PLpro protein inhibitors, their preparation and use

The development of specific compounds targeting the PLPro protease addresses the lack of effective inhibitors, achieving reduced viral load and immune system restoration.

JP2025514293AActive Publication Date: 2025-05-02TSINGHUA UNIVERSITY
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
JP2024563547
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-08-25
Filing Date
2023-04-28
Publication Date
2025-05-02
Estimated Expiration
2043-04-28

AI Technical Summary

Technical Problem

Current antiviral strategies lack effective inhibitors for the PLPro protease, which is crucial for viral replication and immune evasion in host cells.

Method used

Development of specific compounds with a defined structural formula that act as PLPro protein inhibitors, including pharmaceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds.

Benefits of technology

These compounds effectively inhibit PLPro, leading to reduced viral load and restoration of the host's innate immune system, making them potential antiviral agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025514293000001_ABST
    Figure 2025514293000001_ABST
Patent Text Reader

Abstract

The present invention discloses a PLPro protease inhibitor, its preparation method and use. The PLPro protease inhibitor can be used as a PLPro inhibitor in combination with one or more pharma- ceutically acceptable auxiliary materials or one or more other active ingredients to treat a disease or disorder caused by or associated with a viral infection. The auxiliary materials can be carriers, diluents, adhesives, lubricants, wetting agents, etc. The protease inhibitor has high inhibitory activity and is particularly useful as a broad-spectrum antiviral agent for coronaviruses, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2, and especially SARS-CoV, MERS-CoV, SARS-CoV-2 viruses.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to the technical field of medicine, in particular to a PLPro protein inhibitor, its preparation method and use. [Background technology]

[0002] PLpro is one of two important proteases that cleave polyproteins pp1a and pp1ab expressed through the host cell translation machinery (PLpro is responsible for cleaving nsp1, nsp2, and nsp3), and can cleave Lys48-linked polyubiquitin and its modification by the ubiquitin-like molecule interferon-stimulated gene 15 (ISG15) with high activity to achieve immune evasion. When PLpro is inhibited, a reduction in viral load and recovery of the host innate immune system are achieved. PLpro is considered a potential antiviral target due to its multiple roles in viral replication and host cell control. Summary of the Invention [Means for solving the problem]

[0003] The present invention provides compounds having the following structure: or pharma- ceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds thereof: TIFF2025514293000002.tif32170

[0004] (where Ar 1 is a substituted naphthyl or a substituted or unsubstituted non-naphthalene aromatic group; Ar 2 is aryl or heteroaryl; B is heterocyclyl, -S(O) t NR 15 , halogen, -NH 2 is selected from TIFF2025514293000003.tif15170W 2 is selected from C, N, and O; W 2 If N, then R1 ’ does not exist, and W 2 If is O, then R 1 , R 1 ’ does not exist, W 4 is absent or selected from C or S; W 4 If does not exist, R 1 , R 2 does not exist, R 1 , R 1 ’ , R 2 , R 2 ’ are independently H, D, (=O), -C 1 ~C 6 Alkyl, -X, -CH 2 X, -CHX 2 , -CX 3 , -OH, -NH 2 , -COOH, -O(C 1 ~C 6 alkyl), R 2 ’’ , H, C 1 ~C 6 Alkyl, -OH, -(C 1 ~C 6 (alkylene)-COOR 21 , -(C 1 ~C 6 Alkylene)-OR 21 , -(C 1 ~C 6 (alkylene)-CONR 21 R 22 is selected from R 3 is H or C 1 ~C 6 alkyl, L 1 does not exist, or TIFF2025514293000004.tif16170 or -N(R 3 )- is selected from L 3 , L 5is absent or independently selected from alkylene, heteroalkylene, cycloalkylene, heterocyclylene, and the carbonyl may be optionally substituted; L 4 -NR 15 C(O)-, -NR 15 S(O) t -, -C(O)-, -C(O)O-, -NR 15 -, -C(O)NR 15 -, -S(O) t NR 15 -, Selected from TIFF2025514293000005.tif21170, L 6 does not exist or C 1 ~C 6 Alkylene, -SO 2 -, -NR 15 C(O)-, -NR 15 S(O) t -, -C(O)-, -C(O)O-, -NR 15 -, -C(O)NR 15 -, -S(O) t NR 15 -, Selected from TIFF2025514293000006.tif21170, R 15 is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, or R 15 is a nitrogen atom and L bonded to it. 3 Or L 5 together form a heterocyclyl, which is optionally substituted; t is 1 or 2; R 21 is H or C 1 ~C 6 is alkyl, R 22 is H or C 1 ~C 6 is alkyl, R 23 or R 23’ is H or C1 ~C 6 alkyl, X is selected from F, Cl, Br, and I.

[0005] In an embodiment of the present invention, L 6 teeth, It could also be TIFF2025514293000007.tif14170.

[0006] In an embodiment of the present invention, L 6 teeth, It could also be TIFF2025514293000008.tif14170.

[0007] Preferably, the substituted naphthyl is selected from the following: TIFF2025514293000009.tif40170

[0008] (where R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 represents a substituent on the ring, and is independently H, D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl), -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O)t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L -N=CR'R'', optionally substituted, and R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 cannot be H at the same time, t is 1 or 2; R L does not exist or C 1 ~C 6 Alkylene, C 3 ~C 6 Heteroalkylene, C 3 ~C 6 Cycloalkylene, C 3 ~C 6 Heterocyclylene, -NR 4 C(O)-, -NR 4 S(O) t -, -C(O)-, -C(O)O-, -NR 4 -, -C(O)NR 4 -, -S(O) t NR 4 -, optionally substituted; R' and R'' are independently H, D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 selected from cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, optionally substituted; R 4is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy; More preferably, R L is absent or -CH 2 -, -CH 2 CH 2 -, -CH(CH 3 )CH 2 - selected from More preferably, R' and R'' are H, -CH 3 , -CH 2 CH 3 , -CH(CH 3 )CH 3 is selected from More preferably, R 4 -H, -CH 3 , -CH 2 CH 3 , -CH(CH 3 )CH 3 is selected from More preferably, R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 are independently H, D, -CH 3 , -X, -CH 2 F, -CHF 2 , -CF 3 , -OH, -CN, -OCH 3 , -OCH 2 X, -OCHX 2 , -OCX 3 , -NH 2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 Alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), and R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 cannot be H at the same time, More preferably, the substituted naphthyl is TIFF2025514293000010.tif58170 is selected.)

[0009] More preferably, the R 42 , R 43 , R 45 , R 46 are independently H, -F, -D, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -N(CH 3 ) 2 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH2 is selected from.

[0010] The non-naphthalene aromatic groups are selected from: Phenyl, substituted phenyl, TIFF2025514293000011.tif69170

[0011] (Here, L 2 is absent or -O-, C 1 ~C 6 Alkylene (including methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), -CO-, -CONR 53 -, -NR 53 -, -NR 53 CO-, -(C 1 ~C 6 alkylene)-O-, -(C 1 ~C 6 alkylene)-CO-, -(C 1 ~C 6 (alkylene)-CONR 53 -, -(C 1 ~C 6 (alkylene)-NR 53 -, -(C 1 ~C 6 (alkylene)-NR 53 CO-, R 53 is H, D or C 1 ~C 6 alkyl, R 51 H, D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl), -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -RL -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; t is 1 or 2; R L does not exist or C 1 ~C 6 Alkylene, C 3 ~C 6 Heteroalkylene, C 3 ~C 6 Cycloalkylene, C 3 ~C 6 Heterocyclylene, -NR 4 C(O)-, -NR 4 S(O) t -, -C(O)-, -C(O)O-, -NR 4 -, -C(O)NR 4 -, -S(O) t NR 4 -, optionally substituted; R' and R'' are independently H, D, amino, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 selected from cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, optionally substituted; Preferably, R 51 -H, -D, -CH 3, -X, -CF 3 , -OH, -OCH 3 , -OCH 2 X, -OCHX 2 , -OCX 3 , -NH 2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), Ar 3 is selected from substituted or unsubstituted phenyl, substituted or unsubstituted oxygen-containing 5- or 6-membered heterocyclyl, substituted or unsubstituted nitrogen-containing 5- or 6-membered heterocyclyl, substituted or unsubstituted sulfur-containing 5- or 6-membered heterocyclyl; Preferably, Ar 3 is phenyl, C 1 ~C 6 is selected from alkyl-substituted phenyl, furyl, pyrrolyl, thienyl, pyridyl, pyrimidinyl, thiazolyl, imidazolyl, oxazolyl, optionally substituted, more preferably Ar3 is selected from phenyl, tert-butylphenyl, thienyl, pyridyl, optionally substituted; W 3 is selected from N or CH; R 6 H, D, C 1 ~C 6 Alkyl, -OH, -(C 1 ~C 6 (alkylene)-COOR 61 , -(C 1 ~C 6 Alkylene)-OR 61 , -(C 1 ~C 6 (alkylene)-CONR 61 is selected from R 61 is H, D or C 1 ~C 6 is alkyl, Preferably, W 3 is N and R 6 are H, D, and CH 3 , -CH 2 COOH, -CH 2 COOCH 3 and R 62 H, D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl), -N 3 , -B(OH) 2 , -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O)t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; T 1 , T 2 , T 3 , T 4 , T 5 , T 6 , T 7 are independent of each other. 7 , TIFF2025514293000012.tif16170 or N, X' is N, O, or S; In some embodiments of the present invention, T 4 and T 5 If there is a single bond between 4 and T 5 Both are -CONR 8 - and T 6、 T 7 is an independent CR 7 or N, In some embodiments of the present invention, T 6 and T 7 If there is a single bond between 6 and T 7 Both are -CONR 8 -And T 1 ~T 7 CR 7 R 7 are each independently H, O, -D, or -CH 3 , -X, -CF 3 , -OH, -OCH 3 , -OCH 2 X, -OCHX 2 , -OCX 3 , -NH2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 Alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), -O(C 1 ~C 6 Alkyl)NH(C 1 ~C 6 alkyl), Selected from TIFF2025514293000013.tif22170, R 8 H, D, C 1 ~C 6 Alkyl, -(C 1 ~C 6 (alkylene)-COOR 61 , -(C 1 ~C 6 Alkylene)-OR 61 , -(C 1 ~C 6 (alkylene)-CONR 61 is selected from S 3 are O, S, and NR91 , C.R. 92 R 93 is selected from S 1 , S 2 , S 4 , S 5 , S 6 , S 7 are, independently, N, CR 94 is selected from Here, R 92 , R 93 , R 94 are independently bond, H, D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl), -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L -N=CR'R'', TIFF2025514293000014.tif22170, optionally replaced; Preferably, R 92 , R 93 , R 94are independently a bond, H, D, or -CH 3 , -F, -CF 3 , -OH, -OCH 3 , -NH 2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 Alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), Selected from TIFF2025514293000015.tif22170, R 91 is a bond, H, -D, C 1 ~C 6 Alkyl, -OH, -(C 1 ~C 6 (alkylene)-COOR 61 , -(C 1 ~C 6 Alkylene)-OR 61 , -(C 1 ~C 6 (alkylene)-CONR 61 , Selected from TIFF2025514293000016.tif22170, Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 are independently N or CR 11 is selected from R 11 are bonds, H, D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl), -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; Preferably, R 11 are independently a bond, H, -D, or -CH 3 , -F, -CF 3 , -OH, -OCH 3 , -NH 2 , -NH(C 1 ~C6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), R 72 , R 73 are independently H, -D, -CH 3 , -X, -CF 3 , -OH, -OCH 3 , -NH 2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -N 3 , -B(OH) 2 , -NO 2 , -COO(C 1 ~C 6 alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), R 31 is N or CR 36 and R 32 is NR 37 or -N=CR 38 - and R 35 or R 37 are independently H, -D, C 1 ~C 6 Alkyl, -OH, -(C 1 ~C 6 (alkylene)-COOR 61 , -(C 1 ~C 6 Alkylene)-OR 61 , -(C 1 ~C 6 (alkylene)-CONR 61 is selected from R 33 , R 34 , R 36 , R 38 are independently H, -D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl) 3 , -N 3 , -B(OH) 2, -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; Preferably, R 33 , R 34 , R 36 , R 38 are independently H, -D, -CH 3 , -F, -CF 3 , -OH, -OCH 3 , -NH 2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), R 24 does not exist or CR 23 , N.R. 27 is selected from R 25 CR 28 , N.R. 29 is selected from R 23 , R 26 , R 28 are independently H, -D, C 1 ~C 6 Alkyl, C 1 ~C 6 Haloalkyl, C 3 ~C 6 Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C 1 ~C 6 Alkyl) 3 , -N 3 , -B(OH) 2 , -NO 2 -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-RL -NR'R'', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; Preferably, R 23 , R 26 , R 28 are independently H, -D, -CH 3 , -F, -CF 3 , -OH, -OCH 3 , -NH 2 , -NH(C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)(C 1 ~C 6 Alkyl), -NO 2 , -COO(C 1 ~C 6 alkyl), -COOH, -CN, -Si(CH 3 ) 3 , -NHSO 2 (C 1 ~C 6 Alkyl), -SO 2 NH 2 , -SO 2 (C 1 ~C 6 alkyl), -N(C 1 ~C 6 Alkyl)SO 2 (C 1 ~C 6 Alkyl), -SO 2 NH(C 1 ~C 6 Alkyl), -SO 2 N(C 1 ~C 6 Alkyl)(C 1 ~C 6 alkyl), R 27 , R 29 are independently H, C 1 ~C 6 Alkyl, -OH, -(C 1 ~C 6 (alkylene)-COOR 61 , -(C 1 ~C6 Alkylene)-OR 61 , -(C 1 ~C 6 (alkylene)-CONR 61 ) More preferably, the non-naphthalene aromatic group is TIFF2025514293000017.tif17170, More preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000018.tif33170.

[0012] More preferably, R 51 , R 52 are independently H, D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0013] More preferably, the non-naphthalene aromatic group is TIFF2025514293000019.tif29170, and more preferably the non-naphthalene aromatic group is The file is TIFF2025514293000020.tif41170.

[0014] More preferably, R 61 , R 62 are independently H, -D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3, -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0015] More preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000021.tif240170.

[0016] More preferably, R 7 , R 7 ', R 7 '', R 7 ''', R 7α , R 7β are independently H, -D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 , a substituted or unsubstituted morpholine ring, and particularly preferably an unsubstituted morpholine ring.

[0017] More preferably, R 8 ' is selected from H or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, and the like.

[0018] More preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000022.tif146170.

[0019] More preferably, S 1 , S 2 , S 4 , S 5 , S 6 CR 94 It is.

[0020] More preferably, the R 94 -H, -D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0021] Preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000023.tif22170.

[0022] In an embodiment of the invention, the non-naphthalene aromatic group is The file is TIFF2025514293000024.tif20170.

[0023] Preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000025.tif23170.

[0024] More preferably, Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6is CR 11 It is.

[0025] More preferably, the R 11 -H, -D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0026] More preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000026.tif22170.

[0027] More preferably, the R 72 , R 73 -H, -D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0028] More preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000027.tif26170.

[0029] More preferably, the R 33 -H, -D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH 3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0030] More preferably, the R 34 , R 35 , R 37 is selected from H, D or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, and the like.

[0031] Preferably, the non-naphthalene aromatic group is The file is TIFF2025514293000028.tif23170.

[0032] More preferably, the R 27 , R 29 is independently selected from H, D or methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, and the like.

[0033] More preferably, the R 26 , R 28 are independently H, D, -F, -Br, -Cl, -I, -CH 3 , -CH 2 F, -CHF 2 , -CF 3 , -COOH, -CN, -COOCH 3 , -NH 2 , -NHCH 3 , -NO 2 , -OCH3 , -OH, -TMS, -SO 2 CH 3 , -NHSO 2 CH 3 , -SO 2 NH 2 is selected from.

[0034] Preferably, W 1 is C and W 2 is C, or W 1 is C and W 2 is N, or W 1 is C and W 2 is O.

[0035] Preferably, R 1 and R 2 are independently H, (=O), C 1 ~C 3 Alkyl, -COOH, -CF 3 , hydroxy, preferably R 1 and R 2 are both H.

[0036] Preferably, TIFF2025514293000029.tif18170 Preferably, TIFF2025514293000030.tif15170

[0037] Preferably, Ar 2 has the following structure: TIFF2025514293000031.tif24170

[0038] (where: n is 0 or 1, T 11 ~T 16 is independently selected from C, N, O, and S; T 17 represents one or more independent substituents on the ring, and is H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -RL -COR', -R L -C(O)OR', -R L -C(O)NR'R'', -R L -CH=NR', -R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L -N=CR'R'' and may be optionally substituted.

[0039] t is 1 or 2; R L is a univalent atom, alkylene, heteroalkylene, cycloalkylene, heterocyclylene, -NR 4 C(O)-, -NR 4 S(O) t -, -C(O)-, -C(O)O-, -NR 4 -, -C(O)NR 4 -, -S(O) t NR 4 -, optionally substituted; R 4 is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy; R' and R'' are independently selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, and may be optionally substituted.

[0040] In some embodiments of the present invention, Ar 2teeth, The file is TIFF2025514293000032.tif19170.

[0041] In a specific embodiment of the invention, the compound has the following structure: TIFF2025514293000033.tif31170

[0042] In a specific embodiment of the invention, the compound has the following structure: TIFF2025514293000034.tif29170

[0043] (L 6 is absent or a monovalent atom, -NH-, -N(CH 3 )-, -N(CH 3 )C(O)-, -NHC(O)-.

[0044] Preferably, B has the following structure:

[0045] -F, -Cl, -Br, -I, -NH 2 , -S(O) t NR 15 , TIFF2025514293000035.tif119170 (t is 1 or 2, Here, Z 2 ~Z 6 is independently selected from C, N, O, and S; Z 1 is selected from C, N, Z 7 is absent or a bond, C, N, O, S, C 1 ~C 6 alkylene; m1 to m4 are independently selected from integers of 0 to 5; R 12represents one or more independent substituents on the ring, and is H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF2025514293000036.tif14170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; R''' is H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, Selected from TIFF2025514293000037.tif13170, R 13 and R 13 ' are each independently H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -N 3 , -B(OH) 2 , -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF2025514293000038.tif14170-R L -CN, -R L -OR', -R L-OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -R L -N(S(O) t R')(S(O) t R''), -NR'-R L -NR''R'''', -R L -NO 2 , -R L -N=CR'R'', -R L -R'R'' and optionally substituted; R 14 and R 14 Each ' represents one or more independent substituents on the ring, and is H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF2025514293000039.tif15170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -NR'-R L -NR'R'', -R L -NO 2 , -R L -N=CR'R'' and may be optionally substituted.

[0046] More preferably, B has the following structure:

[0047] -F, -Cl, -Br, -I, -NH 2 , -S(O) t NR 15 , TIFF2025514293000040.tif78170 (where Z 1 and Z 4 is independently selected from C, N, O, and S; Z 4 is O or S, R 9 does not exist, t is 1 or 2; Z 7 is absent or a bond, C, N, O, S, C 1 ~C 3 alkylene; m1 and m2 are independently selected from integers of 0 to 5; Z 4 If S, then R 13 is absent or is carbonyl, R 14 is a carbonyl, R''' is H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, Selected from TIFF2025514293000041.tif14170, R 83、 R 84 is H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF2025514293000042.tif15170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O)t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -R L -N(S(O) t R')(S(O) t R''), -NR'-R L -NR''R'''', -R L -NO 2 , -R L - N = CR'R'' and is optionally substituted; Or R 83、 R 84 with the N atoms between them Form TIFF2025514293000043.tif23170, Z 9 ,S,NR 85 , O; m 5 is selected from 1, 2 or 3; R 85 is H, (=O), D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R L -COR', -R L -C(O)OR', -R L -C(O)NR'R'', TIFF2025514293000044.tif15170-R L -CN, -R L -OR', -R L -OC(O)R', -R L -S(O) t -NR'R'', -R L -S(O) t -R', -R L -NR'R'', -R L -NR'C(O)R'', -R L -NR'S(O) t R'', -R L -N(S(O) t R')(S(O) t R''), -NR'-R L-NR''R'''', -R L -NO 2 , -R L -N=CR'R'' and may be optionally substituted.

[0048] Preferably, B has the following structure:

[0049] -F, -Cl, -Br, -I, -NH 2 , -S(O) t NR 15 , TIFF2025514293000045.tif255162 (t is 1 or 2) In some embodiments of the present invention, B is In some embodiments of the present invention, B is -F, -Cl, -Br, -I, -NH 2 is selected from.

[0050] In some embodiments of the present invention, B is TIFF2025514293000047.tif18170 More preferably, R 14 and R 14 ' are each independently H or C 1 ~C 6 Alkyl, D, amino, The file is TIFF2025514293000048.tif15170.

[0051] More preferably, R 13 and R 13 are each independently selected from the following structures:

[0052] -H, -D, (=O), F, Cl, Br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, -CF 3 , -CH 2 D, -OH, -N 3 , -B(OH) 2 , TIFF2025514293000049.tif145170 The present invention further provides the following specific compounds: TIFF2025514293000050.tif230170TIFF2025514293000051.tif239170TIFF20255142930 00052.tif235170TIFF2025514293000053.tif244170TIFF2025514293000054.tif228170 TIFF2025514293000055.tif241170TIFF2025514293000056.tif244170TIFF20255142930 00057.tif216170TIFF2025514293000058.tif236170TIFF2025514293000059.tif255163

[0053] The present invention also provides pharmaceutical compositions comprising the above compounds or pharma- ceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds thereof, and one or more pharma- ceutically acceptable auxiliary materials.

[0054] The pharmaceutical composition may also contain one or more other co-active ingredients.

[0055] For example, the auxiliary material may be a carrier, a diluent, an adhesive, a lubricant, a wetting agent, or the like.

[0056] The compounds of the present invention may be prepared as pharmaceutical compositions in the form of syrups, elixirs, suspensions, powders, granules, tablets, capsules, lozenges, solutions, creams, ointments, lotions, gels, emulsions and the like.

[0057] The pharmaceutical preparation is preferably in unit dosage form. In this form, the preparation is divided into unit doses containing an appropriate amount of active ingredient. The unit dosage form may be a packaged preparation containing a discrete amount of preparation, such as tablets, capsules, and powders packaged in vials or ampoules. The amount of active ingredient in a unit dosage preparation may vary or be adjusted from 0.001mg to 1000mg, depending on the specific application and potency of the active ingredient.

[0058] The present invention also provides the use of the above compounds and pharma- ceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds thereof, and the above pharmaceutical compositions as PLpro inhibitors, e.g., as antiviral drugs.

[0059] The present invention also provides the use of the above compounds and their pharma- ceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds, and the above pharmaceutical compositions, in medicaments for reducing and / or inhibiting coronavirus replication.

[0060] The present invention also provides the use of the above compounds and pharma- ceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds thereof, the above pharmaceutical compositions, in the manufacture of a medicament for reducing and / or inhibiting coronavirus replication.

[0061] The present invention also provides the use of the above compounds and pharma- ceutically acceptable salts, stereoisomers, esters, prodrugs, solvates, and deuterated compounds thereof, the above pharmaceutical compositions, in the manufacture of a medicament for the prophylaxis and / or treatment of a disease or disorder caused by or associated with a viral infection.

[0062] Specifically, in the above uses, the compounds and pharmaceutical compositions have the definitions described in the present invention.

[0063] In one embodiment of the invention, the virus is a coronavirus, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2, in particular SARS-CoV, MERS-CoV, SARS-CoV-2.

[0064] In particular, the above-mentioned disease or disorder is a disease or disorder caused by or associated with a coronavirus infection, such as COVID-19, SARS, MERS, etc.

[0065] The present invention also provides a method for preventing and / or treating a disease or disorder caused by or associated with a viral infection, comprising the step of administering to a subject an effective amount of a compound according to the present invention or a pharma- ceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof, or a pharmaceutical composition according to the present invention.

[0066] Specifically, in the above methods, the compound, pharmaceutical composition, disease or disorder have the definitions set forth in the present invention.

[0067] In particular, the disease or disorder is a disease or disorder caused by or associated with a coronavirus infection, such as COVID-19, SARS, MERS.

[0068] Specifically, the subject is an animal, and in one embodiment of the invention, the subject is a mammal, such as a human, monkey, cat, dog, rat, bat, etc., and in another embodiment of the invention, the subject is an avian. [Brief description of the drawings]

[0069] [Figure 1] The curve of the inhibition rate of compound C21 is shown. [Diagram 2] The curve of the inhibition rate of compound C14 is shown. [Diagram 3]The curve of the inhibition rate of compound C24 is shown. [Figure 4] The curve of the inhibition rate of compound C16 is shown. [Diagram 5] The curve of the inhibition rate of compound C17 is shown. [Figure 6] The curve of inhibition rate of compound C18 is shown. [Figure 7] The curve of the inhibition rate of compound C26 is shown. [Figure 8] The curve of the inhibition rate of compound C75 is shown. [Figure 9] The curve of the inhibition rate of compound C76 is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0070] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0071] The term "alkyl" refers to a straight or branched hydrocarbon chain radical that does not contain unsaturated bonds and is connected to the rest of the molecule by a single bond. Typical alkyl groups are those that contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, isohexyl, and the like. When an alkyl is substituted with a cycloalkyl, one obtains a "cycloalkylalkyl" radical, such as cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, and the like. When an alkyl is substituted with an aryl, one obtains an "aralkyl" radical, such as benzyl, diphenylmethyl, or phenethyl, and the like. When an alkyl is substituted with a heterocyclyl, one obtains a "heterocyclylalkyl" radical. "Alkylene" generally refers to an alkanediyl having two free valence bonds, with typical alkylenes containing 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, such as methylene, ethylene, propylene, butylene, and the like.

[0072] The term "alkoxy" refers to a substituent formed by replacing the hydrogen of a hydroxy with an alkyl, where typical alkoxy groups contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) carbon atoms, such as, for example, methoxy, ethoxy, propoxy, butoxy, and the like.

[0073] The term "cycloalkyl" refers to a saturated or partially saturated (especially saturated) monocyclic or polycyclic group containing 1 to 4 monocyclic and / or fused rings and 3 to 18, preferably 3 to 10 (e.g., 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, such as, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or adamantyl.

[0074] The term "aryl" refers to a monocyclic or polycyclic radical, including monoaryl and / or polycyclic radicals containing fused aryl groups, e.g., containing 1 to 3 monocyclic or fused rings and 6 to 18 (e.g., 6, 8, 10, 12, 14, 16, 18) carbon ring atoms, with typical aryls being aryls containing 6 to 12 carbon ring atoms, such as phenyl, naphthyl, biphenyl, indenyl, etc. "Arylene" refers to a divalent group derived from an aromatic hydrocarbon by removal of two hydrogen atoms.

[0075] The term "heterocyclyl" includes heteroaromatic and heteroalicyclic groups containing from 1 to 3 monocyclic and / or fused rings and from 3 to about 18 ring atoms. Preferred heteroaromatic and heteroalicyclic groups contain from 5 to about 10 ring atoms. Suitable heteroaryls in the compounds of the present invention contain 1, 2 or 3 heteroatoms selected from N, O or S atoms. Examples of heteroaryl include, but are not limited to, coumarin, including 8-coumarin, quinolyl, including 8-quinolyl, isoquinolyl, pyridyl, pyrazinyl, pyrazolyl, pyrimidinyl, furyl, pyrrolyl, thienyl, thiazolyl, isothiazolyl, triazolyl, tetrazolyl, isoxazolyl, oxazolyl, imidazolyl, indolyl, isoindolyl, indazolyl, indolizinyl, phthalazinyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, pyridazinyl, triazinyl, cinnolinyl, benzimidazolyl, benzofuryl, benzofurazanyl, benzothienyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, and furopyridinyl. Suitable heteroalicyclic groups in the compounds of the present invention contain 1, 2, or 3 heteroatoms selected from N, O, or S atoms. Examples of heteroalicyclic groups include pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, oxathianyl, piperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxiranyl, thiiranyl, azepinyl, oxoazepanyl, diazepinyl, triazepinyl, 1,2,3,6-tetrahydropyridinyl, 2- These include, but are not limited to, pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1,3-dioxolanyl, pyrazolinyl, dithianyl, dithiolanyl, dihydropyranyl, dihydrothienyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, 3H-indolyl, and quinolizinyl.

[0076] The above groups may be substituted at one or more available positions with one or more suitable groups, such as, for example, OR', ═O, SR', SOR', SO 2 R', O.S.O. 2 R', O.S.O. 3 R', NO 2 , NHR', N(R') 2 , =N-R', N(R')COR', N(COR') 2 , N(R')SO 2 R', N(R')C(=NR')N(R')R', N 3 , CN, halogen, COR', COOR', OCOR', OCOOR', OCONHR', OCON(R') 2 , CONHR', CON(R') 2 , CON(R')OR', CON(R')SO 2 R', PO(OR') 2 , PO(OR')R', PO(OR')(N(R')R'), C 1 ~C 12 Alkyl, C 3 ~C 10 Cycloalkyl, C 2 ~C 12 Alkenyl, C 2 ~C 12 alkynyl, aryl, and heterocyclyl, where each R′ group is independently hydrogen, OH, NO 2 , N.H. 2 , SH, CN, halogen, COH, CO alkyl, COOH, C 1 ~C 12 Alkyl, C 3 ~C 10 Cycloalkyl, C 2 ~C 12 Alkenyl, C 2 ~C 12 and selected from alkynyl, aryl, and heterocyclyl, where these groups may themselves be substituted, the substituents being selected from the list above.

[0077] "Halogen" refers to bromine, chlorine, iodine, or fluorine. Haloalkyl refers to a group in which a hydrogen atom on an alkyl is replaced with a halogen atom (F, Cl, Br, I), e.g., -CH2 Rh, -CHRh 2 , -CRh 3 where Rh is F, Cl, Br or I, e.g., -CF 3 It is.

[0078] The term "pharmaceutical acceptable salt" refers to an acidic or basic salt that is theoretically free of toxicity, irritation and allergenicity, can achieve or provide clinically acceptable pharmacokinetic, absorption, distribution and metabolic properties of a drug molecule, and can achieve the intended purpose. The salts according to the present invention include pharmaceutical acceptable acid or base salts of acidic, basic or amphoteric groups of the compound. For a list of suitable salts, see S. M. Birge, et al., J. Pharm. Sci., 66, 1-19 (1977).

[0079] Pharmaceutically acceptable salts according to the invention include acid addition salts and base addition salts.

