Sequencing Kit Containing Sulfhydryl Blocking Reagent and Its Use
The introduction of a sulfhydryl blocking reagent in a sequencing kit addresses the issue of incomplete dye washing in nucleic acid sequencing, significantly reducing background signals and improving sequencing quality by blocking enzyme activity and enabling thorough dye removal.
Patent Information
- Application Number
- JP2024572683
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-16
- Filing Date
- 2023-06-16
- Publication Date
- 2025-06-19
AI Technical Summary
The incomplete washing of fluorescent dyes in nucleic acid sequencing leads to increased background signals, decreased signal-to-noise ratios, and compromised sequencing quality due to non-specific adsorption of phi29 DNA polymerase.
A sequencing kit containing a sulfhydryl blocking reagent, such as N-ethylmaleimide and/or iodoacetamide, is used to open and irreversibly block the disulfide bonds in enzyme proteins, thereby releasing and completely removing fluorescent dyes, reducing background signals, and improving sequencing quality.
The use of sulfhydryl blocking reagents effectively blocks polymerase activity during multiple displacement amplification, allows for thorough washing, and enhances sequencing quality by reducing background signals and improving signal-to-noise ratios.
Smart Images

Figure 2025518950000002 
Figure 2025518950000003 
Figure 2025518950000004
Abstract
Description
Technical Field
[0001] This application claims the priority of Chinese Patent Application PCT / CN2022 / 099258 with an application date of June 16, 2022. This application incorporates the entire text of the above-mentioned Chinese patent application by reference.
[0002] The present invention belongs to the field of nucleic acid sequencing, and specifically relates to a kit containing a sulfhydryl blocking reagent, a method for reducing sequencing background signals based on the sulfhydryl blocking reagent, and its use.
Background Art
[0003] DNA sequencing includes first-strand sequencing and second-strand sequencing. After completing the first-strand sequencing, the first strand is used as a template to generate the second strand by multiple displacement amplification (MDA), and then the second strand of DNA is sequenced. In the process of generating the second strand, a multiple-strand displacement amplification enzyme (phi29 DNA polymerase) is used. Since phi29 DNA polymerase is easily adsorbed non-specifically to the sequencing chip, it is difficult to remove and residues remain. The remaining phi29 DNA polymerase binds to dNTP (chemically modified deoxyribonucleotides) at the initiation stage of the second-strand sequence. Since the molecular structure of the modified dNTP contains a fluorescent dye, as a result of the binding of the non-specifically bound enzyme and dNTP, the sequencing background signal increases, the signal-to-noise ratio decreases, and the sequencing quality is affected.
[0004] To reduce the adsorption of non-specific fluorescent substances in the prior art, the method of eluting with an elution solvent is common. To effectively remove the non-specifically bound fluorescent substances, it is necessary to increase the concentration of the eluent and extend the elution time, but the effect of effectively removing non-specific adsorption cannot be achieved. Both of the above methods are disadvantageous for efficient sequencing.
Summary of the Invention
Means for Solving the Problem
[0005] To solve the technical problem of the reduction of sequencing quality caused by incomplete washing of fluorescent dyes in the prior art, the present invention provides a sulfhydryl blocking reagent, a method for reducing the sequencing background signal based on the sulfhydryl blocking reagent, and its use.
[0006] The present invention first includes the step of opening the disulfide bond in the enzyme protein structure so that it becomes a sulfhydryl with an exposed disulfide bond, and the step of blocking the sulfhydryl exposed on the enzyme protein. Among them, as shown in reaction (1) of FIG. 1, a substitution reaction of a halogen generally using iodoacetamide and, as shown in reaction (2) of FIG. 1, an addition reaction generally using N-ethylmaleimide (NEM) can be selected. Michael Addition is a conjugate addition reaction between a compound capable of providing a nucleophilic carbanion and an electrophilic conjugate system under a base catalyst.
