EP6 promoter, its related biological materials and uses

Abstract

Provided are an EP6 promoter, its related biological materials and uses. The sequence of this EP6 promoter is shown in SEQ ID No. 3 of the Sequence Listing. By incorporating this EP6 promoter as a strong exogenous promoter into bacteria with high amino acid productivity instead of the original promoter of an important gene for amino acid synthesis, an improvement in the production amount of the corresponding amino acid is achieved.

Description

Technical Field

[0001] The present invention relates to an EP6 promoter, related biological materials, and uses thereof in the field of biotechnology.

Background Art

[0002] Currently, the industrial productivity of amino acids has been greatly improved. However, in order to further increase the production amount of amino acids while maintaining high productivity, it is necessary to comprehensively consider the carbon source required for the growth of amino acid-producing bacteria and how to introduce the carbon source into the amino acid synthesis pathway to the maximum extent in the late fermentation stage. To solve this problem, in the case of bacteria that produce specific amino acids, in order to achieve the balance between the amino acid metabolic pathway and bacterial growth, it is necessary to use promoters with different strengths for different genes in the corresponding amino acid metabolic pathway.

Summary of the Invention

[0003] An object of the present invention is to provide an EP6 promoter that can be used for producing amino acids.

[0004] The sequence of the EP6 promoter according to the present invention is SEQ ID No.3 in the sequence listing.

[0005] The present invention further provides a biological material related to the EP6 promoter, and this biological material is any one of the following B1) to B7): B1) An expression cassette containing the EP6 promoter, B2) A recombinant vector containing the EP6 promoter, B3) A recombinant vector containing the expression cassette described in B1), B4) A recombinant microorganism containing the EP6 promoter, B5) A recombinant microorganism containing the expression cassette described in B1), B6) A recombinant microorganism containing the recombinant vector described in B2), B7) A recombinant microorganism containing the recombinant vector described in B3).

[0006] In the above biological material, the expression cassette containing the EP6 promoter described in B1) is DNA capable of driving the expression of a target gene in a host cell by the EP6 promoter, and this DNA may contain not only the target gene but also a terminator that terminates the transcription of the target gene. Furthermore, the expression cassette may contain an enhancer sequence.

[0007] Using a conventional expression vector, a recombinant vector containing the EP6 promoter can be constructed.

[0008] In the above biological material, the vector may be a plasmid, cosmid, phage or viral vector.

[0009] In the above biological material, the microorganism may be yeast, bacteria, algae or fungi. Here, the bacteria may be Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium krenatum or Pantoea.

[0010] The present invention further provides the use of the EP6 promoter as a promoter.

[0011] The present invention further provides the use of the EP6 promoter in the production of amino acids.

[0012] The present invention further provides the use of the biological material in the production of amino acids.

[0013] In the above use, the amino acid may be lysine, glutamic acid or valine.

[0014] The EP6 promoter of the present invention can be used to produce various products (including, but not limited to, lysine, glutamic acid, and valine in the examples). The products to be produced may further include glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc. When producing each product, the EP6 promoter of the present invention is placed upstream of the gene in the target product synthesis pathway, and the production of the target product can be realized by driving the synthesis of the gene in the target product synthesis pathway by the EP6 promoter.

[0015] The present invention further provides a method for producing an amino acid. This method includes the steps of introducing the EP6 promoter into a biological cell capable of synthesizing the target amino acid, driving the expression of the gene in the target amino acid synthesis pathway of the biological cell by the EP6 promoter to obtain a recombinant biological cell, and culturing the recombinant biological cell to obtain the target amino acid.

[0016] In the above method, the biological cell may be yeast, bacteria, algae, fungi, plant cells, or animal cells capable of synthesizing the target amino acid.

[0017] The biological cell is any biological cell capable of synthesizing the target amino acid.

[0018] The bacteria may be Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium krenatum, or Pantoea.

[0019] In one embodiment of the present invention, the target amino acid is lysine, and the bacterium is Corynebacterium glutamicum CGMCC No. 12856.

[0020] The bacterium used for producing lysine by using the promoter of the present invention includes, but is not limited to, Corynebacterium glutamicum CGMCC No. 12856. The present invention can synthesize lysine by arranging the EP6 promoter of the present invention upstream of the gene in the lysine synthesis pathway of these bacteria and driving the expression of the gene in the lysine synthesis pathway of these bacteria by the EP6 promoter of the present invention.

[0021] In one embodiment of the present invention, the target amino acid is glutamic acid, and the bacterium is Corynebacterium glutamicum CGMCC No. 21220.

[0022] The bacterium used for producing glutamic acid by using the promoter of the present invention includes, but is not limited to, Corynebacterium glutamicum CGMCC No. 21220. The present invention can synthesize glutamic acid by arranging the EP6 promoter of the present invention upstream of the gene in the glutamic acid synthesis pathway of these bacteria and driving the expression of the gene in the glutamic acid synthesis pathway of these bacteria by the EP6 promoter of the present invention.

[0023] In one embodiment of the present invention, the target amino acid is valine, and the bacterium is Corynebacterium glutamicum CGMCC No. 21260.

[0024] The bacteria used for producing valine by using the promoter of the present invention include, but are not limited to, Corynebacterium glutamicum CGMCC No.21260. The present invention can synthesize valine by arranging the EP6 promoter of the present invention upstream of the gene in the valine synthesis pathway of these bacteria and driving the expression of the gene in the valine synthesis pathway of these bacteria by the EP6 promoter of the present invention.

[0025] In the above method, the target amino acid may be lysine, glutamic acid or valine.

[0026] The EP6 promoter of the present invention can be used for producing lysine in the examples and various products (including but not limited to glutamic acid and valine). The products to be produced may further be glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc. When producing each target product, the EP6 promoter of the present invention can be arranged upstream of the gene in the target product synthesis pathway, and the production of the target product can be realized by driving the synthesis of the gene in the target product synthesis pathway by the EP6 promoter.

[0027] In one embodiment of the present invention, the target amino acid is lysine, the bacterium is Corynebacterium glutamicum CGMCC No.12856, and the gene in the lysine synthesis pathway is the lysA gene (positions 149 to 1486 of SEQ ID No.4).

[0028] The recombinant biological cell is realized by replacing the original promoter of the lysA gene in Corynebacterium glutamicum CGMCC No. 12856 with the EP6 promoter.

[0029] In one embodiment of the present invention, the target amino acid is glutamic acid, the bacterium is Corynebacterium glutamicum CGMCC No. 21220, and the gene in the glutamic acid synthesis pathway is the BBD29_14295 gene (positions 37 to 1161 of SEQ ID No. 11).

[0030] The recombinant biological cell is realized by replacing the original promoter of the BBD29_14295 gene in Corynebacterium glutamicum CGMCC No. 21220 with the EP6 promoter.

[0031] In one embodiment of the present invention, the target amino acid is valine, the bacterium is Corynebacterium glutamicum CGMCC No. 21260, and the gene in the valine synthesis pathway is the ilvC gene (positions 180 to 1196 of SEQ ID No. 18).

[0032] The recombinant biological cell is realized by replacing the original promoter of the ilvC gene in Corynebacterium glutamicum CGMCC No. 21260 with the EP6 promoter.

[0033] The present invention further provides a product for producing an amino acid, and the active ingredient of the product is the EP6 promoter or a biological material.

[0034] Deposit Information of Biological Materials Classification Name: Corynebacterium glutamicum Strain Number: YPGLU001 Name of the Depository Institution: China General Microbiological Culture Collection Center Abbreviation of the Depository Institution: CGMCC Address of the Depository Institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Zip Code: 100101 Date of Deposit: November 23, 2020 Registration Number of the Depositary Center: CGMCC No.21220

[0035] Deposit Information of Biological Materials Classification Name: Corynebacterium glutamicum Strain Number: YPFV1 Name of the Depository Institution: China General Microbiological Culture Collection Center Abbreviation of the Depository Institution: CGMCC Address of the Depository Institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Zip Code: 100101 Date of Deposit: November 30, 2020 Registration Number of the Depositary Center: CGMCC No.21260

[0036] Deposit Information of Biological Materials Classification Name: Corynebacterium glutamicum Strain Number: YP097158 Name of the Depository Institution: China General Microbiological Culture Collection Center Abbreviation of the Depository Institution: CGMCC Address of the Depository Institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Zip Code: 100101 Date of Deposit: August 16, 2016 Registration Number of the Depositary Center: CGMCC No.12856

Brief Description of the Drawings

[0037]

Figure 1

Mode for Carrying Out the Invention

[0038] Hereinafter, the present invention will be described in detail with specific embodiments. However, the shown examples are only for explaining the present invention and do not limit the scope of the present invention. The examples provided below can be used as a guide for those skilled in the art to make further improvements, but do not limit the present invention in any way.

