Improved cell lines and methods for the production of adeno-associated vectors

Abstract

The present invention relates to cell lines in which DNA fragmentation is inhibited, the use of cell lines in which DNA fragmentation is inhibited for the production of adeno-associated virus (AAV), related methods of producing AAV, and methods of producing AAV comprising exposing cells in which AAV is produced to an inhibitor of DNA fragmentation during the AAV production phase.

Description

[Technical field]

[0001] The present invention relates to cell lines in which DNA fragmentation is inhibited, the use of cell lines in which DNA fragmentation is inhibited for the production of adeno-associated virus (AAV), related methods of producing AAV, and methods of producing AAV comprising exposing cells in which AAV is produced to an inhibitor of DNA fragmentation during the AAV production phase. [Background technology]

[0002] In recent years, a rapid increase in the number of gene therapy trials and products based on adeno-associated virus (AAV) derived vectors has been observed. The advantages of AAV vectors in gene therapy include a favorable safety profile due to the fact that AAV is not pathogenic, i.e., not associated with any disease, stable expression of transgenes, and the ability to transduce dividing and non-dividing cells. However, all AAV-derived products must undergo extensive quality control (QC) to ensure their efficacy and safety.

[0003] A major challenge for the production of AAV-based preparations is the identification, characterization, and control of process- and product-related impurities that may occur in the already purified product. Impurities remaining after vector purification include residual amounts of chemical components, proteins, and nucleic acids derived from the cell culture system in which the vector product is produced. Nucleic acid impurities include residual DNA, particularly host cell DNA and / or plasmid DNA, which can exist in two forms: (1) as a nuclease-sensitive process-related contaminant, i.e., non-specifically co-purified with the desired AAV vector product; and (2) as a nuclease-resistant product-related contaminant, i.e., encapsidated in AAV particles. This latter type of product impurity cannot be removed by conventional "downstream processing" methods.

[0004] Residual DNA impurities pose a significant safety risk, as DNA can code for proteins or regulatory RNA and can themselves cause immunotoxicity via TLR9 activation. Thus, for example, the Food and Drug Administration (FDA) recommends levels of residual cell-matrix DNA to be less than 10 ng per dose, with a median DNA size of 200 bp or less.

[0005] Encapsidation of fragments of mammalian producer cell genomic DNA has been reported to occur at a frequency of 1%–3% of AAV genome-containing particles, but the mechanism of packaging of fragments of host cell DNA within AAV particles remains unknown.

[0006] Because of its high similarity to the desired vector product, it is difficult to eliminate AAV-packaged host cell DNA impurities by vector purification methods. Gradient centrifugation can remove AAV-packaged nucleic acid impurities that are significantly different in length from the vector genome. However, there is currently no general technical solution to avoid, reduce, and / or remove nucleic acid impurities associated with nuclease-resistant products. Summary of the Invention [Problem to be solved by the invention]

[0007] Thus, the technical problem underlying the present invention is to provide a means for avoiding, reducing and / or removing nucleic acid impurities associated with nuclease-resistant products.

[0008] The solution to the above technical problem is achieved by the embodiments characterized in the claims.

[0009] In particular, in a first aspect, the present invention relates to a cell line in which DNA fragmentation is inhibited. [Means for solving the problem]

[0010] In a preferred embodiment, the cell line in which DNA fragmentation is inhibited is used to produce adeno-associated virus (AAV). More preferably, the cell line in which DNA fragmentation is inhibited is an AAV producing cell line.

[0011] In a second aspect, the present invention relates to the use of a cell line in which DNA fragmentation is inhibited for the production of adeno-associated virus (AAV).

[0012] In a preferred embodiment, the cell line used for the production of AAV is an AAV producer cell line.

[0013] In a preferred embodiment, the DNA fragmentation is (i) DNA fragmentation caused by programmed cell death, or (ii) DNA fragmentation caused by caspase 3 / DFF40-induced DNA strand breaks.

[0014] In a preferred embodiment, the DNA fragmentation inhibited by the present invention is low molecular weight DNA fragmentation, for example DNA fragmentation resulting in DNA fragments of at most 20 kB (kilobases) in length.

[0015] In particular, the production of recombinant AAV requires the expression of AAV Rep and Cap proteins, which are usually encoded by the AAV genome, for the production of recombinant virus supplied in trans. In addition, helper genes are used that can be obtained from different helper viruses, most commonly helper virus genes such as E1A, E1B, E2A, E4orf6, or VA RNA from adenovirus (AV) or helper virus genes from herpes simplex virus. In addition, a transfer vector is required that contains the gene of interest (GOI) flanked by AAV inverted terminal repeats (ITRs).

[0016] The most common system for recombinant AAV production utilizes the introduction of all genes required for AAV production into producer cells by transient transfection. Transient transfection usually requires a two- or three-plasmid system: a transfer vector containing the gene of interest; pHelper, which provides adenovirus helper functions; and pAAV-Rep2CapX, which provides capsid and replicase functions (CapX = capsid functions for various AAV serotypes).

[0017] Alternatively, some or all of the genes necessary for AAV production may be stably integrated into the host cell genome.

[0018] Thus, the term "AAV-producing cell line" as used herein relates to any cell line in which some or all of the genes encoding the components required for the production of AAV are either transiently expressed in said cell line or stably integrated into the cellular genome. Furthermore, the term "cell line used to produce AAV" as used herein relates to any cell line capable of producing detectable amounts of AAV.

[0019] Preferably, the genes encoding the components required for AAV production are selected from the group consisting of genes encoding AAV Cap proteins VP1, VP2, and VP3; genes encoding AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding adenovirus helper functions E4orf6, E2A, and VA-RNA; genes encoding Ad5 helper genes E1A and E1B; and a gene of interest (GOI) flanked by AAV inverted terminal repeats (ITRs). More preferably, the genes encoding the components required for AAV production include genes encoding AAV Cap proteins VP1, VP2, and VP3; genes encoding AAV Rep proteins Rep78 or Rep68; genes encoding AAV Rep proteins Rep52 or Rep40; genes encoding adenovirus helper function E4orf6, and a gene of interest (GOI) flanked by AAV ITRs. In certain embodiments, the genes encoding components necessary for production of AAV further include at least one, at least two, at least three, at least four, at least five, or all of the following: genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; and genes encoding the adenovirus helper functions E2A, VA-RNA, and DBP (DNA binding protein); and genes encoding the Ad5 helper genes E1A and E1B.

[0020] Thus, in certain embodiments, in an AAV producing cell line according to the invention, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, or all of the following genes are transiently expressed in said cell line or stably integrated into the cellular genome: genes encoding the AAV Cap proteins VP1, VP2, and VP3; A gene encoding one or both of the AAV Rep proteins Rep78 or Rep68; a gene encoding one or both of the AAV Rep proteins Rep52 or Rep40; A gene of interest (GOI) flanked by AAV ITRs; and Optionally, genes encoding any one, any two, any three, or all of the adenoviral helper functions E1A, E1B, DBP, E4orf6, and E2A.