[0007] In the present invention, during the sequencing process, the disulfide bond in the enzyme protein structure is opened with a disulfide bond reducing agent, all disulfide bonds are irreversibly blocked using a blocking reagent, and the fluorescent dye is released and completely removed, thereby reducing the background signal and improving the sequencing quality. The sulfhydryl blocking reagent described in the present invention contains N-ethylmaleimide and / or iodoacetamide, is often used as a protein label in the protein structure, and is an important means for protein detection. The present invention, for the first time, applies a sulfhydryl blocking reagent to the sequencing technology as a means for reducing the second-strand background, can sufficiently block the polymerase in the MDA process, realizes more thorough washing, avoids the influence on the second-strand sequence, and is advantageous for improving the sequencing quality.
[0008] To solve the above technical problems, a first aspect of the present invention provides a sequencing kit comprising a sulfhydryl blocking reagent containing iodoacetamide and / or N-ethylmaleimide.
[0009] In some embodiments, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM N-ethylmaleimide. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 100 mM N-ethylmaleimide.
[0010] In some embodiments, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM iodoacetamide. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide.
[0011] In some embodiments, the sequencing kit further comprises a disulfide bond reducing agent, which is preferably a thiol such as tris(2-carboxyethyl)phosphine solution (TCEP) or β-mercaptoethanol (β-ME) or dithiothreitol (DTT).
[0012] In some embodiments, the disulfide bond reducing agent is dithiothreitol, and the concentration of its working solution is 1-10 mM.
[0013] In some embodiments, the sequencing kit further comprises one or more of DNA polymerase, MDA polymerase, sequencing slide, and a nucleotide mixture with fluorescence modification and reversible blocking. Preferably, the MDA polymerase is phi29 DNA polymerase.
[0014] A second aspect of the present invention is (1) A step of destroying the three-dimensional structure of an enzyme protein in the process of nucleic acid sequencing and exposing an active group; (2) A step of irreversibly blocking the exposed active group using a sulfhydryl blocking reagent in the sequencing kit according to the first aspect of the present invention; (3) A step of releasing a fluorescent substance; (4) An optionally washing step; provided is a method for reducing a nucleic acid sequencing background signal, which includes the above steps.
[0015] In some embodiments, in step (1), the three-dimensional structure is destroyed by breaking a disulfide bond, and the exposed active group is a sulfhydryl, and / or in step (2), the blocking is performed alone or using a sulfhydryl blocking reagent in the sequencing kit according to the first aspect, and / or in step (3), the fluorescent substance may be a nucleotide labeled alone by a marker such as Cy5 fluorescence, ROX fluorescence, Cy3 fluorescence, or EF700 fluorescence.
[0016] In the present invention, "alone" refers to the possibility that the reagent is not derived from the sequencing kit according to the first aspect and is the same reagent manufactured separately.
[0017] In step (3), the fluorescent substance may be a nucleotide labeled with a combination of markers, whereby different luciferases can be linked to the labeled nucleotide. As used herein, the molecular marker used to label the nucleotide and the marker that specifically binds thereto may be any molecular pairing that can specifically bind to each other. Specific binding between the pairing members enables the linkage of the nucleotide and the luciferase. Exemplary pairing members include: (a) haptens or antigenic compounds combined with corresponding antibodies such as digoxigenin-digoxigenin antibody, N3G-N3G antibody, FITC-FITC antibody, or their binding portions or fragments; (b) nucleic acid aptamers and proteins; (c) non-immune binding pairs (e.g., biotin-avidin, biotin-streptavidin, biotin-neutravidin); (d) hormone-hormone binding proteins; (e) receptor-receptor agonists or antagonists; (f) lectin-carbohydrates; (g) enzyme-enzyme cofactors; (h) enzyme-enzyme inhibitors; and (i) complementary oligonucleotides or polynucleotide pairs capable of forming nucleic acid duplexes, but are not limited thereto.
[0018] In step (4), the washing is carried out using an elution reagent, preferably using the elution reagent in the sequencing kit described in the first aspect of the present invention.
