selected from the group consisting of antibodies 10C8, 16C11, 14A6, and 10B3.

8. 2. The antibody combination of claim 1, at least one antibody competes with trastuzumab for binding to the hu PGRN receptor on said cells; A combination wherein at least one antibody does not compete with trastuzumab for binding to the hu PGRN receptor on said cells.

9. The antibody of claim 1, which is an isolated monoclonal antibody.

10. The antibody of claim 9, wherein the monoclonal antibody is a human monoclonal antibody.

11. 2. The antibody of claim 1, wherein the antibody is derived from a human antibody, human IgG, human IgG1, human IgG2, human IgG2a, human IgG2b, human IgG3, human IgG4, human IgM, human IgA, human IgA1, human IgA2, human IgD, human IgE, dog antibody, dog IgGA, dog IgGB, dog IgGC, dog IgGD, chicken antibody, chicken IgA, chicken IgD, chicken IgE, chicken IgG, chicken IgM, chicken IgY, goat antibody, goat IgG, mouse antibody, mouse IgG, pig antibody, rat antibody, llama antibody, alpaca antibody, shark antibody, and camel antibody.

12. Optionally, F ab , F ab2 , Fab' single chain antibody, F v , single chain, monospecific antibody, bispecific antibody, trimeric antibody, multispecific antibody, multivalent antibody, chimeric antibody, canine-human chimeric antibody, canine-mouse chimeric antibody, canine Fc-containing antibody, humanized antibody, human antibody, caninized antibody, CDR-grafted antibody, shark antibody, and nanobody.

13. and an immobilized, detectable label, optionally the detectable label being selected from the group consisting of fluorescein, DyLight, Cy3, Cy5, FITC, HiLyte Fluor 555, HiLyte Fluor 647, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein, 5-FAM, hydroxytryptamine, 5-hydroxytryptamine (5-HAT), 6-carboxyfluorescein (6-FAM), FITC, 6-carboxy-1,4-dichloro-2',7'-dichlorofluorescein (TET), 6-carboxy-1,4-dichloro-2',4',5',7'-tetrachlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-Dimethoxyfluorescein (6-JOE), Alexa Fluor, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 635, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, BODIPY fluorophores, BODIPY 492 / 515, BODIPY 493 / 503, BODIPY 500 / 510, BODIPY 505 / 515, BODIPY 530 / 550, BODIPY 542 / 563, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650-X, BODIPY 650 / 665-X, BODIPY 665 / 676, FL, FL ATP, FI-ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X SE, TR, TR ATP, TR-X SE, rhodamine, rhodamine 110, rhodamine 123, rhodamine B, rhodamine B 200, rhodamine BB, rhodamine BG, rhodamine B extra, 5-carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-carboxyrhodamine 6G, lissamine, lissamine rhodamine B, phallicidin, phalloidin, rhodamine red, rhodamine-2,6-carboxy-X-rhodamine (ROX), carboxy-X-rhodamine (5-ROX), sulforhodamine B can C, sulforhodamine G extra, 6-carboxytetramethyl-rhodamine (TAMRA), tetramethylrhodamine (TRITC), rhodamine WT, Texas red, and Texas red-X.

14. 2. The antibody of claim 1, comprising an effector moiety attached thereto, optionally wherein the effector moiety is selected from the group consisting of a cytotoxic drug, a toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and a radiochemical.

15. 15. The antibody of claim 14, further comprising a cleavable linker disposed between the antibody and the effector moiety, the cleavable linker releasing the effector moiety into or within a cell.

16. 2. An isolated polynucleotide encoding the antibody or derivative of claim 1, optionally having at least one nucleic acid sequence of SEQ ID NOs: 57-64.

17. 17. An expression vector comprising one or more polynucleotides of claim 16.

18. A host cell comprising the isolated polynucleotide of claim 16.

19. A composition comprising at least one antibody or derivative according to claim 1 and a pharmaceutically acceptable carrier.

20. A composition comprising at least one isolated polynucleotide according to claim 16 and a pharmaceutically acceptable carrier.

21. A kit for detecting the expression of hu PGRN in or on a cell, comprising the antibody or derivative of claim 1 and instructions for use, Optionally, the antibody or derivative is in lyophilized form.

22. 22. The kit of claim 21, wherein the cells are selected from the group consisting of breast cancer, adenocarcinoma epidermal growth factor receptor (EGF-R) breast cancer, basal breast cancer, estrogen receptor (ER) luminal breast cancer, ER-positive tamoxifen-resistant luminal breast cancer, letrozole-resistant luminal breast cancer, biliary tract cancer, bladder cancer, brain cancer, glioblastoma, colorectal cancer, epidermoid carcinoma, squamous cell carcinoma, esophageal cancer, gastric cancer, hepatocellular carcinoma, renal cancer, laryngeal cancer, lung cancer, non-small cell lung cancer, lung adenocarcinoma, mesothelioma, myeloma / leukemia, ovarian cancer, prostate cancer, and uterine cancer cells.

Images