[0039] In the following examples, the experimental methods are all ordinary methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature of this field or according to the product handling manuals. Materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. In the quantitative experiments in the following examples, three repeated experiments are set up in each case, and the average value is taken as the result. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0040] pEC-H10-mCherry vector: It is described in the Chinese patent application (publication number CN112980867A) with application number 202110256579.8. The preparation method thereof uses the strongest promoter H10 (GCTCAACCCTTACCGGTCGGCTCTAAGCCGGCGGCGTATGGTAAGCTCTGTTATGTATAGTCCGAGCACGGCGAAAGGATACTC (SEQ ID No. 25)) of Corynebacterium glutamicum reported by Wei et al. (Promoter library-based module combination (PLMC) technology for optimization of threonine biosynthesis in Corynebacterium glutamicum. Applied Microbiology and Biotechnology. 2018(102)4117-4130.) as a template, and designs and synthesizes primers for constructing the pEC-H10-mCherry vector using the gene sequence of the mCherry protein and the sequence of the expression vector pEC-XK99E of Corynebacterium glutamicum. The primers were designed as follows (synthesized by Guangzhou Genewiz Co., Ltd.).

[0041] Primer 1: 5’-GGATCTAGAGTCGACCTGCAG-3’ (SEQ ID No. 26) Primer 2: 5’-TTAACTAGTATTGCGTTGCGCTCAC-3’ (SEQ ID No. 27) Primer 3: 5’-CAATACTAGTTAATGTGAGTTAGCGCG-3’ (SEQ ID No. 28) Primer 4: 5’-AGAGCTTACCATACGCCGCCGGCTTAGAGCCGACCGGTAAGGGTTGAGCCTAGAGGATCCCCGGGTAC-3’ (SEQ ID No. 29) Primer 5: 5’-GCGTATGGTAAGCTCTGTTATGTTATGTATAGTCCGAGCACGGCGAAAGGATACTCATGCGTAAAGGAGAAGAAG-3’ (SEQ ID No. 30) Primer 6: 5’-CGACTCTAGATCCGCCAAACAGCC-3’ (SEQ ID No. 31)

[0042] Construction method: Using pEC-XK99E as a template, the backbone region (6743 bp) of the pEC plasmid was amplified using Primer 1 and Primer 2. Using the promoter H10 as a template, a fragment (387 bp) containing the upstream region of the H10 promoter was amplified using Primer 3 and Primer 4. Using the plasmid pBblactam containing the mCherry gene (Zhang et al., Development of a transcription factor based lactam biosensor. ACS synthetic biology. 2017, 6, 439 - 445.) as a template, a fragment (810 bp) containing the downstream region of the H10 promoter and the mCherry gene was amplified using Primer 5 and Primer 6.

[0043] After the PCR amplification was completed, bands with lengths of 387 bp, 810 bp, and 6743 bp were obtained respectively. After separating and recovering each of the above three bands by agarose gel electrophoresis, using the DNA fragments of the 387 bp and 810 bp bands as templates, fusion PCR amplification was performed using Primer 3 and Primer 6. The obtained PCR amplification fragment was separated and recovered by gel electrophoresis. Then, the recovered fragment (fragment containing H10 and mCherry) and the pEC backbone fragment were each enzymatically cleaved (SpeI, XbaI). After enzymatic cleavage, the fragments were purified by column. The pEC backbone fragment and the fragment containing H10 and mCherry were mixed at a molar ratio of 1:2, and after adding the T4 DNA ligase reaction solution and ligating at 16°C for 1 hour, the fragment was introduced into Escherichia coli DH5α strain. The recombinant vector having the correct sequence is the pEC-H10-mCherry vector.

[0044] pk18 vector: Addgene, product number MLCC1103.

[0045] Corynebacterium glutamicum CGMCC No. 12856 in the following examples has a strain number of YP097158 and was deposited with the China General Microbiological Culture Collection Center on August 16, 2016. The deposit number is CGMCC No. 12856.

[0046] Corynebacterium glutamicum CGMCC No. 21220 in the following examples has a strain number of YPGLU001 and was deposited with the China General Microbiological Culture Collection Center on November 23, 2020. The deposit number is CGMCC No. 21220.

[0047] Corynebacterium glutamicum CGMCC No. 21260 in the following examples has a strain number of YPFV1 and was deposited with the China General Microbiological Culture Collection Center on November 30, 2020. The deposit number is CGMCC No. 21260.

[0048] Example 1: EP6 has promoter activity. I. Construction of the pEC-PyfjB-mCherry vector that initiates mCherry expression with the strong Escherichia coli promoter PyfjB Using the pEC-H10-mCherry vector as the backbone, the pEC-PyfjB-mCherry vector containing the yfjB promoter (SEQ ID No.1: gaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaaaa) of Escherichia coli W3110 was constructed using NEBuilder recombination technology. Based on the expression of the reporter protein mCherry, the promoter strength of PyfjB was detected and used as a control for subsequent mutant promoter sequences. The primer sequences are as follows (synthesized by Shanghai Invitrogen).

[0049] pEC01: 5’-ATGCGTAAAGGAGAAGAAGATAAC-3’ (SEQ ID No.32) pEC02: 5’-CTAGAGGATCCCCGGGTAC-3’ (SEQ ID No.33) P1: 5’- CATGGAATTCGAGCTCGGTACCCGGGGATCCTCTAG GAATTTCTCCGCGTTTTTTT-3’ (SEQ ID No.34) P2: 5’- AATGATAGCCATGTTATCTTCTTCTCCTTTACGCAT TTTTCCGAGGTCCTTGTTGC-3’ (SEQ ID No.35)

[0050] Construction method: Using the pEC-H10-mCherry vector as a template, the 7772bp backbone region of the pEC-H10-mCherry vector was amplified using primers pEC01 and pEC02. Using the DNA fragment shown in SEQ ID No.1 as a template, a 194bp fragment of the yfjB promoter (abbreviated as PyfjB) containing the homology arm of the pEC-H10-mCherry vector was amplified using primers P1 and P2.

[0051] The above two DNA fragments (the backbone region of the pEC-H10-mCherry vector and the PyfjB fragment containing the homology arm of the pEC-H10-mCherry vector) were separated and purified by agarose gel electrophoresis, ligated at 50 °C for 30 minutes using NEBuilder enzyme (NEB), and the ligation product was transformed into Escherichia coli DH5α and grown. The single clone was identified with primers pECF / R (pECF: 5’-GTACCCGGGGATCCTCTAG-3’ (SEQ ID No.36), pECR: 5’-GTTATCTTCTTCTCCTTTACGCAT-3’ (SEQ ID No.37)), the plasmid was extracted to obtain a positive recombinant vector with the correct sequence, which was designated as pEC-PyfjB-mCherry.

[0052] The sequence of the recombinant vector pEC-PyfjB-mCherry is SEQ ID No.2 in the Sequence Listing. Here, the yfjB promoter initiates the expression of the reporter gene mCherry. The fluorescence value of mCherry was measured to obtain the strength of the yfjB promoter.

[0053] II. Construction of the mutant yfjB promoter expression vector pEC-EP6-mCherry PyfjB shown in SEQ ID No.1 was mutated to obtain an EP6 promoter with a size of 124 bp. The sequence of the EP6 promoter is SEQ ID No.3.

[0054] The vector was constructed using NEBuilder recombination technology, and the primers were designed as follows (synthesized by Shanghai invitrogen company). P5: 5’- CATGGAATTCGAGCTCGGTACCCGGGGATCCTCTAG GAATTTCTTCGCGTTTTTTT-3’ (SEQ ID No.38) P6: 5’- AATGATAGCCATGTTATCTTCTTCTCCTTTACGCAT GATTTGGAGGTCCCTGCGTT-3’ (SEQ ID No.39)

[0055] Construction method: Using the pEC-PyfjB-mCherry vector as a template, the 7772 bp backbone region of the pEC-H10-mCherry vector was amplified using primers pEC01 and pEC02. Using the DNA fragment shown in SEQ ID No. 3 as a template, a 196 bp EP6 promoter fragment containing the homology arm of the pEC-H10-mCherry vector was amplified using primers P5 and P6.

[0056] The above two DNA fragments (the backbone region of the pEC-H10-mCherry vector and the EP6 promoter fragment containing the homology arm of the pEC-H10-mCherry vector) were separated and purified by agarose gel electrophoresis, ligated at 50°C for 30 minutes using NEBuilder enzyme (NEB), and the ligation product was transformed into E. coli DH5α and the grown single clones were identified using primers pECF / R (pECF: 5’-GTACCCGGGGATCCTCTAG-3’ (SEQ ID No. 36), pECR: 5’-GTTATCTTCTTCTCCTTTACGCAT-3’ (SEQ ID No. 37)). The plasmid was extracted to obtain a positive recombinant vector with the correct sequence, designated as pEC-EP6-mCherry.

[0057] pEC-EP6-mCherry is a recombinant vector obtained by replacing PyfjB (SEQ ID No. 1) of pEC-PyfjB-mCherry with EP6 (SEQ ID No. 3).

[0058] III. Measurement of promoter activity The pEC-EP6-mCherry vector in Step 2 and the pEC-PyfjB-mCherry vector in Step 1 were respectively introduced into wild-type Corynebacterium glutamicum ATCC13032 to obtain recombinant bacteria ATCC13032 / pEC-EP6-mCherry and ATCC13032 / pEC-PyfjB-mCherry. The pEC-EP6-mCherry vector in Step 2 and the pEC-PyfjB-mCherry vector in Step 1 were respectively introduced into wild-type Corynebacterium glutamicum ATCC13869 to obtain recombinant bacteria ATCC13869 / pEC-EP6-mCherry and ATCC13869 / pEC-PyfjB-mCherry. The pEC-EP6-mCherry vector in Step 2 and the pEC-PyfjB-mCherry vector in Step 1 were respectively introduced into wild-type Corynebacterium glutamicum ATCC14067 to obtain recombinant bacteria ATCC14067 / pEC-EP6-mCherry and ATCC14067 / pEC-PyfjB-mCherry. The promoter strengths of these two promoters in Corynebacterium glutamicum were compared.