[0021] In related specific embodiments, in an AAV producer cell line according to the invention, the following genes are either transiently expressed in said cell line or stably integrated into the host cell genome: (i) a gene encoding the AAV Cap proteins VP1, VP2, and VP3; a gene encoding the AAV Rep proteins Rep78 or Rep68; a gene encoding the AAV Rep proteins Rep52 or Rep40; and a gene of interest (GOI) flanked by AAV ITRs; or (ii) a gene encoding the AAV Cap proteins VP1, VP2, and VP3; a gene encoding the AAV Rep proteins Rep78 or Rep68; a gene encoding the AAV Rep proteins Rep52 or Rep40; a gene encoding the adenoviral helper function E4orf6, and a gene of interest (GOI) flanked by AAV ITRs; or (iii) a gene encoding the AAV Cap proteins VP1, VP2, and VP3; a gene encoding the AAV Rep proteins Rep78 or Rep68; a gene encoding the AAV Rep proteins Rep52 or Rep40; a gene encoding the adenoviral helper functions E4orf6 and E2A, and a gene of interest (GOI) flanked by AAV ITRs; or (iv) a gene encoding the AAV Cap proteins VP1, VP2, and VP3; a gene encoding the AAV Rep proteins Rep78 or Rep68; a gene encoding the AAV Rep proteins Rep52 or Rep40; a gene encoding the adenoviral helper functions E1A, E1B, E4orf6, and E2A, and a gene of interest (GOI) flanked by AAV ITRs; or (v) genes encoding the AAV Cap proteins VP1, VP2, and VP3; genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding the adenoviral helper functions E4orf6 and E2A; and a gene of interest (GOI) flanked by AAV ITRs; (vi) genes encoding the AAV Cap proteins VP1, VP2, and VP3; genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding the adenoviral helper functions E1A, E1B, E4orf6, and E2A; and a gene of interest (GOI) flanked by AAV ITRs; (vii) a gene encoding the AAV Cap proteins VP1, VP2, and VP3; a gene encoding the AAV Rep proteins Rep78 or Rep68; a gene encoding the AAV Rep proteins Rep52 or Rep40; a gene encoding the adenoviral helper functions E4orf6 and DBP, and a gene of interest (GOI) flanked by AAV ITRs; or (viii) a gene encoding the AAV Cap proteins VP1, VP2, and VP3; a gene encoding the AAV Rep proteins Rep78 or Rep68; a gene encoding the AAV Rep proteins Rep52 or Rep40; a gene encoding the adenoviral helper functions E1A, E1B, E4orf6, and DBP, and a gene of interest (GOI) flanked by AAV ITRs; or (ix) genes encoding the AAV Cap proteins VP1, VP2, and VP3; genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding the adenoviral helper functions E4orf6 and DBP; and a gene of interest (GOI) flanked by AAV ITRs; or (x) genes encoding the AAV Cap proteins VP1, VP2, and VP3; genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding the adenoviral helper functions E1A, E1B, E4orf6, and DBP; and a gene of interest (GOI) flanked by AAV ITRs.

[0022] The AAV in the present invention is not limited to a specific AAV serotype.Therefore, the AAV can be selected from any AAV serotype, such as AAV serotype 1 (AAV1), AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, AAVDJ8, AAVrhlO, a hybrid of two or more different serotypes, and a serotype with a mutation that changes the tropism of the AAV serotype.Preferably, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV8, and AAV9, with AAV8 being particularly preferred.

[0023] The cell line according to the present invention may be any suitable cell line known in the art, however, in a preferred embodiment, said cell line is selected from the group consisting of CAP cells, AGE1.hn, HEK293, PER.C6, NSO1, COS-7, BHK, CHO, CV1, VERO, HeLa, MDCK, BRL3A, W138 and HepG2 cells, with CAP cells or HEK293 cells being particularly preferred.

[0024] According to the invention as defined in the first and second aspects above, encapsidation of host cell DNA is inhibited by DNA fragmentation, preferably low molecular weight DNA fragmentation, which can be caused, for example, by (i) programmed cell death or (ii) caspase 3 / DFF40 induced DNA strand breaks in cells used for AAV production.

[0025] As used herein, the term "programmed cell death" includes apoptosis, parthanatos, and pyroptosis. Thus, as used herein, the term "DNA fragmentation caused by programmed cell death" includes apoptotic DNA fragmentation, parthanatos DNA fragmentation, and pyroptosis DNA fragmentation, where apoptotic DNA fragmentation is particularly relevant to the present invention.

[0026] Preferably, inhibition of DNA fragmentation includes any direct or indirect inhibition of endonucleases.For example, direct inhibition of endonucleases may be achieved by genetic modification, chemical inhibition, protein depletion of endonucleases such as (among others) DFF40 (DNA fragmentation factor 40; also known as CAD (caspase-activated DNase), DFFB (DNA fragmentation factor subunit beta)), ENDOG (endonuclease G) and DNASE1L3, while indirect mechanisms include genetic modification, chemical inhibition, protein depletion, mutation, synthetic misregulation of upstream regulators of the above endonucleases such as (among others) DFF45 (DNA fragmentation factor 45; also known as ICAD (inhibitor of caspase-activated DNase), DFFA (DNA fragmentation factor subunit alpha)), caspase 3, caspase 7, granzyme B and caspase 9.

[0027] Thus, in certain embodiments, inhibition of DNA fragmentation encompasses direct or indirect inhibition of an endonuclease by genetic modification.

[0028] For example, each genetic modification capable of achieving inhibition of DNA fragmentation by one or more of the above mechanisms may be (a) knockout of one or more genes selected from the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (b) expression of one or more RNA silencing factors directed to one or more genes selected from the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (c) expression of an RNase H activator or an antisense RNA oligonucleotide that blocks translation initiation or elongation of the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (d) expression of one or more dominant negative mutants of the caspase-3, DFF40, and / or ENDOG genes; (e) Strong overexpression of wild-type or caspase-resistant DFF45; (f) expression of intrabodies and similar mechanisms that target caspase-3, DFF40, and / or mitochondrial endonuclease G at the protein level; (g) transcriptional silencing at the promoters of caspase-3, DFF40, and / or ENDOG; (h) epigenetic silencing by targeted DNA methylation or histone modification of the promoters of the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (i) exon skipping by U7smOpt, antisense oligonucleotides (AONs), or splice switching oligonucleotides (SSOs) against DFF40, CASP3, or ENDOG pre-mRNA; and (j) a mechanism selected from the group consisting of, for example, an inhibitory isoform shift of DFF45 due to a decrease in ASF / SF2.

[0029] Each of the means of gene knockout, expression of RNA silencing factors, expression of dominant negative mutants of certain proteins, such as overexpression of wild type or caspase-resistant DFF45, expression of intrabody, transcriptional silencing, epigenetic silencing by DNA methylation or histone modification, exon skipping by U7smOpt, antisense oligonucleotide (AON), or splice switching oligonucleotide (SSO), and inhibitory isoform conversion are not particularly limited and are known in the art. For example, expression of RNA silencing factors includes expression of suitable microRNA (miRNA), small interfering RNA (siRNA), piwi-binding RNA (piRNA), or repeat-associated small interfering RNA (rasiRNA), as known in the art.

[0030] In other specific embodiments, inhibition of DNA fragmentation encompasses direct or indirect inhibition of the endonuclease by chemical inhibition.

[0031] According to such embodiments, inhibition of DNA fragmentation is not achieved endogenously, i.e., by genetic modification of the cells producing AAV, but rather exogenously, i.e., by exposing the cells producing AAV to an inhibitor of DNA fragmentation, for example, during the AAV production phase, (i) an inhibitor of the apoptosis, parthanatos, and / or pyroptosis pathways, or (ii) an inhibitor of caspase 3 / DFF40-induced DNA strand breaks.

[0032] Chemical inhibitors of DNA fragmentation are not particularly limited and are known in the art. However, in preferred embodiments of all of the above aspects of the invention, the inhibitors of DNA fragmentation are selected from the group consisting of Z-VAD-fmk (Z-Val-Ala-Asp fluoromethylketone; CAS No. 161401-82-7); Z-IETD-fmk (Z-Ile-Glu-Thr-Asp; CAS No. 210344-98-2); Z-DEVD-fmk (Z-Asp-Glu-Val-Asp; CAS No. 210344-98-2); 4-95-9;PNR-3-80(5-((1-(2-naphthoyl)-5-chloro-1H-indol-3-yl)methylene)-2-thioxodihydro-pyrimidine-4,6(1H,5H)-dione);PNR-3-82(5-((1-(2-naphthoyl)-5-methoxy-1H-indol-3-yl)methylene)-2-thioxodihydropyrimidine-4,6(1H,5H)-dione);Zn 2+ ions; EDTA (ethylenediaminetetraacetic acid); adezmapimod (SB203580; 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-1H-imidazole; CAS number 152121-47-6); and proteolytic targeting chimeras (PROTACs) directed against caspase-3, DFF40, and / or mitochondrial endonuclease G, with Z-VAD-fmk being particularly preferred.

[0033] Each chemical inhibitor can be added to cells in the AAV production method from 5 days before the start of AAV production to 2 days after the start of AAV production. The appropriate concentration range is not particularly limited and is known in the art. This includes, for example, a range of 0.5 to 20 μg / ml, preferably 10 to 20 μg / ml, for Z-VAD-fmk, Z-IETD-fmk, or Z-DEVD-fmk.

[0034] In this case, PROTACs are heterobifunctional small molecules composed of two active domains and a linker that can remove specific undesirable proteins. PROTACs work by inducing selective intracellular protein degradation and are composed of two covalently linked protein-binding molecules, one capable of binding to an E3 ubiquitin ligase and the other bound to a target protein for degradation. Recruitment of the E3 ligase to the target protein triggers the ubiquitination of the target protein and its subsequent degradation by the proteasome.

