NCgl2747 gene variant and its use in the preparation of L-lysine

By introducing the NCgl2747 A955T gene variant into Corynebacterium glutamicum, the production of L-lysine is enhanced, addressing limitations in current fermentation methods and improving microbial growth and productivity.

JP2025518814APending Publication Date: 2025-06-19NINGXIA EPPEN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024571087
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-01
Filing Date
2023-03-30
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

Current methods for producing L-lysine through fermentation are limited by the performance characteristics of microorganisms used, which can be improved through genetic modifications to enhance production efficiency.

Method used

The introduction of the NCgl2747 A955T gene variant into Corynebacterium glutamicum strains, which encodes a protein that facilitates increased L-lysine production, is achieved through recombinant DNA technology, including the use of expression cassettes and recombinant vectors.

Benefits of technology

The implementation of the NCgl2747 A955T gene variant leads to enhanced L-lysine yield and growth rate of the microorganism, indicating improved fermentation efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025518814000001
    Figure 2025518814000001
  • Figure 2025518814000002
    Figure 2025518814000002
  • Figure 2025518814000003
    Figure 2025518814000003
Patent Text Reader

Abstract

Provided are an NCgl2747 gene variant and its use in the preparation of L-lysine. The NCgl2747 gene variant is a DNA molecule shown in SEQ ID NO: 3 and encodes an NCgl2747 variant protein shown in SEQ ID NO: 4. Mutating the NCgl2747 gene into the NCgl2747 gene variant shown in SEQ ID NO: 3 or overexpressing the NCgl2747 gene variant contributes to an increase in L-lysine yield and growth rate. On the other hand, weakening or knocking out the gene is disadvantageous for the accumulation of L-lysine and at the same time reduces the growth rate of the strain. The NCgl2747 gene variant and the NCgl2747 variant protein encoded thereby can be used in the preparation of L-lysine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an NCgl2747 gene variant in the field of biotechnology and its use in the preparation of L-lysine.

Background Art

[0002] L-lysine has physiological effects such as promoting development, enhancing immunity, and improving the function of the central nervous tissue, and is one of the eight essential amino acids for growth that humans and animals cannot synthesize by themselves. Currently, L-lysine is the second largest amino acid species in the world, and the main production method is fermentation. Among them, Corynebacterium glutamicum and the like are important production strains of lysine. Approximately 90% of the industrial production of L-lysine is used as a nutritional enhancer in the feed industry, 10% is used as a flavor or sweetener in the food industry, and in the pharmaceutical industry, it is used as a pharmaceutical intermediate.

[0003] Improving the production of L-lysine by fermentation methods may be related to fermentation techniques such as stirring and oxygen supply, the composition of the nutrient medium such as the concentration of sugar during the fermentation process, or the processing of the fermentation broth into an appropriate product form by drying, pelletizing, ion exchange chromatography, etc., or the inherent performance characteristics of the related microorganisms themselves.

[0004] Methods used to improve the performance characteristics of these microorganisms include mutagenesis, selection of mutants, and screening. The strains obtained in this way are resistant to antimetabolites or auxotrophic for regulatory important metabolites and produce L-lysine.

Summary of the Invention

[0005] An object of the present invention is to provide a protein capable of producing L-lysine and its related biological materials. To solve the above technical problems, the present invention first provides NCgl2747 A955TProvide a protein named NCgl2747 A955T is one of the following A1) or A). A1) A protein having the amino acid sequence of SEQ ID NO: 4 A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of A1). In order to facilitate the purification of the protein in A1), the tags shown in the following table can be bound to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO: 4.

[0006] TIFF2025518814000001.tif45170

[0007] The present invention also provides a biological material related to NCgl2747 A955T The biological material is one of the following B1)-B4). B1) A nucleic acid molecule encoding NCgl2747 A955T B2) An expression cassette containing the nucleic acid molecule described in B1) B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2) B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

[0008] In the above biological material, the nucleic acid molecule described in B1) may be any of the following b11), b12) or b13). b11) The DNA molecule shown in SEQ ID NO: 3 of the sequence listing b12) A DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) and encoding NCgl2747 A955T b13) A genomic DNA molecule that hybridizes to the nucleotide sequence defined in b11) or b12) under stringent conditions and encodes NCgl2747 A955T

[0009] ​​​ Here, the nucleic acid molecule may be DNA such as cDNA, genomic DNA, or recombinant DNA, or the nucleic acid molecule may be RNA such as mRNA or hnRNA.

[0010] A person skilled in the art can easily mutate the nucleotide sequence encoding the NCgl2747 protein of the present invention using known methods such as directed evolution methods and site-directed mutagenesis methods. The NCgl2747 A955T protein of the present invention. A955T Artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the NCgl2747 protein of the present invention are those that encode the NCgl2747 A955T protein and, as long as they have the function of the NCgl2747 A955T protein, all are derived from the nucleotide sequence of the present invention and are equivalent to the nucleotide sequence of the present invention.

[0011] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 4 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), and this can be used to evaluate the identity between related sequences.

[0012] In the above biological material, the stringent conditions are as follows: hybridization is carried out in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4 and 1 mM EDTA at 50 °C, and then rinsed with 50 °C, 2×SSC, 0.1% SDS; or hybridization is carried out in a mixed solution of 7% SDS, 0.5 M NaPO4 and 1 mM EDTA at 50 °C, and then rinsed with 50 °C, 1×SSC, 0.1% SDS; or hybridization is carried out in a mixed solution of 7% SDS, 0.5 M NaPO4 and 1 mM EDTA at 50 °C, and then rinsed with 50 °C, 0.5×SSC, 0.1% SDS; or hybridization is carried out in a mixed solution of 7% SDS, 0.5 M NaPO4 and 1 mM EDTA at 50 °C, and then rinsed with 50 °C, 0.1×SSC, 0.1% SDS; or hybridization is carried out in a mixed solution of 7% SDS, 0.5 M NaPO4 and 1 mM EDTA at 50 °C, and then rinsed with 65 °C, 0.1×SSC, 0.1% SDS; or hybridization is carried out in a solution of 6×SSC, 0.5% SDS at 65 °C, and then the membrane is washed once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS; or hybridization and membrane washing are carried out twice for 5 minutes each in a solution of 2×SSC, 0.1% SDS at 68 °C, and then hybridization and membrane washing are carried out twice for 15 minutes each again in a solution of 0.5×SSC, 0.1% SDS at 68 °C; or hybridization and membrane washing are carried out in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65 °C.

[0013] The above identity of 75% or more may be 80%, 85%, 90% or more identity.

[0014] In the above biological material, NCgl2747 described in B2) A955T An expression cassette containing a nucleic acid molecule encoding a protein (NCgl2747 A955T gene expression cassette) refers to DNA capable of expressing NCgl2747 protein in a host cell, and the DNA is NCgl2747 A955T A955T ​Not only a promoter that initiates gene transcription, but also NCgl2747 A955T It may also contain a terminator that terminates gene transcription. Furthermore, the above-described expression cassette may contain an enhancer sequence.

