qPCR Method and Kit with Improved Specificity and Sensitivity
By using a non-fluorescent competitive probe to suppress non-specific signals from wild-type nucleic acids, the PCR method achieves improved sensitivity and specificity for detecting mutant strains, addressing the limitations of current PCR techniques.
Patent Information
- Application Number
- JP2024569026
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-22
- Filing Date
- 2023-06-22
- Publication Date
- 2025-06-12
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current PCR methods face challenges in achieving sufficient sensitivity and specificity for detecting mutant strains, particularly when wild-type nucleic acid sequences are present in high concentrations, leading to false positives and difficulties in distinguishing variants.
The introduction of a non-fluorescent competitive probe (Com probe) that matches the wild-type sequence but not the mutant sequence, which suppresses non-specific signals from wild-type nucleic acids and enhances the detection specificity of mutant nucleic acids.
This approach effectively reduces non-specific signals from high-concentration wild-type samples, improving the positive detection rate and specificity of mutant nucleic acids, thereby enhancing the accuracy and sensitivity of mutant detection.
Smart Images

Figure 2025517952000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method and kit for enhancing the specificity and sensitivity of real-time polymerase chain reaction (PCR) for the discrimination and detection of specific gene variants. More specifically, the present invention relates to a qPCR method and kit that suppress the amplification of wild-type (non-mutated) nucleic acid sequences by fluorescent probes used for the detection of mutations, and enhance the positive detection rate and detection specificity of mutant nucleic acids, thereby enhancing the accuracy and sensitivity of the discrimination between mutant and wild-type nucleic acid sequences and enabling easier discrimination or detection of mutations.
Background Art
[0002] As a method for discriminating nucleic acid sequence variations, a qPCR (quantitative real time PCR) method applying the following molecular diagnostic methods is generally used for examining single nucleotide polymorphisms (hereinafter referred to as SNPs). The qPCR method has advantages such as being the most widely used, rapid, having high sensitivity and specificity, low analysis cost, and being easily automatable.
[0003] The qPCR method is known as an analysis method using TaqMan probes, which are a type of hydrolysis probe. The basic principle applied to this is to utilize the 5'→3' exonuclease activity possessed by Taq DNA polymerase (Holland P.M. et al., 1991. Proc. Natl. Acad. Sci., 88:7276-7280). In 1991, Holland et al. revealed that when using a probe with a base sequence complementary to the template DNA, a specific PCR reaction can be confirmed in real time by the 5'→3' exonuclease activity of Taq DNA polymerase. Subsequently, various qPCR techniques utilizing probes modified with fluorescent dyes were developed based on this method and have been widely utilized in various fields (Heid, C.A. et al., 1996. Genome Res. 6.986-994.; Livak K.J. 1999. Genet. Anal., 14:143-149).
[0004] The method using hydrolysis probes uses a probe with a reporter and a quencher attached to both ends together with primers during the PCR reaction, and utilizes the principle of fluorescence resonance energy transfer. That is, when the reporter and the quencher are adjacent, energy transfer occurs from the reporter to the adjacent quencher, and fluorescence is not detected. However, as the PCR amplification product increases, the probe bound to the target gene is decomposed by the 5'→3' nuclease activity of Taq DNA polymerase, and the fluorescence of the reporter diverges. The TaqMan probe assay, which is an analytical method using hydrolysis probes, is very important to find the optimal conditions under which the probe binds to the target base sequence and subsequent decomposition of the probe can occur by nuclease activity. That is, the PCR conditions (thermal profile) under which the primers and probes used in PCR hybridize to the target sequence and the probe can be decomposed simultaneously are important. To meet these two requirements, two-step PCR is generally applied. That is, a denaturation step is performed at 95°C, and extension is performed after annealing at a temperature 7 to 10°C lower than the Tm of the probe. If the reaction of the second step is carried out at a very high temperature, the probe will be separated from the target rather than decomposed by the 5'→3' nuclease activity of Taq DNA polymerase, and the fluorescence will not increase (Logan, J. et al. 2009. Caister Academic Press). The TaqMan TM (dual labeled) probe has the advantage that SNP detection or mutation analysis can be performed using various fluorescent substances. However, in this method, in order to impart specificity to the probe, a short probe must be used, and therefore, the Tm value inevitably becomes low, making it difficult to maintain a stable annealing state.
[0005] To overcome this, there is a disadvantage that expensive MGB (Miner Groove Binder) probes or LNA (Locked Nucleic Acid) probes must be used (Letertre, C. et al. 2003. Mol. Cell Probes, 17: 307-311). The MGB TaqMan probe is similar to a general TaqMan probe, but by adding a minor groove binding part to the 3' end, even if the probe length is short, the Tm is high, so it can maintain a stable annealing state under PCR conditions (Kutyavin, I. V. et al. 2000. Nucleic Acids Res., 28: 655-661).
[0006] Sometimes, the ARMS (Amplification Refractory Mutation System) PCR principle is applied together with TaqMan probes to analyze SNPs without using a separate modified probe such as MGB (Ellison, G. et al. 2010. J. Exp. Clin. Cancer Res., 29: 132). However, in the ARMS PCR method, it is very difficult to find the optimal PCR conditions for differentiating SNPs (Punia P. and SAunders. N. http: / / www.horizonpress.com / pcrbooks). Also, when a large amount of wild-type gene is contained during ARMS PCR, high false positive detections frequently occur.
[0007] SARS-CoV-2 (Covid-19) is an RNA virus, and genetic sequence mutations occur during the replication process in the bodies of animals such as humans. Such sequence mutations lead to the emergence of clinically important mutant strains such as the Delta mutant strain (B.1.617.2), the Omicron mutant strain (BA.1), and the Stealth Omicron mutant strain (BA.2). The said mutant strains are of hygienic importance such as increased infectivity and enhanced pathogenicity. In the case of a pandemic or endemic, the emergence of new mutant strains has become frequent, and monitoring such mutant strains is necessary for hygienic dynamic research such as the occurrence frequency, timing, and distribution of mutant strains, and can provide very important information for grasping the fatality rate and transmission power of each mutant strain.
[0008] As a result, global health authorities including the World Health Organization (WHO) classify similar genetic mutant populations into lineages or clades and designate and manage them as Variants of Concern (VOC) or Variants of Interest (VOI).
