Conferring cytoplasmic male sterility
The method of haploid induction using a CMS heterozygous plant with a CENH3 knockout mutation addresses the inefficiencies of traditional methods for developing homozygous inbred lines in corn, enabling rapid and cost-effective conversion to CMS plants.
Patent Information
- Application Number
- JP2024568280
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-19
- Filing Date
- 2023-05-15
- Publication Date
- 2025-06-05
AI Technical Summary
The existing methods for developing homozygous inbred lines in corn are time-consuming and expensive, requiring multiple generations of selection and self-pollination.
A method involving haploid induction using a CMS heterozygous plant (CHIP) with a CENH3 knockout mutation, crossed with a normal cytotype plant (DIP) to generate haploid progeny with CMS-C cytotype, which can then be doubled to produce homozygous lines.
This method allows for the conversion of a maize line into a CMS plant in one cross, eliminating the need for trait introgression and significantly reducing the time and cost of developing homozygous inbred lines.
Smart Images

Figure 2025517365000001 
Figure 2025517365000002 
Figure 2025517365000003
Abstract
Description
[Technical field]
[0001] The subject matter disclosed herein generally relates to the field of plant breeding. More specifically, the subject matter relates to a method for imparting CMS (cytoplasmic male sterility) to a plant line. Furthermore, the subject matter disclosed herein relates to a specific characteristic in CMS-derived line (e.g., CENH3 editing) used in conversion method. In addition, the subject matter generally relates to haploid induction.
[0002] Sequence Listing This application is accompanied by a sequence listing entitled 82657-WO-REG-ORG-P-1.xml, created on May 5, 2023, which is approximately 187 kilobytes in size. This sequence listing is incorporated herein by reference in its entirety. This sequence listing has been submitted herewith via EFS-Web and complies with 37 C.F.R. § 1.824(a)(2)-(6) and (b). [Background technology]
[0003] Male sterile corn inbred lines can be utilized to avoid the need for detasseling in the production of corn hybrids, leading to significant cost savings. The trait called cytoplasmic male sterility (CMS) is a maternally inherited trait and is a useful tool for efficient production of hybrid seeds. Three major types of CMS have been identified (CMS-T, CMS-S, and CMS-C). A nuclear gene called restorer of fertility (Rf) can override the cytoplasmic male sterility effect. Lines carrying the Rf gene produce functional pollen even though they still have the CMS cytoplasm. The restorer loci Rf1 and Rf2 are known to suppress the CMS phenotype in CMS-T lines, while the Rf3 gene restores fertility in CMS-S lines. See Laughnan et al. Annu. Rev. Genet. 1983.17:27-48. The restorer locus of CMS-C, Rf4, was mapped to chromosome 8 reported by Sisco et al. In Crop Science Vol.31 No.5, p.1263-1266, 1991. Kohls et al. reported the fine mapping of Rf4 at the Maize Genetics Conference in 2010. A patent application published as WO2012047595, incorporated herein by reference, also reports the identification of genes and markers associated with Rf4. Breeders use CMS systems to generate hybrid seeds by developing female lines that have CMS cytoplasm but lack restorer genes and developing male lines that have the appropriate restorer genes. The F1 hybrid seeds produced by the female lines have CMS cytoplasm but produce fertile plants due to the action of the paternally contributed nuclear restorer genes. Cytotype C was identified as a desirable CMS system for maize because it is generally stable to environmental and genetic backgrounds.
[0004] Breeders cross inbred parent lines, one as male and one as female, to form hybrid seeds. The process of developing substantially homozygous inbred parent lines usually requires the selection of hybrid crosses and self-pollinating (self-fertilizing) them for many generations to become nearly homozygous. This process is time-consuming and expensive. To reduce the time to develop homozygous inbred lines in corn, rice, wheat, barley and other crops, breeders may choose to use haploid inducer lines to induce haploid seed production in the hybrid parents. The chromosomes of the haploid plants are then doubled, for example, by a chromosome doubling agent such as colchicine, to form doubled haploid homozygous lines. Haploid induction has been observed in many plant species, such as sorghum, barley, wheat and other grasses.
[0005] In maize, haploid induction (HI) has been linked to the MATRILINEAL, ig1, CENH3 and DMP genes. See generally WO 2017 / 087682, incorporated herein by reference; T. Kelliher, et al., MATRILINEAL, a sperm-specific phospholipase, triggers maize haploid induction, NATURE 542, 105-109 (2017); U.S. Pat. No. 7,439,416, incorporated herein by reference; M Pollacsek, Management of the ig gene for haploid induction in maize, ARGRONOMIE, 12:247-251 (1991); U.S. Pat. No. 8,618,354, incorporated herein by reference; A.B. Britt and S. Kuppu, Cenh3: An Emerging Player in Haploid Induction Technology, FRONT. PLANT SCI.7:357(2016)doi:10.3389 / fpls.2016.00357; and see also Chinese Patent No. 111763687, which is incorporated herein by reference. Haploid derivatives can be generated in various ways, for example, by genome editing. As disclosed herein, haploid derivatives can be generated, for example, by CENH3 mutation. CENH3 is a centromere-specific mutant of HISTONE3 (H3) and is required for kinetochore nucleation and spindle attachment in mitosis and meiosis.
[0006] In the presently disclosed subject matter, CMS-C type lines carrying the cenh3 mutation serve as haploid derivatives in the CMS transformation process. Summary of the Invention [Means for solving the problem]
[0007] A method for converting a maize line of normal cytotype into a cytoplasmic male sterile (CMS) plant is advantageous for saving the cost and time of hybrid seed production. The current industry standard is to use trait introgression to cross elite lines of a female heterosis pool into a CMS cytoplasm. Disclosed herein is a method for achieving this conversion into a CMS cytoplasm without introgression, but instead by a haploid induction process. This process converts the nuclear genome into a CMS cytoplasm 100% in one cross. In this method, a first plant (hereinafter referred to as "CHIP") is a CMS heterozygous for a knockout mutation of CENH3 in its nuclear genome (i.e., one allele of CENH3 is wild type; "CENH3+ / -") and is a paternal haploid derivative (i.e., capable of generating paternal haploids). Optionally, CHIP can contain restorers (e.g., Rf3, Rf4, Rf10, Rf11, etc.) in its nuclear genome, in which case it will self-pollinate despite having a CMS cytotype. Alternatively, CHIP can also contain non-restore alleles (e.g., rf3, rf4, rf10, rf11, rf12). In that case, CHIP is male sterile and requires a maintainer line to continue growing. The maintainer line is not CMS (i.e. has normal cytoplasm). In addition, any anthocyanin marker is homozygous in CHIP.
[0008] The second plant, referred to herein as a "DIP," is not a haploid derivative (i.e., homozygous wild type for CENH3 ("CENH3+ / +")), has a normal cytotype (i.e., is not cytoplasmic male sterile), and contains the desired nuclear genome converted into a CMS cytoplasm. The DIP is a pollen donor.
[0009] The CHIP is crossed with pollen from the DIP, and the progeny include diploid progeny ("F1s"), haploid progeny (containing only the nuclear genome of the DIP), and aneuploid progeny. Only haploid progeny are desired, and the haploid progeny contain (i) the haploid nuclear genome (i.e., the desired genome) of the DIP with one wild-type CENH3 allele ("CENH3+ / null"), and (ii) the CMS-C cytotype, (iii) further lacking a restorer, and optionally (iv) a visual marker.
[0010] If used, visual markers such as anthocyanin markers (e.g., R1-nj or R1-scm2) can be used to distinguish undesired diploid F1 progeny from desired haploid progeny. If used, the markers are present in the haploid derivative genome (i.e., CHIP) in the homozygous state. Aneuploids are distinguished from true haploid progeny using genetic markers of the derivative parent, i.e., all putative haploids that show female (derivative) parent markers (indicative of CHIP nuclear DNA) are disposed of as aneuploids. Alternatively, haploid progeny can be distinguished from diploids and aneuploids by sequencing, selectable markers, growth rate or ploidy level measurements. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0011] Brief description of the sequences in the sequence listing SEQ ID NO: 1 Nucleotide sequence of gRNA140 carried by LbCas12a RNP targeting the second exon of gene ID GRMZM2G158526 in biolistic bombardment of SYN-INBC34 inbred immature embryos of Example 1 and SYN-INBC34 x SYN-INBC34RS inbred immature embryos of Example 2.
[0012] SEQ ID NO:2 is the nucleotide sequence of a primer used for TaqMan assay 3895.
[0013] SEQ ID NO:3 is the nucleotide sequence of a primer used in TaqMan assay 3895
[0014] SEQ ID NO:4 is the nucleotide sequence of the probe used in TaqMan assay 3895.
[0015] SEQ ID NO:5 is a nucleotide sequence representing the 19 base pair deletion in cenh3.
[0016] SEQ ID NO:6 is a nucleotide sequence representing the 10 base pair deletion in cenh3.
[0017] SEQ ID NO:7 is a partial nucleotide sequence of wild-type cenh3 (GRMZM2G158526).
[0018] SEQ ID NO:8 is a partial nucleotide sequence of a 10 base pair deletion mutant (509A115A) of cenh3.
[0019] SEQ ID NO:9 is a partial nucleotide sequence of a 19 base pair deletion mutant (509A151A) of cenh3.
[0020] SEQ ID NO: 10 is a partial amino acid sequence of the cenh3 allele (GRMZM2G158526).
[0021] SEQ ID NO: 11 is a partial amino acid sequence of the predicted amino acid sequence of the KD (Kelly Dawe at the University of Georgia) cenh3 allele.
[0022] SEQ ID NO:12 is a partial amino acid sequence of a 10 base pair deleted cenh3 allele.
[0023] SEQ ID NO: 13 is a partial amino acid sequence of the cenh3 allele having a 19 base pair deletion splice variant a.
[0024] SEQ ID NO:14 is a partial amino acid sequence of the cenh3 allele having a 19 base pair deletion splice variant c.
[0025] SEQ ID NO:15 is a partial amino acid sequence of the cenh3 allele having a 19 base pair deletion splice variant b.
[0026] SEQ ID NO: 16 is a partial amino acid sequence of the cenh3 allele having a 19 base pair deletion splice variant d.
[0027] SEQ ID NO:17 is a partial amino acid sequence of the cenh3 allele having the 19 base pair deletion splice variant e.
[0028] SEQ ID NO: 18 is a partial amino acid sequence of the cenh3 allele having a 10 base pair deletion splice variant a.
[0029] SEQ ID NO:19 is a partial amino acid sequence of the cenh3 allele having a 10 base pair deletion splice variant b.
[0030] SEQ ID NO:20 is a partial amino acid sequence of the cenh3 allele having a 10 base pair deletion splice variant c.
[0031] SEQ ID NO:21 is a partial amino acid sequence of the cenh3 allele having a 10 base pair deletion splice variant d.
[0032] SEQ ID NO:22 is a partial amino acid sequence of the cenh3 allele having a 10 base pair deletion splice variant e.
