Cucumber 1K liquid phase breeding chip and special single nucleotide polymorphism variation site thereof

Abstract

The invention discloses a cucumber 1K liquid phase breeding chip and a special single nucleotide polymorphism variation site thereof. The 1K liquid phase breeding chip provided by the invention comprises a probe combination for detecting 1121 single nucleotide polymorphism variation sites in a cucumber genome, and the position information of a probe corresponding to each single nucleotide polymorphism variation site in a cucumber reference genome is shown in a table 3 in the specification. Single nucleotide polymorphism variation sites involved in the liquid phase breeding chip provided by the invention have the advantages of high polymorphism, good repeatability, stable and reliable marking, convenient statistics and the like, and a DNA fingerprint database for identifying the authenticity of cucumber varieties can be established based on the liquid phase breeding chip. The method can be used for cucumber variety authenticity, early breeding and identification of cucumber varieties and identification of cucumber seed resources, provides technical support for enrichment of cucumber germplasm resources, breeding of new varieties and protection of the new varieties, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of cucumber variety identification, and in particular to a cucumber whole-genome 1K liquid-phase breeding chip and its dedicated single nucleotide polymorphism (SNP) variation sites and applications. Background Art

[0002] Cucumbers are an important vegetable crop in my country, accounting for 81% of global cucumber production. Cucumbers have a rich, fragrant flavor and are rich in vitamin C and dietary fiber. They clear heat and detoxify, moisten the lungs, and relieve coughs, possessing excellent health benefits. Cucumbers are a pillar industry in many parts of China, helping to adjust industrial structures, increase farmers' incomes, and promote rural economic development. In recent years, as people's aspirations for a better life continue to rise, higher demands have been placed on cucumber varieties with excellent disease resistance, high yields, and high quality. Cucumber varieties with superior comprehensive traits and prominent advantageous traits are urgently needed, but conventional breeding techniques struggle to achieve precise aggregation of multiple superior genetic traits. With the rapid advancement of cucumber genomics and functional gene research, over 100 cucumber germplasm accessions have been whole-genome sequenced, and the functions of over 50 genes have been elucidated. These breakthroughs have revealed the rich genetic diversity within cucumber species and their domestication history, laying the theoretical foundation for precision breeding. However, the small number of molecular markers used in traditional breeding (typically only dozens to hundreds) is no longer sufficient to meet the demands of modern gene aggregation breeding for the coordinated improvement of multiple traits. This is particularly true for complex quantitative traits such as disease resistance, stress tolerance, and quality, which present significant limitations. Furthermore, with a large number of cucumber varieties in China, including over 2,000 registered varieties, establishing DNA fingerprints for cucumber varieties is crucial to supporting seed regulatory authorities in their identification and subsequent cultivar identification. Therefore, a rapid, accurate, and high-throughput technology for whole-genome genotyping of cucumbers is crucial.

[0003] To address this technical bottleneck, with the continuous development of high-throughput sequencing technology and the continuous reduction of sequencing costs, liquid-phase chip solutions for targeted sequencing technology that combines high-throughput sequencing with multiplex PCR have emerged. By designing specific primer probes for the sites to be detected, thousands of probe sequences are integrated into a single tube for multiplex PCR amplification, and the amplified products of the mixed samples are deeply sequenced, and finally the genotype information of different samples at each site is obtained based on the sequencing results. This new molecular breeding tool has three major innovative advantages: (1) High-density marker coverage. By designing specific probe primers, tens of thousands of key variant sites can be captured at one time. (2) Precise targeting design. Based on the high-quality reference genome of cucumber 9930, the gene intervals that control agronomic traits such as fruit size and bitterness synthesis can be accurately located. (3) Dynamic upgrade capability. Compared with solid-phase chips, liquid-phase chips can flexibly update probe combinations to achieve synchronous tracking of newly discovered important genotypes. In practical applications, this technology has significantly improved the detection efficiency of sample genotypes, can solve the problems existing in the above-mentioned traditional genotype detection technologies, and has a very broad application prospect. Summary of the Invention