[0059] Single clones of the above six recombinant bacteria were selected and inoculated in equal amounts into 96-deep well plates containing 900 μL of LBHIS medium. Each single clone contained three replicates and was cultured at 30 °C and 800 rpm for 24 hours. Then, a microplate reader was used to measure the fluorescence value of mCherry, and the activities of the yfjB and EP6 promoters were compared based on the fluorescence intensity.

[0060] LBHIS medium: 5 g of Tryptone / L, 5 g of NaCl / L, 2.5 g of yeast extract / L, 18.5 g of BHI (Brain Heart Infusion) / L, 91 g of sorbitol / L, pH 7.2.

[0061] As a result, it was shown that the EP6 promoter has promoter activity, and its promoter activity is significantly higher than that of the yfjB promoter (Figure 1).

[0062] Example 2: Substitution of the promoter of the lysA gene in the lysine metabolic pathway in Corynebacterium glutamicum and its effect on lysine production I. Preparation of recombinant bacteria Using the pk18 vector, by replacing the original promoter (positions 1 to 148 of SEQ ID No. 4) of the important gene lysA in the lysine metabolic pathway of Corynebacterium glutamicum CGMCC No. 12856 with high lysine productivity with the EP6 and yfjB promoters respectively by homologous recombination method, the expression of lysA in the lysine metabolic pathway was initiated using an exogenous promoter, and lysine-producing bacteria combining the exogenous promoter and the gene were obtained. Through the fermentation test of these producing bacteria, it was revealed that the strain starting lysA with EP6 can further increase the production amount of lysine, and this strain was named YPL-4-042. Positions 149 to 1486 of SEQ ID No. 4 are the sequence of lysA.

[0063] The vector was constructed using NEBuilder recombination technology, and the primers were designed as follows (synthesized by Shanghai invitrogen company). P7: 5’- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CCCAGGTGAAGAAGTCGTTG-3’ (SEQ ID No. 40) P8: 5’-AAAAAAACGCGGAGAAATTCATGCCCCGTTCGACAATAAA-3’ (SEQ ID No. 41) P9: 5’-TTTATTGTCGAACGGGGCATGAATTTCTCCGCGTTTTTTT-3’ (SEQ ID No. 42) P10: 5’-GCGAGATCAGCTGGTGTCATTTTTCCGAGGTCCTTGTTGC-3’ (SEQ ID No. 43) P11: 5’-GCAACAAGGACCTCGGAAAAATGACACCAGCTGATCTCGC-3’ (SEQ ID No.44) P12: 5’- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TCGAACATCATCTCCACGCC-3’ (SEQ ID No.45) P8E: 5’-AAAAAAACGCGAAGAAATTCATGCCCCGTTCGACAATAAA-3’ (SEQ ID No.46) P9E: 5’-TTTATTGTCGAACGGGGCATGAATTTCTTCGCGTTTTTTT-3’ (SEQ ID No.47) P10E: 5’-GCGAGATCAGCTGGTGTCATGATTTGGAGGTCCCTGCGTT-3’ (SEQ ID No.48) P11E: 5’-AACGCAGGGACCTCCAAATCATGACACCAGCTGATCTCGC-3’ (SEQ ID No.49)

[0064] The specific method of homologous recombination is as follows. Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P7 / P8 (the sequence of the PCR product is positions 1 to 801 of SEQ ID No.5) to obtain an 801bp upstream homologous arm fragment. Using the pEC-PyfjB-mCherry vector as a template, PCR amplification was performed using primers P9 / P10 to obtain 162bp of PyfjB (the sequence of the PCR product is positions 762 to 923 of SEQ ID No.5). Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P11 / P12 (the sequence of the PCR product is positions 884 to 1648 of SEQ ID No.5) to obtain a 765bp downstream homologous arm fragment.

[0065] After the PCR reaction, the three obtained PCR products were each recovered by electrophoresis using a column-type DNA gel recovery kit. The three recovered PCR products were digested with XbaI and BamHI and ligated with the purified pK18mobsacB vector (Addgene, containing kanamycin resistance as a selectable marker) and NEBuilder enzyme (NEB) at 50 °C for 30 minutes. The ligation product was transformed into Escherichia coli DH5α, and the single clones grown were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID No.50), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID No.51)) to obtain a positive integration vector (recombinant vector). The recombinant vector with the correct sequence was extracted and designated as pK18-PyfjB-lysAOE. Since this recombinant vector contains a kanamycin resistance marker, recombinants in which the vector has been integrated into the genome can be obtained by kanamycin screening.

[0066] pK18-PyfjB-lysAOE contains the DNA fragment shown in SEQ ID No.5. In SEQ ID No.5, positions 1 to 801 are the sequence of the upstream homology arm fragment, positions 884 to 1648 are the sequence of the downstream homology arm fragment, and positions 762 to 923 are the sequence of PyfjB.

[0067] Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P7 / P8E (positions 1 to 801 of SEQ ID No.6) to obtain an 801 bp upstream homology arm fragment. Using pEC-EP6-mCherry as a template, PCR amplification was performed using P9E / P10E to obtain 164 bp of EP6 (positions 762 to 925 of SEQ ID No.6). Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P11E / P12 (positions 886 to 1650 of SEQ ID No.6) to obtain a 765 bp downstream homology arm fragment.

[0068] After the PCR reaction was completed, the three resulting PCR products were each recovered by electrophoresis using a column-type DNA gel recovery kit. The three recovered PCR products were digested with XbaI and BamHI and ligated with the purified pK18mobsacB vector (Addgene, containing kanamycin resistance as a selectable marker) and NEBuilder enzyme (NEB) at 50°C for 30 minutes. The ligation product was transformed into Escherichia coli DH5α, and single clones that grew were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID No.50), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID No.51)) to obtain a positive integration vector (recombinant vector). A recombinant vector with the correct sequence was extracted and designated pK18-EP6-lysAOE. Since this recombinant vector contains a kanamycin resistance marker, recombinants in which the vector has been integrated into the genome can be obtained by kanamycin screening.

[0069] pK18-EP6-lysAOE contains the DNA fragment shown in SEQ ID No.6. In SEQ ID No.6, positions 1 to 801 are the sequence of the upstream homology arm fragment, positions 886 to 1650 are the sequence of the downstream homology arm fragment, and positions 762 to 925 are the sequence of EP6.

[0070] The recombinant vectors pK18-PyfjB-lysAOE and pK18-EP6-lysAOE with the correct sequences were respectively electrotransformed into Corynebacterium glutamicum CGMCC No.12856 with high lysine productivity, cultured in a recovery medium according to the recovery culture conditions, and the cultured single colonies were identified by PCR with primers P13 / P14. Those with an 885-bp (SEQ ID No.7) fragment amplified by PCR for the recombinant bacterium introduced with pK18-PyfjB-lysAOE were positive strains, designated as CGMCC No.12856 / pK18-PyfjB-lysAOE. Those with an 885-bp (SEQ ID No.8) fragment amplified by PCR for the recombinant bacterium introduced with pK18-EP6-lysAOE were positive strains, designated as CGMCC No.12856 / pK18-EP6-lysAOE. Those from which no fragment was obtained by amplification were the original bacteria.

[0071] The positive strains were cultured in a medium containing 15% sucrose, and the cultured single colonies were further identified by PCR with primers P15 / P16. Strains with an 841-bp (SEQ ID No.9) fragment amplified were positive strains in which the original promoter of lysA of Corynebacterium glutamicum CGMCC No.12856 with high lysine productivity was replaced by PyfjB. Strains with an 843-bp (SEQ ID No.10) fragment amplified were positive strains in which the original promoter of lysA of Corynebacterium glutamicum CGMCC No.12856 with high lysine productivity was replaced by EP6. Those from which no fragment was obtained by amplification were the original bacteria.

[0072] The positive strains obtained from the recombinant bacteria introduced with pK18-PyfjB-lysAOE and pK18-EP6-lysAOE were respectively named YPL-4-041 (PyfjB-lysA integrated strain) and YPL-4-042 (EP6-lysA integrated strain).

[0073] YPL-4-041 (PyfjB-lysA integrated strain) is a recombinant bacterium obtained by replacing the original promoter of lysA (positions 1 to 148 of SEQ ID No. 4) in Corynebacterium glutamicum CGMCC No. 12856 with high lysine productivity with the yfjB promoter without changing other nucleotides in its genome, and can improve the lysine production. YPL-4-042 (EP6-lysA integrated strain) is a recombinant bacterium obtained by replacing the original promoter of lysA (positions 1 to 148 of SEQ ID No. 4) in Corynebacterium glutamicum CGMCC No. 12856 with high lysine productivity with the EP6 promoter without changing other nucleotides in its genome. The EP6 promoter starts the expression of lysA as a mutated yfjB promoter and can further improve the lysine production.