[0033] SEQ ID NO:23 is the nucleotide sequence of the forward primer for assay SM0253EQ.
[0034] SEQ ID NO:24 is the nucleotide sequence of the reverse primer for assay SM0253EQ.
[0035] SEQ ID NO:25 is the nucleotide sequence of the probe for assay SM0253EQ.
[0036] SEQ ID NO:26 is the nucleotide sequence of the probe for assay SM0253EQ.
[0037] SEQ ID NO:27 is the nucleotide sequence of the target for assay SM0253EQ.
[0038] SEQ ID NO:28 is the nucleotide sequence of the forward primer for assay SM0093B.
[0039] SEQ ID NO:29 is the nucleotide sequence of the reverse primer for assay SM0093B.
[0040] SEQ ID NO:30 is the nucleotide sequence of the probe for assay SM0093B.
[0041] SEQ ID NO:31 is the nucleotide sequence of the probe for assay SM0093B.
[0042] SEQ ID NO:32 is the nucleotide sequence of the target for assay SM0093B.
[0043] SEQ ID NO:33 is the nucleotide sequence of the forward primer for assay SM0435A.
[0044] SEQ ID NO:34 is the nucleotide sequence of the reverse primer for assay SM0435A.
[0045] SEQ ID NO:35 is the nucleotide sequence of the probe for assay SM0435A.
[0046] SEQ ID NO:36 is the nucleotide sequence of the probe for assay SM0435A.
[0047] SEQ ID NO:37 is the nucleotide sequence of the target for assay SM0435A.
[0048] SEQ ID NO:38 is the nucleotide sequence of the forward primer for assay SM1071CQ.
[0049] SEQ ID NO:39 is the nucleotide sequence of the reverse primer for assay SM1071CQ.
[0050] SEQ ID NO:40 is the nucleotide sequence of the probe for assay SM1071CQ.
[0051] SEQ ID NO:41 is the nucleotide sequence of the probe for assay SM1071CQ.
[0052] SEQ ID NO:42 is the nucleotide sequence of the target for assay SM1071CQ.
[0053] SEQ ID NO:43 is the nucleotide sequence of the forward primer for assay SM1280CQ.
[0054] SEQ ID NO:44 is the nucleotide sequence of the reverse primer for assay SM1280CQ.
[0055] SEQ ID NO:45 is the nucleotide sequence of the probe for assay SM1280CQ.
[0056] SEQ ID NO:46 is the nucleotide sequence of the probe for assay SM1280CQ.
[0057] SEQ ID NO:47 is the nucleotide sequence of the target for assay SM1280CQ.
[0058] SEQ ID NO:48 is the nucleotide sequence of the forward primer for assay SM1447AQ.
[0059] SEQ ID NO:49 is the nucleotide sequence of the reverse primer for assay SM1447AQ.
[0060] SEQ ID NO:50 is the nucleotide sequence of the probe for assay SM1447AQ.
[0061] SEQ ID NO:51 is the nucleotide sequence of the probe for assay SM1447AQ.
[0062] SEQ ID NO:52 is the nucleotide sequence of the target for assay SM1447AQ.
[0063] SEQ ID NO:53 is the nucleotide sequence of the forward primer for assay SM1847AQ.
[0064] SEQ ID NO:54 is the nucleotide sequence of the reverse primer for assay SM1847AQ.
[0065] SEQ ID NO:55 is the nucleotide sequence of the probe for assay SM1847AQ.
[0066] SEQ ID NO:56 is the nucleotide sequence of the probe for assay SM1847AQ.
[0067] SEQ ID NO:57 is the nucleotide sequence of the target for assay SM1847AQ.
[0068] SEQ ID NO:58 is the nucleotide sequence of the forward primer for assay SM1286AQ.
[0069] SEQ ID NO:59 is the nucleotide sequence of the reverse primer for assay SM1286AQ.
[0070] SEQ ID NO:60 is the nucleotide sequence of the probe for assay SM1847AQ.
[0071] SEQ ID NO:61 is the nucleotide sequence of the probe for assay SM1847AQ.
[0072] SEQ ID NO:62 is the nucleotide sequence of the target for assay SM1286AQ.
[0073] SEQ ID NO:63 is the nucleotide sequence of the forward primer for assay SM2513.
[0074] SEQ ID NO:64 is the nucleotide sequence of the reverse primer for assay SM2513.
[0075] SEQ ID NO:65 is the nucleotide sequence of the probe for assay SM2513.
[0076] SEQ ID NO:66 is the nucleotide sequence of the probe for assay SM2513.
[0077] SEQ ID NO:67 is the nucleotide sequence of the target for assay SM2513.
[0078] SEQ ID NO:68 is the nucleotide sequence of the forward primer for assay SM2962.
[0079] SEQ ID NO:69 is the nucleotide sequence of the reverse primer for assay SM2962.
[0080] SEQ ID NO:70 is the nucleotide sequence of the probe for assay SM2962.
[0081] SEQ ID NO:71 is the nucleotide sequence of the probe for assay SM2962.
[0082] SEQ ID NO:72 is the nucleotide sequence of the target for assay SM2962.
[0083] SEQ ID NO:73 is the nucleotide sequence of the forward primer for assay SM2988.
[0084] SEQ ID NO:74 is the nucleotide sequence of the reverse primer for assay SM2988.
[0085] SEQ ID NO:75 is the nucleotide sequence of the probe for assay SM2988.
[0086] SEQ ID NO:76 is the nucleotide sequence of the probe for assay SM2988.
[0087] SEQ ID NO:77 is the nucleotide sequence of the target for assay SM2988.
[0088] SEQ ID NO:78 is the nucleotide sequence of the forward primer for assay SM3400.
[0089] SEQ ID NO:79 is the nucleotide sequence of the reverse primer for assay SM3400.
[0090] SEQ ID NO:80 is the nucleotide sequence of the probe for assay SM3400.
[0091] SEQ ID NO:81 is the nucleotide sequence of the probe for assay SM3400.
[0092] SEQ ID NO:82 is the nucleotide sequence of the target for assay SM3400.
[0093] SEQ ID NO:83 is the nucleotide sequence of the forward primer for assay SM3747.
[0094] SEQ ID NO:84 is the nucleotide sequence of the reverse primer for assay SM3747.
[0095] SEQ ID NO:85 is the nucleotide sequence of the probe for assay SM3747.
[0096] SEQ ID NO:86 is the nucleotide sequence of the probe for assay SM3747.
[0097] SEQ ID NO:87 is the nucleotide sequence of the target for assay SM3747.
[0098] SEQ ID NO:88 is the nucleotide sequence of the forward primer for assay SM4788.
[0099] SEQ ID NO:89 is the nucleotide sequence of the reverse primer for assay SM4788.
[0100] SEQ ID NO:90 is the nucleotide sequence of the probe for assay SM4788.
[0101] SEQ ID NO:91 is the nucleotide sequence of the probe for assay SM4788.
[0102] SEQ ID NO:92 is the nucleotide sequence of the target for assay SM4788.
[0103] SEQ ID NO:93 is the nucleotide sequence of the forward primer for assay SM5515.
[0104] SEQ ID NO:94 is the nucleotide sequence of the reverse primer for assay SM5515.
[0105] SEQ ID NO:95 is the nucleotide sequence of the probe for assay SM5515.
[0106] SEQ ID NO:96 is the nucleotide sequence of the probe for assay SM5515.
[0107] SEQ ID NO:97 is the nucleotide sequence of the target for assay SM5515.
[0108] SEQ ID NOs: 98-100 are the nucleotide sequences of primers and probes for assay PM1901 (wild-type ZmCENH3).
[0109] SEQ ID NOs:101-103 are the nucleotide sequences of primers and probes for assay PM1909 (mutation in ZmCENH3 containing a 10 bp deletion).
[0110] SEQ ID NOs:101, 102 and 104 are the nucleotide sequences of primers and probes for assay PM1913 (mutation in ZmCENH3 containing a 19 bp deletion).
[0111] SEQ ID NOs:105-108 are the nucleotide sequences of primers and probes for assay SM0576CQ.
[0112] SEQ ID NOs:109-112 are the nucleotide sequences of primers and probes for assay SM0956IQ.
[0113] SEQ ID NOs:113-116 are the nucleotide sequences of primers and probes for assay SM2669.
[0114] SEQ ID NOs:117-120 are the nucleotide sequences of primers and probes for assay SM2670.
[0115] SEQ ID NOs:121-124 are the nucleotide sequences of primers and probes for assay SM2915.
[0116] SEQ ID NOs:125-128 are the nucleotide sequences of primers and probes for assay SM2916.
[0117] SEQ ID NOs:129-132 are the nucleotide sequences of primers and probes for assay SM6623.
[0118] SEQ ID NOs:133-136 are the nucleotide sequences of primers and probes for assay SM8040.
[0119] SEQ ID NOs:137-140 are the nucleotide sequences of primers and probes for assay SM8091.
[0120] SEQ ID NOs:141-144 are the nucleotide sequences of primers and probes for assay SM2918.
[0121] SEQ ID NOs:145-148 are the nucleotide sequences of primers and probes for assay SM4813.
[0122] SEQ ID NOs:149-152 are the nucleotide sequences of primers and probes for assay SM2914.
[0123] SEQ ID NOs:153-156 are the nucleotide sequences of primers and probes for assay SM4812.
[0124] SEQ ID NOs:157-160 are the nucleotide sequences of primers and probes for assay SM0954BQ.
[0125] SEQ ID NOs:161-164 are the nucleotide sequences of primers and probes for assay SM6568.
[0126] SEQ ID NOs:165-168 are the nucleotide sequences of primers and probes for assay SM0953BQ.
[0127] SEQ ID NOs:169-172 are the nucleotide sequences of primers and probes for assay SM7200.
[0128] SEQ ID NOs:173-176 are the nucleotide sequences of primers and probes for assay SM5665.
[0129] SEQ ID NO: 177 is the partial nucleotide sequence of a 19 base pair deletion mutant of cenh3 in Table 1 (509A150A).
[0130] definition All technical and scientific terms used herein are intended to have the same meaning as commonly understood by those skilled in the art, unless otherwise defined below. References to technology used herein are intended to refer to technology commonly understood in the art, including variations in technology and / or equivalent technical substitutions that would be apparent to those skilled in the art. While the following terms are believed to be fully understood by those skilled in the art, the following definitions are set forth to facilitate the description of the subject matter disclosed herein.
[0131] In accordance with long-standing patent law convention, the terms "a," "an," and "the" refer to "one or more" when used in this application, including the claims. For example, the phrase "a cell" refers to one or more cells, and in certain embodiments may refer to a tissue and / or an organ. Similarly, the phrase "at least one," when used herein to refer to an entity, refers to, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more of the applicable entity, including, but not limited to, all integer values from 1 to 100, as well as integer values greater than 100.
