Improved oligonucleotides targeting RNA-binding protein sites

Antisense oligonucleotides complementary to TDP-43 binding sites, incorporating 2'-MOE nucleosides and cholesterol moieties, address the functional depletion of TDP-43 in cells, effectively restoring RNA-binding protein function and offering a therapeutic solution for TDP-43 pathologies.

JP2025518522APending Publication Date: 2025-06-17F HOFFMANN LA ROCHE & CO AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024568256
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-05-18
Filing Date
2023-05-18
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

Current treatments for TDP-43 pathologies, such as ALS and FTLD, are inadequate in restoring the functional depletion of TDP-43, leading to persistent cytoplasmic mislocalization and nuclear depletion.

Method used

Development of antisense oligonucleotides that are complementary to conserved TDP-43 binding sites on pre-mRNA transcripts, incorporating 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides and bound to at least one cholesterol moiety, to restore RNA-binding protein function in TDP-43 depleted cells.

Benefits of technology

The antisense oligonucleotides effectively restore the nuclear function of TDP-43 in RNA processing, enhancing the functional phenotype of TDP-43 target RNAs and providing a novel therapeutic approach for treating TDP-43 pathologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025518522000026
    Figure 2025518522000026
  • Figure 2025518522000001
    Figure 2025518522000001
  • Figure 2025518522000002
    Figure 2025518522000002
Patent Text Reader

Abstract

The present invention relates to an antisense oligonucleotide complementary to a conserved TDP-43 binding site on a pre-mRNA transcript capable of restoring RNA binding protein function in the processing of multiple independent mRNAs in TDP-43 depleted cells. The continuous nucleotide sequence of the antisense oligonucleotide contains 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, and the antisense oligonucleotide is bound to a cholesterol moiety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to antisense oligonucleotides that are complementary, for example, completely complementary, to RNA binding protein target sites on multiple RNAs such as TDP-43 binding sites on multiple RNA transcripts, and can restore RNA binding protein function to multiple RNA transcripts for use in conditions and medical indications where the RNA binding protein is functionally depleted. The continuous nucleotide sequence of the antisense oligonucleotide contains one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, and the antisense oligonucleotide is bound to at least one cholesterol moiety.

Background Art

[0002] TAR DNA-binding protein 43 (TDP-43) is a versatile RNA / DNA-binding protein involved in RNA-related metabolism. Dysregulation of TDP-43 deposits acts as inclusions in the brains and spinal cords of patients with motor neuron diseases: amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) (Prasad et al., Front. Mol. Neurosci., 2019).

[0003] TDP-43 is mainly localized in the nucleus but also shuttles to the cytoplasm for some of its functions (Ayala et al., 2008). In diseases such as ALS and FTLD, there is an increase in cytoplasmic TDP-43 concentration that leads to cytoplasmic inclusion formation (Neumann et al., 2006; Winton et al., 2008a). Cytoplasmic mislocalization can be associated with nuclear depletion and lead to a reduction or loss of TDP-43 function. There are TDP-43 mutations that result in abnormal splicing of TDP-43 target RNAs and widespread splicing abnormalities (see, for example, Arnold et al., PNAS 2013 110 E736-745 and Yang et al., PNAS. U.S.A. 111, E1121-E1129).

[0004] Klim et al. reported that the loss of STMN2 upon TDP-43 hypofunction is due to changes in STMN2 splicing, suggesting the restoration of STMN2 as a therapeutic strategy for ALS.

[0005] TDP-43 depletion has been shown in various diseases called TDP-43 pathologies, including, for example, amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy, and chronic traumatic encephalopathy.

[0006] Tollervey et al., Nature Neuroscience 2010, 452-458 reported on the characterization of RNA targets and the position-dependent splicing regulation of TDP-43 in healthy brain tissue and brain tissue from FTLD patients. Most TDP-43 binding sites mapped to introns, long non-coding RNAs (lncRNAs), and intergenic transcripts and were enriched in UG-rich motifs. The conserved RNP segment in TDP-43 is involved in binding to RNA sequences with TAR DNA sequences and UG repeats (Ayala et al., J. Mol. Biol. 2005; 348: 575-588). TDP-43 depletion in cells such as TDP pathologies correlates with the loss of RNA binding of TDP-43 to its RNA targets.

[0007] TDP-43 binding sites in human RNA are available online from databases of RNA-binding proteins and related motifs (see https: / / attract.cnic.es / results / e9f29380-8921-406e-84a8-27ce9b9398b4#). The specific characterized human RNA TDP-43 binding sites disclosed herein include the following RNA sequences: GUGAAUGA, GUUGUGC, UGUGUGUGUGUG (SEQ ID NO: 85), GAAUGG, UGUGUGUG, GAAUGA, UGUGUG, GUUGUUC, and GUUUUGC.

[0008] Melamed et al. reported early polyadenylation-mediated loss of STMN2 as a feature of TDP-43 neurodegeneration. WO 2019 / 241648 discloses 2’O-methoxyethyl ASOs for increasing STMN2 expression.

[0009] The inventors have identified antisense oligonucleotides that are complementary, e.g., fully complementary, to TDP-43 nucleic acid binding sites and can restore the expression and splicing of RNA transcripts that are dysregulated in the processing or regulation of TDP-43 RNA transcripts targets, e.g., in cells exhibiting loss of TDP-43 function, thereby providing a novel approach for restoring TDP-43 functionality in TDP-43 depleted cells (i.e., cells in which TDP-43 function is lost), as well as a novel therapeutic approach for treating TDP-43 pathologies.

[0010] The inventors have determined that it is possible to reduce the toxicity of antisense oligonucleotides while maintaining or improving their efficacy by modification. Object of the Invention

[0011] The present invention relates to antisense oligonucleotides complementary to conserved TDP-43 binding sites on pre-mRNA transcripts that can restore RNA-binding protein function in the processing of multiple independent mRNAs in TDP-43 depleted cells. The continuous nucleotide sequence of the antisense oligonucleotide includes one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, and the antisense oligonucleotide is bound to at least one cholesterol moiety.

[0012] The present invention provides antisense oligonucleotides for restoring the functionality of RNA-binding proteins, such as TDP-43 functionality or TDP-43-like functionality, in cells having reduced levels of functional TDP-43.

[0013] The present invention provides oligonucleotides that can restore the nuclear function of TDP-43 in RNA processing or the expression of one or more TDP-43 target RNAs, thereby at least partially restoring or enhancing the functional phenotype of the TDP-43 target RNA. Such oligonucleotide compounds are referred to herein as RNA-binding protein mimics, such as TDP-43 mimics.

[0014] The present invention provides antisense oligonucleotides complementary to TDP-43 binding sites and their use in treatments such as the treatment of TDP-43 pathologies.

[0015] The present invention further provides antisense oligonucleotides complementary to TDP-43 binding sites on multiple RNA transcripts, i.e., RNA transcripts transcribed from different loci. The multiple RNA transcripts can be independently selected, for example, from the group consisting of pre-mRNA, mRNA, and lncRNA. SUMMARY OF THE INVENTION

[0016] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, which comprises a continuous nucleotide sequence of at least 8 nucleotides complementary to a sequence selected from the group consisting of (5'-3') (UG)n, (GU)n [where n is 4 to 20], UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO: 95), UGUGUGUGUGU (SEQ ID NO: 84), UGUGUGUGUGUG (SEQ ID NO: 85), UGUGUGUGUGUGU (SEQ ID NO: 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO: 87), GUGUGUGUGUG (SEQ ID NO: 88), GUGUGUGUGUGU (SEQ ID NO: 89), GUGUGUGUGUGUG (SEQ ID NO: 90), and GUGAAUGA, the continuous nucleotide sequence contains one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, and the antisense oligonucleotide is bound to at least one cholesterol moiety.

[0017] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0018] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence may contain at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0019] In some embodiments, all of the nucleosides of the continuous nucleotide sequence or its continuous sequence may be 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

[0020] In some embodiments, the antisense oligonucleotide may be attached to two or more or three or more cholesterol moieties. In some embodiments, the antisense oligonucleotide may be attached to one cholesterol moiety. In some embodiments, the antisense oligonucleotide may be attached to two cholesterol moieties. In some embodiments, the antisense oligonucleotide may be attached to three cholesterol moieties.

[0021] In some embodiments, the cholesterol moiety(ies) may be covalently attached to the antisense oligonucleotide.

[0022] In some embodiments, the cholesterol moiety may be selected from the group consisting of 5'-cholesterol-TEG-CE phosphoramidite, 5'-cholesterol-CE phosphoramidite, or cholesteryl-TEG-CE phosphoramidite. In some embodiments, the cholesterol moiety may be a combination selected from the group consisting of 5'-cholesterol-TEG-CE phosphoramidite, 5'-cholesterol-CE phosphoramidite, or cholesteryl-TEG-CE phosphoramidite. In some embodiments, the cholesterol moiety is 5'-cholesterol-TEG-CE phosphoramidite. In some embodiments, all of the cholesterol moieties are 5'-cholesterol-TEG-CE phosphoramidite.

[0023] In embodiments where there is more than one cholesterol moiety, each cholesterol moiety is independently selected such that the cholesterol moieties within the antisense oligonucleotide may be the same or different.

[0024] In some embodiments, the linker can be located between the antisense oligonucleotide and the cholesterol moiety. In some embodiments, the linker can be located between each of the antisense oligonucleotide and the cholesterol moiety. In some embodiments, the linker can be located between each of the cholesterol moieties.

[0025] In some embodiments, the linker can be a cleavable linker.

[0026] In some embodiments, the linker can be a physiologically labile linker such as an S1 nuclease-sensitive linker.

[0027] In some embodiments, the alkyl group linker is located between the antisense oligonucleotide and the cholesterol moiety(ies).

[0028] In some embodiments, the physiologically labile linker is a phosphodiester-linked cytidine-adenosine dinucleotide having three consecutive phosphodiester bonds.

[0029] In some embodiments, the C3 alkyl group is a linker located between the antisense oligonucleotide and the cholesterol moiety(ies). In some embodiments, the C3 alkyl group is located between the antisense oligonucleotide and another linker.

[0030] In some embodiments, the C6 alkyl group is a linker located between the antisense oligonucleotide and the cholesterol moiety(ies). In some embodiments, the C6 alkyl group is located between the antisense oligonucleotide and another linker.

[0031] In some embodiments, the C12 alkyl group is a linker positioned between the antisense oligonucleotide and the cholesterol moiety(ies). In some embodiments, the C12 alkyl group is positioned between the antisense oligonucleotide and another linker.

[0032] In some embodiments, the TEG group is a linker positioned between the antisense oligonucleotide and the cholesterol moiety(ies). In some embodiments, another TEG group is positioned between the antisense oligonucleotide and another linker.

[0033] In some embodiments, the HEG group is a linker positioned between the antisense oligonucleotide and the cholesterol moiety(ies). In some embodiments, the HEG group is positioned between the antisense oligonucleotide and another linker.

[0034] In some embodiments, the antisense oligonucleotide may contain phosphorothioate (PS) or phosphodiester (PO) linkages between the cholesterol moiety and the linker.

[0035] In another embodiment, the antisense oligonucleotide may contain phosphorothioate (PS) or phosphodiester (PO) linkages between the linker and the antisense oligonucleotide.

[0036] In another embodiment, the antisense oligonucleotide may contain a phosphorothioate (PS) or phosphodiester (PO) bond between the cholesterol moiety and the linker, and a phosphorothioate (PS) or phosphodiester (PO) bond between the linker and the antisense oligonucleotide. For example, in some embodiments, the antisense oligonucleotide may have the structure: "cholesterol-PO / PS-linker-PO / PS-oligonucleotide", where the PO / PS group is located between the linker and the cholesterol moiety, and another PO / PS group is located between the linker and the antisense oligonucleotide. Here, the phosphorothioate (PS) bond or phosphodiester (PO) bond may be independently selected such that both are phosphorothioate (PS) bonds, both are phosphodiester (PO) bonds, or one is a phosphorothioate (PS) bond and the other is a phosphodiester (PO) bond.

[0037] In some embodiments, the antisense oligonucleotide may have the structure shown as follows.

Chemical formula

[0038] In some embodiments, the antisense oligonucleotide may have the structure shown as follows.

Chemical formula

[0039] In some embodiments, the antisense oligonucleotide may have the structure shown as follows.

Chemical formula

[0040] In some embodiments, the antisense oligonucleotide may have the structure shown as follows. [Chemistry]

[0041] As described in the Background section, functional TDP-43 is mainly a nuclear-localized protein and can be present in the cytoplasm. However, the aggregation of TDP-43 in the cytoplasm, called cytoplasmic inclusions (also referred to as abnormal TDP-43), is associated with non-functional TDP-43, which is related to, for example, the loss of functionality of nuclear TDP-43 in the processing of many pre-mRNAs. Therefore, cells expressing TDP-43 in cytoplasmic inclusions should be considered as depleted of TDP-43.