[0074] The PCR identification primers are as follows. P13: 5’-GGCGACGATCTTGTTTGACC-3’ (inside the cg1332 gene) (SEQ ID No. 52) P14: 5’-ACTGATCCCCATAATAAGCG-3’ (inside PyfjB) (SEQ ID No. 53) P15: 5’-CGCTTATTATGGGGATCAGT-3’ (inside PyfjB) (SEQ ID No. 54) P16: 5’-GTAGTAGACATCGAAATCGG-3’ (inside the argS gene) (SEQ ID No. 55)

[0075] Recovery medium: The solvent is water, and the solutes and their contents in the recovery medium are respectively, glucose 5 g / L, urea 3 g / L, yeast powder 10 g / L, biotin 10 μg / L, soybean meal powder 15 g / L, succinic acid 0.5 g / L, potassium dihydrogen phosphate 1 g / L, sodium chloride 2.5 g / L, sorbitol 91 g / L, brain heart infusion 18.5 g / L, and the pH is 7.0.

[0076] 15% Sucrose-containing Medium: The solvent is water, and the solutes and their contents in the 15% sucrose-containing medium are sucrose 15 g / L, urea 3 g / L, yeast powder 10 g / L, biotin 10 μg / L, soybean meal powder 15 g / L, succinic acid 0.5 g / L, potassium dihydrogen phosphate 1 g / L, sodium chloride 2.5 g / L, sorbitol 91 g / L, brain heart infusion 18.5 g / L, agar powder 15 g / L, and the pH is 7.0.

[0077] Recovery Culture Conditions: Resuspend the cells in the recovery medium at 46°C, transfer them to an EP tube, culture them at 220 rpm for 45 - 60 minutes in a shaker at 37°C, and then transfer them to a shaker at 30°C and culture at 220 rpm for 45 - 60 minutes.

[0078] II. Fermentation Experiment of L-Lysine The above-mentioned strains YPL-4-041, YPL-4-042 and the original strain Corynebacterium glutamicum CGMCC No.12856 were subjected to fermentation experiments in a fermentation tank of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) under fermentation medium 1 and culture conditions 1, and the L-lysine production was measured after the fermentation was completed. Each strain was repeated 3 times. The production of L-lysine was measured by high performance liquid chromatography.

[0079] Fermentation Medium 1: The solvent is water, and the solutes and their contents in the fermentation medium 1 are starch hydrolyzate 30 g / L, ammonium sulfate 12 g / L, magnesium sulfate 0.87 g / L, molasses 20 g / L, acidic corn steep liquor 3 mL / L, phosphoric acid 0.4 mL / L, potassium chloride 0.53 g / L, antifoaming agent (2% GPE type antifoaming agent) 4 mL / L, ferrous sulfate 120 mg / L, manganese sulfate 120 mg / L, nicotinamide 42 mg / L, calcium pantothenate 6.3 mg / L, vitamin B1 6.3 mg / L, copper sulfate 0.6 g / L, zinc sulfate 0.6 g / L, biotin 0.88 mg / L. The acidic corn steep liquor is a product of Ningxia Yipin Biotechnology Co., Ltd.

[0080] Culture Conditions 1: Calibration: DO 100%, temperature 37°C, air volume 4 L / min, rotation speed 1000 rpm, tank pressure 0 Mpa, calibrate after 5 min Inoculation amount: 10% Cultivation temperature: 37°C pH: 6.9 ± 0.05 Dissolved oxygen DO: 10 - 30% Initial conditions: temperature 37°C, pH 6.9, tank pressure 0 Mpa, air volume 3 L / min, rotation speed 550 rpm Overall process control: 1. Overall process control 1. When the dissolved oxygen is less than 30%, the rotation speed increases sequentially as 750 rpm → 800 rpm → air volume 4 L / min → 850 rpm → 950 rpm; 2. After 6 h of fermentation, the tank pressure is increased to 0.01 Mpa, and after 12 h, the tank pressure is increased to 0.02 Mpa → 0.03 Mpa → 0.04 Mpa → 0.05 Mpa Residual sugar control: Before F12 h, it is 0.1 - 0.2%, and after F12 h, the residual sugar is controlled to 0.1 - 0.05% according to the DO requirement Control of ammoniacal nitrogen: Before F12 h, it is 0.1 - 0.15, from F12 to F32 h, it is 0.15 - 0.25, and after F32 h, it is 0.1 - 0.15 Feed materials: 25% aqueous ammonia, 70% concentrated sugar, 50% ammonium sulfate, 10% GPE - type antifoaming agent Fermentation cycle: about 48 h

[0081] As a result, the L - lysine production of strain CGMCC No.12856 was 18.9 g / 100 mL, the L - lysine production of YPL - 4 - 041 was 19.2 g / 100 mL, which was significantly higher than that of strain CGMCC No.12856 (P < 0.05), the L - lysine production of YPL - 4 - 042 was 19.7 g / 100 mL, which was also significantly higher than that of strain CGMCC No.12856 (P < 0.05). Thus, by replacing the original promoter of lysA with the yfjB or EP6 promoter in the lysine - producing bacterium CGMCC No.12856, the lysine production can be increased. It is clear that when the expression of lysA is initiated by the mutated EP6, the lysine production will be even higher.

[0082] Example 3: Increase of the promoter of the BBD29_14295 gene in the glutamate metabolic pathway in Corynebacterium glutamicum and its effect on glutamate production I. Preparation of recombinant bacteria Using the pk18 vector, by replacing the original promoter (positions 1 to 36 of SEQ ID No. 11) of the important gene BBD29_14295 in the glutamate metabolic pathway of Corynebacterium glutamicum CGMCC No. 21220 with high glutamate productivity with the EP6 and yfjB promoters respectively by homologous recombination method, the expression of BBD29_14295 in the glutamate metabolic pathway was initiated using exogenous promoters, and glutamate-producing bacteria combined with exogenous promoters and genes were obtained. Through the fermentation tests of these producing bacteria, it was revealed that the strain starting BBD29_14295 with EP6 could further increase the production of glutamate, and this strain was named YPG-092. Positions 37 to 1161 of SEQ ID No. 11 are the sequence of BBD29_14295.

[0083] The vector was constructed using NEBuilder recombination technology, and the primers were designed as follows (synthesized by Shanghai invitrogen company). P17: 5’- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGGAAACAACGCAGCCATAG-3’ (SEQ ID No. 56) P18: 5’-AAAAAAACGCGGAGAAATTCTTAGAGGAATTTAACGCCTT-3’ (SEQ ID No. 57) P19: 5’-AAGGCGTTAAATTCCTCTAAGAATTTCTCCGCGTTTTTTT-3’ (SEQ ID No. 58) P20: 5’-TCGTCGATTAGCTCGAACATTTTTCCGAGGTCCTTGTTGC-3’ (SEQ ID No. 59) P21: 5’-GCAACAAGGACCTCGGAAAAATGTTCGAGCTAATCGACGA-3’ (SEQ ID No. 60) P22: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ATGACGTCCTGGAGCGCTGC-3'(SEQ ID No.61) P18E: 5'-AAAAAAACGCGAAGAAATTCTTAGAGGAATTTAACGCCTT-3'(SEQ ID No.62) P19E: 5'-AAGGCGTTAAATTCCTCTAAGAATTTCTTCGCGTTTTTTT-3'(SEQ ID No.63) P20E: 5'-TCGTCGATTAGCTCGAACATGATTTGGAGGTCCCTGCGTT-3'(SEQ ID No.64) P21E: 5'-AACGCAGGGACCTCCAAATCATGTTCGAGCTAATCGACGA-3'(SEQ ID No.65)

[0084] The specific method of homologous recombination is as follows. Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification was performed with primers P17 / P18 (positions 1 to 792 of SEQ ID No.12) to obtain an upstream homologous arm fragment of 792 bp. Using the pEC-PyfjB-mCherry vector as a template, PCR amplification was performed with primers P19 / P20 to obtain PyfjB 162 bp (positions 753 to 914 of SEQ ID No.12). Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification was performed with primers P21 / P22 (positions 875 to 1699 of SEQ ID No.12) to obtain a downstream homologous arm fragment of 825 bp.

[0085] After the PCR reaction, the three obtained PCR products were each recovered by electrophoresis using a column-type DNA gel recovery kit. The three recovered PCR products were digested with XbaI and BamHI and ligated with the purified pK18mobsacB vector (Addgene, containing kanamycin resistance as a selection marker) and NEBuilder enzyme (NEB) at 50 °C for 30 minutes. The ligation product was transformed into Escherichia coli DH5α, and the single clones that grew were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID No.50), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID No.51)) to obtain a positive integration vector (recombinant vector). The recombinant vector having the obtained correct sequence was designated as pK18-PyfjB-BBD29_14295OE. Since this recombinant vector contains a kanamycin resistance marker, recombinants in which the vector has been integrated into the genome can be obtained by kanamycin screening.

[0086] pK18-PyfjB-BBD29_14295OE contains the DNA fragment shown in SEQ ID No.12. In SEQ ID No.12, positions 1 to 792 are the sequence of the upstream homology arm fragment, positions 875 to 1699 are the sequence of the downstream homology arm fragment, and positions 753 to 914 are the sequence of PyfjB.