[0004] In response to the shortcomings of the prior art, the present invention aims to provide a cucumber whole-genome 1K liquid-phase breeding chip and its dedicated single nucleotide polymorphism variation site and application. This liquid-phase breeding chip can accurately obtain the genotype of single nucleotide polymorphism variation sites in the cucumber whole genome.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Option 1:

[0007] A probe combination for detecting a combination of single nucleotide polymorphism variation sites (SNP sites) in the entire cucumber genome, wherein each SNP variation site corresponds to a probe, and the combination of SNP variation sites includes 1121 SNP variation sites. The positions and base types of the 1121 SNP variation sites in the cucumber genome are shown in Table 1 of the specification of the present invention. The positions of the 1121 SNP variation sites in the genome are determined based on the cucumber 9930 reference genome version V2. In Table 1, the numbers on the left represent the chromosome numbers where the SNP variation sites are located, the values ​​in the middle represent the physical positions of the chromosomes where the SNP variation sites are located, and the letters on the right represent the two base types of the SNP variation sites.

[0008] In the probe combination of scheme 1 of the present invention, as a preferred embodiment, the corresponding positions of the nucleotide sequences of each probe in the probe combination in the genome are shown in Table 3 of the present invention specification. The corresponding positions are determined based on the cucumber 9930 reference genome version V2. In Table 3, the numbers on the left side of "-" represent the chromosome number where the single nucleotide polymorphism variation site is located, and the data on the right side of "-" represent the starting position to the ending position on the chromosome where the probe is located.

[0009] Option 2:

[0010] A cucumber whole-genome 1K liquid-phase breeding chip comprises the probe combination for detecting cucumber single nucleotide polymorphism variation site combination according to the first solution of the present invention.

[0011] The liquid-phase breeding chip targeting scheme 1 is used to detect cucumber single nucleotide polymorphism variation sites to obtain base information of the polymorphic sites.

[0012] The liquid-phase breeding chip may also include other commonly required reagents or equipment.

[0013] Option 3:

[0014] The use of the probe combination for detecting single nucleotide polymorphism variation sites in cucumber according to the above scheme 1 includes any one of the following (1) to (8):

[0015] (1) A kit for preparing a method for identifying cucumber varieties;

[0016] (2) A kit for preparing a method for identifying the authenticity of cucumber varieties;

[0017] (3) a kit for preparing a method for analyzing the genetic relationship of cucumber varieties;

[0018] (4) Used to identify cucumber varieties;

[0019] (5) Used to identify the authenticity of cucumber varieties;

[0020] (6) Used to analyze the genetic relationship of cucumber varieties;

[0021] (7) Used to identify whether the cucumber variety to be tested contains the 56 excellent cucumber genes shown in Table 2 or which of the 56 excellent cucumber genes shown in Table 2 it contains;

[0022] (8) Used to construct a fingerprint database of the cucumber varieties to be tested.

[0023] Option 4:

[0024] The use of the cucumber whole genome 1K liquid-phase breeding chip of the above-mentioned scheme 2 includes any one of the following (A) to (E);

[0025] (A) Used to identify cucumber varieties;

[0026] (B) Used to identify the authenticity of cucumber varieties;

[0027] (C) used to analyze the genetic relationship of cucumber varieties;

[0028] (D) for identifying whether the cucumber variety to be tested contains the 56 excellent cucumber genes shown in Table 2 of the present application specification or which of the 56 excellent cucumber genes shown in Table 2 it contains;

[0029] (E) Used to construct a fingerprint database of the cucumber varieties to be tested.

[0030] Option 5:

[0031] A method for constructing a fingerprint database of cucumber varieties for testing comprises the following steps:

[0032] S1-1: Obtaining genomic DNA of the tested cucumber varieties;

[0033] S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library;

[0034] S1-3: The DNA library is combined with the probes of the above-mentioned scheme 1 to form a hybridization system and hybridization capture is performed, and the sequencing library is obtained after purification;

[0035] S1-4: Sequencing the sequencing library and performing data analysis to obtain the genotyping information of the 1121 single nucleotide polymorphism variation sites shown in Table 1 of the present specification, and constructing a fingerprint database of the test cucumber varieties based on the genotyping information of the 1121 single nucleotide polymorphism variation sites.