[0132] Unless otherwise indicated, all numerical values expressing quantities of ingredients, reaction conditions, and the like used in the specification and claims are to be understood in each instance to be modified by the term "about". As used herein, the term "about", when referring to a measurable value, such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of the particular amount, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1%, such variations being appropriate for carrying out the disclosed methods and / or using the disclosed compositions, nucleic acids, polypeptides, and the like. Thus, unless indicated to the contrary, the numerical parameters set forth in the specification and appended claims are approximations that may vary depending upon the desired properties sought to be obtained by the subject matter disclosed herein.
[0133] As used herein, the term "allele" refers to a variant or alternative sequence form at a locus. In diploids, a single allele is inherited separately from each parent at each locus to a progeny individual. Although the two alleles at a given locus present in a diploid organism occupy corresponding positions in a pair of homologous chromosomes, those skilled in the art will understand that the alleles in any particular individual do not necessarily represent all of the alleles present in a species.
[0134] As used herein, the term "amplification" refers to constructing multiple copies of a nucleic acid molecule or multiple copies complementary to a nucleic acid molecule using at least one of the nucleic acid molecules as a template. Amplification systems include the polymerase chain reaction (PCR) system, the ligase chain reaction (LCR) system, nucleic acid sequence-based amplification (NASBA, Cangene, Mississauga, Ontario), the Q-beta replicase system, the transcription-based amplification system (TAS) and strand displacement amplification (SDA). See, for example, Diagnostic Molecular Microbiology: Principles and Applications, PERSING et al., Ed., American Society for Microbiology, Washington, DC (1993). The product of amplification is called an "amplicon."
[0135] As used herein, when used in connection with a list of entities, the term "and / or" refers to the entities present singly or in combination. Thus, for example, the phrase "A, B, C and / or D" includes not only A, B, C and D individually, but also all combinations and subcombinations of A, B, C and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD and BCD). In some embodiments, one or more of the elements referred to by "and / or" may also be present individually in single or multiple occurrences in combinations and / or subcombinations.
[0136] The term "aneuploid" refers to a plant that has an abnormal number of chromosomes in its haploid set.
[0137] As used herein, the term "backcross" or "backcrossed" is understood within the present invention to refer to a process in which hybrid progeny are repeatedly backcrossed to one of the parents.
[0138] The terms "irradiate," "irradiation," and "biolistic irradiation" refer to the process of accelerating particles toward a target biological sample (e.g., cells, tissues, etc.) to damage cell membranes of cells in the target biological sample and / or to cause particles to penetrate the target biological sample. Methods of biolistic irradiation are known in the art (e.g., U.S. Pat. No. 5,584,807) and commercially available (e.g., helium gas-driven accelerator (BioRad's PDS-1000 / He™). The biolistic PDS-1000 Gene Gun (BioRad, Hercules, Calif.) uses helium pressure to accelerate DNA-coated gold or tungsten microparticles toward target cells.
[0139] As used herein, the term "multiply" refers to the process of increasing the number of seeds.
[0140] As used herein, the term "cDNA" refers to a single- or double-stranded DNA that is complementary to and derived from mRNA.
[0141] As used herein, the term "CHIP" refers to one of the parents in the primary cross of the methodology of the present invention. This parent has a heterozygous cenh3 mutation (C) in its nuclear genome, is a paternal haploid derivative (HI), and is one of the parents (P) as described above. CHIP is female fertile and CMS male sterile. CHIP can optionally contain a homozygous restorer in its nuclear genome. CHIP can also optionally contain a homozygous anthocyanin marker in its nuclear genome.
[0142] The term "chromosome," as recognized in the art, is used herein to mean a self-replicating genetic structure within the cell nucleus which contains the cellular DNA and carries the linear arrangement of genes.
[0143] The term "comprising," which is synonymous with "comprising," "containing," and "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements and / or method steps. "Comprising" is a terminology that means that the specified elements and / or steps are present, but that other elements and / or steps may be added and still be included within the scope of the relevant subject matter.
[0144] As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specifically recited. When the phrase "consisting of" appears in a clause in the body of a claim rather than immediately following the preamble, it limits only the elements recited in that clause and does not exclude other elements from the claim as a whole.
[0145] As used herein, the phrase "consisting essentially of" limits the scope of the associated disclosure or claims to the particular materials and / or steps and methods that do not materially affect the basic and novel characteristics of the disclosed and / or claimed subject matter.
[0146] As used herein, the term "cytoplasmic exchange" refers to the exchange of cytoplasm from one line to another (e.g., the "Normal A" cytoplasm of a corn line is exchanged for another corn line that was originally "Normal B" cytoplasm).
[0147] As used herein, the term "DIP" refers to one of the parents in the primary cross of the methodology of the present invention. This parent contains the desired haploid nuclear genome (the "desired parent" or "DIP"). The DIP is self-pollinating (homozygous for wild-type CENH3) and has a normal cytotype.
[0148] As used herein, a plant referred to as "diploid" has two complete sets of chromosomes (2n; one set from each parent).
[0149] As used herein, the term "elite line" or "inbred line" refers to any line resulting from breeding and selection for superior agronomic performance. An elite line has stable genetics, i.e., is reasonably or nearly isogenic across its entire genome. Stated differently, an elite line is reasonably or nearly homozygous for all alleles in its genome.
[0150] As used herein, the term "expression", when used with respect to a polynucleotide such as a gene, an ORF or a portion thereof, or a transgene in a plant, refers to the process of converting the genetic information encoded in the gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) by "transcription" of the gene (i.e., by the enzymatic action of RNA polymerase), and, where applicable (e.g., if the gene codes for a protein), into a protein by "translation" of the mRNA. Gene expression can be regulated at many stages in the process. For example, in the case of an antisense or dsRNA construct, respectively, expression can refer to the transcription of only the antisense RNA or only the dsRNA. In embodiments, "expression" refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. "Expression" can also refer to the production of a protein.
[0151] As used herein, the term "gene" refers to a hereditary unit "genome" that occupies a specific location on a chromosome and contains a sequence of DNA that provides the genetic instructions for a particular characteristic or trait in an organism.
[0152] As used herein, the term "genotype" refers to the genetic constitution of a cell or organism. An individual's "genotype for a set of genetic markers" includes the particular alleles for one or more genetic marker loci present in the individual. As is known in the art, genotypes can be associated with single or multiple loci, regardless of whether the loci are related or unrelated and / or linked or unlinked. In some embodiments, an individual's genotype is associated with one or more genes that are related in that the one or more genes are involved in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in some embodiments, the genotype includes the sum of one or more alleles present at one or more loci of a quantitative trait within the individual. In some embodiments, the genotype is expressed in terms of haplotypes (defined herein below).
[0153] As used herein, the term "germplasm" refers to the totality of genotypes of a population or another population (e.g., a species). The term "germplasm" may also refer to plant material, e.g., a group of plants that serves as a repository for various alleles. The phrase "adapted germplasm" refers to plant material with proven genetic superiority for a given environment or geographic region, for example, whereas the phrases "non-adapted germplasm," "unprocessed germplasm," and "exotic germplasm" refer to plant material with unknown or unproven genetic value for a given environment or geographic region, for example, and thus the phrase "non-adapted germplasm" in some embodiments refers to plant material that is not part of an established breeding population and whose relationship to members of the established breeding population is unknown.
[0154] As used herein, a plant referred to as "haploid" has a single set of chromosomes (genome), and the reduced number of chromosomes (1n) in a haploid plant is equal to that of a gamete. As used herein, a plant referred to as "doubled haploid" is generated by doubling the haploid set of chromosomes (1n to 2n). A plant or seed obtained from a doubled haploid plant that has been selfed to any number of generations can still be identified as a doubled haploid plant. A doubled haploid plant is considered a homozygous plant. A plant is considered to be doubled haploid if it is fertile, even if the entire growing part of the plant does not consist of cells with two sets of chromosomes, i.e., a plant will be considered doubled haploid if it contains viable gametes, even if it is a chimera.
[0155] As used herein, "HaploidBC1" refers to the progeny of a haploid plant that has been pollinated with its recurrent parent to allow backcrossing to occur to the progeny. The HaploidBC1 progeny contains a diploid genome.
[0156] As used herein, haploid inductivity ratio ("HIR") means the number of viable haploid kernels relative to the total number of kernels after an ear is pollinated with haploid-inducing pollen.
[0157] As used herein, the term "heterologous" when used in reference to a gene or nucleic acid refers to a gene that encodes an element that is not present in its natural environment (i.e., altered by the hand of man). For example, a heterologous gene can include a gene from one species that has been introduced into another species. A heterologous gene can also include a gene native to an organism that has been modified in some way (e.g., mutated, added in multiple copies, linked to a non-native promoter or enhancer polynucleotide, etc.). A heterologous gene can further include plant gene polynucleotides, including cDNA forms of plant genes, where the cDNA can be expressed in either sense (to produce mRNA) or antisense orientation (to produce an antisense RNA transcript complementary to the mRNA transcript). In one aspect of the invention, a heterologous gene is distinguished from an endogenous plant gene in that a heterologous gene polynucleotide is typically associated with a polynucleotide that contains regulatory elements, such as a promoter, that is not naturally associated with the gene for the protein encoded by the heterologous gene or the plant gene polynucleotide in a chromosome, or is associated with a portion of the chromosome not found in nature (e.g., a gene expressed at a locus where the gene is not normally expressed). Furthermore, in embodiments, a "heterologous" polynucleotide is a polynucleotide that is not naturally associated with the host cell into which it is introduced, including multiple non-naturally occurring copies of a naturally occurring polynucleotide.
[0158] As used herein, the term "heterozygosity" refers to the genetic situation in which different alleles are present at corresponding loci on homologous chromosomes.
[0159] As used herein, the term "homozygous" refers to the genetic situation in which identical alleles are present at corresponding loci on homologous chromosomes.
[0160] As used herein, the term "human-induced mutation" refers to any mutation that arises as a direct or indirect result of human action. The term includes, but is not limited to, mutations obtained by any method of targeted mutagenesis.
[0161] As used herein, the term "hybrid" refers to the progeny produced by crossing two genetically different parent plants. The progeny resulting from this cross is a "biparental" population. In the context of plant breeding, the terms "hybrid," "hybrid plant," and "hybrid progeny" refer to plants that are the progeny of genetically different parents produced by crossing plants of different lines or varieties or species, including, but not limited to, crosses between two inbred lines (e.g., genetically heterozygous or near-heterozygous individuals). The phrase "single-cross F1 hybrid" refers to an F1 hybrid produced from a cross between two inbred lines.
