Polymeric micelles encapsulating nucleic acids
By employing pH-responsive polymeric micelles formed from a cationic polymer and a block copolymer with a maleic anhydride derivative, the challenges of mRNA delivery are addressed, resulting in enhanced stability, release, and transfection efficiency.
Patent Information
- Application Number
- JP2025519307
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-11
- Filing Date
- 2023-06-12
- Publication Date
- 2025-06-12
AI Technical Summary
Current mRNA delivery systems face challenges such as rapid enzymatic degradation, insufficient cell uptake, and undesirable immune responses due to the harsh in vivo environment, which limits their therapeutic efficacy.
The development of pH-responsive polymeric micelles using a cationic polymer with a primary amine side chain and a block copolymer containing a maleic anhydride derivative, which forms a reversible covalent bond and stabilizes the micelles for efficient nucleic acid delivery.
This approach enhances the stability and blood retention of micelles, allows for efficient release of nucleic acids under acidic conditions, and significantly suppresses enzymatic degradation, thereby improving transfection efficiency and therapeutic outcomes.
Smart Images

Figure 2025518406000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to nucleic acid-encapsulating polymeric micelles capable of improving stability in a harsh in vivo environment by using block copolymers. The disclosures of all cited documents in this specification are hereby incorporated by reference in their entirety into this specification.
Background Art
[0002] mRNA has the potential as a nucleic acid therapeutic agent because it is translated into a therapeutic protein in the cytoplasm. Although plasmid DNA, one of the nucleic acid therapeutic agents, can induce insertion into the host genomic DNA, it requires a delivery system targeting the cell nucleus, while mRNA has advantages over such plasmid DNA (U. Sahin et. al., Nat. Rev. Drug Discovery 13 (2014), 759-780). However, systemic administration of naked mRNA is rapidly enzymatically degraded due to negatively charged phosphate groups, has insufficient cell uptake, and exhibits an undesirable immune response (N. B. Tsui et. al., Clin. Chem. 48 (2002), 1647-1653). Therefore, the development of mRNA-loaded nanocarriers is essential for the application of mRNA.
[0003] Polyion complex (PIC) micelles are one of the promising nanocarriers capable of delivering mRNA. Block copolymers containing poly(ethylene glycol) and polycations can encapsulate mRNA via electrostatic interactions to protect the mRNA-loaded PIC core (S. Uchida et. al., Biomaterials 82 (2016), 221-228). mRNA-loaded PIC micelles containing poly(amino acids) are utilized to inhibit enzymatic degradation of the loaded mRNA, enhance cell uptake by charge neutralization, and achieve increased gene expression (S. Uchida et. al., Biomaterials 82 (2016), 221-228). However, it is essential to further improve the stability of PIC in the harsh in vivo environment for in vivo use.
SUMMARY OF THE INVENTION
PROBLEMS TO BE SOLVED BY THE INVENTION
[0004] Therefore, in order to increase the therapeutic effect of therapeutic nucleic acids, it is important to develop micelles that enable increased blood retention and efficient release of nucleic acids under acidic conditions.
MEANS FOR SOLVING THE PROBLEMS
[0005] The present invention aims to increase the stability of micelles and efficient release of nucleic acids under acidic conditions by introducing a pH-responsive maleic anhydride derivative and a primary amine into the side chain of a cationic polymer to form a reversible covalent bond with the amino group. Furthermore, the present invention aims to further stabilize the micelles by polyion complex (PIC) formation. The object of the present invention is to stabilize the micelle structure by covalent bond and PIC formation and increase blood retention.
[0006] That is, the present invention is as follows. [1] A pH-responsive carrier for nucleic acid delivery to cells or tissues, comprising a combination of a cationic polymer having a side chain containing a primary amine represented by the following formula (1) and a block copolymer:
[0007]
CHEMICAL
[0008] [Chemical formula] (wherein R a and R b each independently represents a hydrogen atom, or an optionally substituted alkyl group, alkenyl group, cycloalkyl group, aryl group, aralkyl group, acyl group, heterocyclic group, heterocyclic alkyl group, hydroxy group, alkoxy group, or aryloxy group. Further, R a and R b may be bonded to each other to form an aromatic ring or a cycloalkyl ring together with the carbon atoms to which they are respectively bonded. The bond between the carbon atoms to which R a and R b are respectively bonded may be a single bond or a double bond), L 1 is NH, CO, or the following formula (11): -(CH 2 ) p1 -NH- (11) (wherein p1 represents an integer of 1 to 6.) or a group represented by, the following formula (12): -L 2a -(CH 2 ) q1 -L 3a - (12) (wherein L 2a represents OCO, OCONH, NHCO, NHCOO, NHCONH, CONH, or COO, L 3a represents NH or CO, and q1 represents an integer of 1 to 6.) represents a group represented by, m11 and m12 each independently represent an integer of 1 to 500 (provided that the sum of m11 and m12 represents an integer of 10 to 500), m13, m14, and m15 each independently represent an integer of 1 to 5, n represents an integer of 1 to 500, the notation " / " indicates that the arrangement order of each of the (m11 + m12) monomer units shown on the left and right of this notation is arbitrary.). [2] The carrier according to [1], wherein the cationic polymer having a side chain containing a primary amine is a polymer represented by the following formula (2) or branched polyethyleneimine.
[0009] [Chemical formula] [In the formula, R 21 and R 22 each independently represent a hydrogen atom, a linear or branched alkyl group having 1 to 12 carbon atoms which may be substituted, or an azide, an amine, a maleimide, a ligand, or a labeling agent. R 30 is (CH 2 ) m23 (m23 represents an integer of 1 to 5). R 32 represents a methylene group or an ethylene group. R 31 and R 33 each independently represent the following general formula (41) or (42): -NH-(CH 2 ) r -X 11 (41) (In the formula, X 11 represents an amine compound residue obtained from a primary amine compound, and r represents an integer of 0 to 5). -[NH-(CH 2 ) s1 t1 -X 12 (42) (In the formula, X 12 is synonymous with X 11 , s1 and t1 are independent of each other, and are independently between [NH-(CH 2 ) s1 units, and each represents an integer of 1 to 5 and 2 to 5, respectively). m21 and m22 each independently represent an integer of 1 to 500 (provided that the sum of m21 and m22 represents an integer of 10 to 500). The notation " / " indicates that the sequence order of each of the (m21 + m22) monomer units shown on the left and right of this notation is arbitrary.] [3]R31 and R 33 The carrier according to [2], wherein each of them independently represents the following group.
[0010] [Chemical formula] [4] The carrier according to [1], wherein the compound represented by formula (I) is at least one of the compounds represented by the following formulas (Ia) to (Ig).