[0087] Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification was performed using primers P17 / P18E (positions 1 to 792 of SEQ ID No. 13) to obtain an upstream homologous arm fragment of 792 bp. Using the pEC-EP6-mCherry vector as a template, PCR amplification was performed using P19E / P20E to obtain EP6 of 164 bp (positions 753 to 916 of SEQ ID No. 13). Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification was performed using primers P21E / P22 (positions 877 to 1701 of SEQ ID No. 13) to obtain a downstream homologous arm fragment of 825 bp.

[0088] After the PCR reaction, the three obtained PCR products were each recovered by electrophoresis using a column-type DNA gel recovery kit. The three recovered PCR products were digested with XbaI and BamHI and ligated with the purified pK18mobsacB vector (Addgene, containing kanamycin resistance as a selection marker) and NEBuilder enzyme (NEB) at 50°C for 30 minutes. The ligation product was transformed into Escherichia coli DH5α, and the single clones grown were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID No. 50), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID No. 51)) to obtain a positive integration vector (recombinant vector). The recombinant vector having the obtained correct sequence was designated as pK18-EP6-BBD29_14295OE. Since this recombinant vector contains a kanamycin resistance marker, recombinants in which the vector has been integrated into the genome can be obtained by kanamycin screening.

[0089] pK18 - EP6 - BBD29_14295OE contains the DNA fragment shown in SEQ ID No. 13. In SEQ ID No. 13, positions 1 to 792 are the sequence of the upstream homology arm fragment, positions 877 to 1701 are the sequence of the downstream homology arm fragment, and positions 753 to 916 are the sequence of EP6.

[0090] The recombinant vectors (pK18 - PyfjB - BBD29_14295OE, pK18 - EP6 - BBD29_14295OE) with the correct sequences were respectively electrotransformed into Corynebacterium glutamicum CGMCC No. 21220 with high glutamate productivity, cultured in a recovery medium (the same as in Example 2) according to the recovery culture conditions (the same as in Example 2), and the cultured single colonies were identified by PCR with P23 / P24 primers. Those with an 849 - bp (SEQ ID No. 14) fragment amplified by PCR for the PyfjB - BBD29_14295 - integrated bacteria are positive strains, those with an 849 - bp (SEQ ID No. 15) fragment amplified by PCR for the EP6 - BBD29_14295 - integrated bacteria are positive strains, and those without a fragment obtained by amplification are the original bacteria.

[0091] The positive strains were cultured in a medium containing 15% sucrose (the same as the 15% sucrose - containing medium in Example 2), and the cultured single colonies were further identified by PCR with P25 / P26 primers. Strains with an 889 - bp (SEQ ID No. 16) fragment amplified are strains in which the original promoter of BBD29_14295 in the genome of Corynebacterium glutamicum CGMCC No. 21220 with high glutamate productivity was replaced with PyfjB, strains with an 891 - bp (SEQ ID No. 17) fragment amplified are strains in which the original promoter of BBD29_14295 in the genome of Corynebacterium glutamicum CGMCC No. 21220 with high glutamate productivity was replaced with EP6, and those without a fragment obtained by amplification are the original bacteria.

[0092] The recombinant strain with the original promoter of BBD29_14295 replaced by PyfjB was named YPG-091 (PyfjB-BBD29_14295 integrated strain), and the recombinant strain with the original promoter of BBD29_14295 replaced by EP6 was named YPG-092 (EP6-BBD29_14295 integrated strain).

[0093] YPG-091 (PyfjB-BBD29_14295 integrated strain) is a recombinant bacterium obtained by replacing the original promoter (the 1st to 36th positions of SEQ ID No.11) of BBD29_14295 in Corynebacterium glutamicum CGMCC No.21220 with high glutamic acid productivity with PyfjB without changing other nucleotides in its genome, and it can improve the production amount of glutamic acid. YPG-092 (EP6-BBD29_14295 integrated strain) is a recombinant bacterium obtained by replacing the original promoter (the 1st to 36th positions of SEQ ID No.11) of BBD29_14295 in Corynebacterium glutamicum CGMCC No.21220 with high glutamic acid productivity with EP6 without changing other nucleotides in its genome. The EP6 promoter starts the expression of BBD29_14295 as a mutated yfjB promoter and can further improve the production amount of glutamic acid.

[0094] The PCR identification primers are as follows. P23: 5’-GAAGTAGGTCCTCGTGTTGC-3’ (inside the BBD29_14290 gene) (SEQ ID No.66) P24: 5’-ACTGATCCCCATAATAAGCG-3’ (inside PyfjB) (SEQ ID No.67) P25: 5’-CGCTTATTATGGGGATCAGT-3’ (inside PyfjB) (SEQ ID No.68) P26: 5’-GACGAGTTGTGCTTGTAGTC-3’ (inside the BBD29_14295 gene) (SEQ ID No.69)

[0095] II. Fermentation experiment of L-glutamic acid The above strains YPG-091, YPG-092 and the original strain CGMCC No.21220 were subjected to fermentation experiments in a fermentation tank of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) with fermentation medium 2 and culture conditions 2. After the fermentation was completed, the L-glutamic acid production and OD value were measured. Each strain was repeated 3 times. The glutamic acid production was measured by a biosensor.

[0096] Fermentation medium 2: The solvent is water, and the solutes and their concentrations in the fermentation medium 2 are glucose 5.0 g / L, phosphoric acid 0.38 g / L, magnesium sulfate 1.85 g / L, potassium chloride 1.6 g / L, biotin 550 μg / L, vitamin B1 300 μg / L, ferrous sulfate 10 mg / L, manganese sulfate 10 g / dl, KH2PO4 2.8 g / L, vitamin C 0.75 mg / L, vitamin B12 2.5 μg / L, para-aminobenzoic acid 0.75 mg / L, antifoaming agent 0.0015 mL / dL, betaine 1.5 g / L, sugarcane molasses 7 mL / L, corn steep liquor 77 mL / L, and aspartic acid 1.7 g / L.

[0097] Culture conditions 2: Calibrated DO 100%, temperature 32.5 °C, air volume 7 L / min, rotation speed 700 rpm, tank pressure 0 Mpa, calibration after 5 min Inoculation amount: 13%, 0 h: rotation speed 400 rpm, air volume 3 L / min, pressure 0.05 MPA, culture temperature 32.5 °C Bacterial liquid concentration OD = 1.0: rotation speed 600 rpm, air volume 5 L / min, pressure 0.08 MPA, culture temperature 37 °C Bacterial liquid concentration OD = 1.0 to bacterial liquid concentration OD = 1.4: rotation speed 700 rpm, air volume 7 L / min, pressure 0.11 MPA, culture temperature 38 °C After culturing for 32 h to 34 h: The fermentation is completed, and in the control process, the dissolved oxygen of 50 to 20% is used as the criterion for increasing or decreasing the air volume. pH: Controlled at 7.0 at 0 h and 6.8 at 14 h. Flow sugar control: The concentration of sugar added to the fermentation tank is controlled at 50 to 55%, and the residual sugar in the fermentation tank is controlled at 0.5 to 1.0%.

[0098] As a result, the L-glutamic acid production of CGMCC No. 21220 was 102.1 g / L, the OD(562 nm) was 46.1, the L-glutamic acid production of YPG-091 was 103.3 g / L, significantly higher than that of strain CGMCC No. 21220 (P<0.05), the OD(562 nm) was 46.6, the L-glutamic acid production of YPG-092 was 105.1 g / L, significantly higher than that of strain CGMCC No. 21220 (P<0.05), and the OD(562 nm) was 47.1. Thus, by replacing the original promoter of BBD29_14295 with the yfjB or EP6 promoter in the glutamic acid-producing bacterium CGMCC No. 21220, the production of glutamic acid can be increased, and it is revealed that when the expression of BBD29_14295 is initiated by the mutated EP6, the glutamic acid production will be even higher.

[0099] Example 4, Increase of the ilvC gene promoter in the valine metabolic pathway in Corynebacterium glutamicum and its effect on valine production I. Preparation of recombinant bacteria Using the pk18 vector, by replacing the original promoter (positions 1 to 179 of SEQ ID No. 18) of the important gene ilvC in the valine metabolic pathway of valine-high-producing Corynebacterium glutamicum CGMCC No. 21260 with the EP6 and yfjB promoters respectively by homologous recombination method, the expression of ilvC in the valine metabolic pathway was initiated using an exogenous promoter, and valine-producing bacteria combining the exogenous promoter and the gene were obtained. Fermentation tests of these producing bacteria revealed that the strain initiating ilvC with EP6 can further increase the production of valine, and this strain was named YPV-098. Positions 180 to 1196 of SEQ ID No. 18 are the sequence of ilvC.