[0015] In the above biological material, the expression cassette described in B2) may specifically be the DNA molecule shown in SEQ ID NO:.8.

[0016] NCgl2747 A955T A recombinant vector containing a gene expression cassette can be constructed using an existing expression vector.

[0017] In the above biological material, the vector may be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid may be the pK18mobsacB vector or the pXMJ19 vector.

[0018] The recombinant vector described in B3) may be the recombinant vector pK18-NCgl2747 A955T , pK18-NCgl2747 A955T OE, or pXMJ19-NCgl2747 A955T It may be.

[0019] The recombinant vector pK18-NCgl2747 A955T is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI I recognition site and the BamH I recognition site of the pK18mobsacB vector with the DNA fragment shown in SEQ ID NO: 5 of the sequence listing without changing other sequences of the pK18mobsacB vector. The recombinant vector pK18-NCgl2747 A955T contains the mutation site (A-T) of the mutant gene NCgl2747 shown in SEQ ID NO: 3. A955T

[0020] pK18-NCgl2747 A955TOE is a recombinant vector obtained by inserting the expression cassette described in B2) between the recognition sequences of Xbal I and BamH I of pK18mobsacB. pXMJ19-NCgl2747 A955T is a recombinant vector obtained by inserting the expression cassette described in B2) into the pXMJ19 vector.

[0021] In the above-mentioned biological materials, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Corynebacterium glutamicum, Escherichia coli, Pantoea ananatis, Bacillus brevis, or Brevis lactobacillus.

[0022] In one embodiment of the present invention, Corynebacterium glutamicum is Corynebacterium glutamicum YP097158 or Corynebacterium glutamicum ATCC13032.

[0023] B4) The recombinant microorganism is a recombinant microorganism obtained by substituting the NCgl2747 gene in the microorganism containing the NCgl2747 gene shown in SEQ ID NO: 1 with the nucleic acid molecule described in B1), or a recombinant microorganism obtained by introducing and expressing the nucleic acid molecule described in B1) into the microorganism.

[0024] In an embodiment of the present invention, the recombinant microorganism is recombinant bacterium YPL-NCgl2747-1, recombinant bacterium L2747-1, recombinant bacterium YPL-NCgl2747-3, recombinant bacterium L2747-3, recombinant bacterium YPL-NCgl2747-5 or recombinant bacterium L2747-5.

[0025] The recombinant bacterium YPL-NCgl2747-1 is a strain obtained by replacing the NCgl2747 gene of Corynebacterium glutamicum YP097158 with the NCgl2747 A955T gene without changing other sequences.

[0026] The recombinant bacterium L2747-1 is a strain obtained by replacing the NCgl2747 gene of ATCC13032 with the NCgl2747 A955T gene without changing other sequences.

[0027] The recombinant bacterium YPL-NCgl2747-3 is a recombinant bacterium obtained by replacing the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the NCgl2747 A955T gene and its promoter (i.e., positions 1-331 of SEQ ID NO: 8 in the Sequence Listing) without changing other nucleotides in the genome of Corynebacterium glutamicum YP097158.

[0028] The recombinant bacterium L2747-3 is a recombinant bacterium obtained by replacing the spacer region between the upstream homology arm NCgl1741 and the downstream homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the NCgl2747 A955T gene and its promoter (i.e., positions 1-331 of SEQ ID NO: 8 in the Sequence Listing) without changing other nucleotides in the genome of Corynebacterium glutamicum ATCC13032.

[0029] The recombinant bacterium YPL-NCgl2747-5 is a recombinant bacterium obtained by introducing pXMJ19-NCgl2747 A955T into Corynebacterium glutamicum YP097158.

[0030] The recombinant bacterium L2747-5 is pXMJ19-NCgl2747A955T It is a recombinant bacterium obtained by introducing A955T into Corynebacterium glutamicum ATCC13032.

[0031] The present invention also provides a method for preparing L-lysine, which method comprises the steps of obtaining a recombinant living cell by expressing NCgl2747 in a recipient living cell, or increasing the content or activity of NCgl2747 in the recipient living cell, or increasing the content or activity of the protein shown in SEQ ID NO: 2 in the recipient living cell, and culturing the recombinant living cell to obtain L-lysine. A955T or increasing the content or activity of NCgl2747 in the recipient living cell, A955T or increasing the content or activity of the protein shown in SEQ ID NO: 2 in the recipient living cell, and culturing the recombinant living cell to obtain L-lysine.

[0032] In the above method, the living cell may be a yeast, bacterium, alga, fungus, plant cell or animal cell capable of synthesizing L-lysine. The bacterium is Corynebacterium glutamicum such as Corynebacterium glutamicum YP097158.

[0033] Examples of the bacterium of the present invention include, but are not limited to, Corynebacterium glutamicum, which contains the NCgl2747 gene shown in SEQ ID NO: 1 in the sequence listing and is capable of synthesizing L-lysine. Any bacterium that can produce L-lysine using the NCgl2747 mutant protein shown in SEQ ID NO: 4 of the present invention and its related biological materials can be used. For example, the bacterium may be Corynebacterium glutamicum, Escherichia coli, Pantoea ananatis, Bacillus brevis, or Brevis lactobacillus.

[0034] The above method involves NCgl2747A955T It is achieved by introducing and expressing a gene encoding it into recipient living cells, or by introducing and expressing a gene encoding the protein shown in SEQ ID NO: 2 into recipient living cells, or the recipient living cells contain the DNA molecule shown in SEQ ID NO: 1, and the method is achieved by replacing the DNA molecule shown in SEQ ID NO: 1 with the DNA molecule shown in SEQ ID NO: 3 in the recipient living cells.

[0035] In the above method, the culture of the recombinant living cells is carried out using a medium capable of growing the recombinant living cells, and / or the culture of the recombinant living cells is carried out using conditions capable of growing the recombinant biological cells. The recombinant living cells may be recombinant microorganisms as described above.

[0036] In addition, the present invention provides a product for preparing L-lysine, NCgl2747 A955T or the biological material is included in the product or is an active ingredient of the product.

[0037] NCgl2747 of the present invention A955T or the biological material can be used to produce various products including but not limited to lysine in the examples, and the amino acids produced may be glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline. When producing various target products, by placing NCgl2747 of the present invention A955T in the synthetic pathway of the target product, the production of the target product can be achieved.