[0011] [Chemical formula] [5] The carrier according to [4], wherein the compound represented by formula (I) is a compound represented by the following formula (Ia) or (Ib).
[0012] [Chemical formula] [6] The block copolymer represented by formula (1) is the block copolymer represented by the following formula (3), which is the carrier according to [1].
[0013] [Chemical formula] [7] A polyion complex comprising the carrier according to any one of [1] to [6] and a nucleic acid. [8] The polyion complex according to [7], wherein a cationic polymer having a side chain containing a primary amine is covalently bonded to the block copolymer represented by formula (1). [9] The polyion complex according to [8], wherein the covalent bond is cleaved in a pH-dependent manner.
[10] A nucleic acid delivery kit comprising the polyion complex according to [7] for use in nucleic acid delivery to a target cell or tissue.
[11] A nucleic acid delivery device comprising the polyion complex according to [7] for use in nucleic acid delivery to a target cell or tissue. The present invention enables the clinical application of nucleic acid therapeutics. For example, siRNA can suppress the expression of disease-related genes in vivo, and mRNA can produce therapeutic proteins continuously and safely. Furthermore, the present invention can significantly suppress the enzymatic degradation of RNA and increase the transfection efficiency of RNA.
Brief Description of the Drawings
[0014]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Modes for Carrying Out the Invention
[0015] Therapeutic nucleic acids are expected to be promising for the treatment of intractable diseases, but their systemic administration involves various problems such as instability, short half-life, and non-specific immune responses. Therefore, an approach using stimulus-responsive nanocarriers to deliver nucleic acids can be an effective strategy for enhancing the activity of nucleic acids in a tissue-selective manner in target tissues. In the present invention, in order to release the loaded nucleic acid in a pH-dependent manner, a polymeric micelle having the ability to form a polyion complex between the nucleic acid and the block copolymer and encapsulate the nucleic acid by a covalent bond cleavable under a given pH condition was developed.
[0016] In the present invention, to prepare a polymer-nucleic acid complex (polyplex), a cationic polymer having a primary amine in its side chain was first mixed with the nucleic acid. In this complex, an electrostatic bond is formed between the nucleic acid and the cationic polymer. Then, a block copolymer containing a pH-responsive maleic anhydride derivative is introduced into the complex to form a reversible covalent bond with the amino group of the cationic polymer, thereby increasing the stability of the micelle and efficiently releasing the nucleic acid under acidic conditions. A schematic diagram explaining micelle formation is shown in Fig. 4a.
[0017] The polymer complex of the present invention is a nucleic acid-encapsulating polymer micelle complex (polyion complex: PIC) containing a specific cationic polymer and nucleic acid.
[0018] 1. pH-Responsive Carrier for Nucleic Acid Delivery A pH-responsive carrier for nucleic acid delivery to cells or tissues includes a combination of a cationic polymer having a side chain containing a primary amine represented by the following formula (1) and a block copolymer:
[0019]
Chemical formula
[0020] The structures (e.g., degree of polymerization) of the above-mentioned PEG and polycation are not limited, and those of any structure can be selected. Among them, as the polycation, a polypeptide having a cationic group in the side chain is preferable. In this specification, the term "cationic group" means not only a group in which a hydrogen ion is coordinated and has already become a cation, but also a group that becomes a cation when a hydrogen ion is coordinated. All known such cationic groups are included. More specifically, the cationic polymer having a side chain containing a primary amine is a polymer represented by the following formula (2) or branched polyethyleneimine.
[0021] [Chemical formula] [In the formula, R 21 and R 22 each independently represents a hydrogen atom, or a linear or branched alkyl group having 1 to 12 carbon atoms which may be substituted, or an azide, amine, maleimide, ligand, or labeling agent, R 30 is (CH 2 ) m23 (m23 represents an integer of 1 to 5.), R 32 represents a methylene group or an ethylene group, R 31 and R 33 each independently represents the following general formula (41) or (42): -NH-(CH 2 ) r -X 11 (41) (In the formula, X 11represents an amine compound residue obtained from a primary, secondary, or tertiary amine compound or a quaternary ammonium salt, and r represents an integer from 0 to 5.) -[NH-(CH 2 ) s1 t1 -X 12 (42) (In the formula, X 12 is synonymous with X 11 , and s1 and t1 are independent of each other and independently between [NH-(CH 2 ) s1 units, and represent integers from 1 to 5 and from 2 to 5, respectively.), m21 and m22 each independently represent an integer from 1 to 500 (provided that the sum of m21 and m22 represents an integer from 10 to 500.), The notation " / " indicates that the sequence order of each of the (m21 + m22) monomer units shown on the left and right of this notation is arbitrary.). In the present invention, the structure of the branched polyethyleneimine is as follows:
[0022]
Chemical formula
[0023] (2) The block copolymer represented by formula (1) The cis-aconitic anhydride (CAA)-amide bond is stable at physiological pH (pH 7.4), but is cleaved at pH 6.5, which is the pathophysiological pH in tumors and inflamed tissues. For this reason, CAA was selected as the pH-responsive functional group. In the present invention, a poly(ethylene glycol)-poly(L-lysine) block copolymer having CAA was used. In the examples, by using mRNA-encapsulating micelles as a model, the stability of the micelles under physiological conditions, as well as the disintegration of the micelles and the release of functional mRNA at pH 6.5 were confirmed. Furthermore, PEG-pLL(CAA) / m was found to enhance protein expression when compared to naked mRNA alone (Figure 10). Therefore, the usefulness of the system for delivering therapeutic nucleic acids in vivo was demonstrated by the above model.
[0024] More specifically, the above specific cationic polymer can preferably be exemplified by a block copolymer represented by the following general formula (1).
[0025] [Chemical formula]
[0026] In the structural formula represented by the general formula (1), the block portion with the repeating unit number (degree of polymerization) of n corresponds to the PEG portion, and the block portion composed of sub-portions with repeating unit numbers of m11 and m12 respectively (that is, the portion indicated by the brackets [] in the general formula (1)) corresponds to the polycation portion. Furthermore, the notation " / " in the structural formula of the polycation portion means that the sequence order of each monomer unit shown on the left and right of this notation may be arbitrary. For example, when the block portion composed of monomer units A and B is shown as [-(A)a- / -(B)b-], the notation " / " means that a number of A and b number of B, that is, the total number of each monomer unit (a + b) may be randomly linked in any sequence order (however, all monomer units A and B are linearly linked).
[0027] In the general formula (1), R 11 and R 12 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 12 carbon atoms which may be substituted, or a functional group, ligand, or labeling agent such as azide, amine, maleimide, etc.