[0100] The vector was constructed using NEBuilder recombination technology, and the primers were designed as follows (synthesized by Shanghai invitrogen company). P27: 5’- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AGAGATCAACGACCGCCCAG-3’ (SEQ ID No.70) P28: 5’-AAAAAAACGCGGAGAAATTCTTAGATCTTGGCCGGAGCCA-3’ (SEQ ID No.71) P29: 5’-TGGCTCCGGCCAAGATCTAAGAATTTCTCCGCGTTTTTTT-3’ (SEQ ID No.72) P30: 5’-TAAAGCAGTTCAATAGCCATTTTTCCGAGGTCCTTGTTGC-3’ (SEQ ID No.73) P31: 5’-GCAACAAGGACCTCGGAAAAATGGCTATTGAACTGCTTTA-3’ (SEQ ID No.74) P32: 5’- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TGAGGCGCTTGGTGAAGGTG-3’ (SEQ ID No.75) P28E: 5’-AAAAAAACGCGAAGAAATTCTTAGATCTTGGCCGGAGCCA-3’ (SEQ ID No.76) P29E: 5’-TGGCTCCGGCCAAGATCTAAGAATTTCTTCGCGTTTTTTT-3’ (SEQ ID No.77) P30E: 5’-TAAAGCAGTTCAATAGCCATGATTTGGAGGTCCCTGCGTT-3’ (SEQ ID No.78) P31E: 5’-AACGCAGGGACCTCCAAATCATGGCTATTGAACTGCTTTA-3’ (SEQ ID No.79)

[0101] The specific method of homologous recombination is as follows. Using Corynebacterium glutamicum ATCC14067 as a template, PCR amplification was performed using primers P27 / P28 (positions 1 to 805 of SEQ ID No. 19), and an 805-bp upstream homology arm fragment was obtained. Using the pEC-PyfjB-mCherry vector as a template, PCR amplification was performed using primers P29 / P30, and 162 bp of PyfjB (positions 766 to 927 of SEQ ID No. 19) was obtained. Using Corynebacterium glutamicum ATCC14067 as a template, PCR amplification was performed using primers P31 / P32 (positions 888 to 1822 of SEQ ID No. 19), and a 935-bp downstream homology arm fragment was obtained.

[0102] After the PCR reaction, the three obtained PCR products were each recovered by electrophoresis using a column-type DNA gel recovery kit. The three recovered PCR products were digested with XbaI and BamHI and ligated with the purified pK18mobsacB vector (Addgene, containing kanamycin resistance as a selection marker) and NEBuilder enzyme (NEB) at 50 °C for 30 minutes. The ligation product was transformed into Escherichia coli DH5α, and the single clones that grew were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID No. 50), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID No. 51)) to obtain a positive integration vector (recombinant vector). The recombinant vector with the correct sequence obtained was designated pK18-PyfjB-ilvCOE. Since this recombinant vector contains a kanamycin resistance marker, recombinants in which the vector has been integrated into the genome can be obtained by kanamycin screening.

[0103] pK18-PyfjB-ilvCOE contains the DNA fragment shown in SEQ ID No. 19. In SEQ ID No. 19, positions 1 to 805 are the sequence of the upstream homology arm fragment, positions 888 to 1822 are the sequence of the downstream homology arm fragment, and positions 766 to 927 are the sequence of PyfjB.

[0104] Using Corynebacterium glutamicum ATCC14067 as a template, PCR amplification was performed using primers P27 / P28E (positions 1 to 805 of SEQ ID No. 20) to obtain an 805-bp upstream homology arm fragment. Using the pEC-EP6-mCherry vector as a template, PCR amplification was performed using P29E / P30E to obtain 164 bp of EP6 (positions 766 to 929 of SEQ ID No. 20). Using Corynebacterium glutamicum ATCC14067 as a template, PCR amplification was performed using primers P31E / P32 (positions 890 to 1824 of SEQ ID No. 20) to obtain a 935-bp downstream homology arm fragment.

[0105] After the PCR reaction, the three obtained PCR products were each recovered by electrophoresis using a column-type DNA gel recovery kit. The three recovered PCR products were digested with XbaI and BamHI and ligated with the purified pK18mobsacB vector (Addgene, containing kanamycin resistance as a selectable marker) and NEBuilder enzyme (NEB) at 50 °C for 30 minutes. The ligation product was transformed into Escherichia coli DH5a, and the single clones grown were identified by PCR using M13 primers (M13F: 5’-TGTAAAACGAGCGGCCAGT-3’ (SEQ ID No. 50), M13R: 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID No. 51)) to obtain a positive integration vector (recombinant vector). The recombinant vector with the correct sequence obtained was designated pK18-EP6-ilvCOE. Since this recombinant vector contains a kanamycin resistance marker, recombinants in which the vector has been integrated into the genome can be obtained by kanamycin screening.

[0106] pK18-EP6-ilvCOE contains the DNA fragment shown in SEQ ID No. 20. In SEQ ID No. 20, positions 1 to 805 are the sequence of the upstream homology arm fragment, positions 890 to 1824 are the sequence of the downstream homology arm fragment, and positions 766 to 929 are the sequence of EP6.

[0107] The integration vectors (pK18-PyfjB-ilvCOE, pK18-EP6-ilvCOE) with the correct sequences were respectively electrotransformed into Corynebacterium glutamicum CGMCC No.21260 with high valine productivity, cultured in a recovery medium (the same as in Example 2) according to the recovery culture conditions (the same as in Example 2), and the cultured single colonies were identified by PCR with P33 / P34 primers. Those with a 901-bp (SEQ ID No.21) fragment of the PyfjB-ilvC integrated bacteria amplified by PCR were positive strains, those with a 901-bp (SEQ ID No.22) fragment of the EP6-ilvC integrated bacteria amplified by PCR were positive strains, and those without a fragment obtained by amplification were the original bacteria.

[0108] The positive strains were cultured in a medium containing 15% sucrose (the same as the 15% sucrose-containing medium in Example 2), and the cultured single colonies were further identified by PCR with P35 / P36 primers. The strain with a 1023-bp (SEQ ID No.23) amplified was a strain in which the original promoter of ilvC in the genome of Corynebacterium glutamicum CGMCC No.21260 with high valine productivity was replaced by PyfjB, the strain with a 1025-bp (SEQ ID No.24) amplified was a strain in which the original promoter of ilvC in the genome of Corynebacterium glutamicum CGMCC No.21260 with high valine productivity was replaced by EP6, and those without a fragment obtained by amplification were the original bacteria.

[0109] The recombinant strain in which the original promoter of ilvC was replaced by PyfjB was named YPV-097 (PyfjB-ilvC integrated strain), and the recombinant strain in which the original promoter of ilvC was replaced by EP6 was named YPV-098 (EP6-ilvC integrated strain).

[0110] YPV-097 (PyfjB-ilvC integrated strain) is a recombinant bacterium obtained by replacing the original promoter of ilvC (positions 1 to 179 of SEQ ID No. 18) of Corynebacterium glutamicum CGMCC No. 21260 with high valine productivity with PyfjB, without changing other nucleotides in its genome, and can improve the production amount of valine. YPV-098 (EP6-ilvC integrated strain) is a recombinant bacterium obtained by replacing the original promoter of ilvC (positions 1 to 179 of SEQ ID No. 18) of Corynebacterium glutamicum CGMCC No. 21260 with high valine productivity with EP6, without changing other nucleotides in its genome. The EP6 promoter starts the expression of ilvC as a mutated yfjB promoter and can further improve the production amount of valine.

[0111] The PCR identification primers are as follows. P33: 5’-CCCGACTTTGTTACCCTTTC-3’ (inside the CEY17_RS06885 gene) (SEQ ID No. 80) P34: 5’-ACTGATCCCCATAATAAGCG-3’ (inside PyfjB) (SEQ ID No. 81) P35: 5’-CGCTTATTATGGGGATCAGT-3’ (inside PyfjB) (SEQ ID No. 82) P36: 5’-GGGTGGTTGTTGTAGGAAGC-3’ (inside the ilvC gene) (SEQ ID No. 83)

[0112] II. Fermentation experiment of valine The above strains YPV-097, YPV-098 and the original strain Corynebacterium glutamicum CGMCC No. 21260 were subjected to fermentation experiments in a BLBIO-5GC-4-H type fermentation tank (Shanghai Bailun Biotechnology Co., Ltd.) with fermentation medium 3 and culture conditions 3. After the fermentation was completed, the production amount of L-valine acid and the OD value were measured. It was repeated 3 times for each strain. The measurement method of the L-lysine production amount is high performance liquid chromatography.

[0113] Fermentation medium 3: The solvent is water, and the solutes and their concentrations are respectively ammonium sulfate 14 g / L, potassium dihydrogen phosphate 1 g / L, dipotassium hydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, yeast powder 2 g / L, ferrous sulfate 18 mg / L, manganese sulfate 4.2 mg / L, biotin 0.02 mg / L, vitamin B1 2 mg / L, antifoam (CB - 442) defoaming agent 0.5 mL / L, 70% glucose (base sugar) 40 g / L.