[0038] Explanation regarding the deposit of biological materials Classification name: Corynebacterium glutamicum Strain number: YP097158 Name of the depository institution: China General Microbiological Culture Collection Center Abbreviation of the depository institution: CGMCC Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101 Date of deposit: August 16, 2016 Registration number of the deposit center: CGMCC No. 12856

Mode for Carrying Out the Invention

[0039] Hereinafter, the present invention will be described in more detail in conjunction with specific examples. However, these examples are for explaining the present invention and do not limit the scope of the present invention. The examples provided below are provided as a guide for those skilled in the art to make further improvements and do not limit the present invention in any way.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples can all be obtained from commercial sources unless otherwise specified. The quantitative experiments in the following examples were set to repeat the experiments three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence list is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0041] Example 1 Construction of a recombinant vector containing the coding region of the NCgl2747 gene with point mutations Based on the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were designed and synthesized to amplify the coding region of the NCgl2747 gene. Point mutations were introduced into the NCgl2747 gene coding regions of Corynebacterium glutamicum YP097158 (deposit number: CGMCC No. 12856, deposit date: August 16, 2016, depository institution: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, telephone number: 010 - 64807355) and the wild - type Corynebacterium glutamicum strain ATCC13032 by allelic replacement. This point mutation mutated adenine (A) at position 955 in the nucleotide sequence (SEQ ID NO: 1) of the NCgl2747 gene to thymine (T) to obtain a DNA molecule shown in SEQ ID NO: 3 (the mutated NCgl2747 gene is denoted as the NCgl2747 A955T gene).

[0042] Here, the NCgl2747 gene shown in SEQ ID NO: 1 encodes the NCgl2747 protein whose amino acid sequence is shown in SEQ ID NO: 2.

[0043] The NCgl2747 A955T gene shown in SEQ ID NO: 3 encodes a mutant protein (NCgl2747 A955T protein) whose amino acid sequence is shown in SEQ ID NO: 4. Phenylalanine (F) at position 319 in the amino acid sequence (SEQ ID NO: 4) of the NCgl2747 I319F protein is mutated from isoleucine (I) at position 319 of the NCgl2747 protein.

[0044] The recombinant vector was constructed using the NEBuilder assembly technology, and the primers were designed as follows (synthesized by Shanghai Invitrogen Company), and the nucleotides in bold are the mutation positions. P1: 5’ - CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTCACCCGCTACGAAGTTGT-3’ (The underlined nucleotide sequence is the sequence on pK18) (SEQ ID NO: 15), P2: 5’-CTACCTGAAAAGCGTGCTGAGCTGGGACATTTG-3’ (SEQ ID NO: 16), P3: 5’-CAAATGTCCCAGCTCAGCACGCTTTTCAGGTAGCTCTCGGTG-3’ (SEQ ID NO: 17), P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TTGTTCTACGAATGCCCAC-3' (The underlined nucleotide sequence is the sequence on pK18) (SEQ ID NO: 18).

[0045] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P1 and P2, and P3 and P4 respectively, to obtain two DNA fragments (NCgl2747 Up and NCgl2747 Down) of the NCgl2747 gene coding region with mutated nucleotides of 624 bp and 705 bp.

[0046] Using NEBuilder enzyme (manufactured by NEB), the above two DNA fragments (NCgl2747 Up and NCgl2747 Down) separated and purified by agarose gel electrophoresis were ligated with the pK18mobsacB plasmid (manufactured by Addgene) purified by enzyme digestion (Xbal I and BamH I) at 50°C for 30 minutes. After transforming the ligation product into Escherichia coli DH5α and growing the monoclonal clones, they were identified by PCR using primers M13F / M13R (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID NO: 19), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID NO: 20)). Then, the plasmid was extracted to obtain a positive recombinant vector with the correct sequence designated as pK18-NCgl2747 A955T containing the kanamycin resistance marker.

[0047] This recombinant vector pK18-NCgl2747 A955T of NCgl2747 A955TThe Up-Down DNA with a size of 1296 bp (SEQ ID NO: 5) contains a mutation site (A-T) that mutates the adenine (A) at position 955 in the coding region of the NCgl2747 gene of Corynebacterium glutamicum strain YP097158 to thymine (T), and ultimately changes isoleucine (I) at position 319 of the encoded protein to phenylalanine (F).

[0048] Recombinant vector pK18-NCgl2747 A955T is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaII recognition site and the BamHI recognition site of the pK18mobsacB vector with the DNA fragment shown in SEQ ID NO: 5 of the Sequence Listing without changing the other sequences of pK18mobsacB. Recombinant vector pK18-NCgl2747 A955T contains the mutant gene NCgl2747 shown in SEQ ID NO: 3 A955T and includes the mutation site (A-T).

[0049] Example 2 Construction of a genetically recombinant strain containing the gene NCgl2747 A955T using the allelic replacement plasmid (pK18-NCgl2747) of Example 1 A955T ​) was transformed into L-lysine-producing Corynebacterium glutamicum YP097158 (the construction method is described in International Publication No. 2014121669A1, and it was confirmed by sequencing that the wild-type NCgl2747 gene coding region is retained on the chromosome of this strain) and the wild-type Corynebacterium glutamicum strain ATCC13032 by electroporation and cultured on a solid culture plate containing kanamycin (see Table 1 for medium components and culture conditions). The single colonies formed by culturing were identified with the primer P1 of Example 1 and the universal primer M13R respectively, and the strains that could amplify a 1384 bp band were regarded as positive strains. The positive strains were cultured in a medium containing 15% sucrose (the medium with the sucrose concentration in the medium of Table 1 increased to 15 g / L), and the single colonies obtained by culturing were cultured in a kanamycin medium and a kanamycin-free medium respectively. The strains that grew in the kanamycin-free medium but did not grow in the kanamycin medium were further amplified by PCR using the following primers (synthesized by Shanghai Invitrogen Company). P5: 5’-TCTATCCAAGGCATACCGC-3’ (SEQ ID NO: 21); P6: 5’-TCCCATTGGTTTCACACAG-3’ (SEQ ID NO: 22).

[0050] The obtained DNA fragment (280 bp) was treated (denatured at high temperature at 95°C for 10 minutes, followed by rapid ice bath for 5 minutes) and then subjected to SSCP (Single-Strand Conformation Polymorphis) electrophoresis (the amplified fragment of plasmid pK18-NCgl2747A1089C was used as the positive control, the amplified fragment of Corynebacterium glutamicum ATCC13032 was used as the negative control, and water was used as the blank control). Table 2 shows the preparation of PAGE for SSCP electrophoresis and the electrophoresis conditions. Since the fragment structures were different and the electrophoresis positions were different, the strains whose electrophoresis positions of the fragments did not match the positions of the negative control segments but matched the positions of the positive control segments were the strains that succeeded in isotope substitution. The positive strain NCgl2747 A955TThe gene fragment was amplified again by primer P5 / P6 PCR, ligated into the pMD19-T vector for sequencing. By comparing the sequences, the strain with the base sequence mutation (A-T) was identified as a positive strain that had successfully undergone allelic substitution. The positive strains obtained from Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum strain ATCC13032 were named YPL-NCgl2747-1 and L2747-1, respectively.