[0028] Examples of the linear or branched alkyl group having 1 to 12 carbon atoms include methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, sec-butyl group, tert-butyl group, n-pentyl group, n-hexyl group, decyl group, undecyl group, etc. Further, examples of the substituent of the alkyl group include acetal-protected formyl group, cyano group, formyl group, carboxyl group, amino group, alkoxycarbonyl group having 1 to 6 carbon atoms, acylamide group having 2 to 7 carbon atoms, siloxy group, silylamino group, and trialkylsiloxy group (each alkylsiloxy group is independently having 1 to 6 carbon atoms), etc.
[0029] The ligand molecule means a compound used for the purpose of targeting a specific biomolecule, and examples thereof include antibodies, aptamers, proteins, amino acids, low-molecular compounds, monomers of biopolymers, etc. Examples of the labeling agent include rare-earth fluorescent labeling agents, coumarin, dimethylaminosulfonylbenzoxadiazole (DBD), dansyl, nitrobenzoxadiazole (NBD), pyrene, fluorescein, fluorescent proteins, etc., but are not limited thereto.
[0030] When the above substituent is an acetal-protected formyl group, this substituent can be converted to another substituent, i.e., a formyl group (or aldehyde group; -CHO) when hydrolyzed under mild acidic conditions. Further, when the above substituent (especially the substituent in R 11 is a formyl group, or a carboxyl group or an amino group, for example, an antibody or its fragment or other functional or target protein can be linked through these groups.
[0031] In general formula (1), R 13 represents a compound represented by the following general formula (I).
[0032]
Chemical formula
[0033] L 1 is NH, CO, the following general formula (11): -(CH 2 ) p1 -NH- (11) (wherein, p1 represents an integer of 1 to 6). a group represented by, or the following general formula (12): -L 2a -(CH 2 ) q1 -L 3a - (12) (wherein, L 2a represents OCO, OCONH, NHCO, NHCOO, NHCONH, CONH, or COO, L 3a represents NH or CO, and q1 represents an integer of 1 to 6). represents a group represented by).
[0034] In the above formula (1), m11 and m12 each independently represent an integer from 1 to 500 (provided that the sum of m11 and m12 represents an integer from 10 to 500), and m13, m14, and m15 each independently indicate an integer from 1 to 5. In the above formula (1), n represents the number of repeating units (degree of polymerization) of the PEG moiety, and more specifically represents an integer from 1 to 500 (preferably from 100 to 400, more preferably from 200 to 300).
[0035] The molecular weight (Mn) of the cationic polymer represented by the general formula (1) is not particularly limited, but is preferably from 23,000 to 45,000, more preferably from 28,000 to 34,000. For each individual block moiety, the molecular weight (Mw) of the PEG moiety is preferably from 8,000 to 15,000, more preferably from 10,000 to 12,000, and the molecular weight (Mn) of the polycation moiety is preferably from 15,000 to 30,000 in total, more preferably from 18,000 to 22,000.
[0036] The cationic polymer represented by the general formula (1) can be prepared by any method. For example, R 11 and a segment containing the block moiety of the PEG chain (PEG segment) are synthesized in advance, and a given monomer is polymerized in sequence at one end of this PEG segment (the side opposite to R 11 ), and then each side chain is optionally substituted or converted to contain a cationic group, or the above PEG segment and a block moiety containing a cationic group in the side chain are synthesized in advance and then linked to each other. The procedures and conditions of each reaction in these preparation methods can be appropriately selected or determined in consideration of standard methods.
[0037] In one embodiment of the present invention, the compound represented by the formula (I) is at least one of the compounds represented by the following formulas (Ia) to (Ig).
[0038]
Chemical formula
[0039] In a preferred embodiment of the present invention, the compound represented by formula (I) is a compound represented by the following formula (Ia) or (Ib).
[0040]
Chemical formula
[0041] In formula (I), the possible substituent is a saturated or unsaturated acyclic or cyclic hydrocarbon group. In the case of an acyclic hydrocarbon group, it may be either linear or branched. Such hydrocarbon groups include C 1 ~C 20 alkyl group, C 2 ~C 20 alkenyl group, C 4 ~C 20 cycloalkyl group, C 6 ~C 18 aryl group, C 6 ~C 20 aralkyl group, C 1 ~C 20 alkoxy group, and C 6 ~C 18 aryloxy group.
[0042] The above compound represented by formula (I) binds (covalently) to the amino group in a cationic polymer having a side chain containing a primary amine to form a structure represented by the following formula (I’).
[0043]
Chemical formula
[0044] Regarding the above bond, for example, when the above compound represented by formula (I) is a compound represented by the above formula (Ib) or (Ic), the above structure represented by formula (I’) formed after the bond is as shown below.
[0045]
Chemical formula
[0046] In a further embodiment of the present invention, the block copolymer represented by Formula 1 is represented by the following Formula 2.
[0047] [Chemical formula]
[0048] (3) Nucleic acid In one aspect, the nucleic acid encapsulated in the polyion complex micelle of the present invention as a component of the core part is DNA or RNA. Examples of RNA include mRNA, siRNA (small interfering RNA), antisense nucleic acid (antisense RNA), aptamer (RNA aptamer), self-replicating RNA, miRNA (microRNA), and lncRNA (long non-coding RNA). Examples of DNA include antisense nucleic acid (antisense DNA), aptamer (DNA aptamer), pDNA (plasmid DNA), and MCDNA (minicircle DNA). As long as the expression of the target gene can be suppressed by RNA interference (RNAi), any siRNA can be used. Examples of target genes preferably include, but are not limited to, cancer (tumor) genes, anti-apoptosis genes, cell cycle-related genes, and growth signal genes. Furthermore, the base pairs of siRNA are generally not limited as long as they are less than 30 base pairs (for example, 19 to 21 base pairs). Since nucleic acids such as siRNA are anionic molecules, they can interact (aggregate) with a cationic polymer having a side chain containing a primary amine via electrostatic interaction.
[0049] (4) Polyion complex (PIC) The PIC of the present invention can be referred to as a core-shell type micelle-like complex in a state where a part of the nucleic acid and the above-mentioned cationic polymer (poly-cation part) form a core region by electrostatic interaction, and the other part of the cationic polymer (including the PEG part) forms a shell region surrounding the core region. The polyion complex micelles of the present invention are supramolecular aggregates that can be obtained by mixing a nucleic acid and the polymer of the present invention in a buffer solution, and are also called polyion complexes (PIC) or polyion complex-type polymer micelles (PIC micelles). The polymer complex of the present invention can be prepared, for example, by mixing a nucleic acid and a polymer compound in an arbitrary buffer solution. If the polymer used to form the polyion complex micelles of the present invention is a cationic polymer having a side chain containing a primary amine, the nucleic acid and the polycation can aggregate through electrostatic interaction to form a polyplex structure. Then, a block copolymer containing a pH-responsive maleic anhydride derivative represented by the formula (1) is introduced into the complex to form a reversible covalent bond with the amino group of the cationic polymer.