[0009] The treatment effects such as vaccines and antibody therapeutics can be reduced by mutant lineages, and the sensitivity of antigen tests or PCR tests for infection and treatment monitoring can also be reduced. As a result, at health authorities and medical sites, etc., an effective and economical method for differentially detecting mutant strains is needed.
[0010] In the case of a virus such as SARS-CoV-2, it is reported that the viral load in clinical specimens varies from 3 to 10 log copies / ml depending on the progression of the patient's illness (D. Jacot, G. Greub, K. Jaton et al., https: / / doi.org / 10.1016 / j.micinf.2020.08.004).
[0011] A high viral load indicates a low Ct value when detecting the presence or absence of infection using PCR, which can be a factor facilitating diagnosis. However, during the diagnosis of variants, a high viral load can cause false positives due to non-specific detection.
[0012] The threshold can be increased by the amount of contamination sources that nourish non-specific detection. In the case of non-mutated wild-type sequences, it can act as a contamination source that interferes with variant-specific detection. Therefore, a high wild-type (non-mutated) viral load generates non-specific fluorescence signals, increasing the possibility of false positives.
[0013] There are methods using sequence-specific primers such as AS-PCR (Allele Specific PCR) and ARMS-PCR as PCR methods for variant detection. However, this method has a high probability of non-specific amplification at the 3' end of the primer, especially in the case of a high viral load, making it difficult to distinguish variants. Usually, since the variant discrimination is 0.1% or more, false positives may appear when the wild-type viral load is 10 5 copies / reaction or more.
[0014] Another PCR method for variant detection is a method using hydrolysis probes that can distinguish the mutated part. To discriminate variants by this method, it is very important to control the Tm value of the hydrolysis probe. Generally, the use of fluorescence hydrolysis probes (hydrolysis probe, TaqMan probe, dual labeled probe) with a high Tm value results in a high fluorescence signal value due to hydrolysis such as RFU (relative fluorescence units) and high detection sensitivity. However, when the viral load of non-mutated samples is high, the non-specific binding of the probe increases, and the possibility of being determined as a false positive becomes high. On the other hand, when using a hydrolysis probe with a low Tm value, non-specific binding by non-mutated samples can be suppressed, but the possibility of being determined as a false negative increases in specimens with a low viral load.
[0015] To solve the above problems, a method of setting the length of a probe having an appropriate Tm value or finely adjusting the temperature conditions of PCR is applied, but it is not easy to overcome the above problems. Further, as one solution to overcome the above problems, an MGB (Minor Groove Binder) probe having a relatively short length sequence can be applied, but the cost is very high.
[0016] Thus, there are still technical limitations in methods that can show sufficient sensitivity and specificity from clinical samples with various virus amounts and can distinguish mutants.
Summary of the Invention
Problems to be Solved by the Invention
[0017] An object of the present invention is to provide a PCR kit and a PCR method that show sufficient sensitivity and specificity from clinical samples with various virus loads and can easily distinguish mutants.
[0018] In particular, an object of the present invention is to provide a PCR kit and a PCR method that can accurately identify trace mutants coexisting with a wild-type gene present in a large amount with high accuracy.
Means for Solving the Problems
[0019] The inventors of the present invention invented a method for economically implementing mutant detection PCR having high sensitivity and high specificity, which is an object of the present invention, by adding a non-fluorescent competitive probe ( com petition probe; hereinafter referred to as a Com probe) corresponding to a fluorescent detection probe for mutant discrimination to a PCR solution. The term "Com probe" encompasses the meaning of competing with a fluorescent detection probe and hybridizing to a non-mutant target base sequence.
[0020] In real-time PCR for confirming the presence or absence of a mutant of a template containing a target base sequence at which a high probability of mutation is known, the present invention uses a fluorescence hydrolysis probe for target base sequence mutation classification and a co-probe for suppressing non-specific signals of a non-mutated (wild-type) target base sequence.
[0021] In the present invention, the fluorescence hydrolysis probe has a sequence that matches the mutant target base sequence and has one or more, preferably 1 to 3, more preferably 1 or 2 different amino acids in the amino acid sequence from the non-mutated target base sequence. Generally, when there is one or more mismatches between the probe and the template, the hybridization firmness is weak, and the probe dissociates before hydrolysis by the 3'-nuclease of the enzyme during the polymerization process of DNA polymerase. However, when an excessive amount of non-mutated template is present, hydrolysis of a small amount of non-dissociated fluorescence probe occurs, generating non-specific signals (see A in Figure 4). In the present invention, in order to suppress the generation of non-specific signals generated by an excessive amount of non-mutated template, a co-probe that matches the sequence of the non-mutated template is provided. At this time, the co-probe does not contain a fluorescent substance and is not linked to a fluorescent substance. After the co-probe binds to the non-mutated template (wild type, WT) present in excess in the sample, displacement does not occur, so the generation of non-specific signals by the fluorescence hydrolysis probe can be suppressed. In addition, since the added co-probe is mismatched with the sequence of the mutant strain, it has no effect on the hydrolysis of the fluorescence hydrolysis probe that matches the mutant strain sequence, facilitating the detection of mutants by qPCR (B in Figure 4).
[0022] As described above, the method of adding the Com probe of the present invention to qPCR can provide the effect of suppressing the non-specific signal value (decrease in threshold) that appears in a high-concentration non-variant (wild-type) sample caused by the use of a high-Tm mutation-specific fluorescent probe. The present invention provides a method of introducing a non-fluorescent Com probe having a sequence that matches the non-mutant (wild-type) template and mismatches the mutant region of the mutant template, and provides a method of enhancing the positive detection and specificity of the mutant. The method of the present invention is hereinafter named "STexS II (SNP Typing with excellent specificity II)".
Advantages of the Invention
[0023] When the method or kit of the present invention is used, it is possible to achieve the effect of controlling the high non-specific signal caused by a high-concentration wild-type sample in the mutant detection qPCR test by adding a Com probe.
[0024] The method or kit of the present invention solves the problem of low positive detection rate due to the high threshold value that appears when using a fluorescent hydrolysis probe having a high Tm value by adding a Com probe to qPCR, and takes advantage of the low Ct value, small deviation of Ct values, and high signal of qPCR when applying a high-Tm fluorescent hydrolysis probe, reduces the high threshold value, which is a disadvantage, and provides the effect of enhancing positive detection.