[0051] Both recombinant bacteria YPL-NCgl2747-1 and L2747-1 contain the mutant gene NCgl2747 shown in SEQ ID NO: 3 A955T and can express the protein shown in SEQ ID NO: 4. The only difference between recombinant bacterium YPL-NCgl2747-1 and Corynebacterium glutamicum YP097158 is that YPL-NCgl2747-1 is a strain obtained by substituting the NCgl2747 gene of Corynebacterium glutamicum YP097158 with the NCgl2747 A955T gene without changing other sequences. The only difference between recombinant bacterium L2747-1 and ATCC13032 is that L2747-1 is a strain obtained by substituting the NCgl2747 gene of ATCC13032 with the NCgl2747 A955T gene without changing other sequences.

[0052] TIFF2025518814000002.tif65170

[0053] TIFF2025518814000003.tif50170

[0054] Example 3 Construction of an engineered strain overexpressing the NCgl2747 gene or the NCgl2747 A955T gene on the genome Based on the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, upstream and downstream homologous arm fragments and the NCgl2747 or NCgl2747 A955T Three pairs of primers were designed and synthesized to amplify the gene coding region and promoter region of NCgl2747 or NCgl2747 A955T genes were inserted into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 by homologous recombination. The primers were designed as follows (synthesized by Shanghai Invitrogen Company). P7: 5’- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTGGACTGAGG-3’ (The underlined nucleotide sequence is the sequence on pK18) (SEQ ID NO: 23), P8: 5’-GATTGAGTAGCAAGTGCTTTGGTGCACCGAGAACAGATG-3’ (SEQ ID NO: 24), P9: 5’-CATCTGTTCTCGGTGCACCAAAGCACTTGCTACTCAATC-3’ (SEQ ID NO: 25), P10: 5’-GATTTAATTGCGCCATCTGCTACTGCTTGTAAGTGGACAGG-3’ (SEQ ID NO: 26), P11: 5’-CCTGTCCACTTACAAGCAGTAGCAGATGGCGCAATTAATC-3’ (SEQ ID NO: 27), P12: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC-3' (The underlined nucleotide sequence is the sequence on pK18) (SEQ ID NO: 28).

[0055] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P7 / P8, P9 / P10, and P11 / P12 respectively, to obtain an upstream homologous arm fragment of 763 bp (corresponding to the partial coding region of Corynebacterium glutamicum ATCC13032 NCgl1740, the NCgl1741 gene, and its promoter region, and the sequence is shown in SEQ ID NO: 6), the NCgl2747 gene and its promoter fragment of 1645 bp (the sequence is shown in SEQ ID NO: 7), and a downstream homologous arm fragment of 596 bp (corresponding to the partial coding region of the Corynebacterium glutamicum ATCC13032 NCgl1742 gene, and the sequence is shown in SEQ ID NO: 9). After the PCR reaction, the three fragments amplified from each template were separately recovered by electrophoresis using a column DNA gel recovery kit. Using NEBuilder enzyme (manufactured by NEB), the three recovered fragments were ligated with the pK18mobsacB plasmid (manufactured by Addgene) purified by enzymatic digestion (Xbal I and BamH I) at 50 °C for 30 minutes. Monoclonal colonies grown after transformation of the ligation product were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGACGGCCAGT-3’ (SEQ ID NO: 19), M13R: 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 20)) to obtain a positive integration plasmid (recombinant vector). The obtained recombinant vector is pK18-NCgl2747OE. The positive integration plasmid contains a kanamycin resistance marker, and recombinants for integrating the plasmid into the genome can be obtained by kanamycin screening. In SEQ ID NO: 7, positions 1-331 are the promoter of the NCgl1741 gene, and positions 332-1645 are the NCgl1741 gene.

[0056] Using Corynebacterium glutamicum YPL-NCgl2747-1 as a template, PCR amplification was performed using primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain an upstream homologous arm fragment of 763 bp (corresponding to the partial coding region of Corynebacterium glutamicum ATCC13032 NCgl1740, the NCgl1741 gene, and its promoter region, and the sequence is shown in SEQ ID NO: 6), NCgl2747 A955T gene and its promoter fragment of 1645 bp (the sequence is shown in SEQ ID NO: 8), and a downstream homologous arm fragment of 596 bp (corresponding to the partial coding region of the Corynebacterium glutamicum ATCC13032 NCgl1742 gene, and the sequence is shown in SEQ ID NO: 9). After the PCR reaction, the three fragments amplified from each template were separately recovered by electrophoresis using a column DNA gel recovery kit. Using NEBuilder enzyme (manufactured by NEB), the three recovered fragments were ligated with the pK18mobsacB plasmid (manufactured by Addgene) purified by enzymatic digestion (Xbal I and BamHI) at 50°C for 30 minutes. Monoclonal colonies grown after transformation of the ligation product were identified by PCR using M13 primers (M13F: 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 19), M13R: 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 20)) to obtain a positive integration plasmid (recombinant vector). The obtained recombinant vector is pK18-NCgl2747 A955T OE. The positive integration plasmid contains a kanamycin resistance marker, and recombinants for integrating the plasmid into the genome can be obtained by kanamycin screening. In SEQ ID NO: 8, positions 1-331 are the promoter of the NCgl2747 A955T gene, and positions 332-1645 are the NCgl2747 A955T gene.

[0057] The correctly sequenced integration plasmids (pK18-NCgl2747OE, pK18-NCgl2747 A955TOE) was electrotransformed into Corynebacterium glutamicum strain YP097158 and wild-type Corynebacterium glutamicum ATCC13032 respectively and cultured in a medium. Refer to Table 1 for the medium components and culture conditions. The single colonies generated by culturing were identified by PCR using P13 / P14 primers. Those that amplified a fragment with a size of 1959 bp (the sequence is shown in SEQ ID NO: 10) by PCR were regarded as positive strains, and those that did not amplify the fragment were regarded as the original bacteria. The positive strains were streak-cultured on a solid medium containing 15% sucrose (the medium with the sucrose concentration in the medium of Table 1 increased to 15 g / L). The single colonies generated by culturing were further identified by PCR using P15 / P16 primers. Bacteria with a size of 1600 bp (the sequence is shown in SEQ ID NO: 11) were amplified. The bacteria were positive strains in which the NCgl2747 or NCgl2747A1089C gene and its promoter were integrated into the spacer region of the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 of the genome of Corynebacterium glutamicum. The strains obtained using Corynebacterium glutamicum YP097158 as the starting strain were named YPL-NCgl2747-2 (without mutation point) and YPL-NCgl2747-3 (with mutation point) respectively, and the strains obtained using Corynebacterium glutamicum ATCC13032 as the starting strain were named L2747-2 (without mutation point) and L2747-3 (with mutation point) respectively.

