Therapeutic nucleic acid molecules, mixtures, drugs and use in the treatment of solid tumors

Abstract

The present invention relates to the field of gene pharmaceutical technology, and particularly relates to the use in the treatment of therapeutic nucleic acid molecules, mixtures, drugs and solid tumors. Provided is a nucleic acid molecule or a nucleic acid molecule mixture mainly composed of a nucleic acid molecule fragment encoding interleukin IL-12 p35 and p40 subunits and a nucleic acid molecule fragment encoding IL-7 protein, and nucleic acid molecules in different combined forms containing the above nucleic acid molecule fragments are provided, and the combined forms include the fusion of different nucleic acid molecule fragments and the formation of a composition by different nucleic acid molecule fragments in a free form. The provided nucleic acid molecule fragments have been verified to exhibit an effective therapeutic effect on solid tumors, either by combining in a free form or by preparing as a fusion nucleic acid molecule. Furthermore, an aptamer is used to complex with the above nucleic acid composition or fusion nucleic acid molecule to obtain a nucleic acid molecule drug, and a corresponding preparation method is provided, expecting to alleviate the urgent need for drugs for current solid tumor treatment.

Description

Technical Field

[0001] (Cross - reference to related applications) This application claims the priority of a Chinese patent application filed on May 6, 2022 (Application No.: 2022104869114, Title of Invention: Therapeutic Nucleic Acid Molecules, Mixtures, Drugs and Use in the Treatment of Solid Tumors), part of the content of which is incorporated herein by reference, and the priority of a Chinese patent application filed on May 4, 2023 (Application No.: 202310493889, Title of Invention: Therapeutic Nucleic Acid Molecules, Mixtures, Drugs and Use in the Treatment of Solid Tumors), the entire content of which is incorporated herein by reference.

[0002] The present disclosure relates to the field of gene medicine technology, and particularly to therapeutic nucleic acid molecules, mixtures, drugs and their use in the treatment of solid tumors.

Background Art

[0003] Tumors are clinically distinguished into solid tumors and non - solid tumors. Solid tumors and palpable tumors are called solid tumors due to palpable tumors caused by clinical examinations such as X - ray imaging, CT scans, B - mode ultrasound examinations, or palpation. Tumors that cannot be visualized by X - ray, CT scan, B - mode ultrasound examination, or palpation, or tumors not caused by palpation, such as leukemia in blood diseases, belong to non - solid tumors.

[0004] The main treatment modalities for solid tumors are four types: surgery, chemotherapy, radiotherapy, and targeted therapy. These methods can remove, damage, kill, and destroy tumor cells, and relieve the disease condition. Depending on the type of tumor, one treatment modality can be adopted, or multiple treatment modalities can be used for combined treatment. In addition, tumor immunotherapy has developed rapidly and has gradually developed into another effective treatment means following the four main tumor treatment modalities. Among them, due to the excellent properties of nucleic acid molecules, tumor immunotherapy using nucleic acid molecules has also been proposed. Briefly speaking, the treatment with nucleic acid molecules means that chemically modified nucleic acid molecules are taken up into the cytoplasm, perform transcription and expression using the original nucleotides in the cytoplasm, and generate the proteins necessary for the organism. However, therapeutic products based on nucleic acid molecules are still lacking at present.

Summary of the Invention

[0005] An object of the present disclosure is to provide a nucleic acid molecule or a mixture of nucleic acid molecules having a therapeutic effect on solid tumors, including alleviating at least one technical problem existing in the prior art.

[0006] To achieve at least one of the above objects of the present disclosure, the following technical means are particularly adopted.

[0007] In a first aspect, the present disclosure provides a therapeutic nucleic acid molecule or a mixture of nucleic acid molecules, comprising a nucleic acid molecule fragment (A) encoding an IL-7 protein and a nucleic acid molecule fragment (B) encoding the p35 and p40 subunits of interleukin IL-12.

[0008] As used herein, a nucleic acid or nucleic acid molecule refers to a polymeric form of nucleotides of any length that includes ribonucleotides and / or deoxyribonucleotides. Examples of nucleic acids or nucleic acid molecules include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA heteroduplexes, or polymers containing purine and pyrimidine bases or other natural, chemical or biochemical modifications, unnatural or derivatized nucleotide bases. The protein or polypeptide of interest encoded by the nucleic acid or nucleic acid molecule may optionally encode the sense strand or the antisense strand. The nucleic acid or nucleic acid molecule acid may be naturally occurring, synthetic, recombinant, or any combination thereof.

[0009] IL-12 is mainly produced by the activation of antigen-presenting cells such as dendritic cells and macrophages. IL-12 binds to the IL-12 receptors IL-12RB1 and IL-12RB2 on the cell membrane, activates downstream Jak2 and Tyk2, further induces phosphorylation and dimerization of STAT4, and the latter binds to the promoter of target genes to control the expression of genes such as IFNγ. IL-12 can activate the expression of CD69 and CD25 by NK cells and promote the amplification of NK cells. IL-12 promotes the differentiation and activation of Th1 cells and thus can activate killer CD8 + T cells. IL-12 promotes the differentiation of macrophages into inflammatory M1 type rather than anti-inflammatory M2 type, and can further induce the expression of chemokines CXCL9, CXCL10, CXCL11, and promote the mobilization and enrichment of immune cells.

[0010] IL-7 is widely expressed in tissues including lymph nodes, bone marrow, spleen, skin, lungs, liver, etc. By interacting with the IL-7 receptor, IL-7 activates the Jak-Stat 5 and PI3K-AKT signaling pathways, thereby controlling the expression of downstream genes. IL-7 is involved in the activation of NK, NKT, LAK and CD8 +It can enhance the tumor-killing function of T cells. IL-7 can enhance the killing ability of T cells and NK cells against tumors by inducing the expression of perforin, IFNγ, FasL, etc. In addition, IL-7 can suppress the proliferation of tumor cells by stimulating the release of IL-1β, IL-1α, and TNF-α by monocytes. IL-7 is CD8 + It can downregulate the expression of PD-1 on T cells and thereby reverse T cell exhaustion. IL-7 plays an important role in maintaining the survival and amplification of memory T cells. Also, after antigen withdrawal, IL-7 is memory CD4 + and CD8 + It can maintain the balance of the T cell pool.

[0011] There are interactions in the biological functions of cytokines. IL-7 can increase the expression of the IL-12 receptor in NK cells and T cells and make the latter more sensitive to IL-12. IL-7 can cooperate with IL-12 to improve the expression of IFN-γ. IL-12 and IL-7 can synergistically activate T cells and NK cells and enhance their killing ability against tumor cells. The synergistic effect of IL-12 and IL-7 induces the expression of NKG2E, NKp44, and NKp46 by NK cells and promotes the maturation of NK cells. The synergistic effect of IL-12 and IL-7 induces the expression of HLA-DR by antigen-presenting cells and promotes their antigen-presenting ability. The synergistic effect of IL-12 and IL-7 enhances the amplification of T cells and maintains tumor-infiltrating lymphocytes. IL-7 can increase the TCR diversity of tumor-infiltrating CD8 + T cells, but the synergistic effect of IL-12 and IL-7 increases the proportion of a small number of partial T cell clones, thereby enhancing T cell clonality. This synergistic effect activates tumor-infiltrating T cells and enhances anti-tumor activity.

[0012] In any embodiment, the nucleic acid molecule further comprises a nucleic acid fragment (C) comprising a nucleic acid fragment encoding at least one protein of IFN-α, IFN-β, IFN-γ, GM-CSF, IL-15, and IL-2, and the nucleic acid fragment (C) encodes IFN-α which can enhance the antigen-presenting ability of dendritic cells and promote migration to lymph nodes. IFN-α enhances the killing ability of immune cells by inducing the release of perforin and granzyme. IFN-α can suppress the immunosuppressive function and cell amplification ability of Tregs and MDSCs. IFN-α can promote the differentiation of M1 macrophages. Also, IFN-α can exert a direct antitumor effect through mechanisms such as suppression of the cell cycle of tumor cells, promotion of cell terminal differentiation, and induction of cell apoptosis.

[0013] In any embodiment, based on the biological functions of the cytokines IL-12, IL-7, and IFN-α and their synergistic effects among them, in the field of antitumor therapy, in any embodiment, the combined use of these three cytokines is expected to achieve the main effectiveness of inducing the differentiation and activation of Th1 cells, inducing the maturation of NK cells, activating and promoting the amplification of T cells and NK cells, exerting a killing ability against tumors, maintaining the survival and amplification of memory T cells, promoting the differentiation of macrophages into inflammatory M1 type, enhancing the antigen-presenting ability of dendritic cells, inducing the expression of chemokines to promote the mobilization of immune cells and infiltration into tumor tissues, reversing T cell exhaustion, suppressing the functions of Tregs and MDSCs, directly suppressing the growth of tumor cells, and inducing apoptosis, etc.

[0014] In any embodiment, the amino acid sequence of IL-7 encoded by the nucleic acid fragment (A) is shown in SEQ ID NO.42, or comprises an amino acid sequence having at least 80% identity with SEQ ID NO.42, for example, it may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% identity with SEQ ID NO.42, but is not limited thereto.

[0015] In any embodiment, the nucleotide sequence of the nucleic acid molecule fragment (A) is selected from any of SEQ ID NOs: 22 to 24 and SEQ ID NOs: 47 to 49. Here, SEQ ID NOs: 22 to 24 are RNA sequences, and SEQ ID NOs: 47 to 49 are DNA sequences.

[0016] In any embodiment, the nucleotide sequence of the nucleic acid molecule fragment (A) is selected from any of nucleotide sequences having at least 70%, 75%, 80%, at least 90%, at least 95%, or at least 98% identity with SEQ ID NOs: 22 to 24 and SEQ ID NOs: 47 to 49.

[0017] In any embodiment, the amino acid sequence of the p35 subunit of IL-12 encoded by the nucleic acid molecule fragment (B) is shown in SEQ ID NO. 39, or includes an amino acid sequence having at least 80% identity with SEQ ID NO. 39. For example, it may include an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% identity with SEQ ID NO. 39, but is not limited thereto.

[0018] In any embodiment, the amino acid sequence of the p40 subunit of IL-12 encoded by the nucleic acid molecule fragment (B) is shown in SEQ ID NO. 40, or includes an amino acid sequence having at least 80% identity with SEQ ID NO. 40. For example, it may include an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% identity with SEQ ID NO. 40, but is not limited thereto.

[0019] In any embodiment, the p35 subunit and the p40 subunit of IL-12 encoded by the nucleic acid molecule fragment (B) are linked by a linker whose amino acid sequence is shown in SEQ ID NO. 41 (GSSGGGGSPGGGSS).

[0020] In any embodiment, the nucleotide sequence of nucleic acid fragment (B) is selected from any of SEQ ID NOs. 19 to 21 and SEQ ID NOs. 44 to 46. Here, SEQ ID NOs. 19 to 21 are RNA sequences, and SEQ ID NOs. 44 to 46 are DNA sequences.

[0021] In any embodiment, the nucleotide sequence of said nucleic acid fragment (B) is selected from any of nucleotide sequences having at least 70%, 75%, 80%, at least 90%, at least 95%, or at least 98% identity to SEQ ID NOs. 19 to 21 and SEQ ID NOs. 44 to 46.

[0022] In any embodiment, the amino acid sequence of the IFN-α polypeptide encoded by nucleic acid fragment (C) is shown in SEQ ID NO. 43, or includes an amino acid sequence having at least 80% identity to SEQ ID NO. 43, for example, it may include an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% identity to SEQ ID NO. 43, but is not limited thereto.

[0023] In any embodiment, the nucleotide sequence of nucleic acid fragment (C) is selected from any of SEQ ID NOs. 26 to 28 and SEQ ID NOs. 50 to 52. Here, SEQ ID NOs. 26 to 28 are RNA sequences, and SEQ ID NOs. 50 to 52 are DNA sequences.

[0024] In any embodiment, the nucleotide sequence of said nucleic acid fragment (C) is selected from any of nucleotide sequences having at least 70%, 75%, 80%, at least 90%, at least 95%, or at least 98% identity to SEQ ID NOs. 26 to 28 and SEQ ID NOs. 50 to 52.