Brief Description of the Drawings
[0025] Figure 1 shows the influence of qPCR by the change in the length (Tm value) of the fluorescent hydrolysis probe for mutation detection.
[0026] As fluorescence hydrolysis probes, FAM-Cov19-Q954H(a), FAM-Cov19-Q954H-1(b), and FAM-Cov19-Q954H-3(c) were used for Q954H detection, JOE-Cov19-T547K-1(d), JOE-Cov19-T547K-3(e), and JOE-Cov19-T547K-5(f) were used for T547K detection, and FAM-Cov19-T19R-S1(g), FAM-Cov19-T19R-S2(h), and FAM-Cov19-T19R-S3(i) were used for T19R detection. As the template, a standard plasmid was used. -△- represents 5x10 3 copy number, -○- represents 5x10 2 copy number, -□- represents 5x10 1 copy number of the mutant test group, -◇- represents 5x10 7 copy number of the non-mutant wild-type test group, and -X- represents the control group without added template.
[0027] Figure 2 shows the results of testing the degree of non-specific PCR signal suppression by the addition amount of the commiscible probe.
[0028] In the drawings, b, e, and h are the test groups using 0.5 μM of the commiscible probe, c, f, and i are the test groups using 1.0 μM of the commiscible probe, and a, d, and g are the control groups without addition. At this time, the type, usage amount of the template DNA for each target mutation, and the conditions of qPCR are as shown in Figure 1. As the template, a standard plasmid was used. -△- represents 5x10 3 copy number, -○- represents 5x10 2 copy number, -□- represents 5x10 1 copy number of the mutant test group, -◇- represents 5x10 7 copy number of the non-mutant wild-type test group, and -X- represents the control group without added template.
[0029] Figure 3 shows the inhibitory effect of the increase in the Tm of the commiscible probe on the non-specific PCR signal.
[0030] The fluorescent probe FAM-Cov19-Q954H-3 was used at 0.75 μM for Q954H detection, and the com-probes were tested at 0.5 μM each for no addition (a), Cov19-Q954-Com-1 (b), and Cov19-Q954-Com-2 (c). Other qPCR conditions were as shown in Figure 1. A standard plasmid was used as the template, -△- represents 5x10 3 copies, -○- represents 5x10 2 copies, -□- represents 5x10 1 copies in the mutant test section, -◇- represents 5x10 7 copies in the non-mutant wild-type test section, and -X- represents the control section without template.
[0031] Figure 4 is a schematic diagram showing the principle of controlling the qPCR non-specific signal by wild-type samples when com-probes are added.
[0032] A. Explain the qPCR signal generated in the test section without com-probe. The qPCR diagram on the right is an example of the test result without com-probe, showing the qPCR in a of Figure 3 as a logarithmic function graph, where a represents 5x10 3 copies in the mutant test section, and b represents 5x10 7 copies in the non-mutant wild-type test section.
[0033] B. A diagram explaining the principle of suppressing the qPCR non-specific signal by adding com-probes. The qPCR diagram on the right is an example of the test result with com-probe added, showing the qPCR in c of Figure 3 as a logarithmic function graph, where a represents 5x10 3 copies in the mutant test section, and b represents 5x10 7 copies in the non-mutant wild-type test section.
[0034] Figure 5 shows the deviation of Ct values by qPCR conditions (A) and the results of repeated Q954H detection tests for threshold setting (B).
[0035] -△- represents the test section using 3x10 1 copies of pCov19-S-Q954 (mutant), and -◇- represents 1x107 This is the test group using multiple copies of pCov19-S-H954 (non-mutated). -X- is the control group without template. The test was repeated 10 times using a fluorescence hydrolysis probe and a comm probe as shown in Table 6. Table 6 shows the Ct value (A) of each qPCR test, the derived qPCR threshold, and positive detection (B).
[0036] Figure 6 shows the deviation of Ct values by qPCR conditions (A) and the results of the T547K detection repeated test for threshold setting (B).
[0037] -△- is the test group using 3x10 1 copies of pCov19-S-T547 (mutated), and -◇- is the test group using 1x10 7 This is the test group using multiple copies of pCov19-S-K547 (non-mutated). -X- is the control group without template. The test was repeated 10 times using a fluorescence hydrolysis probe and a comm probe as shown in Table 6. Table 7 shows the Ct value (A) of each qPCR test, the derived qPCR threshold, and positive detection (B).
[0038] Figure 7 shows the RT-qPCR results using SARS-Cov2 RNA specimens.
[0039] The fluorescence hydrolysis probes used were FAM-Cov19-Q954H (a), FAM-Cov19-Q954H-3 (b and d), JOE-Cov19-T547K-1 (d), and JOE-Cov-T547K-5 (e and f), and the comm probes used were Cov19-Q954-Com-2 (c) and Cov19-T547-Com-3 (f). For each reaction, NCCP No.43408 RNA was used in an amount corresponding to 2x10 4 (-△-), 2x10 3 (-○-) copies. The detection tests for Q954H (-▲-) and T547K (-●-) using NCCP No.43326 RNA were performed at 2x10 7 copies.
BEST MODE FOR CARRYING OUT THE INVENTION
[0040] The present invention relates to (a) one or more templates containing a target base sequence at a position with a high probability of mutation, (b) a forward primer and a reverse primer for the template, (c) a nucleic acid polymerase that polymerizes nucleic acids from the forward primer and the reverse primer, (d) a fluorescence hydrolysis probe that is complementary to the mutated target base sequence and binds to the mutated target base sequence, (e) a commiscible probe for suppressing non-specific signals of the non-mutated target base sequence, and relates to a qPCR kit for detecting mutants, characterized in that the commiscible probe for suppressing non-specific signals is complementary to the non-mutated target base sequence, preferentially binds to the non-mutated target base sequence rather than the mutated target base sequence, and has a structure in which the 3'-end is not extended by a nucleic acid polymerase.
[0041] The present invention also relates to a qPCR kit for detecting mutants, characterized in that the fluorescence hydrolysis probe is complementary to the mutated target base sequence, consists of 10 to 30 nucleotides, and the 5'-end and 3'-end are modified with a reporter and a quencher capable of fluorescence resonance energy transfer, respectively.
[0042] The present invention also relates to a qPCR kit for detecting mutants, characterized in that the commiscible probe for suppressing non-specific signals consists of 10 to 40 nucleotides complementary to the non-mutated target base sequence, does not contain a fluorescent or chromogenic agent, and is not linked to a fluorescent or chromogenic agent.