[0080] The acid addition salts include, but are not limited to, salts from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, and phosphonic acid, and salts from organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, alkanedioic acids, aromatic acids, and salts of aliphatic and aromatic sulfonic acids. Thus, these salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, hydrochloride, hydrobromide, iodate, acetate, propionate, octanoate, isobutyrate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, mandelate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, phthalate, benzenesulfonate, tosylate, phenylacetate, citrate, lactate, maleate, tartrate, methanesulfonate, and salts of amino acids such as arginate, gluconate, galacturonate, and the like. Acid addition salts can be prepared by contacting the free base form with a sufficient amount of the desired acid to form the salt in a conventional manner. The free base form may be regenerated by contacting the salt form with a base and the free base isolated in the conventional manner.

[0081] The base addition salts according to the present invention refer to salts formed with metals or amines, such as hydroxides of alkali metals and alkaline earth metals, or organic amines. Examples of metals used as cations include, but are not limited to, sodium, potassium, magnesium, and calcium. Examples of suitable amines include, but are not limited to, N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine (ethane-1,2-diamine), N-methylglucosamine, and procaine. The base addition salts can be prepared by contacting the free acid form with a sufficient amount of the desired base to form the salt in a conventional manner. The free acid form can be regenerated by contacting the salt form with an acid, and the free acid can be isolated in a conventional manner.

[0082] The term "solvate" should be understood to mean any form of the compound of the invention in which the compound is linked to another molecule (usually a polar solvent) by a non-covalent bond, including in particular hydrates and alcoholates, such as methanolates. Preferred solvates are hydrates.

[0083] The term "prodrug" is used in its broadest sense and includes derivatives that can be converted to the compounds of the present invention in vivo. Examples of prodrugs include, but are not limited to, derivatives and metabolites of compounds that contain a biohydrolyzable moiety, such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogs. Preferably, prodrugs with a carboxyl function are lower alkyl esters of carboxylic acids. The carboxylic acid esters are obtained by esterifying any carboxylic acid moiety present in the molecule. Prodrugs can usually be prepared by conventional methods, such as those described in Burger "Medicinal Chemistry and Drug Discovery 6th Edition (Donald J. Abraham ed., 2001, Wiley) and "Design and Applications of Prodrugs" (H. Bundgaard ed., 1985, Harwood Academic Publishers).

[0084] The term "absent" refers to the linking group being a connecting bond, e.g., In the TIFF2025514293000060.tif24170 structure, the absence of L6 means that Ar 2 is directly linked to B, and for example, -R L In -CH=NR', R L The absence of indicates that the group is -CH=NR'.

[0085] All compounds according to the present invention are intended to represent such a specific compound or any variation or form thereof. In particular, compounds referred to herein may have asymmetric centers and therefore exist in different enantiomeric or diastereomeric forms. Any given compound according to the present invention may represent any one racemate, one or more enantiomeric forms, one or more diastereomeric forms, and mixtures thereof. Similarly, stereoisomers or geometric isomers of double bonds may also exist, and in some cases, molecules may exist as (E)-isomers or (Z)-isomers (trans and cis isomers). When a molecule contains multiple double bonds, each double bond has its own stereoisomerism, which may be the same or different from the stereoisomerism of other double bonds of the molecule. Furthermore, compounds according to the present invention may exist as atropisomers. All stereoisomers of compounds according to the present invention, including enantiomers, diastereoisomers, geometric isomers, and atropoisomers, and mixtures thereof, are within the scope of the present invention.

[0086] Example 1: TIFF2025514293000061.tif21170C1: 1 H NMR (600 MHz, DMSO-d 6) δ 9.23 (s, 1H), 9.07 (s, 1H), 8.74 (dd, J = 9.4, 5.7 Hz, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.78 (d, J = 7.0 Hz, 1H), 7.73 (dd, J = 10.3, 2.7 Hz, 1H), 7.54 - 7.46 (m, 2H), 6.99 (d, J = 8.4 Hz, 1H), 6.81 (dd, J = 8.4, 2.8 Hz, 1H), 6.56 (d, J = 2.7 Hz, 1H), 4.08 (s, 2H), 3.50 (d, J = 12.2 Hz, 2H), 2.99 (t, J = 10.3 Hz, 2H), 1.95 (dd, J = 8.8, 4.3 Hz, 2H), 1.89 (d, J = 10.1 Hz, 5H), 1.36 (d, J = 5.0 Hz, 2H), 1.19 (d, J = 5.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d 6 ) δ 170.03, 160.14 (d, J = 243.6 Hz), 147.99, 138.34 (d, J = 18.6 Hz), 134.86, 131.30, 129.40, 128.68 (d, J = 8.6 Hz), 128.34, 127.64 (d, J = 5.2 Hz), 126.84, 125.53, 116.17, 116.00, 115.80, 113.51, 111.77 (d, J = 20.0 Hz), 54.19, 51.08, 34.58, 25.82, 18.27, 14.59. MS (ESI, m / z):C27H28FN3O, [M+H]+430.229.

[0087] Example 2: TIFF2025514293000062.tif25170C2: 1 1H NMR (600 MHz, DMSO-d 6) δ 9.09 - 9.06 (m, 1H), 8.73 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 8.0, 5.6 Hz, 1H), 7.67 (dt, J = 26.1, 7.3 Hz, 2H), 7.29 (dd, J = 10.6, 7.9 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.90 (dd, J = 8.4, 2.7 Hz, 1H), 6.65 (d, J = 3.0 Hz, 1H), 3.25 (dt, J = 8.6, 4.3 Hz, 4H), 3.16 (dd, J = 8.8, 4.6 Hz, 4H), 1.92 (s, 3H), 1.37 (d, J = 5.8 Hz, 2H), 1.19 (d, J = 5.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO-d 6 ) δ 169.93, 157.71 (d, J = 249.7 Hz), 148.11, 138.27, 134.47, 133.49, 131.44, 129.12 (d, J = 8.3 Hz), 127.36, 126.68 (d, J = 5.3 Hz), 125.84, 123.42 (d, J = 16.2 Hz), 120.85 (d, J = 5.4 Hz), 117.54, 115.14, 109.02 (d, J = 19.2 Hz), 46.17, 43.01, 34.14, 18.40, 14.58. MS (ESI, m / z):C25H26FN3O, [M+H]+404.212.

[0088] Example 3: TIFF2025514293000063.tif26170C3: 1 1H NMR (600 MHz, DMSO-d 6) δ 9.03 (s, 1H), 8.72 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.79 (dd, J = 8.0, 5.6 Hz, 1H), 7.72 - m 7.2 =2H (H). 10.6, 7.8 Hz, 1H), 6.96 (dd, J = 8.7, 2.7 Hz, 1H), 6.79 - 6.74 (m, 1H), 6.51 (d, J = 3.2 Hz, 1H), 3.84 (s, J = 2,0H), 3,2 2.80 (d, J = 11.6 Hz, 2H), 1.89 (s, 3H), 1.79 (d, J = 14.5 Hz, 4H), 1.35 (t, J = 3.3 Hz, 2H), 1.17 (d, J = 5.8 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.17, 157.70 (d, J = 249.4 Hz), 148.49, 138.16, 134.49, 133.48, 131.22, 129.07 (d, J = 8.3 Hz), 7.6,127. 123.43 (d, J = 15.6 Hz), 120.85, 115.36, 113.12, 109.01 (d, J = 19.1 Hz), 54.13, 52.57, 34.14, 27.52, 18.26. MS (ESI, m / z):C27H28FN3O, [M+H]+430.229.

[0089] Chapter 4: TIFF2025514293000064.tif26170C4: 1 H NMR (600 MHz, DMSO-d 6) δ 9.46 (s, 1H), 9.01 (d, J = 2.7 Hz, 1H), 7.56 (dd, J = 12.5, 3.4 Hz, 2H), 7.52 - 7.47 (m, 2H), 7.35 (t, J = 7.7 Hz, 1H), 7.18 - 7.14 (m, 1H), 7.11 (dd, J = 8.6, 5.5 Hz, 2H), 6.90 (d, J = 6.0 Hz, 2H), 4.14 (s, 2H), 3.62 (d, J = 12.2 Hz, 2H), 3.15 (t, J = 10.6 Hz, 2H), 2.24 (s, 3H), 2.05 - 1.90 (m, 4H), 1.32 (s, 2H), 1.31 - 1.29 (m, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.34, 148.14, 144.99, 137.92, 133.87, 131.56, 129.50, 128.96, 126.09, 125.89, 124.06, 123.92, 123.19, 122.63, 115.99, 113.68, 54.17, 51.10, 34.59, 25.90, 18.84, 18.79. MS (ESI, m / z):C27H29N3OS, [M+H]+444.209.

[0090] Example 5: TIFF2025514293000065.tif26170C5: 1 1H NMR (600 MHz, DMSO-d 6) δ 11.09 (d, J = 15.0 Hz, 1H), 9.02 (s, 1H), 7.60 - 7.54 (m, 2H), 7.52 - 7.47 (m, 2H), 7.35 (t, J = 7.7 Hz, 1H), 7.16 (t, J = 4.4 Hz, 1H), 7.11 (t, J = 8.7 Hz, 2H), 6.91 (d, J = 6.3 Hz, 2H), 4.06 (t, J = 3.4 Hz, 2H), 3.69 (dd, J = 12.7, 2.7 Hz, 2H), 3.32 (dd, J = 26.5, 12.7 Hz, 2H), 2.74 (d, J = 5.0 Hz, 3H), 2.24 (s, 3H), 2.21 (dd, J = 8.9, 4.4 Hz, 2H), 1.98 (t, J = 6.7 Hz, 2H), 1.32 (s, 2H), 1.30 (s, 2H). 13 13C NMR (151 MHz, DMSO-d 6 ) δ 170.32, 147.80, 144.99, 144.08, 137.97, 133.86, 131.55, 129.50, 128.96, 126.12, 125.89, 124.06, 123.90, 123.17, 122.63, 116.02, 113.73, 62.39, 51.63, 38.65, 34.58, 23.97, 18.83, 18.80. MS (ESI, m / z):C28H31N3OS, [M+H]+458.224.

[0091] Example 6: TIFF2025514293000066.tif26170C6: 1 1H NMR (600 MHz, DMSO-d 6) δ 9.41 (s, 1H), 9.03 (s, 1H), 7.57 (d, J = 5.1 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.52 - 7.48 (m, 2H), 7.36 (t, J = 7.7 Hz, 1H), 7.18 - 7.13 (m, 2H), 7.11 (d, J = 7.9 Hz, 1H), 7.00 (d, J = 7.5 Hz, 2H), 3.44 - 3.37 (m, 4H), 3.22 (p, J = 4.6 Hz, 4H), 2.26 (s, 3H), 1.36 - 1.30 (m, 4H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.20, 148.22, 144.98, 144.07, 137.94, 133.89, 131.71, 129.50, 128.96, 127.12, 126.12, 124.07, 123.94, 123.20, 122.59, 117.87, 115.37, 46.27, 42.97, 34.60, 18.95, 18.80. MS (ESI, m / z):C25H27N3OS, [M+H]+418.193.

[0092] Example 7: TIFF2025514293000067.tif25170C7: 1 H NMR (600 MHz, DMSO-d 6) δ 9.34 (s, 1H), 8.92 (s, 1H), 7.34 (d, J = 2.3 Hz, 1H), 7.25 - 7.18 (m, 2H), 7.11 (d, J = 8.4 Hz, 1H), 6.96 (dd, J = 7.0, 2.2 Hz, 1H), 6.92 - 6.85 (m, 2H), 4.14 (s, 2H), 3.61 (dd, J = 12.7, 2.8 Hz, 2H), 3.10 (d, J = 12.0 Hz, 2H), 2.23 (s, 3H), 1.99 (dt, J = 12.5, 5.3 Hz, 2H), 1.97 - 1.90 (m, 2H), 1.28 (d, J = 1.9 Hz, 9H), 1.24 (dd, J = 5.8, 3.8 Hz, 4H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.16, 150.54, 148.08, 143.49, 138.03, 131.54, 128.30, 125.92, 122.88, 122.10, 121.67, 115.97, 113.71, 54.22, 51.13, 34.72, 31.67, 25.88, 18.78, 18.72. MS (ESI, m / z):C27H25N3O, [M+H]+418.284.

[0093] Example 8: TIFF2025514293000068.tif25170C8: 1 H NMR (600 MHz, DMSO-d 6) δ 8.94 - 8.90 (m, 1H), 7.34 (d, J = 1.8 Hz, 1H), 7.23 - 7.20 (m, 2H), 7.11 (d, J = 8.2 Hz, 1H), 6.96 (dt, J = 6.9, 1.8 Hz, 1H), 6.92 - 6.89 (m, 1H), 6.87 (d, J = 2.7 Hz, 1H), 4.07 (s, 2H), 3.68 (d, J = 12.2 Hz, 2H), 3.34 - 3.24 (m, 2H), 2.75 (dt, J = 8.1, 3.6 Hz, 3H), 2.26 - 2.18 (m, 5H), 1.97 (t, J = 6.9 Hz, 2H), 1.28 (d, J = 1.2 Hz, 9H), 1.22 - 1.29 (m, 4H). 13 13C NMR (151 MHz, DMSO-d 6 ) δ 170.14, 150.53, 147.71, 143.48, 138.08, 131.53, 128.30, 125.93, 122.89, 122.11, 121.68, 116.00, 113.78, 62.44, 51.74, 38.66, 34.73, 31.68, 23.91, 18.77, 18.72. MS (ESI, m / z): C28H37N3O, [M+H]+ 432.299.

[0094] Example 9: TIFF2025514293000069.tif20170C9: 1 1H NMR (600 MHz, DMSO-d 6) δ 9.07 (s, 1H), 8.74 (dd, J = 9.3, 5.7 Hz, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.79 (d, J = 7.1 Hz, 1H), 7.73 (Hdd, J = 1.5. 14. - 7.46 (m, 2H), 6.98 (d, J = 8.2 Hz, 1H), 6.42 (dd, J = 8.2, 2.6 Hz, 1H), 6.19 (d, J = 2.6 Hz, 1H), 4.13 (s, Hz, 1H = 9), 4. 3.83 (dd, J = 8.8, 5.4 Hz, 2H), 2.75 (s, 6H), 1.91 (s, 3H), 1.35 (q, J = 4.3 Hz, 2H), 1.19 (q, J = 4.6 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 169.93, 160.15 (d, J = 243.5 Hz), 148.98, 138.35 (d, J = 11.8 Hz), 134.85, 131.23, 129.41, 128.4 87 (d, J = Hz). 127.65 (d, J = 5.1 Hz), 126.85, 124.40, 116.12 (d, J = 24.7 Hz), 113.16, 111.77 (d, J = 19.7 Hz), 110.79, 54.5. 6.41pm, 2.65pm. MS (ESI, m / z):C26H28FN3O, [M+H]+418.228.

[0095] Chapter 10: TIFF2025514293000070.tif21170C10: 1 H NMR (600 MHz, DMSO-d 6) δ 9.06 (s, 1H), 8.64 (dd, J = 13.2, 8.2 Hz, 1H), 8.02 (dd, J = 11.7, 8.5 Hz, 1H), 7.86 (d, J = 8.3 Hz, 1H), 7.82 (d, J = 7.1 Hz, 1H), 7.51 (t, J = 7.7 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 3.82 (t, J = 7.0 Hz, 2H), 3.42 (d, J = 13.2 Hz, 2H), 3.13 (s, 1H), 2.08 (s, 6H), 1.91 (s, 3H), 1.36 - 1.30 (m, 2H), 1.18 (q, J = 4.8 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.15, 150.03, 138.63 - 136.56 (m), 131.18, 129.44 (d, J = 26.9 Hz), 127.62 (d, J = 4.6 Hz), 126.27, 123.19, 114.92 (d, J = 15.9 Hz), 112.77, 112.21 (d, J = 17.4 Hz), 110.39, 56.29, 41.94, 34.50, 18.33. MS (ESI, m / z):C26H27F2N3O, [M+H]+436.219.

[0096] Example 11: TIFF2025514293000071.tif25170C11: 1 1H NMR (600 MHz, DMSO-d 6) δ 9.08 (s, 1H), 8.77 - 8.72 (m, 1H), 8.26 - 8.20 (m, 1H), 7.80 (d, J = 7.6 Hz, 1H), 7.75 - 7.69 (m, 2H), 7.68 (d, J = 7.7 Hz, 1H), 6.99 (d, J = 8.2 Hz, 1H), 6.42 (dd, J = 8.2, 2.6 Hz, 1H), 6.19 (d, J = 2.6 Hz, 1H), 4.15 - 4.09 (m, 1H), 4.00 (t, J = 8.0 Hz, 2H), 3.79 (td, J = 11.7, 10.3, 5.7 Hz, 3H), 2.76 (s, 6H), 1.91 (s, 3H), 1.40 - 1.33 (m, 2H), 1.21 (d, J = 5.4 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.01, 148.98, 138.22, 137.85, 133.46, 131.25, 130.50, 129.38, 127.57, 127.26, 126.34, 125.98, 124.72, 124.43, 113.22, 110.82, 55.73, 54.52, 34.27, 25.97, 18.43, 14.67. MS (ESI, m / z):C26H28ClN3O, [M+H]+434.199.

[0097] Example 12: TIFF2025514293000072.tif25170C12: 1 H NMR (600 MHz, DMSO-d 6) δ 8.94 (s, 1H), 8.63 (d, J = 8.5 Hz, 1H), 8.18 (d, J = 8.3 Hz, 1H), 7.73 (d, J = 7.9 Hz, 1H), 7.58 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.50 (dd, J = 8.3, 6.8 Hz, 1H), 6.91 (d, J = 8.1 Hz, 2H), 6.33 (dd, J = 8.2, 2.5 Hz, 1H), 6.11 (d, J = 2.6 Hz, 1H), 3.97 (s, 3H), 3.80 (t, J = 7.0 Hz, 2H), 3.41 (t, J = 6.5 Hz, 2H), 3.18 - 3.10 (m, 1H), 2.08 (s, 6H), 1.91 (s, 3H), 1.35 - 1.26 (m, 2H), 1.12 (d, J = 5.4 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.00, 154.62, 149.98, 138.22, 133.06, 131.08, 129.32, 125.53, 125.22, 123.26, 122.35, 112.63, 110.47, 103.71, 56.68, 56.27, 56.00, 46.02, 41.92, 34.12, 18.44, 14.62. MS (ESI, m / z):C27H31N3O2, [M+H]+430.249.

[0098] Example 13: TIFF2025514293000073.tif26170C13: 1 1H NMR (600 MHz, DMSO-d 6) δ 9.06 (singlet, 1H), 8.77 - 8.71 (multiplet, 1H), 8.22 - 8.16 (multiplet, 1H), 7.86 (doublet, J = 7.7 Hz, 1H), 7.73 (doublet, J = 7.7 Hz, 1H), 7.72 - 7.67 (multiplet, 2H), 6.92 (doublet, J = 8.2 Hz, 1H), 6.34 (doublet of doublets, J = 8.2, 2.6 Hz, 1H), 6.11 (doublet, J = 2.6 Hz, 1H), 3.81 (triplet, J = 7.0 Hz, 2H), 3.42 (singlet, 2H), 3.15 (singlet, 1H), 2.25 - 2.02 (multiplet, 6H), 1.89 (singlet, 3H), 1.38 - 1.34 (multiplet, 2H), 1.19 (doublet, J = 5.7 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.22, 149.98, 138.57, 137.94, 133.60, 131.72, 131.13, 129.80, 129.71, 127.80, 127.43, 127.21, 126.41, 123.24, 121.77, 112.75, 110.43, 56.65, 56.27, 41.91, 34.33, 18.41, 14.59. MS (ESI, m / z):C26H28BrN3O, [M+H]+478.149.

[0099] Example 14: TIFF2025514293000074.tif24170C14: 1H NMR (600 MHz, DMSO-d6) δ 8.98 (s, 1H), 8.72 - 8.66 (m, 1H), 8.06 - 8.00 (m, 1H), 7.69 (d, J = 7.2 Hz, 1H), 7.61 - 7.53 (m, 2H), 7.31 (dd, J = 7.2, 1.1 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.2, 2.6 Hz, 1H), 6.11 (d, J = 2.6 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.6 Hz, 2H), 3.15 (s, 1H), 2.64 (s, 3H), 2.10 (s, 6H), 1.91 (s, 3H), 1.33 (q, J = 3.1 Hz, 2H), 1.14 (q, J = 4.5 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ 170.03, 149.96, 138.14, 136.33, 133.91, 132.87, 132.33, 131.09, 128.56, 126.16, 125.79, 125.09, 123.31, 112.67, 110.51, 56.65, 56.26, 41.90, 34.48, 19.58, 18.47, 14.63. MS (ESI, m / z): C27H31N3O, [M+H]+414.254. Figure 2 shows the inhibition rate curve of compound C14.

[0100] Example 15: TIFF2025514293000075.tif25170C15: 1H NMR (600 MHz, DMSO-d6) δ 9.03 (s, 1H), 8.72 (d, J = 8.4 Hz, 1H), 8.12 (d, J = 8.4 Hz, 1H), 7.81 (d, J = 7.9 Hz, 1H), 7.71 - 7.62 (m, 2H), 7.55 - 7.29 (m, 1H), 7.27 (d, J = 7.9 Hz, 1H), 6.92 (d, J = 8.1 Hz, 1H), 6.34 (dd, J = 8.4, 2.5 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (t, J = 6.6 Hz, 2H), 3.11 (p, J = 6.3 Hz, 1H), 2.07 (s, 6H), 1.91 (s, 3H), 1.35 (s, 2H), 1.18 - 1.15 (m, 2H). 13C NMR (151 MHz, DMSO-d6) δ 170.18, 150.02, 146.55, 131.13, 128.76, 127.21, 126.73, 125.87, 121.98, 117.32 (t, J = 257.8 Hz), 112.65, 110.44, 56.75, 56.30, 41.98, 14.58. MS (ESI, m / z):C27H29F2N3O, [M+H]+466.230.

[0101] Example 16: TIFF2025514293000076.tif27170C16: 1 1H NMR (400 MHz, DMSO-d 6) δ 9.02 (s, 1H), 8.72 (d, J = 6.5 Hz, 1H), 8.07 (d, J = 6.5 Hz, 1H), 7.78 (s, 1H), 7.67 (t, J = 8.7 Hz, 2H), 7.28 (t, J = 8.5 Hz, 1H), 6.90 (d, J = 7.6 Hz, 1H), 6.34 (d, J = 7.2 Hz, 1H), 6.11 (s, 1H), 3.79 (s, 2H), 3.10 (s, 1H), 2.06 (s, 6H), 1.87 (s, 3H), 1.33 (s, 2H), 1.23 (s, 2H), 1.16 (s, 2H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 169.69, 153.27 (d, J H-F = 245.2 Hz), 149.57, 137.55, 132.64 (d, J H-F = 23.8 Hz), 130.65, 129.11, 128.66, 128.57, 125.41, 126.87, 126.21, 125.40 (d, J H-F = 15.2 Hz), 122.73, 112.24, 109.94, 56.30, 55.84, 41.53, 33.64, 17.93, 14.08. MS (ESI, m / z): C 26 H 28 FN 3 O, [M+H] +418.221. Figure 4 shows the inhibition rate curve of compound C16.

[0102] Example 17: TIFF2025514293000077.tif26170C17: 1H NMR (400 MHz, Methanol-d4) δ 8.61 (d, J = 8.4 Hz, 1H), 8.26 (d, J = 8.6 Hz, 1H), 8.02 (d, J = 7.2 Hz, 1H), 7.84 - 7.37 (m, 3H), 7.01 (d, J = 7.9 Hz, 1H), 6.48 (d, J = 7.9 Hz, 1H), 6.26 (s, 1H), 4.07 (d, J = 8.4 Hz, 2H), 3.81 (s, 2H), 3.33 (s, 6H), 2.82 (s, 3H), 1.98 (s, 2H), 1.48 (s, 2H). 13 C NMR (100 MHz, Methanol-d4) δ 168.39, 147.15, 134.48, 133.47, 133.09, 132.97, 132.49, 132.11, 130.49, 127.97, 126.87, 125.47, 125.09, 125.04, 123.29, 116.05, 112.55, 61.03, 49.74, 42.05, 35.70, 20.80, 18.80. MS(ESI, m / z): C26H28ClN3O, [M+H]+434.191. Figure 5 shows the inhibition rate curve of compound C17.

[0103] Example 18: TIFF2025514293000078.tif26170C18: 1 H NMR (400 MHz, Methanol-d4) δ 8.42 (d, J = 8.5 Hz, 1H), 8.02 (dd, J = 28.6, 7.7 Hz, 2H), 7.65 - 7.44 (m, 2H), 7.23 (t, J = 9.1 Hz, 1H), 6.97 (d, J = 8.1 Hz, 1H), 6.44 (d, J = 8.2 Hz, 1H), 6.24 (s, 1H), 3.96 (t, J = 7.3 Hz, 2H), 3.70 - 3.41 (m, 3H), 3.33 (s, 3H), 2.45 (s, 6H), 1.96 (s, 2H), 1.46 (s, 2H).13 13C NMR (100 MHz, Methanol-d4) δ 168.39, 161.79, 159.27, 147.15, 134.48, 134.38, 134.35, 132.97, 132.11, 132.03, 130.49, 126.98, 126.90, 125.47, 125.44, 123.77, 123.57, 123.53, 123.45, 121.61, 121.58, 116.05, 112.69, 112.55, 112.49, 61.03, 49.74, 42.05, 35.98, 20.80, 18.80. MS(ESI, m / z): C26H28FN3O, [M+H]+418.223. Figure 6 shows the inhibition rate curve of Compound C18.

[0104] Example 19: TIFF2025514293000079.tif22170C19: 1 1H NMR (600 MHz, DMSO-d 6 ) δ 8.88 (s, 1H), 7.30 (t, J = 7.6 Hz, 2H), 7.26 - 7.20 (m, 2H), 7.18 (t, J = 7.5 Hz, 1H), 7.06 (d, J = 8.3 Hz, 1H), 6.47 (d, J = 6.8 Hz, 2H), 4.03 (s, 2H), 3.79 (s, 2H), 3.47 (s, 1H), 2.20 (s, 3H), 1.24 (s, 4H). 13 13C NMR (151 MHz, DMSO-d 6 ) δ 170.20, 143.96, 137.91, 131.41, 128.85, 128.50, 126.83, 126.01, 125.11, 124.57, 113.17, 110.89, 55.97, 54.13, 52.84, 34.63, 19.58, 18.92, 18.67. MS (ESI, m / z):C22H27N3O, [M+H]+350.222.

[0105] Example 20: TIFF2025514293000080.tif23170C20: 1 H NMR (600 MHz, DMSO-d 6 ) δ 9.11 (s, 1H), 8.32 (d, J = 8.0 Hz, 1H), 7.96 (d, J = 8.0 Hz, 1H), 7.67 (s, 1H), 7.43 (t, J = 7.5 Hz, 1H), 7.38 (d, J = 7.7 Hz, 1H), 7.00 (d, J = 8.2 Hz, 1H), 6.43 (dd, J = 8.1, 2.6 Hz, 1H), 6.27 (d, J = 2.6 Hz, 1H), 4.18 (d, J = 8.0 Hz, 1H), 4.01 (t, J = 7.8 Hz, 2H), 3.91 (dd, J = 8.6, 5.6 Hz, 2H), 2.71 (s, 6H), 2.51 (d, J = 4.5 Hz, 3H), 1.98 (s, 3H), 1.21 (d, J = 4.2 Hz, 2H), 1.18 (d, J = 4.3 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 169.94, 148.98, 140.23, 138.79, 138.20, 137.75, 131.24, 125.73, 124.69, 124.48, 124.31, 123.50, 123.41, 113.14, 110.90, 55.19, 54.27, 40.52, 40.08, 30.79, 18.55, 14.13. MS (ESI, m / z):C24H27N3OS, [M+H]+406.194.

[0106] Example 21: TIFF2025514293000081.tif20170C21: 1 H NMR (600 MHz, DMSO-d 6) δ 8.68 (s, 1H), 7.40 (dd, J = 7.6, 1.4 Hz, 1H), 7.01 (t, J = 7.5 Hz, 1H), 6.95 (dd, J = 14.7, 7.9 Hz, 2H), 6.37 (dd, J = 8.2, 2.5 Hz, 1H), 6.20 (d, J = 2.5 Hz, 1H), 3.87 (t, J = 7.1 Hz, 2H), 3.49 (t, J = 6.5 Hz, 2H), 3.23 (s, 1H), 2.97 (t, J = 6.2 Hz, 2H), 2.74 (t, J = 6.2 Hz, 2H), 2.15 (s, 6H), 2.03 (s, 3H), 1.75 (ddt, J = 18.6, 11.3, 3.7 Hz, 4H), 1.12 (q, J = 4.7, 4.2 Hz, 2H), 1.01 (t, J = 3.5 Hz, 2H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 169.95, 149.94, 139.85, 138.19, 137.24, 136.73, 131.11, 129.08, 128.34, 124.73, 123.43, 112.65, 110.58, 56.56, 56.28, 41.85, 34.82, 29.84, 26.33, 23.28, 23.08, 18.50, 14.59. MS (ESI, m / z): C26H33N3O, [M+H]+404.269. Figure 1 shows the inhibition rate curve of compound C21.

[0107] Example 22: TIFF2025514293000082.tif34170C22: 1 H NMR (600 MHz, DMSO-d 6) δ 8.92 (s, 1H), 7.70 - 7.64 (m, 2H), 7.63 - 7.59 (m, 2H), 7.50 - 7.40 (m, 2H), 7.35 (td, J = 7.3, 1.3 Hz, 1H), 7.34 - 7.30 (m, 2H), 7.04 (d, J = 8.1 Hz, 1H), 6.47 (d, J = 2.5 Hz, 1H), 6.43 (dd, J = 8.1, 2.5 Hz, 1H), 3.93 (t, J = 7.0 Hz, 2H), 3.54 (t, J = 6.4 Hz, 2H), 3.20 (s, 1H), 2.21 (s, 3H), 2.13 (s, 6H), 1.31 - 1.26 (m, 4H). 13 C NMR (151 MHz, DMSO-d 6 ) δ 170.41, 150.16, 143.40, 140.42, 137.88, 137.74, 131.37, 129.44, 129.38, 127.66, 126.93, 126.81, 125.70, 123.65, 112.91, 110.64, 56.79, 56.36, 41.99, 34.50, 18.95, 18.77. MS (ESI, m / z):C28H31N3O, [M+H]+426.254.

[0108] Example 23: TIFF2025514293000083.tif27170C23: 1 1H NMR (400 MHz, Chloroform-d) δ 7.61 - 7.51 (m, 4H), 7.47 - 7.29 (m, 6H), 7.03 (d, J = 8.2 Hz, 1H), 6.55 - 6.40 (m, 3H), 3.96 (t, J = 6.9 Hz, 2H), 3.70 - 3.62 (m, 2H), 3.28 (q, J = 6.3 Hz, 1H), 3.10 (q, J = 7.4 Hz, 22H), 2.32 (s, 3H), 2.23 (s, 6H), 1.39 (s, 4H). MS (ESI, m / z):C28H31N3O, [M+H]+426.254.

[0109] Example 24: TIFF2025514293000084.tif21170C24: 1 H NMR (600 MHz, DMSO-d6) δ 9.04 (s, 1H), 8.00 (d, J = 2.2 Hz, 1H), 7.46 (d, J = 8.1 Hz, 1H), 7.34 (d, J = 2.2 Hz, 1H), 7.30 (d, J = 7.5 Hz, 1H), 7.24 (t, J = 7.8 Hz, 1H), 6.97 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.26 (d, J = 2.6 Hz, 1H), 3.88 (t, J = 7.1 Hz, 2H), 3.52 (t, J = 6.3 Hz, 2H), 2.88 (s, 1H), 2.17 (s, 6H), 2.02 (s, 3H), 1.23 (q, J = 2.5 Hz, 4H). 13C NMR (151 MHz, DMSO-d6) δ 170.05, 154.97, 149.94, 145.67, 137.98, 136.48, 131.20, 126.61, 124.13, 123.48, 122.29, 112.78, 110.52, 110.26, 106.70, 56.27, 41.83, 34.48, 18.55, 16.96, 15.04. MS (ESI, m / z):C24H27N3O2, [M+H]+390.217. Figure 3 shows the inhibition rate curve of compound C24.

[0110] Example 25: TIFF2025514293000085.tif22170C25: 11H NMR (600 MHz, DMSO-d6) δ 8.56 (s, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.19 (td, J = 7.2, 2.2 Hz, 1H), 7.15 - 7.09 (m, 2H), 6.91 (d, J = 8.2 Hz, 1H), 6.33 (dd, J = 8.2, 2.6 Hz, 1H), 6.26 (t, J = 4.6 Hz, 1H), 6.10 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.5 Hz, 2H), 3.17 (s, 1H), 2.65 (t, J = 8.0 Hz, 2H), 2.22 (td, J = 8.0, 4.6 Hz, 2H), 2.11 (s, 6H), 1.92 (s, 3H), 1.08 (q, J = 4.6 Hz, 2H), 0.95 (q, J = 4.7 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ 169.96, 149.94, 138.36, 136.76, 136.45, 134.00, 131.02, 128.08, 127.76, 126.86, 126.37, 124.66, 123.36, 112.55, 110.51, 56.70, 56.29, 43.52, 41.92, 34.25, 27.87, 22.96, 19.04, 18.28, 13.49. MS (ESI, m / z):C26H31N3O, [M+H]+402.254..

[0111] Example 26: TIFF2025514293000086.tif25170C26: 1H NMR (400 MHz, DMSO) δ 9.13 (dt, J = 8.7, 1.7 Hz, 1H), 9.05 (s, 1H), 8.98 (dd, J = 4.2, 1.6 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.6 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.40 (dd, J = 7.4, 5.7 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.06 (s, 6H), 1.86 (s, 3H), 1.35 (q, J = 4.7 Hz, 2H), 1.27 - 1.16 (m, 2H). 19 F NMR (376 MHz, DMSO) δ -126.10. MS (ESI, m / z)C25H27F4O[M+H]+ 419.217 Figure 7 shows the inhibition rate curve of compound C26.

[0112] Example 27: TIFF2025514293000087.tif22170C27: 11H NMR (600 MHz, DMSO) δ 9.20 (d, J = 5.1 Hz, 1H), 8.88 (d, J = 4.4 Hz, 1H), 8.67 (d, J = 8.4 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.4, 6.8, 1.5 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.69 - 7.64 (m, 1H), 6.95 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.18 (d, J = 2.6 Hz, 1H), 3.91 (d, J = 7.0 Hz, 2H), 3.66 (s, 2H), 3.07 (dp, J = 7.7, 4.0 Hz, 1H), 2.42 (s, 6H), 1.88 (s, 3H), 1.42 - 1.32 (m, 2H), 1.28 - 1.23 (m, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.31, 150.66, 149.45, 148.73, 146.85, 137.83, 131.20, 130.11, 129.37, 127.44, 126.63, 125.90, 123.87, 123.01, 113.04, 110.63, 55.72, 55.39, 45.95, 40.96, 40.53, 33.94, 18.38, 14.07, 8.98. MS (ESI, m / z): C25H28N4O, [M+H]+ 401.234.

[0113] Example 28: TIFF2025514293000088.tif22170C28: 11H NMR (600 MHz, DMSO) δ 9.20 (d, J = 7.8 Hz, 1H), 8.88 (d, J = 4.4 Hz, 1H), 8.66 (d, J = 8.4 Hz, 1H), 8.06 (d, J = 8.4 Hz, 1H), 7.80 - 7.74 (m, 1H), 7.74 - 7.64 (m, 2H), 6.98 (dd, J = 8.3, 2.1 Hz, 1H), 6.42 (dd, J = 7.9, 2.5 Hz, 1H), 6.20 (d, J = 2.5 Hz, 1H), 4.11 (s, 1H), 3.98 (t, J = 7.5 Hz, 2H), 3.89 - 3.78 (m, 2H), 2.69 (s, 6H), 1.90 (d, J = 2.5 Hz, 3H), 1.37 (q, J = 5.0 Hz, 2H), 1.26 (q, J = 5.1 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.24, 150.67, 149.08, 148.72, 146.83, 137.94, 131.25, 130.11, 129.40, 127.44, 126.67, 125.88, 123.06, 113.24, 110.78, 54.54, 33.94, 18.39, 14.11. MS (ESI, m / z): C25H28N4O, [M+H]+401.233.

[0114] Example 29: TIFF2025514293000089.tif26170C29: 1H NMR (600 MHz, DMSO) δ 9.16 (dd, J = 8.6, 1.6 Hz, 1H), 9.11 (d, J = 2.8 Hz, 1H), 9.05 (dd, J = 4.1, 1.6 Hz, 1H), 7.7 Hz (d (d, J = 7.7 Hz, 1H), 7.73 (dd, J = 8.6, 4.1 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.6 Hz, 1H), 6.3, J.1 = 2.16 (d J = 7.2 Hz, 2H), 3.64 (s, 2H), 2.51 - 2.38 (m, 6H), 1.88 (s, 3H), 1.39 - 1.33 (m, 2H), 1.22 (q, J = 4.7 Hz, 2H). 13 C NMR (151 MHz, DMSO) δ 123.74, 122.43, 113.03, 110.52, 55.90, 55.48, 33.72, 18.36, 14.46, 9.09. MS (ESI, m / z):C25H27ClN4O, [M+H]+435.195.

[0115] Chapter 30: TIFF2025514293000090.tif27170C30: 11H NMR (600 MHz, DMSO) δ 9.11 (s, 1H), 8.80 (d, J = 4.3 Hz, 1H), 8.17 (d, J = 8.5 Hz, 1H), 7.71 (d, J = 4.3 Hz, 1H), 7.56 (t, J = 8.1 Hz, 1H), 7.18 (d, J = 7.7 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.2, 2.5 Hz, 1H), 6.15 (d, J = 2.5 Hz, 1H), 3.96 (s, 3H), 3.84 (t, J = 7.2 Hz, 2H), 3.48 (s, 2H), 3.24 (s, 1H), 2.18 (s, 6H), 1.88 (s, 3H), 1.34 (t, J = 3.4 Hz, 2H), 1.22 (q, J = 5.0 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.34, 156.19, 149.86, 148.87, 146.49, 140.70, 137.77, 131.15, 128.58, 123.53, 123.43, 117.33, 112.86, 110.49, 108.25, 56.18, 56.11, 41.49, 34.24, 18.38, 14.11. MS (ESI, m / z): C26H30N4O2, [M+H]+ 431.244.

[0116] Example 31: TIFF2025514293000091.tif24170C31: 11H NMR (600 MHz, DMSO) δ 9.07 (s, 1H), 8.74 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 8.0, 5.5 Hz, 1H), 7.72 - 7.62 (m, 2H), 7.29 (dd, J = 10.6, 7.9 Hz, 1H), 7.00 (d, J = 8.5 Hz, 1H), 6.90 (dd, J = 8.3, 2.6 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.82 - 3.76 (m, 1H), 3.46 - 3.41 (m, 1H), 3.22 (s, 1H), 2.82 (d, J = 11.2 Hz, 1H), 2.73 (s, 6H), 2.60 (t, J = 10.5 Hz, 1H), 2.06 (s, 1H), 1.93 (s, 3H), 1.83 - 1.77 (m, 1H), 1.55 (h, J = 6.9 Hz, 2H), 1.37 (q, J = 3.1 Hz, 2H), 1.18 (d, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.01, 158.54, 156.88, 148.56, 138.21, 134.51 (d, J = 4.0 Hz), 133.52 (d, J = 4.6 Hz), 131.40, 129.12 (d, J = 8.3 Hz), 127.36, 126.69, 126.11, 125.85, 123.42 (d, J = 16.0 Hz), 120.85 (d, J = 5.3 Hz), 117.95, 115.71, 109.08, 108.96, 60.98, 49.72, 49.55, 34.14, 24.55, 23.25, 18.42, 14.59. MS (ESI, m / z):C28H32FN3O, [M+H]+446.260.

[0117] Example 32: TIFF2025514293000092.tif24170C32: 11H NMR (600 MHz, DMSO) δ 9.19 (s, 1H), 8.88 (d, J = 4.4 Hz, 1H), 8.68 (d, J = 8.4 Hz, 1H), 8.06 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.4, 6.7, 1.4 Hz, 1H), 7.71 (d, J = 4.4 Hz, 1H), 7.66 (ddd, J = 8.3, 6.7, 1.3 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.92 (dd, J = 8.4, 2.6 Hz, 1H), 6.67 (d, J = 2.8 Hz, 1H), 3.75 (d, J = 11.8 Hz, 1H), 3.44 (d, J = 12.3 Hz, 1H), 3.24 (s, 1H), 2.83 (t, J = 11.0 Hz, 2H), 2.76 (s, 6H), 2.63 (t, J = 11.3 Hz, 2H), 2.07 - 2.03 (m, 1H), 1.92 (s, 3H), 1.81 (dd, J = 10.3, 6.0 Hz, 1H), 1.64 - 1.49 (m, 3H), 1.39 (q, J = 4.0 Hz, 2H), 1.26 (q, J = 4.3 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.26, 150.67, 148.74, 148.59, 146.84, 137.94, 131.44, 130.14, 129.37, 127.45, 126.64, 126.17, 125.87, 123.04, 118.09, 115.73, 61.08, 49.72, 49.55, 40.53, 33.99, 24.54, 23.17, 18.39, 14.09. MS (ESI, m / z): C27H32N4O, [M+H]+ 429.265.

[0118] Example 33: TIFF2025514293000093.tif24170C33: 11H NMR (600 MHz, DMSO) δ 9.17 (s, 1H), 8.88 (d, J = 4.3 Hz, 1H), 8.66 (dd, J = 8.5, 1.4 Hz, 1H), 8.06 (dd, J = 8.4, 1.2 Hz, 1H), 7.77 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.70 (d, J = 4.3 Hz, 1H), 7.65 - 7.57 (m, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.95 (dd, J = 8.4, 2.7 Hz, 1H), 6.68 (d, J = 2.7 Hz, 1H), 3.70 - 3.65 (m, 4H), 3.10 (dd, J = 6.7, 3.7 Hz, 4H), 1.91 (s, 3H), 1.39 (t, J = 3.5 Hz, 2H), 1.27 (q, J = 4.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.12, 150.65, 148.73, 146.85, 145.69, 138.01, 131.74, 130.15, 129.42, 127.42, 126.69, 126.11, 125.79, 122.93, 117.37, 114.93, 50.18, 47.36, 34.06, 18.31, 14.03. MS (ESI, m / z): C24H25N3O3S, [M+H]+ 436.169.

[0119] Example 34: TIFF2025514293000094.tif24170C34: 11H NMR (600 MHz, DMSO) δ 9.16 (d, J = 5.1 Hz, 1H), 8.87 (d, J = 4.4 Hz, 1H), 8.66 (d, J = 8.6 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (ddd, J = 8.3, 6.8, 1.4 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.67 (ddd, J = 8.3, 6.9, 1.3 Hz, 1H), 6.86 (d, J = 8.3 Hz, 1H), 6.50 (d, J = 8.4 Hz, 1H), 6.28 (d, J = 2.7 Hz, 1H), 3.61 (d, J = 7.6 Hz, 1H), 3.47 (d, J = 11.7 Hz, 1H), 3.08 (s, 1H), 3.01 (s, 1H), 2.69 (d, J = 12.8 Hz, 1H), 2.00 (d, J = 4.5 Hz, 1H), 1.92 (s, 1H), 1.87 (s, 3H), 1.79 (s, 1H), 1.72 (s, 1H), 1.53 (s, 1H), 1.35 (s, 2H), 1.25 (s, 2H), 1.23 (dd, J = 7.2, 4.6 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.62, 150.65, 148.73, 146.87, 145.39, 138.20, 131.33, 130.10, 129.37, 127.46, 126.70, 125.88, 123.01, 122.20, 113.49, 111.69, 53.25, 47.69, 46.22, 45.71, 40.53, 33.85, 23.90, 22.62, 18.24, 17.81, 14.11. MS (ESI, m / z):C27H30N3O, [M+H]+427.249.

[0120] Example 35: TIFF2025514293000095.tif24170C35: 11H NMR (600 MHz, DMSO) δ 9.04 (s, 1H), 8.71 (d, J = 8.5 Hz, 1H), 8.10 - 8.06 (m, 1H), 7.79 (dd, J = 8.0, 5.6 Hz, 1H), 7.71 (ddd, J = 8.4, 6.8, 1.4 Hz, 1H), 7.65 (ddd, J = 8.1, 6.8, 1.1 Hz, 1H), 7.29 (dd, J = 10.7, 7.9 Hz, 1H), 7.00 (d, J = 8.4 Hz, 1H), 6.94 (dd, J = 8.4, 2.7 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.69 - 3.64 (m, 4H), 3.09 (dd, J = 6.7, 3.7 Hz, 4H), 1.92 (s, 3H), 1.36 (t, J = 3.0 Hz, 2H), 1.19 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 169.88, 158.54, 156.89, 145.70, 138.35, 134.48, 134.45, 133.50, 133.47, 131.69, 129.05 (d, J = 8.4 Hz), 127.40, 126.72, 126.10, 125.76, 123.44 (d, J = 16.3 Hz), 120.88 (d, J = 5.4 Hz), 117.26, 114.97, 109.01 (d, J = 19.3 Hz), 50.19, 47.39, 40.53, 34.20, 18.33, 14.51. MS (ESI, m / z): C25H25FN2O3S, [M+H]+ 453.164.

[0121] Example 36: TIFF2025514293000096.tif24170C36: 11H NMR (600 MHz, DMSO) δ 9.16 (s, 1H), 8.87 (d, J = 4.3 Hz, 1H), 8.67 (d, J = 8.4 Hz, 1H), 8.05 (d, J = 8.4 Hz, 1H), 7.77 (dd, J = 8.5, 6.8 Hz, 1H), 7.71 - 7.63 (m, 2H), 6.93 (d, J = 8.1 Hz, 1H), 6.37 (dd, J = 8.2, 2.6 Hz, 1H), 6.16 (d, J = 2.5 Hz, 1H), 3.59 (q, J = 7.6 Hz, 4H), 3.16 (s, 3H), 2.69 (s, 1H), 1.88 (s, 3H), 1.44 (s, 3H), 1.37 (q, J = 5.1 Hz, 2H), 1.25 (q, J = 5.1 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.35, 150.62, 149.73, 148.70, 146.92, 137.63, 131.18, 130.09, 129.38, 127.44, 126.61, 125.89, 123.44, 122.95, 113.05, 110.65, 73.24, 62.57, 62.53, 53.83, 50.68, 33.98, 22.52, 18.47, 18.39, 17.18, 14.04. MS (ESI, m / z): C25H27N3O2, [M+H]+402.218.

[0122] Example 37: TIFF2025514293000097.tif24170C37: 11H NMR (600 MHz, DMSO) δ 9.15 (s, 1H), 8.87 (d, J = 4.4 Hz, 1H), 8.66 (dd, J = 8.5, 1.4 Hz, 1H), 8.05 (dd, J = 8.5, 1.3 Hz, 1H), 7.76 (ddd, J = 8.3, 6.7, 1.4 Hz, 1H), 7.70 (d, J = 4.4 Hz, 1H), 7.66 (ddd, J = 8.3, 6.7, 1.3 Hz, 1H), 6.85 (d, J = 8.3 Hz, 1H), 6.51 (dd, J = 8.2, 2.6 Hz, 1H), 6.32 (d, J = 2.6 Hz, 1H), 3.82 (qd, J = 10.9, 5.6 Hz, 2H), 3.31 - 3.27 (m, 1H), 3.16 (dd, J = 13.4, 7.5 Hz, 1H), 2.97 - 2.85 (m, 1H), 1.86 (s, 3H), 1.35 (t, J = 3.7 Hz, 2H), 1.24 (q, J = 5.4 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 173.08, 170.65, 150.59, 148.65, 147.02, 146.28, 138.00, 131.30, 130.02, 129.40, 127.46, 126.70, 125.88, 122.99, 122.12, 113.07, 111.37, 47.03, 44.07, 42.54, 33.90, 18.27, 14.11. MS (ESI, m / z):C24H23N3O3, [M+H]+402.177.

[0123] Example 38: TIFF2025514293000098.tif24170C38: 11H NMR (600 MHz, DMSO) δ 9.14 (dt, J = 8.7, 1.5 Hz, 1H), 9.05 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.2, 2.6 Hz, 1H), 6.14 (d, J = 2.6 Hz, 1H), 3.58 (q, J = 7.7 Hz, 4H), 3.15 (s, 3H), 1.87 (s, 3H), 1.43 (s, 3H), 1.34 (t, J = 3.2 Hz, 2H), 1.20 (q, J = 4.8 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 173.08, 170.65, 150.59, 148.65, 147.02, 146.28, 138.00, 131.30, 130.02, 129.40, 127.46, 126.70, 125.88, 122.99, 122.12, 113.07, 111.37, 47.03. 13 13C NMR (151 MHz, DMSO) δ 170.16, 157.95, 156.26, 150.67, 149.77, 138.35, 138.27, 137.88, 134.92, 134.89, 134.05, 131.17, 129.20, 129.15, 128.83, 123.30, 122.50, 112.98, 112.93, 112.81, 110.52, 73.24, 62.57, 50.68, 40.53, 38.72, 33.63, 22.52, 18.35, 14.39. MS (ESI, m / z): C25H26FN3O2, [M+H]+ 420.208.

[0124] Example 39: TIFF2025514293000099.tif24170C39: 11H NMR (699 MHz, dmso) δ 9.11 (d, J = 8.6 Hz, 1H), 9.00 (s, 1H), 8.95 (d, J = 4.2 Hz, 1H), 7.82 (dd, J = 8.0, 4.8 Hz, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.52 (dd, J = 10.6, 7.9 Hz, 1H), 6.79 (d, J = 8.2 Hz, 1H), 6.40 (dd, J = 8.3, 2.5 Hz, 1H), 6.21 (d, J = 2.5 Hz, 1H), 3.21 (s, 1H), 3.03 (t, J = 11.5 Hz, 1H), 2.70 (s, 1H), 2.58 (s, 1H), 2.31 (d, J = 14.0 Hz, 1H), 1.88 (d, J = 2.9 Hz, 1H), 1.82 (s, 3H), 1.76 - 1.72 (m, 1H), 1.66 (s, 1H), 1.52 (s, 1H), 1.41 (s, 1H), 1.29 (s, 2H), 1.17 (dd, J = 12.5, 7.6 Hz, 4H). MS (ESI, m / z):C27H29FN4O, [M+H]+445.240.

[0125] Example 40: TIFF2025514293000100.tif24170C40: 11H NMR (600 MHz, DMSO) δ 9.17 (dt, J = 8.6, 1.6 Hz, 1H), 9.12 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 6.99 (d, J = 8.4 Hz, 1H), 6.89 (dd, J = 8.4, 2.7 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.79 (d, J = 11.8 Hz, 1H), 3.49 - 3.43 (m, 1H), 3.06 (s, 1H), 2.79 - 2.70 (m, 2H), 2.65 (s, 6H), 2.58 (ddd, J = 11.8, 8.6, 2.5 Hz, 2H), 2.06 - 2.02 (m, 1H), 1.91 (s, 3H), 1.79 (dt, J = 9.4, 3.3 Hz, 1H), 1.38 (q, J = 3.7 Hz, 2H), 1.20 (q, J = 4.3 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 170.07, 157.96, 156.27, 150.66, 148.68, 138.36, 138.28, 138.03, 134.93, 134.89, 134.07, 131.42, 129.23, 129.18, 128.85, 125.83, 122.52, 117.86, 115.49, 112.93, 112.81, 60.84, 50.10, 49.53, 33.66, 24.88, 23.40, 18.38, 14.41. MS (ESI, m / z): C27H31FN4O, [M+H]+ 447.248.

[0126] Example 41: TIFF2025514293000101.tif24170C41: 11H NMR (600 MHz, DMSO) δ 9.12 (dt, J = 8.7, 1.6 Hz, 1H), 9.07 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.73 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.94 (dd, J = 8.4, 2.8 Hz, 1H), 6.67 (d, J = 2.8 Hz, 1H), 3.69 - 3.64 (m, 4H), 3.11 - 3.06 (m, 4H), 1.90 (s, 3H), 1.42 - 1.35 (m, 2H), 1.22 (q, J = 4.9 Hz, 2H). 13 13C NMR (151 MHz, DMSO) δ 169.93, 157.97, 156.28, 150.71, 145.76, 138.37, 138.30, 134.88, 134.85, 133.96, 131.70, 129.17, 129.12, 128.82, 125.96, 122.53, 117.28, 114.86, 112.94, 112.81, 50.20, 47.39, 40.53, 33.71, 18.27, 14.38. MS (ESI, m / z): C24H24FN3O3S, [M+H]+ 454.153.

[0127] Example 42: TIFF2025514293000102.tif20170C42: 11H NMR (699 MHz, dmso) δ 9.17 (s, 1H), 8.86 (d, J = 4.3 Hz, 1H), 8.64 (d, J = 8.5 Hz, 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.75 (t, J = 7.5 Hz, 1H), 7.68 (d, J = 4.4 Hz, 1H), 7.64 (t, J = 7.7 Hz, 1H), 7.02 (d, J = 8.2 Hz, 1H), 6.91 (d, J = 8.5 Hz, 1H), 6.64 (s, 1H), 3.72 (d, J = 13.0 Hz, 3H), 3.46 (d, J = 10.9 Hz, 4H), 3.08 (d, J = 11.7 Hz, 1H), 2.86 (d, J = 12.7 Hz, 1H), 1.90 (s, 3H), 1.35 (s, 2H), 1.26 (d, J = 6.6 Hz, 6H), 1.25 - 1.24 (m, 2H). MS (ESI, m / z):C27H32N4O, [M+H]+429.265.

[0128] Example 43: TIFF2025514293000103.tif20170C43: 11H NMR (699 MHz, dmso) δ 9.14 (s, 1H), 8.85 (d, J = 4.3 Hz, 1H), 8.64 (d, J = 8.4 Hz, 1H), 8.03 (d, J = 8.4 Hz, 1H), 7.75 (t, J = 7.7 Hz, 1H), 7.67 (d, J = 4.4 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.82 - 6.80 (m, 1H), 6.57 (s, 1H), 2.94 (s, 3H), 2.60 (s, 3H), 1.87 (s, 3H), 1.61 (s, 1H), 1.35 (q, J = 5.0 Hz, 3H), 1.23 (s, 3H), 0.41 (s, 2H), 0.31 (s, 2H). MS (ESI, m / z):C27H30N4O, [M+H]+427.249.

[0129] Example 44: TIFF2025514293000104.tif24170C44: 11H NMR (699 MHz, dmso) δ 9.78 (s, 1H), 9.11 (d, J = 8.7 Hz, 1H), 9.08 (s, 1H), 8.96 (d, J = 4.1 Hz, 1H), 7.83 (dd, J = 7.9, 4.8 Hz, 1H), 7.69 (dd, J = 8.6, 4.1 Hz, 1H), 7.53 (dd, J = 10.6, 7.9 Hz, 1H), 7.01 (d, J = 8.4 Hz, 1H), 6.90 (dd, J = 8.3, 2.7 Hz, 1H), 6.63 (d, J = 2.8 Hz, 1H), 3.71 (d, J = 12.9 Hz, 2H), 3.49 (d, J = 9.8 Hz, 1H), 3.44 (d, J = 12.0 Hz, 2H), 3.05 (t, J = 10.9 Hz, 2H), 2.92 (t, J = 12.5 Hz, 2H), 1.88 (s, 3H), 1.33 (d, J = 5.0 Hz, 2H), 1.27 (d, J = 6.6 Hz, 6H), 1.19 (s, 2H). MS (ESI, m / z):C27H31FN4O, [M+H]+447.256.

[0130] Example 45: TIFF2025514293000105.tif24170C45: 11H NMR (699 MHz, dmso) δ 9.11 (d, J = 8.6 Hz, 1H), 9.03 (s, 1H), 8.95 (d, J = 4.0 Hz, 1H), 7.82 (dd, J = 7.8, 4.7 Hz, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.52 (dd, J = 10.8, 8.1 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.80 (dd, J = 8.3, 2.6 Hz, 1H), 6.56 (d, J = 2.8 Hz, 1H), 2.95 (d, J = 5.0 Hz, 4H), 2.60 (d, J = 5.0 Hz, 4H), 1.85 (s, 3H), 1.60 (s, 1H), 1.33 (s, 2H), 1.18 (d, J = 5.1 Hz, 2H), 0.41 (d, J = 6.5 Hz, 2H), 0.30 (s, 2H). MS (ESI, m / z):C27H29FN4O, [M+H]+445.239.

[0131] Example 46: TIFF2025514293000106.tif20170C46: 1 1H NMR (699 MHz, dmso) δ 9.07 (d, J = 8.5 Hz, 1H), 9.05 (s, 1H), 8.90 (d, J = 4.0 Hz, 1H), 7.92 (d, J = 8.4 Hz, 1H), 7.85 (d, J = 7.1 Hz, 1H), 7.69 (t, J = 7.7 Hz, 1H), 7.57 (dd, J = 8.6, 4.1 Hz, 1H), 6.94 (d, J = 8.3 Hz, 1H), 6.81 (s, 1H), 6.56 (s, 1H), 2.94 (s, 3H), 2.60 (s, 2H), 1.87 (s, 4H), 1.60 (s, 1H), 1.34 (s, 3H), 1.18 (s, 3H), 0.41 (s, 2H), 0.30 (s, 2H). MS (ESI, m / z):C27H30N4O, [M+H]+427.249.

[0132] Example 47: TIFF2025514293000107.tif24170C47: 1 H NMR (699 MHz, dmso) δ 8.98 - 8.93 (m, 1H), 7.82 (h, J = 8.1 Hz, 2H), 7.75 - 7.70 (m, 1H), 7.44 (dq, J = 17.2, 8.1 Hz, 2H), 7.37 (q, J = 8.4 Hz, 1H), 7.01 (q, J = 8.1 Hz, 1H), 6.47 - 6.42 (m, 1H), 6.42 - 6.37 (m, 1H), 3.90 (t, J = 8.5 Hz, 2H), 3.54 (s, 1H), 2.46 (s, 4H), 2.21 - 1.97 (m, 9H), 1.36 - 1.31 (m, 2H), 1.30 - 1.25 (m, 2H). MS (ESI, m / z):C26H29N3O, [M+H]+400.238.

[0133] Example 48: TIFF2025514293000108.tif24170C48: 11H NMR (600 MHz, DMSO) δ 9.08 (d, J = 4.9 Hz, 1H), 8.72 (d, J = 8.5 Hz, 1H), 8.09 (d, J = 8.2 Hz, 1H), 7.80 (dd, J = 7.9, 5.5 Hz, 1H), 7.72 - 7.62 (m, 2H), 7.30 (dd, J = 10.6, 7.9 Hz, 1H), 7.03 (d, J = 8.4 Hz, 1H), 6.92 (dd, J = 8.6, 2.9 Hz, 1H), 6.66 (d, J = 2.7 Hz, 1H), 3.72 (s, 2H), 3.48 (s, 2H), 3.46 (s, 1H), 3.09 (q, J = 10.6 Hz, 2H), 2.99 (s, 1H), 2.92 (t, J = 12.4 Hz, 1H), 1.93 (s, 3H), 1.36 (s, 2H), 1.29 (d, J = 6.6 Hz, 6H), 1.21 - 1.16 (m, 2H). MS (ESI, m / z):C28H32FN3O, [M+H]+446.260.

[0134] Example 49: TIFF2025514293000109.tif24170C49: 11H NMR (699 MHz, dmso) δ 9.00 (d, J = 3.9 Hz, 1H), 8.71 - 8.67 (m, 1H), 8.04 (dd, J = 8.5, 3.7 Hz, 1H), 7.76 (d, J = 8.1 Hz, 1H), 7.65 (d, J = 8.5 Hz, 1H), 7.62 (d, J = 8.0 Hz, 1H), 7.26 (d, J = 10.1 Hz, 1H), 6.93 - 6.89 (m, 1H), 6.78 (d, J = 8.3 Hz, 1H), 6.54 (s, 1H), 2.93 (d, J = 6.3 Hz, 4H), 2.58 (d, J = 5.5 Hz, 4H), 1.87 (d, J = 3.8 Hz, 3H), 1.59 (s, 1H), 1.32 (s, 2H), 1.14 (s, 2H), 0.40 (t, J = 5.3 Hz, 2H), 0.29 (s, 2H). MS (ESI, m / z):C28H30FN3O, [M+H]+444.244

[0135] Example 50: TIFF2025514293000110.tif24170C50: 1 1H NMR (600 MHz, DMSO) δ 9.04 (d, J = 6.0 Hz, 1H), 8.72 (d, J = 8.7 Hz, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.81 - 7.76 (m, 1H), 7.69 (q, J = 7.3 Hz, 2H), 7.67 - 7.61 (m, 2H), 7.30 - 7.26 (m, 1H), 6.89 (d, J = 8.2 Hz, 1H), 6.51 (s, 1H), 6.29 (d, J = 10.1 Hz, 1H), 1.89 (s, 3H), 1.33 (q, J = 6.0 Hz, 3H), 1.16 (d, J = 6.3 Hz, 3H). MS (ESI, m / z): C25H26FN3O, [M+H]+404.2138.

[0136] Example 51: TIFF2025514293000111.tif24170C51: 1 1H NMR (600 MHz, DMSO) δ 9.13 (dt, J = 8.7, 1.6 Hz, 1H), 9.03 (s, 1H), 8.98 (dd, J = 4.1, 1.6 Hz, 1H), 7.85 (dd, J = 8.0, 5.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 (dd, J = 10.7, 8.0 Hz, 1H), 6.83 (d, J = 8.2 Hz, 1H), 6.48 (dd, J = 8.2, 2.5 Hz, 1H), 6.26 (d, J = 2.5 Hz, 1H), 5.45 (s, 1H), 3.24 (s, 1H), 3.06 (s, 2H), 2.58 (s, 1H), 2.49 (s, 3H), 1.89 (d, J = 12.4 Hz, 2H), 1.85 (s, 3H), 1.47 (s, 1H), 1.32 (q, J = 4.6 Hz, 2H), 1.19 (q, J = 4.8 Hz, 2H). MS (ESI, m / z): C26H29FN4O, [M+H]+433.232.

[0137] Example 52: TIFF2025514293000112.tif24170C52: 11H NMR (600 MHz, DMSO) δ 9.16 (d, J = 8.6 Hz, 1H), 9.07 (s, 1H), 8.98 (t, J = 6.4 Hz, 1H), 7.84 (dd, J = 8.2, 4.7 Hz, 1H), 7.70 (td, J = 8.4, 4.2 Hz, 1H), 7.57 - 7.51 (m, 1H), 7.06 (d, J = 8.2 Hz, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.79 - 6.74 (m, 1H), 6.46 (d, J = 17.9 Hz, 1H), 3.78 (d, J = 12.4 Hz, 1H), 3.25 (d, J = 12.8 Hz, 2H), 2.87 (t, J = 12.5 Hz, 2H), 2.61 (s, 3H), 1.88 (s, 5H), 1.62 (d, J = 13.1 Hz, 2H), 1.36 (s, 2H), 1.20 (d, J = 6.1 Hz, 2H). MS (ESI, m / z): C26H29FN4O, [M+H]+433.232.

[0138] Example 53: TIFF2025514293000113.tif24170C53: 1 1H NMR (600 MHz, DMSO) δ 9.16 (s, 1H), 9.08 (s, 1H), 8.99 (dt, J = 4.2, 2.3 Hz, 1H), 7.86 (ddd, J = 8.3, 4.8, 2.1 Hz, 1H), 7.74 (dq, J = 7.6, 4.1 Hz, 1H), 7.60 - 7.52 (m, 2H), 6.93 - 6.86 (m, 2H), 6.52 (s, 1H), 6.30 (s, 1H), 1.87 (s, 3H), 1.34 (t, J = 2.9 Hz, 3H), 1.20 (dd, J = 6.9, 4.8 Hz, 3H). MS (ESI, m / z):C24H25FN4O, [M+H]+405.208.

[0139] Example 54: TIFF2025514293000114.tif24170C54: 1 H NMR (600 MHz, DMSO) δ 9.03 (s, 1H), 8.76 - 8.70 (m, 1H), 8.07 (d, J = 8.2 Hz, 1H), 7.78 (t, J = 6.7 Hz, 1H), 7.69 - 7.61 (m, 1H), 7.33 - 7.22 (m, 1H), 7.06 (s, 1H), 6.92 (d, J = 8.5 Hz, 1H), 6.77 - 6.73 (m, 1H), 6.44 (d, J = 2.9 Hz, 1H), 3.02 (s, 3H), 2.73 - 2.65 (m, 3H), 2.14 (d, J = 9.4 Hz, 2H), 2.09 - 1.99 (m, 2H), 1.90 (s, 3H), 1.35 (s, 2H), 1.17 (s, 2H). MS (ESI, m / z): C28H32FN3O, [M+H]+446.767.

[0140] Example 55: TIFF2025514293000115.tif24170C55: 11H NMR (600 MHz, DMSO) δ 8.98 (s, 1H), 8.72 (d, J = 8.3 Hz, 1H), 8.07 (d, J = 8.1 Hz, 1H), 7.79 (dd, J = 7.9, 5.6 Hz, 1H), 7.70 - 7.66 (m, 1H), 7.64 (t, J = 7.5 Hz, 1H), 7.28 (dd, J = 10.6, 7.9 Hz, 1H), 6.80 (d, J = 8.3 Hz, 1H), 6.45 (dd, J = 8.3, 2.5 Hz, 1H), 6.24 (d, J = 2.5 Hz, 1H), 5.33 (d, J = 8.2 Hz, 1H), 2.98 - 2.92 (m, 2H), 2.54 (d, J = 11.8 Hz, 2H), 1.86 (s, 3H), 1.78 (dd, J = 13.1, 3.5 Hz, 2H), 1.32 (s, 2H), 1.15 (d, J = 5.5 Hz, 2H), 0.89 - 0.80 (m, 2H). MS (ESI, m / z): C26H28FN3O, [M+H]+418.222. TIFF2025514293000116.tif24170

[0141] Example 56: C56: 11H NMR (600 MHz, DMSO) δ 9.13 (dd, J = 8.7, 1.6 Hz, 1H), 9.01 (s, 1H), 8.98 (dd, J = 4.1, 1.7 Hz, 1H), 7.84 (dd, J = 8.1, 4.9 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.53 (dd, J = 10.7, 8.0 Hz, 1H), 6.80 (d, J = 8.2 Hz, 1H), 6.44 (dd, J = 8.3, 2.5 Hz, 1H), 6.23 (s, 1H), 5.28 (d, J = 8.2 Hz, 1H), 3.08 (d, J = 9.4 Hz, 1H), 2.88 (dt, J = 12.5, 3.7 Hz, 2H), 2.46 - 2.40 (m, 2H), 1.84 (s, 3H), 1.74 (dd, J = 13.0, 3.6 Hz, 2H), 1.32 (q, J = 4.5 Hz, 2H), 1.19 (d, J = 5.4 Hz, 2H), 1.11 (dd, J = 10.6, 3.2 Hz, 2H). MS (ESI, m / z): C25H27FN4O, [M+H]+419.217.

[0142] Example 57: TIFF2025514293000117.tif21170C57: 1 1H NMR (400 MHz, Methanol-d 4) δ 7.78 (dd, J = 7.9, 1.2 Hz, 1H), 7.62 (dd, J = 7.3, 1.1 Hz, 1H), 7.60 (d, J = 5.5 Hz, 1H), 7.44 (d, J = 5.5 Hz, 1H), 7.36 (t, J = 7.6 Hz, 1H), 6.99 (d, J = 8.2 Hz, 1H), 6.46 (dd, J = 8.2, 2.6 Hz, 1H), 6.41 (d, J = 2.5 Hz, 1H), 3.95 (dd, J = 7.7, 6.7 Hz, 2H), 3.59 (dd, J = 7.6, 5.8 Hz, 2H), 3.29 (q, J = 6.2 Hz, 1H), 2.25 (s, 6H), 2.07 (s, 3H), 1.36 (q, J = 2.4 Hz, 4H). 13 C NMR (101 MHz, Methanol-d 4 ) δ 172.81, 149.54, 140.40, 139.14, 136.76, 135.41, 130.73, 125.79, 124.48, 124.11, 123.89, 123.77, 122.42, 112.83, 110.33, 56.23, 55.94, 40.54, 35.28, 16.99, 13.67. MS (ESI, m / z):C24H27N3OS, [M+H]+406.1948.

[0143] Example 58: TIFF2025514293000118.tif25170C58: 1 H NMR (400 MHz, DMSO-d 6) δ 9.17 (dd, J = 8.6, 1.6 Hz, 1H), 9.08 (s, 1H), 9.04 (dd, J = 4.2, 1.6 Hz, 1H), 7.93 (d, J = 8.0 Hz, 1H), 7.77 (dd, J = 7.9, 1.4 Hz, 1H), 7.74 (dd, J = 8.6, 4.2 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.13 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.07 (s, 6H), 1.86 (s, 3H), 1.37 (q, J = 4.9, 4.3 Hz, 2H), 1.25 (t, J = 3.4 Hz, 2H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 170.31, 151.39, 150.05, 143.87, 141.28, 138.62, 137.80, 134.24, 131.15, 128.85, 128.73, 123.08, 122.60, 120.88, 119.66, 112.77, 110.26, 56.73, 56.30, 41.97, 33.76, 18.29, 14.39. MS (ESI, m / z):C26H27F3N4O2, [M+H]+485.2159.

[0144] Example 59: TIFF2025514293000119.tif25170C59: 1 H NMR (400 MHz, DMSO-d 6) δ 9.14 (dt, J = 8.7, 1.6 Hz, 1H), 9.11 (s, 1H), 8.97 (dd, J = 4.2, 1.6 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.53 (dd, J = 10.8, 8.0 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.37 (dd, J = 8.2, 2.5 Hz, 1H), 6.15 (d, J = 2.5 Hz, 1H), 4.39 (p, J = 6.3 Hz, 1H), 4.07 (dd, J = 7.5, 5.8 Hz, 2H), 3.80 (t, J = 7.3 Hz, 2H), 2.87 (s, 6H), 1.86 (s, 3H), 1.35 (q, J = 4.8, 4.4 Hz, 2H), 1.19 (q, J = 4.9 Hz, 2H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 170.22, 150.64, 150.02, 137.98, 134.95, 134.05, 131.02, 128.84, 123.31, 122.48, 112.93, 112.76, 110.47, 64.45, 56.78, 55.36, 52.36, 33.61, 18.24, 14.40. MS (ESI, m / z):C25H27FN4O2, [M+H]+435.2191.

[0145] Example 60: TIFF2025514293000120.tif25170C60: 1 1H NMR (400 MHz, Methanol-d 4) δ 8.78 (dd, J = 9.9, 1.7 Hz, 1H), 7.62 (dd, J = 8.4, 5.0 Hz, 1H), 7.34 (dd, J = 10.7, 8.4 Hz, 1H), 6.99 (d, J = 8.3 Hz, 1H), 6.75 (d, J = 9.9 Hz, 1H), 6.45 (dd, J = 8.3, 2.6 Hz, 1H), 6.26 (d, J = 2.5 Hz, 1H), 3.94 (t, J = 7.1 Hz, 2H), 3.56 (dd, J = 7.5, 5.7 Hz, 2H), 3.26 (p, J = 6.3 Hz, 1H), 2.22 (s, 6H), 2.03 (s, 3H), 1.45 - 1.39 (m, 2H), 1.29 (t, J = 3.5 Hz, 2H). MS (ESI, m / z):C25H27FN4O2, [M+H]+435.2191.

[0146] Example 61: TIFF2025514293000121.tif2617061: 1 1H NMR (400 MHz, DMSO-d 6 ) δ 9.29 (s, 1H), 9.07 (d, J = 8.5 Hz, 1H), 8.37 (d, J = 7.1 Hz, 1H), 8.20 (s, 1H), 8.05 - 7.94 (m, 1H), 6.94 (d, J = 8.3 Hz, 1H), 6.37 (dd, J = 8.1, 2.5 Hz, 1H), 6.14 (d, J = 2.5 Hz, 1H), 3.82 (t, J = 7.1 Hz, 2H), 3.43 (t, J = 6.5 Hz, 2H), 3.18 (d, J = 5.2 Hz, 1H), 2.11 (s, 6H), 1.89 (s, 3H), 1.44 (q, J = 2.3 Hz, 2H), 1.24 (q, J = 3.7, 3.1 Hz, 2H). MS (ESI, m / z):C27H26F6N4O, [M+H]+537.2084.

[0147] Example 62: TIFF2025514293000122.tif24170C62: 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.37 (dd, J = 8.9, 1.6 Hz, 1H), 9.10 (s, 1H), 8.04 - 7.91 (m, 2H), 7.68 (dd, J = 10.7, 8.0 Hz, 1H), 7.18 (t, J = 54.6 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.39 (dd, J = 8.2, 2.5 Hz, 1H), 6.16 (d, J = 2.5 Hz, 1H), 3.92 (t, J = 7.3 Hz, 2H), 3.66 (d, J = 7.0 Hz, 2H), 3.44 (dt, J = 9.3, 4.6 Hz, 1H), 2.49 (s, 6H), 1.88 (s, 3H), 1.37 (q, J = 4.9, 4.3 Hz, 2H), 1.25 (t, J = 3.3 Hz, 2H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 170.14, 155.74, 149.39, 137.99, 137.24, 136.61, 135.13, 131.22, 130.99, 129.27, 123.83, 118.17, 114.49, 114.20, 114.02, 113.05, 110.53, 56.49, 55.96, 55.37, 49.06, 41.02, 33.60, 19.02, 18.31, 14.43. MS (ESI, m / z):C26H27F3N4O, [M+H]+469.2210.

[0148] Example 63: TIFF2025514293000123.tif26170C63: 1 H NMR (400 MHz, DMSO-d 6) δ 9.15 (dt, J = 8.7, 1.6 Hz, 1H), 9.04 (s, 1H), 8.98 (dd, J = 4.2, 1.5 Hz, 1H), 7.85 (dd, J = 8.1, 5.1 Hz, 1H), 7.70 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.82 (dd, J = 8.4, 2.7 Hz, 1H), 6.58 (d, J = 2.6 Hz, 1H), 4.64 (d, J = 4.2 Hz, 1H), 3.58 (dq, J = 9.0, 4.5 Hz, 1H), 3.48 - 3.34 (m, 2H), 2.72 (ddd, J = 12.9, 10.1, 3.0 Hz, 2H), 1.88 (s, 3H), 1.76 (dd, J = 13.1, 4.1 Hz, 2H), 1.46 - 1.38 (m, 2H), 1.36 (q, J = 4.7 Hz, 2H), 1.20 (q, J = 4.9 Hz, 2H). 13 13C NMR (101 MHz, DMSO-d 6 ) δ 170.23, 150.63, 149.14, 137.91, 134.96, 134.04, 131.29, 129.18, 129.10, 128.83, 124.74, 122.43, 117.19, 114.79, 112.94, 112.76, 66.38, 47.08, 34.20, 33.67, 18.30, 14.36. MS (ESI, m / z):C25H26FN3O2, [M+H]+420.2082.

[0149] Example 64: TIFF2025514293000124.tif24170C64: 1 1H NMR (400 MHz, DMSO-d 6) δ 9.15 - 8.84 (m, 2H), 7.66 (dd, J = 8.1, 5.0 Hz, 1H), 7.46 (dd, J = 10.9, 8.1 Hz, 1H), 7.18 (d, J = 9.1 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.6 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 4.01 (s, 3H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.06 (s, 6H), 1.88 (s, 3H), 1.32 (q, J = 4.8, 4.4 Hz, 2H), 1.22 - 1.07 (m, 2H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 170.11, 162.14, 157.09, 154.60, 150.06, 137.98, 137.52, 136.14, 136.02, 134.93, 134.88, 131.13, 126.82, 126.74, 125.86, 125.83, 123.08, 113.89, 113.67, 113.49, 112.71, 110.25, 56.77, 56.30, 53.80, 41.98, 33.73, 18.33, 14.45. MS (ESI, m / z):C26H29FN4O2, [M+H]+449.2347.

[0150] Example 65: TIFF2025514293000125.tif24170C65: 1 H NMR (400 MHz, DMSO-d 6) δ 9.14 (dt, J = 8.7, 1.7 Hz, 1H), 9.06 (s, 1H), 8.97 (dd, J = 4.1, 1.5 Hz, 1H), 7.85 (dd, J = 8.0, 5.1 Hz, 1H), 7.71 (dd, J = 8.7, 4.1 Hz, 1H), 7.54 (dd, J = 10.8, 8.0 Hz, 1H), 6.89 (d, J = 8.2 Hz, 1H), 6.31 (dd, J = 8.2, 2.5 Hz, 1H), 6.08 (d, J = 2.5 Hz, 1H), 4.34 (s, 1H), 3.66 (t, J = 7.6 Hz, 2H), 3.55 (t, J = 6.9 Hz, 2H), 2.72 - 2.60 (m, 1H), 1.85 (s, 3H), 1.35 (q, J = 4.7, 4.3 Hz, 2H), 1.20 (t, J = 3.2 Hz, 2H), 1.03 (s, 6H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 170.31, 158.36, 155.83, 150.64, 150.35, 138.37, 138.26, 137.88, 134.96, 134.91, 134.07, 131.01, 129.20, 129.13, 128.84, 128.82, 122.47, 112.95, 112.77, 112.44, 109.96, 68.17, 53.03, 33.61, 27.11, 26.81, 18.31, 14.39. MS (ESI, m / z):C26H28FN3O2, [M+H]+434.2238.

[0151] Example 66: TIFF2025514293000126.tif26170C66: 1 H NMR (400 MHz, DMSO-d 6) δ 9.19 (d, J = 8.7 Hz, 1H), 9.06 (s, 1H), 9.00 (dd, J = 4.2, 1.5 Hz, 1H), 8.45 (d, J = 4.7 Hz, 3H), 7.86 (dd, J = 8.0, 5.0 Hz, 1H), 7.74 (dd, J = 8.6, 4.2 Hz, 1H), 7.56 (dd, J = 10.8, 8.0 Hz, 1H), 6.91 (d, J = 8.3 Hz, 1H), 6.49 (dd, J = 8.4, 2.6 Hz, 1H), 6.26 (d, J = 2.6 Hz, 1H), 3.48 (d, J = 9.5 Hz, 2H), 3.08 (d, J = 9.1 Hz, 2H), 2.39 - 2.31 (m, 1H), 2.09 (d, J = 2.8 Hz, 2H), 1.87 (s, 3H), 1.40 (s, 3H), 1.36 (q, J = 5.0 Hz, 2H), 1.20 (t, J = 3.4 Hz, 2H). 13 C NMR (101 MHz, DMSO-d 6 ) δ 170.26, 150.45, 145.85, 137.99, 131.31, 122.74, 122.51, 113.97, 111.49, 66.82, 49.57, 33.63, 31.48, 26.81, 21.65, 18.27, 14.41. MS (ESI, m / z):C25H25FN4O, [M+H]+417.2085.

[0152] Example 67: TIFF2025514293000127.tif29170C67: 11H NMR (400 MHz, DMSO) δ 9.16 (s, 1H), 8.93 (d, J = 4.4 Hz, 1H), 8.47 (d, J = 8.3 Hz, 1H), 7.79 (d, J = 4.4 Hz, 1H), 7.70 - 7.52 (m, 2H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.5 Hz, 1H), 6.14 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.42 (t, J = 6.4 Hz, 2H), 3.13 (t, J = 6.4 Hz, 1H), 2.08 (s, 6H), 1.86 (s, 3H), 1.42 - 1.33 (m, 2H), 1.27 (q, J = 5.7, 5.1 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.45, 159.56, 157.03, 150.87, 150.01, 147.02 (d, J = 2.7 Hz), 138.76 (d, J = 11.3 Hz), 137.61, 131.16, 129.27, 126.53 (d, J = 8.4 Hz), 123.61 (d, J = 81.9 Hz), 121.89 (d, J = 4.8 Hz), 113.50 (d, J = 18.4 Hz), 112.82, 110.37, 56.68, 56.29, 41.94, 34.16, 18.31, 14.09. MS (ESI, m / z):C25H27FN4O, [M+H]+419.217.

[0153] Example 68: TIFF2025514293000128.tif29170C68: 11H NMR (400 MHz, DMSO) δ 9.03 (s, 1H), 8.72 (d, J = 8.2 Hz, 1H), 8.16 - 8.06 (m, 1H), 7.81 (d, J = 7.9 Hz, 1H), 7.72 - 7.60 (m, 2H), 7.50 (d, J = 74.0 Hz, 1H), 7.26 (d, J = 7.8 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.1, 2.5 Hz, 1H), 6.11 (d, J = 2.5 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (t, J = 6.5 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.06 (s, 6H), 1.90 (s, 3H), 1.35 (t, J = 3.6 Hz, 2H), 1.17 (d, J = 5.1 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.17, 150.01, 146.57 (d, J = 3.0 Hz), 137.99, 135.39, 133.33, 131.12, 128.75, 127.19, 126.71, 126.18, 125.88, 123.22, 121.98, 119.88, 117.32, 112.69, 110.44, 56.72, 56.30, 41.96, 34.18, 18.42, 14.58. MS (ESI, m / z):C27H29F2N3O2, [M+H]+466.223.

[0154] Example 69: TIFF2025514293000129.tif29170C69: 11H NMR (400 MHz, DMSO) δ 9.15 (dd, J = 8.6, 1.7 Hz, 1H), 9.06 (s, 1H), 8.99 (dd, J = 4.2, 1.6 Hz, 1H), 7.87 (d, J = 8.0 Hz, 1H), 7.71 (dd, J = 8.6, 4.1 Hz, 1H), 7.59 (d, J = 42.5 Hz, 1H), 7.52 - 7.25 (m, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.35 (dd, J = 8.2, 2.6 Hz, 1H), 6.12 (d, J = 2.5 Hz, 1H), 3.81 (t, J = 7.0 Hz, 2H), 3.41 (dd, J = 7.4, 5.6 Hz, 2H), 3.11 (p, J = 6.1 Hz, 1H), 2.07 (s, 6H), 1.88 (s, 3H), 1.36 (q, J = 4.7, 4.2 Hz, 2H), 1.20 (q, J = 4.9 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.41, 151.48, 150.13, 146.72, 138.29, 138.12, 136.74, 134.41, 131.16, 129.40, 128.82, 123.26, 122.33, 118.90, 117.33, 113.82, 111.35, 60.08, 55.79, 42.69, 33.69, 17.61, 13.10. MS (ESI, m / z):C26H28F2N4O2, [M+H]+467.218.

[0155] Example 70: TIFF2025514293000130.tif29170C70: 11H NMR (400 MHz, DMSO) δ 9.15 (s, 1H), 8.86 - 8.76 (m, 1H), 8.20 - 8.09 (m, 2H), 7.94 (d, J = 7.5 Hz, 1H), 7.86 - 7.72 (m, 2H), 6.91 (d, J = 8.2 Hz, 1H), 6.34 (dd, J = 8.2, 2.5 Hz, 1H), 6.12 (d, J = 2.6 Hz, 1H), 3.80 (t, J = 7.0 Hz, 2H), 3.40 (dd, J = 7.4, 5.7 Hz, 2H), 3.11 (p, J = 6.2 Hz, 1H), 2.07 (s, 6H), 1.86 (s, 3H), 1.40 (q, J = 4.7, 4.2 Hz, 2H), 1.25 (q, J = 4.8 Hz, 2H). 13C NMR (101 MHz, DMSO) δ 170.39, 150.01, 144.24, 137.72, 133.05, 132.46, 131.92, 131.15, 128.95, 128.43, 127.86, 126.78, 125.38, 123.19, 118.18, 112.79, 110.38, 108.84, 56.70, 56.29, 41.95, 34.66, 18.34, 14.56. MS (ESI, m / z):C27H28N4O, [M+H]+425.226

[0156] Example 71 TIFF2025514293000131.tif22170C71: 1 1H NMR (400 MHz, DMSO-d 6) δ 8.86 (s, 1H), 8.20 (s, 1H), 7.38 (t, J = 7.9 Hz, 2H), 7.32 (t, J = 8.2 Hz, 1H), 7.12 (t, J = 7.4 Hz, 1H), 7.01 (t, J = 7.3 Hz, 3H), 6.97 - 6.91 (m, 2H), 6.85 - 6.79 (m, 1H), 6.42 (dd, J = 8.2, 2.3 Hz, 1H), 6.35 (d, J = 2.2 Hz, 1H), 3.96 - 3.89 (m, 2H), 3.63 - 3.57 (m, 2H), 3.18 - 3.10 (m, 1H), 2.32 (s, 6H), 2.12 (s, 3H). MS (ESI, m / z): C28H31N3O2, [M+H]+442.242.

[0157] Example 72 TIFF2025514293000132.tif27170C72: 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.96 (s, 1H), 8.13 - 8.06 (m, 2H), 7.57 (d, J = 8.2 Hz, 1H), 7.55 - 7.41 (m, 3H), 7.22 - 7.16 (m, 1H), 7.05 - 6.99 (m, 1H), 6.43 (s, 2H), 3.94 - 3.89 (m, 2H), 3.55 - 3.50 (m, 2H), 3.21 - 3.16 (m, 1H), 2.19 (s, 3H), 2.11 (s, 6H), 1.32 - 1.29 (m, 2H), 1.25 - 1.22 (m, 2H). MS (ESI, m / z):C29H32N4O, [M+H]+453.258.

[0158] Example 73 TIFF2025514293000133.tif27170C73: 1 H NMR (400 MHz, DMSO-d 6) δ 11.25 (s, 1H), 8.88 (s, 1H), 8.38 - 8.17 (m, 2H), 7.84 - 7.71 (m, 1H), 7.58 - 7.46 (m, 1H), 7.39 - 7.29 (m, 1H), 6.91 (d, J = 7.2 Hz, 1H), 6.41 - 6.28 (m, 1H), 6.20 - 6.09 (m, 1H), 3.86 - 3.74 (m, 2H), 3.16 - 3.04 (m, 1H), 2.06 (s, 6H), 1.92 (s, 3H), 1.26 - 1.13 (m, 2H), 1.11 - 0.98 (m, 2H). MS (ESI, m / z):C25H28N4O2, [M+H]+417.221.

[0159] Example 74 TIFF2025514293000134.tif29170C74: 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.03 (s, 1H), 8.59 (d, J = 8.3 Hz, 1H), 8.26 (s, 1H), 8.20 (d, J = 8.2 Hz, 1H), 7.83 (t, J = 7.5 Hz, 1H), 7.63 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 8.1 Hz, 1H), 6.34 (d, J = 7.8 Hz, 1H), 6.13 (s, 1H), 4.05 (s, 3H), 3.81 (t, J = 6.7 Hz, 2H), 3.20 (s, 1H), 3.03 (dd, J = 14.3, 7.1 Hz, 2H), 2.11 (s, 6H), 1.90 (s, 3H), 1.30 (s, 2H), 1.14 (s, 2H). MS (ESI, m / z):C26H30N4O2, [M+H]+431.237.

[0160] Example 75 TIFF2025514293000135.tif26170C75: 1 H NMR (400 MHz, DMSO-d 6) δ 9.09 (d, J = 8.2 Hz, 1H), 9.06 - 8.99 (m, 1H), 8.98 - 8.92 (m, 1H), 7.75 (d, J = 7.1 Hz, 1H), 7.67 - 7.54 (m, 2H), 6.92 (d, J = 8.0 Hz, 1H), 6.34 (d, J = 7.5 Hz, 1H), 6.11 (s, 1H), 3.80 (t, J = 6.6 Hz, 2H), 3.44 - 3.37 (m, 2H), 3.11 (s, 1H), 2.70 (s, 3H), 2.06 (s, 5H), 1.89 (s, 3H), 1.38 - 1.29 (m, 2H), 1.20 - 1.12 (m, 2H). MS (ESI, m / z):C26H30N4O, [M+H]+415.242. Figure 8 shows the inhibition rate curve of Compound C75.

[0161] Example 76 TIFF2025514293000136.tif29170C76: 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.05 (dd, J = 8.6, 1.5 Hz, 1H), 8.96 (s, 1H), 8.85 (dd, J = 4.0, 1.5 Hz, 1H), 7.78 (d, J = 8.0 Hz, 1H), 7.60 (dd, J = 8.6, 4.1 Hz, 1H), 7.13 (d, J = 8.1 Hz, 1H), 6.91 (d, J = 8.3 Hz, 1H), 6.34 (dd, J = 8.2, 2.4 Hz, 1H), 6.11 (d, J = 2.4 Hz, 1H), 3.96 (s, 3H), 3.85 - 3.76 (m, 2H), 3.48 - 3.40 (m, 2H), 3.21 - 3.13 (m, 1H), 2.10 (s, 6H), 1.88 (s, 3H), 1.35 - 1.29 (m, 2H), 1.16 - 1.11 (m, 2H). MS (ESI, m / z):C26H30N4O2, [M+H]+431.237. Figure 9 shows the inhibition rate curve of compound C76.

[0162] Example 77 TIFF2025514293000137.tif23170C77: 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.48 (s, 1H), 7.02 (dd, J = 6.0, 3.2 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 6.76 - 6.70 (m, 2H), 6.37 (dd, J = 8.2, 2.4 Hz, 1H), 6.28 (d, J = 2.4 Hz, 1H), 4.32 - 4.27 (m, 2H), 4.26 - 4.20 (m, 2H), 3.90 - 3.85 (m, 2H), 3.52 - 3.46 (m, 2H), 3.21 - 3.13 (m, 1H), 2.11 (s, 6H), 2.08 (s, 3H), 1.08 (d, J = 3.2 Hz, 4H). MS (ESI, m / z):C24H29N3O3, [M+H]+408.221.

[0163] Example 78 TIFF2025514293000138.tif22170C78: 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.82 (s, 1H), 7.01 (d, J = 8.6 Hz, 1H), 6.88 (dd, J = 7.4, 1.9 Hz, 1H), 6.82 - 6.75 (m, 2H), 6.44 - 6.39 (m, 2H), 5.96 (s, 2H), 3.94 - 3.87 (m, 2H), 3.55 - 3.48 (m, 2H), 3.21 - 3.13 (m, 1H), 2.16 (s, 3H), 2.11 (s, 6H), 1.43 - 1.38 (m, 2H), 1.17 - 1.12 (m, 2H). MS (ESI, m / z):C23H27N3O3, [M+H]+394.205.

[0164] Example 79 TIFF2025514293000139.tif27170C79: 1 H NMR (400 MHz, CDCl 3 ) δ 9.02 (d, J = 4.0 Hz, 1H), 8.45 (d, J = 8.6 Hz, 1H), 7.93 (s, 1H), 7.72 (s, 1H), 7.61 - 7.55 (m, 1H), 7.53 - 7.48 (m, 1H), 7.48 - 7.42 (m, 1H), 7.36 - 7.31 (m, 1H), 6.92 (d, J = 8.1 Hz, 1H), 1.93 (s, 3H), 1.83 - 1.75 (m, 2H), 1.49 - 1.41 (m, 2H). MS (ESI, m / z):C20H16BrFN2, [M+H]+383.048.

[0165] Example 80 TIFF2025514293000140.tif27170C80: 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.00 (d, J = 4.0 Hz, 1H), 8.44 (d, J = 8.5 Hz, 1H), 7.71 (s, 1H), 7.70 - 7.60 (m, 3H), 6.90 (d, J = 8.2 Hz, 1H), 6.70 (d, J = 2.4 Hz, 1H), 6.40 - 6.35 (m, 1H), 3.89 - 3.82 (m, 2H), 3.47 - 3.42 (m, 2H), 3.16 - 3.10 (m, 1H), 2.08 (s, 6H), 1.83 (s, 3H), 1.66 - 1.62 (m, 2H), 1.45 - 1.40 (m, 2H). MS (ESI, m / z):C25H27FN4, [M+H]+402.222.