[0114] Cultivation conditions 3: Calibrated DO 100%, temperature 33°C, air flow rate 1 L / min, rotation speed 400 rpm, tank pressure 0.01 Mpa, calibration after 5 min Inoculation amount 3.5%, cultivation temperature 33°C pH 7.0 ± 0.05, dissolved oxygen DO 10 - 20% Initial conditions: temperature 33°C, pH 7.0, tank pressure 0 MPa, air flow rate 0.1 L / min, rotation speed 400 rpm Overall process control: temperature 33°C, pH 7.0, tank pressure 0 MPa, air flow rate 0.2 L / min, rotation speed 400 rpm Residual sugar control: Before 12 h, it is 0.1 - 0.2%, and after 12 h, the residual sugar is controlled below 0.02% according to the DO requirement. Cultivation maturity criterion: OD 610 30 - 35, OD 610 After OD > 30, stop aeration and let it stand still for 2 h (perform bacterial separation or continuous catalysis according to the purpose of batch experiment). Feed materials: ammonia water, 70% concentrated sugar, 5% GPE - type defoaming agent Fermentation cycle: about 18 - 20 h

[0115] As a result, the L - valine production of Corynebacterium glutamicum CGMCC No.21260 is 84.1 g / L, and OD 610 is 98.2, the L - valine production of YPV - 097 is 85.7 g / L, which is significantly higher than that of strain CGMCC No.21260 (P < 0.05), and OD 610is 99.2, the L-valine production amount of YPV-098 is 87.6 g / L, which is significantly higher than that of strain CGMCC No. 21260 (P<0.05), and OD 610 is shown to be 100.3. Thus, by replacing the original promoter of ilvC with the yfjB or EP6 promoter in the valine-producing bacterium CGMCC No. 21260, the valine production amount can be increased. It is clear that when the expression of ilvC is initiated by the mutated EP6, the valine production amount will be even higher.

[0116] The present invention has been described in detail above. A person skilled in the art can implement the present invention in a wider range without departing from the spirit and scope of the present invention and without performing unnecessary experiments, under the same parameters, concentrations and conditions. Although specific embodiments of the present invention have been shown, it should be understood that further improvements can be made to the present invention. In short, based on the principle of the present invention, this application is intended to include any changes, uses, or improvements to the present invention that depart from the scope disclosed in this application and use conventional techniques known in the art. Some basic features can be applied within the scope of the following appended claims.

[0117] The sequences 1 to 24 according to the above embodiments are as follows. Sequence 1: gaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaaaa Sequence 2: Array 3: Gaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcagtttccgggtttcaagggaagcggacacattgtcactatttcatttaacgcagggacctccaaatc Array 4: Array 5: Array 6: Array 7: Ggcgacgatcttgtttgaccagttttggtacacggctagtggggtagtgccgaggccatacgtgtcgttgttttctgcaacccaggtgaagaagtcgttgagggagtttttgtagccctgttcttgggaggccatgatgccgttccatgccaggctgggcgccattgcggaatcgaggacaaccttgtcggtgtgctgtgggtagcgggtggcgtagaccgatccgaggtaggttccgtaggacagtccgaagatggagatcttgtcatcgccaagtgcttggcggacgcgctcccagtcgttggcggtgttgtcggtggtcaggctggaggtgtagccgggggtgccgatctcgcaggattctttaacgaaagcgccttcgcgggtgagcagcgagaggaaatcgtatcctggtgcgatgttgtcgcagttaaccggtgtggagccgaccattccgcgaggctgcactgcaacgaggtcgtagttttggtacatggcttctggccagttcatggattggctgccgaagaagctataggcatcgccaccagggccaccggagttaccgaagatggtgccgtgcttttcgccttgggcagggaccttgacaaagcccacgctgatatcgccaagtgagggatcagaatagtgcatgggcacgtcgatgctgccacattgagcggaggcaatatctacctgaggtgggcattcttcccagcggatgttttcttgcgctgctgcagtgggcattgataccaaaaaggggctaagcgcagtcgaggcggcaagaactgctactaccctttttattgtcgaacggggcatgaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagt Array 8: Ggcgacgatcttgtttgaccagttttggtacacggctagtggggtagtgccgaggccatacgtgtcgttgttttctgcaacccaggtgaagaagtcgttgagggagtttttgtagccctgttcttgggaggccatgatgccgttccatgccaggctgggcgccattgcggaatcgaggacaaccttgtcggtgtgctgtgggtagcgggtggcgtagaccgatccgaggtaggttccgtaggacagtccgaagatggagatcttgtcatcgccaagtgcttggcggacgcgctcccagtcgttggcggtgttgtcggtggtcaggctggaggtgtagccgggggtgccgatctcgcaggattctttaacgaaagcgccttcgcgggtgagcagcgagaggaaatcgtatcctggtgcgatgttgtcgcagttaaccggtgtggagccgaccattccgcgaggctgcactgcaacgaggtcgtagttttggtacatggcttctggccagttcatggattggctgccgaagaagctataggcatcgccaccagggccaccggagttaccgaagatggtgccgtgcttttcgccttgggcagggaccttgacaaagcccacgctgatatcgccaagtgagggatcagaatagtgcatgggcacgtcgatgctgccacattgagcggaggcaatatctacctgaggtgggcattcttcccagcggatgttttcttgcgctgctgcagtgggcattgataccaaaaaggggctaagcgcagtcgaggcggcaagaactgctactaccctttttattgtcgaacggggcatgaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcagt Sequence 9: Cgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaaaaatgacaccagctgatctcgcaacattgattaaagagaccgcggtagaggttttgacctcccgcgagctcgatacttctgttcttccggagcaggtagttgtggagcgtccgcgtaacccagagcacggcgattacgccaccaacattgcattgcaggtggctaaaaaggtcggtcagaaccctcgggatttggctacctggctggcagaggcattggctgcagatgacgccattgattctgctgaaattgctggcccaggctttttgaacattcgccttgctgcagcagcacagggtgaaattgtggccaagattctggcacagggcgagactttcggaaactccgatcacctttcccacttggacgtgaacctcgagttcgtttctgcaaacccaaccggacctattcaccttggcggaacccgctgggctgccgtgggtgactctttgggtcgtgtgctggaggcttccggcgcgaaagtgacccgcgaatactacttcaacgatcacggtcgccagatcgatcgtttcgctttgtcccttcttgcagcggcgaagggcgagccaacgccagaagacggttatggcggcgaatacattaaggaaattgcggaggcaatcgtcgaaaagcatcctgaagcgttggctttggagcctgccgcaacccaggagcttttccgcgctgaaggcgtggagatgatgttcgagcacatcaaatcttccctgcatgagttcggcaccgatttcgatgtctactac Sequence 10: Cgcttattatggggatcagtttccgggtttcaagggaagcggacacattgtcactatttcatttaacgcagggacctccaaatcatgacaccagctgatctcgcaacattgattaaagagaccgcggtagaggttttgacctcccgcgagctcgatacttctgttcttccggagcaggtagttgtggagcgtccgcgtaacccagagcacggcgattacgccaccaacattgcattgcaggtggctaaaaaggtcggtcagaaccctcgggatttggctacctggctggcagaggcattggctgcagatgacgccattgattctgctgaaattgctggcccaggctttttgaacattcgccttgctgcagcagcacagggtgaaattgtggccaagattctggcacagggcgagactttcggaaactccgatcacctttcccacttggacgtgaacctcgagttcgtttctgcaaacccaaccggacctattcaccttggcggaacccgctgggctgccgtgggtgactctttgggtcgtgtgctggaggcttccggcgcgaaagtgacccgcgaatactacttcaacgatcacggtcgccagatcgatcgtttcgctttgtcccttcttgcagcggcgaagggcgagccaacgccagaagacggttatggcggcgaatacattaaggaaattgcggaggcaatcgtcgaaaagcatcctgaagcgttggctttggagcctgccgcaacccaggagcttttccgcgctgaaggcgtggagatgatgttcgagcacatcaaatcttccctgcatgagttcggcaccgatttcgatgtctactac Sequence 11: Array 12: Array 13: Array 14: Gaagtaggtcctcgtgttgctgcccgattcggcaaaaccatcctggagctgggcggaaacaacgcagccatagtcaccccagatgcagatcttgacctggcacttcgcggaattgtcttcgcggctgccggaaccgctggtcagcgctgcaccaccatgcgccgcgttatcgtccacgagtccattgcagaagagctcaccgaaaaactcgtttccgcataccaaaccctgaccatcggcgatcctcgcgacgagcagatcctcgttggaccactgatcaatgaatccggattccagggtatgcaggatgcactcaaggctgcaaccgaacagggcggaacggttatcaccggtggcaaccgagtcctcgaagatgaattcccagaggcctactacgttgagcctgcaatcgtaaccatgccagcacaaacagacattgtgcgcgatgaaaccttcgcaccaattctctacgtgctgacctactccactttggaagaagcaatcgcactccaaaacgatgttccacagggcctttcttctgcaatcttcaccgaaaaccagcgcgaagcagagctcttcgtctccgcttccggctccgactgtggcattgccaacgtcaacatcggtacctccggcgcagaaatcggcggcgcattcggtggcgaaaaggaaaccggtggcggacgcgaatccggctccgactcctggaagtcctacatgcgacgcgccaccaacaccgtcaactactccggcgaactgccactcgcccaaggcgttaaattcctctaagaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagt Array 15: Gaagtaggtcctcgtgttgctgcccgattcggcaaaaccatcctggagctgggcggaaacaacgcagccatagtcaccccagatgcagatcttgacctggcacttcgcggaattgtcttcgcggctgccggaaccgctggtcagcgctgcaccaccatgcgccgcgttatcgtccacgagtccattgcagaagagctcaccgaaaaactcgtttccgcataccaaaccctgaccatcggcgatcctcgcgacgagcagatcctcgttggaccactgatcaatgaatccggattccagggtatgcaggatgcactcaaggctgcaaccgaacagggcggaacggttatcaccggtggcaaccgagtcctcgaagatgaattcccagaggcctactacgttgagcctgcaatcgtaaccatgccagcacaaacagacattgtgcgcgatgaaaccttcgcaccaattctctacgtgctgacctactccactttggaagaagcaatcgcactccaaaacgatgttccacagggcctttcttctgcaatcttcaccgaaaaccagcgcgaagcagagctcttcgtctccgcttccggctccgactgtggcattgccaacgtcaacatcggtacctccggcgcagaaatcggcggcgcattcggtggcgaaaaggaaaccggtggcggacgcgaatccggctccgactcctggaagtcctacatgcgacgcgccaccaacaccgtcaactactccggcgaactgccactcgcccaaggcgttaaattcctctaagaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcagt Sequence 16: Cgcttattatggggatcagtttcagggtttcaagggaagcactcacattgtcatcaatcttcgcaacaaggacctcggaaaaatgttcgagctaatcgacgactggggtcccgaaaagatcgtcatcgtcagcgatcaaaaaaccgggatgcgtggcgtacttgtcatcgacaacaccgcccgcggcatgggcaagggcggcacgcgcatgcagcccaccgtttcagtcgcagaaatagccaggttggctcgcgtcatgacctggaaatgggctggtgtagacctcttttatggtggtgcaaaagccggaatccaagcagaccccacctccccagataaagaagcaatccttcggtcattcgtcagaaaactctccaacgaagtacctaaagaatatgtcttcggcctggacatggggctgactgaaaatgacgccgccatcatcgtcgacgagctcggctggggcaccagtatgggaacaccctacgagctcggtggagtgccctacgacaagcttggtatcaccggctttggtgttgcagaagtggtggatcaagtagcacaaatgcaaaaactcaaaggtgcatcggtagcagtccaaggcttcggtgccgttggacatgccacagcttcccgcctggcagaacttggctatcctgttgtggctatctccacagcaaagggagcaatcgcagaccccaacgggctcaacatccccgagctcatggaactacgcgatcaggtgggtgactcacttgtggaccactacccagcacttcgcatcaacccaggtgacgaacttttcaccgaagccgaaatcctcgtaccggcagcgctccaggacgtcatcgatgaagacgcagccaatcgactacaagcacaactcgtc Sequence 17: Cgcttattatggggatcagtttccgggtttcaagggaagcggacacattgtcactatttcatttaacgcagggacctccaaatcatgttcgagctaatcgacgactggggtcccgaaaagatcgtcatcgtcagcgatcaaaaaaccgggatgcgtggcgtacttgtcatcgacaacaccgcccgcggcatgggcaagggcggcacgcgcatgcagcccaccgtttcagtcgcagaaatagccaggttggctcgcgtcatgacctggaaatgggctggtgtagacctcttttatggtggtgcaaaagccggaatccaagcagaccccacctccccagataaagaagcaatccttcggtcattcgtcagaaaactctccaacgaagtacctaaagaatatgtcttcggcctggacatggggctgactgaaaatgacgccgccatcatcgtcgacgagctcggctggggcaccagtatgggaacaccctacgagctcggtggagtgccctacgacaagcttggtatcaccggctttggtgttgcagaagtggtggatcaagtagcacaaatgcaaaaactcaaaggtgcatcggtagcagtccaaggcttcggtgccgttggacatgccacagcttcccgcctggcagaacttggctatcctgttgtggctatctccacagcaaagggagcaatcgcagaccccaacgggctcaacatccccgagctcatggaactacgcgatcaggtgggtgactcacttgtggaccactacccagcacttcgcatcaacccaggtgacgaacttttcaccgaagccgaaatcctcgtaccggcagcgctccaggacgtcatcgatgaagacgcagccaatcgactacaagcacaactcgtc Sequence 18: Array 19: Array 20: Array 21: Cccgactttgttaccctttctgagggacttggctgtgttgccatccgcgtcaccaaagcggaggaagtactgccagccatccaaaaggctcgagagatcaacgaccgcccagtagtcatcgacttcatcgtcggtgaagacgcacaggtatggccaatggtgtctgctggatcatccaactccgatatccagtacgcactcggattgcgcccattctttgatggtgatgaatctgcagcagaagatcctgccgacattcacgaagccgtcagcgacattgatgccgccgttgaatcgaccgaggcataaggagagacccaagatggctaattctgacgtcacccgccacatcctgtccgtactcgttcaggacgtagacggaatcatttcccgcgtatcaggtatgttcacccgacgcgcattcaacctcgtgtccctcgtgtctgcaaagaccgaaacactcggcatcaaccgcatcacggttgttgtcgacgccgacgagctcaacattgagcagatcaccaagcagctcaacaagctgatccccgtgctcaaagtcgtgcgacttgatgaagagaccaccatcgcccgcgcaatcatgctggttaaggtctctgcggatagcaccaaccgtccgcagatcgtcgacgccgcgaacatcttccgcgcccgagtcgtcgacgtggctccagactctgtggttattgaatccacaggcaccccaggcaagctccgcgcactgcttgatgtgatggaaccattcggaatccgcgaactgatccaatccggacagattgcactcaaccgcggtccgaagaccatggctccggccaagatctaagaatttctccgcgtttttttcgcattcatctcgctaacttcgcttattatggggatcagt Array 22: Cccgactttgttaccctttctgagggacttggctgtgttgccatccgcgtcaccaaagcggaggaagtactgccagccatccaaaaggctcgagagatcaacgaccgcccagtagtcatcgacttcatcgtcggtgaagacgcacaggtatggccaatggtgtctgctggatcatccaactccgatatccagtacgcactcggattgcgcccattctttgatggtgatgaatctgcagcagaagatcctgccgacattcacgaagccgtcagcgacattgatgccgccgttgaatcgaccgaggcataaggagagacccaagatggctaattctgacgtcacccgccacatcctgtccgtactcgttcaggacgtagacggaatcatttcccgcgtatcaggtatgttcacccgacgcgcattcaacctcgtgtccctcgtgtctgcaaagaccgaaacactcggcatcaaccgcatcacggttgttgtcgacgccgacgagctcaacattgagcagatcaccaagcagctcaacaagctgatccccgtgctcaaagtcgtgcgacttgatgaagagaccaccatcgcccgcgcaatcatgctggttaaggtctctgcggatagcaccaaccgtccgcagatcgtcgacgccgcgaacatcttccgcgcccgagtcgtcgacgtggctccagactctgtggttattgaatccacaggcaccccaggcaagctccgcgcactgcttgatgtgatggaaccattcggaatccgcgaactgatccaatccggacagattgcactcaaccgcggtccgaagaccatggctccggccaagatctaagaatttcttcgcgttttttttgcatccatcttgttaacttcgcttattatggggatcagt Sequence 23: Array 24:

Industrial Applicability

[0118] For amino acid-producing bacteria, the present invention uses the EP6 promoter to initiate the expression of genes in the corresponding amino acid synthesis pathway to obtain the corresponding expression cassette. Then, using this expression cassette as a strong exogenous promoter, it is incorporated into amino acid-high-producing bacteria in place of the original promoter of an important gene for amino acid synthesis, thereby realizing an improvement in the production amount of the corresponding amino acid. This indicates that the EP6 promoter of the present invention not only has high promoter activity but can also be used for amino acid production, showing good prospects for application.

Claims

1. A DNA molecule whose sequence is SEQ ID No. 3 in the sequence listing.

2. A biological material related to the DNA molecule according to Claim 1, which is any one of the following B1) to B7): B1) An expression cassette containing the DNA molecule according to Claim 1, B2) A recombinant vector containing the DNA molecule according to Claim 1, B3) A recombinant vector containing the expression cassette described in B1), B4) A recombinant microorganism containing the DNA molecule according to Claim 1, B5) A recombinant microorganism containing the expression cassette described in B1), B6) A recombinant microorganism containing the recombinant vector described in B2), B7) A recombinant microorganism containing the recombinant vector described in B3).

3. Use of the DNA molecule according to Claim 1 as a promoter.

4. Use of the DNA molecule according to Claim 1 or the biological material according to Claim 2 in the production of amino acids.

5. The use according to Claim 4, wherein the amino acid is lysine, glutamic acid or valine.

6. A method for producing an amino acid, comprising: introducing the DNA molecule according to Claim 1 into a biological cell capable of synthesizing a target amino acid, driving the expression of a gene in the target amino acid synthesis pathway of the biological cell by the DNA molecule according to Claim 1 to obtain a recombinant biological cell; and culturing the recombinant biological cell to obtain the target amino acid.

7. The method according to Claim 6, wherein the biological cell is a yeast, bacterium, alga, fungus, plant cell or animal cell capable of synthesizing a target amino acid.

8. The method according to claim 7, characterized in that the bacterium is Corynebacterium glutamicum.

9. The method according to any one of claims 6 to 8, characterized in that the target amino acid is lysine, glutamic acid or valine.

10. A product for producing an amino acid, comprising as an active ingredient the DNA molecule according to claim 1 or the biological material according to claim 2.

Images