[0058] The recombinant bacterium YPL-NCgl2747-2 contains a double copy of the NCgl2747 gene shown in SEQ ID NO: 1. Specifically, the recombinant bacterium YPL-NCgl2747-2 is a recombinant bacterium obtained by replacing the spacer region between the upstream homology arm NCgl1741 and the downstream homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the NCgl2747 gene and its promoter (i.e., positions 1-331 of SEQ ID NO: 7 in the Sequence Listing) without changing other nucleotides in the genome of Corynebacterium glutamicum YP097158. The recombinant bacterium containing a double copy of the NCgl2747 gene can significantly and stably increase the expression of the NCgl2747 gene.

[0059] The recombinant bacterium L2747-2 contains the NCgl2747 gene shown in SEQ ID NO: 1 with double copies. Specifically, the recombinant bacterium L2747-2 is a recombinant bacterium obtained by replacing the spacer region between the upstream homology arm NCgl1741 and the downstream homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the NCgl2747 gene and its promoter (i.e., positions 1-331 of SEQ ID NO: 7 in the Sequence Listing) without changing other nucleotides in the genome of Corynebacterium glutamicum ATCC13032. The recombinant bacterium containing a double copy of the NCgl2747 gene can significantly and stably increase the expression of the NCgl2747 gene.

[0060] The recombinant bacterium YPL-NCgl2747-3 contains the mutant NCgl2747 A955T gene shown in SEQ ID NO: 3 with double copies. Specifically, the recombinant bacterium YPL-NCgl2747-3 is a bacterium that, without changing other nucleotides in the genome of Corynebacterium glutamicum YP097158, replaces the spacer region between the upstream homology arm NCgl1741 and the downstream homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with NCgl2747 A955TIt is a recombinant bacterium obtained by substituting a gene and its promoter (i.e., positions 1-331 of SEQ ID NO: 8 in the Sequence Listing).

[0061] The recombinant bacterium L2747-3 contains the mutant NCgl2747 shown in SEQ ID NO: 3. A955T Specifically, in the recombinant bacterium L2747-3, without changing other nucleotides in the genome of Corynebacterium glutamicum ATCC13032, the spacer region between the upstream homology arm NCgl1741 and the downstream homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 was replaced with the NCgl2747 A955T gene and its promoter (i.e., positions 1-331 of SEQ ID NO: 8 in the Sequence Listing) to obtain the recombinant bacterium.

[0062] The primers for PCR identification are shown below: P13: 5’-TCCAAGGAAGATACACGCC-3’ (corresponding to the outside of the upstream homology arm NCgl1740) (SEQ ID NO: 29), P14: 5'-GGTCGTAGATTTCATCGGC-3’ (corresponding to the inside of the NCgl2747 gene) (SEQ ID NO: 30), P15: 5’-CAACGGTGTTCCAGAACTAATC-3’ (corresponding to the inside of the NCgl2747 gene) (SEQ ID NO: 31), P16: 5'-TGGTCGTTGGAATCTTGC-3' (corresponding to the outside of the downstream homology arm NCgl1740) (SEQ ID NO: 32).

[0063] Example 4 Construction of an engineered strain overexpressing the NCgl2747 gene or the NCgl2747 A955T gene on a plasmid Based on the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, NCgl2747 or NCgl2747 A1089CA pair of primers for amplifying the gene coding region and the promoter region was designed and synthesized. The primers were designed as follows (synthesized by Shanghai Invitrogen Company). P17: 5’- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC CAAAGCACTTGCTACTCAATC-3’ (The underlined nucleotide sequence is the sequence on pXMJ19) (SEQ ID NO: 33), P18: 5’- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC CTACTGCTTGTAAGTGGACAGG-3’ (The underlined nucleotide sequence is the sequence on pXMJ19) (SEQ ID NO: 34).

[0064] Construction method: Using Corynebacterium glutamicum ATCC13032 and YPL-NCgl2747-1 as templates respectively, PCR amplification was performed using primers P17 / P18 to obtain the NCgl2747 gene and its promoter fragment (the sequence is shown in SEQ ID NO: 12) and the NCgl2747 A955T gene and its 1715bp promoter fragment (the sequence is shown in SEQ ID NO: 13). The amplification products were electrophoresed, purified and recovered using a column DNA gel recovery kit. Using NEBuilder enzyme (manufactured by NEB), the recovered DNA fragment was ligated with the shuttle plasmid pXMJ19 recovered by EcoR I enzyme digestion at 50°C for 30 minutes. After transformation of the ligation products, the grown monoclonal clones were identified by PCR using M13 primers to obtain the positive overexpression plasmids pXMJ19-NCgl2747 (containing the NCgl2747 gene) and pXMJ19-NCgl2747 A955T (containing the NCgl2747 A955T gene). The positive plasmid was sent for sequencing. Since this plasmid contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the plasmid has been transformed into the strain. In SEQ ID NO: 12, positions 37-367 are the promoter of the NCgl2747 gene, and positions 368-1681 are the NCgl2747 gene. In SEQ ID NO: 13, positions 37-367 are NCgl2747A955T It is the promoter of a gene, and positions 368 - 1681 are NCgl2747 A955T gene.

[0065] The correctly sequenced pXMJ19 - NCgl2747 and pXMJ19 - NCgl2747 A955T plasmids were electrotransformed into Corynebacterium glutamicum YP097158 and wild - type Corynebacterium glutamicum ATCC13032 strain respectively and cultured in a medium. Refer to Table 1 for the medium components and culture conditions. The single colonies generated by the culture were identified by PCR using primers M13R(-48) / P18 (M13R(-48): AGCGGATAACAATTTCACACAGGA). The strains obtained using Corynebacterium glutamicum YP097158 as the starting strain were named YPL - NCgl2747 - 4 (containing plasmid pXMJ19 - NCgl2747) and YPL - NCgl2747 - 5 (containing plasmid pXMJ19 - NCgl2747 A955T ). The strains obtained using Corynebacterium glutamicum ATCC13032 as the starting strain were named L2747 - 4 (containing plasmid pXMJ19 - NCgl2747) and L2747 - 5 (containing plasmid pXMJ19 - NCgl2747 A955T ). The recombinant bacteria YPL - NCgl2747 - 4 and L2747 - 4 contain plasmids carrying the NCgl2747 gene shown in SEQ ID NO: 1. The recombinant bacteria YPL - NCgl2747 - 5 and L2747 - 5 contain plasmids carrying the mutant NCgl2747 A955T gene shown in SEQ ID NO: 3.