[0025] In any embodiment, the nucleic acid molecule fragment (A), nucleic acid molecule fragment (B), and / or nucleic acid molecule fragment (C) can optimize the mRNA sequence by sequence optimization means to improve the properties related to the expression effect after in vivo administration. For example, improve mRNA stability, increase the translation effect in the target tissue, reduce the number of truncated proteins expressed, improve the folding of the expressed protein or prevent its misfolding, reduce the toxicity of the expression product, reduce cell death caused by the expression product, increase and / or decrease protein aggregation, and obtain an mRNA with improved properties. The purpose of sequence optimization is to optimize the characteristics of the preparation and delivery of nucleic acid-based therapeutic agents while maintaining the structure and functional integrity, overcome the expression threshold, increase the expression rate, half-life and / or protein concentration, optimize protein localization, and further avoid adverse biological responses such as immune responses and / or degradation pathways. The sequence optimization means include: (1) performing codon optimization to ensure proper folding and proper expression based on the codon usage frequency in a specific organ and / or host organism; (2) adjusting the G / C content to increase mRNA stability or reduce secondary structure; (3) minimizing tandem repeat codons or base runs that may impair gene construction or expression; (4) customizing transcription and translation control regions; (5) reducing or eliminating problematic secondary structures within the polynucleotide.

[0026] "Sequence identity" between two nucleotide sequences indicates the proportion of the same nucleotides between the sequences. "Sequence identity" between two amino acid sequences indicates the proportion of the same amino acids between the sequences.

[0027] The term "% identity" or similar terms means the percentage of the same nucleotides or amino acids between the sequences being compared in an optimal alignment. This percentage is purely statistical, and the differences between the two sequences may be randomly distributed (but not necessarily so) over the entire length of the sequences being compared. The comparison of two sequences is typically performed by comparing the variant sequences against fragments or "comparison windows" in order to identify sub-regions of the corresponding sequences after an optimal alignment.

[0028] In any embodiment, the nucleic acid molecule comprises a DNA molecule and / or an RNA molecule.

[0029] In any embodiment, the DNA molecule comprises a linear DNA molecule and / or a circular DNA molecule.

[0030] In any embodiment, the RNA molecule comprises an mRNA or a circular RNA.

[0031] In any embodiment, the 5'-end and / or 3'-end of the nucleic acid molecule fragment has a protective modifying group.

[0032] In any embodiment, the nucleic acid molecule fragment is an mRNA fragment, and the modifying group at the 5'-end of the mRNA fragment is selected from ARCA, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3'OMeG)(5')ppp(5')(2'OMeG)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, mCAP, dmCAP, tmCAP or dmCAP.

[0033] In any embodiment, the protective modifying group at the 3'-end of the mRNA fragment is poly(A), and the length of the poly(A) is 50 to 200, optionally 80 to 200.

[0034] In any embodiment, the mRNA fragment further comprises a 5'UTR.

[0035] In any embodiment, the length of the 5’UTR may optionally be 10 to 200 nucleotides, or optionally 15 to 100 nucleotides.

[0036] In any embodiment, the 5’UTR contains a KOZAK sequence or a DNAH2 5’UTR.

[0037] In any embodiment, the nucleotide sequence of the KOZAK sequence is shown in SEQ ID.NO.16.

[0038] In any embodiment, the nucleotide sequence of the DNAH2 5’UTR is shown in SEQ ID.NO.38.

[0039] In any embodiment, the mRNA fragment further contains a 3’UTR.

[0040] In any embodiment, the 3’UTR sequences are shown in SEQ ID.NO.1 to 10. SEQ ID.NO.1 is from Creatine Kinase (CK), SEQ ID.NO.2 is from Myoglobin, SEQ ID.NO.3 is α-actin, SEQ ID.NO.4 is from Albumin, SEQ ID.NO.5 and 7 are from a-globin, SEQ ID.NO.6 is from Col6a2, collagen, type IV, alpha 2, and SEQ ID.NO.10 is from Hemoglobin HBA2.

[0041] In any embodiment, the mRNA contains, in order from the 5’ end to the 3’ end, a 5’ cap, a 5’UTR, an ORF, a 3’UTR, and a 3’ poly(A) tail.

[0042] In any embodiment, based on the provided RNA sequence, one of ordinary skill in the art can obtain the corresponding DNA sequence (e.g., by converting uracil to thymine). Similarly, based on the provided DNA sequence, one of ordinary skill in the art can obtain the corresponding RNA sequence (e.g., by converting thymine to uracil). In any embodiment, based on the provided RNA or DNA sequence, one of ordinary skill in the art can obtain the corresponding amino acid sequence.

[0043] In any embodiment, one or more uridines in the mRNA are replaced with modified nucleosides. In some embodiments, the modified nucleosides that replace uridine are pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), or 5-methyl-uridine (m5U).

[0044] In a second aspect, the present disclosure provides a first therapeutic nucleic acid molecule composition comprising a mixture of nucleic acid molecules according to any of the above embodiments.

[0045] In any embodiment, the mass ratio of each free nucleic acid molecule fragment is from 10:1 to 1:10, and optionally, the mass ratio of each free nucleic acid molecule fragment may be, for example, 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, 1:10, but is not limited thereto.

[0046] In a third aspect, the present disclosure provides a therapeutic fusion nucleic acid molecule comprising the nucleic acid molecule according to any of the above embodiments, wherein the nucleic acid molecule comprises nucleic acid molecule fragment (A) and nucleic acid molecule fragment (B), and in any embodiment, further comprises nucleic acid molecule fragment (C).

[0047] In any embodiment, at least any two nucleic acid molecule fragments are linked by a linker.

[0048] In any embodiment, the mass ratio of each nucleic acid molecule fragment in the fusion nucleic acid molecule is 10:1 to 1:10. Optionally, the mass ratio of each free nucleic acid molecule fragment may be, for example, 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, 1:10, but is not limited thereto.

[0049] In a fourth aspect, the present disclosure provides a second therapeutic nucleic acid molecule composition comprising a combination of the first therapeutic nucleic acid molecule composition described in the above embodiment and the therapeutic fusion nucleic acid molecule described in the above embodiment.

[0050] In any embodiment, the mass ratio of each nucleic acid molecule fragment in the second therapeutic nucleic acid molecule composition is 10:1 to 1:10. Optionally, the mass ratio of each free nucleic acid molecule fragment may be, for example, 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, 1:10, but is not limited thereto.

[0051] In a fifth aspect, the present disclosure provides the use of the nucleic acid molecule or nucleic acid molecule mixture described in any of the above embodiments, the first therapeutic nucleic acid molecule composition described in the above embodiment, the therapeutic fusion nucleic acid molecule described in the above embodiment, or the second therapeutic nucleic acid molecule composition described in the above embodiment in the preparation of an anti-solid tumor agent or the evaluation of the efficacy of a solid tumor agent.

[0052] In any embodiment, the mass ratio of each nucleic acid molecule fragment in the nucleic acid molecule or nucleic acid molecule mixture is 10:1 to 1:10. Optionally, the mass ratio of each free nucleic acid molecule fragment may be, for example, 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, 1:10, but is not limited thereto.

[0053] In any embodiment, the solid tumor includes an epithelial tumor, Hodgkin's lymphoma, non-Hodgkin's lymphoma, prostate tumor, ovarian tumor, renal cell tumor, gastrointestinal tumor, liver tumor, colorectal tumor, hemangioma, mesothelioma, pancreatic tumor, breast tumor, sarcoma, lung tumor, colon tumor, brain tumor, melanoma, small cell lung tumor, neuroblastoma, testicular tumor, carcinoid tumor, adenocarcinoma tumor, glioma, seminoma, retinoblastoma or osteosarcoma.

[0054] In a sixth aspect, the present disclosure provides a nucleic acid molecule drug for treating a solid tumor, comprising a nucleic acid molecule component and a carrier encapsulating the nucleic acid molecule component.

[0055] The nucleic acid molecule component is selected from the therapeutic nucleic acid molecule or nucleic acid molecule mixture described in any of the above embodiments, the first therapeutic nucleic acid molecule composition described in the above embodiments, the therapeutic fusion nucleic acid molecule described in the above embodiments, or the second therapeutic nucleic acid molecule composition described in the above embodiments.

[0056] In any embodiment, the mass ratio of each free nucleic acid molecule fragment is from 10:1 to 1:10, and optionally, the mass ratio of each free nucleic acid molecule fragment may be, for example, 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, 1:10, but is not limited thereto.

[0057] In any embodiment, the mass ratio of each nucleic acid molecule fragment in the fusion nucleic acid molecule is from 10:1 to 1:10, and optionally, the mass ratio of each nucleic acid molecule fragment in the fusion nucleic acid molecule may be, for example, 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, 1:10, but is not limited thereto.

[0058] In any embodiment, the carrier includes liposome nanoparticles.

[0059] In any embodiment, each free nucleic acid molecule fragment or fusion nucleic acid molecule in the nucleic acid molecule component is independently encapsulated by liposome nanoparticles.

[0060] In any embodiment, at least two free nucleic acid fragments or fusion nucleic acid molecules are independently encapsulated together by liposomal nanoparticles. For example, two free nucleic acid fragments, or three free nucleic acid fragments, or fusion nucleic acid molecules are independently encapsulated together by liposomal nanoparticles.

[0061] In any embodiment, at least two free nucleic acid fragments are encapsulated together by liposomal nanoparticles. For example, two free nucleic acid fragments, or three free nucleic acid fragments are encapsulated together by liposomal nanoparticles.

[0062] In any embodiment, at least one free nucleic acid fragment and one fusion nucleic acid molecule are encapsulated together by liposomal nanoparticles.

[0063] In any embodiment, the liposomal nanoparticles contain 20% - 50% (e.g., but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of cationic lipid in mole percentage, 20% - 50% (e.g., but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of DOPG, 5% - 20% (e.g., but not limited to, 5%, 10%, 15%, or 20%) of cholesterol, and 1% - 5% (e.g., but not limited to, 1%, 2%, 3%, 4%, or 5%) of PEG - DMG.

[0064] In any embodiment, the liposomal nanoparticles contain 50% of Dlin - MC3 - DMA, 10% of DOPG, 38.5% of cholesterol, and 1.5% of PEG - DMG in mole percentage.

[0065] In any embodiment, it further contains a therapeutic protein or a component for therapeutic chemical medicine.

[0066] In any embodiment, the therapeutic protein includes Atezolizumab.

[0067] In a seventh aspect, the present disclosure provides a method for preparing a nucleic acid molecule drug according to any of the above embodiments, wherein a free nucleic acid molecule fragment and / or a fusion nucleic acid molecule is dissolved in a buffer solution to obtain an aqueous phase, each component of the liposome nanoparticles is weighed and dissolved in an organic solvent to obtain an organic phase, and the aqueous phase and the organic phase are mixed to remove the organic phase to obtain the nucleic acid molecule drug.

[0068] In any embodiment, the volume ratio of the aqueous phase to the organic phase is 1:2 to 4, optionally 1:3.

[0069] In any embodiment, the buffer solution contains citrate buffer or sodium acetate, optionally citrate buffer.

[0070] In any embodiment, the pH of the buffer solution is 3 to 7, optionally 4.

[0071] In any embodiment, the concentration of the free nucleic acid molecule fragment and / or the fusion nucleic acid molecule in the aqueous phase is 0.05 mg / mL to 0.5 mg / mL, optionally 0.1 mg / mL.

[0072] In any embodiment, the organic solvent is selected from C1-C4 lower carbon alcohols, optionally absolute ethanol.

[0073] In any embodiment, the concentration of the lipid component in the organic phase is 5 mg / mL to 7 mg / mL, optionally 6 mg / mL.

[0074] In any embodiment, the aqueous phase and the organic phase are mixed using microfluidics, and the organic solvent is filtered using tangential flow.

[0075] Optionally, the flow rate of the microfluidics exceeds 3 ml / min, and further optionally is 12 mL / min.