[0162] In the context of two nucleic acid or amino acid sequences, the term "identity" or "same" refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or amino acid sequence of a reference ("query") sequence (or its complementary strand) compared to a test ("subject") sequence when the two sequences are aligned globally. Unless otherwise indicated, sequence identity as used herein refers to the value obtained using the Needleman and Wunsch algorithm ((1970) J. Mol. Biol. 48:443-453) as implemented in the EMBOSS needle alignment tool, or any equivalent program, using the default matrix file EBLOSUM62 for proteins with default parameters (gap open=10, gap extension=0.5, end gap penalty=false, end gap open=10, end gap extension=0.5) or DNAfull for nucleic acids with default parameters (gap open=10, gap extension=0.5, end gap penalty=false, end gap open=10, end gap extension=0.5). EMBOSS Needle is available, for example, from EMBL-EBI, for example at the following website: ebi.ac.uk / Tools / psa / emboss_needle / , and described in the following publication: “EMBL-EBI search and sequence analysis tools APIs in 2019.” Madeira et al. Nucleic Acids Research, June 2019, 47(W1):W636-W641. As used herein, the term “equivalent program” refers to any sequence comparison program that generates an alignment having identical nucleotide or amino acid residue matches and identical percent sequence identity for any two sequences of interest, as compared to the corresponding alignment generated by EMBOSS Needle. In some embodiments, substantially identical nucleic acid or amino acid sequences may perform substantially the same function.
[0163] The phrase "inbred line" refers to a genetically homozygous or nearly homozygous population. For example, an inbred line may be derived through several cycles of brother / sister mating or selfing. In some embodiments, an inbred line is a true breeding for one or more phenotypic traits of interest. An "inbred line", "inbred individual" or "inbred progeny" is an individual taken from an inbred line. The term "inbred line" refers to a substantially homozygous individual or line.
[0164] As used herein, "introduced" refers to the delivery, expression, application, transport, transfer, penetration or other similar terms that indicate the delivery to a desired object, whether the nucleic acid or protein or a combination thereof. For example, a nucleic acid encoding a site-specific nuclease and optionally at least one guide RNA can be introduced into a haploid embryo upon haploid induction. Similarly, an existing editing machinery (including a site-specific nuclease protein and optionally at least one guide RNA) can be introduced into a haploid embryo upon the addition of an appropriate cell-penetrating peptide.
[0165] As used herein, the terms "introgression," "introgressed," and "introgress" refer to both the natural and artificial process by which a genomic region of one species, variety, or cultivar is transferred to the genome of another species, variety, or cultivar by crossing the species. This process may optionally be completed by backcrossing to the recurrent parent.
[0166] As used herein, the term "isolated" when used in relation to the nucleic acid molecule or polynucleotide of the present invention refers to a polynucleotide that has been identified in the respective source organism and isolated / separated from the context of its chromosomal polynucleotide. An isolated nucleic acid or polynucleotide is not a nucleic acid as it exists in a natural context, even if it has a naturally occurring counterpart. In contrast, a non-isolated nucleic acid is a nucleic acid found in a naturally occurring state, such as DNA and RNA. For example, a given polynucleotide (e.g., a gene) is present on a host cell chromosome in the vicinity of adjacent genes. An isolated nucleic acid molecule can exist in single-stranded or double-stranded form. Alternatively, it can include both the sense and antisense strands (i.e., the nucleic acid molecule can be double-stranded). In a preferred embodiment, the nucleic acid molecule of the present invention is understood to be isolated.
[0167] As used herein, the term "knockout mutation" refers to a genetic mutation in which the expression of said gene is silenced or "knocked out." This mutation may include, but is not limited to, mutations obtained by any method of targeted mutagenesis.
[0168] As used herein, the term "locus" refers to a location (e.g., a gene, a genetic marker, etc.) on a chromosome of a given species.
[0169] As used herein, "maternal haploid induction line" refers to a line that produces pollen and, when crossed as male, results in female development of haploid seeds. "Paternal haploid induction line" refers to a line that, when used in crosses as female, results in androgenic development of haploid seeds. Haploid induction line plants can use either of these maternal or paternal mechanisms to derive haploids.
[0170] As used herein, the term "maintainer line" refers to a plant line that is male fertile, contains normal cytoplasm, is substantially genetically similar (e.g., isogenic) to a CMS plant line, and is used to maintain stocks of CMS derived lines. The maintainer line is preferably homozygous for a non-restored allele (e.g., rf4) and an R1 color marker (e.g., R1-nj or R1-SCM2). In addition, the maintainer line may contain a CenH3 mutation. As used herein, the maintainer line is used as a male in crosses with CMS lines that may or may not contain a CenH3 mutation. As used herein, the term "normal cytoplasm" refers to a cytotype that is fertile (as opposed to cytoplasmic male sterility). The maintainer lines may be self-pollinated to increase their seed stock.
[0171] As used herein, the term "molecular marker" may be used to refer to a genetic marker as defined above or its encoded product (e.g., protein) that is used as a reference point when identifying the presence / absence of an HI-associated locus. Molecular markers may be derived from genomic or expressed nucleotide sequences (e.g., RNA, cDNA, etc.). The term also refers to nucleotide sequences that are complementary to or adjacent to a marker sequence, such as nucleotide sequences used as probes and / or primers that can amplify the marker sequence. Nucleotide sequences are "complementary" if they hybridize specifically in solution (e.g., according to Watson-Crick base pairing rules). The term also refers to a genetic marker that exhibits a trait by the absence of nucleotide sequences that are complementary to or adjacent to a marker sequence, such as nucleotide sequences used as probes and / or primers that can amplify the marker sequence.
[0172] As used herein, the terms "nucleotide sequence," "polynucleotide," "nucleic acid sequence," "nucleic acid molecule," and "nucleic acid fragment" refer to a polymer of RNA or DNA that is single- or double-stranded, and optionally contains synthetic, non-natural and / or altered nucleotide bases. "Nucleotides" are the monomeric units from which DNA or RNA polymers are built, and consist of a purine or pyrimidine base, a pentose, and a phosphate group. Nucleotides (usually found in their 5'-monophosphate form) are designated by their one-letter code as follows: "A" stands for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C" stands for cytidylate or deoxycytidylate, "G" stands for guanylate or deoxyguanylate, "U" stands for uridylate, "T" stands for deoxythymidylate, "R" stands for purine (A or G), "Y" stands for pyrimidine (C or T), "K" stands for G or T, "H" stands for A or C or T, "I" stands for inosine, and "N" stands for any nucleotide.
[0173] The term "progeny" refers to any plant obtained as offspring by vegetative breeding or sexual reproduction from one or more parent plants or their progeny. For example, progeny plants can be obtained by cloning or selfing a parent plant or by crossing two parent plants, including selfing and F1 or F2 or even further generations. F1 is the first generation progeny born from a parent, at least one of which is used for the first time as a donor of a trait, and the progeny of the second generation (F2) and subsequent generations (F3, F4, etc.) are specimens obtained from selfing F1, F2, etc. Thus, F1 can be a hybrid obtained from a cross between two true breeding parents (true breeding is homozygous for a trait), while F2 can be the progeny obtained from self-pollination of said F1 hybrid.
[0174] The term "PCR (polymerase chain reaction)" is understood within the context of the present invention to refer to a method for producing relatively large amounts of specific regions of DNA, thereby allowing various analyses based on those regions.
[0175] As used herein, the term "plant" may refer to a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term "plant" may refer to either a whole plant, a plant component or organ (e.g., leaves, stems, roots, etc.), a plant tissue, a seed, and / or a plant cell.
[0176] A "plant cell" is the structural and physiological unit of a plant, including the protoplast and the cell wall. A plant cell may be in the form of an isolated single cell or a cultured cell, or may be part of a more highly organized unit, such as a plant tissue, a plant organ, or a whole plant.
[0177] As used herein, "stored pollen" refers to pollen that has been manually collected and stored in some manner for future use (see U.S. Patent Application No. 63 / 289,299, incorporated herein by reference).
[0178] As used herein, the term "primer" refers to an oligonucleotide that can anneal (in some embodiments, specifically anneal to) a nucleic acid target, thereby allowing DNA polymerase and / or reverse transcriptase to bind thereto, and thus function as an initiation point for DNA synthesis when placed under conditions that induce synthesis of a primer extension product (e.g., at a suitable temperature and pH in the presence of nucleotides and a polymerization agent such as a DNA polymerase). In some embodiments, one or more primers are used to amplify plant nucleic acids (e.g., using the polymerase chain reaction; PCR).
[0179] As used herein, the term "probe" refers to a nucleic acid (e.g., a single-stranded nucleic acid or a strand or subsequence of a double or more stranded nucleic acid) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, a probe is of sufficient length to form a stable, sequence-specific double-stranded molecule with its complement, and thus, in some embodiments, can be used to detect a sequence of interest present in multiple nucleic acids.
[0180] The term "plant cell culture" refers to cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development.
[0181] "Plant material" refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures or other parts or products of a plant.
[0182] A "plant organ" is a clearly visible structural and differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.
[0183] As used herein, "plant tissue" refers to a group of plant cells organized into structural and functional units. Any tissue of a plant, either in a plant or in culture, is included. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into structural and / or functional units. The use of this term in combination with or in the absence of any particular type of plant tissue included above or otherwise in this definition is not intended to exclude other types of plant tissue.
[0184] The term "plant part" refers to a part of a plant, including single cells and cell tissues, such as intact plant cells in a plant, cell masses, and tissue cultures that can regenerate plants. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; and pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rhizomes, seeds, protoplasts, and calluses.
[0185] As used herein, the term "phenotype", "phenotypic trait" or "trait" refers to one or more traits of a plant or plant cell. A phenotype may be observable by the naked eye or by any other means of evaluation known in the art, such as microscopy, biochemical analysis or electromechanical assay. In some cases, a phenotype is directly controlled by a single gene or locus (i.e., corresponds to a "single gene trait"). In the case of haploid induction, a color marker such as R Navajo is used, and if the seed is an induced haploid seed, other markers are used, including transgenes that are visualized by the presence or absence of color in the seed. The use of R Navajo as a color marker and the use of transgenes are well known in the art as a means of detecting the induction of haploid seeds in female plants. In other cases, a phenotype is the result of the interaction between several genes, which in some embodiments also results from the interaction of the plant and / or plant cell with its environment.
[0186] As used herein, the term "population" means a genetically heterogeneous collection of plants that share a common genetic origin.
[0187] As used herein, the term "primer" refers to an oligonucleotide that can anneal (and in some embodiments specifically anneal) to a nucleic acid target and serve as a point of initiation of DNA synthesis when placed under conditions that induce synthesis of a primer extension product (e.g., in the presence of agents for polymerization such as nucleotides and DNA polymerase and at a suitable temperature and pH). In some embodiments, one or more primers are used to amplify plant nucleic acids (e.g., using the polymerase chain reaction, PCR).