[0050] The PIC of the present invention can be easily prepared, for example, by mixing a nucleic acid and a cationic polymer in an arbitrary buffer solution (for example, Tris buffer solution). The mixing ratio of the cationic polymer and the nucleic acid is not limited at all. However, in the present invention, for example, the ratio (N / C ratio) of the total number (N) of cationic groups (for example, amino groups) in the block copolymer to the total number (C) of phosphate groups in the nucleic acid can be set to 0.1 to 200, particularly 0.5 to 100, and more preferably 1 to 50. When the N / C ratio is within the above range, it is preferable in that free molecules of the cationic polymer can be reduced. It should be noted that the above cationic group (N) means a group that can form an ionic bond with the phosphate group in the nucleic acid encapsulated in the micelle through electrostatic interaction.
[0051] The PIC of the present invention can be of any size. For example, when measured by dynamic light scattering measurement (DLS), the particle size is preferably 5 to 200 nm, more preferably 10 to 100 nm.
[0052] When the PIC of the present invention is introduced into a cell or tissue, it releases the encapsulated nucleic acid. In this case, in response to a change in the pH environment in the cytoplasm (a change to a weakly acidic environment (for example, about pH 5.5)), the above compound represented by formula (I) dissociates (is cleaved) from the nucleic acid. As a result, since the overall charge (total charge) of the nucleic acid is restored to the initial charge (total charge) originally possessed by the nucleic acid, the nucleic acid can exist in a state where its structure and activity are regenerated in the recipient cell.
[0053] 2. Kit for nucleic acid delivery device The kit for the nucleic acid delivery device of the present invention is characterized by containing the polymer compound of the present invention. This kit can be preferably used, for example, for gene therapy using RNAi and protein therapy using mRNA in target cells. In the kit of the present invention, the storage form of the polymer is not limited, and it can be selected from a solution form, a powder form, etc. in consideration of stability (storability), ease of use, etc.
[0054] The kit of the present invention may contain other components in addition to the aforementioned polymer compound. Examples of other components include nucleic acids for transfecting cells, buffers used for dissolution, dilution, etc., proteins, and instruction manuals (user manuals), etc., which can be appropriately selected according to the purpose and type of the polymer. The kit of the present invention is used to prepare polyion complex (PIC) micelles that encapsulate nucleic acids (for example, mRNA or siRNA) in the core and transfect target cells. The prepared PIC has advantages as a device for delivering nucleic acids to target cells.
[0055] 3. Device for delivering nucleic acid The present invention can provide a nucleic acid delivery device containing the aforementioned polyion complex. The delivery device of the present invention can stabilize nucleic acids that have been difficult to stably deliver to target cells by enhancing resistance to enzymatic degradation.
[0056] The delivery device of the present invention can be used in various animals such as humans, mice, rats, rabbits, pigs, dogs, and cats, but is not limited thereto. Parenteral methods such as intravenous injection are usually used to administer the device to the target animal, and various conditions such as the amount, frequency, and duration of administration can be appropriately determined according to the type and condition of the target animal. The delivery device of the present invention can be used for treatment (gene therapy) that transfects a desired nucleic acid into cells at the diseased site. Accordingly, the present invention also provides a pharmaceutical composition containing the aforementioned polyion complex, a gene therapy agent for various diseases containing the pharmaceutical composition, and a method (particularly, gene therapy) for treating various diseases including the use of PIC.
[0057] The methods and conditions are the same as described above. Furthermore, various diseases include, but are not limited to, cancer (e.g., lung cancer, pancreatic cancer, brain tumor, liver cancer, breast cancer, colon cancer, neuroblastoma, and bladder cancer), cardiovascular diseases, musculoskeletal diseases, and central nervous system diseases.
[0058] The aforementioned pharmaceutical composition can be appropriately selected and used with diluents, fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, dispersants, buffers, preservatives, solubilizing agents, antiseptics, flavoring agents, soothing agents, stabilizers, and isotonic agents commonly used in drug manufacturing, and can be formulated by conventional methods. Furthermore, intravenous injection agents (including drip infusion) are usually used in the form of the pharmaceutical composition. For example, the pharmaceutical composition may be provided in single-dose ampoules or multi-dose containers.
Example
[0059] The present invention will be further described in more detail by the following exemplary examples, but does not limit the scope of the present invention.
[0060] [Example 1] 1. Materials and Methods 1.1. Materials α-Methoxy-ω-aminopoly(ethylene glycol) (MeO-PEG-NH 2 )(M w = 12 kDa) was purchased from NOF CORPORATION (Tokyo, Japan). ε-Trifluoroacetyl-L-lysine N-carboxy anhydride (Lys-(TFA)-NCA) was purchased from Chuo Kaseihin Co., Inc. (Tokyo, Japan). N,N-Dimethylformamide (DMF) (purity > 99.5%), methanol (purity > 99.5%) were purchased from Fujifilm Wako Pure Chemical, Co., Inc., (Tokyo, Japan). Diethyl ether (purity > 95%), cis-aconitic anhydride (purity > 95%), dextran sulfate (M r ~ 40,000), and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (1.0 M), fetal bovine serum (FBS), penicillin-streptomycin, and RPMI-1640 medium were purchased from Sigma-Aldrich (St. Louis, Missouri, USA). Oxalyl chloride (purity > 98%) and anhydrous dichloromethane (purity > 98%) were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan).