[0043] The present invention also relates to a qPCR kit for detecting mutants, characterized in that the commiscible probe for suppressing non-specific signals has the same number of bases as the fluorescence hydrolysis probe or is 1 to 10 bases longer.
[0044] The present invention also relates to a qPCR kit for mutant detection, wherein the commprobe for non-specific signal suppression has the same Tm value as the fluorescent hydrolysis probe or has a high Tm value.
[0045] The present invention also relates to a qPCR kit for mutant detection, which is characterized by having a structure that prevents extension by a nucleic acid polymerase at the 3'-end of the commprobe for non-specific signal suppression. As the structure that prevents extension by a nucleic acid polymerase at the 3'-end, a structure in which a 3' terminal modifier is bound or modified to the 3'-end of the commprobe may be used, but it is not limited to such a structure in which a 3' terminal modifier is bound or modified. The 3' terminal modifier is not particularly limited, and examples thereof include 3'-Phosphate, 3'-Spacer C3, 3'-ddC, 3'-Inverted End, and the like.
[0046] The present invention also relates to (a) one or more templates containing a target base sequence at a position with a high probability of mutation, (b) a forward primer and a reverse primer for the template, (c) a DNA polymerase that polymerizes DNA from the forward primer and the reverse primer, (d) a fluorescent hydrolysis probe for mutation discrimination that is complementary to the mutant target base sequence and binds to the mutant target base sequence, and is used in a qPCR method for mutant detection or a qPCR kit for mutant detection, The present invention relates to a commprobe for non-specific signal suppression that is complementary to a non-mutant target base sequence, preferentially binds to the non-mutant target base sequence over the mutant target base sequence, has a structure in which the 3'-end is not extended by a DNA polymerase, and suppresses non-specific signals of the non-mutant target base sequence to improve the specificity of mutant detection.
[0047] Further, the present invention is characterized in that the commprobe for non-specific signal suppression consists of 10 to 40 nucleotides complementary to a non-mutated target base sequence, does not contain a fluorescent or chromogenic agent, and is not linked to a fluorescent or chromogenic agent.
[0048] Further, the present invention is characterized in that the commprobe for non-specific signal suppression has the same number of bases as the fluorescent hydrolysis probe or is 1 to 10 bases longer.
[0049] Further, the present invention is characterized in that the commprobe for non-specific signal suppression has the same Tm value as the fluorescent hydrolysis probe or has a higher Tm.
[0050] Further, the present invention relates to a commprobe for non-specific signal suppression, which has a structure that prevents extension by a nucleic acid polymerase at the 3'-end of the commprobe. The structure that prevents extension by a nucleic acid polymerase at the 3'-end of the commprobe may be one in which a 3' terminal modifier is bound or modified to the 3'-end of the commprobe, but is not limited to such a structure. Further, the 3' terminal modifier is not particularly limited, and examples include 3'-Phosphate, 3'-Spacer C3, 3'-ddC, 3'-Inverted End, and the like.
[0051] Further, the present invention relates to a commprobe for non-specific signal suppression, wherein the fluorescent hydrolysis probe is complementary to a mutated target base sequence, consists of 10 to 30 nucleotides, and the 5'-end and 3'-end are each modified with a reporter and a quencher capable of fluorescence resonance energy transfer.
[0052] Further, the present invention (A) adding a non-specific signal suppression Comprobe, which is complementary to the non-mutated target base sequence, preferentially binds to the non-mutated target base sequence over the mutated target base sequence, and has a structure that cannot be extended at the 3' end by a nucleic acid polymerase, to a mutant detection qPCR reaction solution containing one or more templates containing a target base sequence with a high probability of mutation, a forward primer and a reverse primer for the template, a nucleic acid polymerase that polymerizes nucleic acids from the forward primer and the reverse primer, and a fluorescent hydrolysis probe for mutation discrimination that is complementary to the mutated target base sequence and binds to the mutated target base sequence; and (B) After the step (A), performing a polymerase chain reaction to detect a gene mutant with high specificity.
[0053] The present invention also relates to (C) obtaining an amplification curve from the reaction in the step (B); and (D) determining whether the target base sequence contains a mutation from the amplification curve, and further relates to a method for detecting a gene mutant.
[0054] The present invention also relates to a method for detecting a gene mutant, wherein one or more bases at the 3' end of the forward primer correspond to a position with a high probability of mutation in the target base sequence.
[0055] The present invention also relates to a method for detecting a gene mutant, wherein the mutation is a single nucleotide polymorphism.
[0056] The present invention also relates to a method for detecting a gene mutant, wherein the nucleic acid polymerase is a thermostable DNA polymerase.
[0057] The present invention also relates to a method for detecting a gene mutant, wherein the nucleic acid polymerase is a wild-type or mutant DNA polymerase.
[0058] The present invention also relates to a method for detecting a gene mutant, wherein the non-specific signal suppression Comprobe consists of 10 to 40 nucleotides.
[0059] The present invention also relates to a method for detecting a gene variant, wherein the non-specific signal suppressing commprobe has the same number of bases as the fluorescence hydrolysis probe or is 1 to 10 bases longer.
[0060] The present invention also relates to a method for detecting a gene variant, wherein the non-specific signal suppressing commprobe has the same Tm value as the fluorescence hydrolysis probe or has a higher Tm.
[0061] The present invention also relates to a method for detecting a gene variant, which is characterized by having a structure that prevents extension by a nucleic acid polymerase at the 3'-end of the non-specific signal suppressing commprobe. Examples of the structure that prevents extension by a nucleic acid polymerase at the 3'-end of the commprobe include, but are not limited to, those in which a 3' terminal modifier is bound or modified to the 3'-end of the commprobe. The 3' terminal modifier is not particularly limited, and examples include 3'-Phosphate, 3'-Spacer C3, 3'-ddC, 3'-Inverted End, and the like.
[0062] The present invention also relates to a method for detecting a gene variant, wherein the fluorescence hydrolysis probe is complementary to the mutated target base sequence, consists of 10 to 30 nucleotides, and the 5'-end and 3'-end are each modified with a reporter and a quencher capable of fluorescence resonance energy transfer.