[0036] Option 6:

[0037] A method for identifying a cucumber variety to be tested comprises the following steps:

[0038] S2-1: Obtain genomic DNA of the cucumber variety to be tested and the standard cucumber variety respectively;

[0039] S2-2: The genomic DNA of each species obtained in step S2-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library of the corresponding species;

[0040] S2-3: The DNA library of each species is combined with the probe of the above scheme 1 to form a hybridization system and perform hybridization capture, and the sequencing library of each species is obtained after purification;

[0041] S2-4: Sequencing and data analysis are performed on the sequencing libraries of each variety to obtain genotyping information of the 1121 single nucleotide polymorphism variation sites shown in Table 1 of the present specification in each variety;

[0042] S2-5: The genotyping results of the 1121 single nucleotide polymorphism variation sites of the tested cucumber variety are compared with the genotyping results of the 1121 single nucleotide polymorphism variation sites of the standard cucumber variety, and the similarity LS of the single nucleotide polymorphism variation sites of the two cucumber varieties is calculated, where:

[0043] The calculation formula of LS is: LS = (1-D / T) × 100%, where D is the number of differential SNP variation sites between the two varieties compared, and T is the total number of SNP variation sites compared;

[0044] Then make the following judgment:

[0045] If the site similarity between the cucumber variety to be tested and a certain standard cucumber variety is ≥97.0%, the cucumber variety to be tested and the standard cucumber variety are the same variety or suspected to be the same variety; the fewer the number of different sites, the higher the variety similarity;

[0046] If the site similarity between the cucumber variety to be tested and a certain standard cucumber variety is between 95.0% and 97.0% but does not include 97%, then the cucumber variety to be tested and the standard cucumber variety are similar varieties;

[0047] If the site similarity between the cucumber variety to be tested and a certain standard cucumber variety is less than 95.0%, the cucumber variety to be tested and the standard cucumber variety are different varieties.

[0048] The standard cucumber varieties described in the present invention refer to known cucumber varieties, such as the 96 cucumber varieties recorded in Table 4 of the present invention.

[0049] In the method for constructing a fingerprint database of test cucumber varieties in the above-mentioned scheme five or the method for identifying the cucumber varieties to be tested in the above-mentioned scheme six, as an implementable embodiment, in step S1-2 or S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, and the system is: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water is used to make up the system to 20 μL.

[0050] In the method for constructing a fingerprint database of test cucumber varieties of the above-mentioned scheme five or the method for identifying the test cucumber varieties of the above-mentioned scheme six, as an implementable embodiment, in step S1-2 or S2-2, the reaction system for the adapter ligation is 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina trueseq universal adapter sequence, and ultrapure water is added to 20 μL.

[0051] In the method for constructing a fingerprint database of test cucumber varieties of the above-mentioned scheme five or the method for identifying the test cucumber varieties of the above-mentioned scheme six, as an implementable embodiment, in step S1-3 or S2-3, the hybridization system is 2.5 μg of the concentrated DNA library obtained in step S2-2, 4 μL of a probe working solution with a concentration of 50 ng / μL, and ultrapure water is added to the system to 16 μL.

[0052] Beneficial effects of the present invention:

[0053] (1) The SNP locus combination provided by the present invention has the advantages of high polymorphism, good repeatability, uniform distribution on chromosomes, stable and reliable markers, and convenience for statistics, and can accurately reflect the genetic relationship of the tested cucumber varieties to the greatest extent possible.

[0054] (2) The material background of the SNP site combination involved in the liquid-phase breeding chip of the present invention covers a wider range of cucumber varieties, with high representativeness and rich diversity information.

[0055] (3) The 1K liquid-phase breeding chip provided by the present invention can be applied to cucumber variety authenticity identification, kinship identification, hybrid breeding, and fingerprint map construction, which is conducive to accelerating the progress of cucumber research and breeding.

[0056] (4) The present invention provides for the first time a method for constructing a DNA fingerprint database for identifying the authenticity of cucumber varieties based on high-throughput sequencing, which can be used for early identification of cucumber varieties at the seed or seedling stage, ensuring the authenticity of the varieties, effectively protecting the rights and interests of producers and breeders, and providing technical support for the protection of cucumber germplasm resources and new varieties.