[0166] Example 81 TIFF2025514293000141.tif27170C81: 1 H NMR (400 MHz, CDCl 3) δ 9.10 - 9.04 (m, 1H), 9.02 (s, 1H), 7.96 - 7.89 (m, 1H), 7.63 - 7.56 (m, 1H), 7.46 - 7.36 (m, 1H), 7.30 (s, 1H), 7.00 - 6.92 (m, 1H), 6.41 - 6.33 (m, 2H), 6.24 - 6.19 (m, 1H), 3.92 - 3.84 (m, 2H), 3.52 - 3.44 (m, 2H), 2.98 - 2.91 (m, 2H), 2.77 - 2.66 (m, 1H), 2.07 (d, J = 4.7 Hz, 3H), 1.65 - 1.58 (m, 2H), 1.42 - 1.35 (m, 2H). MS (ESI, m / z):C24H25FN4O, [M+H]+405.201.

[0167] Example 82 TIFF2025514293000142.tif27170C82: 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.23 (d, J = 8.6 Hz, 1H), 8.93 (d, J = 3.8 Hz, 1H), 7.87 - 7.77 (m, 1H), 7.64 (dd, J = 8.6, 4.1 Hz, 1H), 7.54 - 7.42 (m, 1H), 6.77 (d, J = 8.2 Hz, 1H), 6.45 - 6.37 (m, 1H), 6.31 - 6.27 (m, 1H), 4.06 - 4.00 (m, 1H), 3.85 - 3.76 (m, 1H), 3.09 - 3.01 (m, 1H), 2.70 - 2.55 (m, 2H), 1.88 (s, 3H), 1.75 - 1.67 (m, 1H), 1.26 - 1.20 (m, 2H), 1.12 - 1.07 (m, 2H), 1.06 (s, 3H), 0.93 (s, 3H). MS (ESI, m / z):C26H29FN4O, [M+H]+432.233.

[0168] Example 83 TIFF2025514293000143.tif27170C83: 1 1H NMR (400 MHz, DMSO-d 6 ) δ 9.14 (d, J = 8.6 Hz, 1H), 9.07 (s, 1H), 8.97 (d, J = 3.3 Hz, 1H), 7.90 - 7.82 (m, 1H), 7.75 - 7.69 (m, 1H), 7.59 - 7.50 (m, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.36 - 6.28 (m, 1H), 6.11 (d, J = 2.1 Hz, 1H), 3.89 - 3.82 (m, 2H), 3.43 - 3.37 (m, 3H), 3.00 - 2.92 (m, 1H), 2.85 (s, 2H), 2.40 (s, 7H), 1.86 (s, 3H), 1.38 - 1.32 (m, 2H), 1.22 - 1.17 (m, 2H). MS (ESI, m / z):C26H29FN4O, [M+H]+432.233.

[0169] Example 84 TIFF2025514293000144.tif27170C84: 1 1H NMR (400 MHz, DMSO-d 6 ) δ 9.09 - 9.03 (m, 1H), 8.99 - 8.95 (m, 1H), 7.68 (dd, J = 8.6, 4.1 Hz, 1H), 7.56 - 7.43 (m, 2H), 7.26 (d, J = 1.9 Hz, 1H), 7.22 - 7.17 (m, 1H), 6.95 (d, J = 8.1 Hz, 1H), 3.47 (s, 2H), 1.91 (s, 3H), 1.20 - 1.13 (m, 2H), 0.95 - 0.89 (m, 2H). MS (ESI, m / z):C20H18BrFN2, [M+H]+385.064.

[0170] Example 85 TIFF2025514293000145.tif27170C85: 1H NMR (400 MHz, DMSO-d 6 ) δ 9.06 (d, J = 8.6 Hz, 1H), 9.00 - 8.94 (m, 1H), 7.72 - 7.65 (m, 1H), 7.57 - 7.52 (m, 1H), 7.52 - 7.46 (m, 1H), 6.78 (d, J = 8.0 Hz, 1H), 6.18 - 6.10 (m, 2H), 3.76 - 3.69 (m, 2H), 3.41 (s, 2H), 3.11 - 3.04 (m, 1H), 2.06 (s, 6H), 1.81 (s, 3H), 1.19 - 1.13 (m, 2H), 0.94 - 0.88 (m, 2H). MS (ESI, m / z):C25H29FN4, [M+H]+405.238.

[0171] Example 86 TIFF2025514293000146.tif27170C86: 1 H NMR (400 MHz, CDCl 3 ) δ 9.08 - 9.02 (m, 1H), 8.92 - 8.85 (m, 1H), 7.60 - 7.51 (m, 2H), 7.41 - 7.33 (m, 1H), 6.86 - 6.80 (m, 1H), 6.49 - 6.41 (m, 2H), 3.49 (s, 2H), 1.89 (s, 3H), 1.28 - 1.23 (m, 2H), 1.06 - 0.99 (m, 2H). MS (ESI, m / z): C20H20FN3, [M+H]+322.164.

[0172] Example 87 TIFF2025514293000147.tif27170C87: 1 H NMR (400 MHz, DMSO-d 6) δ 9.25 - 9.12 (m, 1H), 9.10 - 8.95 (m, 2H), 7.94 - 7.84 (m, 1H), 7.78 - 7.67 (m, 1H), 7.61 - 7.49 (m, 1H), 7.24 (s, 1H), 6.76 (d, J = 7.9 Hz, 1H), 6.55 - 6.41 (m, 1H), 6.28 (s, 1H), 4.90 (s, 2H), 1.84 (s, 3H), 1.37 - 1.29 (m, 2H), 1.22 - 1.14 (m, 2H). MS (ESI, m / z):C20H18FN3O, [M+H]+336.143.

[0173] Example 88: TIFF2025514293000148.tif27170C88: 1 1H NMR (400 MHz, DMSO) δ 8.93 (s, 1H), 8.71 - 8.61 (m, 1H), 8.24 - 8.14 (m, 1H), 7.72 (d, J = 7.7 Hz, 1H), 7.59 - 7.47 (m, 2H), 7.06 (d, J = 7.8 Hz, 1H), 6.91 (d, J = 8.2 Hz, 1H), 6.33 (dd, J = 8.2, 2.4 Hz, 1H), 6.12 (d, J = 2.4 Hz, 1H), 3.79 (t, J = 7.0 Hz, 2H), 3.48 - 3.37 (m, 2H), 3.17 - 3.05 (m, 1H), 2.81 (s, 6H), 2.06 (s, 6H), 1.94 (s, 3H), 1.32 (s, 2H), 1.12 (s, 2H). 1313C NMR (151 MHz, DMSO) δ 170.00, 150.41, 149.98, 138.13, 133.45, 132.62, 131.09, 129.06, 128.77, 126.11, 125.84, 125.01, 124.72, 123.26, 113.53, 112.61, 110.51, 56.72, 56.30, 45.37, 41.96, 34.33, 18.49, 14.70. MS (ESI, m / z): C28H34N4O, [M+H]+ 443.273.

[0174] Example 89: TIFF2025514293000149.tif25170C89: 1 1H NMR (400 MHz, DMSO-d 6 ) δ 9.03 - 8.96 (m, 2H), 7.75 (dd, J = 8.1, 5.0 Hz, 1H), 7.58 (d, J = 8.8 Hz, 1H), 7.46 (dd, J = 10.9, 8.0 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (dd, J = 8.1, 2.5 Hz, 1H), 6.13 (d, J = 2.5 Hz, 1H), 3.86 (d, J = 7.5 Hz, 2H), 3.52 (d, J = 14.5 Hz, 2H), 2.69 (s, 4H), 2.29 (s, 6H), 1.87 (s, 3H), 1.32 (q, J = 4.9 Hz, 2H), 1.16 (td, J = 5.0, 2.5 Hz, 2H). 13 13C NMR (101 MHz, MeOD) δ 173.88, 160.82, 150.73, 138.44, 135.60, 132.18, 129.83, 125.25, 124.33, 114.27, 113.88, 113.69, 111.13, 57.66, 56.86, 41.78, 34.62, 24.57, 18.22, 14.96. MS (ESI, m / z): C26H29FN4O, [M+H]+ 433.240.

[0175] Rate 90: TIFF2025514293000150.tif26170C90: 1 H NMR (400 MHz, Methanol-d 4 ) δ 9.20 (dt, J = 8.9, 1.6 Hz, 1H), 8.93 (dd, J = 4.3, 1.6 Hz, 1H), 8.00 (dd, J = 8.1, 5.0 Hz, 1H), 7.78 - 7.67 (m, 1H), 7.49 (dd, J = 4.3, 1.6 Hz, 1H), 8.1 Hz, 1H), 6.96 (d, J = 8.3 Hz, 1H), 6.44 (dd, J = 8.2, 2.6 Hz, 1H), 6.23 (d, J = 2.5 Hz, 1H), 3.22 (s, 1H), 2.21 (s, 6H), 1.94 (s, 3H), 1.52 - 1.45 (m, 2H), 1.38 - 1.31 (m, 2H). 13 C NMR (101 MHz, MeOD) δ 173.98, 159.65, 157.11, 151.12, 151.07, 146.30, 139.25; 132.12, 130.82, 130.74, 130.27, 126.34, 124.90, 123.39, 120.09, 114.24, 113.92, 113.73, 111.10, 57.19, 42.02, 18.22, MS (ESI, m / z):C25H23D4FN4O, [M+H]+423.249.

[0176] Page 91: TIFF2025514293000151.tif25170C91: 1 H NMR (400 MHz, Methanol-d 4) δ 7.30 (t, J = 7.0 Hz, 2H), 7.20 (d, J = 3.2 Hz, 1H), 7.14 (t, J = 7.7 Hz, 1H), 7.04 (d, J = 8.2 Hz, 1H), 6.85 (d, J = 3.2 Hz, 1H), 6.48 (dd, J = 8.2, 2.6 Hz, 1H), 6.36 (d, J = 2.6 Hz, 1H), 4.14 - 4.01 (m, 2H), 3.83 (s, 5H), 3.37 (s, 1H), 2.85 (s, 6H), 2.09 (s, 3H), 1.36 - 1.26 (m, 4H). 13 C NMR (101 MHz, MeOD) 13C NMR (101 MHz, DMSO-d 6 ) δ 169.19, 148.54, 137.97, 136.63, 134.07, 130.77, 128.83, 127.08, 124.15, 120.43, 118.59, 112.59, 110.57, 108.48, 99.98, 55.33, 54.92, 54.20, 34.39, 32.56, 18.21, 14.30. MS (ESI, m / z):C25H30N4O, [M+H]+403.249.

[0177] Compound Production (1) Preparation of Substituted Naphthyl-Cyclopropylamine Intermediate (1-(Substituted Naphthalen-1-yl)cyclopropylamine) The synthesis scheme is as follows: TIFF2025514293000152.tif41170

[0178] Substituted naphthonitrile (1, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, the reaction system was cooled to -78°C, and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched with stirring for 20 minutes, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, the organic phase was collected, evaporated to dryness using a rotary evaporator, and then separated by silica gel column chromatography to obtain substituted naphthyl-cyclopropylamine intermediate 2.

[0179] (2) Preparation of the Compounds of Examples 1 to 3 The synthesis scheme is as follows. TIFF2025514293000153.tif105170

[0180] Methyl 2-methyl-5-bromobenzoate (3, 2 mmol, 1.0 eq) was placed in a 50 mL sealed tube, and nitrogen- and hydrogen-containing amine compound 4 (3 mmol, 1.5 eq), tris(dibenzylideneacetone)dipalladium (0.04 mmol, 0.02 eq), X-PHOS ligand (0.08 mmol, 0.04 eq), and cesium carbonate (4 mmol, 2.0 eq) were added. Toluene solvent (10 mL) was then added, the reaction system was protected with argon, and the sealed tube was heated to 110 °C and stirred overnight. When the conversion of the substrate was complete as detected by thin layer chromatography, the organic solvent was evaporated to dryness on a rotary evaporator and purified by column chromatography separation to obtain intermediate 5.

[0181] Intermediate 5 (1.0 eq) was placed in a round-bottom flask, and tetrahydrofuran:water=2:1 was added as a solvent. Lithium hydroxide (4.0 eq) was then added to the reaction system, and the reaction was allowed to proceed with stirring at 60°C for 6 hours. The reaction system was then acidified with 2N hydrochloric acid, and ethyl acetate was added to precipitate a white solid. The solid was suction filtered and dried to obtain intermediate 6.

[0182] Intermediate 6 and the three-membered cyclic amine intermediate 2 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 7.

[0183] Finally, when Boc (tert-butoxycarbonyl) protection was present in the amine compound 6, the tert-butoxycarbonyl was removed from compound 7 with hydrochloric acid to give the final product.

[0184] (3) Preparation of the compounds of Examples 4 to 6 The synthesis scheme is as follows. TIFF2025514293000154.tif55170

[0185] 1-(3-bromophenyl)cyclopropanamine (8, 10 mmol, 1.0 eq) was placed in a 100 mL round-bottom flask, 50 mL of dichloromethane solvent was added, and then di-tert-butyl dicarbonate (40 mmol, 4.0 eq) was added. The mixture was stirred at room temperature and reacted for 4 hours. The organic solvent was then evaporated to dryness using a rotary evaporator, and the mixture was purified by column chromatography separation to obtain intermediate 9.

[0186] Intermediate 9 (4 mmol, 1.0 eq) was placed in a 50 mL sealed tube and thiophene-2-boronic acid pinacol ester (6 mmol, 1.5 eq), tris(dibenzylideneacetone)dipalladium (0.08 mmol, 0.02 eq), X-PHOS ligand (0.16 mmol, 0.04 eq), and potassium phosphate (10 mmol, 2.5 eq) were added. DMF:ethanol:water (10 mL:10 mL:5 mL) was then added as a solvent, the reaction system was protected with argon, and the sealed tube was heated to 95 °C and stirred overnight. Upon completion of the conversion of the substrate as detected by thin layer chromatography, the organic solvent was evaporated to dryness on a rotary evaporator, and the organic phase was extracted with ethyl acetate and purified by column chromatography separation to obtain intermediate 10.

[0187] Intermediate 10 (4 mmol, 1.0 eq) was dissolved in 20 mL of dichloromethane solvent, and 2 mL of a 4N hydrochloric acid-dioxane solution was added. The mixture was stirred at room temperature for 2 hours to cause a white solid to precipitate. The solid was suction filtered and dried to obtain Intermediate 11.

[0188] Intermediate 11 and the carboxylic acid intermediate 6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 12.

[0189] Finally, when Boc (tert-butoxycarbonyl) protection was present in the amine compound 6, the tert-butoxycarbonyl was removed from compound 7 with hydrochloric acid to give the final product.

[0190] (4) Preparation of the compounds of Examples 7 and 8 The synthesis scheme is as follows. TIFF2025514293000155.tif34170

[0191] 3-tert-Butylbenzonitrile (16, 10mmol, 1.0eq) was placed in a round-bottom flask, 10mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10mmol, 1.1eq) was added, the reaction system was cooled to -78℃, and then ethyl Grignard reagent (20mmol, 2.0eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20mmol, 2.0eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched for 20 minutes while stirring, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and dried by rotary evaporation, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 17.

[0192] 3-tert-Butylbenzene-cyclopropylamine intermediate 17 and the carboxylic acid intermediate 6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 18.

[0193] In Example 7, since the amine compound 6 was protected with Boc (tert-butoxycarbonyl), the tert-butoxycarbonyl was finally removed from the compound 18 with hydrochloric acid to obtain the final product.

[0194] (5) Preparation of Compounds of Examples 9 to 18 The synthesis scheme is as follows. TIFF2025514293000156.tif64170

[0195] Methyl 2-methyl-5-bromobenzoate (3, 10 mmol, 1.0 eq) was placed in a 350 mL sealed tube and azetidin-3-yl-dimethylamine (19, 15 mmol, 1.5 eq), tris(dibenzylideneacetone)dipalladium (0.2 mmol, 0.02 eq), X-PHOS ligand (0.4 mmol, 0.04 eq), and cesium carbonate (50 mmol, 5.0 eq) were added. Toluene solvent (60 mL) was then added, the reaction was protected with argon, and the sealed tube was heated to 110 °C and allowed to react overnight with stirring. Upon complete conversion of the substrate as detected by thin layer chromatography, the organic solvent was evaporated to dryness on a rotary evaporator and purified by column chromatography separation to give intermediate 20.

[0196] Intermediate 20 (1.0 eq) was placed in a round-bottom flask, and tetrahydrofuran:water=2:1 was added as a solvent. Then, potassium hydroxide (4.0 eq) was added to the reaction system, and the mixture was stirred at 60° C. for 6 hours. The organic solvent was then evaporated to dryness using a rotary evaporator. Then, 2N hydrochloric acid was added to the excess aqueous solution to acidify it and adjust it to pH=1. Then, the aqueous solution was evaporated to dryness using a rotary evaporator, and a methanol solution was added to extract the organic matter. The mixture was filtered under suction to remove the filter cake, and the filtrate was collected and evaporated to dryness using a rotary evaporator to obtain intermediate 21 as a white solid.

[0197] Intermediate 21 and the three-membered cyclic amine intermediate 2 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the mixture was reacted at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 22. Final product 22 is an example of this.

[0198] (6) Preparation of the compound of Example 19 The synthesis scheme is as follows. TIFF2025514293000157.tif35170

[0199] Benzonitrile (23, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was cooled to -78°C, after which ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and the mixture was quenched for 20 minutes while stirring, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and evaporated to dryness using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 24.

[0200] Cyclopropylamine intermediate 24 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 25. The final product 25 is C19.

[0201] (7) Preparation of the compound of Example 20 The synthesis scheme is as follows. TIFF2025514293000158.tif35170

[0202] Benzo[B]thiophene-3-carbonitrile (26, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, the reaction system was cooled to -78°C, and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched for 20 minutes while stirring, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and dried by rotary evaporation, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 27.

[0203] Cyclopropylamine intermediate 27 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 28. The final product 28 is C20.

[0204] (8) Preparation of the compound of Example 21 The synthesis scheme is as follows. TIFF2025514293000159.tif34170

[0205] 5,6,8,9-Tetrahydro-1-cyanonaphthalene (29, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, the reaction system was cooled to -78°C, and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched with stirring for 20 minutes, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and dried by rotary evaporation, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 30.

[0206] Cyclopropylamine intermediate 30 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 31. The final product 31 is C21.

[0207] (9) Preparation of the compound of Example 22 The synthesis scheme is as follows. TIFF2025514293000160.tif41170

[0208] 4-Cyanobiphenyl (32, 10mmol, 1.0eq) was placed in a round-bottom flask, 10mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10mmol, 1.1eq) was added, the reaction system was cooled to -78℃, and then ethyl Grignard reagent (20mmol, 2.0eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20mmol, 2.0eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched for 20 minutes while stirring, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and dried by rotary evaporation, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 33.

[0209] Cyclopropylamine intermediate 33 and the carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the mixture was reacted at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 34. The final product 34 is Example C22.

[0210] (10) Preparation of the compound of Example 23 The synthesis scheme is as follows. TIFF2025514293000161.tif41170

[0211] 3-Cyanobiphenyl (35, 10mmol, 1.0eq) was placed in a round-bottom flask, 10mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10mmol, 1.1eq) was added, the reaction system was cooled to -78℃, and then ethyl Grignard reagent (20mmol, 2.0eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20mmol, 2.0eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched with stirring for 20 minutes, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and dried by rotary evaporation, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 36.

[0212] Cyclopropylamine intermediate 36 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 37. The final product 37 is C23.

[0213] (11) Preparation of the compound of Example 24 The synthesis scheme is as follows. TIFF2025514293000162.tif37170

[0214] Benzofuran-4-carbonitrile (38, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, the reaction system was cooled to -78°C, and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched with stirring for 20 minutes, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and evaporated to dryness using a rotary evaporator, followed by separation by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 39.

[0215] Cyclopropylamine intermediate 39 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 40. The final product 40 is C24.

[0216] (12) Preparation of the compound of Example 25 The synthesis scheme is as follows. TIFF2025514293000163.tif64170

[0217] 1-Tetralone (41, 20 mmol, 1.0 eq), trimethylsilyl cyanide (24 mmol, 1.2 eq), zinc iodide (0.5 mmol, 0.025 eq) were placed in a 250 mL round-bottom flask, 100 mL of toluene was added as a solvent, and the mixture was stirred at room temperature for 8 hours. After the reaction was complete, as detected by thin-layer chromatography, the organic solvent was evaporated and dried using a rotary evaporator, and the mixture was purified by silica gel column chromatography separation to obtain intermediate 42. Intermediate 42 (15 mmol, 1.0 eq) was placed in a 250 mL round-bottom flask, 50 mL of pyridine was added, and then phosphorus oxychloride (45 mmol, 3.0 eq) was added dropwise at room temperature. After the addition was completed, the mixture was heated to 80°C and reacted for 8 hours. After the reaction was completed, the organic solvent was evaporated to dryness using a rotary evaporator, the reaction system was adjusted to neutral, and the organic phase was extracted with ethyl acetate. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography separation to obtain intermediate 43.

[0218] Intermediate 43 (10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, and the reaction system was cooled to -78 ° C., and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, and the mixture was quenched for 20 minutes while stirring, and then an excess of saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and evaporated to dryness using a rotary evaporator, and then separated by silica gel column chromatography to obtain 3-tert-butylphenyl-cyclopropylamine intermediate 44.

[0219] Cyclopropylamine intermediate 44 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 45. The final product 45 is C25.

[0220] (13) Preparation of the compound of Example 26 The synthesis scheme is as follows. TIFF2025514293000164.tif39170

[0221] 8-Fluoroquinoline-4-carbonitrile (71, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, the reaction system was cooled to -78°C, and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction was stirred at room temperature for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched for 20 minutes while stirring, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, and the organic phase was collected and dried by rotary evaporation, and then separated by silica gel column chromatography to obtain 8-fluoroquinolyl-cyclopropylamine intermediate 72.

[0222] Cyclopropylamine intermediate 72 and carboxylic acid intermediate 21 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 70°C for 12 hours. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 73. The final product 73 is C26.

[0223] (14) Preparation of the compound of Example 27 The overall synthetic scheme is as follows: The manufacturing method of TIFF2025514293000165.tif37170 subscheme step 1 is as follows. TIFF2025514293000166.tif29170

[0224] Weigh out 1.64g (25mmol, 2.5eq.) of zinc powder, wash it with 2M hydrochloric acid three times, or with 0.5M hydrochloric acid and stir for 5min, then wash it with anhydrous ethanol and anhydrous ether three times, and dry it by stirring in an oil bath at 140℃ for 2h by vacuum pump. The activated zinc powder was placed in a three-neck flask, and under Ar protection, ultra-dry tetrahydrofuran (5mL) was added, and 1,2-dibromoethane (173μL, 2mmol, 0.2eq.) was added. The mixture was refluxed and heated to 75℃, and when a large amount of bubbles were confirmed, the reaction was continued for 30min. The mixture was naturally cooled to room temperature, and 255μL (2mmol, 0.2eq.) of trimethylchlorosilane was slowly added, and when a large amount of bubbles were confirmed, the reaction was continued for 15min. Heat to 65℃, dissolve 1.04mL of methyl 1-bromocyclopropanecarboxylate (10mmol, 1.0eq) in 15mL of ultra-dry tetrahydrofuran, and slowly add dropwise to the reaction system. Keep at 65℃ and react for 4h (if a large amount is added, it can be reacted overnight to ensure complete reaction), to obtain intermediate 27-2, which was directly added to step 2 without the need for post-treatment.

[0225] The preparation method of subscheme step 2 is as follows. TIFF2025514293000167.tif32170

[0226] Preparation of Intermediate 27-4a The synthesis scheme is as follows. TIFF2025514293000168.tif34170

[0227] Weigh out 2080 mg (10 mmol, 1.0 eq.) of 5-bromoquinoline 27-3a and add it to Pd 2 (dba) 3 91.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) was added dissolved in 20mL of tetrahydrofuran. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4a.

[0228] Preparation of intermediate 27-4b The synthesis scheme is as follows. TIFF2025514293000169.tif34170

[0229] Weigh out 2080 mg (10 mmol, 1.0 eq.) of 4-bromoquinoline 27-3b and add it to Pd 2 (dba) 391.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) was added dissolved in 20mL of tetrahydrofuran. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4b.

[0230] Preparation of intermediate 27-4c The synthesis scheme is as follows. TIFF2025514293000170.tif34170

[0231] Weigh out 2410 mg (10 mmol, 1.0 eq.) of 4-bromo-8-chloroquinoline 27-3c and add it to Pd 2 (dba) 3 91.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) was added dissolved in 20mL of tetrahydrofuran. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4c.

[0232] Preparation of intermediate 27-4d The synthesis scheme is as follows. TIFF2025514293000171.tif34170

[0233] Weigh out 2370 mg (10 mmol, 1.0 eq.) of 4-bromo-8-methoxyquinoline 27-3d and add it to Pd 2 (dba) 3 91.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. Stirred at room temperature for 30min, and when the reaction and conversion were completely completed as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4d.

[0234] Preparation of intermediate 27-4e The synthesis scheme is as follows. TIFF2025514293000172.tif32170

[0235] Weigh out 2239 mg (10 mmol, 1.0 eq.) of 1-bromo-4-fluoronaphthalene 27-3e and add it to Pd 2 (dba) 3 91.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) was added dissolved in 20mL of tetrahydrofuran. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4e.

[0236] Preparation of intermediate 27-4f The synthesis scheme is as follows. TIFF2025514293000173.tif34170

[0237] Weigh out 2249 mg (10 mmol, 1.0 eq.) of 5-bromo-8-fluoroquinoline 27-3f and add it to Pd 2 (dba) 3 91.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) was added dissolved in 20mL of tetrahydrofuran. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4f.

[0238] Preparation of intermediate 27-4g The synthesis scheme is as follows. TIFF2025514293000174.tif34170

[0239] 2-Bromonaphthalene 27-3g 2059mg (10mmol, 1.0eq.) was weighed out and mixed with Pd 2 (dba) 3 91.5mg (0.1mmol, 0.01eq) and Qphos 71mg (0.1mmol, 0.01eq) were added and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 27-2 Reformatsky reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. Stirred at room temperature for 30min, and when the reaction and conversion were completely completed as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 27-4g.

[0240] The production method of subscheme step 3 is as follows. TIFF2025514293000175.tif106170

[0241] Preparation of Intermediate 27-5a The synthesis scheme is as follows. TIFF2025514293000176.tif25170

[0242] Weigh out 2518mg (11.09mmol, 1.0eq) of intermediate 27-4a, dissolve it in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 65mL), add 2484mg (44.37mmol, 4.0eq) of potassium hydroxide, and react at 50℃ for 8h. When the reaction was detected to be completely converted, add 2N HCl solution to adjust pH=3, evaporate all of the solvent on a rotary evaporator, add 25mL of methanol, filter to take the filtrate, evaporate the filtrate on a rotary evaporator to obtain a gray solid, and finally wash the gray solid repeatedly with DCM / PE to obtain a white solid product 27-5a. TIFF2025514293000177.tif62170

[0243] The preparation scheme of intermediates 27-5b to 27-5g is the same as that of intermediate 27-5a.

[0244] The preparation scheme for sub-scheme step 4 is as follows. TIFF2025514293000178.tif99170

[0245] Preparation of Intermediate 27-6a The synthesis scheme is as follows. TIFF2025514293000179.tif29170

[0246] Weigh out 426 mg (2 mmol, 1.0 eq) of intermediate 27-5a and dissolve it in 25 mL of ultra-dry toluene, add 0.611 mL of triethylamine (4.4 mmol, 2.2 eq), and add 0.516 mL of DPPA (2.4 mmol, 1.2 eq) under Ar protection. Stir at room temperature for 30 min, and when all the carboxylic acid raw material is converted to acyl azide, heat to 75 ° C and react for 4 h. When most of the acyl azide is converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C, and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, take the organic phase, add to 2.5 ml HCl (4 M HCl in Dioxane, 10 mmol, 2.0 eq) solution, filter with sand core funnel, wash with petroleum ether and ethyl acetate several times, and obtain white powder product 27-6a. TIFF2025514293000180.tif67170

[0247] The preparation scheme of intermediates 27-6b to 27-6g is the same as that of intermediate 27-6a.

[0248] The preparation scheme for sub-scheme step 5 is as follows. TIFF2025514293000181.tif34170

[0249] Preparation of Intermediate 27-9a The synthesis scheme is as follows. TIFF2025514293000182.tif46170

[0250] Methyl 2-methyl-5-bromobenzoate 27-8 4580mg (20mmol, 1.0eq), 3-(dimethylamino)azetidine dihydrochloride 27-7a (22mmol, 1.1eq) 3740mg, Pd 2 (dba) 3Weighed out 370mg (0.4mmol, 0.02eq), XPhos 760mg (1.6mmol, 0.08eq), and cesium carbonate 26080mg (80mmol, 4.0eq), dissolved in 100mL of toluene, placed in a sealed tube, heated to 110°C under Ar protection, and left overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9a was obtained by column chromatography.

[0251] Preparation of intermediate 27-9b The synthesis scheme is as follows. TIFF2025514293000183.tif45170

[0252] Methyl 2-methyl-5-bromobenzoate 27-8 1700mg (7.4mmol, 1.0eq), 3-dimethylaminopiperidine 27-7b 1000mg (7.8mmol, 1.05eq), Pd 2 (dba) 3 Weighed out 204mg (0.22mmol, 0.03eq), XPhos 425mg (0.89mmol, 0.12eq), and cesium carbonate 9600mg (29.72mmol, 4.0eq), dissolved in 45mL of toluene, placed in a sealed tube, heated to 110°C under Ar protection, and reacted overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9b was obtained by column chromatography.

[0253] Preparation of intermediate 27-9c The synthesis scheme is as follows. TIFF2025514293000184.tif45170

[0254] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10mmol, 1.0eq), Thiomorpholine-1,1-dioxide 27-7c 1480mg (11mmol, 1.1eq), Pd 2 (dba) 3Weighed out 274.5mg (0.3mmol, 0.03eq), XPhos 572mg (1.2mmol, 0.12eq), and cesium carbonate 1304mg (40mmol, 4.0eq), dissolved in 60mL of toluene, placed in a sealed tube, heated to 110°C under Ar protection, and reacted overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9c was obtained by column chromatography.