[0061] 1.2. Polymer synthesis The PEG-pLL block copolymer was prepared as previously reported [8]. Poly(ethylene glycol)-b-poly[L-lysine(TFA)] (PEG-pLL(TFA)) was first synthesized by ring-opening polymerization (ROP) using MeO-PEG-NH 2 (Mw = 12000 g mol -1 ) as an initiator. Briefly, MeO-PEG-NH 2(1 g, 0.083 mmol) and Lys(TFA)-NCA (1 g, 3.75 mmol) were separately dissolved in 10 mL of anhydrous DMF. Next, the two solutions were mixed under Ar flow and reacted in a water bath at 35 °C for 48 h. The mixture was precipitated with diethyl ether to obtain PEG-pLL(TFA). Deprotection of the TFA groups was completed by dissolving the collected PEG-pLL(TFA) in methanol containing 1 M NaOH and maintaining the reaction in a water bath at 35 °C for 12 h. The mixture was dialyzed against 0.01 M HCl and pure water (molecular weight cut-off (MWCO): 6,000 - 8,000 Da) and then purified by lyophilization to obtain poly(ethylene glycol)-b-poly(L-lysine) (PEG-pLL). The degree of polymerization (DP) of the lysine groups was determined by 1H-NMR (400 MHz, JEOL ECS-400, JEOL, Tokyo, Japan), and the polydispersity of the polymer was tested by aqueous GPC (Extrema 4500 Model, JASCO) (eluent: 10 mM PBS, pH 7.4; temperature: 25 °C; flow rate: 0.75 mL min 2 in D 1 2O and -1 tested by 1H-NMR (400 MHz, JEOL ECS-400, JEOL, Tokyo, Japan). The polydispersity of the polymer was tested by aqueous GPC (Extrema 4500 Model, JASCO) (eluent: 10 mM PBS, pH 7.4; temperature: 25 °C; flow rate: 0.75 mL min
[0062] The PEG-pLL(CAA) block copolymer was synthesized by further conjugating cis-aconitic anhydride (CAA) molecules to the amino groups of the lysine block of PEG-pLL via a condensation reaction of an acid chloride and an amine. Briefly, CAA (153 mg, 1 mmol) was reacted with oxalyl chloride (2 mL, 2.5 g, 20 mmol) at 25 °C overnight to prepare the acid chloride of CAA (CAA-Cl). CAA-Cl was purified by vacuum evaporation to remove all of the excess oxalyl chloride, and the product was collected as an oily liquid. Next, PEG-pLL (200 mg, 0.011 mmol) was dissolved in 20 mL of anhydrous dichloromethane and then reacted with the prepared CAA-Cl at 25 °C overnight. The final product, PEG-pLL(CAA), was obtained by precipitating the mixture with diethyl ether. The number of CAA units in PEG-pLL was determined at 80 °C in DMSO-d6 1Confirmed by 1H-NMR, the polydispersity of the polymer was tested by aqueous GPC (eluent: 10 mM PBS, pH 3.0; temperature: 25 °C; flow rate: 0.75 mL min -1 ; detector: UV 220 nm).
[0063] To prepare homo-P(Asp-det), homo-PBLA was synthesized via the ROP reaction of BLA-NCA initiated by n-butylamine. n-Butylamine (50.0 μL, 0.506 mmol) and BLA-NCA (10.0 g, 40.1 mmol) were separately dissolved in 10 mL of anhydrous DMF. Next, the two solutions were mixed under Ar flow and reacted at 35 °C for 48 h. The mixture was precipitated with diethyl ether to obtain homo-PBLA powder. Next, homo-pAsp(DET) was synthesized by aminolysis of homo-PBLA. Homo-PBLA (120 mg, 0.01 mmol) was dissolved in 10 mL of anhydrous DMF. Diethylenetriamine (DET) (2.5 mL, 25 mmol) was added to the homo-PBLA solution. The mixture was reacted at 0 °C for 1 h, and then the reaction was stopped by dropwise addition of ice-cold 5 M HCl(aq) equal to the amine groups fed into the solution. The neutralized solution was first dialyzed against 0.01 M HCl (MWCO: 6,000 - 8,000 Da), and then changed to dialysis against pure water. The purified solution was lyophilized to obtain homo-pAsp(DET) as a white powder. The final product was characterized by 1H-NMR in D 2 2O (Figure 3). 1 1H-NMR (Figure 3).
[0064] 1.3. mRNA Transcribed In Vitro Plasmid RNA templates for preparing Gaussia luciferase (gluc) and firefly luciferase (fLuc) mRNAs were prepared by inserting the corresponding protein coding sequences with a 120 bp poly A / T sequence into the pSP73 vector (Promega, Madison, Wisconsin, USA). The linearized gluc and fLuc plasmids were used as templates for in vitro transcription using the mMESSAGE mMACHINE™ T7 Ultra Kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA) to generate gluc and fluc mRNAs. Next, the obtained mRNAs were purified by the RNeasy Mini Kit (Qiagen, Hilden, Germany). The mRNA concentration was determined by measuring the absorbance at 260 nm using a NanoDrop 3300 spectrophotometer (Thermo Fisher Scientific).
[0065] 1.4. Preparation of micelles To prepare PEG-pLL / m loaded with mRNA, the synthesized mRNA was dissolved in 10 mM HEPES buffer at a concentration of 25 ng / μL. The PEG-pLL block copolymer was also dissolved in 10 mM HEPES buffer, and the concentration of PEG-pLL was adjusted to match the molar ratio of [amine groups (N) in the polymer] / [phosphate groups (P) in the mRNA]. Next, the micelles were maintained at 4 °C for 1 hour before use. To prepare PEG-pLL(CAA) / m loaded with mRNA, the synthesized mRNA and PEG-pLL(CAA) polymer were dissolved in 10 mM HEPES buffer at pH 8.5 and pH 3.5, respectively. Next, the PEG-pLL(CAA) solution (0.5 mg / mL) was gradually added to the mRNA solution (25 μg / mL) so that the N / P ratio became 4. The volume ratio of the polymer solution to the mRNA solution was controlled at 1:1. Finally, the pH of the micelle solution was adjusted to 7.4 by adding 10 mM HEPES at pH 8.5 and left stirred for 2 hours before use. To prepare PEG-pLL(CAA) / m loaded with mRNA polyplexes, first, homo-polyplexes were prepared by mixing mRNA and homo-P(Asp-det) at N / P ratios of 2, 6, 10, and 16, and the final mRNA concentration was adjusted to 25 μg / mL. Then, the polyplexes were maintained at 4 °C for 30 minutes, after which the PEG-pLL(CAA) solution (0.5 mg / mL) was gradually added to the mRNA solution. The volume ratio of the polymer solution to the mRNA solution was controlled at 1:1. Finally, the pH of the micelle solution was adjusted to 7.4 by adding 10 mM HEPES at pH 8.5 and left stirring for 2 hours before use.
[0066] 1.5. Characterization of Micelles The Z-average diameter of the micelles (mRNA 25 ng / μL) was measured using a Zetasizer Nano ZS (Malvern Instruments Ltd, UK) by dynamic light scattering (DLS). mRNA loading was also confirmed by fluorescence correlation spectroscopy (FCS) measurements. First, mRNA was labeled with Cy5 using the Label IT Tracker Intracellular Nucleic Acid Localization kit (Mirus Bio Corporation, Madison, WI, USA). Using this Cy5-labeled mRNA, PEG-pLL / m and PEG-PGBA / m were prepared as described above. Next, the micelle solution was diluted with 10 mM HEPES buffer (pH 7.4) until the Cy5-labeled mRNA reached 2 mM. Then, FCS measurements were performed on the diluted micelle solution (200 μL) by He-Ne laser (633 nm) scanning. In this specification, Alexa Fluor 647 dye was selected as the standard, and the diffusion coefficient of the Cy5-labeled mRNA was obtained by comparing their diffusion times with that of Alexa Fluor 647. Furthermore, the counts obtained per molecule were analyzed to calculate the number of associated mRNAs per micelle according to the following formula: Number of associations = Counts per molecule (micelle) / Counts per molecule (naked mRNA)
[0067] 1.6. pH sensitivity of micelles To examine the pH sensitivity of PEG-pLL(CAA) / m, Cy5-labeled glucmRNA micelles were prepared and incubated at room temperature for 1 hour in 10 mM HEPES buffer containing 150 mM NaCl, pH 7.4, 6.5, 5.5, and 4.5. Next, the samples were analyzed by FCS to track micelle dissociation.
[0068] 1.7. Stability of micelles against polyanions The stability of micelles against counter polyanion exchange was estimated by mixing micelles with sodium dextran sulfate and subsequently measuring FCS. Briefly, a Cy5-labeled mRNA micelle solution containing 200 ng of Cy5-labeled mRNA was mixed with sodium dextran sulfate at various S / P ([sulfate in dextran sulfate] / [phosphate in mRNA]) ratios, and then the resulting solution was maintained at room temperature for 1 hour, and the diffusion coefficient of Cy5-labeled mRNA was obtained by the FCS measurement described above.
[0069] 1.8. Stability in FBS To test the stability of micelles against nucleases, micelles loaded with glucmRNA were incubated in 10% FBS (the final concentration of mRNA was adjusted to 6.25 ng / μL) at 37 °C for 15 minutes. The resulting solution containing mRNA was washed with an RNeasy mini kit and then reverse-transcribed with a ReverTra Ace qPCR RT Master Mix kit. Finally, qRT-PCR analysis was ultimately performed using a primer pair (forward; TGAGATTCCTGGGTTCAAGG and reverse; GTCAGAACACTGCACGTTGG) for gluc mRNA by a 7500 Fast real-time PCR instrument (Applied Biosystems, USA).
[0070] 1.9. Uptake in vitro The uptake of micelles by cells was measured using an LSM780 confocal laser scanning microscope. CT26 cells (10,000 cells) were seeded into an 8-well borosilicate chamber cover glass (Lab Tek) and incubated at 37 °C in RPMI containing 10% FBS and 1% penicillin / streptomycin in 5% CO 2 for 24 h. After 24 h, Cy5-labeled glucmRNA and micelles encapsulating mRNA (700 ng of mRNA per well, relative fluorescence intensity: 400 [RFU]) were used for CT26 cells. After an additional 6 h, the cells were washed three times with PBS, and the cell nuclei were stained with 1% Hoechst33342 solution for 5 min before LSM imaging.
[0071] 1.10. In vitro cell transfection CT26 cells were cultured at 37 °C in RPMI containing 10% FBS and 1% penicillin / streptomycin in 5% CO 2 for 24 h. To evaluate the gluc expression efficiency, the cells were seeded into a 96-well plate at a density of 50,000 cells per well. After a 24-h incubation, 500 ng of gluc mRNA, PEG-pLL / m, and PEG-pLL(CAA) / m containing 250 ng of gluc mRNA were added. The mRNA was also complexed with in vivo-jetPEI (Polyplus-transfection, Illkirch-Graffenstaden, France) at 1.2 μl PEI / μg mRNA and transfected into the cells according to the manufacturer's instructions. After an additional 24 h, 50 μL of the culture medium was collected for a luciferase assay using the Renilla luciferase assay system (Promega, Madison, WI, USA) and a GloMax 96 microplate luminometer (Promega, Madison, WI, USA).
[0072] 1.11. In vivo transfection To generate a CT26 tumor model, 1×10 6Individual CT26 cells were inoculated into the flanks of female balb / c mice provided by Charles River Laboratories Japan, Inc. Approximately two weeks later, palpable tumors were observed. Micelles and PEI polyplexes were prepared as described above using 5 μg of firefly luciferase (fluc) mRNA per mouse. Next, the mice were randomized into four groups and naked mRNA, PEG-pLL / m, PEG-pLL(CAA) / m, and PEI polyplexes were injected intratumorally. One hour, nine hours, and 24 hours after injection, 200 μL of a 50 mg / mL luciferin solution was injected intraperitoneally into the mice, and 10 minutes later, fluc expression was imaged using an IVIS Spectrum imaging system (SP-BFM-T1, PerkinElmer, Waltham, MA, USA).
[0073] 1.12. Statistical analysis Results were presented as mean ± standard deviation (s.d.). Groups were compared by performing a two-sided Student's t-test in Graph Pad Prism 8.
[0074] 2. Results and discussion 3.1 Synthesis and characterization of block copolymers The PEG-pLL(TFA) block copolymer was successfully synthesized from the ROP of Lys(TFA)-NCA, using the terminal amine of MeO-PEG-NH 2 as an initiator as described in previous literature. Next, the trifluoroacetyl group was cleaved by alkaline hydrolysis to obtain PEG-pLL, and the final product was characterized by 1H-NMR analysis (D 2 O; 25 °C). The DP of the lysine groups was determined by comparing the characteristic peak of -O-CH 2 -CH 2 -O- of the PEG block (δ = 3.57~3.84 ppm) with the peak of -CH 2 -CH 2 -CH 2 - of the PLL side chain (δ = 1.30~1.80 ppm). 1It was determined to be 46 units by 1H-NMR, and a narrow molecular weight distribution was observed by aqueous GPC (Figure 1).
[0075] Next, the obtained PEG-pLL block copolymer was modified with CAA to produce PEG-pLL(CAA) by reacting CAA-Cl with lysine groups. The introduced CAA units were determined to be 15 units by 1H-NMR by comparing the peak of -O-CH 2 -CH 2 -O- (δ = 3.46 - 3.61 ppm) with the characteristic peak of -CH- of CAA (δ = 5.61 - 5.74 ppm) (Figure 2a). Also, the results of aqueous GPC of PEG-pLL(CAA) showed that the polymer had a narrow molecular weight distribution (Figure 2b). 1 It was determined to be 15 units by 1H-NMR (Figure 2a). Also, the results of aqueous GPC of PEG-pLL(CAA) showed that the polymer had a narrow molecular weight distribution (Figure 2b).
[0076] 3.2 Formation and Characterization of Micelles The PEG-pLL mRNA PIC micelles were assembled by mixing PEG-PLL with gLuc mRNA in 10 mM HEPES buffer. Based on previous results, stable PEG-pLL / m was formed when the [amine groups in PLys] / [phosphate in mRNA] (N / P) ratio increased above 3. Therefore, PEG-pLL / m loaded with gluc was prepared using N / P 4. The PEG-pLL(CAA) block copolymer is designed to exert dual functions, electrostatic and covalent interactions, for effective loading of mRNA. Under acidic pH conditions (pH 3 - 4), PEG-pLL(CAA) is most likely to be in the free polymer form with protonated amines and closed CAA rings. When this solution is dropped into an alkaline mRNA solution (pH 7 - 8), it can induce the formation of an ionic complex between the remaining amine groups in the p(LL-CAA) block and mRNA. Furthermore, the remaining CAA moiety can react with the primary amines of the PLL-CAA block to form pH-sensitive amide bonds by further addition of the polymer. Further reaction between the amine groups that have not reacted with the CAA groups can crosslink the core of the micelles. To clarify the effect of CAA, N / P 4 was used with PEG-pLL(CAA) / m. When the sizes of the two types of micelles were examined by dynamic light scattering (DLS), both PEG-pLL and PEG-pLL(CAA) formed micelles with a diameter of approximately 80 nm (Figure 4b). The diffusion coefficient of Cy5-labeled mRNA (19.95 ± 1.98 μm 2 / s) decreased after mixing with the polymer (12.07 ± 0.87 μm 2 / sec for PEG-pLL / m and 10.94 ± 2.50 μm 2Since encapsulation of mRNA in micelles was successfully demonstrated, encapsulation of mRNA in micelles was confirmed by fluorescence correlation spectroscopy (FCS). Furthermore, comparing the ratio of the number of counts per molecule of micelle and Cy5-labeled mRNA (Table 1), it was found that the two types of micelles had similar numbers of mRNA per micelle. To further confirm the pH sensitivity of the micelles, the micelles were incubated in buffer solutions of various pHs (10 mM HEPES buffer containing 150 mM NaCl), and then the aggregation of the micelles was evaluated by FCS. Here, to better understand the disassembly process of the micelles, the diffusion coefficient of the micelles in various pH buffers was normalized by the diffusion coefficient of the initial micelles. In the complex formation of PEG-pLL(CAA) and Cy5-mRNA, the normalized diffusion coefficient increased from 1.05 to 1.76 as the pH decreased from 6.5 to 4.5, indicating that PEG-pLL(CAA) / m gradually separated Cy5-mRNA as a result of the pH decrease. Also, the diffusion coefficient of PEG-pLL(CAA) / m (19.11 ± 1.33 μm 2 / sec) was close to that of naked mRNA (19.95 ± 1.87 μm 2 / sec), and it was observed that complete release of mRNA occurred at pH 4.5. On the other hand, the normalized diffusion coefficient of PEG-pLL / m remained almost unchanged, suggesting that PEG-pLL / m maintained its association with Cy5-mRNA even as the pH decreased (Figure 4c).
[0077] Furthermore, it was found that mRNA polyplexes could also be encapsulated by this system. Formation of the micelles was confirmed by DLS (Figures 5 and 6).
[0078]
Table 1
[0079] 3.3 Stability of micelles The self-assembly of electrostatically mediated PICs is known as a reversible way in which nanoparticles coexist in equilibrium with polyions [9, 10]. Diluting or adding other charged substances to the system can essentially damage the integrity of the system and may cause polyion exchange
[11] . Therefore, counter-polyion exchange is one of the important issues in nucleic acid delivery systems
[12] . Here, first, the stability of micelles in the presence of dextran sulfate was evaluated. The micelles were incubated with dextran sulfate for 1 hour at various S / P ([sulfate in dextran sulfate] / [phosphate in mRNA]) ratios, and the diffusion coefficient of Cy5-mRNA was measured by FCS. In the complex formation of PEG-pLL(CAA) and Cy5-mRNA, it was found that the mRNA was completely released at S / P = 2. On the other hand, PEG-pLL(CAA) / m could retain the mRNA at S / P = 4 (Figure 7a). In addition to polyion exchange, the ability of the micelles to protect the loaded mRNA from enzymatic degradation was investigated by qRT-PCR. The results showed that 66% of the mRNA was detected in the PEG-pLL(CAA) / m group. On the other hand, PEG-pLL / m showed only slight mRNA protection (Figure 7b). Therefore, these results demonstrated that the core cross-linked by CAA greatly protected the mRNA from polyanion and nuclease attacks, proving that this strategy is advantageous.
[0080] 3.4 Activity in vitro Furthermore, the in vitro performance of the mRNA micelles was investigated. Cellular uptake was studied in CT26 cells by using Cy5-labeled mRNA and CLSM. After 6-hour incubation, it was found that intracellular uptake could be improved by PIC formation. Furthermore, the fluorescence intensity of the Cy5 signal in cells treated with PEG-pLL(CAA) / m was significantly higher than that in PEG-pLL / m, suggesting an improvement in uptake (Figs. 8a - 8d). Next, the possibility of protein translation was evaluated by the luminescence level after introducing gluc mRNA into CT26 cells. As shown in Fig. 8e, PEG-pLL(CAA) / m showed a 16-fold increase in gluc expression compared with PEG-pLL / m. It should also be noted that the in vitro transfection efficiency of the micelles was much lower than that of the positive control PEI polyplex.
[0081] Furthermore, the in vitro transfection efficiency of PEG-p(LL-CAA) micelles encapsulating mRNA polyplexes was evaluated in different cell lines. After 24-hour incubation, obvious differences in gluc expression were observed in CT26 cells, HCT116 cells, B16F10 cells, RAW246.7 cells, and DC2.4 cells (Fig. 9).
[0082] 3.4 Activity in vivo Finally, in vivo mRNA transfection was examined in mice bearing CT26 tumors. The mice were treated with a single intratumoral injection of firefly luciferase (fluc) mRNA, PEG-pLL / m encapsulating the mRNA, PEG-pLL(CAA) / m, and PEI polyplexes. Protein expression was followed by measuring bioluminescence using IVIS 10 minutes after luciferin injection. Compared to naked mRNA, both PEG-pLL / m and PEG-pLL(CAA) / m showed enhanced fluc expression at the injection site at 9 hours. Furthermore, the luminescence intensity of the PEG-pLL(CAA) / m treatment group was much higher than that of the PEG-pLL / m group (Figures 10a and 10c). In contrast, the control formulation, PEI polyplex, showed strong gene expression in vitro but failed to result in strong gene expression in vivo (Figure 10).