[0057] (5) The method for identifying cucumber varieties provided by the present invention can be used to identify unknown cucumber varieties as well as the authenticity of known varieties.

[0058] (6) The method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, saving manpower and material resources, etc., and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is a distribution diagram of SNP sites of the 1K liquid-phase breeding chip of the present invention on the cucumber genome.

[0060] Figure 2 It is the genotype deletion rate of the 1K liquid-phase breeding chip of the present invention in 96 representative cucumber varieties.

[0061] Figure 3 : MAF value of the 1K liquid-phase breeding chip of the present invention in 96 representative cucumber varieties.

[0062] Figure 4 The results are the analysis results of the 1K liquid-phase breeding chip of the present invention on the excellent gene carrying status of 96 cucumber varieties.

[0063] Figure 5 This is a distribution diagram of the background recovery rate of 128 individual plants in the BC2F1 population using the 1K liquid-phase breeding chip of the present invention. DETAILED DESCRIPTION

[0064] The following examples and figures are provided to facilitate a better understanding of the present invention. They are intended to explain certain aspects or features of the present invention in detail, but are not intended to limit the present invention.

[0065] Unless otherwise defined, technical and scientific terms used herein have the same meanings as commonly used in the art.

[0066] Without departing from the spirit or scope of the present invention, improvements made to the embodiments of the present invention or extensions of technical applications shall fall within the scope of protection of the present invention.

[0067] The experimental methods in the following examples are all conventional methods unless otherwise specified. For liquid phase chip application methods not described in detail in the specification, please refer to (Targeted Genotyping by Sequencing (GBTS) Technology and Its Applications, 2020).

[0068] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0069] Example 1: Acquisition of SNP sites from the cucumber whole genome 1K liquid phase breeding chip

[0070] The present invention is based on 182 cucumber resequencing data disclosed in the vegetable whole genome SNP variation big data platform VegSNPDB (www.vegsnpdb.cn), and screens high-quality SNP sites that can represent the genetic information of the whole genome and are suitable for targeted sequencing. Specifically, the SNP screening criteria are as follows: minimum allele frequency MAF>0.15, genotype heterozygosity <0.1, genotype deletion rate <0.1, and no other variations, SSRs, and Indels within 50bp on both sides of the SNP. In addition, the 13 cucumber mitochondrial SNP variations and 56 key SNP variations linked to important agronomic traits screened by this team were combined. Finally, the inventors of the present invention screened out 1121 SNP sites that are evenly distributed throughout the cucumber genome, which are used for the cucumber 1K liquid phase breeding chip with a high polymorphism information content (PIC value). The positions of these 1121 SNP sites on the cucumber chromosomes and the variant bases are shown in Table 1, and their distribution on the 7 cucumber chromosomes is shown in Table 1. Figure 1 The base types and physical locations of the above SNP sites on chromosomes were determined based on the cucumber 9930 reference genome (Long_genome_v2.fa.gz).

[0071] The SNP sites involved in the cucumber 1K breeding liquid phase chip are evenly distributed on the chromosome, with an average physical distance of 170.6kb between each site and a maximum distance of 610.1kb. 36.4% of the variation sites are located in the exon region of the gene.

[0072] Table 1. Chromosome location and base information of 1121 SNP variants

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079] Note: In the SNP locus information, the data on the left of “_” is the chromosome where the SNP is located, the middle value is the physical position of the chromosome where the SNP is located, and the data on the right of “_” is the two genotypes of the SNP variation.

[0080] The important functional genes and variation information of cucumber involved in the cucumber 1K liquid-phase breeding chip of the present invention are shown in Table 2.