[0063] The present invention also relates to 1) A commprobe comprising the amino acid sequence of TGGTCAACCAAAATGCACAAG and having a structure that prevents extension by a nucleic acid polymerase at the 3'-end; 2) A commprobe comprising the amino acid sequence of GTGGTCAACCAAAATGCACAAGC and having a structure that prevents extension by a nucleic acid polymerase at the 3'-end; 3) A Comprobe that includes the amino acid sequence of TCAATGGTTTAACAGGCACAGGTG and has a structure that prevents extension by a nucleic acid polymerase at the 3'-end; and 4) A Comprobe that includes the amino acid sequence of GTGTGTTAATCTTACAACCAGAACTCA and has a structure that prevents extension by a nucleic acid polymerase at the 3'-end; and is one or more selected from the above, and relates to a Comprobe that improves the specificity and sensitivity of PCR for detecting SARS-Cov-2 variants. The structure that prevents extension by a nucleic acid polymerase at the 3'-end of the Comprobe includes, but is not limited to, those in which a 3' terminal modifier is bound or modified to the 3'-end of the Comprobe. Further, the 3' terminal modifier is not particularly limited, and examples include 3'-Phosphate, 3'-Spacer C3, 3'-ddC, 3'-Inverted End, etc.
[0064] The present invention also relates to a PCR kit for detecting SARS-Cov-2 variants that includes the above Comprobe.
[0065] The present invention also relates to a highly specific and sensitive detection method for detecting SARS-Cov-2 variants from a sample using the above PCR kit for detecting SARS-Cov-2 variants.
Mode for Carrying Out the Invention
[0066] Hereinafter, the configuration of the present invention will be described in more detail based on specific examples and test examples. However, it is obvious to those having ordinary knowledge in the technical field to which the present invention belongs that the scope of the present invention is not limited to the scope described in the examples and test examples. SARS-Cov-2 RNA sample As SARS-CoV-2 RNA samples, three standard pathogen resources (NCCP43326, NCCP43410, NCCP43408) obtained through transfer from the National Pathogen Resource Bank were used. Among the RNA samples obtained through transfer, NCCP43326 is the wild-type Covid 19, NCCP43410 is the Delta variant, and NCCP43408 is the Omicron variant (Table 1). The RNA samples were used while being stored frozen at -70°C. SARS-Cov-2 sequence comparison and mutation screening For sequence comparison of the variants, sequence information of the spike trimer coding region among the genomic sequences of each sample registered with the Global Initiative on Sharing All Influenza Data (GISAID) was compared and analyzed, and three mutations, namely, S:T19R (21618 C>G), S:T547K (23202 C>A), and S:Q954H (24424 A>T), were selected as sites for variant classification.
[0067] In Table 1, SARS-CoV-2 RNA samples and mutated sequences were compared.
[0068]
Table 1
[0069] Preparation of standard plasmid DNA sample Using the primer sets for standard plasmid production in Table 2 with three standard pathogen resource RNAs as templates, PCR products containing the T19R, T547K, and Q954H sites of the S gene of SARS-CoV-2 were produced, and then cloned into the pTOP-TA vector [manufactured by Enzynomics, South Korea] to produce three wild-type (pCov19-S-T19, pCov19-S-T547, pCov19-S-Q954) and three mutant (pCov19-S-R19, pCov19-S-K547, pCov19-S-H954) standard plasmid DNAs. Each standard plasmid DNA was cleaved with the restriction enzyme NotI, purified, and then diluted with sterilized distilled water to 1x10 8Copies / μL were prepared respectively. The DNA prepared in this way was stored frozen until used in the experiment. Primer / probe / comprobe and standard plasmid Table 2 shows the primer, probe, comprobe, and plasmid information used in the examples and test examples of the present invention.
[0070]
Table 2
[0071] Performance of qPCR The fluorescence hydrolysis probe for real-time detection used in qPCR was designed to have a base sequence capable of hybridizing to the amplification product, and in order to apply the fluorescence resonance energy transfer (FRET) principle, a probe with a fluorescent substance (such as FAM or JOE) attached to the 5' end and a quencher (BHQ1) attached to the 3' end was used. Also, the comprobe was attached with a phosphate group at the 3' end to prevent amplification by polymerase. The oligonucleotides used were produced using the applicant's GENOTECH oligonucleotide synthesis system.
[0072] Using each DNA sample prepared as described above as a template, real-time polymerase chain reaction was performed using primers, fluorescent hydrolysis probes, and comm probes prepared by testing. As primers for Q954H detection, Cov19-Q954H-F1 and Cov19-Q954H-R1 were used. As primers for T547K detection, Cov19-T547K-F and Cov19-T547K-R were used. For T19R detection, Cov19-T19R-F and Cov19-T19R-R were added at 0.5 - 0.75 μM each and used. The types and concentrations of the fluorescent probes and comm probes (Com probe) used in other test examples are described in each example. The polymerase and PCR buffer solution used were products from Enzynomics (cat no. RT 431M), and the total volume of the reaction solution was adjusted to 20 μL. Wild-type DNA standards for the detection test used pCov19-S-T19, pCov19-S-T547, pCov19-S-Q954, and for mutations, pCov19-S-R19, pCov19-S-K547, pCov19-S-H954 were used in the amounts as in the examples. At this time, qPCR was performed using the CFX9600 Real-Time System at 95°C for 10 minutes, then at 95°C for 10 - 15 seconds and 60°C for 10 - 15 seconds for 45 - 50 cycles. RT-qPCR (quantitative reverse transcription PCR) using SARS-CoV-2 RNA standards of three types of standard pathogen resources (NCCP43326, NCCP43410, NCCP43408) obtained by sublicense from the National Pathogen Resource Bank was performed at 50°C for 30 minutes and 95°C for 10 minutes, then at 95°C for 10 - 15 seconds and 60°C for 10 - 15 seconds for 45 - 50 cycles using the CFX9600 Real-Time System.
[0073] Example 1: Generation of non-specific signals in qPCR by the length of the fluorescent probe In this example, the changes in the qPCR signals and Ct values due to the length of the fluorescent hydrolysis probe for mutation detection were tested. Tests were conducted to detect T19R, T547K, and Q954H, which are the mutation regions of SARS-Cov-2, as mutants for the detection test. Using each DNA standard plasmid in Table 2 as a template, the test was carried out while increasing the bases of the fluorescent probe by 1 to 3 each to increase the Tm value (Figure 1 and Table 3). The templates used in the test were pCov19-S-Q954 (wild type) and pCov19-S-H954 (mutant type) for the Q954H mutation discrimination test, pCov19-S-T547 (wild type) and pCov19-S-K547 (mutant type) for the T547K mutation discrimination test, and Cov19-S-T19 (wild type) and pCov19-S-R19 (mutant type) standard plasmids for the T19R mutation discrimination test.
[0074] As a result of the test, using probes with 1 to 3 bases longer, such as b, e, h (using medium Tm probe) and c, f, i (using high Tm probe) in Figure 1, showed higher signals than using short specific probes (low Tm probe) as in a, d, g in Figure 1. Especially in the test using a low copy number (5x10 1 ), the use of long specific probes showed an effect of slightly lowering the Ct value (Table 3: Ct values of qPCR due to the increase in Tm of the probe for mutation detection). However, in order to obtain high signals and low Ct values, as a result of using long probes (high Tm probe), non-specific signals appeared in non-mutant test strains at a high concentration (10 7 copies / reaction) as shown in c, f, i in Figure 1. Therefore, in order to use a long probe (high Tm probe) with a high signal value, the threshold needs to be adjusted by increasing it through testing for accurate mutation discrimination. However, when increasing the threshold, the height of all signals decreases, and especially the Ct value increases, so the advantages of using long probes may be lost. Therefore, when using long probes, a new method that can suppress non-specific signals while maintaining high signals is required.
[0075]
Table 3
[0076] The detailed test content is as shown in Figure 1.
[0077] Example 2: Suppression of non-specific qPCR signals through the addition of comprobe When using a high-Tm mutant-specific fluorescent probe, high non-specific signals occur in high-concentration wild-type samples (c, f, i in Figure 1). This is a non-specific signal that appears because the mutant-specific fluorescent probe has a low binding force (hybridization), but binds to a certain level in a high-concentration wild-type sample and is decomposed by Taq DNA polymerase. As a method for controlling such non-specific signals, the inventors invented and added a competition probe (named "Com probe" from "Competition probe" or "Combination probe") that can preferentially bind to the wild-type sample over the fluorescent probe.
[0078] The Com probe was composed of a non-amplifying oligonucleotide (phosphorylated at the 3'-end) with the same sequence as the wild-type sequence containing the same sequence as the region where the mutant-specific probe binds.
[0079] For the specific tests in Example 2, high-Tm probes of FAM-Cov19-Q954H-3 for Q954H detection, JOE-Cov19-T547K-5 for T547K detection, and FAM-Cov19-T19R-S3 for T19R detection were each used at 0.75 μM, and the Com probe (com probe) was Cov19-Q954-Com-2 for Q954H detection, Cov19-T547-Com-3 for T547K detection, and Cov19-T19-Com-3 for T19R detection, respectively. The qPCR signal patterns and Ct values of the test groups added without addition and at concentrations of 0.5 - 1.0 μM were compared (Figure 2 and Table 4).
[0080] As a result, when the commiscible probe was not added, distinct non-specific signals were observed (a, d, g in Fig. 2). However, when the commiscible probe was added, the higher the concentration of the commiscible probe, the more significantly the non-specific signals decreased in the high-concentration wild-type test area. In particular, the addition of a high concentration of 1.0 μM commiscible probe had little effect on qPCR, and a distinct non-specific signal reduction effect was observed (b, e, h, c, f, i in Fig. 2). Especially in the mutant detection test with a very small amount (5x10 1 replication numbers), it also showed excellent qPCR detection ability. It was confirmed that even when the commiscible probe was added, the overall Ct value was maintained at the same level as when the commiscible probe was not added (Table 4: qPCR Ct values according to the amount of commiscible probe (Com probe) used).
[0081]
Table 4
[0082] Example 3: Effect by the length of comprobe To observe the effect of the length of the commiscible probe, the effects of a commiscible probe (Cov19-Q954-Com-1) with the same length as the fluorescent probe and a commiscible probe (Cov19-Q954-Com-2) that is 3 bases longer than the fluorescent probe were compared. At this time, the commiscible probe was tested at a concentration of 0.5 μM, which is less than the amount of 0.75 μM of the fluorescent probe used. As a result, a distinct suppression effect of non-specific signals was confirmed in the longer commiscible probe compared to the shorter commiscible probe against the non-specific signals generated when no commiscible probe was added (b, c in Fig. 3). The average Ct value at this time was the same as when no commiscible probe was added, or decreased as observed from Ct = 37.02 without addition to Ct = 36.44 with addition, similar to the replication number test results (Table 5). Such a decrease in the Ct value can provide favorable conditions for the detection of low-concentration samples. 1 The following Table 5 shows the Ct values of qPCR according to the length of the commiscible probe.
[0083]
[0084]
Table 5
[0085] In the mutation detection qPCR test with the addition of the Com probe in Examples 2 and 3, the clear control effect of the high non-specific signal caused by the high-concentration wild-type sample can be explained as shown in Fig. 4. Since the difference between the mutant template and the non-mutant template in the fluorescence probe is one base, it is not easy to make a clear distinction. However, when there is one or more mismatches between the probe and the template, the hybridization firmness is weak, and generally, the probe dissociates from the template before hydrolysis by the 3'-nuclease activity of Taq DNA polymerase during the DNA polymerization process. However, when an excessive amount of non-mutant (wild-type) template is present, a part of the fluorescence probe mismatched with the non-mutant template is decomposed by the 3'-nuclease of Taq DNA polymerase, and excessive non-specific signals are generated as shown in Fig. 4b. However, when a certain amount of Com probe is added as in the method of the present invention, competitive binding between the Com probe and the probe occurs with respect to the non-mutant template. In particular, since the Com probe is complementary to the non-mutant template sequence, it matches the non-mutant template sequence and no dissociation occurs, so non-specific signals generated by the hydrolysis of the fluorescence probe do not occur (Fig. 4d). Similarly, when the Com probe is added, the Com probe frequently dissociates because its sequence mismatches with the mutant strain. However, since the fluorescence probe matches the mutant strain sequence and hydrolysis by the 3'-nuclease easily occurs, the qPCR signal can be clearly confirmed (Fig. 4a, c).