[0066] Example 5 Construction of an engineered strain with a deletion of the NCgl2747 gene in the genome Based on the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the NCgl2747 gene coding region as upstream and downstream homologous arm fragments. The primers were designed as follows (synthesized by Shanghai Invitrogen Company). P19: 5’- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GCAGCAAGTAGCCTGGGTAT-3’ (The underlined nucleotide sequence is the sequence on pK18) (SEQ ID NO: 35), P20: 5’-AGAAGATGAAGGACGTGGGTAACTTCCTGTCCACT-3’ (SEQ ID NO: 36), P21: 5’-AGTGGACAGGAAGTTACCCAGTCCTTCATCTTCTCCGAC-3’ (SEQ ID NO: 37), P22: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ACGCAACACTTGATGGAGT-3' (The underlined nucleotide sequence is the sequence on pK18) (SEQ ID NO: 38).

[0067] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P19 / P20 and P21 / P22 respectively to obtain the upstream homologous arm fragment of 647 bp and the downstream homologous arm fragment of 753 bp for knocking out NCgl2747. The amplification products were electrophoresed, purified and recovered using a column DNA gel recovery kit, and the recovered DNA fragments were ligated with the pK18mobsacB plasmid (manufactured by Addgene) purified by XbaI I / BamH I at 50°C for 30 minutes. The monoclonal colonies grown after transformation of the ligation products were identified by PCR using M13 primers to obtain the positive knockout vector pK18-ΔNCgl2747. The plasmid contains a complete knockout NCgl2747 homologous arm fragment of 1400 bp (the sequence is shown in SEQ ID NO: 14) and kanamycin resistance as a screening marker, and the plasmid was sent for sequencing.

[0068] The correctly arrayed knockout plasmid pK18-ΔNCgl2747 was transformed into Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum ATCC13032 strain and cultured in a medium. Refer to Table 1 for the medium components and culture conditions. The single colonies generated by culturing were identified by PCR using the P19 / P22 primers. Strains that simultaneously amplified 1400bp and 2549bp bands were regarded as positive strains, and strains that amplified only the 2549bp band were regarded as the original strains. After screening the positive strains on a 15% sucrose solid medium, each was cultured in a kanamycin medium and a kanamycin-free medium. Strains that grew in the kanamycin-free medium but not in the kanamycin medium were further identified by PCR using the primers P19 / P22. Strains that amplified the 1400bp band were regarded as positive strains with the NCgl2747 gene coding region knocked out. The positive strain NCgl2747 fragment was further amplified by PCR using the P19 / P22 primers, ligated to the pMD19-T vector to determine the sequence, and strains with the correctly determined sequence were named YPL-NCgl2747-6 (with the NCgl2747 gene on the genome of Corynebacterium glutamicum YP097158 knocked out) and L2747-6 (with the Ncgl2747 gene on the genome of wild-type Corynebacterium glutamicum ATCC13032 knocked out).

[0069] Example 6 L-Lysine fermentation experiment The strains constructed in Examples 1 to 5, the Corynebacterium glutamicum original strains YP097158 and ATCC13032 were placed in a BLBIO-5GC-4-H fermentation tank (Shanghai Bairun Biotechnology Co., Ltd.), and fermentation experiments were carried out using the medium shown in Table 3 under the control process shown in Table 4. After the fermentation was completed, the production of L-lysine was detected using the ninhydrin colorimetric method, and OD(660nm) was measured with a spectrophotometer. The results of repeating each strain 3 times are shown in Table 5.

[0070] TIFF2025518814000004.tif86170

[0071] TIFF2025518814000005.tif70170

[0072] TIFF2025518814000006.tif88170

[0073] As a result, as shown in Table 5, a point mutation NCgl2747 in the coding region of the Ncgl2747 gene in Corynebacterium glutamicum I319F and overexpression were carried out, which contributed to an increase in the yield of L-lysine and the growth rate. However, weakening or knockout of the gene was disadvantageous for the accumulation of L-lysine and simultaneously decreased the growth rate of the strain.

[0074] The present invention has been described in detail above. For those skilled in the art, the present invention can be implemented more widely under parameters, concentrations and conditions without departing from the object and scope of the present invention and without performing unnecessary experiments. Although specific examples of the present invention have been shown, it should be understood that further improvements can be made to the present invention. In short, according to the principle of the present invention, this application is intended to include any modification, use or improvement of the present invention, including modifications that depart from the scope of the disclosure in this application and modifications made by conventional techniques known in the art. The application of some essential features of this application can be implemented according to the scope of the following appended claims.

[0075] The sequences 1-14 involved in the above-mentioned embodiments are as follows.