[0081] Table 2 Important functional genes and variation information in cucumber 1K liquid-phase breeding array

[0082]

[0083]

[0084] Example 2: Preparation of Probes for Cucumber 1K Liquid-Phase Breeding Chip

[0085] The cucumber 1K liquid-phase breeding chip includes 1,121 probe combinations, each of which hybridizes to a single SNP site region to form a double strand. Based on the principle of complementary base pairing, oligonucleotide probes are designed to complement the target sequence. The probe combination design principles are as follows:

[0086] (1) The average probe length is 190 bp, the SNP is located in the middle of the probe, and the flanking sequences are 90-100 bp;

[0087] (2) The region where the probe is located is relatively conservative (no other variations in the 50 bp on both sides), avoiding areas with repetitive sequences and structural variations;

[0088] (3) The GC content of the probe is 40%-60%, with a stronger capture ability in the 50% region, avoiding high GC and high AT regions.

[0089] The unknown information of 1121 probes in the cucumber 1K liquid-phase breeding array is shown in Table 3.

[0090] The probe sequences in Table 3 were synthesized from single-stranded nucleotides, with lengths ranging from 109 bp to 220 bp, with an average of 190 bp. The 5' end was modified with a biotin group, and the biotin was covalently coupled to polystyrene microspheres.

[0091] Table 3 Probe position information of cucumber 1K liquid phase breeding chip

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098] Note: In the SNP site information, the data on the left of “-” is the chromosome where the SNP is located, and the data on the right of “-” is the starting and ending positions of the probe on the chromosome.

[0099] Example 3: Evaluation of the genotype detection efficiency of the cucumber 1K liquid-phase breeding chip

[0100] A cucumber whole-genome 1K liquid-phase breeding chip involves SNP sites listed in Table 1 of Example 1, and includes the probe combination of Example 2. There are 1121 SNP sites corresponding to 1121 probes, each of which hybridizes with a SNP site to form a double strand.

[0101] In order to evaluate the genotype capture efficiency of 1121 SNP sites, the cucumber 1K liquid-phase breeding chip of the present invention was used to perform SNP genotyping on 96 cucumber hybrids collected from China.

[0102] The basic information of the 96 cucumber varieties tested in this example is shown in Table 4. The 96 cucumber varieties tested are all excellent varieties commonly used in production or some varieties introduced from abroad.

[0103] Table 4. Information on 96 cucumber varieties

[0104]

[0105]

[0106] The experimental method for detecting cucumber 1K liquid-phase breeding chips includes the following steps: obtaining genomic DNA, library construction, hybridization capture, sequencing, and data analysis.

[0107] 1. Obtaining genomic DNA of the test cucumber varieties

[0108] The genomic DNA of the leaves of 96 tested cucumber varieties were extracted by SDS and magnetic bead methods respectively to obtain the genomic DNA of the tested cucumber varieties.

[0109] The quality and concentration of the genomic DNA of the test cucumber varieties must meet the PCR requirements. The standards are: 1% agarose electrophoresis shows a single DNA band with no obvious diffusion; the A260 / A230 ratio detected by the UV spectrophotometer Nanodrop2000 (Thermo) is greater than 2.0, and the A260 / A280 ratio is around 1.8; the concentration of the genomic DNA of the test cucumber varieties is >50ng / μL.

[0110] 2. Library construction

[0111] Take 300 ng of DNA that has passed quality control, add 2.6 μL of fragmentation and end-repair enzyme, 4 μL of end-repair reaction buffer, and make up the volume to 20 μL with ultrapure water. Then, treat at 37°C for 30 minutes and 72°C for 30 minutes. After DNA is fragmented and repaired by the end-repair enzyme, an A is added to the 3' end.

[0112] Use 10 ng of the repaired DNA from the previous step, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of the Illumina TrueSeq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1), and ultrapure water to make up to 20 μL. Incubate at 22°C for 60 min. Ligate the A-added DNA fragments to the adapters. Use PCR amplification to connect the index and sequencer-compatible sequences to the ends of the adapter-containing DNA fragments to form a complete library structure. Add purification magnetic beads and pipette or vortex to mix thoroughly to purify the library and select fragments. Mix equal amounts of the purified and selected fragments to form a mixed library.