[0019] In some embodiments, in step (1), the disulfide bond reducing agent alone or in the sequencing kit described in the first aspect of the present invention is a thiol such as tris(2-carboxyethyl)phosphine solution (TCEP) or β-mercaptoethanol (β-ME) or dithiothreitol (DTT) to reduce the disulfide bond and open the three-dimensional space by breaking the disulfide bond. Preferably, the concentration range of the working solution of the disulfide bond reducing agent is 1 to 50 mM, preferably 1 to 10 mM.
[0020] In some embodiments, in step (2), the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution that contains 50-100 mM N-ethylmaleimide alone or in the sequencing kit described in the first aspect. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution that contains 100 mM N-ethylmaleimide.
[0021] In some embodiments, in step (2), the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution that contains 50-100 mM iodoacetamide alone or in the sequencing kit described in the first aspect. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution that contains 100 mM iodoacetamide.
[0022] In some embodiments, in step (1), after loading the sequencing reagent containing a disulfide bond reducing agent onto the chip, the sequencing reagent is eluted, and / or in step (2), after adding the sulfhydryl blocking reagent and reacting, secondary elution is performed.
[0023] In some embodiments, the elution reagents used for the elution and secondary elution are both the elution reagents in the sequencing reagent tank of the MGISEQ-2000RS high-throughput sequencing kit; and / or the enzyme protein is MDA polymerase, for example, phi29 DNA polymerase.
[0024] The third aspect of the present invention is (1) a step of loading a nucleic acid to be tested onto a sequencing slide, (2) a step of performing first-strand sequencing by contacting the nucleic acid to be tested with a sequencing reagent such as dNTP molecules and DNA polymerase, (3) a step of adding polymerase and amplifying to generate a second strand after completing the first-strand sequencing, (4) Optionally, an elution step; (5) A step of blocking the exposed active groups using the sequencing kit according to the first aspect of the present invention or the method according to the second aspect of the present invention; (6) Optionally, an elution step; (7) A step of performing second-strand sequencing; provided is a nucleic acid sequencing method comprising the above steps.
[0025] Specifically, the nucleic acid sequencing comprises: (1) A step of loading DNA nanospheres onto a sequencing slide using an MGISEQ-2000RS high-throughput sequencing kit; (2) A step of pumping a dNTP molecule mixed solution into the sequencing slide and polymerizing dNTP molecules onto a DNA sequencing strand using DNA polymerase to perform first-strand sequencing; (3) After completion of the first-strand sequencing, adding MDA polymerase, amplifying to generate a second strand, and eluting excess MDA polymerase and polymerization reagents with an elution reagent; (4) A step of using the method according to the second aspect of the present invention to open the three-dimensional structure of the remaining MDA enzyme on the sequencing chip, block the exposed groups, and after reacting for, for example, 30 minutes, eluting with the elution reagent and performing second-strand sequencing; The above steps are included.
[0026] Preferably, the nucleic acid sequencing is performed with a gene sequencer MGISEQ-2000RS, the cycles are performed 50 to 400 times, for example, 50, 100, 150, 200, or 400 times, and / or the polynucleotide is DNA or RNA.
[0027] The fourth aspect of the present invention provides the use of the sequencing kit according to the first aspect in nucleic acid sequencing or in the manufacture of reagents used in nucleic acid sequencing.
Advantages of the Invention
[0028] The positive progressive effect of the present invention is that The present invention first uses a sequencing kit containing a sulfhydryl blocking reagent, based on the strategy of opening the disulfide bonds of enzyme proteins and then irreversibly blocking them to better release the intertwined dye substances, reducing the background signal, improving the signal-to-noise ratio and sequencing quality. By using such protocols and reagent components in sequencing scripts and sequencing kits, the sequencing quality of the products is improved, and the value and market share of the products are enhanced.
Brief Description of the Drawings
[0029]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Mode for Carrying Out the Invention
[0030] Hereinafter, the present invention will be further described according to the embodiments of the examples, but the present invention is not limited to the scope of the above examples. In the following examples, experimental methods for which specific conditions are not described are selected according to ordinary methods and conditions, or the product manuals.
[0031] The mechanism for irreversibly blocking DNA polymerase sulfhydryl in the present invention is shown in FIG. 1.
[0032] Equipment, reagents and raw materials used in the examples Experimental equipment: MGISEQ-2000RS sequencer, MGIDL-200H loader, MGISEQ-2000RS sequencing slide, and the excitation wavelengths of the equipment are 532 and 650 nm, respectively.
[0033] Reagents and raw materials used in the experiment (see Table 1): Table 1 Reagents and Raw Materials Used in the Experiment
Table 1
[0034] Ammonium bicarbonate (analytical grade), N-ethylmaleimide (NEM, analytical grade), ultrapure water, Escherichia coli first-strand circular DNA as a template (standard library reagent V3.0), primer sequence: CAACTCCTTGGCTCACAGAACATGGCTACGATCCGACTT (SEQ ID NO: 1). DNA polymerase and MDA enzyme were provided by BGI, and DNA nanospheres were provided by BGI. All the following experiments used Escherichia coli first-strand circular DNA as a template, completed the production of DNA nanospheres using the MGISEQ-2000RS high-throughput sequencing kit (FCL PE150, catalog number: 1000012555, MGI), loaded them onto a chip (MGI, catalog number: 1000008403), and then performed sequencing. The nucleotide mixed solution with fluorescence modification and reversible blocking mentioned in this example contains dATP-1 (referring to an adenine nucleotide with both reversible blocking group modification and Cy5 fluorescence modification), dTTP-1 (referring to a thymine nucleotide with both reversible blocking group modification and ROX fluorescence modification), dGTP-1 (referring to a guanine nucleotide with both reversible blocking group modification and Cy3 fluorescence modification), and dCTP-1 (referring to a cytosine nucleotide with both reversible blocking group modification and EF700 fluorescence modification). The above dATP-1, dTTP-1, dGTP-1, and dCTP-1 are all from MGI's MGISEQ-2000RS high-throughput sequencing kit. Depending on the platform, the nucleotide mixed solution with fluorescence modification and reversible blocking varies. For example, the nucleotide mixed solution can be mixed with simple reversible blocking group nucleotides or other modification types.
[0035] Experimental Methods and Steps (a) Production of sulfhydryl blocking reagent: A predetermined amount of ammonium bicarbonate was accurately weighed and dissolved in ultrapure water to prepare a 50 mM ammonium bicarbonate aqueous solution. A predetermined amount of N-ethylmaleimide and iodoacetamide were accurately weighed to prepare a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide and a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide.
[0036] (b) The nucleic acid sequencing method is carried out with reference to the instructions and briefly described as follows:
[0037] Step 1: Load the above DNA nanospheres onto the chip (i.e., sequencing slide) prepared above;
[0038] Step 2: Pump the prepared dNTP molecule mixed solution (derived from the above MGISEQ-2000RS high-throughput sequencing reagent set) into the chip, use DNA polymerase to add dNTP molecules to the parental strand of DNA, and perform first-strand sequencing;
[0039] Step 3: After completing the first-strand sequencing, enter the MDA process to grow the second strand. After completing the growth of the second strand, elute the excess MDA enzyme (derived from the above MGISEQ-2000RS high-throughput sequencing reagent set) cleanly with an elution reagent (derived from the MGISEQ-2000RS high-throughput sequencing reagent set);
[0040] Step 4: Pump in a 10 mM DTT reagent to open the disulfide bond of the enzyme protein, then elute the DTT reagent cleanly, pump in a sulfhydryl blocking reagent, which is an ammonium bicarbonate solution containing N-ethylmaleimide, react for 30 minutes, and then elute the solution cleanly with the above elution reagent to perform second-strand sequencing.
[0041] Example 1 Using the MGISEQ-2000RS high-throughput sequencing kit, the #13 well position of the kit was set as a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide. On the MGISEQ-2000RS sequencing platform, a nucleotide mixed solution with fluorescence modification and reversible blocking was sequentially polymerized. Then, the free nucleotides were eluted using the above-mentioned elution reagent, so that polymerization and correction were performed simultaneously with signal acquisition. At this time, the nucleotide mixed solution to be polymerized was a nucleotide with reversible blocking modification.