[0188] The term "primer", as used herein, refers to an oligonucleotide that serves as a starting point for DNA synthesis when placed under conditions that allow binding of DNA polymerase to an amplification target and induce synthesis of a primer extension product, e.g., in the presence of a polymerization agent such as nucleotides and DNA polymerase, and under appropriate temperature and pH conditions. (Amplification) primers are preferably single-stranded to maximize the efficiency of amplification. Preferably, primers are oligodeoxyribonucleotides. Primers are generally long enough to prime the synthesis of extension products in the presence of an agent for polymerization. The exact length of the primers depends on many factors, including temperature and primer composition (A / T and G / C content). A pair of bidirectional primers consists of one forward primer and one reverse primer, which are commonly used in the technical field of DNA amplification, such as PCR amplification. It is understood that "primer" as used herein can refer to more than one primer, especially when there is some ambiguity in the information regarding the terminal sequences of the target region to be amplified. Thus, "primer" includes a collection of primer oligonucleotides that include sequences that represent possible variations in sequence, or include nucleotides that allow typical base pairing. Oligonucleotide primers can be prepared by any suitable method. Methods for preparing oligonucleotides of specific sequences are known in the art, and include, for example, cloning and restriction of appropriate sequences and direct chemical synthesis. Chemical synthesis methods can include, for example, phosphodiester or phosphotriester methods, diethyl phosphoramidate methods, and solid support methods, such as those disclosed in U.S. Pat. No. 4,458,066. Primers can be labeled, if desired, by incorporating a means that is detectable, for example, by spectroscopic, fluorescent, photochemical, biochemical, immunochemical, or chemical means. Template-dependent extension of oligonucleotide primers is catalyzed by a polymerization agent in the presence of an appropriate amount of the four deoxyribonucleotide triphosphates (dATP, dGTP, dCTP, and dTTP, i.e., dNTPs) or analogs in a reaction medium that is composed of appropriate salts, metal cations, and a pH buffer system.Suitable polymerization agents are enzymes known to catalyze primer-dependent and template-dependent DNA synthesis. Known DNA polymerases include, for example, E. coli DNA polymerase I or its Klenow fragment, T4 DNA polymerase, and Taq DNA polymerase. Reaction conditions for catalyzing DNA synthesis using these DNA polymerases are known in the art. The products of synthesis are double-stranded molecules that contain the target sequence, consisting of the template strand and the primer extension strand. These products then serve as templates for the next round of replication. In the second round of replication, the primer extension strand of the first cycle anneals to its complementary primer; synthesis results in "short" products bounded at both the 5' and 3' ends by the primer sequence or their complement. Repeated cycles of denaturation, primer annealing, and extension result in an exponential accumulation of the target region defined by the primers. Sufficient cycles are performed to achieve a desired amount of polynucleotides that contain the target region of the nucleic acid. The desired amount can vary and depends on the function that the product polynucleotides are to perform. PCR methods are well described in handbooks and known to those skilled in the art. After amplification by PCR, the target polynucleotide is detected by hybridization with a probe polynucleotide, which forms a stable hybrid with the polynucleotide of the target sequence under low, medium or even highly stringent hybridization and washing conditions. If the probe is expected to be essentially completely complementary (i.e., about 99% or more) to the target sequence, highly stringent conditions can be used. If some mismatch is expected, for example, if a mutant strain is expected from the result that the probe is not completely complementary, the stringency of hybridization can be reduced. However, conditions that exclude non-specific / accidental binding are typically selected. Conditions that affect hybridization and conditions to select for non-specific binding are known in the art and described, for example, in Sambrook and Russell, 2001.In general, the lower the salt concentration and the higher the temperature, the more stringent the hybridization conditions. "PCR primer" is preferably understood within the scope of the present invention to refer to a relatively short fragment of single-stranded DNA used for PCR amplification of a specific region of DNA.
[0189] As used herein, the term "probe" refers to a nucleic acid (e.g., a single-stranded nucleic acid or a strand or subsequence of a double-stranded or higher order nucleic acid) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, a probe has a length sufficient to form a stable and sequence-specific double-stranded molecule with its complement, and thus can be used in certain embodiments to detect a sequence of interest present in a plurality of nucleic acids.
[0190] The term "probe" refers to a single-stranded oligonucleotide that forms a hydrogen-bonded duplex with a substantially complementary oligonucleotide in a target nucleic acid assay or its cDNA derivative.
[0191] As used herein, the terms "marker probe" and "probe" refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence or absence of a sequence within a larger sequence, e.g., a nucleic acid probe that is complementary to all or a portion of a marker or marker locus, by nucleic acid hybridization. Marker probes that contain about 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides can be used for nucleic acid hybridization.
[0192] The term "progeny" refers to the offspring of a particular mating. Typically, progeny are produced from the mating of two individuals, although some species (particularly some plants and hermaphroditic animals) can self-fertilize (i.e., the same plant acts as a donor of both male and female gametes). Progeny can be, for example, an F1, an F2, or any subsequent generation.
[0193] As used herein, the terms "progeny" and "progeny plant" refer to plants generated from vegetative breeding or sexual reproduction from one or more parent plants. In gynogenic haploid induction, the haploid embryo of the female parent contains female chromosomes except for male chromosomes, and is therefore not the progeny of the male haploid derived line. Haploid corn seeds typically still have normal triploid endosperm that contains the male genome. The edited haploid progeny, the resulting edited doubled haploid plants, and the resulting seeds are not the only desired progeny. In many cases, there are also progeny of the seeds from the haploid derived line itself carrying the Cas9 transgene, the resulting plants, and the seeds of the haploid derived plants. Both haploid seeds and haploid derivative (from self-pollination) seeds can be progeny. Progeny plants can be obtained by cloning or selfing a single parent plant, or by crossing two or more parent plants. For example, progeny plants can be obtained by cloning or selfing a parent plant, or by crossing two parent plants, including selfing and F1 or F2 or even other generations. F1 is the first generation progeny produced from parents at least one of which is used for the first time as a donor of the trait, while the second (F2) and subsequent generation progeny (F3, F4, etc.) are samples produced from selfing, outcrossing, backcrossing and / or other crosses such as F1, F2, etc. Thus, F1 can be (and in some embodiments is) a hybrid resulting from a cross between two pure breeding parents (i.e., the pure breeding parents are each homozygous for the trait of interest or its alleles), while F2 can be (and in some embodiments is) the progeny resulting from self-pollination of the F1 hybrid.
[0194] The terms "R1-nj" and "R1-SCM2" refer to the R1-navajo and R1-SCM2 anthocyanin markers. These visual markers are useful for distinguishing between haploids and diploids (or aneuploids). As described herein, haploid plants are identified as cream-colored, while diploids are purple.
[0195] As used herein, the term "regeneration" and grammatical variations thereof refer to the production of plants from tissue culture.
[0196] As used herein, "restorer" or "fertility restorer" or "Rf" or "restorer allele" refers to one or more genes in a plant that restore fertility to a male-sterile plant. Examples of restorer genes include, but are not limited to, Rf3, Rf4, Rf10, Rf11, and Rf12. A plant may be heterozygous or homozygous for one or more restorer genes. For example, a plant may contain Rf4 and Rf11, but may be rf10. Another plant of the cross may be rf4, but may be Rf11 and Rf10. Thus, each plant may contain a restorer allele and lack a non-restorer allele. Thus, a CMS plant that contains at least one restorer allele is nevertheless male fertile.
[0197] A non-restoring allele (also referred to as "rf") refers to one or more genes in a plant that do not restore fertility to a male sterile plant. Examples of non-restoring alleles include, but are not limited to, rf3, rf4, rf10, rf11, and rf12. A plant homozygous for a non-restoring allele will be male sterile if the plant has CMS.
[0198] As used herein, "spontaneous chromosome doubling" ("SCD"), or "spontaneous haploid genome doubling", or "haploid male fertility", or "spontaneous genome doubling" are used interchangeably to describe the doubling of the haploid genome without any intervention. SCD allows for correct meiosis of chromosomes and the subsequent formation of mature pollen. In this disclosure, SCD was calculated by dividing the number of fertile haploid plants by the total number of plants.
[0199] As used herein, a "spontaneously doubled haploid plant" refers to a plant in which the floret has undergone spontaneous doubling. Other tissues of a spontaneously doubled haploid plant may retain their haploid state (e.g., roots, leaves, stems).
[0200] As used herein, the term "targeted mutagenesis" or "mutagenesis strategy" refers to any method of mutagenesis that results in the deliberate mutagenesis of a selected gene. Targeted mutagenesis includes CRISPR, TILLING, TALEN, and other methods yet to be discovered that can be used to achieve the same result. As used herein, the term "targeted mutagenesis" or "mutagenesis strategy" refers to any method of mutagenesis that results in the deliberate mutagenesis of a selected gene. Targeted mutagenesis includes CRISPR, TILLING, TALEN, and other methods yet to be discovered that can be used to achieve the same result.
[0201] As used herein, the term "trait" refers to a phenotype of interest, a gene that contributes to the phenotype of interest, and a nucleic acid sequence associated with the gene that contributes to the phenotype of interest. For example, an "HI trait" refers to a haploid induction phenotype and a gene that contributes to haploid induction (e.g., matl in maize or Os03g27610 in rice) and a nucleic acid sequence associated with the presence or absence of the haploid induction phenotype (e.g., an HI-associated gene product).
[0202] As used herein, the term "transfected" refers to the introduction of a nucleic acid into a cell.
[0203] As used herein, the term "transgene" refers to a nucleic acid molecule that is introduced into an organism or one or more of its ancestors by some form of artificial transfer technique. Artificial transfer techniques thus produce "transgenic organisms" or "transgenic cells." It is understood that while artificial transfer techniques may be performed on (or may develop into) cells within and / or into ancestors, any progeny individual that has the artificially transferred nucleic acid molecule or a fragment thereof will still be considered transgenic even if one or more natural and / or assisted breedings result in the artificially transferred nucleic acid molecule being present in the progeny individual.
[0204] A method of conferring cytoplasmic male sterility (CMS) to a plant line is described herein. The method includes obtaining a first plant (CHIP) that is a haploid derivative and includes a CMS cytoplasm, obtaining a second plant (DIP) that includes a desired nuclear genome, and crossing the CHIP with the DIP and generating progeny from the cross. The resulting progeny includes the CMS cytoplasm and the desired nuclear genome from the CHIP and the DIP, respectively. In an embodiment, the CMS cytoplasm is selected from the group consisting of CMS-C, CMS-S, and CMS-T. In one embodiment, the CMS cytoplasm is CMS-C. In one embodiment, the CHIP is female fertile and CMS male sterile. In another embodiment, the CHIP is female fertile and CMS male fertile. The CHIP is a paternal haploid derivative and includes a cenh3 mutation. In one embodiment, the cenh3 mutation is a knockout mutation. In one embodiment, the cenh3 knockout mutation is obtained by gene editing. In another embodiment, the cenh3 knockout mutation comprises SEQ ID NO:5 or SEQ ID NO:6. In another embodiment, the cenh3 knockout mutation is heterozygous. In yet another embodiment, the cenh3 mutation is edited using CRISPR-Cas12a. In one embodiment, the CRISPR-Cas12a is selected from the group consisting of AsCas12a, LbCas12a and FnCas12a, MbCas12a and Mb2Cas12a. In one embodiment, the CRISPR-Cas12a is LbCas12a.
[0205] In yet another embodiment, the CHIP further comprises an anthocyanin marker. The anthocyanin marker is selected from the group consisting of R1-navajo and R1-SCM2. In one embodiment, the anthocyanin marker is R1-navajo, and in another embodiment, the anthocyanin marker is R1-SCM2. The anthocyanin marker is homozygous. In yet another embodiment, the CHIP further comprises a restorer allele, the restorer allele being selected from the group consisting of Rf3, Rf4, Rf11, Rf10, and Rf12. In an embodiment, the restorer allele is Rf4. In another embodiment, the restorer allele is homozygous. In another embodiment, the CHIP further comprises a non-restorer allele, the non-restorer allele being selected from the group consisting of rf3, rf4, rf10, rf11, and rf12. The non-restorer allele is rf4 and is homozygous.
[0206] In an embodiment, the CHIP comprises a cenh3 mutation, an R1-navajo marker, and a restorer allele of the restorer 4 gene. In another embodiment, the CHIP comprises a cenh3 mutation, an R1-SCM2 marker, and a restorer allele of the restorer 4 gene. In one embodiment, the CHIP comprises a cenh3 mutation, an R1-navajo marker, and a non-restoring allele of the restorer 4 gene, while in another embodiment, the CHIP comprises a cenh3 mutation, an R1-SCM2 marker, and a non-restoring allele of the restorer 4 gene. In yet another embodiment, the CHIP is selected from the group consisting of maize, wheat, rice, sunflower, tomato, barley, brassica, cucumber, and watermelon. In another embodiment, the CHIP is maize.
[0207] In an embodiment, the DIP is a pollen donor in a cross between CHIP and DIP. The DIP can be homozygous or heterozygous for the non-restoring allele. In another embodiment, the DIP is homozygous for the non-restoring allele, and the non-restoring allele is selected from the group consisting of rf3, rf4, rf10, rf11 and rf12. In one embodiment, the non-restoring allele is rf4. In an embodiment, the DIP is selected from the group consisting of maize, wheat, rice and sunflower, tomato, barley, brassica, cucumber and watermelon. In one embodiment, the DIP is maize.
[0208] In yet another embodiment, a plant produced by the above-mentioned method is disclosed herein, which is a CMS haploid plant. In an embodiment, the CMS haploid plant contains the CMS cytoplasm of CHIP and the nuclear genome of DIP, while lacking the anthocyanin marker, the restorer allele, and the cenh3 knockout mutation. In another embodiment, the CMS haploid plant is treated with a doubling agent. In one embodiment, the doubling agent is selected from the group consisting of colchicine, pronamide, dithipyr, trifluralin, nitrous oxide, or another known anti-microtubule agent. In another embodiment, the doubling agent is colchicine. In yet another embodiment, the CMS haploid plant is pollinated with pollen from a DIP. In another embodiment, the CMS haploid plant is pollinated with stored pollen. In yet another embodiment, the CMS haploid plant is CMS confirmed by genotyping or other molecular analysis. EXAMPLES
[0209] Example 1: Generating CMS haploid derivative lines (CHIPs) using the R1-nj color marker. 1. To select efficient gRNAs for gene editing, we transfected etiolated maize protoplasts with LbCas12a-crRNA RNP complexes containing various candidate gRNAs. The crRNA scaffold used for LbCas12a is based on the CRISPR-LbCpf1 system. Protoplasts were isolated from etiolated maize leaves grown under dark conditions as described (Sheen, 1991). Transfection of protoplasts was performed as described (Sant'Ana et al., 2020) with some modifications. Transfection reactions were performed with 5 × 10 per reaction. 5 The transfected protoplasts were composed of 100 μl of W1 solution (0.6 M mannitol, 100 mM CaCl2) and incubated for 15 min in PEG solution (40% PEG-4000, 0.6 M mannitol, 100 mM CaCl2). After termination with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl and 2 mM MES, pH 5.7), the transfected protoplasts were resuspended in 300 μl of W1 solution (0.6 M mannitol, 4 mM MES, pH 5.7, 4 mM KCl), transferred to a 96-well clear-bottom microplate and incubated for 2 days in the dark at 28 °C without shaking. DNA was isolated from the transfected protoplasts after 2 days and gene editing efficiency was analyzed by PCR amplification followed by restriction of the amplicons with T7 endonuclease I (NEB).
[0210] 2. Biolistic bombardment of SYN-INBC34 inbred immature embryos was performed using LbCas12a RNP with gRNA140 selected as described above with sequence CAGGTGGTGCGAGTACCTCGGCG (SEQ ID NO: 1) targeting the second exon of gene ID GRMZM2G158526 and DNA vector 26258 with PMI selection marker (see Table 16). To generate LbCas12a-crRNA RNP complex, 0.3 nmol of Cas12 protein and 0.3 nmol of crRNA were mixed in a total volume of 11 μl and incubated at room temperature for 10 min. For RNP delivery alone, RNP was coated onto 0.6 μm gold particles (Bio-Rad, USA) as follows: 100 μl of gold particles (10 mg / ml suspension in water) and 20 μl of glycogen (20 mg / ml) were added to the premixed RNP, mixed gently, and then incubated on ice for 10 min. For co-delivery of RNP and DNA, RNP and DNA vector plasmid 26258 were coated onto gold particles as follows: 100 μl of gold particles (10 mg / ml suspension in water) and 20 μl of glycogen (20 mg / ml) were added to the premixed RNP and DNA vector, mixed gently, and incubated on ice for 10 min. The RNP / DNA coated gold particles were centrifuged at 8,000 g for 40 s and the supernatant was removed. The pellet was resuspended in 30 μl of sterile water by brief sonication and then spread onto macrocarrier discs (10 μl each), followed by air drying in a laminar flow hood (2–4 h).
[0211] 3. Immature embryos were isolated from spikes harvested approximately 9–11 days after pollination and precultured in osmotically adjusted medium for 1–3 days. The precultured embryos were then irradiated with the LbCas12a-RNP complex and DNA described above using a BioRad PDS-1000 HeTM biolistic particle delivery system. The irradiated embryos were incubated in callus induction medium. The induced callus was then transferred to mannose selection medium. The mannose-resistant callus was transferred to regeneration medium to induce shoot formation. The shoots were then subcultured on rooting medium. For TaqMan R assays, leaf samples were taken from rooted plants to detect mutations at the target site using the real-time quantitative polymerase chain reaction (qPCR) TaqMan R method described above.
[0212] 4. We identified CenH3-het edited plants using TaqMan Assay 3895 with primers TCCTTGTTCCGTCTTTTGCAG (SEQ ID NO:2) and AAGGCAAAAGGAGGGAACTGAT (SEQ ID NO:3) and probe TACCTCGGCGACGCC (SEQ ID NO:4) and positively identified by PCR sequencing for the frameshift allele. SYN-INBC34 is rf4 / rf4, does not have the R-nj marker and is not CMS. The following steps introduced the edited CenH3 allele into a genetic background containing homozygous R1-nj, CMS and homozygous Rf4.
[0213] 5. T0 events were grown to maturity and selfed and / or outcrossed as males to CMS-C material, SYN-INB77M-CMS (rf4 / rf4 and male sterile). T1 generation plants from the T0 selfs were also identified by TaqMan assay and PCR sequencing as heterozygous for a frameshift mutation in the CenH3 coding sequence (hereafter referred to as CenH3[+ / -] plants), grown to maturity, and crossed to CMS to generate further CMS-Cenh3 edited seed. In the F1 generation after crossing T0 or T1 CenH3 mutant pollen to SYN-INB77M-CMS, we identified plants with a heterozygous 10 base deletion in CENH3 by TaqMan assay and Sanger sequencing. This plant was male sterile and pollinated with pollen from the RWKS plant line homozygous for R-nj and Rf4. b. T1 generation (non-CMS) CenH3(+ / -) mutant plants were also intercrossed to RWKS to generate F1 carrying CenH3 and R-nj markers. c. All seeds from the CMS CenH3(+ / -) x RWKS cross in step 5b were red or purple, indicating that the R1-nj marker was present at least in the heterozygous state. Seeds were sown and the resulting plants were genotyped for CenH3(+ / -) and Rf4(+ / -) zygosity by TaqMan assay and then self-pollinated (they are fertile by the Rf4 marker). Some plants were also backcrossed with seeds bearing CenH3(+ / -) and R-nj from the F1 progeny of the CenH3(+ / -) x RWKS cross in step 5b. d. Purple seeds resulting from the cross in step 5c were sown and selected by TaqMan and sequencing for CenH3 (+ / -) heterozygosity, R-nj homozygosity and CMS cytoplasm. These derivatives are easily propagated by selfing. In the absence of the Rf4 marker (i.e., the derivative is rf4 / rf4), seeds can also be propagated using a cross with a sibling or maintainer plant carrying the R-nj marker and optionally a mutant allele of CenH3 (+ / + or + / -). e. This derivative is then used as the CMS donor line for one-step conversion. This material is used as female and crossed with pollen from any line desired to be directly converted to CMS cytoplasm. After crossing, the haploids are colored as mature dry seeds with cream colored embryos (diploid hybrids have purple embryos). The haploid seeds may or may not be chemically treated to induce genome doubling and are then sown in soil and grown to maturity, after which they are replaced by pollen from the recurrent parent. [ka] [ka]
[0214] Example 2: Generating a CMS haploid derivative line ("CHIP") using the R1-SCM2 color marker. 1. To select efficient gRNAs for gene editing, we transfected etiolated maize protoplasts with LbCas12a-crRNA RNP complexes containing various candidate gRNAs. The crRNA scaffold used for LbCas12a is based on the CRISPR-LbCpf1 system. Protoplasts were isolated from etiolated maize leaves grown under dark conditions as described (Sheen, 1991). Transfection of protoplasts was performed as described (Sant'Ana et al., 2020) with some modifications. Transfection reactions were performed with 5 × 10 per reaction. 5The transfected protoplasts were composed of 100 μL of W1 solution (0.6 M mannitol, 100 mM CaCl2) and incubated for 15 min in PEG solution (40% PEG-4000, 0.6 M mannitol, 100 mM CaCl2). After termination with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl and 2 mM MES, pH 5.7), the transfected protoplasts were resuspended in 300 μL of W1 solution (0.6 M mannitol, 4 mM MES, pH 5.7, 4 mM KCl), transferred to a 96-well clear-bottom microplate and incubated for 2 days in the dark at 28 °C without shaking. DNA was isolated from the transfected protoplasts after 2 days and gene editing efficiency was analyzed by PCR amplification followed by restriction of the amplicons with T7 endonuclease I (NEB).
[0215] 2. Biolistic bombardment of SYN-INBC34xSYN-INBC34RS isolated immature embryos (heterozygous for R1-SCM2 marker) was performed using LbCas12a complexed with gRNA140 (sequence CAGGTGGTGCGAGTACCTCGGCG, SEQ ID NO: 1) targeting the second exon of gene ID GRMZM2G158526 and DNA vector 26258 (Table 16), both carrying the PMI selection marker. To generate the Cas12a-crRNA RNP complex, 0.3 nmol of Cas12 protein and 0.3 nmol of crRNA were mixed in a total volume of 11 μl and incubated at room temperature for 10 min. For RNP delivery alone, RNP was coated onto 0.6 μm gold particles (Bio-Rad, USA) as follows: 100 μl of gold particles (10 mg / ml suspension in water) and 20 μl of glycogen (20 mg / ml) were added to the premixed RNP, mixed gently, and incubated on ice for 10 min. For RNP and DNA co-delivery, RNP and DNA vector plasmid 26258 were coated onto gold particles as follows: 100 μl of gold particles (10 mg / ml suspension in water) and 20 μl of glycogen (20 mg / ml) were added to the premixed RNP and DNA vector, mixed gently, and incubated on ice for 10 min. The RNP / DNA coated gold particles were centrifuged at 8,000 g for 40 s and the supernatant was removed. The pellet was resuspended in 30 μl of sterile water by brief sonication and spread onto macrocarrier discs (10 μl each), followed by air drying in a laminar flow hood (2–4 h).
[0216] 3. Immature embryos were isolated from spikes harvested approximately 9–11 days after pollination and precultured in osmotically adjusted medium for 1–3 days. The precultured embryos were irradiated with the LbCas12a-RNP complex and DNA described above using a BioRad PDS-1000 HeTM biolistic particle delivery system. The irradiated embryos were then incubated in callus induction medium. The induced callus was transferred to mannose selection medium. The mannose-resistant callus was transferred to regeneration medium to induce shoot formation. The shoots were then subcultured on rooting medium. For TaqMan R assays, leaf samples were taken from rooted plants to detect mutations at the target site using the real-time quantitative polymerase chain reaction (qPCR) TaqMan R method described previously.
[0217] 4. We identified CenH3-het edited plants using TaqMan Assay 3895 with primers TCCTTGTTCCGTCTTTTGCAG (SEQ ID NO:2) and AAGGCAAAAGGAGGGAACTGAT (SEQ ID NO:3) and probe TACCTCGGCGACGCC (SEQ ID NO:4) and positively identified by PCR sequencing for the frameshift allele. The following steps introduced the edited CenH3 allele into a genetic background containing homozygous R1-SCM2, CMS and homozygous Rf4.
[0218] 5. TO events were grown to maturity and self-pollinated. Purple-seeded T1 progeny were planted and CenH3(+ / -) plants were identified by TaqMan and PCR sequencing and grown to maturity for selfing and crossing with the panicle of the SYN-INB77M-CMS line carrying the maintainer alleles rf4 and rf11.
[0219] 6. Two SYN-INB77M-CMS ears were obtained after pollination with a plant carrying the R1-SCM2 marker and the sequence of the 19 base pair deletion, TACCTCGGCGACGCCGGTG (SEQ ID NO: 5). The progeny seeds were sown, again selecting for purple seeds. The seedlings were genotyped and further selected for homozygous R1-SCM2 using the R1 marker and heterozygous for the 19 base pair deletion using a TaqMan assay specific for this cenh3 mutant allele. If the plant is male fertile, the plant is selfed. If the plant is male sterile, the plant is crossed as a female with a non-CMS T2 plant in which R1-SCM2 and CenH3 (+ / -) are present.
[0220] [Table 1]
[0221] [Table 2]
[0222] [Table 3]
[0223] [Table 4]
[0224] 7. Genotype the next generation for homozygosity for R1-SCM2, the presence of CMS and heterozygous knockout CenH3 (+ / -) constructs. This particular combination is one of the ideal derivative genotypes that can be used for CMS cytoplasmic exchange. These derivatives are easily propagated by selfing. However, if the line is male sterile (i.e., the Rf4 marker is absent and the derivative plants are rf4 / rf4), they can also be crossed as females to propagate seeds with maintainer pollen that is homozygous for the R1-SCM2 or R-nj marker and any mutant alleles of CenH3 (+ / + or + / -).
[0225] 8. This induced plant is then used as the CMS donor line for one-step conversion. This material is used as female and crossed by pollen from any line desired to be directly converted to CMS cytoplasm. After crossing, haploids are colored 10-25 days after in vitro pollination (we select cream colored embryos 24 hours after color induction in an incubator). Haploid seeds may or may not be chemically treated to induce genome doubling and can simply be transplanted into soil and grown for further crossing with the recurrent parent. Again, fertile induced plants can be maintained by selfing, while sterility induced plants can be crossed with a non-CMS (i.e. normal cytoplasm) maintainer line carrying the R1-SCM2 (or R-nj) color marker. Optionally, the maintainer line can carry non-restored alleles of rf4 and rf11 as well as CenH3 WT or CenH3 knockout (mutant) alleles.
[0226] Example 3. Proof of concept of cytoplasmic exchange in maize (Normal A cytoplasmic exchange) Cytoplasmic exchange in maize using CenH3(+ / -) derivatives was demonstrated by obtaining genome-edited material from Kelly Dawe's lab at the Department of Plant Biology at the University of Georgia and crossing it to a panel of maize lines to generate haploids. The haploids were then doubled and selfed to generate DH1 seeds. The cytoplasm of the material obtained from Dr. Dawe was "Normal A," a cytoplasm known to be common to transformable maize genetic backgrounds and characterized by a distinctive genotype for the SM2914 marker. In contrast, the line selected for this cytoplasmic exchange into Normal A is known to be Normal B, which is not a transformable background and is characterized by a distinct distinctive genotype for the SM2914 marker.
[0227] We genotyped plants from Dr. Dawe for the CenH3 editing allele, selected CenH3 heterozygous (+ / -) plants that were CenH3 heterozygous (+ / -) and crossed them as females with seven Normal B Syngenta males. We harvested the ears 16 days after pollination and isolated the embryos in germination medium on petri plates with colchicine for 24 hours to induce genome doubling. We then transferred the embryos to recovery medium on phyta trays and allowed the plants to grow to the two-leaf stage. We then harvested leaves from the plants and extracted DNA to assess with a panel of TaqMan endpoint markers that are polymorphic between haploid derivatives of Normal A and the male parent of Normal B. These markers cover all 10 chromosomes and were used to select plants that only had chromosomes from the pollen donor.
[0228] [Table 5]
[0229] We identified "paternal haploid" offspring because the male parent markers were "homozygous" and selected these plants from plants genotyped as hybrids with all nuclear DNA markers in the panel being heterozygous. Table 8 below shows a summary of haploid induction rates based on this data. Some plants were also tested by ploidy analysis to determine if they were indeed haploid. See Figure 3a (diploid control) and Figure 3b (haploid).
[0230] [Table 6]
[0231] [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5]
[0232] The data indicate that 3-10% haploids were recovered from derivative crosses. The haploids were grown to maturity and self-pollinated (recalling that the genome was doubled by colchicine treatment, it is more reasonable to say that these were doubled haploids). The seed numbers shown in Table 10 below were obtained from self-pollinated ears.
[0233] [Table 8-1] [Table 8-2] [Table 8-3]
[0234] Importantly, both the doubled haploids and the progeny of the DH1 generation were genotyped and shown to have cytoplasmic markers associated with Normal A, but not with Normal B. This clearly demonstrates that the cytoplasmic exchange concept works efficiently using CenH3+ / - derivatives. This concept is easily applied to the exchange of male-sterile cytoplasm (as shown in the examples below).
[0235] Example 4: CMS cytoplasmic exchange repeat parent using heterozygous CENH3 line and R1-SCM2 marker. Step 1. We selected 13 DIP corn lines (9 feed corn and 4 sweet corn) to convert to CMS. These lines have the sterility restorer genotypes rf4 and rf11. The DIP corn lines are sometimes called recurrent parents.
[0236] Step 2. We sowed two types of conversion line material, one segregating a 19 bp deletion in CENH3 (SEQ ID NO: 9) and one segregating a 10 bp deletion in CENH3 (SEQ ID NO: 8). Both types of material segregate wild type 1:1 heterozygotes and carry the R1-SCM2 allele (anthocyanin marker expressed in the scutellum of embryos).
[0237] Step 3. From these sowings, we identified cenh3 mutant heterozygous plants using TaqMan assays specific for wild type and both deletion alleles (a total of three assays) and grew them to maturity. These resulting lines are transformation line plants, i.e., CHIP plants.
[0238] [Table 9-1] [Table 9-2] [Table 9-3]
[0239] Step 4. We pollinated the panicles of the transformed lines from CHIP plants with pollen from the recurrent parent (DIP) plant and harvested the panicles for embryo extraction 16-19 days after pollination. The extracted embryos (i.e., F1 generation) were placed in Petri dishes containing 40 ml of Murashige and Skoog medium (MS) medium containing 0.5 mg / ml colchicine or the same MS medium without colchicine (see generally Maluszynski, et al., eds., DOUBLED HAPLOID PRODUCTION IN CROP PLANTS: A MANUAL (2003); see also WO 2002 / 085104, incorporated herein by reference). The plates were placed in a Percival growth chamber at 28°C with continuous light and 123 μmol / m.sec for 16-24 hours to allow the embryos to express color from the dominant R1-SCM2 allele.
[0240] Step 5. After 16-24 hours, white embryos (i.e. embryos lacking R1-SCM2 expression) were transferred to phyta trays containing 100 ml of germination medium and placed in a growth chamber with 16 hours of light, 118 μmol / m.sec at 28 °C, and 8 hours of darkness at 24 °C. The germination medium recipe contained MS salts, vitamins, and myo-inositol (see generally Murashige and Skoog, A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures, Physiologia Plantarum 15:473-497 (1962)), and was supplemented with 0.5 ml / liter of plant preservative mixture (PPM, Plant Cell Technology.).
[0241] Step 6. After about 10 days, we transplanted the surviving seedlings into 2.5 inch pots containing soil and placed them in a hardening chamber under the following environmental conditions: day temperature: 80°F, night temperature: 72°F, humidity: 55%, photoperiod: 12 hours, light intensity: about 1200 μmol, CO2: 400 ppm.
[0242] Step 7. Seedlings were harvested approximately 5 days after transplanting and genotyped with markers covering all 10 maize chromosomes. A subset of 144 plants that were found to be homozygous for all markers were selected for doubling (Table 13). We also confirmed the cytoplasm type by testing them with two markers (SM2915 and SM2916) in the CMS cytoplasm.
[0243] [Table 10]
[0244] [Table 11]
[0245] Step 8. We calculated the haploid recovery rate (HRR) as the ratio of the number of confirmed haploid seedlings to the number of extracted embryos. Plants carrying either of the CENH3 mutations (10 bp deletion or 19 bp deletion) in the heterozygous state had very similar HRR (Table 14).
[0246] [Table 12]
[0247] All haploids were pollinated with pollen from the recurrent parent plant to generate the HaploidBC1 generation.