[0113] 3. Hybridization capture

[0114] Concentrate the mixed library to a dry powder and then add it to the hybridization system for hybridization capture. Add 2.5 μg of the concentrated library to 4 μL of 50 ng / μL probe working solution, and bring the system up to 16 μL with ultrapure water. Incubate at 95°C for 10 minutes and then at 65°C for 2-4 hours. After hybridization, transfer 16 μL of the hybridization capture solution to the prepared magnetic beads. Purify the enriched product to complete the sequencing library preparation.

[0115] 4. Sequencing and Data Analysis

[0116] Equal amounts of the purified products were mixed to generate sequencing libraries, which were then sequenced using a BGI T7 sequencer. The raw sequencing bases were split according to the barcodes of the different samples, and low-quality sequencing data were filtered. The data were then aligned with the cucumber 9930 reference genome (V2) to mine SNP variant information. Based on the obtained SNP information, the corresponding SNP genotypes were derived, thereby constructing fingerprints for the test varieties.

[0117] 5. Efficiency evaluation

[0118] After testing 96 cucumber samples, the average genotype data detection rate of the cucumber 1K liquid phase breeding chip was 99.2% ( Figure 2 ).

[0119] By counting the minimum allele frequencies (MAF) of 1121 SNPs, 89.6% of the SNP sites had MAF values ​​greater than 0.05, and the average MAF value was 0.33 ( Figure 3 ), indicating that the cucumber 1K liquid-phase breeding chip developed by the present invention has high polymorphism in 96 cucumber test varieties.

[0120] Example 4: Evaluation of the number of superior alleles carried by 96 cucumber varieties

[0121] The cucumber 1K liquid-phase breeding chip developed by the present invention can be used to identify whether a test variety contains 56 known cucumber excellent genes or which of the 56 known cucumber excellent genes it contains.

[0122] According to the SNP information of 96 tested cucumber varieties obtained in Example 3 and the corresponding relationship between the linkage variation of the excellent genes listed in Table 2 and the SNP in Example 1, the number of excellent genes carried by the 96 cucumber varieties can be quickly obtained (see Figure 4 ), providing data support for precise gene aggregation breeding.

[0123] Example 5: Method for detecting whether a cucumber variety to be tested belongs to a certain variety among 96 tested cucumber varieties

[0124] 1. Obtaining genomic DNA of the cucumber variety to be tested

[0125] The leaves of the cucumber variety to be tested, “Jingyan White Elf”, were taken from the experimental base of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.

[0126] According to the method of step 1 in Example 3, the "leaves of the test cucumber variety" are replaced with "leaves of the cucumber variety to be tested", and the other steps remain unchanged to obtain the genomic DNA of the cucumber variety to be tested.

[0127] 2. Preparation of Sequencing Library

[0128] According to the method of step 2 in Example 3, the "genomic DNA of the test cucumber variety" was replaced with the "genomic DNA of the cucumber variety to be tested", and the other steps remained unchanged to obtain the sequencing library of the cucumber variety to be tested.

[0129] 3. Hybridization capture

[0130] Proceed according to the method of step 3 in Example 3.

[0131] 4. Sequencing

[0132] Take the sequencing library of the cucumber variety to be tested and sequence it.

[0133] The sequencing results of 1121 SNP amplification products of the tested cucumber varieties in the cucumber 1K liquid-phase breeding array were compared with the 1121 SNP sites of 96 tested cucumber varieties (shown in Table 4), and the site similarity LS of the two cucumber varieties was calculated, where:

[0134] The LS calculation formula is: LS = (1-D / T) × 100%, where D is the number of differential sites between the two samples compared, and T is the total number of sites compared.

[0135] Then make the following judgment:

[0136] If the site similarity between the cucumber variety to be tested and a certain standard cucumber variety (test cucumber variety) is ≥97.0%, the cucumber variety to be tested and the standard cucumber variety are suspected to be the same variety; the fewer the number of different sites, the higher the site similarity;

[0137] If the site similarity between the cucumber variety to be tested and a certain standard cucumber variety (the tested cucumber variety) is between 95.0% and 97.0% and does not include 97%, the cucumber variety to be tested and the standard cucumber variety are similar varieties.

[0138] If the site similarity between the cucumber variety to be tested and a certain standard cucumber variety is less than 95.0%, the cucumber variety to be tested and the standard cucumber variety are different varieties.

[0139] The results showed that the genetic similarity between the tested cucumber variety and the 96 tested cucumber varieties at 1121 SNP loci was 94%. Therefore, the tested cucumber variety did not belong to any of the 96 tested cucumber varieties, that is, the tested cucumber variety "Jingyan White Elf" was different from any of the 96 tested cucumber varieties.

[0140] Example 6: Construction of a DNA fingerprint database of 96 cucumber varieties

[0141] The cucumber 1K liquid-phase breeding chip developed by the present invention can be used to construct a DNA fingerprint database of 96 cucumber varieties, and establish a unique DNA fingerprint molecular identity card for each variety resource.

[0142] Based on the 1121 nucleotide variation information in Example 1 and the 96 test cucumber varieties in Implementation Case 3, the method of Example 3 can be used to quickly construct a DNA fingerprint database of 96 cucumber varieties, providing data support for whether newly collected variety resources will be introduced into the DNA fingerprint database in the future.

[0143] Example 7: Screening for Individual Plants with Rapid Recovery Background in Backcross Breeding

[0144] The cucumber 1K liquid-phase breeding chip developed by the present invention can be used to identify and quickly determine the genomic percentages of the donor and recipient of each individual plant in backcross breeding progeny, providing data support for screening backcross progeny with a high background recovery rate.

[0145] Based on the 1121 nucleotide variation information in Example 1, 128 individuals of the BC2F1 population constructed from the donor parent HZ257 and the recurrent parent HT109 were identified at the seedling stage. 592 SNP variations that differed between the donor parent and the recurrent parent were screened, and the proportion of the 128 individuals that were consistent with the recurrent parent genotype was calculated. The recurrent parent genotype accounted for 95% as the selection criterion for restoring the recurrent parent background. Finally, two individuals ( Figure 5), and its field phenotype has no significant difference from that of the recurrent parent, which significantly improves the identification efficiency and saves field planting costs.

Claims

1. A probe combination for detecting a combination of single nucleotide polymorphism variation sites in cucumber, wherein each single nucleotide polymorphism variation site corresponds to a probe, and the combination of single nucleotide polymorphism variation sites includes 1,121 single nucleotide polymorphism variation sites. The positions and base types of the 1,121 single nucleotide polymorphism variation sites in the cucumber genome are shown in the following table, wherein: The number on the left indicates the chromosome number where the single nucleotide polymorphism variation site is located, the number in the middle indicates the physical position of the chromosome where the single nucleotide polymorphism variation site is located, and the letters on the right indicate the two base types of the single nucleotide polymorphism variation site: The locations of 1,121 single nucleotide polymorphism (SNP) variants in the genome were determined based on the cucumber 9930 reference genome version 2.

2. The probe combination for detecting cucumber single nucleotide polymorphism variation site combination according to claim 1, characterized in that, The corresponding positions of the nucleotide sequences of the probes in the probe combination in the genome are shown in the following table, where the numbers on the left of "-" represent the chromosome numbers where the single nucleotide polymorphism variation sites are located, and the numbers on the right of "-" represent the starting and ending positions on the chromosomes where the probes are located: The corresponding positions were determined based on the cucumber 9930 reference genome version V2.

3. A cucumber liquid phase breeding chip, characterized in that: The invention comprises the probe combination for detecting cucumber single nucleotide polymorphism variation site combination according to claim 1 or 2.

4. A use of a probe combination, characterized in that, The probe combination is the probe combination for detecting a combination of single nucleotide polymorphism variation sites in cucumber according to claim 1 or 2, and the use includes any one of the following (1) to (8): (1) A kit for preparing a method for identifying cucumber varieties; (2) A kit for preparing a method for identifying the authenticity of cucumber varieties; (3) a kit for preparing a method for analyzing the genetic relationship of cucumber varieties; (4) Used to identify cucumber varieties; (5) Used to identify the authenticity of cucumber varieties; (6) Used to analyze the genetic relationship of cucumber varieties; (7) It is used to identify whether the cucumber variety to be tested contains the fifty-six cucumber excellent genes or which of the fifty-six cucumber excellent genes it contains. The positions, gene IDs, associated traits and base variation types of the fifty-six cucumber excellent genes on the chromosomes are shown in the following table: (8) Used to construct a fingerprint database of the cucumber varieties to be tested.

5. A use of a cucumber liquid phase breeding chip, characterized in that: The liquid-phase breeding chip is the cucumber liquid-phase breeding chip according to claim 3, and the use includes any one of the following (A) to (E); (A) Used to identify cucumber varieties; (B) Used to identify the authenticity of cucumber varieties; (C) used to analyze the genetic relationship of cucumber varieties; (D) for identifying whether the cucumber variety to be tested contains the fifty-six cucumber excellent genes or which of the fifty-six cucumber excellent genes it contains, wherein the locations on the chromosomes, gene IDs, associated traits, and base variation types of the fifty-six cucumber excellent genes are as shown in the table of claim 4; (E) Used to construct a fingerprint database of the cucumber varieties to be tested.

6. A method for constructing a fingerprint database of cucumber varieties for testing, characterized in that: The steps include: S1-1: Obtaining genomic DNA of the tested cucumber varieties; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: combining the DNA library with the probe combination for detecting the combination of single nucleotide polymorphism variation sites in cucumber according to claim 1 or 2 to form a hybridization system and perform hybridization capture, and obtaining a sequencing library after purification; S1-4: Sequencing the sequencing library and performing data analysis to obtain the genotyping information of the 1,121 single nucleotide polymorphism variation sites described in claim 1, and constructing a fingerprint database of the test cucumber varieties based on the genotyping information of the 1,121 single nucleotide polymorphism variation sites.

7. A method for identifying a cucumber variety to be tested, characterized in that: The steps include: S2-1: Obtain genomic DNA of the cucumber variety to be tested and the standard cucumber variety respectively; S2-2: The genomic DNA of each species obtained in step S2-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library of the corresponding species; S2-3: The DNA library of each variety is respectively combined with the probe combination for detecting the combination of single nucleotide polymorphism variation sites of cucumber according to claim 1 or 2 to form a hybridization system and perform hybridization capture, and the sequencing library of each variety is obtained after purification; S2-4: Sequencing the sequencing libraries of each variety and performing data analysis to obtain genotyping information of the 1,121 single nucleotide polymorphism variation sites described in the table of claim 1 in each variety; S2-5: The genotyping results of the 1,121 SNP variation sites of the tested cucumber variety are compared with the genotyping results of the 1,121 SNP variation sites of the standard cucumber variety, and the similarity LS of the SNP variation sites of the two cucumber varieties is calculated. The LS calculation formula is: LS = (1-D / T) × 100%, where D is the number of different SNP variation sites between the two varieties, and T is the total number of SNP variation sites compared; then the following judgment is made: If the similarity of the single nucleotide polymorphism variation site between the cucumber variety to be tested and a certain standard cucumber variety is greater than or equal to 97.0%, then the cucumber variety to be tested and the standard cucumber variety are the same variety; If the similarity of the single nucleotide polymorphism variation site between the cucumber variety to be tested and a certain standard cucumber variety is between 95.0% and 97.0% but does not include 97%, then the cucumber variety to be tested and the standard cucumber variety are similar varieties; If the similarity of the single nucleotide polymorphism variation site between the cucumber variety to be tested and a certain standard cucumber variety is less than 95.0%, the cucumber variety to be tested and the standard cucumber variety are different varieties.

8. The method for identifying the cucumber variety to be tested according to claim 7, wherein In step S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, which includes: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to make up the system to 20 μL.

9. The method for identifying the cucumber variety to be tested according to claim 7, wherein In step S2-2, the reaction system for the adapter ligation is 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina Trueseq universal adapter sequence, and ultrapure water to 20 μL.

10. The method for identifying the cucumber variety to be tested according to claim 7, wherein: In step S2-3, the hybridization system is 2.5 μg of the concentrated DNA library obtained in step S2-2, 4 μL of a probe working solution with a concentration of 50 ng / μL, and ultrapure water is added to make up the system to 16 μL.

Images