[0042] According to the experimental steps, SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform. Briefly, a nucleotide mixed solution with fluorescence modification and reversible blocking was sequentially polymerized on the MGISEQ-2000RS sequencing platform. Next, the free nucleotides were eluted using the elution reagent, signal acquisition was performed under a photographic solution, a cleavage reagent for removing the protecting group was used, and the step of washing with the elution reagent was performed. Next, the Q30 reduction width of each cycle and the sequencing error rate curve of each cycle were statistically analyzed to evaluate the sequencing quality.
[0043] Example 2 Using the MGISEQ-2000RS high-throughput sequencing kit, the #13 well position of the kit was set as a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide. On the MGISEQ-2000RS sequencing platform, a nucleotide mixed solution with fluorescence modification and reversible blocking was sequentially polymerized. Then, the free nucleotides were eluted using the elution reagent, so that polymerization and compensation were performed simultaneously with signal acquisition. At this time, the nucleotide mixed solution to be polymerized was a nucleotide with reversible blocking modification. According to the same experimental steps as in Example 1, SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform. Next, the Q30 reduction width of each cycle and the sequencing error rate curve of each cycle were statistically analyzed to evaluate the sequencing quality.
[0044] Comparative Example 1 Using the MGISEQ-2000RS high-throughput sequencing kit, a 50 mM ammonium bicarbonate solution was placed in well position #13 of the kit. According to the same experimental steps as in Example 1, SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform, and then the Q30 reduction width of each cycle and the sequencing error rate curve of each cycle were statistically analyzed to evaluate the quality of sequencing.
[0045] Effect Example 1 Analysis of Results: Here, according to Figure 2, it was found that the proportion of bases reaching an error of 1 in 1000 during the test cycle differed depending on the blocking reagent, and the higher the proportion of bases with a lower error rate, the better. Specifically, when a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added, the proportion of 1 in 1000 errors was the highest, followed by the case when a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide was added. The 50 mM ammonium bicarbonate solution without a blocking reagent had the lowest proportion of 1 in 1000 errors. From this, it was found that the 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide had the best effect.
[0046] According to Figure 3, in cycles A, G, and T, when a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added, the background signal value was the lowest. Next was the case when a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide was added. The 50 mM ammonium bicarbonate solution without a blocking reagent had the highest background signal value. In cycle C, the background signal value when a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide was added corresponded to the background signal value when a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added, but both were still lower than the background signal value of the 50 mM ammonium bicarbonate solution without a blocking reagent.
[0047] According to Figure 4, in cycles A, C, G, and T, the signal-to-noise ratio was the highest when a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added. Next was the case when a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide was added. The 50 mM ammonium bicarbonate solution without a blocking reagent had the lowest signal-to-noise ratio in all cases.
[0048] Effect Example 2 Using the MGISEQ-2000RS high-throughput sequencing kit, the 13th well position of the kit was respectively set as a 50 mM ammonium bicarbonate solution containing 100 mM N-ethylmaleimide and a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide. On the MGISEQ-2000RS sequencing platform, a nucleotide mixed solution with fluorescence modification and reversible blocking was sequentially polymerized. Then, the free nucleotides were eluted using the above-mentioned elution reagent. According to the same experimental steps as in Example 1, SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform. Next, the Q30 reduction width of each cycle and the sequencing error rate curve of each cycle were statistically analyzed to evaluate the sequencing quality.
[0049] Results: As shown in Fig. 5, when using a blocking reagent, the sequencing quality (Q30) of the ammonium bicarbonate solution containing 100 mM N-ethylmaleimide was higher than that of 50 mM N-ethylmaleimide. As shown in Figs. 6-9, the blocking reagent containing Q30 (%) at a concentration of 100 mM was significantly higher than the sequencing results of the blocking reagent component at a concentration of 50 mM, and the backgrounds of A, G, C, and T were also significantly lower than the background of the blocking component at 50 mM. In short, increasing the concentration of the blocking reagent component improved the sequencing quality.