[0042] An antisense oligonucleotide can be an isolated antisense oligonucleotide or a purified oligonucleotide. The antisense oligonucleotide of the present invention is a manufactured (artificial) antisense oligonucleotide.

[0043] Functional phenotypes can be, for example, RNA processing events that are regulated by or dependent on functional TDP-43 (i.e., non-abnormal TDP-43, typically nuclear TDP-43), and / or RNA processing events whose fidelity is dependent on functional TDP-43. Thus, the enhancement of TDP-43 functionality by the use of the antisense oligonucleotides of the present invention can be evaluated, for example, as exemplified herein, by referring to STMN2, CAMK2B, KALRN, ACTL6B, and UNC13A RNA processing, by assessing the fidelity of RNA processing events that are regulated by or dependent on functional TDP-43.

[0044] Advantageously, the antisense oligonucleotide or a continuous nucleotide sequence thereof comprises at least 12 or at least 13 consecutive nucleotides that are complementary, for example, completely complementary, to the sequence UGUGUGUGUGUG (SEQ ID NO: 85), or GUGUGUGUGUGU (SEQ ID NO: 89), or UGUGUGUGUGUGU (SEQ ID NO: 86), or GUGUGUGUGUGUG (SEQ ID NO: 90).

[0045] In some embodiments, the antisense oligonucleotide or a continuous nucleotide sequence thereof comprises at least 14 consecutive nucleotides that are complementary, for example, completely complementary, to the sequence UGUGUGUGUGUGUG (SEQ ID NO: 91), or GUGUGUGUGUGUGU (SEQ ID NO: 92).

[0046] In some embodiments, the antisense oligonucleotide or a continuous nucleotide sequence thereof comprises at least 18 consecutive nucleotides that are complementary, for example, completely complementary, to the sequence (UG)n or (GU)n [where n is an integer from 6 to 20, for example 7 to 9].

[0047] In some embodiments, the antisense oligonucleotide or a continuous nucleotide sequence thereof comprises at least 18 consecutive nucleotides that are complementary, for example, completely complementary, to the sequence UGUGUGUGUGUGUGUGUG (SEQ ID NO: 93), or GUGUGUGUGUGUGUGUGU (SEQ ID NO: 94).

[0048] In some embodiments, the antisense oligonucleotide or a continuous nucleotide sequence thereof according to the present invention comprises a sequence selected from CACACAC, CACACACA, CACACACAC, ACACACAC, or ACACACACA.

[0049] In some embodiments, the antisense oligonucleotide or a continuous nucleotide sequence thereof according to the present invention comprises the sequence of SEQ ID NO: 1.

[0050] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 2.

[0051] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 3.

[0052] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 4.

[0053] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 5.

[0054] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 6.

[0055] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 7.

[0056] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 8.

[0057] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 9.

[0058] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 10.

[0059] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 11.

[0060] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 12.

[0061] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 13.

[0062] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 14.

[0063] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 15.

[0064] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 16.

[0065] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 17.

[0066] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 18.

[0067] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 19.

[0068] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 20.

[0069] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 21.

[0070] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 22.

[0071] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 23.

[0072] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 24.

[0073] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 25.

[0074] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 26.

[0075] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 27.

[0076] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 28.

[0077] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 29.

[0078] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 30.

[0079] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 31.

[0080] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 32.

[0081] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 33.

[0082] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 34.

[0083] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 35.

[0084] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 36.

[0085] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 37.

[0086] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 38.

[0087] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 39.

[0088] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 40.

[0089] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 41.

[0090] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 42.

[0091] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 43.

[0092] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 44.

[0093] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 45.

[0094] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 46.

[0095] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 47.

[0096] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 48.

[0097] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 49.

[0098] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 50.

[0099] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 51.

[0100] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 52.

[0101] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 53.

[0102] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 54.

[0103] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 55.

[0104] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 56.

[0105] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 57.

[0106] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 58.

[0107] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 59.

[0108] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention includes the sequence of SEQ ID NO: 60.

[0109] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence (SEQ ID NO: 61).

[0110] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 62.

[0111] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 63.

[0112] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 64.

[0113] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 65.

[0114] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 66.

[0115] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 67.

[0116] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 68.

[0117] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 69.

[0118] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 70.

[0119] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 71.

[0120] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 72.

[0121] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 73.

[0122] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 74.

[0123] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 75.

[0124] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 76.

[0125] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 77.

[0126] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 78.

[0127] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 79.

[0128] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 80.

[0129] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 81.

[0130] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 82.

[0131] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence of SEQ ID NO: 83.

[0132] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises the sequence or compound shown in Table 1.

[0133] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NOs: 118 to 126.

[0134] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 118.

[0135] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 119.

[0136] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 120.

[0137] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 121.

[0138] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 122.

[0139] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 123.

[0140] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 124.

[0141] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 125.

[0142] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises SEQ ID NO: 126.

[0143] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises (CA)n or (AC)n, wherein n is an integer from 1 to 20, such as 2 to 20, 3 to 20, 4 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 11 to 20, 12 to 20, 13 to 20, 14 to 20, 15 to 20, 16 to 20, 17 to 20, 18 to 20, 19 to 20, 1 to 15, 1 to 10, 1 to 5, 5 to 15, 5 to 10 or 10 to 15.

[0144] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence according to the present invention comprises (CA)n or (AC)n, wherein n is an integer, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0145] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention comprises a sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126.

[0146] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to the present invention consists of a sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126.

[0147] The continuous nucleotide sequence may include a fragment of 8 or more consecutive nucleotides of any one of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126.

[0148] The continuous nucleotide sequence may consist of a fragment of 8 or more consecutive nucleotides of any one of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126.

[0149] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to any aspect of the present invention has a length of at least 8 consecutive nucleotides.

[0150] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to any aspect of the present invention has a length of at least 9 consecutive nucleotides.

[0151] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to any aspect of the present invention has a length of at least 10 consecutive nucleotides.

[0152] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence according to any aspect of the present invention has a length of at least 11 consecutive nucleotides.

[0153] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 12 contiguous nucleotides.

[0154] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 13 contiguous nucleotides.

[0155] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 14 contiguous nucleotides.

[0156] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 15 contiguous nucleotides.

[0157] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 16 contiguous nucleotides.

[0158] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 17 contiguous nucleotides.

[0159] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 18 contiguous nucleotides.

[0160] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 19 contiguous nucleotides.

[0161] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 20 consecutive nucleotides.

[0162] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 21 consecutive nucleotides.

[0163] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 22 consecutive nucleotides.

[0164] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 23 consecutive nucleotides.

[0165] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 24 consecutive nucleotides.

[0166] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 25 consecutive nucleotides.

[0167] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 26 consecutive nucleotides.

[0168] In some embodiments, an antisense oligonucleotide or a continuous nucleotide sequence thereof according to any aspect of the present invention has a length of at least 27 consecutive nucleotides.

[0169] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 28 contiguous nucleotides.

[0170] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 29 contiguous nucleotides.

[0171] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 30 contiguous nucleotides.

[0172] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 31 contiguous nucleotides.

[0173] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 32 contiguous nucleotides.

[0174] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 33 contiguous nucleotides.

[0175] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 34 contiguous nucleotides.

[0176] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 35 contiguous nucleotides.

[0177] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 36 contiguous nucleotides.

[0178] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 37 contiguous nucleotides.

[0179] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 38 contiguous nucleotides.

[0180] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 39 contiguous nucleotides.

[0181] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof according to any aspect of the invention has a length of at least 40 contiguous nucleotides.

[0182] In some embodiments, the antisense oligonucleotide can consist of a contiguous nucleotide sequence.

[0183] In some embodiments, the antisense oligonucleotide can be a contiguous nucleotide sequence.

[0184] In some embodiments, the contiguous nucleotide sequence can be at least 75% complementary to the target sequence.

[0185] In some embodiments, the continuous nucleotide sequence can be at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target sequence.

[0186] In some embodiments, the continuous nucleotide sequence can contain 1, 2, 3, 4, 5, 6, 7, 8, or more mismatches relative to the target sequence.

[0187] In some embodiments, the antisense oligonucleotide according to the present invention has a Gibbs free energy of the antisense oligonucleotide relative to the complementary target RNA of less than about -10ΔG, for example less than about -15ΔG, for example less than about -17ΔG.

[0188] The antisense oligonucleotide may be able to restore the functional phenotype of one or more TDP-43 target RNAs in cells in which TDP-43 is depleted or in which abnormal TDP-43 protein is expressed.

[0189] Advantageously, the antisense oligonucleotide of the present invention comprising a continuous nucleotide sequence comprising one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides may further comprise one or more additional or alternative modified nucleosides. In other words, the antisense oligonucleotide of the present invention comprises one or more 2'-MOE nucleosides and may further comprise one or more additional or alternative modified nucleosides.

[0190] Conveniently, the antisense oligonucleotides of the present invention may contain LNA nucleosides. LNA nucleotides within a continuous nucleotide sequence are even more advantageous. In some embodiments, the antisense oligonucleotides of the present invention may contain LNA nucleosides and non-LNA nucleosides, such as DNA nucleosides. In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence may contain LNA nucleosides and DNA nucleosides. In some embodiments, all the nucleosides of the antisense oligonucleotide or its continuous nucleotide sequence are independently selected from LNA and DNA nucleosides. Advantageously, the length of the continuous DNA nucleosides present within the antisense oligonucleotide or its continuous nucleotide sequence is limited so as to prevent RNaseH recruitment that results in target RNA degradation. Suitably, the antisense oligonucleotide or its continuous nucleotide sequence does not contain more than four continuous DNA nucleosides, and more preferably does not contain more than three continuous DNA nucleosides.

[0191] When used, advantageously, the antisense oligonucleotides according to the present invention can regulate the splicing of two or more TDP-43 target pre-mRNAs (target RNAs). By way of example, the two or more TDP-43 target RNAs can be independently selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA and UNC13A pre-mRNA.

[0192] In some embodiments, the antisense oligonucleotides according to the present invention can regulate the splicing of one or more TDP-43 target pre-mRNAs (target RNAs).

[0193] In some embodiments, the antisense oligonucleotides according to the present invention can regulate the splicing of two or more TDP-43 target pre-mRNAs (target RNAs).

[0194] In some embodiments, the antisense oligonucleotides according to the present invention can regulate the splicing of three or more TDP-43 target pre-mRNAs (target RNAs).

[0195] In some embodiments, the antisense oligonucleotides according to the present invention can regulate the splicing of four or more TDP-43 target pre-mRNAs (target RNAs).

[0196] In some embodiments, the antisense oligonucleotides according to the present invention can regulate the splicing of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more TDP-43 target pre-mRNAs (target RNAs).

[0197] In some embodiments, when administered to TDP-43 depleted cells, the antisense oligonucleotide can enhance the fidelity of pre-mRNA splicing of at least one, such as two or more pre-mRNAs selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA and UNC13A pre-mRNA. In some embodiments, the two or more selected pre-mRNAs are selected from the group consisting of STMN2 and CAMK2B; STMN2 and KALRN; STMN2 and ACTL6B; and STMN2 and UNC13A.

[0198] In some embodiments, when administered to TDP-43 depleted cells, the antisense oligonucleotide can enhance the fidelity of pre-mRNA splicing of two or more pre-mRNAs selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA and UNC13A pre-mRNA. In some embodiments, the two or more selected pre-mRNAs are selected from the group consisting of STMN2 and CAMK2B; STMN2 and KALRN; STMN2 and ACTL6B; STMN2 and UNC13A.

[0199] In some embodiments, when administered to TDP-43 depleted cells, the antisense oligonucleotide can enhance the fidelity of pre-mRNA splicing of three or more pre-mRNAs selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA.

[0200] In some embodiments, when administered to TDP-43 depleted cells, the antisense oligonucleotide can enhance the fidelity of pre-mRNA splicing of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA.

[0201] In some embodiments, when administered to TDP-43 depleted cells expressing STMN2 pre-mRNA, the antisense oligonucleotide can reduce the proportion of STMN2 mature mRNA containing a potential exon (ce1) between exon 1 and exon 2 as compared to wild-type STMN2 mature mRNA having a continuous exon 1 / exon 2 junction.

[0202] In some embodiments, when administered to TDP-43 depleted cells expressing CAMK2B pre-mRNA, the antisense oligonucleotide can reduce the level of aberrant exon inclusion in the CAMK2B mRNA transcript.

[0203] In some embodiments, when administered to TDP-43 depleted cells expressing KALRN pre-mRNA, the antisense oligonucleotide can reduce the level of aberrant exon inclusion in the KALRN mRNA transcript.

[0204] In some embodiments, when administered to TDP-43 depleted cells expressing ACTL6B pre-mRNA, the antisense oligonucleotide can reduce the level of aberrant exon inclusion in the ACTL6B mRNA transcript.