[0086] Example 4: Threshold and positive detection through mutation detection qPCR replication test In order to more clearly verify the effect of the com probe as described in Example 3, repeated tests were carried out. To detect the Q954H mutation and the T547K mutation, the changes in Ct values and thresholds due to various types of probes with different Tm values, the amount of probe used, and the usage conditions of the com probe were tested by repeating qPCR 10 times. The specific conditions of the test are shown in Table 6 and Table 7. The Q954H repeated test conditions are as shown in Table 6, and the T547K test conditions are as shown in Table 7. First, the wild-type standard plasmid was tested 10 times at a copy number of 1x10 7 Based on the test results, the threshold of qPCR was determined. qPCR with Ct ≤ 40 that exceeded the determined threshold for each test group was defined as positive detection.
[0087] For the detection of the Q954H mutation, when the low-Tm probe (FAM-Cov19-Q954H) was used at a low concentration of 0.25 μM, the number of positive detections was as low as 5 (B in Figure 5 and test group a in Table 6). When the concentration of the low-Tm probe was increased to 0.5 μM, the number of positive detections slightly increased to 7 (B in Figure 5 and test group d in Table 6). At this time, the change in the threshold due to the increase in the usage amount was less than 300 for each, and was not large. To improve positive detection, a high-Tm probe (FAM-Cov19-Q954H-3) was used. However, in the test groups using 0.25 μM or 0.5 μM, the number of positive detections was not significantly improved because of the high thresholds of 800 and 1000 instead (B in Figure 5 and test groups b and e in Table 6). However, when the high-Tm probe (FAM-Cov19-Q954H-3) was used, the deviation of the Ct value decreased compared with the case when the low-Tm probe (FAM-Cov19-Q954H) was used, the Ct value also became smaller, and the signal height was also higher (b and e in Figure 5A, B). Looking at such results, when applying a method to reduce the high threshold, which is the cause of the small number of positive detections in qPCR when using a high-Tm probe, positive detection can be greatly improved.
[0088] Then, the inventors applied a Com probe capable of reducing the critical value to the test section where a high-Tm probe was applied and conducted tests. As predicted, when 0.5 μM of the Com probe (Cov19-Q954-Com-2) was added, the critical value could be set to 300 or less in both test sections using 0.25 μM and 0.5 μM of the high-Tm probe (FAM-Cov19-Q954H-3). With such a low critical value set, despite the application of the high-Tm probe, the number of positive detections increased, and the fast Ct value and small Ct value deviation, which are characteristics of the high-Tm probe, appeared (test sections c and f in Fig. 4 and Table 6).
[0089] Similar to the Q954H mutation detection test, in the T547K mutation detection test as well, as a result of applying a high-Tm probe and a Com probe, the critical value decreased, and a fast Ct value, small Ct value deviation, and high positive detection results could be obtained (Fig. 6 and Table 7).
[0090] Table 6 shows the Q954 mutation detection repeated test conditions and qPCR results.
[0091]
Table 6
[0092] Table 7 shows the repeated test conditions and qPCR results for T547K mutation detection.
[0093]
Table 7
[0094] Example 5: RT-qPCR test using SARS-Cov2 RNA specimens By applying the high-Tm probe according to the above embodiments, the advantages of low Ct value, small deviation of Ct value, and high signal are utilized, and the Com probe that reduces the critical value and increases the positive detection rate is directly applied to the SARS-Cov-2 RNA sample and evaluated by RT-qPCR. As the RNA samples, the RNA of the Omicron variant NCCP No. 43408 and the RNA of the wild strain NCCP No. 43326 were used. For the detection of Q954H, FAM-Cov19-Q954H was used as the low-Tm probe and FAM-Cov19-Q954H-3 was used as the high-Tm probe. For the detection of T547K, JOE-Cov19-T547K-1 was used as the low-Tm probe and JOE-Cov19-T547K-5 was used as the high-Tm probe, each at 0.5 μM. As the Com probe, Cov19-Q954-Com-2 was used for the detection of Q954H and Cov19-T547-Com-3 was used for the detection of T547K, each at 0.35 μM. At this time, each primer set used in the test was at 0.5 μM, and other test conditions were the same as those in the RT-qPCR test in the text.
[0095] First, the critical values for the NCCP No. 43326 RNA samples with the estimated number of replications of 2x10 7 When the high-Tm probe was applied, it increased to 1200 RFU (Q954H) and 500 (T547K) RFU, and when the Com probe was applied together, the critical value decreased to 200 RFU or less (g, h, i in Fig. 7). Applying this, RT-qPCR for the mutation detection of each Q954H and T547K was performed, and as in the test using the standard plasmid DNA (Example 4), very excellent improvement in positive detection was shown when the high-Tm probe and the Com probe were applied. Especially in the RNA samples with low concentrations, the decrease in Ct value was remarkable, and the positive detection also became clearer (test sections c and f in Fig. 7 and Table 8).
[0096] Table 8 shows the results of the RT-qPCR test using SARS-Cov2 RNA specimens.
[0097]
Table 8
[0098] *All test conditions were the same as those in Figure 7. The Ct value indicates the average value, and a positive detection was determined as a Ct value of 40 or less.
Industrial Applicability
[0099] The present invention is very useful when detecting gene mutations in various fields including healthcare, medicine, pharmacy, veterinary medicine, and the food field.
Claims
1. (i) one or more templates containing a target base sequence at a position with a high probability of mutation, (ii) a forward primer and a reverse primer for the template, (iii) a nucleic acid polymerase that polymerizes nucleic acids from the forward primer and the reverse primer, (iv) a fluorescence hydrolysis probe that is complementary to the mutant target base sequence and binds to the mutant target base sequence, (v) a commiscible probe for suppressing non-specific signals of the non-mutant target base sequence, and the commiscible probe for suppressing non-specific signals is complementary to the non-mutant target base sequence, preferentially binds to the non-mutant target base sequence rather than the mutant target base sequence, and has a structure in which the 3'-end is not extended by a nucleic acid polymerase, characterized in that it is a qPCR kit for mutant detection.
2. The fluorescence hydrolysis probe is complementary to the mutant target base sequence, consists of 10 to 30 nucleotides, and is a probe modified at the 5'-end and 3'-end with a reporter and a quencher capable of fluorescence resonance energy transfer, respectively, according to the qPCR kit for mutant detection described in Claim 1.
3. The commiscible probe for suppressing non-specific signals consists of 10 to 40 nucleotides complementary to the non-mutant target base sequence and does not contain a fluorescent or chromogenic agent, according to the qPCR kit for mutant detection described in Claim 1.