[0076] In any embodiment, after mixing, a concentration step is further included to make the final concentration of the free nucleic acid fragments and / or the fusion nucleic acid molecules be 50 μg / mL to 200 μg / mL, optionally 100 μg / mL.

[0077] In an eighth aspect, the present disclosure provides a pharmaceutical composition comprising the nucleic acid molecule drug according to any of the above embodiments, or the nucleic acid molecule drug obtained by preparing according to the preparation method according to any of the above embodiments.

[0078] In any embodiment, the pharmaceutical composition further comprises a protein-based drug selected from at least one of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-CTLA-4 antibody, an anti-CD20 antibody, an anti-Her2 antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-VEGFR antibody, an anti-EGFR antibody, an anti-RANKL antibody, an anti-CD30 antibody, an anti-VEGFR2 antibody, an anti-GD2 antibody, an anti-CD38 antibody, an anti-CD22 antibody, and an anti-CD33 antibody.

[0079] In any embodiment, the pharmaceutical composition further comprises at least one of atezolizumab, nivolumab, pembrolizumab, pidilizumab, durvalumab, avelumab, and ipilimumab.

[0080] Compared with the prior art, the beneficial effects of the present disclosure are as follows.

[0081] The nucleic acid molecule or nucleic acid molecule mixture provided by the present disclosure, which mainly comprises a nucleic acid fragment encoding an IL-7 protein and a nucleic acid fragment encoding the p35 and p40 subunits of interleukin IL-12, can generally activate various immune cell activities and achieve an effective treatment for solid tumors.

[0082] The present disclosure also provides nucleic acid molecules in different combinatorial forms containing the above nucleic acid molecule fragments, and the combinatorial forms include the fusion of different nucleic acid molecule fragments and the formation of a composition by different nucleic acid molecule fragments in a free form. The two types of nucleic acid molecule fragments provided by the present disclosure have been verified to exhibit an effective therapeutic effect on solid tumors whether combined in a free form or prepared as a fusion nucleic acid molecule.

[0083] The present disclosure further uses an aptamer to complex with the above nucleic acid composition or fusion nucleic acid molecule to obtain a nucleic acid molecule drug, and provides a corresponding preparation method, expecting to alleviate the urgent need for drugs in current solid tumor treatment.

Brief Description of the Drawings

[0084] To more clearly explain the specific embodiments of the present disclosure or the technical aspects in the prior art, the following briefly describes the drawings that need to be used in the description of the specific embodiments or the prior art. It is obvious that the drawings in the following description are some embodiments of the present disclosure, and those skilled in the art can also obtain other drawings from these drawings without creative effort.

[0085]

Figure 1

[0086]

Figure 2

[0087]

Figure 3

[0088]

Figure 4

[0089]

Figure 5

[0090]

Figure 6

[0091]

Figure 7

[0092]

Figure 8

[0093]

Figure 9

[0094]

Figure 10

[0095]

Figure 11

[0096]

Figure 12

[0097]

Figure 13

[0098]

Figure 14

[0099]

Figure 15

Embodiments for Carrying out the Invention

[0100] Hereinafter, the technical aspects of the present disclosure will be clearly and completely described with reference to the examples. Obviously, the described examples are some of the examples of the present disclosure, not all of them. Based on the examples in the present disclosure, all other examples obtained by those skilled in the art without creative efforts belong to the scope protected by the present disclosure.

[0101] To prove that the therapeutic nucleic acid molecule or nucleic acid molecule mixture provided by the present disclosure has a therapeutic effect on solid tumors, the present disclosure constructs an evaluation method for the therapeutic effect on solid tumors, and the specific steps are as follows.

[0102] 1. Construction of a mouse CT26 tumor model Selection of experimental animals: (1) Strain: BALB / c, (2) Grade: SPF grade, (3) Age: 7.6 - 8.7 weeks, (4) Gender: female.

[0103] Tumor inoculation: CT26.WT cells were revived and subcultured, and the number of revival passages was N + 8. CT26.WT cells in the logarithmic growth phase (the number of inoculation passages was N + 11) were collected, the culture medium was removed, washed twice with PBS, and then inoculated. The inoculation amount was: 1×10 6 cells / 100 μL / animal, and the inoculation position was the first position shown in Figure 1.

[0104] 2. Construction of a mouse KM12 tumor model Selection of experimental animals: (1) Strain: SCID mice, (2) Grade: SPF grade, (3) Age: 10 weeks, (4) Gender: female.

[0105] Tumor inoculation: KM - 12 cells were revived and subcultured, and the number of revival passages was N + 8. KM - 12 cells in the logarithmic growth phase were collected, the culture medium was removed, washed twice with PBS, and then inoculated. The inoculation amount was: 5×10 6It was 5×10 cells / 200 μL / animal, and the inoculation site was the first position shown in Fig. 1.

[0106] 3. Construction of Mouse Cal27 Tumor Model Selection of experimental animals: (1) Strain: BALB / c nude mice; (2) Grade: SPF grade; (3) Age: 4 - 6 weeks; (4) Gender: male.

[0107] Tumor inoculation: Cal27 cells were revived and subcultured, and the number of revival passages was N + 8. Cal27 cells in the logarithmic growth phase (the passage number for inoculation was N + 11) were collected, the culture medium was removed, and after washing twice with PBS, they were inoculated. The inoculation dose was 5×10 9 cells / L / animal, and the inoculation site was the second position shown in Fig. 1.

[0108] 4. Construction of Mouse NCI - N87 Tumor Model Selection of experimental animals: (1) Strain: SCID; (2) Grade: SPF grade; (3) Age: 11 weeks; (4) Gender: female.

[0109] Tumor inoculation: NCI - N87 cells were revived and subcultured, and the number of revival passages was N + 8. NCII - N87 cells in the logarithmic growth phase (the passage number for inoculation was N + 11) were collected, the culture medium was removed, and after washing twice with PBS, they were inoculated. The inoculation dose was 3.0×10 6 cells / 200 μL / animal, and the inoculation site was the first position shown in Fig. 1.

[0110] 5. Construction of Mouse A375 Tumor Model Selection of experimental animals: (1) Strain: SCID; (2) Grade: SPF grade; (3) Age: 6 - 8 weeks; (4) Gender: female.

[0111] Tumor inoculation: A375 cells were revived and subcultured, and the number of revival passages was N + 8. A375 cells in the logarithmic growth phase (the passage number for inoculation was N + 11) were collected, the culture medium was removed, and after washing twice with PBS, they were inoculated. The inoculation dose was 5×10 6 cells / 200 μL / animal, and the inoculation site was the first position shown in Fig. 1.

[0112] 6. Construction of Mouse NCI-H1975 Tumor Model Selection of experimental animals: (1) Strain: NSG; (2) Grade: SPF grade; (3) Age: 10 weeks; (4) Gender: female.

[0113] Tumor inoculation: The NCI-H1975 cells were revived and subcultured, and the number of revival passages was N+8. The NCI-H1975 cells in the logarithmic growth phase (the passage number for inoculation was N+11) were collected, the culture medium was removed, and after washing twice with PBS, they were inoculated at an inoculation dose of 1×10 6 cells / 100 μL / animal, and the inoculation site was position 1 shown in Figure 1.

[0114] 7. Construction of Mouse MDA-MB-231 Tumor Model Selection of experimental animals: (1) Species: mouse; (2) Strain: huHSC-NCG-hIL15 (T038070); (3) Grade: SPF grade; (4) Age: 16.7 weeks (age at inoculation); (5) Gender: female.

[0115] Identification of humanized mice: 8.7 weeks after immune reconstitution with hHSC-NCG-hIL15, the mouse peripheral blood was analyzed by flow cytometry for the following indicators: hCD45 + , hCD3 + , CD4, CD8, NK (hCD56 + , hCD16 + ). The average proportion of hCD45 cells in live cells was 24.82%, and the average proportion of hCD56 + / hCD45 + was 10.8%. It was determined that the construction of the humanized model was successful, and cell amplification was performed. +

[0116] Tumor inoculation: The MDA-MB-231 cells were revived and subcultured, and the number of revival passages was N+23. At 12.5 weeks after immune reconstitution, the MDA-MB-231 cells in the logarithmic growth phase (the passage number for inoculation was N+33) were collected, the culture medium was removed, and after washing twice with PBS, they were inoculated at an inoculation dose of 5×10 6 cells / 100 μL / animal (Matrigel 1:1), and the inoculation site was position 3 shown in Figure 1. ​

[0117] 8. Euthanasia of Animals During the experiment, the tumor size was observed, the body weight of the mice was weighed, and clinical pathological evaluation was performed. Then, based on clinical observation, the clinical score (in aspects such as body weight, mouse posture, activity, hair, skin, etc.) was evaluated. If the experimental mice showed the following indicators, the animals would be euthanized. (1) When the tumor volume of a single mouse exceeded 3000 mm 3 , the single mouse would be euthanized. (2) Diarrhea persisted. (3) Activity was slow (unable to eat or drink). (4) The back was rounded and slept on the side. (5) Activity decreased and muscle atrophy symptoms appeared. (6) Breathing became difficult. (7) Body temperature decreased progressively. (8) Paralysis and convulsions occurred. (9) Bleeding continued. (10) The animal could not move normally due to the tumor being too large or other reasons. (11) The animal could not move normally due to severe ascites or an increase in abdominal circumference.

[0118] 9. Index Calculation Formula The calculation method of tumor volume is: tumor volume (mm 3 ) = 0.5 × tumor major axis × tumor minor axis 2 .

[0119] TGI TV (Relative Tumor Inhibition Rate) calculation formula:

Number

Number

[0120] TGITW (Tumor weight change) Calculation formula:

Number

[0121] 10. Statistical analysis The experimental results were expressed as mean ± standard error (Mean ± SEM). The comparison between the samples of the two groups adopted an independent samples t-test (T-Test), the data was analyzed using SPSS, and P < 0.05 indicated a significant difference. The graphing software was Graphpad prism.

[0122] The present disclosure provides a method for preparing mRNA-containing lipid nanoparticles. Unless otherwise specified, the mRNA used for injection administration in the following examples all adopted the administration method of lipid nanoparticles obtained by encapsulating cationic lipids alone. For the preparation method of lipid nanoparticles obtained by encapsulating cationic lipids alone, refer to Example 8 or Example 15. For the preparation method of lipid nanoparticles obtained by encapsulating cationic lipids together, refer to Example 7, 9, 16 or 17. Those skilled in the art can prepare lipid nanoparticles with reference to the above preparation methods based on the type and amount of nucleic acid molecules. In the following examples, the nucleotide sequences of SEQ ID NO.11 - 15 and SEQ ID NO.25 are from mice, and the nucleotide sequences of SEQ ID NO.17 - 24 and SEQ ID NO.26 - 29 are from humans.

[0123] Note that the mRNA containing one open reading frame used in the following examples had a structure including a 5' cap, 5' UTR, ORF, 3' UTR, and 3' poly(A) tail in order from the 5' end to the 3' end. The 5' cap had the sequence of the 5' UTR shown in SEQ ID NO. 38, the ORF was selected from, for example, any of SEQ ID NOs. 11 to 15 and SEQ ID NOs. 17 to 29, the sequence of the 3' UTR was shown in SEQ ID NO. 10, and the length of the 3' poly(A) tail was 100A. All uridines in the mRNA sequence were replaced with N1-methyl-pseudouridine (m1ψ). Administration by in-situ injection herein means intratumoral injection (intratumoral injection means injecting into the interior of the tumor, that is, injecting a therapeutic agent at any position in contact with the tumor).

Example

[0124] Example 1 In this example, the effect of combinations of mRNAs encoding different polypeptides on the tumor suppression rate was investigated.

[0125] Five groups of experiments were conducted using the above CT26 tumor model as an experimental model, and the number of mice in each group was 8.

[0126] Group 1.1 (G1) was administered physiological saline, the administration frequency was twice a week, and the administration period was 3 weeks. Group 1.2 (G2) was a mixture consisting of mRNA encoding the IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO. 14), mRNA encoding IL-7 (the nucleotide sequence is shown in SEQ ID NO. 15), and mRNA encoding GM-CSF (the nucleotide sequence is shown in SEQ ID NO. 25).