[0205] In some embodiments, the antisense oligonucleotide can reduce the level of aberrant exon inclusion in the UNC13A mRNA transcript when administered to TDP-43 depleted cells expressing UNC13A pre-mRNA.

[0206] In some embodiments, the antisense oligonucleotide can correct aberrant splicing of two or more of STMN2, CAMK2B, KALRN, ACTL6B, and UNC13A pre-mRNAs in TDP-43 depleted cells.

[0207] In some embodiments, the antisense oligonucleotide does not contain regions of three or more, or four or more, contiguous DNA nucleosides.

[0208] In some embodiments, the antisense oligonucleotide is unable to mediate RNaseH cleavage.

[0209] In some embodiments, the antisense oligonucleotide is a morpholino antisense oligonucleotide.

[0210] In some embodiments, the antisense oligonucleotide, or its contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides, may further comprise one or more affinity enhancing nucleosides, such as 2'-sugar modified nucleosides, to enhance the binding affinity between the antisense oligonucleotide and the complementary RNA molecule, for example, and advantageously, to provide a lower Gibbs free energy, for example, less than -10, for example less than -15.

[0211] In some embodiments, an antisense oligonucleotide or a contiguous nucleotide sequence thereof that includes one or more 2'-MOE nucleosides may further include a 2'-sugar modified nucleoside independently selected from the group consisting of one or more modified nucleosides, such as 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; locked nucleic acid (LNA), or combinations thereof.

[0212] In some embodiments, the 2'-sugar modified nucleoside can be an affinity-enhanced 2'-sugar modified nucleoside.

[0213] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides in the antisense oligonucleotide or a contiguous nucleotide sequence thereof are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides optionally linked by one or more phosphorothioate internucleoside linkages.

[0214] In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the nucleosides in the antisense oligonucleotide or a contiguous nucleotide sequence thereof are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides optionally linked by one or more phosphorothioate internucleoside linkages.

[0215] In some embodiments, all nucleosides in the antisense oligonucleotide or its continuous nucleotide sequence are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides optionally linked by one or more phosphorothioate internucleoside linkages.

[0216] In some embodiments, an antisense oligonucleotide or its continuous nucleotide sequence containing one or more 2'-MOE nucleosides may further contain 2'-O-methyl nucleosides.

[0217] In some embodiments, one or more additional modified nucleosides within the antisense oligonucleotide or its continuous nucleotide sequence are locked nucleic acid nucleosides (LNA), for example, LNA nucleosides selected from the group consisting of constrained ethyl nucleoside (cEt) or β-D-oxy-LNA.

[0218] In some embodiments, the continuous nucleotide sequence of the antisense oligonucleotide contains nucleoside LNA nucleosides and DNA nucleosides optionally linked by phosphorothioate internucleoside linkages.

[0219] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence is a mixmer or a totalmer.

[0220] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence contains a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1-83 or SEQ ID NOs: 118-126, or at least 8 consecutive nucleotides thereof.

[0221] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence contains a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1-83 or SEQ ID NOs: 118-126, or at least 9 consecutive nucleotides thereof.

[0222] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 10 contiguous nucleotides thereof.

[0223] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 11 contiguous nucleotides thereof.

[0224] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 12 contiguous nucleotides thereof.

[0225] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 13 contiguous nucleotides thereof.

[0226] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 14 contiguous nucleotides thereof.

[0227] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 15 contiguous nucleotides thereof.

[0228] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 16 contiguous nucleotides thereof.

[0229] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 17 contiguous nucleotides thereof.

[0230] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 18 contiguous nucleotides thereof.

[0231] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 19 contiguous nucleotides thereof.

[0232] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 20 contiguous nucleotides thereof.

[0233] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 21 contiguous nucleotides thereof.

[0234] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 22 contiguous nucleotides thereof.

[0235] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 23 consecutive nucleotides thereof.

[0236] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 24 consecutive nucleotides thereof.

[0237] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 25 consecutive nucleotides thereof.

[0238] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 26 consecutive nucleotides thereof.

[0239] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 27 consecutive nucleotides thereof.

[0240] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 28 consecutive nucleotides thereof.

[0241] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises a nucleic acid base sequence selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 29 consecutive nucleotides thereof.

[0242] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 30 contiguous nucleotides thereof.

[0243] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 31 contiguous nucleotides thereof.

[0244] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 32 contiguous nucleotides thereof.

[0245] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 33 contiguous nucleotides thereof.

[0246] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 34 contiguous nucleotides thereof.

[0247] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 1 to 83 or SEQ ID NOs: 118 to 126, or at least 35 contiguous nucleotides thereof.

[0248] In some embodiments, the cytosine bases present in the antisense oligonucleotide or its contiguous nucleotide sequence are independently selected from the group consisting of cytosine and 5-methylcytosine.

[0249] In some embodiments, the cytosine base present in the antisense oligonucleotide or its contiguous nucleotide sequence is 5-methylcytosine.

[0250] In some embodiments, the LNA cytosine base present in the antisense oligonucleotide or its contiguous nucleotide sequence is LNA 5-methylcytosine.

[0251] In some embodiments, the LNA cytosine base present in the antisense oligonucleotide or its contiguous nucleotide sequence is LNA 5-methylcytosine, and the DNA cytosine base is cytosine.

[0252] Advantageously, one or more of the internucleoside linkages located between the nucleosides on the contiguous nucleotide sequence are modified. In some embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the internucleoside linkages located between the nucleosides on the contiguous nucleotide sequence are modified.

[0253] In some embodiments, one or more, or all, of the modified internucleoside linkages are phosphorothioate linkages. In some embodiments, one or more, or all, of the linkages within the contiguous nucleotide sequence are phosphorothioate linkages.

[0254] In some embodiments, all of the internucleoside linkages present in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0255] In some embodiments, all of the internucleoside linkages present in the antisense oligonucleotide are phosphorothioate internucleoside linkages.

[0256] In some embodiments, the antisense oligonucleotide of the present invention that is attached to at least one cholesterol moiety may further comprise one or more conjugate groups. In other words, the antisense oligonucleotide of the present invention is attached to at least one cholesterol moiety and may further comprise one or more additional conjugate groups that are not cholesterol moieties.

[0257] In some embodiments, the antisense oligonucleotide of the present invention may be covalently attached to at least one conjugate moiety.

[0258] In some embodiments, the antisense oligonucleotide of the present invention may be in the form of a pharmaceutically acceptable salt. In some embodiments, the salt may be a sodium salt, a potassium salt, or an ammonium salt.

[0259] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0260] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention, a pharmaceutically acceptable diluent or solvent, and a cation. The cation can be, for example, a sodium cation or a potassium cation. The diluent / solvent can be water.

[0261] The present invention provides a method, such as an in vivo or in vitro method for enhancing the functionality of TDP-43 in cells expressing abnormal or depleted levels of TDP-43, the method comprising administering to the cells an effective amount of the antisense oligonucleotide of the present invention or the composition of the present invention.

[0262] The present invention provides a method for treating or preventing TDP-43 pathology in a subject, the method comprising administering a therapeutically effective amount or a prophylactically effective amount of an antisense oligonucleotide of the present invention or a composition of the present invention to a subject suffering from TDP-43 pathology or a subject susceptible to TDP-43 pathology.

[0263] The present invention provides an antisense oligonucleotide of the present invention or a composition of the present invention for use as a medicament.

[0264] The present invention provides an antisense oligonucleotide of the present invention or a composition of the present invention for use in the treatment of TDP-43 pathology.

[0265] The present invention provides the use of an antisense oligonucleotide of the present invention or a composition of the present invention for the preparation of a medicament for treating or preventing TDP-43 pathology.

[0266] The present invention provides the method of the present invention, an antisense oligonucleotide or a pharmaceutical composition for use according to the present invention, or the use according to the present invention, wherein the TDP-43 pathology is a neuropathy selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine disease, such as spinocerebellar ataxia type 3, myopathy and chronic traumatic encephalopathy.

[0267] In some embodiments, the TDP-43 pathology is a neuropathy selected from the group consisting of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD).

[0268] The present invention provides a pharmaceutical solution comprising an antisense oligonucleotide of the present invention and a pharmaceutically acceptable solvent such as phosphate buffered saline.

[0269] In some embodiments, the antisense oligonucleotides of the invention can be in solid powder form, such as in the form of a lyophilized powder.

[0270] Typically, the antisense oligonucleotides of the invention comprise a continuous nucleotide sequence that is at least 8 or at least 10 nucleotides in length, such as 10 - 32, 15 - 32, 20 - 32, 21 - 32, 22 - 32, 23 - 32, 24 - 32, 25 - 32, 26 - 32, 27 - 32 or 10 - 20 nucleotides in length, and the continuous nucleotide sequence is at least 75% complementary, such as at least 90% complementary, or completely complementary to the TDP-43 RNA binding sequence. In some embodiments, all the nucleosides of the antisense oligonucleotide form the continuous nucleotide sequence.

[0271] In some embodiments, the antisense oligonucleotides of the invention can modulate the splicing of at least two human pre-mRNAs. For example, the splicing of human STMN2, CAMK2B, KALRN, ACTL6B and UNC13A pre-mRNAs depends on TDP-43 binding as shown in the examples.

[0272] In a further aspect, the invention provides a method for treating or preventing a neurodegenerative disease, such as amyotrophic lateral sclerosis (ALS), comprising administering a therapeutically effective amount or a prophylactically effective amount of the oligonucleotide of the invention to a subject suffering from or susceptible to the disease.

[0273] In a further aspect, the oligonucleotide or composition of the invention is used for the treatment or prevention of a neurodegenerative disease as a neurodegenerative disorder characterized by the pathology of TDP-43 or the mislocalization of TDP-43 from the nucleus, such as amyotrophic lateral sclerosis (ALS).

[0274] Sequence Listing The sequence listing submitted with this application is incorporated herein by reference. Brief Description of the Drawings

[0275]

Figure 1

Mode for Carrying Out the Invention

[0276] RNA Binding Protein Mimics and TDP-43 Mimics TDP-43 is a TAR RNA / DNA binding protein encoded by the plus strand of human chromosome 1: 11,012,653-11,022,858 in humans (gene ENSG00000120948, Chr1: 11,012,344-11,025,739, example of a typical TDP-43 transcript = ENST00000439080.6) and is widely involved in RNA splicing, stability and metabolism. In healthy cells, the TDP-43 protein is located in the nucleus, but in some neurodegenerative diseases, dysfunctional TDP-43 aggregates are formed in the cytoplasm (often associated with hyperphosphorylated and ubiquitinated TDP-43).

[0277] TDP-43 is an example of an RNA binding protein that binds to GU repeats in a number of independent RNA transcripts. The interaction between an RNA binding protein such as TDP-43 and a population of a number of RNA transcripts has a great impact on the biology of RNA transcripts such as splicing, RNA stability, and RNA accumulation for pre-mRNA, and thus provides a mechanism for exerting the expression of a population of independent RNAs in a cell. This is particularly relevant in the case of TDP-43 depletion where loss of RNA binding of functional TDP-43 is closely related to neurodegeneration.

[0278] The present invention provides antisense oligonucleotides that are complementary to GU-rich regions on multiple RNA transcripts, such as conserved TDP-43 binding sites on a population of pre-mRNA transcripts. As exemplified in the examples, administration of the antisense oligonucleotides of the present invention can restore the functional processing of multiple independent RNA transcripts that are abnormally processed in the absence or depletion of an RNA-binding protein, such as TDP-43. Thus, the antisense oligonucleotides of the present invention, also referred to as the compounds of the present invention, are sometimes referred to as RNA-binding protein mimics or TDP-43 mimics in that they restore the functionality of RNA-binding proteins, such as TDP-43, when modulating the RNA biology of multiple RNA transcripts.

[0279] As an example, RNA-binding protein functionality, such as TDP-43 functionality restored or enhanced by use of the compounds of the present invention (e.g., in TDP-43 depleted cells), is pre-mRNA transcript expression, processing, such as splicing events, and results in restoration of dysregulated functional gene expression in cells that otherwise have reduced levels of functional TDP-43 (referred to herein as TDP-43 depleted cells). This can result in enhanced gene expression or enhanced quality of gene expression.

[0280] Advantageously, the compounds of the present invention can mimic functional TDP-43 and restore the nuclear function of TDP-43 in the expression of one or more TDP-43 target RNAs, thereby restoring the functional phenotype of the TDP-43 target RNAs.

[0281] Other RNA-binding proteins can bind to the TDP-43 binding site, and thus it will be understood that the TDP-43 mimics referred to herein are oligonucleotides that are complementary to the TDP-43 binding site of one or more RNA targets, such as multiple nucleic acid targets (i.e., RNA targets described from different loci), and can restore normal (wild-type) expression.