[0255] Preparation of intermediate 27-9d The synthesis scheme is as follows. TIFF2025514293000185.tif45170

[0256] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10mmol, 1.0eq), 3-aminoquinuclidine hydrochloride 27-7d 2190mg (11mmol, 1.1eq), Pd 2 (dba) 3 Weighed out 92mg (0.1mmol, 0.01eq), XPhos 1431mg (0.3mmol, 0.03eq), and cesium carbonate 1304mg (40mmol, 4.0eq), dissolved them in 60mL of toluene, put them into a sealed tube, heated to 110°C under Ar protection, and reacted overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9d was obtained by column chromatography.

[0257] Preparation of intermediate 27-9e The synthesis scheme is as follows. TIFF2025514293000186.tif41170

[0258] Methyl 2-methyl-5-bromobenzoate 27-8 1420mg (6.2mmol, 1.0eq), 27-7e 936mg (11mmol, 1.1eq), Pd 2 (dba) 3Weigh out 56mg (0.1mmol, 0.01eq), XPhos 118mg (0.4mmol, 0.04eq), and 8300mg (40mmol, 4.0eq) of cesium carbonate, dissolve them in 50mL of toluene, place them in a sealed tube, and heat them to 110°C under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9e was obtained by column chromatography.

[0259] Preparation of intermediate 27-9f The synthesis scheme is as follows. TIFF2025514293000187.tif40170

[0260] Methyl 2-methyl-5-bromobenzoate 27-8 2290 mg (10.0 mmol, 1.0 eq), 27-7f 1.5 mL (11 mmol, 1.1 eq), Pd 2 (dba) 3 Weighed out 91.5mg (0.1mmol, 0.01eq), XPhos 190mg (0.4mmol, 0.04eq), and cesium carbonate 16300mg (50mmol, 5.0eq), dissolved in 50mL of toluene, placed in a sealed tube, heated to 110°C under Ar protection, and reacted overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9f was obtained by column chromatography.

[0261] Preparation of intermediate 27-9g The synthesis scheme is as follows. TIFF2025514293000188.tif46170

[0262] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10.0mmol, 1.0eq), 27-7g 1388mg (11mmol, 1.1eq), Pd 2 (dba) 3Weighed out 91.5mg (0.1mmol, 0.01eq), XPhos 190mg (0.4mmol, 0.04eq), and cesium carbonate 16300mg (50mmol, 5.0eq), dissolved them in 50mL of toluene, placed them in a sealed tube, and heated to 110°C under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9g was obtained by column chromatography.

[0263] Preparation of intermediate 27-9h The synthesis scheme is as follows. TIFF2025514293000189.tif45170

[0264] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10.0mmol, 1.0eq), 27-7h 2mL (11mmol, 1.1eq), Pd 2 (dba) 3 Weigh out 274mg (0.3mmol, 0.03eq), XPhos 571mg (1.2mmol, 0.12eq), and cesium carbonate 13040mg (50mmol, 5.0eq), dissolve them in 50mL of toluene, place them in a sealed tube, and react overnight at 110°C under Ar protection. Wash with water and ethyl acetate, and collect the organic phase. Column chromatography gives the product intermediate 27-9h.

[0265] Preparation of intermediate 27-9i The synthesis scheme is as follows. TIFF2025514293000190.tif37170

[0266] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10.0mmol, 1.0eq), 27-7i 2mL (11mmol, 1.1eq), Pd 2 (dba) 392mg (0.1mmol, 0.01eq), XPhos 190mg (0.4mmol, 0.04eq), and cesium carbonate 13040mg (50mmol, 5.0eq) were weighed, dissolved in 50mL of toluene, placed in a sealed tube, and heated to 110°C under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9i was obtained by column chromatography.

[0267] Preparation of intermediate 27-9j The synthesis scheme is as follows. TIFF2025514293000191.tif37170

[0268] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10.0mmol, 1.0eq), 27-7j 2350mg (11mmol, 1.1eq), Pd 2 (dba) 3 92mg (0.1mmol, 0.01eq), XPhos 190mg (0.4mmol, 0.04eq), and cesium carbonate 13040mg (50mmol, 5.0eq) were weighed, dissolved in 50mL of toluene, placed in a sealed tube, and heated to 110°C under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9j was obtained by column chromatography. TIFF2025514293000192.tif37170

[0269] Methyl 2-methyl-5-bromobenzoate 27-8 2290mg (10.0mmol, 1.0eq), 27-7k 2200mg (11mmol, 1.1eq), Pd 2 (dba) 3Weigh out 92mg (0.1mmol, 0.01eq), XPhos 190mg (0.4mmol, 0.04eq), and cesium carbonate 13040mg (50mmol, 5.0eq), dissolve them in 50mL of toluene, place them in a sealed tube, and react overnight at 110°C under Ar protection. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate 27-9k was obtained by column chromatography.

[0270] The preparation method of subscheme step 6 is as follows. TIFF2025514293000193.tif89170

[0271] Preparation of Intermediate 27-10a The synthesis scheme is as follows. TIFF2025514293000194.tif42170

[0272] Intermediate 27-9a (10 mmol, 1 eq.) was weighed and dissolved in a mixed solution of 25 mL of methanol and 25 mL of water, potassium hydroxide (40 mmol, 4 eq.) was added, and the mixture was heated at 60 ° C. and stirred overnight. After the reaction was completed, excess hydrochloric acid was added to adjust the pH of the reaction solution to acidic (do not make it excessively acidic due to the risk of cyclization of the product), and the solvent was completely evaporated and dried using a rotary evaporator (after the first evaporation and drying using a rotary evaporator, small amounts of methanol were added in multiple portions and evaporated and dried using a rotary evaporator to remove as much water as possible), methanol was added, stirred, and then suction filtered. If the filtered solid contained a large amount of product, the solid was dissolved in methanol multiple times and suction filtered until the solid was completely dissolved (no fluorescence in ultraviolet detection by thin layer chromatography). The filtrate was collected and concentrated, and then recrystallized with dichloromethane to obtain product intermediate 27-10a. TIFF2025514293000195.tif56170

[0273] The preparation scheme of intermediates 27-10b to 27-10l is the same as that of intermediate 27-10a.

[0274] The method for producing the final product, subscheme step 7, is as follows: TIFF2025514293000196.tif32170

[0275] Preparation of compound of Example 27 The synthesis scheme is as follows. TIFF2025514293000197.tif37170

[0276] 184 mg (1 mmol, 1.0 eq) of amine intermediate 27-6a, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 27-10a, and 869 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product FS41, the compound of Example 27.

[0277] (15) Preparation of the compound of Example 28 The synthesis scheme is as follows. TIFF2025514293000198.tif40170

[0278] 30 mg (0.154 mmol, 1.0 eq) of amine intermediate 28-6b, 36 mg (0.154 mmol, 1.0 eq) of carboxylic acid intermediate 28-10a, and 133 μL (0.77 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 87 mg (0.231 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate. The organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS42, the compound of Example 28.

[0279] (16) Preparation of the compound of Example 29 The synthesis scheme is as follows. TIFF2025514293000199.tif40170

[0280] 132 mg (0.58 mmol, 1.0 eq) of amine intermediate 29-6c, 135 mg (0.58 mmol, 1.0 eq) of carboxylic acid intermediate 29-10a, and 504 μL (2.9 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF and stirred until completely dissolved. 330 mg (0.87 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS43, the compound of Example 29.

[0281] (17) Preparation of the compound of Example 30 The synthesis scheme is as follows. TIFF2025514293000200.tif39170

[0282] Amine intermediate 30-6d (0.38 mmol, 1.0 eq), carboxylic acid intermediate 30-10a 106 mg (0.45 mmol, 1.0 eq), and DIPEA 330 μL (1.9 mmol, 5.0 eq) were weighed and dissolved in THF 3 mL and stirred until completely dissolved. HATU 216 mg (0.57 mmol, 1.5 eq) was added and reacted at room temperature for 4 h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS44, the compound of Example 30.

[0283] (18) Preparation of the compound of Example 31 The synthesis scheme is as follows. TIFF2025514293000201.tif37170

[0284] 118 mg (0.5 mmol, 1.0 eq) of amine intermediate 31-6e, 158 mg (0.6 mmol, 1.2 eq) of carboxylic acid intermediate 31-10b, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product FS45, Example 31.

[0285] (19) Preparation of the compound of Example 32 The synthesis scheme is as follows. TIFF2025514293000202.tif37170

[0286] 115 mg (0.5 mmol, 1.0 eq) of amine intermediate 32-6b, 157 mg (0.6 mmol, 1.2 eq) of carboxylic acid intermediate 32-10b, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product FS46, the compound of Example 32.

[0287] (20) Preparation of the compound of Example 33 The synthesis scheme is as follows. TIFF2025514293000203.tif40170

[0288] 92 mg (0.5 mmol, 1.0 eq) of amine intermediate 33-6b, 161 mg (0.6 mmol, 1.2 eq) of carboxylic acid intermediate 33-10c, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS47, the compound of Example 33.

[0289] (21) Preparation of the compound of Example 34 The synthesis scheme is as follows. TIFF2025514293000204.tif39170

[0290] 92 mg (0.5 mmol, 1.0 eq) of amine intermediate 34-6b, 143 mg (0.55 mmol, 1.1 eq) of carboxylic acid intermediate 34-10d, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate. The organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS48, the compound of Example 34.

[0291] (22) Preparation of the compound of Example 35 The synthesis scheme is as follows. TIFF2025514293000205.tif39170

[0292] 100.5 mg (0.5 mmol, 1.0 eq) of amine intermediate 35-6e, 134 mg (0.5 mmol, 1.0 eq) of carboxylic acid intermediate 35-10c, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product FS50, Example 35.

[0293] (23) Preparation of Compound of Example 36 The synthesis scheme is as follows. TIFF2025514293000206.tif39170

[0294] 92 mg (0.5 mmol, 1.0 eq) of amine intermediate 36-6a, 129 mg (0.55 mmol, 1.1 eq) of carboxylic acid intermediate 36-10e, and 434 μL (2.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS52, the compound of Example 36.

[0295] (24) Preparation of the compound of Example 37 The synthesis scheme is as follows. TIFF2025514293000207.tif53170

[0296] Weigh out 4240 mg (20 mmol, 1.0 eq) of intermediate 37-8 and 1920 mg (80 mmol, 4.0 eq.) of lithium hydroxide, dissolve them in HO / MeOH / THF=1 / 2 / 2 (75 mL), and react them at 50° C. overnight. After the reaction was completed, the methanol and tetrahydrofuran were evaporated to dryness using a rotary evaporator, the reaction solution was washed with ethyl acetate and water, the aqueous phase was taken, and the pH value of the aqueous solution was adjusted to acidic by adding 2N HCl solution, the reaction solution was washed with EA and water, the organic phase was taken, and the solution was evaporated to dryness using a rotary evaporator to obtain intermediate 37-11.

[0297] 276 mg (1.5 mmol, 1.0 eq) of amine intermediate 37-6a, 322 mg (1.5 mmol, 1.0 eq) of carboxylic acid intermediate 37-11, and 1304 μL (7.5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of THF and stirred until completely dissolved. 855 mg (2.25 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate. The organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain intermediate 37-12.

[0298] Weigh out 220 mg (0.58 mmol, 1.0 eq.) of intermediate 37-12 and add it to Pd 2 (dba) 35.3mg (0.058mmol, 0.01eq), 11mg (0.023mmol, 0.01eq), and 756mg (2.32mmol, 4.0eq) of cesium carbonate were added and dissolved in 5mL of toluene, placed in a sealed tube, heated to 110°C under Ar protection, and left overnight. When the reaction solution was cooled to room temperature, the toluene was evaporated to dryness on a rotary evaporator, then 2N HCl solution and ethyl acetate were added to wash the reaction solution, and the aqueous phase was taken, then the pH value of the aqueous solution was adjusted to alkaline with saturated sodium bicarbonate aqueous solution, then water and ethyl acetate were added to wash, and the organic phase was taken. The organic phase was evaporated to dryness on a rotary evaporator, and then the product FS53, the compound of Example 37, was obtained by column chromatography.

[0299] (25) Preparation of the compound of Example 38 The synthesis scheme is as follows. TIFF2025514293000208.tif41170

[0300] 113 mg (0.56 mmol, 1.4 eq.) of amine intermediate 38-6f, 94 mg (0.4 mmol, 1.0 eq.) of carboxylic acid intermediate 38-10e, and 139 μL (0.8 mmol, 2.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 182 mg (0.48 mmol, 1.2 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate. The organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS54, the compound of Example 38.

[0301] (26) Preparation of the compound of Example 39 The synthesis scheme is as follows. TIFF2025514293000209.tif39170

[0302] Amine intermediate 39-6f 101mg (0.5mmol, 1.0eq.), carboxylic acid intermediate 39-10d 143mg (0.55mmol, 1.0eq.), and DIPEA 434μL (2.5mmol, 5.0eq.) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 285mg (0.75mmol, 1.5eq.) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified through a column to obtain the final product FS55, the compound of Example 39.

[0303] (27) Preparation of the compound of Example 40 The synthesis scheme is as follows. TIFF2025514293000210.tif40170

[0304] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 40-6f, 157 mg (0.6 mmol, 1.2 eq.) of carboxylic acid intermediate 40-10b, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate. The organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS56, the compound of Example 40.

[0305] (28) Preparation of the compound of Example 41 The synthesis scheme is as follows. TIFF2025514293000211.tif38170

[0306] Amine intermediate 41-6f 101mg (0.5mmol, 1.0eq.), carboxylic acid intermediate 41-10c 148mg (0.55mmol, 1.1eq.), and DIPEA 434μL (2.5mmol, 5.0eq.) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 285mg (0.75mmol, 1.5eq.) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified through a column to obtain the final product FS57, the compound of Example 41.

[0307] (29) Preparation of the compound of Example 42 The synthesis scheme is as follows. TIFF2025514293000212.tif42170

[0308] Amine intermediate 42-6a 92mg (0.5mmol, 1.0eq.), carboxylic acid intermediate 42-10f 144mg (0.55mmol, 1.1eq.), and DIPEA 434μL (2.5mmol, 5.0eq.) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 285mg (0.75mmol, 1.5eq.) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS59, the compound of Example 42.

[0309] (30) Preparation of the compound of Example 43 The synthesis scheme is as follows. TIFF2025514293000213.tif44170

[0310] 92 mg (0.5 mmol, 1.0 eq.) of amine intermediate 43-6b, 143 mg (0.55 mmol, 1.1 eq.) of carboxylic acid intermediate 43-10g, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS60, the compound of Example 43.

[0311] (31) Preparation of the compound of Example 44 The synthesis scheme is as follows. TIFF2025514293000214.tif40170

[0312] Amine intermediate 44-6f 101mg (0.5mmol, 1.0eq.), carboxylic acid intermediate 44-10f 144mg (0.55mmol, 1.1eq.), and DIPEA 434μL (2.5mmol, 5.0eq.) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 285mg (0.75mmol, 1.5eq.) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product F61, the compound of Example 44.

[0313] (32) Preparation of the compound of Example 45 The synthesis scheme is as follows. TIFF2025514293000215.tif44170

[0314] Amine intermediate 45-6f 101mg (0.5mmol, 1.0eq.), carboxylic acid intermediate 45-10g 143mg (0.55mmol, 1.1eq.), and DIPEA 434μL (2.5mmol, 5.0eq.) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 285mg (0.75mmol, 1.5eq.) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product F62, the compound of Example 45.

[0315] (33) Preparation of the compound of Example 46 The synthesis scheme is as follows. TIFF2025514293000216.tif43170

[0316] 184 mg (1.0 mmol, 1.0 eq.) of amine intermediate 46-6a, 572 mg (1.1 mmol, 1.1 eq.) of carboxylic acid intermediate 46-10g, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate. The organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product F63, the compound of Example 46.

[0317] (34) Preparation of the compound of Example 47 The synthesis scheme is as follows. TIFF2025514293000217.tif40170

[0318] Amine intermediate 47-6g 92mg (0.5mmol, 1.0eq.), carboxylic acid intermediate 47-10a 129mg (0.55mmol, 1.1eq.), and DIPEA 434μL (2.5mmol, 5.0eq.) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 285mg (0.75mmol, 1.5eq.) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS64, the compound of Example 47.

[0319] (35) Preparation of the compound of Example 48 The synthesis scheme is as follows. TIFF2025514293000218.tif42170

[0320] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 48-6e, 288 mg (1.1 mmol, 1.1 eq.) of carboxylic acid intermediate 48-10f, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified through a column to obtain the final product FS65, the compound of Example 48.

[0321] (36) Preparation of the compound of Example 49 The synthesis scheme is as follows. TIFF2025514293000219.tif42170

[0322] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 49-6e, 286 mg (1.1 mmol, 1.1 eq.) of carboxylic acid intermediate 49-10g, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS66, the compound of Example 49.

[0323] (37) Preparation of the compound of Example 50 The synthesis scheme is as follows. TIFF2025514293000220.tif36170

[0324] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 50-6e, 321 mg (1.0 mmol, 1.0 eq.) of carboxylic acid intermediate 50-10h, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg of HATU (1.5 mmol, 1.5 eq.) was added and the reaction was allowed to proceed for 4 h at room temperature. After the complete conversion of the reactants, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product FS69-Boc. It was then dissolved in 2 mL of DCM and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added and the reaction was allowed to proceed for 2 h at room temperature. After the reaction was completed, the reaction solution was washed with DCM / H2O, and the aqueous phase was separated. Then, the pH of the aqueous phase was adjusted to alkaline, and the mixture was extracted with ethyl acetate. The organic phase was separated and purified through a column to obtain the final product FS69, which is the compound of Example 50.

[0325] (38) Preparation of the compound of Example 51 The synthesis scheme is as follows. TIFF2025514293000221.tif43170

[0326] 202 mg (1.0 mmol, 1.0 eq.) of amine intermediate 51-6f, 372 mg (1.5 mmol, 1.5 eq.) of carboxylic acid intermediate 51-10i, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS70, the compound of Example 51.

[0327] (39) Preparation of the compound of Example 52 The synthesis scheme is as follows. TIFF2025514293000222.tif35170

[0328] 202 mg (1.0 mmol, 1.0 eq.) of amine intermediate 52-6f, 522 mg (1.5 mmol, 1.5 eq.) of carboxylic acid intermediate 52-10j, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and then the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product FS71-Boc. It was then dissolved in 2 mL of DCM and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added and stirred at room temperature for 2 h. After the reaction was completed, the reaction solution was washed with DCM / H2O, and the aqueous phase was separated. Then, the pH of the aqueous phase was adjusted to alkaline, and the mixture was extracted with ethyl acetate. The organic phase was separated and purified through a column to obtain the final product FS71, which is the compound of Example 52.

[0329] (40) Preparation of the compound of Example 53 The synthesis scheme is as follows. TIFF2025514293000223.tif36170

[0330] 303 mg (1.5 mmol, 1.0 eq.) of amine intermediate 53-6f, 481 mg (1.5 mmol, 1.0 eq.) of carboxylic acid intermediate 53-10h, and 1303 μL (7.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 855 mg (2.25 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and then the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product FS72-Boc. It was then dissolved in 2 mL of DCM and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added and stirred at room temperature for 2 h. After the reaction was completed, the reaction solution was washed with DCM / H2O, and the aqueous phase was separated. Then, the pH of the aqueous phase was adjusted to alkaline, and the mixture was extracted with ethyl acetate. The organic phase was separated and purified through a column to obtain the final product FS72, which is the compound of Example 53.

[0331] (41) Preparation of the compound of Example 54 The synthesis scheme is as follows. TIFF2025514293000224.tif42170

[0332] 202 mg (1.0 mmol, 1.0 eq.) of amine intermediate 54-6e, 370 mg (1.5 mmol, 1.5 eq.) of carboxylic acid intermediate 54-10l, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product FS74, the compound of Example 54.

[0333] (42) Preparation of the compound of Example 55 The synthesis scheme is as follows. TIFF2025514293000225.tif35170

[0334] 201 mg (1.0 mmol, 1.0 eq.) of amine intermediate 55-6e, 334 mg (1.0 mmol, 1.0 eq.) of carboxylic acid intermediate 55-10k, and 870 μL (5.0 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq.) of HATU was added and reacted at room temperature for 4 h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and then the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product FS76-Boc. It was then dissolved in 2 mL of DCM and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added and stirred at room temperature for 2 h. After the reaction was completed, the reaction solution was washed with DCM / H2O, and the aqueous phase was separated. Then, the pH of the aqueous phase was adjusted to alkaline, and the mixture was extracted with ethyl acetate. The organic phase was separated and purified through a column to obtain the final product FS76, which is the compound of Example 55.

[0335] (43) Preparation of the compound of Example 56 The synthesis scheme is as follows. TIFF2025514293000226.tif36170

[0336] 101 mg (0.5 mmol, 1.0 eq.) of amine intermediate 56-6f, 167 mg (0.5 mmol, 1.0 eq.) of carboxylic acid intermediate 56-10k, and 434 μL (2.5 mmol, 5.0 eq.) of DIPEA were weighed and dissolved in 3 mL of THF and stirred until completely dissolved. 285 mg (0.75 mmol, 1.5 eq.) of HATU were added and reacted at room temperature for 4 h. When the reactants were completely converted, the THF was evaporated to dryness on a rotary evaporator, and then the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product FS77-Boc. It was then dissolved in 2 mL of DCM and stirred until completely dissolved. CF3COOH (10 mmol, 10 eq.) was added and stirred at room temperature for 2 h. After the reaction was completed, the reaction solution was washed with DCM / H2O, and the aqueous phase was separated. Then, the pH of the aqueous phase was adjusted to alkaline, and the mixture was extracted with ethyl acetate. The organic phase was separated and purified through a column to obtain the final product FS77, which is the compound of Example 56.

[0337] (44) Preparation of the compound of Example 57 The synthesis scheme is as follows. TIFF2025514293000227.tif30170

[0338] 7-Bromobenzo[b]thiophene (57-3, 10 mmol, 1.0 eq) was dissolved in 50 mL of dry DMF in a round-bottom flask, and then potassium ferrocyanide (5 mmol, 0.5 eq) and Pd 2 (dba) 3 (0.5 mmol, 0.05 eq) and cesium carbonate (15 mmol, 1.5 eq) were added, and the mixture was heated to 120° C. under argon protection and stirred for 12 hours. After the reaction was completed, 50 mL of water was added to the reaction system, and ethyl acetate was added for extraction. The organic phase was collected and dried by a rotary evaporator, and then separated by silica gel column chromatography to obtain benzo[b]thiophene-7-carbonitrile intermediate 57-4.

[0339] Benzo[b]thiophene-7-carbonitrile (2, 10 mmol, 1.0 eq) was placed in a round-bottom flask, 10 mL of dry tetrahydrofuran was added as a solvent, then tetraisopropyl titanate (10 mmol, 1.1 eq) was added, the reaction system was cooled to -78 ° C, and then ethyl Grignard reagent (20 mmol, 2.0 eq) was slowly added dropwise to the reaction system. After the addition was completed, the reaction system was warmed to room temperature and reacted for 1.5 hours. Next, boron trifluoride etherate (20 mmol, 2.0 eq) was added dropwise to the reaction system, and after the addition was completed, the reaction system was stirred at room temperature and reacted for 3 hours. After the reaction was completed, 20 mL of 2N hydrochloric acid was added dropwise to the reaction system, quenched for 20 minutes while stirring, and then excess saturated sodium hydroxide solution was added. Ethyl acetate was added for extraction, the organic phase was collected, evaporated to dryness with a rotary evaporator, and then separated by silica gel column chromatography to obtain intermediate 57-5.

[0340] Intermediate 57-5 and the carboxylic acid intermediate 57-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5eq) and DIPEA (2.0eq) were added, and the reaction was carried out at 50°C for 12h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 57-7. The final product 57-7 is the compound of Example 57.

[0341] (45) Preparation of the compound of Example 58 The synthesis scheme is as follows. TIFF2025514293000228.tif731705-Bromo-8-trifluoromethoxyquinoline (58-8, 10 mmol, 1.0 eq), Pd2(dba)3 (0.1 mmol, 0.01 eq), and 71 mg of QPhos (0.1 mmol, 0.01 eq) were placed in a round-bottom flask and dissolved in 20 mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 58-2 Reformatsky Reagent (20 mmol, 1N, 2.0 eq) dissolved in 20 mL of tetrahydrofuran was added. After stirring at room temperature for 30 min, the reaction and conversion were found to be complete. The solvent was evaporated to dryness using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 58-9 was obtained by purification using column chromatography.

[0342] Intermediate 58-9 (10 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 h. When the reaction was found to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator. Then, 25 mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 58-10.

[0343] Intermediate 58-10 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and DPPA (2.4 mmol, 1.2 eq) was added under argon protection. Stir at room temperature for 30 min. When all the carboxylic acid raw material was converted to acyl azide, heat to 75 ° C. and react for 4 h. When most of the acyl azide was converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C., and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, collect the organic phase, evaporate to dryness with a rotary evaporator, and separate by silica gel column chromatography to obtain intermediate 58-11.

[0344] Intermediate 58-11 and the carboxylic acid intermediate 58-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5eq) and DIPEA (2.0eq) were added, and the reaction was carried out at 50°C for 12h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 58-12. The final product 58-12 is the compound of Example 58.

[0345] (46) Preparation of the compound of Example 59 The synthesis scheme is as follows. TIFF2025514293000229.tif32170

[0346] The product 59-13 (10 mmol, 1.0 eq) obtained above and mCPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. Stirred at room temperature for 12 h, and when the reaction and conversion were found to be complete, triphenylphosphine (5 mmol, 0.5 eq) was added and stirred at room temperature for another 4 h. The solvent was evaporated to dryness using a rotary evaporator, and the product 59-14 was obtained by purification using column chromatography. The final product 59-14 is the compound of Example 59.

[0347] (47) Preparation of the compound of Example 60 The synthesis scheme is as follows. TIFF2025514293000230.tif53170

[0348] The product 60-15 (10 mmol, 1.0 eq) obtained above and mCPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. Stirring was continued at room temperature for 12 h, and when the reaction and conversion were found to be complete, triphenylphosphine (5 mmol, 0.5 eq) was added and stirred at room temperature for another 4 h. The solvent was evaporated to dryness using a rotary evaporator, and the mixture was purified by column chromatography to obtain intermediate product 60-16.

[0349] The intermediate product 60-16 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (3.6 mmol, 1.2 eq) was added dropwise while stirring under ice bath, and then DMF (1.5 mmol, 0.5 eq) was added dropwise. After stirring at room temperature for 12 h, the reaction and conversion were detected as complete. The pH of the solution was adjusted to 8 by adding saturated sodium bicarbonate solution dropwise under ice bath, and the organic phase was extracted and washed twice with water and once with saturated saline. The organic phase was collected and evaporated to dryness on a rotary evaporator to obtain the intermediate product 60-17 without purification.

[0350] The intermediate product 60-17 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of anhydrous methanol, sodium methanolate (5 M, 30 mmol, 10 eq) was added, and the mixture was refluxed at 70° C. and stirred for 12 h. When the reaction and conversion were found to be complete, the solvent was evaporated to dryness on a rotary evaporator, and an appropriate amount of ethyl acetate and saturated ammonium chloride solution were added for extraction, and the organic phase was extracted once with saturated saline, and the organic phase was collected and evaporated to dryness on a rotary evaporator to obtain the intermediate product 60-18 without purification.

[0351] The intermediate product 60-18 (3 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (12 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 h. When the reaction was found to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator. Then, 25 mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 60-19.

[0352] Intermediate 60-19 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and DPPA (2.4 mmol, 1.2 eq) was added under argon protection. Stir at room temperature for 30 min. When all the carboxylic acid raw material was converted to acyl azide, heat to 75 ° C. and react for 4 h. When most of the acyl azide was converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C., and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, collect the organic phase, evaporate to dryness with a rotary evaporator, and separate by silica gel column chromatography to obtain intermediate 60-20.

[0353] Intermediate 60-20 and the carboxylic acid intermediate 60-6 obtained above are added to DMF solvent in an equivalent amount of 1:1, HATU (1.5eq) and DIPEA (2.0eq) are added, and the reaction is carried out at 50°C for 12h. The reaction solution is extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase is evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 60-21. The final product 60-21 is the compound of Example 60.

[0354] (48) Preparation of the compound of Example 61 The synthesis scheme is as follows. TIFF2025514293000231.tif74170

[0355] 4-Bromo-2,8-bis(trifluoromethyl)quinoline (61-22, 10mmol, 1.0eq), Pd 2 (dba) 3 (0.1mmol, 0.01eq) and 71mg of QPhos (0.1mmol, 0.01eq) were placed in a round-bottom flask and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 61-2 Reformatsky Reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate 61-23.

[0356] Intermediate 61-23 (10 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 h. When the reaction was found to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator. Then, 25 mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 61-24.

[0357] Intermediate 61-24 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and DPPA (2.4 mmol, 1.2 eq) was added under argon protection. Stir at room temperature for 30 min. When all the carboxylic acid raw material was converted to acyl azide, heat to 75 ° C. and react for 4 h. When most of the acyl azide was converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C., and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, collect the organic phase, evaporate to dryness with a rotary evaporator, and separate by silica gel column chromatography to obtain intermediate 61-25.

[0358] Intermediate 61-25 and the carboxylic acid intermediate 61-6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5eq) and DIPEA (2.0eq) were added, and the reaction was carried out at 50°C for 12h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 61-26. The final product 61-26 is the compound of Example 61.

[0359] (49) Preparation of the compound of Example 62 The synthesis scheme is as follows. TIFF2025514293000232.tif62170

[0360] Intermediate 62-16 (4.4 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 40 mL of DCM. Methyl trifluoromethanesulfonate (4.4 mmol, 1.0 eq) was added dropwise while stirring at room temperature, and the mixture was stirred at room temperature for 1 h. The solvent was evaporated to dryness using a rotary evaporator, and 20 mL of anhydrous acetonitrile was added to dissolve the mixture. The mixture was stirred in a dry ice acetone bath, and difluorobromomethyltrimethylsilane (19.8 mmol, 4.5 eq) and triphenylphosphine (13.2 mmol, 3.0 eq) were added in that order. Next, HMPA was added dropwise, and the mixture was stirred for 3 h. The ice bath was removed, and the mixture was stirred at room temperature for 15 min. The mixture was further stirred in a dry ice acetone bath, and triethylamine (22.0 mmol, 5.0 eq) and 20 mL of water were added in that order, and the ice bath was removed, and the mixture was stirred at room temperature for 12 h. When the reaction and conversion were complete, the mixture was extracted with an appropriate amount of water and MTBE, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 62-27 was obtained by purification through column chromatography.

[0361] Intermediate 62-27 (10 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (40 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 h. When the reaction was found to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator. Then, 25 mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 62-28.

[0362] Intermediate 62-28 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and DPPA (2.4 mmol, 1.2 eq) was added under argon protection. Stir at room temperature for 30 min. When all the carboxylic acid raw material was converted to acyl azide, heat to 75 ° C. and react for 4 h. When most of the acyl azide was converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C., and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, collect the organic phase, evaporate to dryness with a rotary evaporator, and separate by silica gel column chromatography to obtain intermediate 62-29.

[0363] Intermediate 62-29 and the carboxylic acid intermediate 6 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5eq) and DIPEA (2.0eq) were added, and the reaction was carried out at 50°C for 12h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 62-30. The final product 62-30 is the compound of Example 62.

[0364] (50) Preparation of the compound of Example 63 The synthesis scheme is as follows. TIFF2025514293000233.tif63170

[0365] Methyl 2-methyl-5-bromobenzoate 63-36 (10mmol, 1.0eq), piperidone-4-ethylene ketal (10mmol, 1.0eq) Pd 2 (dba) 3(0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110° C. under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was collected. Product intermediate 63-37 was obtained by column chromatography. The intermediate product 63-37 (10 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved by adding 30 mL of acetone, added 10 mL of 5N hydrochloric acid, heated at 60°C for 4 h under reflux and stirred, and then stirred at room temperature overnight. After the reaction was completed, the solvent was evaporated to dryness using a rotary evaporator, extracted with water and ethyl acetate, and the organic phase was taken. The product intermediate 63-38 was obtained by column chromatography.

[0366] The intermediate product 63-38 (3.3 mmol, 1.0 eq) was placed in a round-bottom flask, dissolved in 15 mL of anhydrous methanol, and sodium borohydride (3.7 mmol, 1.1 eq) was added while stirring in an ice bath. The ice bath was then removed and the mixture was stirred at room temperature for 6 h. After the reaction was completed, the solvent was evaporated to dryness using a rotary evaporator, and the mixture was extracted with water and ethyl acetate, and the organic phase was collected. The intermediate product 63-39 was obtained by column chromatography.

[0367] Intermediate 63-39 (2.0 mmol, 1.0 eq) was dissolved in a mixture of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (8 mmol, 4.0 eq) was added. The reaction was carried out at 50° C. for 8 h. When the reaction was found to be completely converted, the solvent was evaporated to dryness on a rotary evaporator, 2N HCl solution was added to adjust the pH to 1, ethyl acetate was added to extract, and the organic phase was extracted once with saturated brine, and the organic phase was collected and evaporated to dryness on a rotary evaporator to obtain white solid product 63-40.

[0368] Intermediate 63-40 and the amine intermediate 63-41 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5eq) and DIPEA (2.0eq) were added, and the reaction was carried out at 50°C for 12h. The reaction solution was extracted with ethyl acetate, washed three times with saturated ammonium chloride solution, and the organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain product 63-42. The final product 63-42 is the compound of Example 63.

[0369] (51) Preparation of the compound of Example 64 The synthesis scheme is as follows. TIFF2025514293000234.tif72170

[0370] The product 64-13 (10 mmol, 1.0 eq) obtained above and mCPBA (12 mmol, 1.2 eq) were placed in a round-bottom flask and dissolved in 30 mL of DCM. Stirred at room temperature for 12 h, and when the reaction and conversion were found to be complete, triphenylphosphine (5 mmol, 0.5 eq) was added and stirred at room temperature for another 4 h. The solvent was evaporated to dryness using a rotary evaporator and purified by column chromatography to obtain intermediate product 64-43.

[0371] The intermediate product 64-43 (10 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (12 mmol, 1.2 eq) was added dropwise while stirring under ice bath, and then DMF (5 mmol, 0.5 eq) was added dropwise. After stirring at room temperature for 12 h, the reaction and conversion were confirmed to be complete. The pH of the solution was adjusted to 8 by adding saturated sodium bicarbonate solution dropwise under ice bath, and the organic phase was extracted and washed twice with water and once with saturated saline. The organic phase was collected and evaporated to dryness on a rotary evaporator to obtain the intermediate product 64-44 without purification.

[0372] The intermediate product 64-44 (10 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of anhydrous methanol, sodium methanolate (5 M, 100 mmol, 10 e.q.) was added, and the mixture was refluxed at 70° C. and stirred for 12 h. When the reaction and conversion were found to be complete, the solvent was evaporated to dryness on a rotary evaporator, and an appropriate amount of ethyl acetate and saturated ammonium chloride solution were added for extraction, and the organic phase was extracted once with saturated saline, and the organic phase was collected and evaporated to dryness on a rotary evaporator to obtain intermediate product 64-45 without purification.

[0373] Intermediate 64-45 (10mmol, 1.0eq), 3-(dimethylamino)azetidine (10mmol, 1.0eq) Pd 2 (dba) 3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110° C. under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was collected. Product 64-46 was obtained by column chromatography. The final product 64-46 is Example 64.

[0374] (52) Preparation of the compound of Example 65 The synthesis scheme is as follows. TIFF2025514293000235.tif41170

[0375] Intermediate product 65-13 (10 mmol, 1.0 eq), 2-(azetidin-3-yl)propan-2-ol (10 mmol, 1.0 eq) Pd 2 (dba) 3(0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110 °C under Ar protection for 6 h. Water and ethyl acetate were added to wash, and the organic phase was collected. Product 65-47 was obtained by column chromatography. The final product 65-47 is the compound of Example 65.

[0376] (53) Preparation of the compound of Example 66 The synthesis scheme is as follows. TIFF2025514293000236.tif30170

[0377] Intermediate product 66-13 (10mmol, 1.0eq), (3-azabicyclo[3.1.0]-6-hexyl)-tert-butyl carbamate (10mmol, 1.0eq) Pd 2 (dba) 3 (0.2 mmol, 0.02 eq), XPhos (0.8 mmol, 0.08 eq), and cesium carbonate (40 mmol, 4.0 eq) were dissolved in 50 mL of toluene, placed in a sealed tube, and heated to 110 °C under Ar protection for 6 h. Water and ethyl acetate were added to wash, and the organic phase was collected. Intermediate product 66-48 was obtained by column chromatography.

[0378] The intermediate product 66-48 (10 mmol, 1.0 eq) was placed in a round bottom flask, dissolved in 50 mL of DCM, and then added with HCl dioxane solution (4.0 M, 40 mmol, 4.0 eq) and stirred at room temperature overnight. When the reaction was completely converted, the solvent was evaporated to dryness on a rotary evaporator, and the mixture was extracted with saturated sodium carbonate solution and DCM. The organic phase was dried over anhydrous magnesium sulfate, suction filtered, and the solvent was evaporated to dryness on a rotary evaporator, followed by slurrying with DCM / cyclohexane to obtain product 66-49 as a yellow solid. The final product 66-49 is the compound of Example 66.

[0379] The preparation method of subscheme step 2 is as follows. TIFF2025514293000237.tif34170

[0380] Preparation of intermediate 66-4i The synthesis scheme is as follows. TIFF2025514293000238.tif34170

[0381] 2260mg (10mmol, 1.0eq.) of 4-bromo-8-fluoroquinoline 66-3i was weighed, 91.5mg (0.1mmol, 0.01eq) of Pd2(dba)3 and 71mg (0.1mmol, 0.01eq) of Qphos were added, and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 66-2 Reformatsky reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. After stirring at room temperature for 30min, the reaction and conversion were found to be complete. The solvent was evaporated to dryness using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 66-4i was obtained by purification using column chromatography.

[0382] Preparation of intermediate 66-4j The synthesis scheme is as follows. TIFF2025514293000239.tif35170

[0383] 2730mg (10mmol, 1.0eq.) of 1-bromo-4-(difluoromethoxy)naphthalene 66-3j was weighed, 91.5mg (0.1mmol, 0.01eq) of Pd2(dba)3 and 71mg (0.1mmol, 0.01eq) of Qphos were added, and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 66-2 Reformatsky reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. After stirring at room temperature for 30min, the reaction and conversion were found to be complete. The solvent was evaporated and dried using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 66-4j was obtained by purification using column chromatography.

[0384] Preparation of intermediate 66-4k The synthesis scheme is as follows. TIFF2025514293000240.tif35170

[0385] 2740mg (10mmol, 1.0eq.) of 5-bromo-8-(difluoromethoxy)quinoline 66-3k was weighed, 91.5mg (0.1mmol, 0.01eq) of Pd2(dba)3 and 71mg (0.1mmol, 0.01eq) of Qphos were added, and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 66-2 Reformatsky reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. After stirring at room temperature for 30min, the reaction and conversion were found to be complete. The solvent was evaporated and dried using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 66-4k was obtained by purification using column chromatography.

[0386] Preparation of intermediate 66-4l The synthesis scheme is as follows. TIFF2025514293000241.tif34170

[0387] 2320mg (10mmol, 1.0eq.) of 4-bromo-1-naphthonitrile 66-3l was weighed, 91.5mg (0.1mmol, 0.01eq) of Pd2(dba)3 and 71mg (0.1mmol, 0.01eq) of Qphos were added, and dissolved in 20mL of anhydrous tetrahydrofuran. Under the protection of Ar, intermediate 66-2 Reformatsky reagent (20mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. After stirring at room temperature for 30min, the reaction and conversion were found to be complete. The solvent was evaporated to dryness using a rotary evaporator, then dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 66-4l was obtained by purification using column chromatography.

[0388] The production method of subscheme step 3 is as follows. TIFF2025514293000242.tif76170

[0389] Preparation of intermediate 66-5i The synthesis scheme is as follows. TIFF2025514293000243.tif29170

[0390] Weigh out 2450mg (10mmol, 1.0eq) of intermediate 66-4i, dissolve it in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 65mL), add 2240mg (40mmol, 4.0eq) of potassium hydroxide, and react at 50℃ for 8h. When the reaction was detected to be completely converted, add 2N HCl solution to adjust pH=3, evaporate all of the solvent on a rotary evaporator, add 25mL of methanol, filter to take the filtrate, evaporate the filtrate on a rotary evaporator to obtain a gray solid, and finally wash the gray solid repeatedly with DCM / PE to obtain a white solid product 66-5i. TIFF2025514293000244.tif39170

[0391] The preparation scheme of intermediates 66-5j to 66-5l is the same as that of intermediate 66-5i. The preparation scheme for sub-scheme step 4 is as follows. TIFF2025514293000245.tif79170

[0392] Preparation of intermediate 66-6i The synthesis scheme is as follows. TIFF2025514293000246.tif29170

[0393] Weigh out 462 mg (2 mmol, 1.0 eq) of intermediate 66-5i, dissolve it in 25 mL of ultra-dry toluene, add 0.611 mL (4.4 mmol, 2.2 eq) of triethylamine, and add 0.516 mL (2.4 mmol, 1.2 eq) of DPPA under Ar protection. Stir at room temperature for 30 min, and when all the carboxylic acid raw material is converted to acyl azide, heat to 75 ° C and react for 4 h. When most of the acyl azide is converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C, and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, add the organic phase to 2.5 ml of HCl (4 M HCl in Dioxane, 10 mmol, 2.0 eq) solution, filter with a sand core funnel, and wash with petroleum ether and ethyl acetate several times to obtain white powder product 66-6i. TIFF2025514293000247.tif41170

[0394] The preparation scheme of intermediates 66-6j to 66-6l is the same as that of intermediate 66-6a. The method for producing the final product, subscheme step 7, is as follows: TIFF2025514293000248.tif40170

[0395] (54) Preparation of the compound of Example 67 The synthesis scheme is as follows. TIFF2025514293000249.tif40170

[0396] 202 mg (1 mmol, 1.0 eq) of amine intermediate 67-6i, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 67-10, and 890 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product WSZ390, Example 67.

[0397] (55) Preparation of the compound of Example 68 The synthesis scheme is as follows. TIFF2025514293000250.tif40170

[0398] 249 mg (1 mmol, 1.0 eq) of amine intermediate 68-6j, 234 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 68-10, and 890 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 5 mL of DMF and stirred until completely dissolved. 570 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product WSZ334, Example 68.

[0399] (56) Preparation of the compound of Example 69 The synthesis scheme is as follows. TIFF2025514293000251.tif40170

[0400] 250mg (1mmol, 1.0eq) of amine intermediate 69-6k, 234mg (1mmol, 1.0eq) of carboxylic acid intermediate 69-10, and 890μL (5mmol, 5.0eq) of DIPEA were weighed and dissolved in 5mL of DMF and stirred until completely dissolved. 570mg (1.5mmol, 1.5eq) of HATU was added and reacted at room temperature for 3h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product 3W, Example 69.

[0401] (57) Preparation of the compound of Example 70 The synthesis scheme is as follows. TIFF2025514293000252.tif40170

[0402] 208mg (1mmol, 1.0eq) of amine intermediate 70-6l, 234mg (1mmol, 1.0eq) of carboxylic acid intermediate 70-10, and 890μL (5mmol, 5.0eq) of DIPEA were weighed and dissolved in 5mL of DMF and stirred until completely dissolved. 570mg (1.5mmol, 1.5eq) of HATU was added and reacted at room temperature for 3h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product WSZ372, Example 70.

[0403] (58) Preparation of the compounds of Examples 73, 74, 75, 76, 77, 78, 81, 82, and 83 The synthesis scheme is as follows.

[0404] 1. Preparation of intermediate A-5a The synthesis scheme is as follows. TIFF2025514293000253.tif29170

[0405] 2518mg (11.09mmol, 1.0eq) of intermediate A-4a was weighed and dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 65mL), and 2484mg (44.37mmol, 4.0eq) of potassium hydroxide was added. The reaction was carried out at 50℃ for 8h. When the reaction was found to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator, after which 25mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a gray solid. Finally, the gray solid was repeatedly washed with DCM / PE to obtain a white solid product A-5a. TIFF2025514293000254.tif32170

[0406] The preparation schemes of intermediates A-5b to A-5f are the same as those of intermediate A-5a. 2. The manufacturing scheme for sub-scheme step 4 is as follows. TIFF2025514293000255.tif34170

[0407] 3. Preparation of Intermediate A-6a The synthesis scheme is as follows. TIFF2025514293000256.tif29170

[0408] Weigh out 426 mg (2 mmol, 1.0 eq) of intermediate A-5a, dissolve it in 25 mL of ultra-dry toluene, add 0.611 mL (4.4 mmol, 2.2 eq) of triethylamine, and add 0.516 mL (2.4 mmol, 1.2 eq) of DPPA under Ar protection. Stir at room temperature for 30 min, and when all the carboxylic acid raw material is converted to acyl azide, heat to 75 ° C and react for 4 h, when most of the acyl azide is converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C, and react overnight. After adding sodium bicarbonate solution to adjust the pH value to alkaline, add ethyl acetate to extract, and obtain white powder product A-6a by column chromatography. TIFF2025514293000257.tif28170

[0409] 4. Preparation of intermediate A-6b The synthesis scheme is as follows. TIFF2025514293000258.tif28170

[0410] Weigh out 426 mg (2 mmol, 1.0 eq) of intermediate A-5a, dissolve it in 25 mL of ultra-dry toluene, add 0.611 mL (4.4 mmol, 2.2 eq) of triethylamine, and add 0.516 mL (2.4 mmol, 1.2 eq) of DPPA under Ar protection. Stir at room temperature for 30 min, and when all the carboxylic acid raw material is converted to acyl azide, heat to 75 ° C and react for 4 h. When most of the acyl azide is converted to isocyanate, add 4 M water, lower the temperature to 60 ° C, and react overnight. After adding sodium bicarbonate solution to adjust the pH value to alkaline, add ethyl acetate to extract, and obtain gray powder product A-6b by column chromatography.

[0411] The preparation scheme of intermediates A-6c to A-6g is the same as that of intermediate A-6a.

[0412] 5. Sub-scheme The production scheme for step 5 is as follows. TIFF2025514293000259.tif32170

[0413] 6. Preparation of Intermediate A-9a The synthesis scheme is as follows. TIFF2025514293000260.tif45170

[0414] Methyl 2-methyl-5-bromobenzoate A-8 4580mg (20mmol, 1.0eq), 3-(Dimethylamino)azetidine dihydrochloride A-7a 3740mg (22mmol, 1.1eq), Pd 2 (dba) 3Weighed out 370mg (0.4mmol, 0.02eq), XPhos 760mg (1.6mmol, 0.08eq), and cesium carbonate 26080mg (80mmol, 4.0eq), dissolved them in 100mL of toluene, placed them in a sealed tube, heated to 110°C under Ar protection, and left overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. Product intermediate A-9a was obtained by column chromatography.

[0415] 7. The manufacturing method of sub-scheme step 6 is as follows. TIFF2025514293000261.tif32170

[0416] 8. Preparation of Intermediate A-10a The synthesis scheme is as follows. TIFF2025514293000262.tif41170

[0417] Intermediate A-9a (10 mmol, 1 eq.) was weighed and dissolved in a mixed solution of 25 mL of methanol and 25 mL of water, potassium hydroxide (40 mmol, 4 eq.) was added, and the mixture was heated at 60 ° C. and stirred overnight. After the reaction was completed, excess hydrochloric acid was added to adjust the pH of the reaction solution to acidic (do not make it excessively acidic because there is a risk of cyclization of the product), and the solvent was completely evaporated and dried using a rotary evaporator (after the first evaporation and drying using a rotary evaporator, small amounts of methanol were added in multiple portions and evaporated and dried using a rotary evaporator to remove as much water as possible), methanol was added, stirred, and then suction filtered. If the filtered solid contained a large amount of product, the solid was dissolved in methanol multiple times and suction filtered until the solid was completely dissolved (no fluorescence in ultraviolet detection by thin layer chromatography). The filtrate was collected and concentrated, and then recrystallized with dichloromethane to obtain product intermediate A-10a.

[0418] 9. The method for preparing the final product, subscheme step 7, is as follows: TIFF2025514293000263.tif34170

[0419] 10. Preparation of the compound of Example 74 The synthesis scheme is as follows. TIFF2025514293000264.tif40170

[0420] 214 mg (1 mmol, 1.0 eq) of amine intermediate 74-6b, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 74-10a, and 1008 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product XCH-96, the compound of Example 74.

[0421] 11. Preparation of the compound of Example 73 The synthesis scheme is as follows. TIFF2025514293000265.tif40170

[0422] 200 mg (1 mmol, 1.0 eq) of amine intermediate 73-6g, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 73-10a, and 1008 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product XCH-95, the compound of Example 73.

[0423] 12. Preparation of the compound of Example 75 The synthesis scheme is as follows. TIFF2025514293000266.tif40170

[0424] 198 mg (1 mmol, 1.0 eq) of amine intermediate 75-6c, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 75-10a, and 1008 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product XCH-118, Example 75.

[0425] 13. Preparation of the compound of Example 76 The synthesis scheme is as follows. TIFF2025514293000267.tif37170

[0426] 214 mg (1 mmol, 1.0 eq) of amine intermediate 76-6d, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 76-10a, and 1008 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product XCH-120, Example 76.

[0427] 14. Preparation of the compound of Example 77 The synthesis scheme is as follows. TIFF2025514293000268.tif39170

[0428] 191 mg (1 mmol, 1.0 eq) of amine intermediate 77-6e, 270 mg (1 mmol, 1.0 eq) of carboxylic acid intermediate 77-10a, and 1008 μL (5 mmol, 5.0 eq) of DIPEA were weighed and dissolved in 10 mL of DMF and stirred until completely dissolved. 668 mg (1.5 mmol, 1.5 eq) of HATU was added and reacted at room temperature for 3 h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product XCH-130, Example 77.

[0429] 15. Preparation of the compound of Example 78 The synthesis scheme is as follows. TIFF2025514293000269.tif40170

[0430] Amine intermediate 78-6f 177mg (1mmol, 1.0eq), carboxylic acid intermediate 78-10a 270mg (1mmol, 1.0eq), and DIPEA 1008μL (5mmol, 5.0eq) were weighed and dissolved in DMF 10mL and stirred until completely dissolved. HATU 668mg (1.5mmol, 1.5eq) was added and reacted at room temperature for 3h. When the reactants were completely converted, the reaction solution was washed with water and ethyl acetate to remove DMF, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain the crude product, which was purified by passing through a column to obtain the final product XCH-136, Example 78.

[0431] The manufacturing method of subscheme step 8 is as follows. TIFF2025514293000270.tif37170

[0432] 2-Methyl-5-bromobenzoic acid and the three-membered cyclic amine intermediate 78-6a obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 25°C for 3 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain intermediate 78-11.

[0433] The method for producing the final product, subscheme step 9, is as follows: TIFF2025514293000271.tif63170

[0434] 16. Preparation of the intermediate compound XCH-200-Boc compound of Example 81 The synthesis scheme is as follows. TIFF2025514293000272.tif34170

[0435] 81-11 399mg (1mmol, 1.0eq), 3-(dimethylamino)azetidine dihydrochloride 81-7a 222mg (1mmol, 1.1eq), Pd 2 (dba) 3 Weigh out 23mg (0.025mmol, 0.02eq), XPhos 24mg (0.05mmol, 0.04eq), and cesium carbonate 1220mg (80mmol, 3.0eq), dissolve them in 10mL of toluene, place them in a sealed tube, and heat them to 110°C under Ar protection and leave them overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. The product intermediate XCH-200-Boc was obtained by column chromatography.

[0436] 17. Preparation of the compound of Example 81 The synthesis scheme is as follows. TIFF2025514293000273.tif34170

[0437] Weigh out 252mg (0.5mmol, 1.0eq) of XCH-200-Boc, dissolve it in 3mL of toluene, add 1mL of trifluoroacetic acid, put it in a flask and stir it overnight at room temperature. Extract with saturated aqueous sodium bicarbonate and ethyl acetate, and take the organic phase. Column chromatography gives the final product XCH-200, the compound of Example 81.

[0438] 18. Preparation of intermediate compound XCH-205-Boc of Example 82 The synthesis scheme is as follows. TIFF2025514293000274.tif34170

[0439] 82-11 399mg (1mmol, 1.0eq), 3-(dimethylamino)azetidine dihydrochloride 82-7b 244mg (1mmol, 1.1eq), Pd 2 (dba) 3 Weigh out 23mg (0.025mmol, 0.02eq), XPhos 24mg (0.05mmol, 0.04eq), and cesium carbonate 1220mg (80mmol, 3.0eq), dissolve them in 10mL toluene, place them in a sealed tube, and heat them to 110°C under Ar protection and leave them overnight. Water and ethyl acetate were added to wash, and the organic phase was taken. The product intermediate XCH-205-Boc was obtained by column chromatography.

[0440] 19. Preparation of the compound of Example 82 The synthesis scheme is as follows. TIFF2025514293000275.tif34170

[0441] Weigh out 252mg (0.5mmol, 1.0eq) of XCH-205-Boc, dissolve it in 3mL of toluene, add 1mL of trifluoroacetic acid, put it in a flask and stir it overnight at room temperature. Extract with saturated aqueous sodium bicarbonate and ethyl acetate, and take the organic phase. Column chromatography gives the final product XCH-205, the compound of Example 82.

[0442] 20. Preparation of the compound of Example 83 The synthesis scheme is as follows. TIFF2025514293000276.tif34170

[0443] 83-11 399mg (1mmol, 1.0eq), 3-(dimethylamino)azetidine dihydrochloride 83-7c 244mg (1mmol, 1.1eq), Pd 2 (dba) 3 Weigh out 23mg (0.025mmol, 0.02eq), XPhos 24mg (0.05mmol, 0.04eq), and cesium carbonate 1220mg (80mmol, 3.0eq), dissolve in 10mL toluene, place in a sealed tube, and heat to 110°C under Ar protection and leave overnight. Wash with water and ethyl acetate, and take the organic phase. Column chromatography gives the final product XCH-208, the compound of Example 83.

[0444] (59) Preparation of Compounds of Examples 79 and 80 The synthesis scheme is as follows.

[0445] Preparation of Example 79 Compound The synthesis scheme is as follows. TIFF2025514293000277.tif31170

[0446] 79-1x 183mg(1mmol, 1.0eq), 79-2c 122mg(1mmol, 1.0eq), AcOH 33μL(1mmol, 1eq), NaBH(OAc) 3 Weigh out 635mg (3mmol, 3.0eq), dissolve in 10mL THF, put into flask, and stir overnight under Ar protection. Wash with saturated sodium bicarbonate aqueous solution and ethyl acetate, and take organic phase. Column chromatography to obtain final product XCH-193, compound of Example 79. Nuclear magnetic mass spectrometry confirmed that Schiff base product was obtained.

[0447] Preparation of the compound of Example 80 The synthesis scheme is as follows. TIFF2025514293000278.tif31170

[0448] 385 mg (1 mmol, 1.0 eq) of XCH-193, the compound of Example 79; 244 mg (1 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride; 2 (dba) 3 Weigh out 23mg (0.025mmol, 0.02eq), XPhos 24mg (0.05mmol, 0.04eq), and 1220mg (80mmol, 3.0eq) of cesium carbonate, dissolve them in 10mL of toluene, place them in a sealed tube, and heat them to 110°C under Ar protection and leave them overnight. Wash with water and ethyl acetate, and take the organic phase. Column chromatography gives the final product XCH-199, the compound of Example 80.

[0449] (60) Preparation of the compounds of Examples 84, 85, and 86 The synthesis scheme is as follows. TIFF2025514293000279.tif59170

[0450] The preparation scheme for sub-scheme step 1 is as follows. TIFF2025514293000280.tif25170

[0451] Preparation of Intermediate B-2a The synthesis scheme is as follows. TIFF2025514293000281.tif26170

[0452] Weigh out 1000 mg (5 mmol, 1.0 eq) of intermediate B-1a, dissolve it in 25 mL of dichloromethane, and add PBr 3 The mixture was stirred at room temperature for 30 min, and the pH value was adjusted to alkaline by adding a saturated aqueous solution of sodium bicarbonate. The mixture was extracted with ethyl acetate and subjected to column chromatography to obtain the product B-2a.

[0453] The preparation of intermediate B-2b is the same as that of intermediate B-2a.

[0454] The preparation scheme for sub-scheme step 2 is as follows. TIFF2025514293000282.tif30170

[0455] Preparation of the compound of Example 84 The synthesis scheme is as follows. TIFF2025514293000283.tif30170

[0456] 84-2 271mg (1mmol, 1.0eq), three-membered cyclic amine intermediate 190mg (1mmol, 1.0eq), K 2 CO 3 Weigh out 195mg (1.5mmol, 1.5eq), dissolve in 10mL THF, put into flask, and stir overnight at room temperature under Ar protection. Wash with saturated sodium chloride aqueous solution and ethyl acetate, and take organic phase. Column chromatography to obtain final product XCH-210, compound of Example 84.

[0457] Preparation of intermediate 84-3b The synthesis scheme is as follows. TIFF2025514293000284.tif30170

[0458] 84-2b 271mg (1mmol, 1.0eq), three-membered cyclic amine intermediate 190mg (1mmol, 1.0eq), K 2 CO 3 195mg (1.5mmol, 1.5eq) was weighed out, dissolved in 10mL of THF, placed in a flask, and stirred overnight at room temperature under Ar protection. Saturated aqueous sodium chloride solution and ethyl acetate were added to wash, and the organic phase was taken. Intermediate 84-3b was obtained by column chromatography.

[0459] Preparation of the compound of Example 86 The synthesis scheme is as follows. TIFF2025514293000285.tif32170

[0460] Weigh out 351 mg (1 mmol, 1.0 eq) of 84-3b, 109 mg (2 mmol, 2.0 eq) of ammonium chloride, and 558 mg (10 mmol, 10.0 eq) of Fe, and add them to 5 mL of THF: 5 mL of EtOH: 2.5 mL of H 2 The mixture was dissolved in a mixture of 1,000 ml of ethyl acetate and stirred at 80° C. for 5 h under Ar protection in a flask. The mixture was filtered through diatomaceous earth, extracted with ethyl acetate, and the organic phase was collected. The final product XCH-224, compound of Example 86, was obtained by column chromatography.

[0461] Preparation of the compound of Example 85 The synthesis scheme is as follows. TIFF2025514293000286.tif27170

[0462] 385 mg (1 mmol, 1.0 eq) of XCH-210, the compound of Example 84; 244 mg (1 mmol, 1.1 eq) of 3-(dimethylamino)azetidine dihydrochloride; 2 (dba) 3 Weigh out 23mg (0.025mmol, 0.02eq), XPhos 24mg (0.05mmol, 0.04eq), and cesium carbonate 1220mg (80mmol, 3.0eq), dissolve in 10mL toluene, place in a sealed tube, and heat to 110°C under Ar protection and leave overnight. Wash with water and ethyl acetate, and take the organic phase. Column chromatography gives the final product XCH-211, the compound of Example 85.

[0463] (61) Preparation of the compound of Example C87 The synthesis scheme is as follows. TIFF2025514293000287.tif36170

[0464] 2-Methyl-5-nitrobenzoic acid and three-membered cyclic amine intermediate 87-1 were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 25°C for 3 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain intermediate 87-2.

[0465] 365mg (1mmol, 1.0eq) of 87-2, 109mg (2mmol, 2.0eq) of ammonium chloride, and 558mg (10mmol, 10.0eq) of Fe were weighed and dissolved in a mixed solvent of 5mL THF: 5mL EtOH: 2.5mL H2O, placed in a flask, and stirred at 80°C for 5h under Ar protection. The mixture was filtered through diatomaceous earth, extracted with ethyl acetate, and the organic phase was collected. The final product XCH-226, the compound of Example 87, was obtained by column chromatography.

[0466] (62) Preparation of the compound of Example 88 The synthesis scheme is as follows. TIFF2025514293000288.tif41170

[0467] Amine intermediate 88-6-lk401 86mg (0.38mmol, 1.0eq), carboxylic acid intermediate 88-10a 106mg (0.45mmol, 1.0eq), and DIPEA 467μL (1.9mmol, 5.0eq) were weighed and dissolved in THF 3mL and stirred until completely dissolved. HATU 216mg (0.57mmol, 1.5eq) was added and reacted at room temperature for 4h. When the reactants were completely converted, THF was evaporated to dryness on a rotary evaporator, and the reaction solution was washed with water and ethyl acetate, and the organic phase was taken and evaporated to dryness on a rotary evaporator to obtain a crude product, which was purified by passing through a column to obtain the final product lk401, the compound of Example 88.

[0468] (63) Preparation of the compound of Example 89 The synthesis scheme is as follows. TIFF2025514293000289.tif59170

[0469] 5-Bromo-8-fluoroquinoline 89-3 (40mmol, 1.0eq), Pd 2 (dba) 3 (0.4mmol, 0.01eq) and 366.3mg (0.4mmol, 0.01eq) of QPhos were placed in a round-bottom flask and dissolved in 80mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 2 Reformatsky Reagent (80mmol, 1N, 2.0eq) dissolved in 20mL of tetrahydrofuran was added. Stirred at room temperature for 30min, and when the reaction and conversion were complete, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate product 89-4.

[0470] The intermediate 89-4 (10 mmol, 1.0 eq) and m-CPBA (12 mmol, 1.2 eq) obtained above were placed in a round-bottom flask and dissolved in 30 mL of DCM. Stirred at room temperature for 12 h, and when the reaction and conversion were found to be complete, triphenylphosphine (5 mmol, 0.5 eq) was added and stirred at room temperature for another 4 h. The solvent was evaporated to dryness using a rotary evaporator, and the mixture was purified by column chromatography to obtain intermediate product 89-5.

[0471] Intermediate product 89-5 (3 mmol, 1.0 eq) was placed in a round-bottom flask and dissolved in 30 mL of DCM. Phosphorus oxychloride (3.6 mmol, 1.2 eq) was added dropwise while stirring under ice bath, and then DMF (1.5 mmol, 0.5 eq) was added dropwise. After stirring at room temperature for 12 h, the reaction and conversion were confirmed to be complete. The pH of the solution was adjusted to 8 by adding saturated sodium bicarbonate solution dropwise under ice bath, and the solution was extracted with ethyl acetate. The organic phase was washed twice with water and once with saturated saline. The organic phase was collected and evaporated to dryness on a rotary evaporator to obtain intermediate product 89-6 without purification.

[0472] Intermediate product 89-6 (3 mmol, 1.0 eq), methyl borate (6.6 mmol, 2.2 eq), PdCl 2 (dppf) (0.3mmol, 0.1eq), K 2 CO 3 (9 mmol, 3.0 eq) was placed in a round bottom flask and dissolved in 10 mL of toluene. The mixture was heated to 85°C and stirred for 12 h. When the reaction and conversion were found to be complete, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water and once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 89-7 was obtained by purification using column chromatography.

[0473] The intermediate product 89-7 (3 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 50 mL), and potassium hydroxide (12 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 h. When the reaction was found to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator. Then, 25 mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 89-8.

[0474] Intermediate 89-8 (2 mmol, 1.0 eq) was dissolved in 25 mL of ultra-dry toluene, triethylamine (4.4 mmol, 2.2 eq) was added, and DPPA (2.4 mmol, 1.2 eq) was added under argon protection. Stir at room temperature for 30 min. When all the carboxylic acid raw material was converted to acyl azide, heat to 75 ° C. and react for 4 h. When most of the acyl azide was converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C., and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, collect the organic phase, evaporate to dryness with a rotary evaporator, and separate by silica gel column chromatography to obtain intermediate 89-9.

[0475] Intermediate 89-9 and the carboxylic acid intermediate 89-10 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain the final product XLQ-1170, which is the compound of Example 89.

[0476] (64) Preparation of the compound of Example 90 The synthesis scheme is as follows. TIFF2025514293000290.tif56170

[0477] 3-(Dimethylamino)azetidine dihydrochloride 90-11 (6mmol, 1.0eq) was placed in a round-bottom flask, dissolved in 2mL of 2M hydrochloric acid, and stirred at room temperature. Sodium nitrite (7.2mmol, 1.2eq) was dissolved in 1mL of water and then added dropwise to the reaction solution. After stirring at room temperature for 1.5h, the reaction and conversion were found to be complete. The mixture was extracted three times with ethyl acetate and washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 90-12 was obtained by purification through column chromatography.

[0478] Intermediate 90-12 (3 mmol, 1.0 eq) and sodium methanol (3 mmol, 3.0 eq) were placed in a round-bottom flask, and 1.5 mL of deuterium oxide was slowly added dropwise under the protection of argon. The mixture was heated at 80°C and stirred for 10 h. When the reaction and conversion were found to be complete, the mixture was extracted three times with ethyl acetate, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 90-13 was obtained by purification through column chromatography.

[0479] Intermediate 90-13 (2.59 mmol, 1.0 eq) and sodium methanol (7.77 mmol, 3.0 eq) were placed in a round-bottom flask and, under the protection of argon, heated with 2 mL of deuterium oxide and deuterated ethanol (C 2 H 5 OD (2 mL) was slowly added dropwise. The mixture was then heated to 70°C and reacted for 24 hours. Heating was stopped and the mixture was cooled to room temperature. Al-Ni alloy (810 mg) was added in a batchwise manner and stirred at room temperature overnight. The solid metal was removed by suction filtration, the filtrate was collected, extracted with ethyl acetate, washed once with saturated saline, the organic phase was taken and dried over anhydrous sodium sulfate, the drying agent was removed by filtration, the organic phase was acidified with 4 M HCl in dioxane, and the organic solvent was evaporated to dryness on a rotary evaporator to obtain solid product 90-14.

[0480] Intermediate 90-14 (3.84 mmol, 1.1 eq), methyl 2-methyl-5-bromobenzoate 90-15 (3.49 mmol, 1.0 eq), Pd 2 (dba) 3 (0.035mmol, 0.01eq), XPhos (0.14mmol, 0.04eq), and cesium carbonate (13.96mmol, 4.0eq) were dissolved in 20mL of toluene, placed in a sealed tube, and heated to 110°C under Ar protection to react overnight. Water and ethyl acetate were added to wash, and the organic phase was collected. Product intermediate 90-16 was obtained by column chromatography.

[0481] Intermediate 90-16 (0.44 mmol, 1 e.q.) was weighed and dissolved in a mixed solution of 1.1 mL of methanol and 1.1 mL of water, potassium hydroxide (1.76 mmol, 4 e.q.) was added, and the mixture was heated at 60° C. and stirred overnight. After the reaction was completed, excess hydrochloric acid was added to adjust the pH of the reaction solution to acidic (it should not be made excessively acidic due to the risk of cyclization of the product), the solvent was completely evaporated to dryness using a rotary evaporator, ethyl acetate was added to dissolve, the organic phase was dried over anhydrous sodium sulfate, and purified by column chromatography to obtain intermediate product 90-17.

[0482] Intermediate 90-17 and cyclopropylamine intermediate 90-18 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain the final product XLQ-1196, which is the compound of Example 90.

[0483] (65) Preparation of the compound of Example 91 The synthesis scheme is as follows. TIFF2025514293000291.tif65170

[0484] 4-Bromoindole 91-19 (10 mmol, 1.0 eq), dimethyl carbonate (29 mmol, 2.9 eq), potassium carbonate (7 mmol, 0.7 eq) were placed in a round-bottom flask and dissolved in 13 mL of DMF. The mixture was heated to 140 °C and stirred for 4 h. When the reaction and conversion were found to be complete, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. The product intermediate 91-20 was obtained by purification using column chromatography.

[0485] Intermediate 91-20 (2mmol, 1.0eq), Pd 2(dba) 3 (0.02mmol, 0.01eq) and QPhos 14.1mg (0.02mmol, 0.01eq) were placed in a round bottom flask and dissolved in 2mL of anhydrous tetrahydrofuran. Under the protection of argon, intermediate 91-2 Reformatsky Reagent (4mmol, 1N, 2.0eq) dissolved in 6mL of tetrahydrofuran was added. Stirred at room temperature for 30min, and when the reaction and conversion were complete as a result of detection, the solvent was evaporated to dryness using a rotary evaporator, dissolved in ethyl acetate, washed three times with water, washed once with saturated saline, and the organic phase was taken and dried over anhydrous sodium sulfate. Purified by column chromatography to obtain product intermediate product 91-21.

[0486] The intermediate product 91-21 (1.88 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran / methanol / water (3:1:1, 2.16 mL), and potassium hydroxide (7.52 mmol, 4.0 eq) was added. The reaction was carried out at 50°C for 8 h. When the reaction was detected to be completely converted, 2N HCl solution was added to adjust the pH to 3, and all of the solvent was evaporated to dryness on a rotary evaporator, after which 15 mL of methanol was added, filtered to obtain the filtrate, and the filtrate was evaporated to dryness on a rotary evaporator to obtain a pale yellow solid. Finally, the pale yellow solid was repeatedly washed with DCM / PE to obtain a white solid product 91-22.

[0487] Intermediate 91-22 (1.49 mmol, 1.0 eq) was dissolved in 6.4 mL of ultra-dry toluene, triethylamine (3.27 mmol, 2.2 eq) was added, and DPPA (1.64 mmol, 1.2 eq) was added under argon protection. Stir at room temperature for 30 min. When all the carboxylic acid raw material was converted to acyl azide, heat to 75 ° C and react for 8 h. When most of the acyl azide was converted to isocyanate, add excess hydrochloric acid (2 M aqueous solution, > 4.0 eq), lower the temperature to 60 ° C, and react overnight. After adjusting the pH value to alkaline by adding sodium bicarbonate solution, extract with ethyl acetate, collect the organic phase, evaporate to dryness with a rotary evaporator, and separate by silica gel column chromatography to obtain intermediate 91-23.

[0488] Intermediate 91-23 and the carboxylic acid intermediate 10 obtained above were added to DMF solvent in an equivalent ratio of 1:1, HATU (1.5 eq) and DIPEA (2.0 eq) were added, and the reaction was carried out at 50°C for 12 hours. The reaction solution was extracted with ethyl acetate and washed three times with saturated ammonium chloride solution. The organic phase was evaporated to dryness using a rotary evaporator, and then purified by silica gel column chromatography to obtain the final product XLQ-1220, which is the compound of Example 91.

[0489] Experimental Example 1: Detection of PLpro inhibitory activity of the compounds prepared in the above examples Biological Test Conditions 1.Reaction buffer: 20mM HEPE, pH7.5, 100mM NaCl, 1mM TCEP 2. Preparation of Mother Liquor (1) 20 μM Ub-AMC (dissolve Ub-AMC dry powder directly in reaction buffer and centrifuge to remove precipitate before use) (2) 400 nM PLpro (purified with molecular sieves, stored frozen at -80°C, thawed on ice before use, and diluted with reaction buffer) (3) 40 μM test compound (dry powder of test compound is dissolved in DMSO to 40 mM, diluted to 400 μM in 50% DMSO, and then diluted to 40 μM in reaction buffer) 3. Single-point inhibition test reaction system: 10 μM Ub-AMC, 100 nM PLpro, 1 μM test compound, total volume 20 μL, reaction in a 384-well plate.

[0490] 5 μL of PLpro mother solution+5 μL of test compound mother solution was added to a 384-well plate and incubated at 4° C. for 30 minutes.

[0491] 10 μL of the Ub-AMC mother solution was added to a 384-well plate and reacted at 37° C. for 30 minutes, after which the fluorescence intensity of AMC was measured (excitation: 360 nm, emission: 460 nm).

[0492] 4. Control group (+Control): The test compound was replaced with DMSO corresponding to the dilution factor.

[0493] Blank group: PLpro was replaced with reaction buffer. 5. Data processing: Blank values ​​were subtracted from the measured values ​​and normalized based on DMSO values.

[0494] 6. IC 50 Measurement Concentration gradient of test compound (nM): 10000, 5000, 1000, 500, 250, 125, 62.5, 31.25, 15.625, 10, 5, 2, 1, 0.5, 0.1, 0.01 Fluorescence values ​​were measured after 15 min of reaction (the enzyme reaction rate is in the linear range around 15 min and in the nonlinear range at 30 min).

[0495] 7. Data fitting: After data normalization, it was processed using Sigmaplot (fitting equation: logistic, 3 parameters).

[0496] The results are shown in the table below. [Table 1] TIFF2025514293000293.tif249170TIFF2025514293000294.tif239170TIFF202 5514293000295.tif244170TIFF2025514293000296.tif239170TIFF20255142930 00297.tif234170TIFF2025514293000298.tif234170TIFF2025514293000299.t if229170TIFF2025514293000300.tif249170TIFF2025514293000301.tif199170

[0497] Here, GRL0617 is the positive reference (Ghosh et al., 2009; Ghosh et al., 2010; Ratia et al., 2008). "-" indicates not measured.

[0498] Live virus experiments on the ability of the compound of Example 26 to inhibit cell infection by the novel coronavirus To verify the anti-SARS-CoV-2 activity of the compound of Example 26, a Calu-3 cell infection model with live SARS-CoV-2 virus was used to detect the anti-SARS-CoV-2 activity of the molecule of Example 26.

[0499] The 2-fold diluted Example 26 was mixed with 100TCID50 of SARS-CoV-2 in equal volumes, and Calu-3 cells were incubated at 1×10 4 Each well of the cell culture plate was supplemented with 100 μL of DMEM+2% FBS medium, placed in a cell culture incubator, and cultured for 48 hours, after which the cell supernatant was collected.

[0500] Viral RNA extraction and quantitative real-time PCR (qRT-PCR) were performed according to the manufacturer's instructions. Viral RNA from cell supernatants was extracted using TRIzol LS reagent (Invitrogen). Detection was performed using the One-Step PrimeScript RT-PCR Kit (Takara, Japan, Cat. #RR064A) according to the manufacturer's instructions. The RT-PCR program was as follows: Reverse transcription: 95℃ 10s, 42℃ 5min; PCR reaction: (95℃ 5s, 56℃ 30s·72℃ 30s)*40 cycles. Detection was performed with a BioRad fluorescent quantitative PCR instrument. The primer sequences were as follows: SARS-CoV-2-NF(SEQ ID NO:1): GGGGAACTTCTCCTGCTAGAAT, SARS-CoV-2-NR(SEQ ID NO:2): CAGACATTTTG CTCTCAAGCTG, SARS-CoV-2-N-probe(5'-FAM-SEQ ID NO:3-TAMRA-3'): 5'-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3'.

[0501] Cell supernatants were collected 48 hours after infection, and the viral RNA copy numbers in the cell culture supernatants were evaluated by RT-qPCR, and the in vitro inhibitory effects of the test drugs against SARS-CoV-2 were calculated (EC 50 and E.C. 90 (Measure the value of ).

[0502] The inhibition rate of the compound of Example 26 against SARS-CoV-2 live virus (Delta strain) infection is as follows: TIFF2025514293000302.tif70170

[0503] The experiment showed that the compound of Example 26 could more effectively inhibit SARS-CoV-2 live virus from infecting human cells in in vitro experiments.

Claims

1. A compound having the structure: or a pharma- ceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof. (where: Ar １ is a substituted naphthyl or a substituted or unsubstituted non-naphthalene aromatic group; Ar ２ is aryl or heteroaryl; B is heterocyclyl, -S(O) ｔ N.R. １５ , halogen, -NH ２ is selected from W ２ is selected from C, N, and O; W ２ If N, then R １ ’ does not exist, and W ２ When is O, R １ , R １ ’ does not exist, W ４ is absent or selected from C or S; W ４ If does not exist, R １ , R ２ does not exist, R １ , R １ ’ , R ２ , R ２ ’ are independently H, D, (=O), -C １ ~C ６ Alkyl, -X, -CH ２ X, -CHX ２ , -CX ３ , —OH, —NH ２ , -COOH, -O(C １ ~C ６ alkyl), R ２ ’’ is H, C １ ~C ６ Alkyl, -OH, -(C １ ~C ６ (alkylene)-COOR ２１ , -(C １ ~C ６ alkylene)-OR ２１ , -(C １ ~C ６ (alkylene)-CONR ２１ R ２２ is selected from R ３ is H or C １ ~C ６ alkyl, L １ does not exist or C １ ~C ６ Alkylene, -CO-, -SO ２ --, Or -N(R ３ ) - is selected from L ３ , L ５ is absent or independently selected from alkylene, heteroalkylene, cycloalkylene, heterocyclylene, and the carbonyl may be optionally substituted; L ４ is C １ ~C ６ Alkylene, -SO ２ --, --NR １５ C(O)-, -NR １５ S (O) ｔ -, -C(O)-, -C(O)O-, -NR １５ --, --C(O)NR １５ -, -S(O) ｔ N.R. １５ --, is selected from L ６ does not exist or C １ ~C ６ Alkylene, -SO ２ --, --NR １５ C(O)-, -NR １５ S (O) ｔ -, -C(O)-, -C(O)O-, -NR １５ --, --C(O)NR １５ -, -S(O) ｔ N.R. １５ --, is selected from R １５ is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy, or R １５ represents the nitrogen atom and L bonded thereto. ３ Or L ５ together form a heterocyclyl, which is optionally substituted; t is 1 or 2; R ２１ is H or C １ ~C ６ is alkyl, R ２２ is H or C １ ~C ６ is alkyl, R ２３ Or R ２３’ is H or C １ ~C ６ alkyl, X is selected from F, Cl, Br, and I.

2. The compound of claim 1 , wherein the substituted naphthyl is selected from the following: (Here, R ４１ , R ４２ , R ４３ , R ４４ , R ４５ , R ４６ , R ４７ represents a substituent on the ring, and is independently H, D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ Alkyl) ３ , -NO ２ , -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'', optionally substituted, and R ４１ , R ４２ , R ４３ , R ４４ , R ４５ , R ４６ , R ４７ cannot be H at the same time, t is 1 or 2; R Ｌ does not exist or C １ ~C ６ Alkylene, C ３ ~C ６ Heteroalkylene, C ３ ~C ６ Cycloalkylene, C ３ ~C ６ Heterocyclylene, -NR ４ C(O)-, -NR ４ S (O) ｔ -, -C(O)-, -C(O)O-, -NR ４ --, --C(O)NR ４ -, -S(O) ｔ N.R. ４ -, optionally substituted; R′ and R″ are independently H, D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ selected from cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, optionally substituted; R ４ is selected from H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, hydroxy, alkoxy; Preferably, R ４１ , R ４２ , R ４３ , R ４４ , R ４５ , R ４６ , R ４７ are independently H, -D, -CH ３ , -X, -CH ２ F, -CHF ２ , -CF ３ , -OH, -CN, -OCH ３ , -OCH ２ X, -OCHX ２ , -OCX ３ , -NH ２ , -NH(C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), and R ４１ , R ４２ , R ４３ , R ４４ , R ４５ , R ４６ , R ４７ cannot be H at the same time, More preferably, the substituted naphthyl is .)

3. 2. The compound of claim 1, wherein the non-naphthalene aromatic group is selected from the following: Phenyl, substituted phenyl, (Here, L ２ is absent, or -O-, C １ ~C ６ Alkylene, —CO—, —CONR ５３ --, --NR ５３ --, --NR ５３ CO-, -(C １ ~C ６ alkylene)-O-, -(C １ ~C ６ alkylene)-CO-, -(C １ ~C ６ (alkylene)-CONR ５３ -, -(C １ ~C ６ alkylene)-NR ５３ -, -(C １ ~C ６ alkylene)-NR ５３ CO-, R ５３ is H, D or C １ ~C ６ alkyl, R ５１ H, D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ alkyl), -NO ２ -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; t is 1 or 2; Preferably, R ５１ is H, -D, -CH ３ , -X, -CF ３ , -OH, -OCH ３ , -OCH ２ X, -OCHX ２ , -OCX ３ , -NH ２ , -NH(C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), Ar ３ is selected from substituted or unsubstituted phenyl, substituted or unsubstituted oxygen-containing 5- or 6-membered heterocyclyl, substituted or unsubstituted nitrogen-containing 5- or 6-membered heterocyclyl, substituted or unsubstituted sulfur-containing 5- or 6-membered heterocyclyl; Preferably, Ar ３ is phenyl, C １ ~C ６ Ar is selected from alkyl-substituted phenyl, furyl, pyrrolyl, thienyl, pyridyl, pyrimidinyl, thiazolyl, imidazolyl, oxazolyl, and may be optionally substituted, more preferably Ar ３ is selected from phenyl, tert-butylphenyl, thienyl, pyridyl, and may be optionally substituted; W ３ is selected from N or CH; R ６ H, D, C １ ~C ６ Alkyl, -OH, -(C １ ~C ６ (alkylene)-COOR ６１ , -(C １ ~C ６ alkylene)-OR ６１ , -(C １ ~C ６ (alkylene)-CONR ６１ is selected from R ６１ is H, D or C １ ~C ６ is alkyl, Preferably, W ３ is N and R ６ is H, D, CH ３ , -CH ２ COOH, -CH ２ COOCH ３ and R ６２ is H, -D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ Alkyl), -N ３ , -B(OH) ２ , -NO ２ -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ’ -NR'R'', -R Ｌ -S (O) ｔ’ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ’ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; T １ , T ２ , T ３ , T ４ , T ５ , T ６ , T ７ are independently O, C-R ７ , or N, X' is N, O, or S; T １ ~T ７ is C-R ７ When selected from ７ are each independently H, -D, or -CH ３ , -X, -CF ３ , -OH, -OCH ３ , -OCH ２ X, -OCHX ２ , -OCX ３ , -NH ２ , -NH(C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -O(C １ ~C ６ alkyl)NH ２ , -O(C １ ~C ６ Alkyl)N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -O(C １ ~C ６ Alkyl)NH(C １ ~C ６ alkyl), is selected from R ８ is H, -D, C １ ~C ６ Alkyl, -(C １ ~C ６ (alkylene)-COOR ６１ , -(C １ ~C ６ alkylene)-OR ６１ , -(C １ ~C ６ (alkylene)-CONR ６１ is selected from S ３ , O, S, NR ９１ , C.R. ９２ R ９３ is selected from S １ , S ２ , S ４ , S ５ , S ６ , S ７ are independently N, CR ９４ is selected from Here, R ９２ , R ９３ , R ９４ are independently a bond, H, -D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ alkyl), -NO ２ -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'', and optionally substituted; Preferably, R ９２ , R ９３ , R ９４ are independently a bond, H, -D, or -CH ３ , -F, -CF ３ , -OH, -OCH ３ , -NH ２ , -NH(C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), is selected from R ９１ is a bond, H, -D, C １ ~C ６ Alkyl, -OH, -(C １ ~C ６ (alkylene)-COOR ６１ , -(C １ ~C ６ alkylene)-OR ６１ , -(C １ ~C ６ (alkylene)-CONR ６１ , is selected from Y １ , Y ２ , Y ３ , Y ４ , Y ５ , Y ６ , Y ７ are independently N or CR １１ is selected from R １１ are bonds, H, D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ alkyl), -NO ２ -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ’ -NR'R'', -R Ｌ -S (O) ｔ’ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ’ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; Preferably, R １１ are independently a bond, H, -D, or -CH ３ , -F, -CF ３ , -OH, -OCH ３ , -NH ２ , -NH(C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), R ７２ , R ７３ are independently H, -D, -CH ３ , -X, -CF ３ , -OH, -OCH ３ , -NH ２ , -NH(C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ Alkyl), -N ３ , -B(OH) ２ , -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), R ３１ is N or CR ３６ and R ３２ is N.R. ３７ or -N=CR ３８ - and R ３５ Or R ３７ are independently H, -D, C １ ~C ６ Alkyl, -OH, -(C １ ~C ６ (alkylene)-COOR ６１ , -(C １ ~C ６ alkylene)-OR ６１ , -(C １ ~C ６ (alkylene)-CONR ６１ is selected from R ３３ , R ３４ , R ３６ , R ３８ are independently H, -D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ Alkyl) ３ , -N ３ , -B(OH) ２ , -NO ２ -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ’ -NR'R'', -R Ｌ -S (O) ｔ’ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ’ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; Preferably, R ３３ , R ３４ , R ３６ , R ３８ are independently H, -CH ３ , -F, -CF ３ , -OH, -OCH ３ , -NH ２ , -NH(C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), R ２４ does not exist or CR ２３ , N.R. ２７ is selected from R ２５ is CR ２８ , N.R. ２９ is selected from R ２３ , R ２６ , R ２８ are independently H, D, C １ ~C ６ Alkyl, C １ ~C ６ Haloalkyl, C ３ ~C ６ Cycloalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -Si(C １ ~C ６ Alkyl) ３ , -N ３ , -B(OH) ２ , -NO ２ -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ’ -NR'R'', -R Ｌ -S (O) ｔ’ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ’ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; Preferably, R ２３ , R ２６ , R ２８ are independently H, D, -CH ３ , -F, -CF ３ , -OH, -OCH ３ , -NH ２ , -NH(C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), -NO ２ , -COO(C １ ~C ６ alkyl), -COOH, -CN, -Si(CH ３ ) ３ , -NHSO ２ (C １ ~C ６ Alkyl), -SO ２ N.H. ２ , -SO ２ (C １ ~C ６ Alkyl), -N(C １ ~C ６ Alkyl)SO ２ (C １ ~C ６ Alkyl), -SO ２ NH (C １ ~C ６ Alkyl), -SO ２ N (C １ ~C ６ Alkyl) (C １ ~C ６ alkyl), R ２７ , R ２９ are independently H, D, C １ ~C ６ Alkyl, -OH, -(C １ ~C ６ (alkylene)-COOR ６１ , -(C １ ~C ６ alkylene)-OR ６１ , -(C １ ~C ６ (alkylene)-CONR ６１ .)

4. W １ is C and W ２ is C, or W １ is C and W ２ is N, or W １ is C and W ２ The compound of claim 1 , wherein

5. R １ and R ２ are independently H, -D, O, C １ ~C ３ Alkyl, -COOH, -CF ３ , hydroxy, preferably R １ and R ２ are each H, and / or R １ and R ２ The compound according to claim 1, wherein each of

6. A compound described in claim 1.

7. Ar ２ 2. The compound of claim 1, wherein: (where: n is 0 or 1; T １１ ~T １６ is independently selected from C, N, O, and S; T １７ represents one or more independent substituents on the ring, and is H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CH=NR', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' and is optionally substituted.

8. 8. The compound of claim 7, having the structure: (L ６ is absent, or is -NH-, -NR １５ --, --NR １５ C(O)-, -C(O)NR １５ -, C １ ~C ６ alkylene; R １５ is H, C １ ~C ６ alkylene; Preferably, L ６ is absent or is -NH-, -N(CH ３ ) -, -N(CH ３ )C(O)-, -NHC(O)-.

9. 3. The compound of claim 2, wherein B has the structure: -F、-Cl、-Br、-I、-NH ２ 、-S(O) ｔ NR １５ 、 (Here, Z ２ ~Z ６ is independently selected from C, N, O, and S; Z １ is selected from C, N, Z ７ is absent or a bond, C, N, O, S, C １ ~C ６ alkylene; m1 to m4 are independently selected from integers from 0 to 5; R １２ represents one or more independent substituents on the ring, and is H, D, (═O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, —R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'', -R Ｌ -R'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; R''' is H, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, is selected from R １３ and R １３ Each ' is independently H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -N ３ , -B(OH) ２ , -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -R Ｌ -N(S(O) ｔ R') (S(O) ｔ R″), —NR′-R Ｌ -NR''R'''', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'', -R Ｌ -R'R'' is selected from, optionally substituted; R １４ and R １４ Each ' represents one or more independent substituents on the ring, and is H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R″, —NR′-R Ｌ -NR'R'', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' and is optionally substituted.

10. 3. The compound of claim 2, wherein B has the following structure: -F、-Cl、-Br、-I、-NH ２ 、-S(O) ｔ NR １５ 、 (Here, Z １ and Z ４ is independently selected from C, N, O, and S; Z ４ When is O, R １３ does not exist, Z ７ is absent or a bond, C, N, O, S, C １ ~C ３ alkylene; m1 and m2 are independently selected from integers from 0 to 5; Z ４ If S, then R １３ is absent or is carbonyl, R １４ is a carbonyl, R''' is H, D, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, is selected from R ８３、 R ８４ is H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R Ｌ -CR'R'', -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -R Ｌ -N(S(O) ｔ R') (S(O) ｔ R″), —NR′-R Ｌ -NR''R'''', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' is selected from, optionally substituted; Or, R ８３、 R ８４ with the N atoms between them Forming Z ９ , S, NR ８５ , O; m ５ is selected from 1, 2 or 3; R ８５ is H, D, (=O), alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocyclyl, heterocyclylalkyl, halogen, -R Ｌ -COR', -R Ｌ -C(O)OR', -R Ｌ -C(O)NR'R'', -R Ｌ -CN, -R Ｌ -OR', -R Ｌ -OC(O)R', -R Ｌ -S (O) ｔ -NR'R'', -R Ｌ -S (O) ｔ -R', -R Ｌ -NR'R'', -R Ｌ -NR'C(O)R'', -R Ｌ -NR'S(O) ｔ R'', -R Ｌ -N(S(O) ｔ R') (S(O) ｔ R″), —NR′-R Ｌ -NR''R'''', -R Ｌ - NO ２ , -R Ｌ -N=CR'R'' and is optionally substituted.

11. 11. The compound of claim 10, wherein B has the structure: -F、-Cl、-Br、-I、-NH ２ 、-S(O) ｔ NR １５ 、

12. R １４ and R １４ ' are each independently H, D, C １ ~C ６ Alkyl, amino, -OCH ３ 12. The compound according to claim 10 or 11,

13. R １３ and R １３ 12. The compound according to claim 10 or 11, wherein each ' is independently selected from the following structures: -H, D, (=O), F, Cl, Br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, -CF ３ , -CH ２ D, -OH, -N ３ , -B(OH) ２ ,

14. A pharmaceutical composition comprising a compound according to any one of claims 1 to 13 or a pharma- ceutically acceptable salt, stereoisomer, ester, prodrug, solvate, or deuterated compound thereof, and one or more pharma- ceutically acceptable auxiliary materials.

15. Use of a compound according to any one of claims 1 to 13 or a pharma- ceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof, or a pharmaceutical composition according to claim 14, in the manufacture of a medicament for the prophylaxis and / or treatment of a disease or disorder caused by or associated with a viral infection.

16. The use according to claim 15, characterized in that the virus is a coronavirus, such as HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU, SARS-CoV, MERS-CoV, SARS-CoV-2.

17. The use according to claim 16, characterized in that the disease or disorder is selected from COVID-19, SARS, and MERS.

18. Use of a compound according to any one of claims 1 to 13 or a pharma- ceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof, or a pharmaceutical composition according to claim 14, in the manufacture of a medicament for reducing and / or inhibiting coronavirus replication.

19. A method for preventing and / or treating a disease or disorder caused by or associated with a viral infection, comprising administering to a patient a compound according to any one of claims 1 to 13 or a pharma- ceutically acceptable salt, stereoisomer, ester, prodrug, solvate, and deuterated compound thereof, or a pharmaceutical composition according to claim 14.

Citation Information

Patent Citations

  • Antiviral compound as well as preparation method and application thereof

    CN114957110A

  • Antiviral compound as well as preparation method and application thereof

    CN114957165A

  • JP1982501629A

  • Compounds and compositions useful for treating malaria

    JP2011524365A

  • 1-(BENZO [d] [1,3] DIOXOL-5-YL) -N- (PHENYL) CYCLOPROPANE- CARBOXAMIDE DERIVATIVE AND RELATED COMPOUND AS MODULATOR OF ATP-BINDING CASSETTE TRANSPORTER FOR TREATMENT OF CYSTIC FIBROSIS

    JP2013056908A