[0035] In certain embodiments, DNA fragmentation is inhibited by overexpression of one or more enzymes involved in DNA repair, such as DNA repair enzymes, and / or enzymes that inhibit DFF40. Enzymes relevant in this regard include PARP1 (poly[ADP-ribose]polymerase 1), DNA ligase IV, BRCA1, BRCA2, FEN1, ligase III, MRE11, NBS1, and XRCC1.

[0036] In a third aspect, the present invention relates to a method for producing AAV comprising the step of producing AAV in a cell line as defined above for the first and second aspects of the invention.

[0037] Methods for producing AAV in a given cell line are not particularly limited and are known in the art.

[0038] In a fourth aspect, the present invention relates to a method for producing adeno-associated virus (AAV), comprising exposing a cell producing AAV to an inhibitor of DNA fragmentation during the AAV production phase.

[0039] According to this aspect of the invention, inhibition of DNA fragmentation is not achieved endogenously, i.e., by genetic modification of the cells producing AAV, but rather exogenously, i.e., by exposing the cells producing AAV to an inhibitor of DNA fragmentation, for example (i) an inhibitor of the apoptosis, parthanatos, and / or pyroptosis pathways, or (ii) an inhibitor of caspase 3 / DFF40-induced DNA strand breaks, during the AAV production phase.

[0040] The chemical inhibitors of DNA fragmentation are not particularly limited and are known in the art, however, in preferred embodiments of all of the above aspects of the invention, the inhibitors of DNA fragmentation are as defined above.

[0041] Each chemical inhibitor can be added to cells in the AAV production method from 5 days before the start of AAV production to 2 days after the start of AAV production. The appropriate concentration range is not particularly limited and is known in the art. This includes, for example, a range of 0.5 to 20 μg / ml, preferably 10 to 20 μg / ml, for Z-VAD-fmk, Z-IETD-fmk, or Z-DEVD-fmk, as defined above.

[0042] Gene editing techniques known in the art provide completely irreversible gene knockouts or modifications, allowing the generation of new completely stable gene knockout and site-specific gene modified cell lines.

[0043] Particularly preferred in the present invention is, on the one hand, direct or indirect inhibition of the endonuclease by chemical inhibition as defined above in the first, second and third aspects of the invention, and, on the other hand, direct or indirect inhibition of the endonuclease by genetic modification as defined above in all aspects of the invention.

[0044] As used herein, the term "comprising" / "comprises" expressly includes the terms "consisting essentially of" / "consists essentially of" and "consisting of" / "consists of", i.e., all of said terms are interchangeable herein.

[0045] Furthermore, as used herein, the term "about" refers to a range of preferably ±10%, more preferably ±8%, ±6%, ±5%, ±4%, ±3%, ±2%, ±1%, or ±0.5% of a particular value. Thus, by way of example, the term "about 100" can include ranges of 90-110, 92-108, 94-106, 95-105, 96-104, 97-103, 98-102, 99-101, or 99.5-100.5.

[0046] The present invention surprisingly identifies DNA fragmentation as the major cause of contamination associated with nuclease-resistant products due to host cell DNA.

[0047] The present invention advantageously prevents or reduces packaging of host cell DNA during AAV particle production in the host cell, thereby significantly reducing contaminants associated with nuclease-resistant products. In particular, the present invention reduces packaging of host cell DNA by inhibiting DNA fragmentation, preventing or reducing nuclease-resistant contaminants of AAV products while they are still being produced, without affecting AAV particle production in the host cell.

[0048] During AAV particle production in human host cells, the production process itself kills the host cells, this death occurring, inter alia, by programmed cell death.

[0049] Packaging of wild-type AAV genomes occurs in the nucleus of infected cells and is mediated by the AAV Rep78 protein, which crosslinks Rep-binding elements (RBEs) located in the inverted terminal repeats (ITRs) associated with the vector genome to sites adjacent to pores on the surface of preformed AAV empty capsids, thus mediating translocation of single-stranded DNA vector genomes into preformed capsids. However, Rep78 expression causes activation of caspase-3, inducing apoptotic cell death and cell cycle disruption.

[0050] Apoptosis is a form of programmed cell death that occurs in multicellular organisms and is controlled by a series of cysteinyl-aspartic acid-specific proteases (caspases) that can be triggered by intrinsic and extrinsic stimuli. Once activated, caspases execute an irreversible cascade of apoptotic cell death. Major morphological changes during the apoptotic process include cell and nuclear shrinkage, chromatin condensation, internucleosomal cleavage of chromosomal DNA, formation of apoptotic bodies, and phagocytosis by neighboring cells.

[0051] During apoptosis, host cell DNA is degraded into defined pieces by so-called endonucleases. The process of DNA fragmentation is controlled, among other things, by the cleavage of ICAD (inhibitor of caspase-activated DNase), which is activated by caspase-3, and the subsequent activation of the nuclease CAD (caspase-activated DNase; DFF40). The cleavage of genomic DNA by these endonucleases occurs especially between nucleosomes, generating DNA fragments of about 180 base pairs in length and multiples thereof.

[0052] Apoptotic DNA fragmentation is mediated by DNA fragmentation factor (DFF), a heterodimeric protein composed of DFF45 (ICAD) and DFF40 (CAD). DFF40 contains intrinsic DNase activity, whereas DFF45 acts as an inhibitor of DFF40 activity. After apoptosis activation, caspase-3 cleaves DFF45, which dissociates from DFF40 and cleaves DNA into oligonucleosomal long fragments (180 bp apart) known as the "apoptotic ladder" as visualized by agarose gel electrophoresis.

[0053] Thus, the present invention advantageously reduces product-associated impurities and improves product quality. Moreover, in doing so, the present invention improves viral genome packaging and increases the percentage of intact capsids. Furthermore, the present invention increases host cell viability, resulting in increased productivity.

[0054] Unlike process-related impurities, i.e. non-encapsidated DNA contamination, which can be greatly reduced by downstream purification, encapsidated host cell DNA cannot be removed without destroying the product itself. However, encapsidated DNA is a more dangerous type of impurity, since it is efficiently delivered to the nucleus of the target cell. This can have a number of adverse effects: 1. Tumorigenesis: Random integration of DNA from producer cells in patient cells can disrupt tumor suppressor genes, disrupt cell cycle control, and cause uncontrolled cell proliferation. Conversely, transfer of functional DNA sequences (e.g. DNA segments encoding promoter elements or miRNAs) from producer cells can activate dormant DNA sequences or deregulate the transcriptome. 2. Immunotoxicity: Random integration into coding sequences can lead to de novo expression of immunoreactive neoepitopes (with or without frameshifting). 3. Apoptotic cell death: Free DNA can activate the DNA damage response and trigger apoptosis, a particular problem in neurodegenerative diseases where the very treatment appears to block apoptosis. 4. For example, inflammatory responses mediated by intracellular dsDNA sensing via the cGAS-STING pathway. [Brief description of the drawings]