[0282] As reported by Arnold et al. in PNAS 2013, some TDP-43 pathologies are associated with specific TDP-43 mutations, which may not necessarily be associated with TDP-43 cytoplasmic depletion. In the context of the present invention, since the normal function of TDP-43 can be genetically disrupted, this is also thought to be a potential cause of depletion or normal TDP-43 (a phenotype that can be addressed using the TDP-43 mimics of the present invention).

[0283] Examples of TDP-43 RNA targets Depletion of TDP-43 in neurons results in significant changes in the RNA processing of a large population of RNA transcripts in the cell.

[0284] The examples illustrate five of these TDP-43 target RNAs: STMN2, KALRN, ACTL6B, UNC13A, and CAMK2B, but the present invention is not limited in this regard.

[0285] Arnold et al., PNAS 2013 110 E736-745 identified extensive abnormalities in pre-mRNA splicing of TDP-43-bound RNAs in TDP-43-depleted cells (TDP-43 ASO-depleted mice) and described the identification of TDP-43-regulated splicing events serving as indicators using microarray analysis. RNAs identified by Arnold et al. whose splicing is regulated by TDP-43 include Eif4h, Taf1b, Kcnip2 (TDP-43 mutation-dependent), Sort1, Kcnd3, Ahi1, Atxn2, Ctnnd (dose-dependent).

[0286] STMN2 (Klim et al., Nat Neurosci. 2019 Feb;22(2):167-179) - Depletion of TDP-43 in neurons (e.g., in ALS) results in mis-splicing of STMN2 transcripts. STMN2 encodes a microtubule regulatory factor, and its expression is reduced after knockdown of TDP-43 and mislocalization of TDP-43, as well as in patient-specific motor neurons and postmortem patient spinal cords.

[0287] Post-translational stabilization of STMN2 rescued neurite outgrowth and axonal regeneration defects induced by TDP-43 depletion. TDP-43 depletion results in the incorporation of a cryptic intron between exon 1 and exon 2 of STMN2. WO 2019 / 241648 discloses fully MOE-modified phosphorothioate ASOs used to suppress mis-splicing of STMN2.

[0288] Using the above transcripts and related TDP-43 depletion splicing events, the compounds of the invention can be assayed for restoration of TDP-43 functionality.

[0289] TDP-43 pathologies TDP-43 pathologies are diseases associated with reduced or abnormal expression of TDP-43 and are often associated with increased cytoplasmic TDP-43, particularly hyperphosphorylated and ubiquitinated TDP-43.

[0290] TDP-43 depletion has been shown in a variety of diseases called TDP-43 pathologies, including, for example, amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy, and chronic traumatic encephalopathy.

[0291] Cells depleted of TDP-43 Cells in which TDP-43 is depleted refer to cells with a reduced functional level of TDP-43. In the TDP-43 pathological state, it will be understood that abnormal TDP-43 expression leads to the accumulation of dysfunctional cytoplasmic TDP-43 and a reduction in the level of functional nuclear TDP-43. Thus, such cells in which TDP-43 is depleted may be characterized by a reduced functional level of TDP-43 and, thus, may be associated with an increase in the level of dysfunctional TDP-43. For in vitro evaluation, TDP-43 depletion can be manipulated, for example, by genetic engineering approaches (such as CRISPR / CAS9) or by the use of antisense oligonucleotide inhibitors of TDP-43, exemplified by gapmer oligonucleotides targeting human TDP-43 transcripts, as illustrated in the examples.

[0292] In some embodiments, the cells in which TDP-43 is depleted are neuronal cells.

[0293] A sequence complementary to the TDP-43 binding site The TDP-43 binding site is characterized, for example, by a polyGU motif (see the RNA binding A database https: / / attract.cnic.es / results / e9f29380-8921-406e-84a8-27ce9b9398b4#), and may suitably contain a motif of (GU)n or (UG)n for antisense oligonucleotide intervention, where n is at least 3 or preferably at least 4. In some embodiments, n is 4, 5, 6, 7, 8, 9 or 10.

[0294] In some embodiments, the TDP-43 binding site may include a sequence selected from the group consisting of (UG)n, (GU)n [where n is from 4 to 20], UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO: 95), UGUGUGUGUGU (SEQ ID NO: 84), UGUGUGUGUGUG (SEQ ID NO: 85), UGUGUGUGUGUGU (SEQ ID NO: 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO: 87), GUGUGUGUGUG (SEQ ID NO: 88), GUGUGUGUGUGU (SEQ ID NO: 89), GUGUGUGUGUGUG (SEQ ID NO: 90), and GUGAAUGA.

[0295] In some embodiments, the TDP-43 binding site may include a sequence selected from the group consisting of GUGAAUGA, GUUGUGC, UGUGUGUGUGUG (SEQ ID NO: 85), GAAUGG, UGUGUGUG, GAAUGA, UGUGUG, GUUGUUC, and GUUUUGC. In some embodiments, the TDP-43 binding site may include the sequence UGUGUGUGUGUGUG (SEQ ID NO: 91).

[0296] In some embodiments, the antisense oligonucleotide of the present invention may include a sequence complementary, e.g., completely complementary, to one or more sequences selected from the group consisting of (UG)n, (GU)n [where n is from 4 to 20], UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO: 95), UGUGUGUGUGU (SEQ ID NO: 84), UGUGUGUGUGUG (SEQ ID NO: 85), UGUGUGUGUGUGU (SEQ ID NO: 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO: 87), GUGUGUGUGUG (SEQ ID NO: 88), GUGUGUGUGUGU (SEQ ID NO: 89), GUGUGUGUGUGUG (SEQ ID NO: 90), and GUGAAUGA.

[0297] The antisense oligonucleotide of the present invention may include a sequence complementary to, for example, a completely complementary sequence, to one or more sequences selected from the group consisting of TDP-43 binding site sequences such as (GU)n, (UG)n, GUGAAUGA, GUUGUGC, GAAUGG, UGUGUGUG, GAAUGA, UGUGUG, UGUGUGUGUGUG (SEQ ID NO: 85), GUUGUUC, and GUUUUGC.

[0298] Oligonucleotide As used herein, the term "oligonucleotide" is defined as generally understood by those skilled in the art as a molecule comprising two or more covalently linked nucleosides. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are usually prepared in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase portions of the covalently linked nucleotides or nucleosides, or modifications thereof. The antisense oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated.

[0299] The antisense oligonucleotide of the present invention comprising a continuous nucleotide sequence containing one or more 2'-MOE nucleosides may further comprise one or more additional or additional modified nucleosides, such as 2'-sugar modified nucleosides. The antisense oligonucleotides of the present invention may include one or more modified internucleoside linkages, such as phosphorothioate internucleoside linkages.

[0300] Antisense oligonucleotide As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridizing to a target nucleic acid, particularly a contiguous sequence on the target nucleic acid. Antisense oligonucleotides are not essentially double-stranded and thus are not siRNA or shRNA. The antisense oligonucleotides of the present invention may be single-stranded. The single-stranded oligonucleotides of the present invention are understood to be capable of forming hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide) as long as the degree of intra- or intermolecular complementarity is less than about 50% over the entire length of the oligonucleotide.

[0301] In some embodiments, the single-stranded antisense oligonucleotides of the present invention may not contain RNA nucleosides.

[0302] Advantageously, the antisense oligonucleotides of the present invention comprising a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more additional or further modified nucleosides or nucleotides, such as 2'-sugar modified nucleosides. Further, in some antisense oligonucleotides of the present invention, it may be advantageous for the unmodified nucleosides to be DNA nucleosides.

[0303] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to the region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence". In some embodiments, all of the nucleotides of the antisense oligonucleotide constitute a contiguous nucleotide sequence. The contiguous nucleotide sequence is the sequence of nucleotides in an oligonucleotide of the present invention that is complementary, and in some cases completely complementary, to the target nucleic acid or target sequence.

[0304] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence and optionally, further nucleotides, for example, a nucleotide linker region that can be used to attach additional nucleotides, such as functional groups (e.g., conjugate groups) to the contiguous nucleotide sequence, may be included as needed. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the contiguous nucleotide sequence of the oligonucleotide cannot be longer than the oligonucleotide itself and the oligonucleotide cannot be shorter than the contiguous nucleotide sequence.

[0305] Nucleotides and Nucleosides Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides and, for the purposes of the present invention, include both naturally occurring nucleotides and nucleosides and non-naturally occurring nucleotides and nucleosides. By nature, nucleotides such as DNA nucleotides and RNA nucleotides include a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides can also be referred to interchangeably as "units" or "monomers".

[0306] Modified Nucleosides As used herein, the terms "modified nucleoside" or "nucleoside modification" refer to a nucleoside modified by the introduction of one or more modifications to the sugar moiety or the (nucleic acid) base moiety, as compared to the equivalent DNA or RNA nucleoside. Advantageously, the antisense oligonucleotides of the invention comprising a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more additional or further modified nucleosides comprising a modified sugar moiety. The term modified nucleoside may also be used interchangeably herein with the terms "nucleoside analog", or modified "unit", or modified "monomer". Nucleosides having an unmodified DNA or RNA sugar moiety are referred to herein as DNA or RNA nucleosides. Nucleosides having a modification in the base region of a DNA or RNA nucleoside are still generally referred to as DNA or RNA if they are capable of Watson-Crick base pairing. Exemplary modified nucleosides that may be used in the compounds of the invention include LNA, 2'-O-MOE and morpholino nucleoside analogs.

[0307] Modified internucleoside linkage The term "modified internucleoside linkage" is defined as is generally understood by one of ordinary skill in the art as a linkage other than a phosphodiester (PO) linkage that covalently joins two nucleosides to each other. Thus, the antisense oligonucleotides of the invention can comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0308] In some embodiments, at least 50% of the internucleoside linkages of the antisense oligonucleotide or a contiguous nucleotide sequence thereof are phosphorothioates, for example at least 60%, for example at least 70%, for example at least 75%, for example at least 80%, or for example at least 90% or more of the internucleoside linkages are phosphorothioates. In some embodiments, all of the internucleoside linkages of the antisense oligonucleotide or a contiguous nucleotide sequence thereof are phosphorothioates.

[0309] Advantageously, all of the internucleoside linkages of a contiguous nucleotide sequence of the antisense oligonucleotide are phosphorothioates or all of the internucleoside linkages of the antisense oligonucleotide are phosphorothioate linkages.

[0310] Nucleobase The term nucleobase includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase includes modified nucleobases which may differ from the naturally occurring nucleobases but which are functional in nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine and non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research 45:2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0311] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine, 5' nitroindole.

[0312] The nucleobase moiety may be represented by the letter code for each corresponding nucleobase, e.g., A, T, G, C or U, and each letter may optionally include a modified nucleobase of equivalent function. For example, in the exemplified antisense oligonucleotide, the nucleobase moiety is selected from A, T, G, C and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used.

[0313] Modified oligonucleotide The term "modified oligonucleotide" refers to an antisense oligonucleotide that includes one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric oligonucleotide" is a term used in the literature to describe an oligonucleotide that includes sugar-modified nucleosides and DNA nucleosides. In some embodiments, it may be advantageous for the antisense oligonucleotide of the invention to be a chimeric oligonucleotide.

[0314] Complementarity The term "complementary" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may contain nucleosides with modified nucleic acid bases, for example 5-methylcytosine is often used in place of cytosine, and thus it will be understood that the term "complementary" encompasses Watson-Crick base pairing between unmodified and modified nucleic acid bases (see, for example, Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl.37 1.4.1).

[0315] As used herein, the term "% complementary" refers to the percentage of nucleotides in a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that is complementary to a reference sequence (e.g., a target sequence or sequence motif) over a contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleic acid bases (from Watson-Crick base pairs) that are complementary between two sequences (when the target sequence 5'-3' and the oligonucleotide sequence from 3'-5' are aligned), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such comparisons, nucleic acid bases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not tolerated in the calculation of % complementarity of contiguous nucleotide sequences. It will be understood that in determining complementarity, chemical modifications of nucleic acid bases are ignored so long as the functional ability of the nucleic acid base to form Watson-Crick base pairs is retained (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating % identity).

[0316] In the present invention, the level of complementarity between the continuous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence can be at least about 75%.

[0317] In the present invention, the level of complementarity between the continuous nucleotide sequence of the antisense oligonucleotide and the target TDP-43 binding site or target sequence can be at least about 80%.

[0318] In the present invention, the level of complementarity between the continuous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence can be at least about 85%.

[0319] In the present invention, the level of complementarity between the continuous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence can be at least about 90%.

[0320] In the present invention, the level of complementarity between the continuous nucleotide sequence of the antisense oligonucleotide and the TDP-43 binding site or target sequence can be at least about 95%.

[0321] In some embodiments, the continuous nucleotide sequence can be completely complementary to the TDP-43 binding site or target sequence. The term "completely complementary" refers to 100% complementarity.