[0127] Group 1.3 (G3) was a mixture consisting of mRNA encoding IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO. 14), mRNA encoding IL-7 (nucleotide sequence shown in SEQ ID NO. 15), mRNA encoding IFN-α (nucleotide sequence shown in SEQ ID NO. 13), and mRNA encoding GM-CSF (nucleotide sequence shown in SEQ ID NO. 25). Group 1.4 (G4) was a mixture consisting of mRNA encoding IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO. 14), mRNA encoding IL-15 (nucleotide sequence shown in SEQ ID NO. 11), mRNA encoding IFN-α (nucleotide sequence shown in SEQ ID NO. 13), and mRNA encoding GM-CSF (nucleotide sequence shown in SEQ ID NO. 25). Group 1.5 (G5) was a mixture consisting of mRNA encoding IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO. 14), mRNA encoding IL-7 (nucleotide sequence shown in SEQ ID NO. 15), and mRNA encoding IFN-α (nucleotide sequence shown in SEQ ID NO. 13).

[0128] The administration frequency of the mRNA mixture was once a week, the administration period was 3 weeks, and the administration mode for the mice in all 5 groups was in-situ injection. However, the total administration amount of mRNA for each group was 0.12 mg / kg, and different RNAs within each group were administered in equal amounts. 25 days after grouping was set as the experimental end point, and the effects of the 5 groups of experiments on tumors were tested. When verified by the above calculation method, the relative tumor growth inhibition rate (TGI TV ) against mouse colon cancer cells CT26 in IL-12 + IL-7 + GM-CSF (Group G2) was 36.46%, and the relative tumor growth inhibition rate (TGI TV) were 98.56%, 97.67%, and 97.07%, respectively, but there was no significant difference in the relative tumor growth inhibition rate (TGI TV ) among the G3 - G5 groups (P > 0.05). The results of the tumor volume change curves according to the injection days are shown in Figure 2.

[0129] In addition, the present disclosure screened other components for the mRNA three - component mixture of IL - 12 + IL - 7 + IFN - α. After replacing IFN - α with IFN - β or IFN - γ in the mRNA three - component mixture of IL - 12 + IL - 7 + IFN - α, the obtained relative tumor growth inhibition rates (TGI TV ) were 67% and 75% respectively, which were slightly lower than that of IFN - α.

[0130] Example 2 In this example, the ability of different mRNA sequences of the same polypeptide fragment to express the polypeptide fragment in vitro was examined.

[0131] In this example, by in vitro transcription method, the above three IL - 7 mRNAs (sequences are SEQ ID NO.22, SEQ ID NO.23, and SEQ ID NO.24 respectively), three IL - 12 mRNAs (sequences are SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21 respectively), and three IFN - α mRNAs (sequences are SEQ ID NO.26, SEQ ID NO.27, and SEQ ID NO.28 respectively) were prepared and transfected into HEK293 cells respectively. First, HEK293 cells were seeded at a density of 4×10 5 cells / ml, and cell transfection was performed when the cell confluence state was about 80% after 24 hours. The transfection system added to one well of HEK293 cells in a 6 - well plate during transfection contained 2 μg mRNA and the transfection reagent Lipofectamine MessagerMAX (ThermoFisher Scientific). The specific transfection operation was carried out according to the specification of the transfection reagent.

[0132] After 24 hours, the cell supernatant and cell lysate were collected respectively, and the levels of proteins expressed by mRNA were detected by ELISA method respectively.

[0133]

Table 1

Table 2

Table 3

[0134] For the three-segment sequences of IL-12 mRNA, IL-7 mRNA, and IFN-α mRNA listed in this disclosure, there were no significant differences in indicators such as the frequency of common codons, GC content, mRNA secondary structure of the gene (such as mRNA free energy), cis-acting mRNA destabilizing sequences, RNase cleavage sites, and repeat units. However, as can be seen from the transcription results, the expression level of IL-12 in the cells transfected with the IL-12 mRNA sequence of SEQ ID NO.19 was higher than that of the IL-12 mRNA sequences of SEQ ID NO.20 and SEQ ID NO.21. The expression level of IL-7 in the cells transfected with the IL-7 mRNA sequence of SEQ ID NO.22 was higher than that of the IL-7 mRNA sequences of SEQ ID NO.23 and SEQ ID NO.24. The expression level of IFN-α mRNA in the cells transfected with the IFN-α mRNA sequence of SEQ ID NO.26 was higher than that of the IFN-α mRNA sequences of SEQ ID NO.27 and SEQ ID NO.28.

[0135] This disclosure adopts any of the three-segment sequences of IL-12 mRNA in the ORF of IL-12 mRNA in the mRNA three-component mixture (IL-12 + IL-7 + IFN-α), and when the dosage is adjusted according to the IL-12 expression level of each segment sequence, tumor regression, relative tumor growth inhibition rate (TGI) TV) had no effect on effects such as immune memory and combination use with anti-tumor agents. This effect is similarly applicable to IL-7 and IFN-α.

[0136] Example 3 In this example, the influence of the difference in dosage on the tumor suppression effect was examined.

[0137] Using the above mouse MDA-MB-231 tumor model as an experimental model, on the 16th day after construction (14.8 weeks after immune reconstitution), 30 humanized tumor-bearing mice were randomly divided into 5 groups of 6 each based on tumor volume. The day of grouping was designated as D0, and administration was started on the day of grouping, that is, D0. The remaining mice after grouping were euthanized.

[0138] Dosage plan for Group 3.1 (G1): physiological saline, dosage plan for Group 3.2 (G2): 5 mg / kg of tesentriq (positive drug), dosage plan for Group 3.3 (G3): 0.032 mg / kg of mRNA triple-component mixture (IL-12 + IL-7 + IFN-α, SEQ ID NO.19 + SEQ ID NO.22 + SEQ ID NO.26), dosage plan for Group 3.4 (G4): 0.16 mg / kg of mRNA triple-component mixture (IL-12 + IL-7 + IFN-α, SEQ ID NO.19 + SEQ ID NO.22 + SEQ ID NO.26), dosage plan for Group 3.5 (G5): 0.8 mg / kg of mRNA triple-component mixture (IL-12 + IL-7 + IFN-α, SEQ ID NO.19 + SEQ ID NO.22 + SEQ ID NO.26). The changes in tumor volume of mice in G1 - G5 are shown in Figure 3.

[0139] According to the statistical analysis of tumor volume data at the end of drug withdrawal, compared with the control group, tesentriq in Group G2 (TGI TV = 19.67%) could significantly inhibit tumor growth (P < 0.05*), and the low dose in Group G3 (TGI TV = 45.52%), Group G4 (TGI TV = 73.94%), and Group G5 (TGI TV = 95.10%) could all significantly inhibit tumor growth (P < 0.001***).

[0140] In this experiment, the pharmacodynamic effects of different doses of the test subject mRNA triple-component mixture and the positive drug Tislelizumab were evaluated in a huHSC-NCG-hIL15 mouse subcutaneous MDA-MB-231 breast cancer tumor model. From the above experimental data, the positive drug Tislelizumab showed a significant tumor suppression effect at the tumor growth stage compared to the control group G1 in the current test system (TGI TV = 19.67%, P = 0.021*). The test subject mRNA triple-component mixture at low, medium, and high doses showed a significant tumor suppression effect on tumor volume compared to the control group G1.

[0141] Example 4 In this example, (1) the antitumor effects of a single drug of IL-12 + IL-7 + IFN-α (SEQ ID NO.14 + SEQ ID NO.15 + SEQ ID NO.13) containing three components, and (2) the combined administration of this single drug and a protein-based drug (taking the anti-PD-1 antibody as an example) were tested.

[0142] In this experiment, a wild-type BALB / c mouse model was selected, inoculated with mouse colon cancer cells CT26, and (1) the injection administration of the single drug into the tumor, and (2) the combined administration of the single drug and the anti-PD-1 antibody were continuously performed three times at 10 days, 17 days, and 24 days after tumor cell inoculation respectively. (3) As a result of comparison with the anti-PD-1 antibody positive drug, as shown in Figure 4, the single drug containing three different mRNA components and its combined administration with the anti-PD-1 antibody had relative tumor suppression rates (TGI TV ) of 99.06% and 98.39% respectively against mouse colon cancer cells CT26 in the wild-type BALB / c mouse model, while the relative tumor suppression rate of the anti-PD-1 antibody positive drug was 47.78%. As can be seen from the above results, when considering the single agent composed of the three components of IL-12 + IL-7 + IFN-α and its combination with the anti-PD-1 antibody, in the differential analysis of antitumor activity against CT26 mouse colon cancer cells, from the relative tumor suppression rate (TGI TV ) of the experimental results this time, when the combination of IL-12 + IL-7 + IFN-α was used alone and formulated (G3), compared with the physiological saline (G1) of the control group, the relative tumor suppression rate (TGITV ) was 99.06%, and since the anti-tumor activity effect was extremely good, the combined administration with the anti-PD-1 antibody (G4, TGI TV was 98.39%), the synergistic effect by the combination with the anti-PD-1 antibody did not occur. However, when the combination of IL-12 + IL-7 + IFN-α was used alone and formulated, its anti-tumor activity was significantly better than that of the anti-PD-1 antibody used alone (G2, TGI TV was 47.78%), and there was a significant difference in its relative tumor growth inhibition rate (TGI TV ).

[0143] Example 5 In this example, after injecting the LNP formulation containing the three components of IL-12 + IL-7 + IFN-α, it was examined whether the mice with tumor regression could produce immune memory.

[0144] In this example, mice with tumor regression were selected, mouse colon cancer cells CT26 were re-inoculated, and after tumor cell inoculation, the tumor sizes were observed at D0, D4, D7, D11, D13, D15, D18, D20, D22, D25, D27, D32, D34 until 81 days after the first administration to the animals, and the results are shown in FIGS. 5 and 6.

[0145] G1 was 6 mice that had not been injected with the three components of IL-12 + IL-7 + IFN-α, G2 was 6 mice that were injected with the three components of IL-12 + IL-7 + IFN-α and the anti-PD-1 antibody in combination and had tumor regression, and G3 was 6 mice that were injected with the three components of IL-12 + IL-7 + IFN-α alone and had tumor regression.

[0146] Among them, G1 was divided into G1-1 and G1-2. G1-1 was inoculated with only mouse colon cancer cells CT26, and G1-2 was inoculated with mouse colon cancer cells CT26 and injected with the three components of IL-12 + IL-7 + IFN-α on D15.

[0147] From the results, 1) The tumor volume of G1-1 mice that had not been completely injected with the three components of IL-12 + IL-7 + IFN-α was 111.84 ± 1.86 mm after 11 days3 was reached, and the tumor volume reached 2702.94 ± 485.22 mm at the end of the experiment 3 and 2) For the G1-2 mice injected with the three components of IL-12 + IL-7 + IFN-α on day D15, the tumor volume reached 99.71 ± 8.26 mm after 11 days 3 and the tumor volume reached 249.38 ± 162.09 mm at the end of the experiment 3 and 3) For the G2 and G3 mice in which the tumor regressed and the tumor cells were re-inoculated, it was shown that no tumor growth was observed until the test endpoint

[0148] From the above results, when injecting the three components of IL-12 + IL-7 + IFN-α, it has the effect of shrinking the tumor. After the tumor shrinks and the tumor cells are re-inoculated, it can also have the effect of suppressing tumor growth. It is clear that long-term immune memory can be formed in the animal body after injecting IL-12 + IL-7 + IFN-α

[0149] Example 6 In this example, when simultaneously injecting the three components of mouse-derived IL-12 + mouse-derived IL-7 + mouse-derived IFN-α locally into the tumor (the nucleotide sequences are shown in SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.13), the ratio of leukocytes infiltrating into the tumor was examined

[0150] In this example, a wild-type BALB / c mouse model was selected, mouse colon cancer cells CT26 were inoculated, and the preparations containing the above three components (G3 group and G4 group) were respectively injected into the tumor twice continuously on days 10 and 17 after tumor cell inoculation. Compared with the mPD-1 positive drug (G2 group), the positive drug was intraperitoneally injected and injected three times continuously on days 10, 14 and 17 after tumor cell inoculation. Here, the G3 group is a preparation of the three components prepared by the method described in Example 8, and G4 is a preparation of the three components prepared by the method described in Example 7. The results are shown in Figure 7. When the three components of IL-12 + IL-7 + IFN-α are formulated, T cells, NK cells, gMDSC, mMDSC, macrophages, CD4 infiltrating into the tumor+ T and CD25 + CD4 + The cells were significantly different from the saline injection group. As can be seen from the above results, the proportion of leukocytes infiltrating into the tumors in groups G3 and G4 (IL-12 + IL-7 + IFN-α) tended to increase compared to groups G1 (saline) and G2 (mPD-1 positive drug), and the proportion of T cells (CD4 + helper T cells and CD8 + killer T cells included) infiltrating into the tumors in groups G3 and G4 increased significantly, which was consistent with the tumor suppression results in the drug efficacy experiment. Also, the results in the drug efficacy experiments of groups G3 and G4 were relatively consistent.