[0055] [Figure 1] Figure 1 shows the fragment length distribution of AAV encapsidated DNA aligning to a) host cell DNA or b) the rAAV genome (1800 bp). The y-axis represents the fragment frequency and the x-axis represents the corresponding read length in bp. [Diagram 2] Figure 1. Fragment length distribution of AAV encapsidated DNA aligning to host cell DNA. The y-axis represents the frequency of fragments and the x-axis represents the corresponding read length in bp. Dashed lines represent the maximum of individual peaks in the fragment distribution (Peak 1 = 181 bp, Peak 2 = 325 bp, Peak 3 = 507 bp, Peak 4 = 708 bp). [Figure 3A] Figure 1 shows the viability of stable producer clone 1 and stable producer clone 2 induced with different concentrations of Z-VAD-fmk. Stable producer clones 1 (upper panel) and 2 (lower panel). Relative viable cell density (black diamonds) and viability (black circles) measured at different time points (hours) after induction and supplementation. Z-VAD-fmk concentrations ranging from 10 μg / ml (black) to 2.5 μg / ml (dark grey) and even 0 μg / ml (light grey) and DMSO treatment (lightest grey). [Figure 3B]Figure 1 shows the viability of stable producing clone 1 and stable producing clone 2 induced with various concentrations of Z-VAD-fmk. Top panel: Relative viable cell density (grey bars) and viability (black dots) 4 days after induction / transfection of the CAP alpha cell line in a semi-transient AAV production setup with different concentrations of Z-VAD-fmk. 1: no Z-VAD-fmk; 2: 2 μM; 3: 5 μM; 4: 10 μM; 5: 20 μM Z-VAD-fmk. Bottom panel: stable packaging pool not transfected with cargo plasmid. Measured 72 hours after transfection. Viability indicated by black circles. 1: no Z-VAD-fmk; 2: 10 μM Z-VAD-fmk; 3: 20 μM Z-VAD-fmk; 4: DMSO; 5: 10 μM camptothecin; 6: 10 μM camptothecin + 20 μM Z-VAD-fmk. [Figure 4A] Inhibition of apoptotic DNA fragmentation reduces the amount and packaging of hcDNA. Page 1: Sensitivity test of the Sub-G1 DNA-fragmentation assay (Chemometec) using overnight camptothecin treatment (10 μM) on parental CAP cells. M1 population % is the % of pan-DNA staining. Page 2: Mixture curves of apoptotic DNA fragmentation determined by the same assay with Z-VAD-fmk (right) and control samples (left, induction only) after 0 h (black curve), 18 h (dark grey) and 44 h (light grey). [Figure 4B]Figure 1: Inhibition of apoptotic DNA fragmentation reduces the amount and packaging of hcDNA. Page 1: Relative occupancy [%] of encapsidated hcDNA in transient and stable AAV8 producers at 3 days after induction (transient transfection) and 5 days after induction (stable clones). Odd bars: no Z-VAD-fmk; even bars: Z-VAD-fmk 10 μg / ml; 1-6: transiently transfected CAP cells; 1+2: Rep / Cap+cargo 1; 3+4: Rep / Cap+cargo 2; ​​5+6: Rep / Cap, no cargo. 7+8: HEK293 transiently transfected with Rep / Cap+cargo 1; 9+10: stable producing clone 1, no transfection; 11: background assay control. Encapsidated hcDNA was measured relative to untreated controls, each set to 100%. Page 2: Fold difference in hcDNA concentration over time [hours] in raw AAV production using stable producing clone 1 (light grey line) normalized to Z-VAD-fmk 10 μg / ml (dark grey line) as determined by ALU qPCR. [Figure 4C]Inhibition of apoptotic DNA fragmentation reduces the amount and packaging of hcDNA. Page 1: Relative capsid levels compared to camptothecin as determined by ELISA in stable producing clone 1 and transiently transfected HEK293 suspension cells at various Z-VAD-fmk concentrations. Samples were taken 5 days after induction. 1: Untreated control; 2: HEK293 + Z-VAD-fmk 20 μM; 3: HEK293 + Z-VAD-fmk 40 μM; 4: Stable producing clone 1 + Z-VAD-fmk 20 μM; 5: Stable producing clone 1 + Z-VAD-fmk 40 μM; 6: Stable producing clone 1 + DMSO; 7: Stable producing clone 1 + camptothecin 10 μM. Page 2: Corresponding host cell DNA per capsid as determined by ALU qPCR, normalized to untreated control. Relative occupancy is indicated above the bars. 1: untreated control; 2+3: HEK293; 2: Z-VAD-fmk 20 μM; 3: Z-VAD-fmk 40 μM; 4-7: stable producing clone 1; 4: Z-VAD-fmk 20 μM; 5: Z-VAD-fmk 40 μM; 6: DMSO; 7: camptothecin 10 μM. [Diagram 5] Figure 1 shows the percentage of viral genomes containing capsids upon treatment with Z-VAD-fmk. Effect of Z-VAD-fmk on semi-transient transfection of stable packaging pool or full transient transfection of CAP cells. Vg / ml measured by qPCR and normalized to untreated samples (grey bars) and viral genomes normalized to the amount of capsid determined by ELISA (black diamonds). Odd: untreated control; Even: Z-VAD-fmk 20 μM; 1-4: AAV8 packaging pool; 1+2: cargo 1; 3+4: cargo 2; ​​5-8: CAP (full transient); 5+6: cargo 1, 7+8: cargo 2 [Figure 6]Figure 1. Knockout of DFF40 in an AAV producer cell line. PCR amplicon of the DFF40 gene from DNA of an AAV producer cell line expressing wild-type DFF40 (lane 1). PCR amplicon of the same segment in a pool of knockout cells based on the same producer cell line (lane 2). DFF40 allele with an internal deletion sequence visible as several low molecular weight bands. Clonal cell line derived from the knockout pool with no detectable amplicon corresponding to the DFF40 wild-type allele (lane 3). [Figure 7] Quantification of encapsidated hcDNA. Relative amounts of encapsidated hcDNA in the DFF40-WT AAV producing cell line (lane 1), the DFF40 knockout pool (lane 2), and the DFF40 knockout single cell clone (lane 3). The amount of hcDNA is indistinguishable from the background control (lane 4). [Figure 8] Figure 14. Viral titers in DFF40 KO cells remained unchanged. Normalized titers [%] of packaged viral genomes compared between the DFF40-WT AAV producer cell line (lane 1), the DFF40 knockout pool (lane 2), and the DFF40 knockout single-cell clone (lane 3). [Figure 9] siRNA knockdown of DFF40 and other apoptotic genes. Relative amounts of encapsidated hcDNA in stable AAV producer cells transfected with siRNA targeting the genes DFF40 (3), CASP3 (4), CASP8 (5), and AIFM1 (6) normalized to mock-transfected controls (1) compared to non-transfected but ZVAD-fmk-treated cells (2). [Figure 10]Figure 1. End-point PCR for detection of encapsidated hcDNA. HEK293 wt cells (1-4), DFF40 KO pools (5-6), and DFF40 KO single cell clones (11, 12, 13) were transfected with either cargo 3 (1, 3, 5) or cargo 1 (2, 4, 6, 11, 12, 13), treated with ZVAD-fmk (3, 4), or left untreated (1, 2, 5, 6, 11, 12, 13). Purified HEK293 DNA, with (8) or without (7, 11) DNase treatment, was used as PCR control (7, 8), while a no template control (9) was used as PCR negative control. DNA marker 1 kb plus (ThermoFisher) (10). [Figure 11] Figure 1 shows overexpression plasmid constructs. Schematic diagram of overexpression constructs used. (A) Wild-type PARP1 (NM_001618.4) and single mutant form of DFF45 (NM_004401.3) (D117E) were cloned into mammalian expression vector pcDNA3.1(+) (ThermoFischer) and shown as "insert" in the schematic. (B) Mutation of amino acid 117 in the DFF45 gene from aspartic acid (D; GAC (SEQ ID NOs: 9 and 10)) to glutamic acid (E; GAG (SEQ ID NOs: 11 and 12)) results in a caspase-resistant isoform. [Figure 12] Figure 1. Overexpression of anti-apoptotic genes to reduce hcDNA encapsidation in AAV production. Stably inducible AAV producing cells were transfected with an empty expression plasmid (2), a plasmid encoding PARP1 (3), or DFF45 (D117E) (4). Encapsidated hcDNA was measured and compared to untransfected cells that were either uninduced (6) or induced (1,5) and Z-VAD-fmk treated (5). [Figure 13]Figure 1. Inhibition of hcDNA encapsidation using MAPK-inhibitors. Compared to vehicle-treated controls (DMSO, 1), treatment of stably inducible AAV-producing cells with the p38 inhibitor adetumapimod reduced hcDNA encapsidation when used at final concentrations of 30 μM (2) and 60 μM (3). The effect of 60 μM was comparable to Z-VAD-fmk-treated (4) and uninduced samples (5). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0056] The present invention relates to the following nucleotide sequences: SEQ ID NO:1 SV40 PolyA Primer Forward 5'-AGCATAGCATCACAAATTTCACAA-3' SEQ ID NO:2 SV40 polyA primer reverse 5'-CCAGACATGATAAGATACATTGATGAGTT-3' SEQ ID NO:3 SV40 polyA probe FAM-ZEN-IBFQ 5'-AGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTC-3' SEQ ID NO:4 hcDNA_Alu primer forward 5'-GAGGCGGGCGGATCA-3' SEQ ID NO:5 hcDNA_Alu primer reverse 5'-CCCGGCTAATTTTTGTATTTTTAGTAG-3' SEQ ID NO:6 hcDNA_Alu probe HEX-ZEN-IBFQ 5'-CAGCCTGGCCAACATGGTGAAACC-3' SEQ ID NO:7 DFF40 Primer Forward 5'-TTAGAACGGCCCGCAGTC-3' SEQ ID NO:8 DFF40 primer reverse 5'-CCTTGAGACCCGAGAGTTCAC-3' SEQ ID NO:9 Partial DFF45 wild-type coding sequence 5'-GGAGGTACAGCTTGGATTTCCCAAGAGTCCTTTGATGTAGATGAAACAGACAGCGGGGC AGGGTTGAAGTGGAAG-3' SEQ ID NO:10 Partial DFF45 wild-type amino acid sequence DVDETD SEQ ID NO:11 Partial DFF45 mutant coding sequence 5'-GGAGGTACAGCTTGGATTTCCCAAGAGTCCTTTGATGTAGATGAAACAGAGAGCGGGGC AGGTTGAAGTGGAG-3' SEQ ID NO:12 Partial DFF45 mutant amino acid sequence DVDETE SEQ ID NO:13 CASP3 primer forward 5'-AATGGACCTGTTGACCTGAAA-3' SEQ ID NO:14 CASP3 primer reverse 5'-CACGGCAGGCCTGAATAA-3' SEQ ID NO:15 AIFM1 primer forward 5'-GACTGGTGGCCTGGAAATAG-3' SEQ ID NO:16 AIFM1 primer reverse 5'-CGCCTCCTTCCCAACTTTAT-3' SEQ ID NO:17 CASP8 primer forward 5'-GTCTGTGCCCAAATCAACAAG-3' SEQ ID NO:18 CASP8 primer reverse 5'-GAGTCCGAGATTGTCATTACCC-3' SEQ ID NO:19 DFF40 Primer Forward 5'-CCTGGAACCTGGATCACATAAT-3' SEQ ID NO:20 DFF40 primer reverse 5'-TACTCCCAGTCCACTTCTCT-3' SEQ ID NO:21 GAPDH primer forward 5'-AAGGTGAAGGTCGGAGTCAA-3' SEQ ID NO:22 GAPDH primer reverse 5'-AATGAAGGGGTCATTGATGG-3' SEQ ID NO:23 Endpoint PCR Primer Forward 5'-GACTGTGGTTGCTTCATGCT-3' SEQ ID NO:24 End-point PCR primer reverse 5'-ACGTGAATGGTCTTCAGCAG-3' EXAMPLES

[0057] The present invention is further illustrated by, but not limited to, the following examples.

[0058] Testing Procedure: Long-read sequencing with PacBio: The rAAV samples were treated with Denarase® and purified by affinity chromatography.

[0059] PacBio long-read sequencing was performed as known in the art. Briefly, encapsidated DNA was purified, DNA ends were repaired, and barcode adapters were ligated. Damaged regions were repaired, libraries were purified, and primers were annealed. Finally, DNA polymerase was bound and DNA fragments were sequenced on the PacBio Sequel platform with v2.0 chemistry.

[0060] Bioinformatic analysis workflow: · PacBio raw data was demultiplexed using PacBio SMRT Link. Circular consensus sequencing (CCS) reads were generated by PacBio SMRT Link. · CCS reads were aligned to the reference using pbmm2. Analyzed BAM files using samtools and custom scripts. · CCS read counting and visualization was performed using R / Bioconductor.

[0061] Cell culture: Four different production cell types were used: 1. Parental CAP or HEK293 cells harboring the adenovirus E1A and E1B genes and, for AAV production, transiently transfected with genes encoding the AAV Cap proteins VP1, VP2, and VP3; genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding the adenovirus helper functions E4orf6, E2A, and VA-RNA, and a gene of interest (GOI) flanked by AAV inverted terminal repeats (ITRs) for AAV production (fully transient approach). 2. "Alpha" cells are derivatives of the parent cells that additionally contain stably inserted inducible genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40, as well as genes encoding the adenoviral helper functions E4orf6, E2A, and VA-RNA. Upon transfection with a capsid-encoding plasmid flanked by cargo sequences, alpha cells can produce AAV (semi-transient system). 3. "Packaging" cells are derived from alpha cells and further contain stably integrated inducible genes for the AAV Cap proteins VP1, VP2, and VP3. 4. A "complete producer cell" is derived from a packaging cell and further comprises a gene of interest (GOI) flanked by AAV inverted terminal repeats (ITRs), and thus contains all stably integrated genes necessary to produce AAV.

[0062] CAP cells were typically cultured in serum-free PEM defined medium (Thermo Fisher Scientific) supplemented with 4 mM GlutaMax (Gibco) in shake flasks (125 mL; Corning) in a shaking incubator at 120 rpm (5 cm orbit) and 5% CO 2 and incubated at 37°C.

[0063] During routine culture, cells were cultured at a viable cell density of 0.5–1 × 10 with fresh medium every 72–96 h. 6 Cells were diluted to 1000 cells / ml. Viable cell density and viability were determined by trypan blue exclusion using a Vi-Cell Blu cell counter (Beckman Coulter).

[0064] Transient transfection Transient transfections were performed using PEImax (PolySciences) and 1 pg of plasmid per cell in FreeStyle F17 medium (Thermo Fisher Scientific) containing Glutamax 4 mM and IGF 50 μl / L. AAV production was induced by adding doxycycline (Clontech) to a final concentration of 1 μg / mL. AAV8 serotype expression was under the control of a cargo plasmid containing a GFP reporter construct flanked by a doxycycline-inducible promoter and AAV2-ITR. Plasmids were transfected at a 1:1 ratio. Stable producer cells were induced by adding doxycycline without further transfection. Caspase inhibitor Z-VAD-fmk (InvivoGen) and P38 MAPK inhibitor adetumapimod (SB 203580, CellSignal) were added using the indicated concentrations at the time of induction.

[0065] At various times after transfection, cell suspensions were harvested and cells were lysed by adding Triton-X 100 (Sigma). After centrifugation, the supernatants were diluted and incubated with TurboDNAse (ThermoFisher Scientific) to remove non-encapsidated DNA contamination. After TurboDNAse incubation, proteinase K was added to digest the viral capsids, and then viral genomic DNA or hcDNA was amplified by ddPCR or qPCR.

[0066] qPCR / ddPCR to determine viral titer and host cell DNA: a) SV40 polyA (quantification of viral titer), or b) Alu sequences (quantification of hcDNA) The following primer / dual-labeled probe combinations (ordered from MWG, Eurofins, and IDT, respectively, Table 1) for were used:

[0067] As standards for viral genomes, linear transgene plasmids of defined copy numbers were used. As standards for hcDNA assays, previously isolated CAP and HEK293 DNA (purified with DNeasy® Blood & Tissue Kit) were used.

[0068] [Table 1]

[0069] AAV samples were treated with Turbo DNAse (Thermo Fischer Scientific) to digest non-encapsidated DNA before capsid digestion using Proteinase K. Proteinase K was inactivated by heating the process at 95° C. for 15 min. Samples were measured by qPCR or ddPCR as follows:

[0070] The qPCR reaction consisted of the following components: 2× Brilliant Multiplex qPCR Master Mix (Agilent), nuclease-free HO. 2 The kit contained 0 (Thermo Fisher Scientific), primer / probe mix, and samples / standards. qPCR was performed on a LightCycler 480 according to the manufacturer's instructions.

[0071] Additionally, ddPCR was used for absolute quantification of viral titers. Prior to droplet formation, samples were diluted in sample dilution buffer (GeneAmp 10x PCR Buffer I (Thermo Fischer Scientific), fragmented salmon sperm (SSS) DNA, Pluronic F-68 non-ionic detergent) and added to 2x ddPCR Supermix (BioRad) containing appropriate primers / probes (see Table 1). Droplets were generated using a Biorad QX200 Droplet Generator according to the manufacturer's instructions. PCR was performed on a Biorad C100 Touch™ thermal cycler. Droplets were counted using a BioRad QX200 Droplet Reader and analyzed using QuantaSoft analysis software.

[0072] DNA fragmentation assay The Chemometec DNA fragmentation assay was performed using a NucleoCounter® NC-3000™ according to Note No. 3003.Rev.1.4.

[0073] Briefly, cells are permeabilized with ethanol, allowing low molecular weight DNA fragments (e.g., apoptotic DNA) to leak out while retaining larger fragments and intact chromosomes in the nucleus. Total DNA content was stained with DAPI and detected using a NucleoCounter® NC-3000™. Here, cells typically fall into one of three groups when plotted by signal intensity: the G1 peak represents the majority of cells with 2n DNA content; the second smallest peak represents cells in the G2 phase of the cell cycle that contain 4n; the population spanning the middle between the G1 and G2 peaks represents cells in S phase, while cells with a clear sub-G1 DNA content show apoptotic DNA fragmentation and can be identified by the release of ethanol-induced apoptotic fragments.

[0074] Cell lines and culture A stable AAV-producing cell line derived from CAP cells was used in the experiments of Examples 5 to 7. This cell line expresses a transgene flanked by doxycycline-inducible adenoviral helper genes, AAV replicase, capsid sequences, and ITRs.

[0075] CAP cells were typically cultured in serum-free PEM defined medium (Thermo Fisher Scientific) supplemented with 4 mM GlutaMax (Gibco) in shake flasks (125 mL; Corning) in a shaking incubator at 120 rpm (5 cm orbit) and 5% CO 2 and incubated at 37°C.

[0076] During routine culture, cells were cultured at a viable cell density of 0.5–1 × 10 with fresh medium every 72–96 h. 6 Cells were diluted to 1000 cells / ml. Viable cell density and viability were determined by trypan blue exclusion using a Vi-Cell Blu cell counter (Beckman Coulter).

[0077] AAV production AAV production was induced by adding doxycycline (Clontech) to a final concentration of 1 μg / mL. After 3 days, cell suspensions were harvested and cells were lysed by adding Triton-X 100 (Sigma). After centrifugation, the supernatant was diluted and incubated with TurboDNAse (ThermoFisher Scientific) to remove non-encapsidated DNA contamination. After TurboDNAse incubation, proteinase K was added to digest the viral capsid, and then viral genomic DNA or hcDNA was amplified by ddPCR or qPCR.

[0078] Gene knockout Gene knockout of DFF40 was performed as known in the art.

[0079] Single cell cloning The polyclonal pool of knockout and wild-type cells was single-cell cloned using Cytena's single cell sorting machine "c.sight" and monitored for monoclonality using Cell Metric imaging "Solentim."

[0080] Knockdown Transfection of siRNA directed against DFF40 (s17440), CAPS3 (s397), CAPS8 (s2427), or AIFM1 (s17440); (all ThermoFischer) was performed using FuGene-SI transfection reagent (Biozol) according to the manufacturer's instructions. One day after transfection, cells were induced with doxycycline and harvested 3 days later.

[0081] Knockdown efficiency was determined by qPCR: CAP cells (10 6) RNA was isolated using the Quick-RNA Microprep kit (Zymo Research) according to the manufacturer's instructions. Remaining genomic DNA was digested with DNase I (Thermo Fisher Scientific) for 15 min at 37°C. After inactivation of the enzyme in the presence of 2.5 mM EDTA at 65°C for 10 min, cDNA synthesis was performed on 50 ng of RNA per reaction and quantitative PCR was performed with gene-specific primers (Integrated DNA Technologies) using the Quant-X One-Step qRT-PCR TB Green kit (Takara Bio) on a LightCycler 480 instrument (Roche) according to the manufacturer's instructions.

[0082] [Table 2]

[0083] Overexpression Wild-type PARP1 (NM_001618.4) and the single mutant form of DFFA (NM_004401.3) (D117E) were cloned into the mammalian expression vector pcDNA3.1(+) (ThermoFischer) and transfected into stable inducible AAV-producing cells. One day after transfection, AAV production was induced and cells were harvested 3 days after induction.

[0084] End-point PCR for detection of hcDNA encapsidation Encapsidated hcDNA was prepared as described. The PCR setup included 3 μl of sample as template for 40 cycles of end-point PCR using Q5 High-Fidelity DNA Polymerase (NEB) according to the manufacturer's instructions. PCR samples were analyzed on a 2% agarose gel.

[0085] Primers for end-point PCR: Endpoint-fw 5'-GACTGTGGTTGCTTCATGCT-3' (SEQ ID NO: 23) Endpoint-rv 5'-ACGTGAATGGTCTTCAGCAG-3' (SEQ ID NO: 24)

[0086] Example 1 Analysis of nuclease-resistant DNA in recombinant AAV particles introduction: The lengths of DNA fragments encapsidated in recombinant AAV particles that were mapped to a) the host cell genome or b) the rAAV genome were determined. For this purpose, purified and DNase I-treated rAAV particles were analyzed using PacBio technology.

[0087] result: PacBio analysis revealed that the DNA aligned to the host cell genome and the rAAV genome was clearly separated by fragment length. The rAAV genome showed an average fragment length of approximately 1800 bp, which was consistent with the actual size of the ITR-flanked regions. The DNA mapped to the host cell genome showed a broad range in size, starting at approximately 100 bp (Figure 1).

[0088] Detailed analysis of the host cell DNA fragment lengths in Figure 2 revealed a wave-like pattern with distinct peaks. The maximum of each peak (highlighted by the dashed lines) matched the size distribution of the theoretical size distribution of the apoptotic ladder, as shown in Table 3, with a deviation of + / - 20 bp on average.

[0089] [Table 3]

[0090] These data lead to the hypothesis that the source of encapsidated host cell DNA in this AAV production is DNA fragmentation via the apoptotic pathway.

[0091] Example 2 Inhibition of apoptosis with the pan-caspase inhibitor Z-VAD-fmk increases the relative number of viable cells after induction. introduction: Various stable and transient AAV-producing cell lines were induced with doxycycline and treated with various concentrations of the anti-apoptotic pan-caspase inhibitor Z-VAD-fmk. Cell viability was assessed using a NucleoCounter NC-3000.

[0092] result: Treatment of cells with Z-VAD-fmk increased viable cell density and viability. The observed effect correlated with the concentration used, increasing viability by approximately 10 percentage points with 10 μg / ml Z-VAD-fmk treatment for 80 h compared to untreated cells (Figure 3a) and was independent of the CAP cell line investigated. In contrast, the pro-apoptotic camptothecin reduced viability and VCD (Figure 3b), an effect that could be counteracted by co-culture with the anti-apoptotic Z-VAD-fmk.

[0093] Example 3 The pan-caspase inhibitor Z-VAD-fmk drastically reduces the amount of hcDNA in AAV particles. introduction: ·Z-VAD-fmk inhibits caspases 3 and 8, which are upstream of the apoptotic nucleases DFF40 and ENDOG, respectively. Thus, Z-VAD-fmk treatment reduces chromosome fragmentation and decreases the amount of packageable-sized AAV cargo. · Transiently transfected CAP cells and HEK293 cells or intact producer cells were cultured to produce AAV with or without Z-VAD-fmk. The resulting AAV particles were harvested from cell suspensions 1, 2, 3, and 4 days after induction. Encapsidated host cell DNA was measured using a dedicated qPCR assay that amplifies the ALU repeat. DNA fragmentation was determined using a DNA fragmentation assay by Chemometec.

[0094] result: Z-VAD-fmk reduced the amount of low molecular weight DNA that normally appears during vector production, and conversely, treatment with the proapoptotic camptothecin similarly increased short DNA fragments, supporting the apoptotic origin of this type of DNA (Fig. 4A).

[0095] Analysis of viral particles revealed that treatment of cells with up to 40 μg / ml Z-VAD-fmk dramatically reduced packaging of host cell DNA compared to untreated controls (Figure 4B and Figure 4C). These results were consistently observed with the fully transient approach and with intact producer cells, CAP and HEK293 cells.

[0096] ELISA readout confirmed that the reduced hcDNA levels were not the result of a global decrease in capsid production under Z-VAD-fmk treatment: in contrast, in stable producers, capsid levels were slightly increased in the presence of Z-VAD-fmk, and normalization of capsid levels (ELISA) revealed a ∼10-fold decrease in encapsidated hcDNA compared to controls (Figure 4C).

[0097] Example 4 The pan-caspase inhibitor Z-VAD-fmk increases the ratio of capsids containing the viral genome to empty capsids. introduction: Most recombinant AAV capsids remain devoid of the viral genome after assembly. Separation of filled and empty particles is a major challenge in downstream processing of virus particles. Improving the encapsidation of the viral genome would significantly reduce production costs and improve the quality of the final product.

[0098] result: AAV8 packaging pools and parental CAP cells were transfected with cargo plasmids and AAV production plasmids, respectively. Quantification of viral titers was performed using qPCR, and capsid levels were determined using ELISA. Treatment with Z-VAD-fmk increased the percentage of viral genome-containing capsids by 30-90% in transient and semi-transient transfection approaches with two different cargo plasmids (Figure 5).

[0099] Example 5 Knockout of DFF40 at the DNA level. introduction: To prevent apoptotic fragmentation of host cell DNA, DFF40 was knocked out as known in the art. Knockout efficiency was determined by PCR amplification of the entire target region.

[0100] result: End-point PCR of the wild-type control sample (lane 1), the polyclonal pool (lane 2), and the DFF40 clonal cell line (lane 3) shows various percentages of knockout. A single band corresponding to the predicted genomic amplicon size appears on the agarose gel for the wild-type sample, whereas a clear reduction in the intensity of this band and the appearance of a lower molecular weight band was detected in the polyclonal knockout pool (Figure 6). After single-cell cloning, several cell lines could be isolated in which no DFF40 wild-type allele remained.

[0101] Example 6 Reduced encapsidation of hcDNA by DFF40 knockout introduction: DFF40 is a key factor in apoptotic DNA fragmentation, therefore knockout of DFF40 prevents DNA fragmentation into low molecular weight fragments and ensures that viral capsids are free of hcDNA contamination from the respective AAV-producing cells.

[0102] result: Comparative quantification by qPCR revealed a ∼60% relative reduction in hcDNA levels in the DFF40 polyclonal knockout pool (Figure 7, lane 2) compared to AAV preparations of the corresponding producer cell line harboring the DFF40 wild-type allele (Figure 7, lane 1). A genetically confirmed and cloned knockout cell line derived from this KO pool (Figure 7, lane 3) demonstrated a reduction in hcDNA contamination down to background levels (Figure 7, lane 4).

[0103] Example 7 Vector production in DFF40 knockout cells introduction: Because DFF40 is expressed in AAV-producing cells and is evolutionarily conserved, knockout would have a deleterious effect on AAV production.

[0104] result: Cell viability of the DFF40 knockout clones and the corresponding polyclonal pools was unchanged, and vector titers did not decrease in response to the genomic alterations (Figure 8, lanes 1-3).

[0105] Example 8 Knockdown of DFF40 and other apoptotic genes by siRNA transfection introduction: Knockout of DFF40 copies at the DNA level causes a complete loss of DFF40 protein. However, such complete depletion of DFF40 is not required for reduced encapsidation of hcDNA. Small interfering RNAs (siRNAs) are known to reduce protein levels by targeting the corresponding mRNAs, thereby inducing partial depletion of these transcripts. However, less than a quarter of randomly selected siRNAs silence their cognate targets by 95% or more.

[0106] Stable AAV-producing cells were induced with doxycycline and treated with siRNAs targeting various genes that are part of the apoptotic DNA fragmentation pathway. DFF40: An endonuclease involved in the cellular apoptosis process that facilitates DNA degradation. DFF40 cleaves dsDNA at the internucleosomal linker regions of chromatin into high molecular weight fragments (20-100 kb) and then oligonucleosomal fragments known as low molecular weight (LMW) DNA degradation and visualized as a ladder pattern on agarose gel electrophoresis (DNA ladder). · CASP3: CASP3 directly targets ICAD for degradation. · CASP8: The initiator CASP8 mediates CASP3 activation. · AIFM1: AIFM1 induces high molecular weight DNA fragmentation by causing chromatin condensation, but does not induce subsequent low molecular weight DNA fragmentation. One day after transfection, cells were induced by adding doxycycline, and 3 days later, induced cells were harvested and analyzed for encapsidation of hcDNA. Encapsidated host cell DNA was measured using a dedicated qPCR assay that amplifies the ALU repeat.

[0107] result: Stable inducible AAV producer cells were transfected with siRNAs directed against the mRNA of DFF40 (knockdown efficiency (KD-Eff) 66%, CASP3 (KD-Eff 61%), CASP8 (KD-Eff 78%), and AIFM1 (KD-Eff 92%). Viral particles obtained from cells transfected with siRNAs targeting DFF40, CASP3, and CASP8 showed similar reduction in hcDNA compared to mock-transfected cells at >60%, whereas transfection with siRNA against AIFM1, which is known not to fragment DNA at low molecular weight levels, did not affect hcDNA content (Figure 9).

[0108] Thus, effective inhibition of hcDNA packaging can be achieved not only by complete depletion of DFF40 using genetic engineering, but also by more moderate reduction of DFF40 levels using RNA silencing. Furthermore, the positive effect is not limited to DFF40 itself, but can also be achieved by knockdown of upstream factors of the apoptotic cascade that are also known to be involved in DNA degradation of low molecular weight fragments. DNA fragmentation into high molecular weight fragments achieved by AFM1 depletion is not sufficient to reduce hcDNA packaging.

[0109] Example 9 Knockout of DFF40 in HEK293 cells introduction: · Knockout of DFF40 and treatment with Z-VAD-fmk blocked hcDNA encapsidation during AAV production in human CAP cells. Treatment of HEK cells with Z-VAD-fmk causes a reduction in encapsidated hcDNA similar to CAP in a transient setting (see Example 3). Therefore, to demonstrate the effect of completely ablating DFF40 in an independent cellular background, DFF40 was also knocked out in HEK293 cells. Encapsidated host cell DNA was measured using an end-point PCR assay to amplify genomic DNA sequences from HEK293 cells.

[0110] result: HEK293 knockouts were generated using the same approach as CAP cells. HEK293 wt cells (1-4), DFF40 KO pools (5-6), and DFF40 KO single cell clones (11, 12) were transfected with either cargo 3 (1, 3, 5) or cargo 1 (2, 4, 6, 11, 12) and treated with ZVAD-fmk (3, 4) or left untreated (1, 2, 5, 6, 11, 12). Sensitive PCR amplification of genomic DNA sequences from HEK293 cells demonstrated encapsidation of adenoviral E1 sequences present in HEK293 wild type cells transfected with cargo 1 or cargo 3, which was undetectable in samples of transiently transfected cells treated with Z-VAD-fmk or representing confirmed single cell KO clones obtained from polyclonal pools of DFF40 KO cells. Because KO efficiency was less than 100% and end-point PCR was designed to amplify even residual amounts of contaminating DNA, it was predicted that encapsidated hcDNA ( 5 , 6 ) would be detectable in the polyclonal pools ( Fig. 10 ).

[0111] Knockout of DFF40 reduces or completely prevents hcDNA encapsidation in CAP and HEK293 cells, and therefore almost certainly any mammalian cell capable of AAV production.

[0112] Example 10 Overexpression of anti-apoptotic genes blocks hcDNA encapsidation. introduction: Inhibition of apoptosis can be achieved by interference with pro-apoptotic factors using knockdown, knockout, and chemical inhibition, as demonstrated above. Overexpression of anti-apoptotic genes, on the other hand, has been described to inhibit or slow down programmed cell death as well. · A caspase-resistant form of DFF45 harboring the missense mutation D117E was shown to block DFF40-induced LMW fragmentation during apoptosis when transiently expressed in SH-SY5Y cells. PARP1, an enzyme involved in DNA repair, is one of the few known cellular substrates of caspases. Cleavage of PARP1 by caspase 3 is thought to be a hallmark of apoptosis. PARP1 has been reported to be an antagonist of DNA fragmentation in the context of apoptosis as well as cell differentiation and gene expression. ·Caspase-resistant DFF45 mutants and ectopic expression of PARP1 may reduce hcDNA encapsidation in AAV production by decreasing DNA fragmentation. Stable AAV-producing cell lines were transfected with plasmids encoding dominant-negative copies of DFF45(D117E) or wt PARP1. One day after transfection, cells were induced by adding doxycycline, and 3 days later, induced cells were harvested and analyzed for encapsidation of hcDNA. Encapsidated host cell DNA was measured using a dedicated qPCR assay that amplifies the ALU repeat.

[0113] result: Transfection of stable AAV-producing cell lines with plasmids (Figure 11) encoding dominant-negative copies of DFF45(D117E) (Figure 12, lane 4) or wt PARP1 (Figure 12, lane 3) successfully reduced hcDNA encapsidation by more than 60% compared to the untransfected control (lane 1). Despite the average transfection efficiency in the PEI approach being only 40-60%, ectopic expression of DFF45(D117E) and PARP1 results in a similar effect on hcDNA encapsidation as the previously described treatment with Z-VAD-fmk (lane 5).

[0114] The results show that in addition to inhibiting, reducing, and perturbing pro-apoptotic factors, encapsidation of hcDNA can also be prevented by overexpression of anti-apoptotic alleles and genes involved in apoptosis, differentiation, and DNA damage response during gene expression.

[0115] Example 11 Chemical inhibition of upstream proapoptotic factors by non-peptide compounds. introduction: The pan-caspase inhibitor Z-VAD-fmk has been shown to successfully block apoptosis by inactivating all caspases and thereby inhibiting encapsidation of hcDNA. Other compounds such as Z-IETD-fmk and Z-DEVD-fmk have similar effects on encapsidation, and compounds that are not based on short peptides and do not target caspases may achieve the same results.

[0116] Stable AAV-producing cells were induced with doxycycline and treated with increasing concentrations of the p38 MAPK inhibitor SB203580 (adetumapimod). p38 mitogen-activated protein kinase (MAPK) has been described to induce apoptosis through activation of Bax and promotion of cytochrome c release and caspase activation. Thus, the p38 inhibitor adetumapimod (SB203580) was shown to block stress-induced apoptosis and apoptosis-induced DNA fragmentation. Cell suspensions were harvested 3 days after induction and the encapsidated hcDNA content was determined. Encapsidated host cell DNA was measured using a dedicated qPCR assay that amplifies the ALU repeat.

[0117] result: The p38 MAPK inhibitor SB 203580 (Figure 13, lanes 2 and 3) reduces encapsidated hcDNA compared to the vehicle-treated control (lane 1). The reduction efficiency at 60 μM SB203580 (lane 3) was comparable to Z-VAD-fmk treatment (lane 4) and to the uninduced sample (lane 5), reaching more than 75% reduction (Figure 13).

[0118] This result indicates that effective blockade of hcDNA encapsidation by small molecule drugs is not limited to inhibition of caspases or factors directly upstream of DFF40, but also encompasses proteins at the distal end of the apoptotic pathway.

Claims

1. A cell line in which DNA fragmentation is inhibited.

2. Use of cell lines in which DNA fragmentation is inhibited to produce adeno-associated virus (AAV).

3. 3. The cell line of claim 1 or the use of claim 2, wherein the cell line is an AAV-producing cell line.

4. 4. The cell line of claim 1 or claim 3, or the use of claim 2 or claim 3, wherein the DNA fragmentation is (i) DNA fragmentation caused by programmed cell death or (ii) DNA fragmentation caused by caspase 3 / DFF40-induced DNA strand breaks.

5. 5. The cell line of claim 1, 3 or 4, or the use of claim 2 to 4, wherein the DNA fragmentation is low molecular weight DNA fragmentation.

6. 6. The cell line or use according to claim 5, wherein the low molecular weight DNA fragmentation is DNA fragmentation resulting in DNA fragments of at most 20 kB in length.

7. A cell line according to any one of claims 1 and 3 to 6, or a use according to any one of claims 2 to 6, wherein genes encoding components necessary for the production of AAV are either transiently expressed in the cell line or stably integrated into the cellular genome.

8. 8. The cell line or use of claim 7, wherein the genes encoding components necessary for the production of AAV are selected from the group consisting of genes encoding the AAV Cap proteins VP1, VP2, and VP3; genes encoding the AAV Rep proteins Rep78, Rep68, Rep52, and Rep40; genes encoding the adenovirus helper functions E4orf6, E2A, VA-RNA, and DBP; genes encoding the Ad5 helper genes E1A and E1B; and a gene of interest (GOI) flanked by AAV inverted terminal repeats (ITRs).

9. The following genes: genes encoding the AAV Cap proteins VP1, VP2, and VP3; A gene encoding one or both of the AAV Rep proteins Rep78 or Rep68; A gene encoding one or both of the AAV Rep proteins Rep52 or Rep40; A gene of interest (GOI) flanked by AAV ITRs; and 9. The cell line or use of claim 7 or claim 8, optionally wherein genes encoding any one, any two, any three, any four or all of the adenoviral helper functions E1A, E1B, E4orf6, VA-RNA, DBP and E2A are transiently expressed in the cell line or stably integrated into the cell genome.

10. A cell line according to any one of claims 1 and 3 to 9, or a use according to any one of claims 2 to 9, wherein the cell line is a cell line selected from the group consisting of CAP cells, AGE1.hn, HEK293, PER.C6, NSO1, COS-7, BHK, CHO, CV1, VERO, HeLa, MDCK, BRL3A, W138 and HepG2 cells.

11. A cell line according to any one of claims 1 and 3 to 10, or a use according to any one of claims 2 to 10, wherein the DNA fragmentation is caused by programmed cell death, and the DNA fragmentation caused by programmed cell death is apoptotic DNA fragmentation, parthanatos DNA fragmentation, and / or DNA fragmentation due to pyroptosis.

12. 12. A cell line according to any one of claims 1 and 3 to 11, or a use according to any one of claims 2 to 11, wherein the DNA fragmentation is inhibited by direct or indirect inhibition of one or more endonucleases.

13. The direct inhibition of one or more endonucleases is selected from the group consisting of DFF40 (DNA fragmentation factor 40), ENDOG (endonuclease G), and DNASE1L3. (i) genetic modification, (ii) chemical inhibition, and / or 13. The cell line or use of claim 12, comprising (iii) protein depletion.

14. Indirect inhibition of one or more endonucleases may be achieved by inhibiting one or more upstream regulators of one or more endonucleases. (i) genetic modification, (ii) chemical inhibition; (iii) protein depletion, (iv) mutations, and / or (v) The cell line or use according to claim 12, comprising synthesis misregulation, wherein the upstream regulatory factor is selected from the group consisting of DFF45 (DNA fragmentation factor 45), caspase-3, caspase-7, granzyme B, and caspase-9.

15. The DNA fragmentation (a) knockout of one or more genes selected from the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (b) expression of one or more RNA silencing factors directed to one or more genes selected from the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (c) expression of an RNA synthetase activator or an antisense RNA oligonucleotide that blocks translation initiation or elongation of the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (d) expression of one or more dominant negative mutants of the caspase-3, DFF40, and / or ENDOG genes; (e) Strong overexpression of wild-type or caspase-resistant DFF45; (f) expression of intrabodies and similar mechanisms that target caspase-3, DFF40, and / or mitochondrial endonuclease G at the protein level; (g) transcriptional silencing at the promoters of caspase-3, DFF40, and / or ENDOG; (h) epigenetic silencing by targeted DNA methylation or histone modification of the promoters of the group consisting of the CASP3 gene, the DFF40 gene, and the ENDOG gene; (i) exon skipping by U7smOpt, antisense oligonucleotides (AONs), or splice switching oligonucleotides (SSOs) against DFF40, CASP3, or ENDOG pre-mRNA; and (j) a cell line described in any one of claims 1 and 4 to 14, or a use described in any one of claims 2 to 14, which is inhibited by a mechanism selected from the group consisting of a decrease in ASF / SF2, for example an inhibitory isoform shift of DFF45.

16. A cell line described in any one of claims 1, 3, and 5 to 10, or a use described in any one of claims 2, 3, and 5 to 10, wherein DNA fragmentation is inhibited by overexpression of one or more enzymes selected from the group consisting of enzymes involved in DNA repair and enzymes that inhibit DFF40.

17. 17. The cell line or use of claim 16, wherein the enzyme is selected from the group consisting of PARP1 (poly[ADP-ribose]polymerase 1), DNA ligase IV, BRCA1, BRCA2, FEN1, ligase III, MRE11, NBS1, and XRCC1.

18. 18. A method for producing an adeno-associated virus (AAV), comprising producing AAV in a cell line as defined in any one of claims 1 to 17.

19. A method for producing adeno-associated virus (AAV), comprising exposing an AAV-producing cell to an inhibitor of DNA fragmentation during the AAV production phase.

20. The inhibitor of DNA fragmentation is selected from the group consisting of Z-VAD-fmk (Z-Val-Ala-Asp fluoromethyl ketone; CAS number 161401-82-7); Z-IETD-fmk (Z-Ile-Glu-Thr-Asp; CAS number 210344-98-2); Z-DEVD-fmk (Z-Asp-Glu-Val-Asp; CAS number 210344-95-9); PNR-3-80 (5-((1-(2-naphthoyl)-5-chloro-1H-indol-3-yl)methylene)-2-thioxodihydro-pyrimidine-4,6(1H,5H)-dione); PNR-3-82 (5-((1-(2-naphthoyl)-5-methoxy-1H-indol-3-yl)methylene)-2-thioxodihydropyrimidine-4,6(1H,5H)-dione); Zn 2+ 20. The method of claim 19, wherein the proteolysis targeting chimera (PROTAC) directed against caspase-3, DFF40 (DNA fragmentation factor 40), and / or mitochondrial endonuclease G is selected from the group consisting of: EDTA (ethylenediaminetetraacetic acid); adecumapimod (SB 203580; 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-1H-imidazole; CAS number 152121-47-6); and proteolysis targeting chimera (PROTAC) directed against caspase-3, DFF40 (DNA fragmentation factor 40), and / or mitochondrial endonuclease G.

Images