[0322] The compounds of the present invention are complementary to the TDP-43 binding site in the TDP-43 target RNA.

[0323] Complete complementarity may not be required, and in some embodiments, the antisense oligonucleotide may contain 1, 2, 3, 4, 5, 6, 7, 8 or more mismatches to the TDP-43 target RNA TDP-43 RNA binding site to which it effectively binds. In this regard, antisense oligonucleotides that are sufficiently complementary but not identical to multiple TDP-43 binding sites in different TDP-43 target RNAs can be designed. In some embodiments, when there is no complete identity of the TDP-43 binding site sequences in multiple TDP-43 RNA targets, universal bases such as inosine can be used at complementary positions in the antisense oligonucleotide.

[0324] In some embodiments, the continuous nucleotide sequence may contain one or more mismatches to the TDP-43 binding site or target sequence.

[0325] In some embodiments, the continuous nucleotide sequence may contain two or more mismatches to the TDP-43 binding site or target sequence.

[0326] In some embodiments, the continuous nucleotide sequence may contain three or more mismatches to the TDP-43 binding site or target sequence.

[0327] In some embodiments, the continuous nucleotide sequence may contain four or more mismatches to the TDP-43 binding site or target sequence.

[0328] In some embodiments, the continuous nucleotide sequence may contain five or more mismatches to the TDP-43 binding site or target sequence.

[0329] In some embodiments, the continuous nucleotide sequence may contain six or more mismatches to the TDP-43 binding site or target sequence.

[0330] In some embodiments, the continuous nucleotide sequence may include seven or more mismatches to the TDP-43 binding site or target sequence.

[0331] In some embodiments, the continuous nucleotide sequence may include eight or more mismatches to the TDP-43 binding site or target sequence.

[0332] In some embodiments, antisense oligonucleotides of the invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more mismatches can hybridize to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for oligonucleotides 10 to 32 nucleotides in length.

[0333] In some embodiments, antisense oligonucleotides of the invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more mismatches can hybridize to the target nucleic acid with an estimated ΔG° value of less than -12 kcal, -15 kcal, -17 kcal, -20 kcal, -30 kcal, -40 kcal, -50 kcal or -60 kcal for oligonucleotides 10 to 32 nucleotides in length.

[0334] The calculation of the ΔG° value will be described later.

[0335] Identity As used herein, the term "identity" refers to the percentage (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an oligonucleotide) that is identical to a reference sequence (e.g., a sequence motif) over a contiguous nucleotide sequence. Thus, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleic acid bases between two sequences (in the contiguous nucleotide sequence of a compound of the invention and the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, percent identity = (number of matches × 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not tolerated in the calculation of the percentage of identity of a contiguous nucleotide sequence. In determining identity, chemical modifications of nucleic acid bases are understood to be ignored as long as the functional ability of the nucleic acid base to form Watson Crick base pairs is retained (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating % identity).

[0336] Hybridization As used herein, the terms "hybridize" or "hybridizing" are to be understood to mean that two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) form a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the binding between two nucleic acid strands is the strength of hybridization. This is often described by the melting temperature (T m ), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix (2003) "Oligonucleotides" Vol. 13 pp. 515-537). The standard state Gibbs free energy ΔG° more accurately represents the binding affinity and is given by ΔG° = -RTln(K d ) where K d) is associated with, where R is the gas constant and T is the absolute temperature. Thus, the very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid reflects the strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous concentration of 1 M, a pH of 7, and a temperature of 37°C. The hybridization of the oligonucleotide to the target nucleic acid is a spontaneous reaction, and in the case of a spontaneous reaction, ΔG° is less than zero. ΔG° can be experimentally measured, for example, by isothermal titration calorimetry (ITC), as described in Hansen et al., 1965, Chem. Comm. 36 - 38 and Holdgate et al., 2005, Drug Discov Today. Those skilled in the art will know that commercially available devices are available for ΔG° measurement. ΔG° can also be numerically estimated by using the nearest neighbor model described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95:1460 - 1465 and appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211 - 11216 and McTigue et al., 2004, Biochemistry 43:5388 - 5405. In some embodiments, the antisense oligonucleotide of the present invention hybridizes to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for an oligonucleotide 10 - 30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔG°. The antisense oligonucleotide can hybridize to the target nucleic acid with an estimated ΔG° value of less than the range of -10 kcal, for example less than -15 kcal, for example less than -20 kcal, and for example less than -25 kcal for an oligonucleotide 8 - 30 nucleotides in length. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, for example -12 to -40, for example -15 to -30 kcal, or -16 to -27 kcal, for example -18 to -25 kcal.

[0337] Exemplary TDP-43 RNA targets In some embodiments, the TDP-43 target RNA is stathmin 2, or a mammalian protein known as SCG10, SCGN10, such as human STMN2 disclosed as the following gene: ENSG00000104435 (ensemble.org), encoded on the forward strand at human chromosome 8: 79,610,814-79,666,175 (GRCh38: CM000670.2).

[0338] In some embodiments, the TDP-43 target RNA is CAMK2B.

[0339] In some embodiments, the TDP-43 target RNA is KALRN.

[0340] In some embodiments, the TDP-43 target RNA is UNC13A.

[0341] In some embodiments, the TDP-43 target RNA is ACTL6B.

[0342] Target cells As used herein, the term "target cell" refers to a cell that expresses a targeted TDP-43 RNA target whose expression is corrected by administration of a compound of the invention. Appropriately, the target cell is further depleted of TDP-43. For experimental use, TDP-43 depletion can be engineered into the cell, for example, via genetic manipulation (e.g., CRISPR / CAS9), or via use of an ASO inhibitor of TDP-43.

[0343] In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell, such as a monkey cell or a human cell.

[0344] In some embodiments, the target cell is a nerve cell.

[0345] For in vitro evaluation, the target cells can be glutamatergic neurons (also referred to herein as glutaneurons cells), such as human glutamatergic neurons, such as human glutamatergic neurons depleted of TDP-43. Human glutamatergic neurons are available from Cellular Dynamics (iCell GlutaNeurons). The target cells for in vitro evaluation, such as glutaneurons, are in vitro. For example, depletion of TDP-43 in the target cells for in vitro evaluation can be achieved using, for example, antisense oligonucleotides or siRNA reagents, or can be engineered into the cells via, for example, CRISPR / Cas9 editing or shRNA vector expression. As further exemplified in the Examples, for example, the target cells for in vitro use can be human pluripotent stem cell-derived neurons, for example, these can be obtained as iCell GlutaNeurons Kit, 01279 Cat.R1034 (Fujifilm Cellular Dynamics).

[0346] Splicing regulation Splicing regulation can be used to correct potential splicing, regulate alternative splicing, restore open reading frames, and induce protein knockdown.

[0347] Splice regulation can be assayed by RNA sequencing (RNAseq), which enables quantitative assessment of different splice products of pre-mRNA, or by digital droplet PCR using a PCR assay designed to be specific for one or the other splice form. In some embodiments of the invention, antisense oligonucleotides regulate the splicing of STMN2 pre-mRNA, for example, they reduce the level of mature STMN2 mRNA containing the RNA sequence located between exon 1 and exon 2, for example, in target cells or TDP-43 depleted cells (shown in the examples). In some embodiments of the invention, antisense oligonucleotides regulate the splicing of STMN2 pre-mRNA, for example, they enhance the level of mature correctly spliced STMN2 mRNA that does not contain the RNA sequence located between exon 1 and exon 2, called the WT STMN2 transcript, for example, in target cells.

[0348] High-affinity modified nucleoside A "high-affinity modified nucleoside" is a modified nucleotide that, when incorporated into an antisense oligonucleotide, enhances the affinity of the antisense oligonucleotide for its complementary target, as measured by, for example, the melting temperature (T m ). The high-affinity modified nucleosides of the present invention preferably result in an increase in melting temperature of +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C per modified nucleoside. Numerous high-affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0349] Sugar modification The antisense oligonucleotides of the present invention comprising a continuous nucleotide sequence containing one or more 2'-MOE nucleosides may further comprise one or more nucleosides having a modified sugar moiety, i.e., a modification of the sugar moiety as compared to the ribose sugar moiety found in DNA and RNA.

[0350] Numerous nucleosides having a modification of the ribose sugar moiety have been made primarily for the purpose of improving certain properties of oligonucleotides such as affinity and / or nuclease resistance.

[0351] Such modifications include those in which the ribose ring structure is modified, for example, by replacing it with a hexose ring (HNA) or a bicyclic ring (typically having a biradical bridge between the C2 and C4 carbons of the ribose ring (LNA)), or an unlinked ribose ring typically lacking a bond between the C2 and C3 carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (International Publication No. WO 2011 / 017521) or tricyclic nucleic acids (International Publication No. WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, for example, in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0352] Sugar modifications also include modifications made by changing a substituent on the ribose ring to a group other than hydrogen or the 2'-OH group that is naturally present in DNA and RNA nucleosides. The substituent can be introduced, for example, at the 2', 3', 4', or 5' position.

[0353] 2'-Sugar-modified nucleoside A 2'-sugar-modified nucleoside is a nucleoside having a substituent other than H or -OH at the 2'-position (a 2'-substituted nucleoside), or a nucleoside containing a 2'-linked biradical capable of forming a bridge between the 2'-carbon of the ribose ring and a second carbon, for example, an LNA (2'-4' biradical bridge) nucleoside.

[0354] In fact, the development of 2'-sugar substituted nucleosides has attracted much attention, and numerous 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can confer enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA nucleosides, 2'-O-methyl-RNA nucleosides, 2'-alkoxy-RNA nucleosides, 2'-O-methoxyethyl-RNA (MOE) nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. The following are examples of some 2'-substituted modified nucleosides. [Chemical formula]

[0355] With respect to the present invention, 2'-substituted sugar-modified nucleosides do not include 2'-bridged nucleosides such as LNA.

[0356] Locked nucleic acid nucleoside (LNA nucleoside) An "LNA nucleoside" is a 2'-modified nucleoside that contains a biradical (also referred to as a "2'-4' bridge") that links C2' and C4' of the ribose sugar ring of the above nucleoside, which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). The locking of the ribose conformation is associated with an enhanced hybridization affinity (double-strand stabilization) when LNA is incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary double strand.

[0357] Non-limiting, exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0358] Further non-limiting, exemplary LNA nucleosides are disclosed in Scheme 1.

Chemical Structure

[0359] Certain LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA.

[0360] A particularly advantageous LNA is β-D-oxy-LNA.

[0361] Morpholino oligonucleotides In some embodiments, the antisense oligonucleotides of the invention comprise or consist of morpholino nucleosides (i.e., are morpholino oligomers, such as phosphorodiamidate morpholino oligomers (PMO)). Splice-modulating morpholino oligonucleotides are approved for clinical use and are, for example, the 30 nt morpholino oligonucleotide that targets a frameshift mutation in DMD and is used in the treatment of Duchenne muscular dystrophy, see eteplirsen. Morpholino oligonucleotides have nucleobases attached to a six-membered morpholine ring rather than ribose, such as a methylene morpholine ring linked via a phosphorodiamidate group as shown in the description of the following four consecutive morpholino nucleosides.

Chemical formula

[0362] In some embodiments, the morpholino oligonucleotides of the invention can be, for example, 20 to 40 morpholino nucleoside in length, such as 25 to 35 morpholino nucleoside in length.

[0363] RNase H activity and recruitment The RNase H activity of an antisense oligonucleotide refers to the ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide having the same base sequence as the modified oligonucleotide being tested when a complementary target nucleic acid sequence is provided, but containing only DNA monomers having phosphorothioate linkages between all monomers in the oligonucleotide, is used, and when using the methodology provided by Examples 91 - 95 of WO 01 / 23613 (incorporated herein by reference), if it has an initial velocity measured at at least 5%, for example at least 10% or more than 20% of the initial velocity determined, in pmol / l / min, this oligonucleotide is considered to be able to recruit RNase H. For use in determining RHase H activity, recombinant RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland.

[0364] DNA oligonucleotides are known to effectively recruit RNase H, similar to gapmer oligonucleotides that contain a region of DNA nucleosides (typically at least 5 or 6 contiguous DNA nucleosides) flanked 5' and 3' by regions containing 2'-sugar modified nucleosides, typically high affinity 2'-sugar modified nucleosides such as 2-O-MOE and / or LNA. For effective regulation of splicing, degradation of pre-mRNA is undesirable, and thus it is preferred to avoid RNase H degradation of the target. Accordingly, the antisense oligonucleotides of the present invention are preferably not gapmer oligonucleotides. RNase H recruitment can be avoided by limiting the number of contiguous DNA nucleotides in the antisense oligonucleotide, and thus, for effective splice regulation, mixmer and totalmer designs can be used.