[0076] SEQ ID NO:1: Wild-type ORF (CDS) sequence of the Ncgl2747 gene (nucleotide sequence 1314bp) Accession number 2: NCgl2747 protein sequence (i.e., amino acid sequence 437aa encoded by Sequence 1) MTTDKRKTSKTTDTANKAVGADQAARPTRRTTRRIFDQSEKMKDVLYEIRGPVAAEAERMELDGHNILKLNTGNPAVFGFDAPDVIMRDMIANLPTSQGYSTSKGIIPARRAVVTRYEVVPGFPHFDVDDVFLGNGVSELITMTTQALLNDGDEVLIPAPDYPLWTAATSLAGGKPVHYLCDEEDDWNPSIEDIKSKISEKTKAIVVINPNNPTGAVYPRRVLEQIVEIAREHDLLILADEIYDRILYDDAEHISLATLAPDLLCITYNGLSKAYRVAGYRAGWMVLTGPKQYARGFIEGLELLAGTRLCPNVPAQHAIQVALGGRQSIYDLTGEHGRLLEQRNMAWTKLNEIPGVSCVKPMGALYAFPKLDPNVYEIHDDTQLMLDLLRAEKILMVQGTGFNWPHHDHFRVVTLPWASQLENAIERLGNFLSTYKQ Accession number 3: Gene variant NCgl2747 A955T ORF (CDS) sequence (nucleotide sequence 1314bp) GTGACTACAGACAAGCGCAAAACCTCTAAGACCACCGACACCGCCAACAAGGCTGTGGGCGCGGATCAGGCAGCGCGTCCCACTCGGCGAACAACTCGCCGCATCTTCGATCAGTCGGAGAAGATGAAGGACGTGCTGTACGAGATCCGTGGCCCGGTGGCCGCGGAGGCGGAACGCATGGAGCTTGATGGGCATAACATCTTAAAGCTCAACACGGGAAATCCAGCCGTGTTCGGATTCGATGCCCCCGACGTGATTATGCGTGACATGATCGCCAACCTTCCAACTTCCCAAGGGTATTCCACCTCCAAAGGCATTATTCCGGCCCGGCGAGCAGTGG TCACCCGCTACGAAGTTGTGCCCGGATTCCCCCACTTCGATGTTGATGATGTGTTCTTAGGCAACGGTGTCTCAGAACTAATCACCATGACCACCCAAGCACTCCTCAACGACGGCGATGAAGTTCTTATCCCCGCACCGGACTACCCACTGTGGACTGCCGCAACCTCCCTGGCTGGTGGTAAGCCTGTGCACTACCTCTGTGATGAGGAAGATGACTGGAACCCATCCATCGAAGACATCAAGTCCAAAATCTCAGAGAAAACCAAAGCTATTGTGGTGATCAACCCCAACAACCCCACGGGAGCTGTCTACCCGCGCCGGGTGTTGGAACAAATCGTCGAGATTGCACGCGAGCATGACCTGCTGATTTTGGCCGATGAAATCTACGACCGCATTCTCTACGATGATGCCGAGCACATCAGCCTGGCAACCCTTGCACCAGATCTCCTTTGCATCACATACAACGGTCTATCCAAGGCATACCGCGTCGCAGGATACCGAGCTGGCTGGATGGTATTGACTGGACCAAAGCAATACGCACGTGGATTTATTGAGGGCCTCGAACTCCTCGCAGGCACTCGACTCTGCCCAAATGTCCCAGCTCAGCACGCTTTTCAGGTAGCTCTCGGTGGACGCCAGTCCATCTACGACCTCACTGGCGAACACGGCCGACTCCTGGAACAGCGCAACATGGCATGGACGAAACTCAACGAAATCCCAGGTGTCAGCTGTGTGAAACCAATGGGAGCTCTATACGCGTTCCCCAAGCTCGACCCCAACGTGTACGAAATCCACGACGACACCCAACTCATGCTGGATCTTCTCCGTGCCGAGAAAATCCTCATGGTTCAGGGCACTGGCTTCAACTGGCCACATCACGATCACTTCCGAGTGGTCACCCTGCCATGGGCATCCCAGTTGGAAAACGCAATTGAGCGCCTGGGTAACTTCCTGTCCACTTACAAGCAGTAG Accession number 4: Gene variant NCgl2747 I319FProtein sequence (i.e., amino acid sequence 437aa encoded by Sequence 3) MTTDKRKTSKTTDTANKAVGADQAARPTRRTTRRIFDQSEKMKDVLYEIRGPVAAEAERMELDGHNILKLNTGNPAVFGFDAPDVIMRDMIANLPTSQGYSTSKGIIPARRAVVTRYEVVPGFPHFDVDDVFLGNGVSELITMTTQALLNDGDEVLIPAPDYPLWTAATSLAGGKPVHYLCDEEDDWNPSIEDIKSKISEKTKAIVVINPNNPTGAVYPRRVLEQIVEIAREHDLLILADEIYDRILYDDAEHISLATLAPDLLCITYNGLSKAYRVAGYRAGWMVLTGPKQYARGFIEGLELLAGTRLCPNVPAQHAFQVALGGRQSIYDLTGEHGRLLEQRNMAWTKLNEIPGVSCVKPMGALYAFPKLDPNVYEIHDDTQLMLDLLRAEKILMVQGTGFNWPHHDHFRVVTLPWASQLENAIERLGNFLSTYKQ Sequence number 5: NCgl2747 A955T Up-Down (size 1296 bp) TCACCCGCTACGAAGTTGTGCCCGGATTCCCCCACTTCGATGTTGATGATGTGTTCTTAGGCAACGGTGTCTCAGAACTAATCACCATGACCACCCAAGCACTCCTCAACGACGGCGATGAAGTTCTTATCCCCGCACCGGACTACCCACTGTGGACTGCCGCAACCTCCCTGGCTGGTGGTAAGCCTGTGCACTACCTCTGTGATGAGGAAGATGACTGGAACCCATCCATCGAAGACATCAAGTCCAAAATCTCAGAGAAAACCAAAGCTATTGTGGTGATCAACCCCAACAACCCCACGGGAGCTGTCTACCCGCGCCGGGTGTTGGAACAAATCGTCGAGATTGCACGCGAGCATGACCTGCTGATTTTGGCCGATGAAATCTACGACCGCATTCTCTACGATGATGCCGAGCACATCAGCCTGGCAACCCTTGCACCAGATCTCCTTTGCATCACATACAACGGTCTATCCAAGGCATACCGCGTCGCAGGATACCGAGCTGGCTGGATGGTATTGACTGGACCAAAGCAATACGCACGTGGATTTATTGAGGGCCTCGAACTCCTCGCAGGCACTCGACTCTGCCCAAATGTCCCAGCTCAGCACGCTTTTCAGGTAGCTCTCGGTGGACGCCAGTCCATCTACGACCTCACTGGCGAACACGGCCGACTCCTGGAACAGCGCAACATGGCATGGACGAAACTCAACGAAATCCCAGGTGTCAGCTGTGTGAAACCAATGGGAGCTCTATACGCGTTCCCCAAGCTCGACCCCAACGTGTACGAAATCCACGACGACACCCAACTCATGCTGGATCTTCTCCGTGCCGAGAAAATCCTCATGGTTCAGGGCACTGGCTTCAACTGGCCACATCACGATCACTTCCGAGTGGTCACCCTGCCATGGGCATCCCAGTTGGAAAACGCAATTGAGCGCCTGGGTAACTTCCTGTCCACTTACAAGCAGTAG TAGTTGTTAGGATTCACCACGAATCTCAGGATTTTTGAGATTCGTGGTGAATTTTTGCGTTTTCCAGTCAGGCTCCTGCAACTTTCGGACCGATTTCAGAGGGGCGGAGCTGGTTTGTGGTGGATCCTTGAAATGGAACCTCGCAGGAAGCTTTCAGGAAGACCAAGTTGGGCCTAGGGGTGGCGGGATTGCAAAAATCCGTCCCCGGTTCGCCATGAAATGCTGATTTTGATCGAATCTTTGCGCTAACTGTAGGGCGGGTTCAGGGGGTGAATGCACCACGAGCAACCCGAAGGGTGCGAAGTGGGCATTCGTAGAACAA Sequence number 6: P7 / P8 NCgl2747 upper homologous arm of genomic integration (763 bp) AATGCGTTCTGGACTGAGGTGACCACCATGCAAGACGAGGTGGACCTAGTGATCACCAACCCGCCGTTTTCTCTGTTCCGTGAGTTCCTGAGTTGGCTATTACACGGTGACGTGTTGTTTTCTATCATCGGTAACGCGAACGTAATCACATATCTAGGTGCCTGAATCTAGATTAAAACTATAAACATTATTTAAAACCATTGCCTTATTGGAGCATGCTGCAAGCTTTTCGCGGTGGGCTTGCAACATCTTACATCAGAATGAATGATGTTAAACACCTAATAAGTTCAAGTAGTTAAAAGGAAATATCAACAATGTTACGAAAAGCATCTATCACGCTAATGATATCCGTTACGCTCTTAACATGTGCCTCTCCAGCACAGGCACTGTCATCACAAGCACTCTCGTCAGAAAGCTCCACTTCGCAGAGTGATTCTCCTACGCAATTTGTTGCGAGTATAGCTGCGCCCTTCAATAAGAACTTAACCTATGAGCAGCGCAAAGCCATTCGTTTCGGACCTACGACAGAACAAGAAGCAGAACAATGCTTGGCAAAGTATGGTCGCGATGGCGAGGGGCCATGGCCTGCTATTGCTATCTATCCTGACTGCTCCTTCGATACTATCGAACAAGATTTCTATGATCAAGCAATATCCAAAGCCCTCTCAGTAATCAGTCTGGGAAGCTCCTAGAAGACTCGTAACGACCAAAAGCACCGAGAACAGATGCAACTCAAGCCCATTTACATCTGTTCTCGGTGCAC Sequence number 7: Genomic integration of P9 / P10 Ncgl2747 and its promoter sequence (1645 bp) Array number 8: P9 / P10 Ncgl2747 for genomic integration A955T and its promoter sequence (1645 bp) Array number 9: P11 / P12 NCgl2747 homologous arm sequence of genome integration (596 bp) CAGATGGCGCAATTAAATCAAGATCTCAGAACTCATTTTTCAATCTCTTCTTTTAGGGCACCCGTCATCAATTGAGCTATCGGCCATTCATTAAAAACTGCGCGTCGATCAACCGAAAGCTGAGTAAGCAAAAAATTCGCCTCTTCTCTATCGTCAAGAAGCAAAGCGCAACCAATCATAATCTCGCTATAGTTGTCTGGGTGCATTGTTTGATCAAGATTATGCCTAAAAGATCGAATTTCTGTTCTTTGTGAATCCAGTAATCCAGTTTGGCGATACAAAATTTGCCAACCATTAAGCCTGTAAATTGGCGACTCTTCTCGATCTCGTTCCACGAGCCAATCATTGAGAGCTTGAGCTGCTATAAGAAATGCAGTTTTCCTGCTCTGCTCAGAATCAGCTGCCTTAATTAGGCGAAGCACCATCCATGTGGCGAGATTATCAACATCAACAGTTTCTTCAAGCGCTGAATAGAAATCAACAAGCTTATCCAAATGCAGATTCAATACTGATGGAAGCCATCGATTATCAATGAGCTCGTACGGCGTCACTCGCTCGATTGAGGAGTCGCTCCGATCCGTTGAAGGTGTCATAGC Array number 10: Amplified fragment of identification primers P13 and P14 (size 1959 bp) Array No. 11: Amplified fragment of identification primers P15 and P16 (size 1600 bp) Array number 12: P17 and P18 amplify the pXMJ19 plasmid overexpression of NCgl2747 and its promoter sequence (size 1715 bp) GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGAT Array number 13: P17 and P18 amplify pXMJ19 plasmid overexpression of NCgl2747 A955T and its promoter sequence (size 1715bp) GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGAT Array number 14: Homology arm sequence of knockout NCgl2747 (size 1400bp)