[0248] [Table 13]
[0249] After pollination, the ears were left to dry. Another round of embryo rescue and pollination with the recurrent parent was completed to increase DH seed.
[0250] Example 5. General method for converting non-CMS recurrent parental lines into CMS lines. Step 1. Select DIPs to convert to CMS. The lines selected should be homozygous (ideally) or heterozygous for rf4, a recessive allele that confers male sterility when combined with CMS cytoplasm. These lines are the recurrent parents of rf4.
[0251] Step 2. Grow CHIP and genotype individual plants for markers at CenH3 and CMS, Rf4 and R1 loci as required. Plants heterozygous for the CenH3 knockout allele are used for CMS cytoplasmic exchange. In any derivative population, there will be many plants that are homozygous WT for the CenH3 gene. These plants need to be selected as they are not derivatives. The selected CHIP plants are optionally R1-SCM2 or R1-nj homozygous. In an ideal one-step cytoplasmic exchange method, one of these two alleles is already fixed in the line. The derivative line can be propagated by self-pollination (if male fertile) or crossing with pollen of the maintainer line (if male sterile). The maintainer line will have the R1-SCM2 or R1-nj color marker to remain fixed in the derivative line. Maintainer lines, non-restored alleles of rf4 and rf11, may of course carry CenH3 WT or CenH3 knockout (mutant) alleles.
[0252] Step 3. Mate DIP with CHIP as the male (pollen donor).
[0253] Step 4. When using the R1-nj marker, the resulting seeds are grown to maturity, dried, harvested, and haploids (cream-colored embryos) are selected and then sown. In contrast, when using the R1-SCM2 marker, the resulting ears are harvested 10 to 25 days after pollination. The kernel embryos are isolated and incubated in a suitable medium (called embryo rescue medium) suitable for maintaining the viability of the embryos. In one embodiment, the rescue medium used for measuring the haploid induction ratio (HIR) contains 4.43 grams of Murashige and Skoog basal medium with vitamins, 30 grams of sucrose and 70 mg of salicylic acid. The embryos in the rescue medium are placed under conditions that allow the expression of the color indicator gene (e.g., R1-SCM2). In an exemplary embodiment, the embryos are placed under 100-400 micromolar light at 22-31° C. for 16-24 hours until some of the embryos turn purple due to expression of the R1-SCM2 gene (see, for example, the protocol described in WO 2015 / 104358). Purple (diploid) and cream (haploid) embryos can be counted from each panicle. The frequency of haploids, known as HIR or haploid induction ratio, can be determined based on the number of haploids relative to the total embryos. Optionally, a colchicine treatment is applied at some point during this process to induce genome doubling. See generally Maluszynski, et al., eds., DOUBLED HAPLOID PRODUCTION IN CROP PLANTS: A MANUAL (2003). See also WO 2002 / 085104, incorporated herein by reference. In one embodiment, colchicine is added simultaneously to the rescue medium described above.
[0254] Step 5. The DIP seeds are sown so that they are nicked (the shedding of their pollen occurs simultaneously with the ear being received (silking) by the progeny CMS-converted haploid plants) and used as pollen donors when the haploid plants flower. Optionally, however, the pollen stored or preserved here can simply be used as donors for the flowering haploid plants.
[0255] Step 6. Harvest and genotype haploid plants. Plants with the paternal genotype of the CMS cytoplasmic markers and other assays are confirmed as paternal haploids. At a minimum, the haploids are genotyped for the CenH3 gene, and the haploids contain the wild type (unedited) allele. If tested, the haploids have the rf4 allele and the other allele from the DIP (paternal) genome. The haploids are expected to be male sterile from the CMS cytoplasm and rf4 allele, regardless of whether they were treated with doubling agents. In other words, a putative haploid plant (sorted by embryo color) can be optionally confirmed as a cytoplasmic exchange haploid by genotyping if, as a result of genotyping, it does not have the edited CenH3 allele, has the CMS cytoplasmic genotype markers, and all other nuclear markers show up as DIP parent calls (not CHIP).
[0256] Step 7. The haploid plants are pollinated with DIP parent pollen. If the haploids are not treated with chemical doubling agents, any fruit set (implied female fertility) is the result of the natural biological process of spontaneous doubling of the female inflorescence (panicle), known to be common in maize germplasm. Treatment of the embryo with chemical doubling agents can improve the fruit set of the panicle by generating doubled haploid regions. Overall, without wishing to be bound by theory, it is expected that the CMS cytoplasmic exchange pipeline can be performed with or without the doubling step with almost any maize germplasm, due to the fact that haploid panicles have some ovules or embryo sacs that spontaneously double, and that they can be fertilized, e.g., backcrossed, by the recurrent parent pollen such that the pure "HaploidBC1" will fruit. HaploidBC1 is a cross between the recurrent parent and the haploid genome, and if there is any change in the parent line (i.e. if the recurrent parent is not a fixed inbred line), that change can be evident in the different cytoplasmic exchange lines that emerge from the process.
[0257] Step 8. After maturity and drying, the pollinated ears of the haploid plants are harvested and the resulting seeds are sown together with the DIP parent (again acting as the pollen donor). Crossing is performed again to increase the seeds of the CMS lines. In this generation, the CMS lines can be genotyped again to confirm the transformation status and purity and to verify the absence of CHIP nuclear DNA (containing the Rf4 and CenH3 mutation markers).
[0258] Step 9. If it is desired to produce hybrid seeds, the CMS cytoplasmic exchange lines can be planted as females together with the male lines. The female CMS lines should be male sterile so that they can be easily crossed by pollinators without significant human intervention in the hybrid production field.
[0259] [Table 14-1] [Table 14-2]
Claims
1. 1. A method for conferring cytoplasmic male sterility (CMS) to a plant line, comprising: a. Obtaining a first plant (CHIP) containing CMS cytoplasm, which is a haploid derivative; b. Obtaining a second plant (DIP) that contains the desired nuclear genome; and c. crossing the first plant with the second plant; and d. generating progeny therefrom, i. the progeny comprises the CMS cytoplasm and the desired nuclear genome. The method includes:
2. The method of claim 1, wherein the CMS cytoplasm is selected from the group consisting of CMS-C, CMS-S, and CMS-T.
3. The method of claim 2, wherein the CMS cytoplasm is CMS-C.
4. 2. The method of claim 1, wherein the CHIP is female fertile and the CMS is male fertile.
5. 2. The method of claim 1, wherein the CHIP is female fertile and the CMS is male sterile.
6. The method of claim 4, wherein the CHIP is a paternal haploid derivative.
7. The method of claim 6 , wherein the CHIP comprises a cenh3 mutation.
8. The method of claim 7 , wherein the cenh3 mutation is a knockout mutation.
9. The method of claim 8, wherein the cenh3 knockout mutation is obtained by gene editing.
10. 10. The method of claim 9, wherein the cenh3 knockout mutation comprises SEQ ID NO:5 or SEQ ID NO:
6.
11. The method of claim 10, wherein the cenh3 knockout mutation is heterozygous.
12. The method of claim 11, wherein the cenh3 knockout mutation is edited using CRISPR-Cas12a.
13. The method of claim 12, wherein the CRISPR-Cas12a is selected from the group consisting of AsCas12a, LbCas12a, and FnCas12a, MbCas12a, Mb2Cas12a, and the like.
14. The method of claim 13, wherein the CRISPR-Cas12a is LbCas12a.
15. The method of claim 7, wherein the CHIP further comprises an anthocyanin marker.
16. The method of claim 15, wherein the anthocyanin marker is selected from the group consisting of R1-navajo and R1-SCM2.
17. The method of claim 16, wherein the anthocyanin marker is R1-navajo.
18. The method of claim 16, wherein the anthocyanin marker is R1-SCM2.
19. The method of claim 16, wherein the anthocyanin marker is homozygous.
20. The method of claim 7, wherein the CHIP further comprises a restoration allele.
21. 21. The method of claim 20, wherein the restorer allele is selected from the group consisting of Rf3, Rf4, Rf10, Rf11 and Rf12.
22. 6. The method of claim 5, wherein the CHIP comprises a non-restoring allele, the non-restoring allele being selected from the group consisting of rf3, rf4, rf10, rf11 and rf12.
23. 22. The method of claim 21 , wherein the restoring allele is Rf4.
24. 23. The method of claim 22, wherein the non-restoring allele is rf4.
25. 24. The method of claim 23, wherein the restored allele is homozygous.
26. 25. The method of claim 24, wherein the non-restoring allele is homozygous.
27. The method of claim 1, wherein the CHIP comprises a cenh3 mutation, an R1-navajo marker, and a restorer allele of the restorer 4 gene.
28. The method of claim 1, wherein the CHIP comprises a cenh3 mutation, an R1-SCM2 marker and a restorer allele of the restorer factor 4 gene.
29. 2. The method of claim 1, wherein the CHIP comprises a cenh3 mutation, an R1-navajo marker, and a non-restoring allele of the restorer 4 gene.
30. The method of claim 1, wherein the CHIP comprises a cenh3 mutation, an R1-SCM2 marker and a non-restoring allele of the restorer 4 gene.
31. 2. The method of claim 1, wherein the CHIP is selected from the group consisting of corn, wheat, rice, sunflower, tomato, barley, brassica, cucumber and watermelon.
32. 32. The method of claim 31 , wherein the CHIP is corn.
33. 2. The method of claim 1, wherein the DIP is a pollen donor in the cross of step c.
34. The DIP of claim 1 that is homozygous or heterozygous for the non-restored allele.
35. 35. The DIP of claim 34, which is homozygous for the non-restoring allele.
36. 36. The restorer of claim 35, wherein the non-restoring allele is selected from the group consisting of rf3, rf4, rf10, rf11 and rf12.
37. 37. The restorer of claim 36, wherein the non-restoring allele is rf4.
38. 2. The method of claim 1, wherein the DIP is selected from the group consisting of corn, wheat, rice and sunflower, tomato, barley, brassica, cucumber and watermelon.
39. 39. The method of claim 38, wherein the DIP is corn.
40. 10. A plant produced by the method of claim 1, wherein the plant is a CMS haploid plant.
41. 41. The CMS haploid plant of claim 40, comprising the CMS cytoplasm of the CHIP and the nuclear genome of the DIP.
42. 42. The CMS haploid plant of claim 41, lacking anthocyanin markers, a restoration allele and a cenh3 knockout mutation.
43. 43. The CMS haploid plant of claim 42, which has been treated with a doubling agent.
44. 44. The doubling agent of claim 43, selected from the group consisting of colchicine, pronamide, dithipyr, trifluralin, nitrous oxide or another known anti-microtubule agent.
45. 45. The doubling agent of claim 44 which is colchicine.
46. 43. The CMS haploid plant of claim 42, pollinated with pollen from said DIP.
47. 43. The CMS haploid plant of claim 42, which is pollinated with stored pollen.
48. 41. The CMS haploid plant of claim 40, wherein the CMS has been confirmed by genotyping or other molecular analysis.