[0365] Mixmers and Totalmers For splice modulation, it is often advantageous to use antisense oligonucleotides that do not recruit RNAaseH. Since RNaseH activity requires a continuous sequence of DNA nucleotides, the RNaseH activity of antisense oligonucleotides can be achieved by designing antisense oligonucleotides that do not contain regions of more than three or more than four contiguous DNA nucleosides. This can be achieved by using a mixmer design with sugar-modified nucleosides such as 2'-sugar-modified nucleosides and short regions of DNA nucleosides such as one, two or three DNA nucleosides, or contiguous nucleoside regions thereof. Mixmers are exemplified herein by each second design in which the nucleosides alternate between one LNA nucleoside and one DNA nucleoside, for example between LDLDLDLDLDLDLDLL having 5' and 3' terminal LNA nucleosides, and each third design such as LDDLDDLDDLDDLDDL in which every third nucleoside is an LNA nucleoside.

[0366] Totalmers are antisense oligonucleotides or contiguous nucleotide sequences that do not contain DNA or RNA nucleosides, and may contain, for example, fully modified MOE phosphorothioates, such as MMMMMMMMMMMMMMMMMMMM (M = 2'-O-MOE), which have been reported to be effective splice modulating factors for therapeutic use, containing only 2'-O-MOE nucleosides. Alternatively, mixmers may contain a mixture of modified nucleosides such as MLMLMLMLMLMLMLMLMLML, where L = LNA and M = non-LNA modified nucleosides, such as 2'-O-MOE nucleosides.

[0367] Advantageously, the internucleoside between nucleosides in the mixmer and totalmer may be phosphorothioate, or most of the nucleoside linkages in the mixmer may be phosphorothioate. The mixmer and totalmer may include other internucleoside linkages such as, by way of example, phosphodiester or phosphorodithioate.

[0368] Region D’ or D’’ within the oligonucleotide

[0369] The consecutive sequence of nucleobases of the oligonucleotide of the present invention is typically complementary to a plurality of TDP-43 binding sites present in different TDP-43 RNA targets. A region of an antisense oligonucleotide that is complementary, e.g., fully complementary, to a TDP-43 binding site is referred to as a contiguous nucleotide sequence. In some embodiments, all of the nucleosides of the antisense oligonucleotide are within the contiguous nucleotide sequence (i.e., the antisense oligonucleotide and the contiguous nucleotide sequence are of the same length of nucleotides). In some embodiments, the antisense oligonucleotide comprises the contiguous nucleotide sequence and, optionally, a nucleotide-based linker region that can link the oligonucleotide to any functional group such as a conjugate or other non-complementary terminal nucleosides (e.g., region D’ or D’’).

[0370] In some embodiments, the oligonucleotide of the present invention may comprise or consist of a contiguous nucleotide sequence of an oligonucleotide complementary to a target nucleic acid, such as a mixmer or totalmer, and further 5’ and / or 3’ nucleosides. The additional 5’ and / or 3’ nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5’ and / or 3’ nucleosides may be referred to herein as regions D’ and D’’.

[0371] The addition of region D' or D'' can be used for the purpose of linking a continuous nucleotide sequence, such as a mixmer or a totalmer, to a conjugate moiety or another functional group. When used for ligation, the continuous nucleotide sequence having the conjugate moiety can serve as a biodegradable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacture.

[0372] Region D' or D'' independently contains or consists of 1, 2, 3, 4, or 5 additional nucleotides and may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides such as DNA or RNA, nor are they the base-modified versions of these. The D' or D' region can serve as a nuclease-sensitive biodegradable linker (see the definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biodegradable linkers suitable for use as region D' or D'' are disclosed in International Publication No. WO2014 / 076195, which includes, by way of example, phosphodiester-linked DNA dinucleotides. The use of biodegradable linkers in polynucleotide constructs is disclosed in International Publication No. WO2015 / 113922, where they are used to link multiple antisense constructs within a single oligonucleotide.

[0373] In one embodiment, the antisense oligonucleotide of the present invention includes region D' and / or D'' in addition to the continuous nucleotide sequence constituting the mixmer or totalmer.

[0374] In some embodiments, the internucleoside bond located between region D' or D'' and the mixmer or totalmer region is a phosphodiester bond.

[0375] Linker A linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. The conjugate moiety can be attached to the oligonucleotide directly or via a linking moiety (e.g., a linker or a tether). The linker serves to covalently bond a third region, e.g., a conjugate moiety (region C), to a first region, e.g., an oligonucleotide or a continuous nucleotide sequence (region A) complementary to a target nucleic acid.

[0376] In some embodiments of the invention, the antisense oligonucleotide of the invention can optionally include a linker region (second region or region B and / or region Y) located between an antisense oligonucleotide or a continuous nucleotide sequence (region A or first region) complementary to the target nucleic acid and a conjugate moiety (region C or third region).

[0377] Region B refers to a biodegradable linker that includes or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in the mammalian body. Conditions under which the physiologically labile linker undergoes a chemical transformation (e.g., cleavage) include pH, temperature, oxidative or reductive conditions, or chemical conditions such as a drug, as well as salt concentrations found in or similar to those encountered in mammalian cells. Intracellular conditions in mammalian cells also include the presence of enzymatic activities normally present in mammalian cells such as proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment, the biodegradable linker is susceptible to S1 nuclease cleavage. In some embodiments, the nuclease-sensitive linker includes 1 to 5 nucleosides such as DNA nucleosides that include at least two consecutive phosphodiester bonds. Biodegradable linkers containing phosphodiesters are described in more detail in WO 2014 / 076195.

[0378] Region Y does not necessarily have to be biocleavable, but mainly refers to a linker that helps covalently attach a conjugate moiety (region C or the third region) to an oligonucleotide (region A or the first region). The region Y linker can include a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The antisense oligonucleotides of the present invention can be constructed from the following local elements A-C, A-B-C, A-B-Y-C, A-Y-B-C, or A-Y-C. In some embodiments, the linker (region Y) is an aminoalkyl such as a C2-C36 aminoalkyl group including, for example, a C6-C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0379] Treatment As used herein, the term "treatment" refers to both the treatment of an existing disease (e.g., a disease or disorder referred to herein) and the prevention of a disease, i.e., prophylaxis. Thus, it will be appreciated that the treatment referred to herein can, in some embodiments, be prophylactic. In some embodiments, the treatment is not prophylactic; for example, the treatment is the treatment of existing disease symptoms diagnosed in a patient.

[0380] The antisense oligonucleotides of the present invention The antisense oligonucleotides of the present invention are complementary to RNA binding sites on multiple independent pre-mRNA transcripts, such as TDP-43 RNA binding sites on multiple pre-mRNA transcripts. The antisense oligonucleotides of the present invention can regulate the expression of multiple pre-mRNA transcripts, for example, through (independent) regulation of pre-mRNA splicing, enhancement of RNA stabilization, enhancement of the expression of the encoded protein, and reduction of the expression of the truncated protein encoded by the pre-mRNA. Thus, as shown in the examples, the antisense oligonucleotides of the present invention can be used to enhance the fidelity of pre-mRNA processing into mature mRNA encoding a correctly expressed functional protein. Thus, the antisense oligonucleotides of the present invention may be suitable for use in the treatment of diseases associated with dysregulation of pre-mRNA maturation.

[0381] In some embodiments, the antisense oligonucleotides of the present invention may contain 1, 2, 3, 4, 5, 6, 7, 8, or more mismatches between the antisense oligonucleotide and the target nucleic acid TDP-43 binding region. Despite the mismatches, hybridization to the target nucleic acid may still be sufficient to demonstrate the desired regulation of the TDP-43 RNA target RNA. The reduction in binding affinity resulting from the mismatches can be advantageously compensated for by an increase in the number of nucleotides in the antisense oligonucleotide and / or an increase in the number of modified nucleosides that can increase binding affinity to the target, such as the number of 2'-sugar modified nucleosides containing LNA present within the oligonucleotide sequence.

[0382] In some embodiments, one, two, three, four, five, six, seven, eight or more universal nucleosides such as inosine can be used at the mismatch positions.

[0383] Inosine is a nucleoside having the following structure.

Chemical formula

[0384] Universal nucleosides are particularly useful when antisense oligonucleotides target different TDP-43 target RNAs having non-identical TDP-43 binding regions.

[0385] In some embodiments, the continuous nucleotide sequence may include one or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0386] In some embodiments, the continuous nucleotide sequence may include two or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0387] In some embodiments, the continuous nucleotide sequence may include three or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0388] In some embodiments, the continuous nucleotide sequence may include four or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0389] In some embodiments, the continuous nucleotide sequence may include five or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0390] In some embodiments, the continuous nucleotide sequence may include six or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0391] In some embodiments, the continuous nucleotide sequence may include seven or more universal nucleotides at positions representing mismatches to the TDP-43 binding site or target sequence.

[0392] In some embodiments, the continuous nucleotide sequence may include eight or more universal nucleotides at positions representing a mismatch to the TDP-43 binding site or target sequence.

[0393] In some embodiments, the antisense oligonucleotides of the present invention containing universal nucleotides at one or more positions representing a mismatch, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more, may hybridize to a target nucleic acid with an estimated ΔG° value of less than -10 kcal for an oligonucleotide having a length of 10 to 32 nucleotides.

[0394] In some embodiments, the antisense oligonucleotides of the present invention containing one or more, such as two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more mismatches may hybridize to a target nucleic acid with an estimated ΔG° value of less than -12 kcal, -15 kcal, -17 kcal, -20 kcal, -30 kcal, -40 kcal, -50 kcal, or -60 kcal for an oligonucleotide having a length of 10 to 32 nucleotides.

[0395] The calculation of the ΔG° value has been described above.

[0396] In some embodiments, the antisense oligonucleotide of the present invention or its continuous nucleotide sequence includes or consists of a continuous nucleotide length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.

[0397] In some embodiments, the antisense oligonucleotide or continuous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 1-83 or SEQ ID NOs: 118-126. The sequences shown in SEQ ID NOs: 1-83 or SEQ ID NOs: 118-126 may contain modified nucleobases that function as nucleobases shown in base pairing. For example, it will be understood that 5-methylcytosine can be used instead of methylcytosine. Inosine can be used as a universal base.

[0398] In some embodiments, the antisense oligonucleotide or continuous nucleotide sequence comprises or consists of an 8-30 or 8-40 nucleotide length having at least 75%, such as at least 80%, at least 85%, at least 90%, at least 95% identity or more than 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1-83 or SEQ ID NOs: 118-126. In some embodiments, the antisense oligonucleotide or continuous nucleotide sequence comprises or consists of an 8-30 or 8-40 nucleotide length having 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 1-83 or SEQ ID NOs: 118-126.

[0399] It is understood that the continuous nucleobase sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity for the target nucleic acid.

[0400] The pattern in which modified nucleosides (such as high-affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally referred to as oligonucleotide design.

[0401] The antisense oligonucleotides of the present invention are designed using modified nucleosides and DNA nucleosides. Advantageously, high-affinity modified nucleosides are used.

[0402] In one embodiment, an antisense oligonucleotide comprising a continuous nucleotide sequence comprising one or more 2'-MOE nucleosides further comprises at least one additional or extra modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 modified nucleosides, at least 17 modified nucleosides, at least 18 modified nucleosides, at least 19 modified nucleosides, at least 20 modified nucleosides, at least 21 modified nucleosides, at least 22 modified nucleosides, at least 23 modified nucleosides, at least 24 modified nucleosides, at least 25 modified nucleosides, at least 26 modified nucleosides, at least 27 modified nucleosides, at least 28 modified nucleosides, at least 29 modified nucleosides, at least 30 modified nucleosides, at least 31 modified nucleosides, at least 32 modified nucleosides, at least 33 modified nucleosides, at least 34 modified nucleosides, at least 35 modified nucleosides, at least 36 modified nucleosides, at least 37 modified nucleosides, at least 38 modified nucleosides, at least 39 modified nucleosides or more. In one embodiment, an antisense oligonucleotide comprising a continuous nucleotide sequence comprising one or more 2'-MOE nucleosides further comprises 1 to 10 modified nucleosides, e.g., 2 to 9 modified nucleosides, e.g., 3 to 8 modified nucleosides, e.g., 4 to 7 modified nucleosides, e.g., 6 or 7 modified nucleosides. Suitable modifications are described in "Modified Nucleosides", "High Affinity Modified Nucleosides", "Sugar Modifications", "2'-Sugar Modifications" and "Locked Nucleic Acids (LNAs)".

[0403] In one embodiment, an antisense oligonucleotide comprising a continuous nucleotide sequence comprising one or more 2'-MOE nucleosides may further comprise one or more sugar-modified nucleosides, such as 2'-sugar-modified nucleosides. Preferably, the oligonucleotides of the present invention further comprise one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).

[0404] In a further embodiment, the antisense oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in "modified internucleoside linkages". It is advantageous if at least 75%, for example all, of the internucleoside linkages within the continuous nucleotide sequence are phosphorothioate or boranophosphate linkages. In some embodiments, all of the internucleoside linkages in the continuous sequence of the antisense oligonucleotide are phosphorothioate linkages.