Industrial Applicability

[0077] The present invention performs point mutation NCgl2747 in the coding region of the Ncgl2747 gene in Corynebacterium glutamicum I319F and overexpression, which contribute to an increase in the yield and growth rate of L-lysine. However, weakening or knockout of the gene is disadvantageous for the accumulation of L-lysine and simultaneously reduces the growth rate of the strain. This indicates that NCgl2747 of the present invention I319F and the gene encoded thereby can be used for the preparation of L-lysine, showing excellent application prospects.

Claims

1. A protein comprising an amino acid sequence containing SEQ ID NO: 4, or A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of A1). A protein which is as described above.

2. A nucleic acid molecule encoding the protein according to Claim 1, An expression cassette containing the nucleic acid molecule according to B1), A recombinant vector containing the nucleic acid molecule according to B1), or a recombinant vector containing the expression cassette according to B2), A recombinant microorganism containing the nucleic acid molecule according to B1), or a recombinant microorganism containing the expression cassette according to B2), or a recombinant microorganism containing the recombinant vector according to B3) Any one of the above is a biological material related to the protein according to Claim 1.

3. The nucleic acid molecule according to B1) is b11) A DNA molecule shown in SEQ ID NO: 3 of the Sequence Listing, b12) A DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) and encoding the protein according to Claim 1, b13) A genomic DNA molecule that hybridizes to the nucleotide sequence defined in b11) or b12) under stringent conditions and encodes the protein according to Claim 1 The biological material according to Claim 2, characterized in that it is any one of the above.

4. The expression cassette according to B2) is a DNA molecule shown in SEQ ID NO: 8, The recombinant microorganism according to B4) is a recombinant microorganism obtained by substituting the NCgl2747 gene of a microorganism containing the NCgl2747 gene shown in SEQ ID NO: 1 with the nucleic acid molecule according to B1), or a recombinant microorganism obtained by introducing and expressing the nucleic acid molecule according to B1) into a microorganism. The biological material according to Claim 2 or 3, characterized in that it is as described above.

5. A method for preparing L-lysine, comprising: obtaining a recombinant living cell by causing the protein according to claim 1 to be expressed in a recipient living cell, or increasing the content or activity of the protein according to claim 1 in a recipient living cell, or increasing the content or activity of the protein shown in SEQ ID NO: 2 in a recipient living cell; culturing the recombinant living cell to obtain L-lysine; A method for preparing L-lysine, characterized by comprising the above steps.

6. The method according to claim 5, characterized in that the living cell is a yeast, bacterium, alga, fungus, plant cell or animal cell capable of synthesizing L-lysine.

7. The method according to claim 6, characterized in that the bacterium is Corynebacterium glutamicum.

8. The method is achieved by introducing and expressing the gene encoding the protein according to claim 1 into the recipient living cell, or by introducing and expressing the gene encoding the protein shown in SEQ ID NO: 2 into the recipient living cell, or the recipient living cell contains the DNA molecule shown in SEQ ID NO: 1, and the method is achieved by replacing the DNA molecule shown in SEQ ID NO: 1 with the DNA molecule shown in SEQ ID NO: 3 in the recipient living cell. The method according to any one of claims 5 to 7.

9. The culturing of the recombinant living cell is carried out using a medium capable of growing the recombinant living cell, and / or the culturing of the recombinant living cell is carried out using conditions capable of growing the recombinant living cell. The method according to any one of claims 5 to 7.

10. The method is achieved by introducing and expressing a gene encoding the protein according to claim 1 into the recipient living cell, or by introducing and expressing a gene encoding the protein shown in SEQ ID NO: 2 into the recipient living cell, or Alternatively, the recipient living cell contains a DNA molecule shown in SEQ ID NO: 1, and the method is achieved by substituting the DNA molecule shown in SEQ ID NO: 1 with the DNA molecule shown in SEQ ID NO: 3 in the recipient living cell. The method according to claim 9, characterized in that.

11. A product for preparing L-lysine, containing the protein according to claim 1 or the biological material according to any one of claims 2 to 4.