[0083] [Example 2] PEI-doped mRNA-loaded micelles 1. Preparation of PEI-doped mRNA-loaded micelles Poly(ethylene glycol)-poly(L-lysine) (PEG-PLL) with 5 kDa or 12 kDa PEG blocks was prepared by ring-opening polymerization of lysine-NCA. The resulting polymer had pLL segments of 30 units for 5 kDa PEG and 50 units for 12 kDa PEG. The polymer was modified with cis-aconitic anhydride (CAA) to obtain PEG-pLL(CAA). The introduction of CAA into PLL was 10 units for 5 kDa PEG-PLL and 20 units for 12 kDa PEG-PLL. To prepare the micelles, first, mRNA was mixed with branched poly(ethyleneimine) (bPEI) at N / P ratios of 6 and 18 in 10 mM acetate buffer (pH 4.5). Next, the polyplex was mixed with PEG-PLL(CAA) at 2 mg / ml and the pH was adjusted to pH 8. The particle size distribution and zeta potential were measured by using a Zetasizer NS90 (Table 2). The efficiency of mRNA loading into the micelles was confirmed by gel electrophoresis (Figure 11). The micelles were also observed by transmission electron microscopy (TEM) after staining with uranyl acetate (Figure 12).
[0084]
Table 2
[0085] 2. Activity in vitro Mouse colon adenocarcinoma CT26 cells and RAW264.7 macrophages were cultured in RPMI containing 10% FBS and 1% penicillin / streptomycin under 5% CO 2It was cultured at 37°C. To evaluate the gluc expression efficiency, cells were seeded in 96-well plates (50,000 cells / well). After 24 hours of incubation, Gluc mRNA, PEI polyplex, and mRNA-loaded micelles doped with 500 ng of mRNA-containing PEI were used for the cells. The mRNA was also complexed with Lipofectamine and used for the cells. After an additional 24 hours, 50 μL of the culture medium was collected for a luciferase assay using the Renilla luciferase assay system (Promega, Madison, WI, USA) and a GloMax 96 microplate luminometer (Promega, Madison, WI, USA). The results showed the difference in the bioluminescence signal of the mRNA-loaded micelles doped with PEI in cancer cells and macrophages (Figure 13).
Claims
1. A pH-responsive carrier for nucleic acid delivery to cells or tissues, comprising a combination of a cationic polymer having a side chain containing a primary amine and a block copolymer: 【Chemical 1】 [wherein, R 11 and R 12 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 12 carbon atoms which may be substituted, or an azide, an amine, a maleimide, a ligand, or a labeling agent, R 13 represents a compound represented by the following general formula (I), 【Chemical 2】 (wherein, R a and R b each independently represents a hydrogen atom, or an optionally substituted alkyl group, alkenyl group, cycloalkyl group, aryl group, aralkyl group, acyl group, heterocyclic group, heterocyclic alkyl group, hydroxy group, alkoxy group, or aryloxy group. Further, R a and R b may be bonded to each other to form an aromatic ring or a cycloalkyl ring together with the carbon atoms to which they are respectively bonded. The bond between the carbon atoms to which R a and R b are respectively bonded may be a single bond or a double bond.). L 1 is NH, CO, or the following formula (11): -(CH 2 ) p1 -NH-(11) a group represented by the formula (wherein p1 represents an integer of 1 to 6), or the following formula (12): -L 2a -(CH 2 ) q1 -L 3a -(12) (In the formula, L 2a represents OCO, OCONH, NHCO, NHCOO, NHCONH, CONH, or COO, L 3a represents NH or CO, and q1 represents an integer of 1 to 6.) represents a group represented by, m11 and m12 each independently represent an integer of 1 to 500 (provided that the sum of m11 and m12 represents an integer of 10 to 500), m13, m14, and m15 each independently represent an integer of 1 to 5, and n represents an integer of 1 to 500, The notation " / " indicates that the sequence order of each of the (m11 + m12) monomer units shown on the left and right of this notation is arbitrary.].
2. The carrier according to claim 1, wherein the cationic polymer having a side chain containing a primary amine is a polymer represented by the following formula (2) or branched polyethyleneimine. 【Chemical Formula 3】 [wherein, R 21 and R 22 each independently represents a hydrogen atom, a linear or branched alkyl group having 1 to 12 carbon atoms which may be substituted, or an azide, an amine, a maleimide, a ligand, or a labeling agent, R 30 represents (CH 2 ), m23 where m23 represents an integer from 1 to 5, R 32 represents a methylene group or an ethylene group, R 31 and R 33 each independently represents the following general formula (41) or (42): -NH-(CH 2 ) r -X 11 (41) (In the formula, X 11 represents an amine compound residue obtained from a primary amine compound, and r represents an integer of 0 to 5.). -[NH-(CH 2 ) s1 - t1 -X 12 (42) (wherein X 12 is synonymous with X 11 and s1 and t1 are independent of each other and independently in [NH-(CH 2 ) s1 ] units and represent integers of 1 to 5 and 2 to 5, respectively.). m21 and m22 each independently represent an integer of 1 to 500 (provided that the sum of m21 and m22 represents an integer of 10 to 500), The notation " / " indicates that the sequence order of each of the (m21 + m22) monomer units shown on the left and right of this notation is arbitrary.]
3. R 31 and R 33 The carrier according to claim 2, wherein R and R each independently represent the following group. 【Chemical Formula 4】
4. The carrier according to claim 1, wherein the compound represented by formula (I) is at least one of the compounds represented by the following formulas (Ia) to (Ig). 【Chemical Formula 5】
5. The carrier according to claim 4, wherein the compound represented by formula (I) is a compound represented by the following formula (Ia) or (Ib). 【Chemical Formula 6】
6. The carrier according to claim 1, wherein the block copolymer represented by formula (1) is a block copolymer represented by the following formula (3). [Chemical Formula 7]
7. A polyion complex comprising the carrier according to any one of claims 1 to 6 and a nucleic acid.
8. The polyion complex according to claim 7, wherein the cationic polymer having a side chain containing a primary amine is covalently bonded to the block copolymer represented by formula (1).
9. The polyion complex according to claim 8, wherein the covalent bond is cleaved in a pH-dependent manner.
10. A nucleic acid delivery kit comprising the polyion complex according to claim 7 for use in nucleic acid delivery to target cells or tissues.
11. A nucleic acid delivery device comprising the polyion complex according to claim 7 for use in nucleic acid delivery to target cells or tissues.