[0405] Pharmaceutically acceptable salts As used herein, the term "salt" conforms to its generally known meaning, i.e., an ionic aggregate of anions and cations.

[0406] The present invention contemplates pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention. In other words, the present invention provides pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention.

[0407] In some embodiments, the pharmaceutically acceptable salt is a sodium salt, a potassium salt, or an ammonium salt.

[0408] The present invention provides a pharmaceutically acceptable sodium salt of the antisense oligonucleotide of the present invention.

[0409] The present invention provides a pharmaceutically acceptable potassium salt of the antisense oligonucleotide of the present invention.

[0410] The present invention provides a pharmaceutically acceptable ammonium salt of the antisense oligonucleotide of the present invention.

[0411] Delivery of Antisense Oligonucleotide Splice Modulators The present invention provides an antisense oligonucleotide of the present invention, wherein the antisense oligonucleotide is encapsulated in a lipid-based delivery vehicle, covalently bound or encapsulated in a dendrimer, or conjugated to an aptamer.

[0412] This may be for the purpose of delivering the antisense oligonucleotide of the present invention to the target cells and / or improving the pharmacokinetics of the antisense oligonucleotide.

[0413] Examples of lipid-based delivery vehicles include oil-in-water emulsions, micelles, liposomes, and lipid nanoparticles.

[0414] Manufacturing Method In a further aspect, the present invention provides a method for manufacturing the antisense oligonucleotide of the present invention, the method comprising reacting nucleotide units to thereby form covalently linked consecutive nucleotide units contained within the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al. (1987) Methods in Enzymology, Vol. 154, pp. 287-313). In a further embodiment, the method further comprises reacting a consecutive nucleotide sequence with a conjugate moiety (ligand) to covalently attach the conjugate moiety to the antisense oligonucleotide. In a further aspect, there is provided a method for manufacturing a composition of the present invention, the method comprising mixing the antisense oligonucleotide of the present invention with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0415] Pharmaceutical composition In a further aspect, the present invention provides a pharmaceutical composition comprising any of the foregoing antisense oligonucleotides and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments, the antisense oligonucleotide is used in a pharmaceutically acceptable diluent at a concentration of 50-300 μM solution.

[0416] Use The antisense oligonucleotide of the present invention can be utilized, for example, as a research reagent for diagnosis, treatment, and prevention.

[0417] In the study, such antisense oligonucleotides can be used to mimic the activity of TDP-43 in cells (e.g., in vitro cell cultures such as neurons) and experimental animals, thereby facilitating the functional analysis of the target or the evaluation of its usefulness as a target for therapeutic intervention.

[0418] The present invention provides a method such as an in vivo or in vitro method for enhancing the functionality of TDP-43 in cells expressing abnormal or depleted levels of TDP-43, the method comprising administering to the cells an effective amount of an antisense oligonucleotide or pharmaceutical composition according to the present invention. In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells can be in vitro cell cultures or in vivo cells forming part of a mammalian tissue. In a preferred embodiment, the target cells are neuronal cells such as neuronal cells in which normal TDP-43 activity is depleted. In some embodiments, the target cells can express a disease-related variant of TDP-43 and / or a dysfunctional TDP-43.

[0419] For treatment, the antisense oligonucleotide can be administered to an animal or human suspected of having a disease or disorder that can be treated by mimicking TDP-43.

[0420] The present invention provides a method for treating or preventing a disease, the method comprising administering to a subject suffering from or susceptible to the disease a therapeutically effective amount or a prophylactically effective amount of the antisense oligonucleotide or pharmaceutical composition of the present invention.

[0421] The present invention also relates to an antisense oligonucleotide or pharmaceutical composition as defined herein for use as a medicament.

[0422] The antisense oligonucleotide or pharmaceutical composition according to the present invention is typically administered in an effective amount.

[0423] The present invention also provides the use of the antisense oligonucleotide of the present invention for the manufacture of a medicament for the treatment of a disorder according to the present invention, or for a method of treating a disorder mentioned herein.

[0424] The present invention further relates to the use of an antisense oligonucleotide or a pharmaceutical composition as defined herein for the manufacture of a medicament for treating a neurodegenerative disorder characterized by a pathological condition of TDP-43 or mislocalization of TDP-43 from the nucleus, such as a neurodegenerative disorder such as ALS.

[0425] The present invention also provides the antisense oligonucleotide of the present invention for use in a method of treating a disease or disorder mentioned herein.

[0426] In one embodiment, the present invention relates to an antisense oligonucleotide or a pharmaceutical composition for use in the treatment of a neurodegenerative disorder characterized by a pathological condition of TDP-43 or mislocalization of TDP-43 from the nucleus, such as a neurodegenerative disorder such as ALS.

[0427] The disease or disorder can be selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine disease such as spinocerebellar ataxia type 3, myopathy, and chronic traumatic encephalopathy.

[0428] Administration The antisense oligonucleotide or pharmaceutical composition of the present invention can be administered, for example, by intracerebral, intracerebroventricular or intrathecal administration.

[0429] In a preferred embodiment, the antisense oligonucleotide or pharmaceutical composition of the present invention is administered by a parenteral route including intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, for example, intracerebral or intraventricular, intravitreal administration. In one embodiment, the active antisense oligonucleotide or pharmaceutical composition is administered intravenously. In another embodiment, the active antisense oligonucleotide or pharmaceutical composition is administered subcutaneously.

[0430] Combination therapy In some embodiments, the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention is for use in combination treatment with one or more other therapeutic agents.

Examples

[0431] Example 1: Identification of mRNAs mis-spliced in the absence of the TDP43 protein One prominent feature of ALS disease is the presence of cytoplasmic aggregated TDP43 protein in a small fraction of the patient's neurons. The consequence of cytoplasmic aggregation of TDP43 is the depletion of TDP43 in the cell nucleus and thus its inability to perform its normal function in the cell nucleus.

[0432] TDP43 has been shown to affect mRNA splicing. To identify new genes whose mRNAs are regulated by the presence of TDP43, the inventors knocked down TDP43 in a neuronal cell model. RNA sequencing was performed on the cells and de novo transcript analysis was performed to identify affected genes with new splice patterns.

[0433] Human glutamate-activated neurons (Fujifilms) were seeded at 60,000 live cells in a 96-well plate coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) in 200 μl of culture medium together with 10,000 live astrocytes (Fujifilms) (-1 day).

[0434] To knockdown TDP-43, compound A (ID number: 1, SEQ ID NO: 13) was added to the culture medium at 5 μM on day 0. In other wells, PBS was added instead as a control. During the entire experiment, half of the cell culture medium was changed three times a week (on days 2, 5, 7, 10, 12, 14, and 17). Cells were harvested on day 20 using Magnapure lysis buffer (Roche), and RNA was isolated using the MagNA pure 96 system (Roche) according to the manufacturer's instructions, including a DNase treatment step. An NGS library was prepared from 100 ng of total RNA using the KAPA mRNA HyperPrep Kit for Illumina® Platforms (Roche). The library was subjected to paired-end sequencing on a NovaSeq 6000 sequencer (Illumina) with a read length of 150 bp. Data analysis was performed using CLC Genomics Workbench 21. The data was first analyzed by performing a large gap mapping analysis using the hg38 genome assembly, followed by transcript discovery. Predicted novel splicing events were investigated by manual visual inspection to identify actual splicing events. Some of the mis-splicing events identified as a result of TDP43 depletion are shown below, which were later restored again using ASO (Example 2).

[0435] STMN2: Inclusion of a novel exon 2 containing a polyA signal site results in a truncated transcript and produces a truncated STMN2 protein. The first base of the novel exon 2 is located at Chr 8 pos 79,616,822 (hg38).

[0436] CAMK2B: Novel use of a splice donor site results in an extended exon and causes nonsense-mediated decay of the transcript. The last base of the extended exon is located at Chr 7 pos 44,222,117 (hg38), which is the position where splicing occurs together with the next canonical splice acceptor site at Chr 7 pos 44,220,901 (hg38).

[0437] KALRN: Inclusion of the novel exon results in premature termination codons and nonsense-mediated decay of the transcript. The novel exon has two possible splice acceptor sites and the same splice donor site, resulting in an exon whose first and last bases are either chr 3 (hg38): (124,700,977; 124,701,255) or (124,701,093 - 124,701,255).

[0438] UNC13A: Inclusion of the novel exon results in premature termination codons and nonsense-mediated decay of the transcript. The novel exon has two possible splice acceptor sites and the same splice donor site, resulting in an exon whose first and last bases are either chr 19 (hg38): (17,642,591; 17,642,414) or (17,642,541 - 17,642,414). UNC13A is located on the minus strand. ACTL6B: Upon loss of TDP43, it was discovered that a new 69-base pair exon is included in ACTL6B. The first and last bases of the new exon are 100,650,643 and 100,650,575.

[0439] According to the hg38 human gene annotation, ACTL6B is arranged in the minus direction.

[0440] Example 2: Improved recovery of splicing using CA repeat MOE ASO with cholesterol conjugation in TDP43-depleted glutamatergic neurons Here, the inventors demonstrate the CA repeat ASO ability to induce proper splicing on TDP43 target genes STMN2, KALRN, CAMK2B, ACTL6B, and UNC13A. The inventors show that MOE CA repeat ASO with cholesterol conjugated to the 5' end has a particularly strong ability to restore splicing of the affected target genes.

[0441] Human glutamate neurons (Fujifilms) were seeded at 60,000 live cells in 200 μl of culture medium in a 96-well plate coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) together with 10,000 live astrocytes (Fujifilms) (-1 day). To knockdown TDP-43, compound A (ID number: 1 SEQ ID NO: 13) was added to the culture medium at 5 μM on day 0 (except for 4 control wells per plate). During the entire experiment, half of the cell culture medium was changed three times a week (days 2, 5, 7, 9, 12, 14, 16 and 19). CA repeat ASO was added to the cell culture medium at variable doses on day 5. (25 uM, 7.91 uM, 2.5 uM, 0.791 uM, 0.25 uM, 0.0791 uM, 0.025 uM, 0.00791 uM).

[0442] In total, the cells were treated with 7 different ASOs containing CA repeats and 1 negative control ASO (Table 1). Only compound A (SEQ ID NO: 13) was placed in 12 wells in the plate to serve as a baseline reference.

[0443] Cells were harvested on day 21 using Magnapure lysis buffer (Roche), and RNA was isolated with the MagNA pure 96 system (Roche) according to the manufacturer's instructions including a DNase treatment step. Before cDNA synthesis, the purified RNA was denatured at 90 for 30 seconds. cDNA was prepared using the iScript Advanced cDNA Synthesis kit (Biorad) for RT-qPCR according to the manufacturer's instructions.

[0444] Measurement of the expression level of the target gene was performed by droplet digital PCR using the QX1 system (Bio-Rad) together with the QX1 software standard version. The PCR probe assay used to measure the expression of normally spliced target mRNA was designed to span two exons, between which a new "mutated" exon would occur.

[0445] The expression values from the experiment are shown in Table 1. Four genes were measured by quadruple ddPCR reactions to examine RNA. Mix 1 (TARDBP, STMN2, KALRN, HPRT1) Mix 2( (Custom-designed PCR probe assays synthesized by Integrated DNA technologies (IDT) or pre-designed ddPCR assays from BioRad were used): Probe Mix 1 TARDBP: Primer 1: CAGCTCATCCTCAGTCATGTC, Primer 2: GATGGTGTGACTGCAAACTTC, Probe: / 5Cy5 / CAGCGCCCCACAAACACTTTTCT / 3IAbRQSp / ) STMN2: Primer 1: CTGCTCAGCGTCTGC, Primer 2: GTTGCGAGGTTCCGG, Probe: / 5HEX / CTAAAACAG / ZEN / CAATGGCCTACAAGGAAAAAATGAAG / 3IABkFQ / KALRN: Primer 1: CGAGCCCTCGGAGTTTG, Primer 2: TCCTTCCAAGAAATGGTGGC, Probe: / 56-FAM / CGACTTCCA / ZEN / GAATATGATGCTGCTGCTGATG / 3IABkFQ /

[0446] The following CY5.5-labeled HPRT1 probe was purchased from BioRad: dHsaCPE13136107. Probe Mix 2: ACTL6B: Primer 1: TCTGAGCCAAACCTGCAC, Primer 2: ATCAGCTCTGTCAGCTTCTCC, Probe: / 5HEX / CGAGGCTCC / ZEN / GTGGAACACACG / 3IABkFQ / ) UNC13A: Primer 1: GATCAAAGGCGAGGAGAAGG, Primer 2: TGGCATCTGGGATCTTCAC, Probe: / 56-FAM / ACCTGTCTG / ZEN / CATGAGAACCTGTTCCACTTC / 3IABkFQ / CAMK2B: Primer 1: CTGACAGTGCCAATACCACC, Primer 2: GCTGCTCCGTGGTCTTAAT, Probe: / 5Cy5 / ATGAAGACGCTAAAGCCCGGAAGCAG / 3IAbRQSp /

[0447] The following CY5.5-labeled GAPDH probe was purchased from BioRad: dHsaCPE70459273.