[0050] As described above, specific embodiments of the present invention have been described. For those skilled in the art, these are only illustrative explanations, and various changes and modifications can be made to these embodiments on the premise that they do not conflict with the principles and essence of the present invention. Therefore, the protection scope of the present invention is limited by the appended claims.
Claims
1. A sequencing kit, characterized by containing a sulfhydryl blocking reagent.
2. The sulfhydryl blocking reagent contains iodoacetamide and / or N-ethylmaleimide, and / or the concentration of the sulfhydryl blocking reagent is 50 to 100 mM. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50 to 100 mM N-ethylmaleimide, and / or the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50 to 100 mM iodoacetamide. The sequencing kit according to claim 1 is characterized in that.
3. The sequencing kit further contains a disulfide bond reducing agent. Preferably, the disulfide bond reducing agent is a thiol such as tris(2-carboxyethyl)phosphine solution or β-mercaptoethanol or dithiothreitol. The sequencing kit according to claim 1 or 2 is characterized in that.
4. The disulfide bond reducing agent is dithiothreitol, and the concentration of its working solution is 1 to 10 mM. The sequencing kit according to claim 3 is characterized in that.
5. (1) A step of destroying the three-dimensional structure of the enzyme protein in the process of nucleic acid sequencing and exposing the active group. (2) A step of irreversibly blocking the exposed active group using the sulfhydryl blocking reagent defined in the kit according to any one of claims 1 to 4. (3) A step of releasing a fluorescent substance. (4) An optionally washing step. A method for reducing the nucleic acid sequencing background signal, characterized by including the above steps.
6. In step (1), the three-dimensional structure is opened by breaking the disulfide bond, and the exposed active group is sulfhydryl, and / or, In step (2), the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM N-ethylmaleimide, and / or the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM iodoacetamide, and / or, In step (3), the fluorescent substance is a nucleotide labeled alone by a marker such as Cy5 fluorescence, ROX fluorescence, Cy3 fluorescence or EF700 fluorescence, and / or the fluorescent substance is a nucleotide labeled by a combination of markers, and / or, The method according to claim 5, wherein in step (4), the washing is performed using an elution reagent.
7. The method according to claim 6, wherein in step (1), the disulfide bond reducing agent is a thiol such as tris(2-carboxyethyl)phosphine solution (TCEP) or β-mercaptoethanol (β-ME) or dithiothreitol (DTT) to reduce the disulfide bond to break the disulfide bond and open the three-dimensional space.
8. The method according to claim 3 or 7, wherein in step (1), after loading the sequencing reagent containing the disulfide bond reducing agent onto the chip, the disulfide bond reducing agent is eluted, and / or in step (2), after adding the sulfhydryl blocking reagent and reacting, secondary elution is performed.
9. The method according to claim 5, wherein the enzyme protein is MDA polymerase, for example, phi29 DNA polymerase.
10. (1) A step of loading a nucleic acid to be tested onto a sequencing slide, (2) contacting the nucleic acid to be examined with sequencing reagents such as dNTP molecules and DNA polymerase to perform first-strand sequencing; (3) after completion of the first-strand sequencing, adding polymerase for amplification to generate a second strand; (4) optionally, eluting; (5) blocking the exposed active groups using the sequencing kit according to any one of claims 1 to 4 or the method according to any one of claims 5 to 9; (6) optionally, eluting; (7) performing second-strand sequencing; A nucleic acid sequencing method comprising:
11. Use of the sequencing kit according to any one of claims 1 to 4 in nucleic acid sequencing or in the manufacture of reagents used in nucleic acid sequencing.
Citation Information
Patent Citations
Method for enriching and sequencing protein terminal peptide fragment and reagent kit
CN101042374A
Method and kit for de novo sequencing of protein N-terminal sequence by using MALDI-TOT-TOF mass spectrum
CN104483374A
Methods for modifying and identifying nucleic acids
JP2020516302A