[0151] To evaluate the injection effect of the mRNA three-component mixture (IL-12 + IL-7 + IFN-α) into tumors in various cancer types, as described above, five xenograft mouse models of KM12 (CRC), Cal27 (head and neck cancer), NCI-N87 (gastric cancer), A375 (melanoma), and NCI-H1975 (NSCLC) were constructed. Mice bearing KM12 (CRC), Cal27 (head and neck cancer), NCI-N87 (gastric cancer), A375 (melanoma), and NCI-H1975 (NSCLC) tumors received the mRNA three-component mixture (IL-12 + IL-7 + IFN-α (nucleotide sequences are shown in SEQ ID NO.19, SEQ ID NO.22, and SEQ ID NO.26)) and were tested. In each tumor model mouse, T cells, NK cells, gMDSC, mMDSC, macrophages, CD4 + T and CD25 + CD4 + The cells were significantly different from the saline injection group.

[0152] Example 7 In this example, a method for preparing lipid nanoparticles encapsulating together mRNAs encoding three types of polypeptides, namely IL-12 p35 and p40 subunits, IL-7 polypeptide, and IFN-α polypeptide, was provided. The lipid components of the lipid nanoparticles included 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mole percentage.

[0153] The specific preparation method was as follows.

[0154] (a) mRNAs encoding IL-12 p35 and p40 subunit polypeptides, mRNA encoding IL-7 polypeptide, and mRNA encoding IFN-α polypeptide were dissolved in a citrate buffer at pH 4 at a mass ratio of 1:1:1, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0155] (b) Dlin-MC3-DMA, DOPG, cholesterol, and PEG-DMG were dissolved in absolute ethanol according to the compounding amounts, and the concentration of the lipid components in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0156] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixture was immediately diluted 100-fold with a PBS solution at pH 7.4, and then tangential flow filtration (TFF) was performed to remove the ethanol component in the solution. Thereafter, it was concentrated until the mRNA concentration in the system reached 100 μg / ml, and lipid nanoparticles containing RNA encoding IL-12 polypeptide, RNA encoding IL-7 polypeptide, and RNA encoding IFN-α polypeptide were obtained.

[0157] Example 8 In this example, a method for preparing lipid nanoparticles encapsulating mRNA encoding three types of polypeptides, namely, IL-12 p35 and p40 subunits, IL-7 polypeptide, and IFN-α polypeptide, separately was provided. The lipid component of the lipid nanoparticles contained 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mol%.

[0158] The specific preparation method was as follows.

[0159] (1) Lipid nanoparticles of RNA encoding IL-12 polypeptide (a) mRNA encoding IL-12 p35 and p40 subunit polypeptides was dissolved in a citrate buffer at pH 4, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0160] (b) Dlin-MC3-DMA, DOPG, cholesterol, and PEG-DMG were dissolved in absolute ethanol according to the formulation amounts, and the concentration of the lipid components in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0161] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixture was immediately diluted 100-fold with a PBS solution at pH 7.4, and then tangential flow filtration (TFF) was performed to remove the ethanol component in the solution. Thereafter, it was concentrated until the mRNA concentration in the system reached 100 μg / ml to obtain lipid nanoparticles containing RNA encoding IL-12 polypeptide.

[0162] (2) Lipid nanoparticles of RNA encoding IL-7 polypeptide and lipid nanoparticles of RNA encoding IFN-α polypeptide were prepared according to the procedure of step (1) of this example.

[0163] (3) RNAs encoding three types of polypeptides were mixed in a mass ratio of 1:1:1, and lipid nanoparticles containing RNA encoding the IL-12 polypeptide, RNA encoding the IL-7 polypeptide, and RNA encoding the IFN-α polypeptide were obtained.

[0164] Example 9 In this example, a method for preparing lipid nanoparticles encapsulating DNA plasmids encoding three types of polypeptides, namely the IL-12 p35 and p40 subunits, the IL-7 polypeptide, and the IFN-α polypeptide, together was provided. The DNAs encoding the three types of polypeptides were incorporated into three different plasmids respectively. The lipid component of the lipid nanoparticles contained 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mol%.

[0165] The specific preparation method was as follows.

[0166] (a) DNA plasmids encoding the IL-12 p35 and p40 subunit polypeptides, DNA plasmids encoding the IL-7 polypeptide, and DNA plasmids encoding the IFN-α polypeptide were dissolved in a citrate buffer at pH 4 in a mass ratio of 1:1:1, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0167] (b) Dlin-MC3-DMA, DOPG, cholesterol, and PEG-DMG were dissolved in absolute ethanol according to the compounding amounts, and the concentration of the lipid components in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0168] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixed solution was immediately diluted 100-fold with a PBS solution at pH 7.4, and then tangential flow filtration (TFF) was performed to remove the ethanol component in the solution. Thereafter, the solution was concentrated until the mRNA concentration in the system reached 100 μg / ml, and lipid nanoparticles containing a DNA plasmid encoding the IL-12 polypeptide, a DNA plasmid encoding the IL-7 polypeptide, and a DNA plasmid encoding the IFN-α polypeptide were obtained.

[0169] Example 10 In this example, a therapeutic fusion nucleic acid molecule was provided.

[0170] Structure of the fusion RNA molecule: In addition to those encoding IL-12 and IL-7, the fusion RNA molecule includes, but is not limited to, untranslated regions (UTR, such as 5’UTR or 3’UTR), 5’ cap region, polyA tail region, start region, termination region, signal sequence region, linker sequence, and combinations thereof.

[0171] Here, the protein cleavage signal encoded by the linker sequence includes at least one protein cleavage site. Examples of the encoded protein cleavage signal include, but are not limited to, proprotein convertase (or prohormone convertase), thrombin, and / or factor Xa protein cleavage signals, such as those using a furin cleavage site (FCS) (see US Patent No. 7374930B2). One advantage of selecting FCS is that furin is widely distributed in most cell types, and the fusion RNA of the present disclosure can effectively express active polypeptides in almost any type of cell in the body.

[0172] The DNA sequence of the furin cleavage site is CGTCACGTCT (SEQ ID NO. 30), and the RNA sequence of the furin cleavage site in the fusion RNA is CGUCAACGUCGU (SEQ ID NO. 31).

[0173] An example of the structure of a fusion RNA containing a portion encoding an IL-12 and an IL-7 polypeptide will be described. 5' cap--5' UTR--start region--RNA encoding IL-12--linker--RNA encoding IL-7--3' UTR--termination region--3' polyA tail.

[0174] The linker may be, for example, a cleavable junction or a protease-sensitive junction. The linker is selected from the group consisting of an F2A junction (having the amino acid sequence GSGVKQTLNFDLKLAGDVESNPGP, SEQ ID NO. 32), a P2A junction (having the amino acid sequence GSGANTFSLLKQAGDVENCPGP, SEQ ID NO. 33), a T2A junction (having the amino acid sequence GSGEGRGSLLTCGDVENCPGP, SEQ ID NO. 34), an E2A junction (for example, having the amino acid sequence GSGQCTNYALLKLAGDVESNPGP, SEQ ID NO. 35), and combinations thereof, which are cleavable junctions.

[0175] The self-cleaving peptide can be, but is not limited to, a 2A peptide. Examples of 2A peptides known in the art include, for example, foot-and-mouth disease virus (FMDV) 2A peptide, equine rhinitis A virus 2A peptide, Thosea asigna 2A peptide, porcine teschovirus-1 2A peptide. Some viruses use 2A peptides to produce two proteins from one transcript by ribosome skipping, resulting in weakening of normal peptide bonds at the 2A peptide sequence and producing two discontinuous proteins from one translation event. Examples of polynucleotide sequences encoding 2A peptides include, but are not limited to, the following sequences (the polynucleotide sequences of 2A peptides can be modified or codon-optimized by the methods described herein and / or methods known in the art).

[0176] (1) GGAAGCGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCU (SEQ ID NO.36) or (2) UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAAACAAACUCUUAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAUCCAGGTCCACUC (SEQ ID NO.37) The structure of the therapeutic fusion nucleic acid molecule in the following examples is 5'-cap--5'-UTR--start region--RNA encoding IL-12--linker--RNA encoding IL-7--3'-UTR--termination region--3'-polyA tail, where the 5'-cap region is m7Gppp(5')(2'-OMeA)pG (7-methylguanosine triphosphate-2-methoxyguanosine monophosphate cap analog, CAP1-GAG). The 5'-UTR sequence is shown in SEQ ID NO.38. The start region sequence is a promoter sequence, specifically AUG. The RNA encoding IL-12 is shown in SEQ ID NO.19. The linker RNA is shown in SEQ ID NO.31. The RNA encoding IL-7 is shown in SEQ ID NO.22. The 3'-UTR sequence is shown in SEQ ID NO.10. The termination region sequence is a terminator sequence, specifically UAA. The polyA tail region is also called poly(A) and has a length of 100A.

[0177] Here, in the fusion RNA molecule, the nucleic acid fragment (B) (i.e., the RNA encoding IL-12) may be close to the 5'-end or the 3'-end as described above, and the specific structure is 5'-cap--5'-UTR--start region--RNA encoding IL-7--linker--RNA encoding IL-12--3'-UTR--termination region--3'-polyA tail.

[0178] Example 11 In this example, a therapeutic fusion nucleic acid molecule was provided. The difference from Example 10 is only the structure of the fusion RNA molecule. The fusion RNA molecule in this example includes, but is not limited to, an untranslated region (UTR, such as 5’UTR or 3’UTR), a 5’ cap region, a polyA tail region, a start region, a termination region, a signal sequence region, a linker sequence, and combinations thereof, in addition to the portions encoding the IL-12, IL-7, and IFN-α polypeptides.

[0179] The structure of the therapeutic fusion nucleic acid molecule is 5’ cap--5’UTR--start region--RNA encoding IL-12--linker--RNA encoding IL-7--linker--RNA encoding IFN-α--3’UTR--termination region--3’ polyA tail, where the 5’ cap region is m7Gppp(5’)(2’-OMeA)pG (7-methylguanosine triphosphate-2-methoxyguanosine monophosphate cap analog, CAP 1-GAG). The 5’UTR sequence is shown in SEQ ID NO.38. The start region sequence is a promoter sequence, specifically AUG. The RNA encoding IL-12 is shown in SEQ ID NO.19. The linker RNA is shown in SEQ ID NO.31. The RNA encoding IL-7 is shown in SEQ ID NO.22. The RNA encoding IFN-α is shown in SEQ ID NO.26. The 3’UTR sequence is shown in SEQ ID NO.10. The termination region sequence is a terminator sequence, specifically UAA. The polyA tail region is also called poly(A) and has a length of 100A.

[0180] Here, the relative order among the nucleic acid fragments (A), (B), and (C) in the fusion RNA molecule can be interchanged. For example, it may be 5' cap - 5' UTR - start region - RNA encoding IL-12 - linker - RNA encoding IFN-α - linker - RNA encoding IL-7 - 3' UTR - termination region - 3' polyA tail, 5' cap - 5' UTR - start region - RNA encoding IL-12 - linker - RNA encoding IL-7 - linker - RNA encoding IFN-α - 3' UTR - termination region - 3' polyA tail, 5' cap - 5' UTR - start region - RNA encoding IL-7 - linker - RNA encoding IFN-α - linker - RNA encoding IL-12 - 3' UTR - termination region - 3' polyA tail, 5' cap - 5' UTR - start region - RNA encoding IL-7 - linker - RNA encoding IL-12 - linker - RNA encoding IFN-α - 3' UTR - termination region - 3' polyA tail, 5' cap - 5' UTR - start region - RNA encoding IFN-α - linker - RNA encoding IL-7 - linker - RNA encoding IL-12 - 3' UTR - termination region - 3' polyA tail, 5' cap - 5' UTR - start region - RNA encoding IL-7 - linker - RNA encoding IL-12 - linker - RNA encoding IFN-α - 3' UTR - termination region - 3' polyA tail, 5' cap - 5' UTR - start region - RNA encoding IFN-α - linker - RNA encoding IL-12 - linker - RNA encoding IL-7 - 3' UTR - termination region - 3' polyA tail.

[0181] Example 12 In this example, an LNP formulation of a therapeutic fusion nucleic acid molecule was provided, and its preparation method was as follows. The fusion nucleic acid molecule mRNA encoded the IL-12 p35 and p40 subunits and the IL-7 polypeptide. The structure of the fusion nucleic acid molecule mRNA was described in Example 10. The lipid components of the lipid nanoparticles included 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mol%.

[0182] The specific preparation method was as follows.

[0183] (a) The therapeutic fusion nucleic acid molecule mRNA was dissolved in a citrate buffer at pH 4, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0184] (b) Dlin-MC3-DMA, DOPG, cholesterol, and PEG-DMG were dissolved in absolute ethanol according to the formulation amounts, and the concentration of the lipid components in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0185] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixture was immediately diluted 100-fold with a PBS solution at pH 7.4 and then tangential flow filtered (TFF) to remove the ethanol component in the solution. Then, it was concentrated until the mRNA concentration in the system reached 100 μg / ml to obtain lipid nanoparticles containing the therapeutic fusion nucleic acid molecule mRNA.

[0186] Example 13 In this example, an LNP formulation of a therapeutic fusion nucleic acid molecule was provided. The difference from Example 12 was that the fusion nucleic acid molecule mRNA only encoded the IL-12 p35 and p40 subunits, the IL-7 polypeptide, and the IFN-α polypeptide.

[0187] Example 14 The lipid nanoparticles containing the therapeutic fusion nucleic acid molecule mRNA prepared in Example 13 were mixed with the lipid nanoparticles containing the DNA plasmid encoding the IL-12 polypeptide prepared in Example 9, the DNA plasmid encoding the IL-7 polypeptide, and the DNA plasmid encoding the IFN-α polypeptide at a mass ratio of 1:1 to obtain a second therapeutic nucleic acid molecule composition.

[0188] Example 15 In this example, a method for preparing lipid nanoparticles encapsulating mRNA encoding two polypeptides, namely the IL-12 p35 and p40 subunits and the IL-7 polypeptide, separately was provided. The lipid component of the lipid nanoparticles contained 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mol%.

[0189] The specific preparation method was as follows.

[0190] (1) Lipid nanoparticles of RNA encoding the IL-12 polypeptide (a) The mRNA encoding the IL-12 p35 and p40 subunit polypeptides was dissolved in a citrate buffer at pH 4, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0191] (b) Dlin-MC3-DMA, DOPG, cholesterol, and PEG-DMG were dissolved in absolute ethanol according to the formulation amounts, and the concentration of the lipid components in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0192] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixture was immediately diluted 100-fold with a PBS solution at pH 7.4 and then tangential flow filtered (TFF) to remove the ethanol component in the solution. Then, it was concentrated until the mRNA concentration in the system reached 100 μg / ml to obtain lipid nanoparticles containing RNA encoding the IL-12 polypeptide.

[0193] (2) According to step (1) of this example, lipid nanoparticles of RNA encoding IL-7 polypeptide were prepared.

[0194] (3) Lipid nanoparticles of RNA encoding two types of polypeptides were mixed at a mass ratio of 1:1, and lipid nanoparticles containing RNA encoding IL-12 polypeptide and RNA encoding IL-7 polypeptide were obtained.

[0195] Example 16 In this example, a method for preparing lipid nanoparticles encapsulating together mRNA encoding two types of polypeptides, namely IL-12 p35 and p40 subunits and IL-7 polypeptide, was provided. The lipid components of the lipid nanoparticles included 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mol%.

[0196] The specific preparation method was as follows.

[0197] (a) mRNA encoding IL-12 p35 and p40 subunit polypeptides and mRNA encoding IL-7 polypeptide were dissolved in citrate buffer at pH 4 at a mass ratio of 1:1, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0198] (b) Dlin-MC3-DMA, DOPG, cholesterol, and PEG-DMG were dissolved in absolute ethanol according to the compounding amounts, and the concentration of the lipid components in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0199] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixture was immediately diluted 100-fold with PBS solution at pH 7.4, and then tangential flow filtration (TFF) was performed to remove the ethanol component in the solution. Then, it was concentrated until the mRNA concentration in the system reached 100 μg / ml, and lipid nanoparticles containing RNA encoding IL-12 polypeptide and RNA encoding IL-7 polypeptide were obtained.

[0200] Example 17 In this example, a method for preparing lipid nanoparticles encapsulating together DNAs encoding two kinds of polypeptides, IL-12 p35 and p40 subunits and IL-7 polypeptide, which were respectively incorporated into two different plasmids, was provided. The lipid component of the lipid nanoparticles contained 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG in mol%.

[0201] The specific preparation method was as follows.

[0202] (a) A DNA plasmid encoding IL-12 p35 and p40 subunit polypeptides and a DNA plasmid encoding IL-7 polypeptide were dissolved in a citrate buffer at pH 4 at a mass ratio of 1:1, and the concentration was adjusted to 0.1 mg / ml to obtain an aqueous phase.

[0203] (b) Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG were dissolved in absolute ethanol according to the compounding amounts, and the concentration of the lipid component in the organic phase was adjusted to 6 mg / mL to obtain an organic phase.

[0204] (c) The aqueous phase of step (a) and the organic phase of step (b) were mixed at a volume ratio of 1:3 using a microfluidics device at a flow rate of 12 mL / min. The mixture was immediately diluted 100-fold with a PBS solution at pH 7.4, and then tangential flow filtration (TFF) was performed to remove the ethanol component in the solution. Thereafter, it was concentrated until the mRNA concentration in the system reached 100 μg / ml, and lipid nanoparticles containing a DNA plasmid encoding IL-12 polypeptide and a DNA plasmid encoding IL-7 polypeptide were obtained.

[0205] Example 18 In this example, the effects of combinations of mRNAs encoding different polypeptides on the tumor suppression rate were examined. Each combination included mRNAs encoding two types of polypeptides. Here, the mRNA mixtures of groups G1 to G5 were prepared according to the method prepared in Example 15.

[0206] Six groups of experiments were conducted using the above mouse CT26 tumor model as an experimental model, and the number of mice in each group was six.

[0207] Group F1 was administered a mixture of luciferase mRNA at a dose of 0.06 mpk.

[0208] Group F2 was a mixture of mRNAs encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14) at a dose of 0.04 mpk per mouse.

[0209] Group F3 was a mixture consisting of mRNAs encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14) and mRNA encoding mouse-derived IL 7 (the nucleotide sequence is shown in SEQ ID NO.15) at a dose of IL-12 0.02 mpk per mouse + IL 7 0.02 mpk per mouse.

[0210] Group F4 was a mixture consisting of mRNAs encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14) and mRNA encoding mouse-derived IL15 (the nucleotide sequence is shown in SEQ ID NO.11) at a dose of IL-12 0.02 mpk per mouse + IL15 0.02 mpk per mouse.

[0211] The F5 group is a mixture consisting of mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14) and mRNA encoding mouse-derived IL2 (the nucleotide sequence is shown in SEQ ID NO.12), and the dosage was IL-12 0.02 mpk / mouse + IL2 0.02 mpk / mouse.

[0212] The F6 group was a PD-1 antibody, and the dosage was 10 mpk / mouse.

[0213] The administration frequency of the mRNA mixture was once a week, the administration period was 3 weeks, and the administration mode of the 6 groups of mice was all in-situ injection. 21 days after grouping was set as the experimental end point, and the effects of the 6 groups of experiments on tumors were tested.

[0214] Verified by the above calculation method, at the experimental end point, the relative tumor growth inhibition rate (TGI TV ) of the PD-1 antibody (F6 group) was 76.22%, the relative tumor growth inhibition rate (TGI TV ) of IL-12 (F2 group) was 32.66%, the relative tumor growth inhibition rate (TGI TV ) of IL-12 + IL7 (F3 group) was 54.38%, the relative tumor growth inhibition rate (TGI TV ) of IL-12 + IL15 (F4 group) was 49.70%, and the relative tumor growth inhibition rate (TGI TV ) of IL-12 + IL2 (F5 group) was -3.36%. The results of the change curves of the tumor volume of each experimental group according to the number of injection days are shown in Figure 8, and the changes in the tumor volume of each mouse in each experimental group are shown in Figure 9.

[0215] Example 19 After an LNP formulation containing two components of IL-12 + IL-7 was injected, this example was provided to examine whether mice with tumor regression could produce immune memory. In this example, mice with tumor regression were selected, and on the 47th day after the first administration (IL-12 + IL7 each 0.04 mpk), mouse colon cancer cells CT26 (5×10 5Re-inoculated (100 μL / mouse), and after re-inoculation with the re-tumor cells, the results of observing the tumor size on the 61st, 68th, 71st, 75th, and 77th days after the first administration are shown in the figure.

[0216] G1 consisted of 6 mice that had not been injected with the two components of IL-12 + IL-7, and G2 consisted of 2 mice that had been injected with the two components of mouse-derived IL-12 (nucleotide sequence shown in SEQ ID NO. 14) + mouse-derived IL-7 (nucleotide sequence shown in SEQ ID NO. 13), and the tumors had regressed.

[0217] From the results, 1) The tumor volume of G1 mice that had not been completely injected with the two components of IL-12 + IL-7 reached 462.44 ± 86.92 mm 3 by the end of the experiment. 2) It was shown that in G2 mice in which the tumors had regressed and the tumor cells were re-inoculated, no tumor growth was observed until the end of the test.

[0218] From the above results, it was revealed that injecting the two components of IL-12 + IL-7 had the effect of shrinking tumors, and after the tumors had regressed and the tumor cells were re-inoculated, it was also possible to have the effect of suppressing tumor growth. It was also clarified that long-term immune memory could be formed in the bodies of animals after injecting IL-12 + IL-7. The graph of the change in tumor volume of each experimental group is shown in Figure 10.

[0219] Example 20 In this example, the effect of a combination of mRNAs encoding different mouse-derived polypeptides on the tumor suppression rate was examined. Here, the mRNA mixtures of groups G1 to G8 were prepared according to the methods prepared in Example 8 or Example 15.

[0220] Nine groups of experiments were conducted using the above mouse CT26 tumor model as the experimental model, and the number of mice in each group was 6.

[0221] Group G1 was administered luciferase mRNA at a dose of 0.06 mpk.

[0222] Group G2 was mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14), and the dosage was 0.02 mpk / mouse.

[0223] Group G3 was mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14), and the dosage was 0.04 mpk / mouse.

[0224] Group G4 was a mixture of mRNAs encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14), and the dosage was 0.08 mpk / mouse.

[0225] Group G5 was a mixture consisting of mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14) and mRNA encoding mouse-derived IL7 (the nucleotide sequence is shown in SEQ ID NO.15), and the dosage was IL-12 0.02 mpk / mouse + IL7 0.02 mpk / mouse.

[0226] Group G6 was a mixture consisting of mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14), mRNA encoding mouse-derived IL7 (the nucleotide sequence is shown in SEQ ID NO.15), and mRNA encoding mouse-derived IFN-α (the nucleotide sequence is shown in SEQ ID NO.13), and the dosage was IL-12 0.02 mpk / mouse + IL7 0.02 mpk / mouse + IFN-α 0.02 mpk / mouse.

[0227] The G7 group is a mixture consisting of mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14), mRNA encoding mouse-derived IL7 (the nucleotide sequence is shown in SEQ ID NO.15), and mRNA encoding mouse-derived IL15 (the nucleotide sequence is shown in SEQ ID NO.11). The dosage was IL-12 0.02 mpk / mouse + IL7 0.02 mpk / mouse + IL15 0.02 mpk / mouse.

[0228] The G8 group is a mixture consisting of mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.14), mRNA encoding mouse-derived IL7 (the nucleotide sequence is shown in SEQ ID NO.15), and mRNA encoding mouse-derived IL2 (the nucleotide sequence is shown in SEQ ID NO.12). The dosage was IL-12 0.02 mpk / mouse + IL7 0.02 mpk / mouse + IL2 0.02 mpk / mouse.

[0229] The G9 group is a PD-1 antibody, and the dosage was 10 mpk.

[0230] The administration frequency of the mRNA mixture was once a week, the administration period was 3 weeks, and the administration method for all 9 groups of mice was in-situ injection. 21 days after grouping was set as the experimental end point, and the effects of the experiments on the 9 groups on tumors were tested.

[0231] When verified by the above calculation method, at the experimental end point, the relative tumor growth inhibition rate (TGI TV ) of the PD-1 antibody (G9 group) was 76.22%, and the relative tumor growth inhibition rate (TGI TV ) of IL-12 + IL7 + IFN-α (G6 group) was 72.27%. The relative tumor growth inhibition rates (TGI TV ) of IL-12 + IL7 (G5 group), G4 group, and IL-12 + IL7 + IL15 (G8 group) were 54.38%, 54.41%, and 56.22% respectively. The relative tumor growth inhibition rates (TGI TV) were all less than 40%. The relative tumor growth inhibition rate (TGI TV ) curves of each experimental group are shown in Fig. 11, the results of the change curves of the tumor volume of each experimental group according to the number of injection days are shown in Fig. 12, and the changes in the tumor volume of each mouse in each experimental group are shown in Figs. 13A and 13B.

[0232] Example 21 In this example, the effect of a combination of mRNAs encoding different mouse-derived polypeptides on the tumor growth inhibition rate was examined. Here, the mRNA mixtures of groups F3 to F6 were prepared according to the method prepared in Example 15.

[0233] Six groups of experiments were carried out using the above mouse CT26 tumor model as an experimental model, and the number of mice in each group was 6.

[0234] Group F1 was administered with physiological saline.

[0235] Group F2 was mPD1Ab, and the dosage was 10 mpk.

[0236] Group F3 was mRNA encoding mouse-derived IL7 (the nucleotide sequence is shown in SEQ ID NO. 15), and the dosage was 1.2 mpk / mouse.

[0237] Group F4 was mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO. 14), and the dosage was 1.2 mpk / mouse.

[0238] Group F5 was mRNA encoding mouse-derived IFN-α (the nucleotide sequence is shown in SEQ ID NO. 13), and the dosage was 1.2 mpk / mouse.

[0239] Group F6 is a mixture consisting of mRNA encoding mouse-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO. 14), mRNA encoding mouse-derived IL7 (the nucleotide sequence is shown in SEQ ID NO. 15), and mRNA encoding mouse-derived IFN-α (the nucleotide sequence is shown in SEQ ID NO. 13), and the dosage was IL-12 1.2 mpk / mouse + IL7 1.2 mpk / mouse + IFN-α 1.2 mpk / mouse.

[0240] The administration frequency of the mRNA mixture was once a week, the administration period was 3 weeks, and the administration mode for all 6 groups of mice was in-situ injection. The experiment endpoint was set at 20 days after grouping, and the effects of the 6 groups of experiments on tumors were tested.

[0241] Verified by the above calculation method, at the experiment endpoint, the relative tumor growth inhibition rate (TGI TV ) of mPD1Ab (Group F2) was 41.49%, the relative tumor growth inhibition rate (TGI TV ) of IL7 (Group F3) was 9.32%, the relative tumor growth inhibition rate (TGI TV ) of IL-12 (Group F4) was 95.01%, the relative tumor growth inhibition rate (TGI TV ) of IFN-α (Group F5) was 55.88%, and the relative tumor growth inhibition rate (TGI TV ) of IL-12 + IL7 + IFN-α (Group F6) was 94.78%. The results of the change curves of the tumor volumes of each experimental group according to the number of injection days are shown in Figure 14.

[0242] Example 22 In this example, the influence of the difference in dosage on the tumor suppression effect was examined.

[0243] Using the above mouse MDA-MB-231 tumor model as the experimental model, on the 16th day after construction (14.8 weeks after immune reconstitution), 30 humanized tumor-bearing mice were selected and randomly divided into 7 groups of 6 mice each based on tumor volume. The day of grouping was designated as D0, and administration was started on the day of grouping, that is, D0. The remaining mice after grouping were euthanized.

[0244] Dosage plan for group G1: A mixture of luciferase mRNA, with a dosage of 0.06 mpk.

[0245] Dosage plan for group G2: mRNA encoding human-derived IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.19), with a dosage of 0.04 mpk per animal.

[0246] Dosage plan for group G3: A mixture consisting of mRNA encoding human-derived IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.19), mRNA encoding human-derived IL-7 (nucleotide sequence shown in SEQ ID No.22), and mRNA encoding human-derived IFN-α (nucleotide sequence shown in SEQ ID NO.26). The weight ratio of the three types of RNA in the mixture is 1:1:1, and the dosage was 0.022 mpk per animal.

[0247] Dosage plan for group G4: A mixture consisting of mRNA encoding human-derived IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.19), mRNA encoding human-derived IL-7 (nucleotide sequence shown in SEQ ID NO.22), and mRNA encoding human-derived IFN-α (nucleotide sequence shown in SEQ ID NO.26). The weight ratio of the three types of RNA in the mixture is 1:1:1, and the dosage was 0.067 mpk per animal.

[0248] Dosage plan for group G5: A mixture consisting of mRNA encoding human-derived IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.19), mRNA encoding human-derived IL-7 (nucleotide sequence shown in SEQ ID NO.22), and mRNA encoding human-derived IFN-α (nucleotide sequence shown in SEQ ID NO.26). The weight ratio of the three types of RNA in the mixture is 1:1:1, and the dosage was 0.2 mpk per animal.

[0249] Dosing regimen for group G6: 10 mpk of tesentriq (positive drug). The changes in tumor volume of mice in G1 - G6 are shown in Figure 15.

[0250] According to the statistical analysis of tumor volume data at the end of drug withdrawal, compared with the control group, IL - 12 in group G2 (TGI TV = 35.67%) could significantly inhibit tumor growth (P < 0.05*), the low dose in group G3 (TGI TV = 58.50%), group G4 (TGI TV = 61.39%), and group G5 (TGI TV = 82.34%) could all significantly inhibit tumor growth (P < 0.05*).

[0251] In this study, the pharmacodynamic effects of different doses of test subject mRNA triple - component mixtures and the positive drug tesentriq were evaluated in a huHSC - NCG - hIL15 mouse subcutaneous - loaded MDA - MB - 231 breast cancer tumor model. From the above experimental data, in the current test system, the low, medium, and high doses of test subject mRNA triple - component mixtures showed significant tumor - suppressing effects on tumor volume compared with the control group G1.

[0252] Example 23 Experimental method: In this example, the effect of a mixture of mRNAs encoding polypeptides prepared by different processes on the tumor suppression rate was investigated. Here, the mRNA mixture of group T1 was prepared according to the method prepared in Example 12, the mRNA mixture of group T2 was prepared according to the method prepared in Example 16, and the mRNA mixtures of group T3 and group T4 were prepared according to the method prepared in Example 15.

[0253] Using the above mouse MDA - MB - 231 tumor model as the experimental model, four groups of experiments were conducted, and the number of mice in each group was 6.

[0254] Group 2.1 (T1) is an mRNA encoding a fusion protein of human-derived IL-12 and humanized IL-7 (the nucleotide sequences of the open reading frames are shown in SEQ ID NO.19 and SEQ ID NO.22), and the dosage was 0.04 mpk.

[0255] Group 2.2 (T2) is a mixture of an mRNA encoding human-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.19) and an mRNA encoding human-derived IL-7 (the nucleotide sequence is shown in SEQ ID NO.22). The dosage was 0.02 mpk / mouse for IL-12 mRNA and 0.02 mpk / mouse for IL-7 mRNA.

[0256] Group 2.3 (T3) is a mixture consisting of an mRNA encoding human-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.19) and an mRNA encoding human-derived IL-7 (the nucleotide sequence is shown in SEQ ID NO.22). The dosage was 0.02 mpk / mouse for IL-12 + 0.02 mpk / mouse for IL-7.

[0257] Group 2.4 (T4) was administered luciferase mRNA, and the dosage was 0.48 mpk.

[0258] The administration frequency of the mRNA mixture was once a week, the administration period was 3 weeks, and the administration method for all 6 groups of mice was in-situ injection. 33 days after grouping was set as the experimental end point, and the effects of the 6 groups of experiments on tumors were tested.

[0259] When verified by the above calculation method, at the experimental end point, the relative tumor growth inhibition rate (TGI TV ) of the T1 group was 53.21%, the relative tumor growth inhibition rate (TGI TV ) of the T2 group was 54.78%, and the relative tumor growth inhibition rate (TGI TV ) of the T3 group was 54.34%.

[0260] Example 24 Experimental method: In this example, the effect of combinations of mRNAs encoding different polypeptides on the tumor suppression rate was examined. Here, the mRNA mixtures of group P2, group P3, and group P4 were prepared according to the method prepared in Example 15.

[0261] Four groups of experiments were conducted using the above mouse MDA-MB-231 tumor model as the experimental model, and the number of mice in each group was 6.

[0262] Group P1 was administered a mixture of luciferase mRNA at a dose of 0.48 mpk.

[0263] Group P2 is a mixture consisting of mRNA encoding human-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.19) and mRNA encoding human-derived IL-7 (the nucleotide sequence is shown in SEQ ID NO.22), and the dose was IL-12 0.02 mpk / mouse + IL-7 0.02 mpk / mouse.

[0264] Group P3 is a mixture consisting of mRNA encoding human-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.19) and mRNA encoding human-derived IL-7 (the nucleotide sequence is shown in SEQ ID NO.23), and the dose was IL-12 0.02 mpk / mouse + IL-7 0.02 mpk / mouse.

[0265] Group P4 is a mixture consisting of mRNA encoding human-derived IL-12 p35 and p40 subunits (the nucleotide sequence is shown in SEQ ID NO.19) and mRNA encoding human-derived IL-7 (the nucleotide sequence is shown in SEQ ID NO.24), and the dose was IL-12 0.024 mpk / mouse + IL-7 0.024 mpk / mouse.

[0266] The administration frequency of the mRNA mixture was once a week, the administration period was 3 weeks, and the administration mode for all 5 groups of mice was in-situ injection. The experiment endpoint was set at 33 days after grouping, and the effects of the 5 groups of experiments on tumors were tested.

[0267] When verified by the above calculation method, at the experiment endpoint, the relative tumor growth inhibition rate (TGI TV ) of group P2 was 54.38%, the relative tumor growth inhibition rate (TGI TV ) of group P3 was 50.23%, and the relative tumor growth inhibition rate (TGI TV ) of group P4 was 55.01%.

[0268] This disclosure shows that when any of the 3-segment sequences of IL-7 mRNA is adopted for the ORF of IL-7 mRNA in IL-12 + IL-7 and the dosage is adjusted based on the IL-7 mRNA expression level of each sequence, it does not affect the effects such as tumor regression and relative tumor growth inhibition rate (TGI TV ); and when any of the 3-segment sequences of IL-12 mRNA (shown in SEQ ID NO.19 - 21) is adopted for the ORF of IL-12 mRNA in IL-12 + IL-7 and the dosage is adjusted based on the IL-12 expression level of each sequence, it does not affect the effects such as tumor regression and relative tumor growth inhibition rate (TGI TV ).

[0269] Example 25 In this example, a pharmaceutical composition containing the following components was provided.

Table 4

[0270] Finally, it should be noted that each of the above embodiments is used only for explaining the technical aspects of the present disclosure and is not a limitation thereof. Although the present disclosure has been described in detail with reference to each of the above embodiments, those skilled in the art can modify the technical aspects described in each of the above embodiments or equivalently replace some or all of the technical features thereof. It should be understood that these modifications or replacements do not deviate from the essence of the corresponding technical aspects from the scope of the technical aspects of each embodiment of the present disclosure.

Industrial Applicability

[0271] The nucleic acid molecule or nucleic acid molecule mixture mainly composed of the nucleic acid molecule fragment encoding the IL-7 protein provided by the present disclosure and the nucleic acid molecule fragment encoding the p35 and p40 subunits of interleukin IL-12 can generally activate various immune cell activities and achieve effective treatment for solid tumors. The present disclosure also provides nucleic acid molecules in different combined forms containing the above nucleic acid molecule fragments, and the combined forms include the fusion of different nucleic acid molecule fragments and the formation of a composition by different nucleic acid molecule fragments in a free form. It has been verified that the two types of nucleic acid molecule fragments provided by the present disclosure can show an effective therapeutic effect on solid tumors either by combining in a free form or by preparing as a fusion nucleic acid molecule. The present disclosure further uses an aptamer to complex with the above nucleic acid molecule composition or fusion nucleic acid molecule to obtain a nucleic acid molecule drug, and provides a corresponding preparation method, thus alleviating the urgent need for drugs for current solid tumor treatment.

Claims

**Claim 1** A therapeutic nucleic acid molecule or a mixture of nucleic acid molecules, wherein the nucleic acid molecule comprises a nucleic acid fragment (A) encoding an IL-7 protein and a nucleic acid fragment (B) encoding the p35 and p40 subunits of interleukin IL-12. A therapeutic nucleic acid molecule or a mixture of nucleic acid molecules, characterized in that it comprises. **Claim 2** Further comprising a nucleic acid fragment (C), wherein the nucleic acid fragment (C) comprises a nucleic acid fragment encoding at least one protein among IFN-α, IFN-β, IFN-γ, GM-CSF, IL-15 and IL-2, Preferably, the nucleic acid fragment (C) encodes IFN-α, Preferably, the amino acid sequence of IL-7 encoded by the nucleic acid fragment (A) is shown in SEQ ID NO. 42, or comprises an amino acid sequence having at least 80% identity with SEQ ID NO. 42, Preferably, the nucleotide sequence of the nucleic acid fragment (A) is selected from any of SEQ ID NOs. 22-24 and SEQ ID NOs. 47-49, or any of nucleotide sequences having at least 70% identity with SEQ ID NOs. 22-24 and SEQ ID NOs. 47-49, Preferably, the amino acid sequence of the p35 subunit of IL-12 encoded by the nucleic acid fragment (B) is shown in SEQ ID NO. 39, or comprises an amino acid sequence having at least 80% identity with SEQ ID NO. 39, Preferably, the amino acid sequence of the p40 subunit of IL-12 encoded by the nucleic acid fragment (B) is shown in SEQ ID NO. 40, or comprises an amino acid sequence having at least 80% identity with SEQ ID NO. 40, Preferably, the p35 subunit and the p40 subunit of IL-12 encoded by the nucleic acid fragment (B) are linked by a linker having the amino acid sequence shown in SEQ ID NO. 41, Preferably, the nucleotide sequence of the nucleic acid fragment (B) is selected from any of SEQ ID NOs. 19-21 and SEQ ID NOs. 44-46, or any of nucleotide sequences having at least 70% identity with SEQ ID NOs. 19-21 and SEQ ID NOs. 44-46, Preferably, the amino acid sequence of the IFN-α polypeptide encoded by the nucleic acid molecule fragment (C) is shown in SEQ ID NO. 43, or comprises an amino acid sequence having at least 80% identity with SEQ ID NO. 43, Preferably, the nucleotide sequence of the nucleic acid molecule fragment (C) is selected from any of SEQ ID NOs. 26-28 and SEQ ID NOs. 50-52, or any nucleotide sequence having at least 70% identity with SEQ ID NOs. 26-28 and SEQ ID NOs. 50-52. The therapeutic nucleic acid molecule or nucleic acid molecule mixture according to claim 1.

3. The nucleic acid molecule contains a DNA molecule and / or an RNA molecule, Preferably, the DNA molecule contains a linear DNA molecule and / or a circular DNA molecule, Preferably, the RNA molecule contains mRNA or circular RNA, Preferably, the 5'-end and / or 3'-end of the nucleic acid molecule fragment has a modifying group, Preferably, the nucleic acid molecule fragment is an mRNA fragment, and the modifying group at the 5'-end of the mRNA fragment is selected from ARCA, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3'OMeG)(5')ppp(5')(2'OMeG)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, mCAP, dmCAP, tmCAP or dmCAP, Preferably, the protective modifying group at the 3'-end of the mRNA fragment is poly(A), and the length of the poly(A) is 50-200, preferably 80-200, Preferably, the mRNA fragment further contains a 5'UTR, Preferably, the length of the 5'UTR is 10-200 nucleotides, preferably 15-100 nucleotides, Preferably, the 5'UTR contains a KOZAK sequence or a DNAH 2 5'UTR, Preferably, the nucleotide sequence of the KOZAK sequence is shown in SEQ ID.NO. 16, Preferably, the nucleotide sequence of the DNAH2 5'UTR is shown in SEQ ID.NO. 38, Preferably, the mRNA fragment further contains a 3'UTR, Preferably, the sequence of the 3'UTR is shown in SEQ ID.NOs. 1-10, Preferably, the mRNA comprises, in order from the 5'-end to the 3'-end, a 5'-cap, a 5'-UTR, an ORF, a 3'-UTR, and a 3'-poly(A) tail, and the therapeutic nucleic acid molecule or nucleic acid molecule mixture according to claim 1 or 2.

4. A first therapeutic nucleic acid molecule composition comprising the nucleic acid molecule mixture according to any one of claims 1 to 3, Preferably, the mass ratio of each free nucleic acid molecule fragment in the first therapeutic nucleic acid molecule composition is 10:1 to 1:10, and the first therapeutic nucleic acid molecule composition.

5. A therapeutic fusion nucleic acid molecule comprising the nucleic acid molecule according to any one of claims 1 to 3, Preferably, at least any two nucleic acid molecule fragments are linked by a linker, Preferably, the mass ratio of each nucleic acid molecule fragment in the therapeutic fusion nucleic acid molecule is 10:1 to 1:10, and the therapeutic fusion nucleic acid molecule.

6. A second therapeutic nucleic acid molecule composition comprising a combination of the first therapeutic nucleic acid molecule composition according to claim 4 and the therapeutic fusion nucleic acid molecule according to claim 5, Preferably, the mass ratio of each nucleic acid molecule fragment in the second therapeutic nucleic acid molecule composition is 10:1 to 1:10, and the second therapeutic nucleic acid molecule composition.

7. Use in the preparation of an anti-solid tumor agent or the evaluation of the efficacy of a solid tumor agent, Preferably, the solid tumor includes an epithelial tumor, Hodgkin's lymphoma, non-Hodgkin's lymphoma, prostate tumor, ovarian tumor, renal cell tumor, gastrointestinal tumor, liver tumor, colorectal tumor, hemangioma, mesothelioma, pancreatic tumor, breast tumor, sarcoma, lung tumor, colon tumor, brain tumor, melanoma, small cell lung tumor, neuroblastoma, testicular tumor, carcinoid tumor, adenocarcinoma tumor, glioma, seminoma, retinoblastoma or osteosarcoma, and the therapeutic nucleic acid molecule or nucleic acid molecule mixture according to any one of claims 1 to 3, the first therapeutic nucleic acid molecule composition according to claim 4, the therapeutic fusion nucleic acid molecule according to claim 5, or the use of the second therapeutic nucleic acid molecule composition according to claim 6.

8. A nucleic acid molecule drug for treating solid tumors, the nucleic acid molecule drug comprising a nucleic acid molecule component and a carrier encapsulating the nucleic acid molecule component, The nucleic acid molecular component is selected from the therapeutic nucleic acid molecule or nucleic acid molecule mixture according to any one of claims 1 to 3, the first therapeutic nucleic acid molecule composition according to claim 4, the therapeutic fusion nucleic acid molecule according to claim 5, or the second therapeutic nucleic acid molecule composition according to claim 6. Preferably, the mass ratio of each free nucleic acid molecule fragment is 10:1 to 1:

10. Preferably, the mass ratio of each nucleic acid molecule fragment in the fusion nucleic acid molecule is 10:1 to 1:

10. Preferably, the carrier contains liposome nanoparticles. Preferably, each free nucleic acid molecule fragment or fusion nucleic acid molecule in the nucleic acid molecular component is independently encapsulated by liposome nanoparticles together. Preferably, at least two free nucleic acid molecule fragments or fusion nucleic acid molecules are independently encapsulated by liposome nanoparticles together. Preferably, at least two free nucleic acid molecule fragments are encapsulated together by liposome nanoparticles. Preferably, at least one free nucleic acid molecule fragment and a fusion nucleic acid molecule are encapsulated together by liposome nanoparticles. Preferably, the liposome nanoparticles contain 20% to 50% of cationic lipid, 20% to 50% of DOPG, 5% to 20% of cholesterol, and 1% to 5% of PEG-DMG in mol%. Preferably, the liposome nanoparticles contain 50% of Dlin-MC3-DMA, 10% of DOPG, 38.5% of cholesterol, and 1.5% of PEG-DMG in mol%. Preferably, it further contains a therapeutic protein or a therapeutic chemical pharmaceutical component. Preferably, the therapeutic protein contains atezolizumab, and it is a nucleic acid molecule drug.

9. A method for preparing the nucleic acid molecule drug according to claim 8, wherein a free nucleic acid molecule fragment and / or a fusion nucleic acid molecule are dissolved in a buffer to obtain an aqueous phase, each component of the encapsulating carrier is weighed and dissolved in an organic solvent to obtain an organic phase, the aqueous phase and the organic phase are mixed, and the organic phase is removed to obtain the nucleic acid molecule drug. Preferably, the volume ratio of the aqueous phase to the organic phase is 1:2 to 4, and more preferably 1:

3. Preferably, the buffer contains a citrate buffer or sodium acetate, and more preferably a citrate buffer. Preferably, the pH of the buffer is 3 to 7, and more preferably 4. Preferably, the concentration of the free nucleic acid molecule fragment or the fusion nucleic acid molecule in the aqueous phase is 0.05 mg / mL to 0.5 mg / mL, more preferably 0.1 mg / mL. Preferably, the organic solvent is selected from C1-C4 lower carbon alcohols, more preferably absolute ethanol. Preferably, the concentration of the lipid component in the organic phase is 5 mg / mL to 7 mg / mL, more preferably 6 mg / mL. Preferably, the aqueous phase and the organic phase are mixed using microfluidics, and the organic solvent is filtered using a tangential flow. Preferably, the flow rate of the microfluidics exceeds 3 mL / min, more preferably 12 mL / min. Preferably, after mixing, the preparation method further includes a concentration step so that the final concentration of the free nucleic acid molecule fragment and / or the fusion nucleic acid molecule is 50 μg / mL to 200 μg / mL, more preferably 100 μg / mL.

10. A pharmaceutical composition comprising the nucleic acid molecule drug according to claim 8 or the nucleic acid molecule drug obtained by the preparation method according to claim 9, Preferably, the pharmaceutical composition further comprises a protein-based drug selected from at least one of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-CTLA-4 antibody, an anti-CD20 antibody, an anti-Her2 antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-VEGFR antibody, an anti-EGFR antibody, an anti-RANKL antibody, an anti-CD30 antibody, an anti-VEGFR2 antibody, an anti-GD2 antibody, an anti-CD38 antibody, an anti-CD22 antibody, and an anti-CD33 antibody. Preferably, the pharmaceutical composition further comprises at least one of atezolizumab, nivolumab, pembrolizumab, pidilizumab, durvalumab, avelumab, and ipilimumab.

Images