4. The commiscible probe for suppressing non-specific signals has the same Tm value as the fluorescence hydrolysis probe or a higher Tm, according to the qPCR kit for mutant detection described in Claim 1 or 3.
5. The commiscible probe for suppressing non-specific signals has the same number of bases as the fluorescence hydrolysis probe or is 1 to 10 bases longer, according to the qPCR kit for mutant detection described in Claim 1 or 3.
6. The 3'-end of the commiscible probe for suppressing non-specific signals has a structure in which a 3'-terminal modifier that prevents extension by a nucleic acid polymerase is bound or modified, according to the qPCR kit for mutant detection described in Claim 1.
7. (a) one or more templates containing a target base sequence at a position with a high probability of mutation, (b) a forward primer and a reverse primer for the template, (c) a DNA polymerase that polymerizes DNA from the forward primer and the reverse primer, (d) A qPCR method for mutant detection or a qPCR kit for mutant detection, which comprises a fluorescent hydrolysis probe for mutant discrimination that is complementary to the mutant target base sequence and binds to the mutant target base sequence. A commiscible probe for suppressing non-specific signals, which is complementary to the non-mutant target base sequence, preferentially binds to the non-mutant target base sequence rather than the mutant target base sequence, has a structure in which the 3'-end is not extended by DNA polymerase, and suppresses non-specific signals of the non-mutant target base sequence to improve the specificity of mutant detection. **Claim 8** The commiscible probe for suppressing non-specific signals according to claim 7, which consists of 10 to 40 nucleotides complementary to the non-mutant target base sequence and does not contain a fluorescent or chromogenic agent. **Claim 9** The commiscible probe for suppressing non-specific signals according to claim 7 or 8, which has the same Tm value as the fluorescent hydrolysis probe or has a higher Tm. **Claim 10** The commiscible probe for suppressing non-specific signals according to claim 7 or 8, which has the same number of bases as the fluorescent hydrolysis probe or is 1 to 10 bases longer. **Claim 11** The commiscible probe for suppressing non-specific signals according to claim 7 or 8, wherein the 3'-end thereof has a structure in which a 3'-terminal modifier that prevents extension by nucleic acid polymerase is bound or modified. **Claim 12** The commiscible probe for suppressing non-specific signals according to claim 7, wherein the fluorescent hydrolysis probe is complementary to the mutant target base sequence, consists of 10 to 30 nucleotides, and is a probe modified at the 5'-end and 3'-end with a reporter and a quencher capable of fluorescence resonance energy transfer, respectively. **Claim 13** (i) One or more templates containing a target base sequence at a position with a high probability of mutation, a forward primer and a reverse primer for the template, a nucleic acid polymerase for polymerizing nucleic acids from the forward primer and the reverse primer, and a mutant discrimination fluorescent hydrolysis probe that is complementary to the mutant target base sequence and binds to the mutant target base sequence, adding a non-specific signal suppression co-probe that is complementary to the non-mutant target base sequence, preferentially binds to the non-mutant target base sequence over the mutant target base sequence, and has a structure whose 3' end is not extended by the nucleic acid polymerase to the qPCR reaction solution for detecting mutants; and (ii) A method for detecting gene mutants with high specificity by performing a polymerase chain reaction after the step (i).
14. (iii) Obtaining an amplification curve from the reaction of the step (ii); and (iv) Determining whether the target base sequence contains a mutation from the amplification curve, the method for detecting a gene mutant according to claim 13, further comprising.
15. The method for detecting a gene mutant according to claim 13, wherein one or more bases at the 3' end of the forward primer correspond to a position with a high probability of mutation in the target base sequence.
16. The method for detecting a gene mutant according to claim 13, wherein the mutation is a single nucleotide polymorphism.
17. The method for detecting a gene mutant according to claim 13, wherein the nucleic acid polymerase is a thermostable DNA polymerase.
18. The method for detecting a gene mutant according to claim 13, wherein the nucleic acid polymerase is a wild-type or mutant DNA polymerase.
19. The method for detecting a gene mutant according to claim 13, wherein the non-specific signal suppression co-probe consists of 10 to 40 nucleotides.
20. The method for detecting a gene mutant according to claim 13, wherein the non-specific signal suppression co-probe has the same Tm value as the fluorescent hydrolysis probe or has a higher Tm.
21. The method for detecting a gene mutant according to claim 13, wherein the 3' end of the non-specific signal suppression co-probe has a structure in which a 3' terminal modifier that prevents extension by the nucleic acid polymerase is bound or modified.
22. The method for detecting a gene variant according to claim 13, wherein the fluorescence hydrolysis probe is complementary to the mutant target base sequence, consists of 10 to 30 nucleotides, and the 5'-end and 3'-end are modified with a reporter and a quencher capable of fluorescence resonance energy transfer, respectively.
23. The method for detecting a gene variant according to claim 13, wherein the non-specific signal suppression coprobe has the same number of bases as the fluorescence hydrolysis probe or is 1 to 10 bases longer.
24. 1) A coprobe comprising the amino acid sequence of TGGTCAAACCAAATGCACAAG and having a structure at the 3'-end that prevents extension by a nucleic acid polymerase; 2) A coprobe comprising the amino acid sequence of GTGGTCAAACCAAATGCACAAGC and having a structure at the 3'-end that prevents extension by a nucleic acid polymerase; 3) A coprobe comprising the amino acid sequence of TCAATGGTTTAACAGGCCACAGGTG and having a structure at the 3'-end that prevents extension by a nucleic acid polymerase; and 4) A coprobe comprising the amino acid sequence of GTGTGTT AATCTTACAAC CAG AACTCA and having a structure at the 3'-end that prevents extension by a nucleic acid polymerase, wherein the coprobe is selected from one or more of them and improves the specificity and sensitivity of PCR for detecting SARS-CoV-2 variants.
25. A PCR kit for detecting SARS-CoV-2 variants, comprising the coprobe for improving the specificity and sensitivity of PCR for detecting SARS-CoV-2 variants according to claim 24.
26. A method for detecting SARS-CoV-2 variants from a specimen using the PCR kit for detecting SARS-CoV-2 variants according to claim 25.
Citation Information
Patent Citations
PCR method and PCR kit for increasing allelic discrimination
WO2021118288A1