Table 1

[0448] Table 2: Rescue of TDP43 target mRNA splicing after exposure to oligonucleotides The data shown in Table 2 were normalized to the expression of a housekeeping gene (either HPRT1 or GAPDH) present in a given PCR setting and finally to the mean expression value of control wells (PBS) that did not receive TDP43 knockdown or CA repeat ASO. The mean expression for all given conditions is shown in the last column. KD (「knockdown」 describes wells that received treatment only with a gapmer ASO that degrades TDP43 mRNA)

Table 2

[0449] Specific references Salter CG, Beijer D, Hardy H, et al. Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies. Neurol Genet. 2018;4(2):e222. Yukiko Nasu-Nishimura1, Tomoatsu Hayashi, Tomohiro Ohishi, Toshio Okabe, Susumu Ohwada, Yoshimi Hasegawa, Takao Senda, Chikashi Toyoshima, Tsutomu Nakamura, Tetsu Akiyama. Role of the Rho GTPase-activating Protein RICS in Neurite Outgrowth. Genes Cells. 2006 Jun;11(6):607-14. Arundhati Jana, Edward L. Hogan, and Kalipada Pahan. Ceramide and neurodegeneration: Susceptibility of neurons and oligodendrocytes to cell damage and death. J Neurol Sci. 2009 Mar 15;278(1-2):5-15. Conti et al. TDP-43 affects splicing profiles and isoform production of genes involved in the apoptotic and mitotic cellular pathways. Nucleic Acids Res. 2015 Oct 15;43(18):8990-9005. Humphrey et al. Quantitative analysis of cryptic splicing associated with TDP-43 depletion. BMC Medical Genomics 2017; volume10, Article number: 38(2017). Melamed et al. Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration. Nat Neurosci. 2019 Feb; 22(2): 180-190. Klim et al., ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nature Neuroscience 22, pages 167-179(2019)

Table 3

Claims

1. An antisense oligonucleotide having a length of 8 to 40 nucleotides, which contains a continuous nucleotide sequence of at least 8 nucleotides in length complementary to a sequence selected from the group consisting of (5'-3') (UG)n, (GU)n [where n is 4 to 20], UGUGUGUG, UGUGUGUGU, UGUGUGUGUG (SEQ ID NO: 95), UGUGUGUGUGU (SEQ ID NO: 84), UGUGUGUGUGUG (SEQ ID NO: 85), UGUGUGUGUGUGU (SEQ ID NO: 86), GUGUGUGU, GUGUGUGUG, GUGUGUGUGU (SEQ ID NO: 87), GUGUGUGUGUG (SEQ ID NO: 88), GUGUGUGUGUGU (SEQ ID NO: 89), GUGUGUGUGUGUG (SEQ ID NO: 90), and GUGAAUGA, and the continuous nucleotide sequence contains one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, and the antisense oligonucleotide is bound to at least one cholesterol moiety.

2. The antisense oligonucleotide according to claim 1, wherein the continuous nucleotide sequence contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

3. The antisense oligonucleotide according to claim 1, wherein the continuous nucleotide sequence contains at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

4. The antisense oligonucleotide according to any one of claims 1 to 3, wherein all of the nucleosides of the continuous nucleotide sequence are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.

5. The antisense oligonucleotide according to any one of claims 1 to 4, wherein the antisense oligonucleotide is bound to two or more or three or more cholesterol moieties.

6. The antisense oligonucleotide according to any one of claims 1 to 5, wherein the cholesterol moiety is covalently bound to the antisense oligonucleotide.

7. The antisense oligonucleotide according to any one of claims 1 to 6, wherein the cholesterol moiety is selected from the group consisting of 5'-cholesterol-TEG-CE phosphoramidite, 5'-cholesterol-CE phosphoramidite, or cholesteryl-TEG-CE phosphoramidite.

8. The antisense oligonucleotide according to any one of claims 1 to 7, wherein a linker is located between the antisense oligonucleotide and the cholesterol moiety.

9. The antisense oligonucleotide according to any one of claims 1 to 8, wherein the linker is a C3 alkyl group, a C6 alkyl group, a C12 alkyl group, a TEG group, or a HEG group.

10. The antisense oligonucleotide according to claim 8 or 9, wherein the linker is a physiologically labile linker.

11. The antisense oligonucleotide according to claim 10, wherein the physiologically labile linker is an S1 nuclease-sensitive linker.

12. The antisense oligonucleotide according to any one of claims 1 to 11, wherein the antisense oligonucleotide has a structure represented as follows: 【Chemical Formula 9】 or 【Chemical Formula 10】 or [Chemical Formula 11] or [Chemical Formula 12] An antisense oligonucleotide having the same.

13. The continuous nucleotide sequence is a sequence selected from CACACACA, CACACACACA, CACACACACAC, ACACACACA, or ACACACACACAC; or a sequence selected from the group consisting of SEQ ID NOs: 1 to 83, or a fragment of 8 or more consecutive nucleotides thereof. The antisense oligonucleotide according to any one of claims 1 to 12.

14. The continuous nucleotide sequence is at least 8 nucleotides in length. The antisense oligonucleotide according to any one of claims 1 to 13.

15. The continuous nucleotide sequence is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length. The antisense oligonucleotide according to any one of claims 1 to 14.

16. The antisense oligonucleotide consists of the continuous nucleotide sequence. The antisense oligonucleotide according to any one of claims 1 to 15.

17. The continuous nucleotide sequence is at least 75% complementary to the target sequence. The antisense oligonucleotide according to claims 1 to 16.

18. The continuous nucleotide sequence is at least 80%, at least 85%, at least 90% or at least 95% complementary to the target sequence. The antisense oligonucleotide according to any one of claims 1 to 17.

19. The antisense oligonucleotide according to any one of claims 1 to 18, wherein the continuous nucleotide sequence contains 1, 2, 3, 4, 5, 6, 7, 8 or more mismatches with respect to the target sequence.

20. The antisense oligonucleotide according to any one of claims 1 to 19, wherein the Gibbs free energy of the antisense oligonucleotide with respect to the complementary target RNA is less than about -10ΔG, for example less than about -15ΔG, for example less than about -17ΔG.

21. The antisense oligonucleotide according to any one of claims 1 to 20, which can restore the functional phenotypes of one or more TDP-43 target RNAs in cells in which TDP-43 is depleted or abnormal TDP-43 protein is expressed.

22. The antisense oligonucleotide according to any one of claims 1 to 21, which can regulate the splicing of two or more TDP-43 target pre-mRNAs.

23. The antisense oligonucleotide according to claim 22, wherein the two or more TDP-43 target pre-mRNAs are independently selected from the group consisting of STMN2 pre-mRNA, CAMK2B pre-mRNA, KALRN pre-mRNA, ACTL6B pre-mRNA, and UNC13A pre-mRNA.

24. The antisense oligonucleotide according to any one of claims 1 to 23, which can enhance the fidelity of pre-mRNA splicing of two or more mRNAs selected from the group consisting of STMN2 mRNA, CAMK2B mRNA, KALRN mRNA, ACTL6B mRNA, and UNC13A mRNA when administered to TDP-43 depleted cells.

25. When administered to TDP-43 depleted cells expressing STMN2 pre-mRNA, the antisense oligonucleotide according to any one of claims 1 to 24, which can reduce the ratio of STMN2 mature mRNA containing a potential exon (ce1) between exon 1 and exon 2 as compared to wild-type STMN2 mature mRNA having a continuous exon 1 / exon 2 junction. **Claim 26** When administered to TDP-43 depleted cells expressing CAMK2B pre-mRNA, the antisense oligonucleotide according to any one of claims 1 to 25, which can reduce the level of abnormal exon inclusion in the CAMK2B mRNA transcript. **Claim 27** When administered to TDP-43 depleted cells expressing KALRN pre-mRNA, the antisense oligonucleotide according to any one of claims 1 to 26, which can reduce the level of abnormal exon inclusion in the KALRN mRNA transcript. **Claim 28** When administered to TDP-43 depleted cells expressing UNC13A pre-mRNA, the antisense oligonucleotide according to any one of claims 1 to 27, which can reduce the level of abnormal exon inclusion in the UNC13A mRNA transcript. **Claim 29** When administered to TDP-43 depleted cells expressing ACTL6B pre-mRNA, the antisense oligonucleotide according to any one of claims 1 to 28, which can reduce the level of abnormal exon inclusion in the ACTL6B mRNA transcript. **Claim 30** The antisense oligonucleotide according to any one of claims 1 to 23, which can correct abnormal splicing of two or more of STMN2, CAMK2B, KALRN, ACTL6B and UNC13A pre-mRNAs in TDP-43 depleted cells. **Claim 31** The antisense oligonucleotide according to any one of claims 1 to 30, which does not contain a region of more than three or more than four consecutive DNA nucleosides.

32. The antisense oligonucleotide according to any one of claims 1 to 31, which is unable to mediate RNaseH cleavage.

33. The antisense oligonucleotide according to any one of claims 1 to 32, which is a morpholino antisense oligonucleotide.

34. The antisense oligonucleotide according to any one of claims 1 to 33, further comprising one or more modified nucleosides selected independently from the group consisting of, for example, 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; locked nucleic acid (LNA), and any combination thereof.

35. The antisense oligonucleotide according to claim 34, wherein the 2'-sugar modified nucleoside is an affinity-enhanced 2'-sugar modified nucleoside.

36. The antisense oligonucleotide according to claim 34 or 35, wherein one or more of the modified nucleosides are LNA nucleosides selected from the group consisting of locked nucleic acid nucleosides (LNA), for example, constrained ethyl nucleoside (cEt) and β-D-oxy-LNA.

37. The antisense oligonucleotide according to claim 36, wherein the continuous nucleotide sequence of the antisense oligonucleotide comprises LNA nucleosides and DNA nucleosides.

38. The antisense oligonucleotide according to any one of claims 32 to 37, wherein the antisense oligonucleotide or its continuous nucleotide sequence is a mixmer or a totalmer.

39. The antisense oligonucleotide according to any one of claims 1 to 38, wherein one or more of the internucleoside linkages located between the nucleosides on the continuous nucleotide sequence are modified.

40. The antisense oligonucleotide according to any one of claims 1 to 39, wherein at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the internucleoside linkages located between the nucleosides on the continuous nucleotide sequence are modified.

41. The antisense oligonucleotide according to any one of claims 39 or 40, wherein one or more or all of the modified internucleoside linkages contain phosphorothioate linkages.

42. The antisense oligonucleotide according to any one of claims 1 to 41, wherein all of the internucleoside linkages present in the antisense oligonucleotide are phosphorothioate internucleoside linkages.

43. The antisense oligonucleotide according to any one of claims 1 to 42, wherein the antisense oligonucleotide is covalently bound to at least one conjugate moiety.

44. The antisense oligonucleotide according to any one of claims 1 to 43, which is in the form of a pharmaceutically acceptable salt.

45. The antisense oligonucleotide according to claim 44, wherein the salt is a sodium salt or a potassium salt.

46. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 45 and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

47. A method for enhancing the functionality of TDP-43 in cells expressing abnormal or depleted levels of TDP-43, the method comprising administering to the cells an effective amount of the antisense oligonucleotide according to any one of claims 1 to 45 or the pharmaceutical composition according to claim 46.

48. A method for treating or preventing TDP-43 pathologies in a subject, the method comprising administering a therapeutically effective amount or a prophylactically effective amount of the antisense oligonucleotide according to any one of claims 1 to 45 or the pharmaceutical composition according to claim 46 to a subject suffering from or susceptible to the TDP-43 pathology.

49. The antisense oligonucleotide according to any one of claims 1 to 45 or the pharmaceutical composition according to claim 46 for use as a medicament.

50. The antisense oligonucleotide according to any one of claims 1 to 45 or the pharmaceutical composition according to claim 46 for use in the treatment of TDP-43 pathologies.

51. Use of the antisense oligonucleotide according to claims 1 to 45 or the pharmaceutical composition according to claim 46 for the preparation of a medicament for the treatment or prevention of TDP-43 pathologies.

52. The method according to claim 48, the antisense oligonucleotide or pharmaceutical composition for use according to claim 50, or the use according to claim 51, wherein the TDP-43 pathology is a neurological disorder selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy and chronic traumatic encephalopathy.

53. The method, antisense oligonucleotide or pharmaceutical composition for use, or use according to claim 52, wherein the TDP-43 pathology is a neuropathy selected from the group consisting of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD).