Recombinant AAV for gene therapy of SMA disease
The rAAV vector delivers a functional SMN1 gene to treat SMA, addressing the limitations of current treatments by providing sustained protein expression and simplifying administration, thus offering a more accessible therapy for SMA patients.
Patent Information
- Application Number
- JP2024575269
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-21
- Filing Date
- 2023-06-20
- Publication Date
- 2025-07-03
AI Technical Summary
Current treatments for spinal muscular atrophy (SMA), particularly type I SMA, are limited by high costs, complex administration methods, and the need for continuous medical intervention, making them unsuitable for widespread use.
A recombinant adeno-associated virus (rAAV) is developed to deliver a functional copy of the SMN1 gene, enabling sustained expression of the SMN1 protein through a polynucleotide sequence optimized for high expression in spinal cord tissues and low expression in other organs, using a vector system that includes a transgene plasmid, packaging plasmid, and helper plasmid.
The rAAV vector provides sustained and endogenous production of functional SMN1 protein, potentially offering a more convenient and cost-effective treatment option for SMA by reducing the need for frequent medical interventions and minimizing side effects.
Smart Images

Figure 2025520658000039 
Figure 2025520658000040 
Figure 2025520658000041
Abstract
Description
Technical Field
[0001] The present invention relates to gene therapy. In particular, the present invention relates to recombinant adeno-associated virus (AAV) for gene therapy of SMA disease.
Background Art
[0002] Spinal muscular atrophy (SMA) is an autosomal recessive disorder caused by mutations in the SMN1 gene on chromosome 5, resulting in the death of neurons in the anterior horn of the spinal cord and subsequent atrophy. In type I SMA, a prevalence of about 1-2 per 100,000 has been reported. The prevalence in China is estimated to be 1,200-1,500 cases of type I and 20,000 cases of other subtypes.
[0003] Type I SMA is a devastating disease. The onset age of patients is 0-6 months, and patients cannot sit. The lifespan is usually less than 2 years.
[0004] i) Gene therapy (Zolgensma), approved by the US FDA on May 24, 2019 and also by the EMA in May 2020, for the treatment of pediatric patients under 2 years old; ii) Nusinersen (antisense oligonucleotide, ASO), approved by the FDA in December 2016 and by the EMA in May 2017; and iii) Evrysdi, approved by the FDA in August 2020, among others, several treatments for SMA have been approved. However, the approved treatments have several drawbacks that limit their widespread use.
[0005] Zolgensma is indeed very expensive (about $2 million per IV injection). High-dose injections can cause high levels of liver enzymes, which can lead to serious liver damage (https: / / www.medicalnewstoday.com / articles / drugs-zolgensma).
[0006] Nusinersen is delivered directly into the central nervous system (CNS) within the spinal canal (i.e., through lumbar puncture for delivery into the cerebrospinal fluid in order to reach the CNS targets where motor neuron loss begins). After four initial loading doses, nusinersen is administered three times a year (https: / / www.spinraza.com and https: / / medlineplus.gov / druginfo / meds / a617010.html). Nusinersen requires continuous administration with a higher risk in a traumatic and complex manner, and the operation needs to be performed by a well-trained physician / nurse.
[0007] Evrysdi is supplied as an oral solution and needs to be administered once a day after meals and must be compounded by a pharmacist before dispensing. Evrysdi can be administered orally using the provided oral syringe. If the patient is unable to swallow and has a nasogastric or gastrostomy tube, Evrysdi can be administered via the tube. After the delivery of Evrysdi, it is necessary to flush water through the tube (https: / / www.centerwatch.com / directories / 1067-fda-approved-drugs / listing / 4644-evrysdi-risdiplam). The administration of Evrysdi is inconvenient. Young patients (under 2 years old) or patients with disabilities clearly cannot take it orally by themselves, so the assistance of a caregiver / nurse is required.
Summary of the Invention
Problems to be Solved by the Invention
[0008] Therefore, new treatments for SMA, especially type I SMA, are needed, such as gene therapy that can provide sustained expression of functional SMN1 at a desired level.
Means for Solving the Problems
[0009] To meet this need, the inventors have developed a gene therapy for SMA disease that provides for the sustained and endogenous production of SMN1 after transferring a functional copy of the SMN1 gene, such as the SMN1 gene encoding the wild-type SMN1 polypeptide, to a patient.
[0010] In a first aspect, the invention provides a polynucleotide of a subject comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20.
[0011] In a second aspect, the invention provides an expression construct comprising a polynucleotide of a subject comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20, and operably linked to a promoter. In some embodiments, the nucleotide sequence is SEQ ID NO: 11.
[0012] In some embodiments, the construct further comprises an intron. In some embodiments, the intron is between the promoter and the polynucleotide of the subject. In some embodiments, the intron comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24 and 29. In some embodiments, the construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer comprises the nucleotide sequence set forth in SEQ ID NO: 22. In some embodiments, the promoter comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 28, and 31.
[0013] In a third aspect, the present invention provides a recombinant adeno-associated virus (rAAV) comprising a genome containing the expression construct of the present invention. In some embodiments, the rAAV is prepared by a system containing a transgene plasmid containing the rAAV genome, a packaging plasmid encoding the REP and / or CAP protein, and a helper plasmid. Accordingly, the present invention further provides a vector containing the expression construct of the present invention.
[0014] In a fourth aspect, the present invention provides a pharmaceutical composition containing the rAAV of the present invention.
[0015] In a fifth aspect, the present invention provides a host cell containing the polynucleotide, expression construct or rAAV of the present invention.
[0016] In a sixth aspect, the present invention provides a method for treating a disease associated with a deficiency of SMN1, the method comprising administering the rAAV or pharmaceutical composition of the present invention to a subject in need thereof.
[0017] The present invention also provides the use of the polynucleotide, expression construct, rAAV, pharmaceutical composition and / or host cell of the present invention in the preparation of a medicament for treating a disease associated with a deficiency of SMN1 in a subject in need thereof.
[0018] In some embodiments, the disease is SMA such as type I SMA.
Brief Description of the Drawings
[0019]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Mode for Carrying Out the Invention
[0020] 1. Definitions Unless otherwise indicated, all terms used in this specification have the same meaning as would be obtained by one of ordinary skill in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA technology within the knowledge of one of ordinary skill in the art.
[0021] As used herein, "SMN1" means survival motor neuron gene 1 when referring to the gene, and means the protein encoded by the SMN1 gene when referring to the protein. "hSMN1" means the human "SMN1" gene or protein.
[0022] Adeno-associated virus (AAV) is a member of the parvovirus family. It is a simple single-stranded DNA virus and requires a helper virus (such as adenovirus) for replication. The genome of wild-type AAV contains approximately 4.7 kilobases (kb) and includes cap and rep between two inverted terminal repeat (ITR) sequences that are approximately 145 nucleotides in length and can fold into a hairpin structure that functions as a primer during DNA replication initiation. The cap gene encodes the viral capsid protein, and the rep gene is involved in AAV replication and integration. AAV can infect various cells, and the viral DNA can be integrated into human chromosome 19 in the presence of the rep products.
[0023] As used herein, the term "inverted terminal repeat" or "ITR" means the AAV viral cis element named for its symmetry as used herein. These elements are essential for efficient propagation of the AAV genome. In the present invention, the term "ITR" means the ITR for chimeric ITRs formed by fusion of ITR elements from different serotypes of known natural AAV serotypes and their functional variants.
[0024] The production of recombinant AAV particles may involve three plasmids: a transgene plasmid containing an expression construct for expressing an exogenous polynucleotide, a packaging plasmid encoding REP and / or CAP proteins, and a helper plasmid.
[0025] As used herein, the term "expression construct" means a single-stranded or double-stranded polynucleotide that is isolated from a naturally occurring gene or modified to contain nucleic acid segments that do not naturally occur. The expression construct may contain the control sequences necessary to express the coding sequences of the present invention.
[0026] As used herein, the term "polynucleotide" generally means a nucleic acid molecule (e.g., 100 bases in length and up to 30 kilobases) and a sequence that is either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. This term may also mean a DNA or RNA molecule that is either transcribed or untranscribed.
[0027] As used herein, the term "exogenous polynucleotide" means a nucleotide sequence that is not derived from the host in which it is placed. This can be identical or heterologous to the host's DNA. An example is the sequence of interest inserted into a vector. Such foreign DNA sequences can be derived from various sources including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also include DNA sequences encoding antisense oligonucleotides.
[0028] As used herein, the term "expression" includes, but is not limited to, any process involved in the production of a polypeptide, including transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0029] A "control sequence" includes all elements that are necessary or beneficial for the expression of a polynucleotide encoding a polypeptide of the invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, an enhancer, a signal peptide sequence, and a transcription terminator. At a minimum, the control sequences include a promoter and a signal for ending transcription and translation.
[0030] For example, a control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by a host cell and expressing a polynucleotide encoding a polypeptide of the invention. The promoter sequence contains a transcriptional control sequence that mediates the expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, such as the lac operon of Escherichia coli. The promoter also includes variant, modified, and hybrid promoters and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.
[0031] Optionally, an intron can be included in the construct to improve the expression of the coding sequence. A "modified" intron includes modifications such as substitution, insertion, or deletion of one or more nucleotides in the internal region of the native intron.
[0032] As used herein, the term "operably linked" means a configuration in which a control sequence is positioned at an appropriate position relative to the coding sequence of a polynucleotide sequence such that the control sequence directs the expression of the polypeptide coding sequence.
[0033] The polynucleotide encoding the SMN1 protein can be subjected to various manipulations to improve the expression of the polypeptide. Before inserting the polynucleotide into a vector, it is desirable or necessary to perform manipulations of the polynucleotide according to the expression vector or the host, such as codon optimization.
[0034] As used herein, the term "recombinant" means a nucleic acid, vector, polypeptide or protein generated using DNA recombination (cloning) methods and distinguishable from endogenous or wild-type nucleic acids, vectors, polypeptides or proteins.
[0035] The terms "polypeptide" and "protein" are used interchangeably herein and mean a polymer of amino acids, including the full-length protein and fragments thereof.
[0036] As used herein, the term "host cell" means, for example, a microorganism, yeast cell, insect cell and mammalian cell that can be or is used as a recipient of an rAAV vector. This term includes the progeny of the original cell into which it has been transfected. Thus, as used herein, the term "host cell" usually means a cell into which an exogenous DNA sequence has been transfected. It is understood that the progeny of a single parental cell are not necessarily identical in form or genomic or total DNA complementarity to the original parent due to natural, accidental or intentional mutations.
[0037] As used herein, the term "pharmaceutically acceptable" means a molecular entity and composition that is physiologically tolerable and does not normally produce toxicity or allergic or similar side effects such as gastric upset, dizziness when administered to humans.
[0038] As used herein, the term "subject" includes, but is not limited to, non-human primates such as humans, chimpanzees, and other apes and monkey species; domestic animals such as cows, sheep, pigs, goats, and horses; household animals such as dogs and cats; and laboratory animals including rodents such as mice, rats, and guinea pigs. The term does not mean a particular age or sex. Thus, both adult and neonatal subjects as well as fetuses are intended to be encompassed, regardless of sex.
[0039] 2. A polynucleotide or construct for expressing hSMN1 Gene therapy aims to correct defective genes underlying the onset of diseases, introduce exogenous genes into target cells in a subject, and express the products of exogenous genes that are useful for treating specific diseases such as SMA disease. A common approach for this purpose involves delivering functional genes such as SMN1 to the nucleus. Next, this gene can be inserted into the genome of the subject's cells or remain episomal. Delivering a functional gene to the target cells of a subject can be accomplished by many methods including the use of viral vectors. Among the many available viral vectors (e.g., retroviruses, lentiviruses, adenoviruses, etc.), AAV is gaining popularity as a multifunctional vector in gene therapy.
[0040] (i) It can infect (transduce) a variety of non-dividing and dividing cell types, including muscle fibers and neurons. (ii) By lacking viral structural genes, it eliminates the natural host cell response to viral infection, such as the interferon-mediated response. (iii) The wild-type virus is not associated with any pathological conditions in humans. (iv) In contrast to wild-type AAV that can integrate into the host cell genome, replication-incompetent AAV vectors generally persist as episomes, thus having a limited risk of insertional mutagenesis or activation of oncogenes. And (v) In contrast to other vector systems, AAV vectors do not trigger a large immune response (see (ii)), so they confer long-term expression of therapeutic transgenes (provided that their gene products are not rejected), making vectors derived from AAV particularly attractive for delivering genetic material. AAV vectors can be produced even at high titers and are reported to enable gene transfer into important muscle regions in rodents by single injection via intra-arterial, intravenous, or intraperitoneal injection.
[0041] The present invention thus intends to provide a polynucleotide, an expression construct, or a vector comprising the polynucleotide of a subject for expressing SMN1 in a subject. In some embodiments, SMN1 can be derived from any animal species, including but not limited to non-human primates such as humans, chimpanzees, and other apes and monkey species; domestic animals such as cows, sheep, pigs, goats, and horses; household animals such as dogs and cats; and laboratory animals such as rodents like mice, rats, and guinea pigs.
[0042] In some embodiments, SMN1 is human SMN1. In some embodiments, hSMN1 comprises the amino acid sequence of SEQ ID NO: 21 or an allelic variant thereof. In some embodiments, SMN1 is a functional SMN1 polypeptide, such as an SMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of the polypeptide of SEQ ID NO: 21.
[0043] In some embodiments, the polynucleotide encoding SMN1 is codon-optimized to improve expression.
[0044] In some embodiments, the polynucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20. Surprisingly, polynucleotides having the nucleotide sequences of SEQ ID NOs: 4, 5, 6, 7, 8, 11, 16, and 19 achieve higher expression of hSMN1 (1.5 - 4-fold) than SEQ ID NO: 1 in cells, while in in vivo tests, the inventors have found that SEQ ID NOs: 3, 6, 8, and 11 achieve higher expression in the spinal cord but lower expression in the heart and liver compared to SEQ ID NO: 1.
[0045] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0046] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0047] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0048] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0049] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0050] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0051] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0052] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0053] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0054] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0055] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0056] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 or SEQ ID NO: 13. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0057] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 or SEQ ID NO: 14. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0058] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0059] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 16 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0060] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0061] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0062] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0063] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0064] The present invention also provides an expression construct for expressing SMN1, which comprises a polynucleotide encoding SMN1 operably linked to a promoter. In some embodiments, SMN1 is human SMN1. In some embodiments, hSMN1 comprises the amino acid sequence of SEQ ID NO: 21 or an allelic variant thereof.
[0065] In some embodiments, the expression construct achieves high expression of SMN1 polypeptide and / or mRNA in the spinal cord and / or low expression of SMN1 polypeptide and / or mRNA in non-spinal cord tissues such as the heart and / or liver, as compared to, for example, a control expression construct comprising the nucleotide sequence of SEQ ID NO: 1.
[0066] In some embodiments, the polynucleotide comprises a nucleotide sequence selected from SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20. Surprisingly, polynucleotides having the nucleotide sequences of SEQ ID NO: 4, 5, 6, 7, 8, 11, 16 and 19 achieve higher expression of hSMN1 (1.5 to 4 times) than SEQ ID NO: 1 in cells, while in in vivo tests, the inventors have found that SEQ ID NO: 3, 6, 8 and 11 achieve high expression in the spinal cord but low expression in the heart and liver as compared to SEQ ID NO: 1.
[0067] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0068] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0069] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0070] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0071] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0072] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0073] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0074] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0075] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0076] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0077] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0078] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 13 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0079] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 14 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0080] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0081] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 or SEQ ID NO: 16. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0082] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 or SEQ ID NO: 17. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0083] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0084] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0085] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0086] Constructs are generally transferred into mammalian cells (such as human cells) for expression. Constructs often contain promoters - enhancers for high - level expression, such as the SV40 promoter - enhancer, the human cytomegalovirus (CMV) promoter, and the long terminal repeat of Rous sarcoma virus (RSV). These promoters - enhancers are active in many cell types. Tissue and cell - type promoters and enhancer regions can also be used for expression. Exemplary promoter / enhancer regions include, but are not limited to, those derived from genes such as the elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha - fetoprotein, alpha1 - antitrypsin, beta - globin, myelin basic protein, myosin light chain 2, and gonadotropin - releasing hormone genes.
[0087] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 28 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 28. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 31 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 31.
[0088] In some embodiments, the expression construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer is the cytomegalovirus (CMV) immediate early enhancer. In some embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 22.
[0089] It is also desirable to include an intron (e.g., an intron derived from a eukaryotic organism or an artificial intron) in the construct to increase expression in eukaryotic cells. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is upstream of the nucleotide sequence encoding SMN1. In some embodiments, the intron is downstream of the promoter.
[0090] In some embodiments, the intron is the PCI intron as set forth in SEQ ID NO: 24. In some embodiments, the intron is the chimeric intron (avian β-actin (CBA intron and exon) + rabbit globin intron) as set forth in SEQ ID NO: 29.
[0091] In some embodiments, the intron comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24 or 29, or SEQ ID NO: 24 or 29.
[0092] The expression construct further comprises a polyadenylation signal for processing of the transcript. In some embodiments, the construct comprises a polyadenylation signal downstream of the nucleotide sequence encoding hSMN1. In some embodiments, the polyadenylation signal comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 or 30, or SEQ ID NO: 25 or 30.
[0093] In some embodiments, the expression construct comprises, in order from 5' to 3', an enhancer, a promoter, an intron, a polynucleotide of interest encoding hSMN1, and a polyadenylation signal.
[0094] In some embodiments, the expression construct comprises, in order from 5' to 3', a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22 or SEQ ID NO: 22, a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23 or SEQ ID NO: 23, a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24 or SEQ ID NO: 24, a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 or SEQ ID NO: 2, and a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 or SEQ ID NO: 25 and comprises.
[0095] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0096] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0097] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0098] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 6 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0099] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 7 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0100] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0101] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0102] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0103] In some embodiments, the expression construct, in order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0104] In some embodiments, the expression construct, in order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0105] In some embodiments, the expression construct, in order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 13 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0106] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 14 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0107] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 15 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0108] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 16 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16, and the nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0109] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 17 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17, and the nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises
[0110] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 18 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises
[0111] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 19 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0112] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0113] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0114] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0115] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 comprises.
[0116] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0117] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0118] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0119] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 comprising.
[0120] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 and comprises.
[0121] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 and encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 and comprises.
[0122] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 3 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3, which encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or its allelic variant or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 including.
[0123] In some embodiments, the expression construct, in order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 4 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4, encoding a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0124] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 5 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5, encoding a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0125] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 6 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than that of SEQ ID NO: 21 of hSMN1, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0126] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 7 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0127] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 8 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0128] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 9 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0129] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 10 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0130] In some embodiments, the expression construct, in order from 5' to 3', a nucleotide sequence that is SEQ ID NO: 22 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, a nucleotide sequence that is SEQ ID NO: 23 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, a nucleotide sequence that is SEQ ID NO: 24 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is SEQ ID NO: 11 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0131] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12, which encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than that of the hSMN1 of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0132] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 13 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of the hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0133] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 14 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of the hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0134] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is the nucleotide sequence of SEQ ID NO: 15 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0135] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 16, which encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof, or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 25 is included.
[0136] In some embodiments, the expression construct, in the order from 5' to 3', a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 22, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 23, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 24, a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 17, which encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof, or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 25 is included.
[0137] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 18 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21 of hSMN1, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0138] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 19 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19, and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of the hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0139] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 20 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20, and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of the hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0140] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or the hSMN1 polypeptide of SEQ ID NO: 21 having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of its activity, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 and comprises.
[0141] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, A nucleotide sequence that is SEQ ID NO: 11 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0142] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0143] In some embodiments, the expression construct, in order from 5' to 3', The nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, The nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, The nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 including.
[0144] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0145] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 31 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, the nucleotide sequence of SEQ ID NO: 29 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, a nucleotide sequence that is the nucleotide sequence of SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than that of the hSMN1 of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0146] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 31 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, the nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0147] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0148] 3. Recombinant AAV, Pharmaceutical Composition and Host Cell The present invention further provides a recombinant AAV (rAAV) comprising a genome that includes an expression construct of the present invention. In some embodiments, the expression construct is flanked by the 5' and 3' inverted terminal repeats (ITRs) of AAV.
[0149] In some embodiments, the rAAV achieves high expression of the SMN1 polypeptide and / or mRNA in the spinal cord and / or low expression of the SMN1 polypeptide and / or mRNA in non-spinal cord tissues such as the heart and / or liver, as compared to, for example, a control rAAV comprising the nucleotide sequence of SEQ ID NO: 1.
[0150] In some embodiments, the rAAV of the present invention can be selected from human serotype 1 AAV (hAAV1), hAAV2, hAAV3, hAAV4, hAAV5, hAAV6, hAAV7, hAAV8, hAAV9, hAAV10, and hAAV11. In some embodiments, the rAAV is hAAV9.
[0151] In some embodiments, the genome of the rAAV includes an expression construct flanked by the 5' and 3' ITRs of AAV.
[0152] In some embodiments, the expression construct includes a nucleotide sequence encoding SMN1 operably linked to a promoter. In some embodiments, the SMN1 is human SMN1. In some embodiments, the hSMN1 includes the amino acid sequence of SEQ ID NO: 21 or an allelic variant thereof.
[0153] In some embodiments, the construct comprises a nucleotide sequence selected from SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20. Surprisingly, polynucleotides having the nucleotide sequences of SEQ ID NOs: 4, 5, 6, 7, 8, 11, 16, and 19 achieve higher expression of hSMN1 (1.5 - 4 fold) than SEQ ID NO: 1 in cells, while in in vivo tests, the inventors have found that SEQ ID NOs: 3, 6, 8, and 11 achieve higher expression in the spinal cord but lower expression in the heart and liver compared to SEQ ID NO: 1.
[0154] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 2 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0155] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 3 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0156] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 4 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0157] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 5 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0158] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 6 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0159] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 7 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0160] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 8 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0161] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 9 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0162] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 10 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0163] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 11 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0164] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 12 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0165] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 13 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0166] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 14 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0167] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 15 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0168] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 16 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0169] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 17 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0170] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 18 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0171] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 19 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0172] In some embodiments, the nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO: 20 or is a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20 and encodes a functional hSMN1 polypeptide, such as an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the polypeptide of SEQ ID NO: 21. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20 and encodes the polypeptide of SEQ ID NO: 21 or an allelic variant thereof.
[0173] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31.
[0174] In some embodiments, the expression construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer is the cytomegalovirus (CMV) immediate early enhancer. In some embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22.
[0175] It is also desirable to include an intron (e.g., an intron derived from a eukaryotic organism or an artificial intron) in the construct to increase expression in eukaryotic cells. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is upstream of the nucleotide sequence encoding SMN1. In some embodiments, the intron is downstream of the promoter.
[0176] In some embodiments, the intron is the PCI intron described in SEQ ID NO: 24. In some embodiments, the intron is the chimeric intron (avian β-actin (CBA intron and exon) + rabbit globin intron) described in SEQ ID NO: 29.
[0177] In some embodiments, the intron comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24 or 29, or SEQ ID NO: 24 or 29.
[0178] The expression construct further comprises a polyadenylation signal for processing of the transcript. In some embodiments, the construct comprises a polyadenylation signal downstream of the nucleotide sequence encoding hSMN1. In some embodiments, the polyadenylation signal comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 or 30, or SEQ ID NO: 25 or 30.
[0179] In some embodiments, the expression construct comprises, in order from 5' to 3', an enhancer, a promoter, an intron, the polynucleotide of interest encoding hSMN1, and a polyadenylation signal.
[0180] In some embodiments, the expression construct comprises, in order from 5' to 3', a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22 or SEQ ID NO: 22, a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23 or SEQ ID NO: 23, a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24 or SEQ ID NO: 24, a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 or SEQ ID NO: 2, and a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 or SEQ ID NO: 25 and comprises.
[0181] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0182] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0183] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0184] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO:6 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:6, and SEQ ID NO:25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:25 comprising.
[0185] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO:22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:22, SEQ ID NO:23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:23, SEQ ID NO:24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:24, SEQ ID NO:7 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:7, and SEQ ID NO:25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:25 comprising.
[0186] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO:22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:22, SEQ ID NO:23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0187] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0188] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 10 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0189] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0190] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 12 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0191] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 13 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0192] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 14 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0193] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 15 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0194] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 16 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0195] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 17 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 including.
[0196] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 18 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 including.
[0197] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 19 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 19, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0198] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 20, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0199] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0200] In some embodiments, the expression construct, in the 5' to 3' order, the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0201] In some embodiments, the expression construct, in the 5' to 3' order, the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0202] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 28 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0203] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0204] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, The nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, The nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprising.
[0205] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and The nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 comprising.
[0206] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, The nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, The nucleotide sequence of SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and The nucleotide sequence of SEQ ID NO: 30 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 comprises.
[0207] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 2 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2, which encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or its allelic variant or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0208] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3, which encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or its allelic variant or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than that of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 including.
[0209] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, The nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, The nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 4 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4 and encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of the hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0210] In some embodiments, the expression construct, in order from 5' to 3', a nucleotide sequence that is SEQ ID NO: 22 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, a nucleotide sequence that is SEQ ID NO: 23 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, a nucleotide sequence that is SEQ ID NO: 24 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is SEQ ID NO: 5 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5 and encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of the hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0211] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 6 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6, encoding a functional hSMN1 polypeptide such as hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than that of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0212] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 7 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 7, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0213] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 8 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 8, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of hSMN1 of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0214] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 9 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 comprises.
[0215] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 10 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 10, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0216] In some embodiments, the expression construct, in order from 5' to 3', a nucleotide sequence that is SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, a nucleotide sequence that is SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, a nucleotide sequence that is SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0217] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 12 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of SEQ ID NO: 21 of hSMN1, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0218] In some embodiments, the expression construct, in the order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 13 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 13 and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0219] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, SEQ ID NO: 14 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 14 and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of SEQ ID NO: 21, and SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0220] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 15 and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than that of the hSMN1 of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 including.
[0221] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 16 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0222] In some embodiments, the expression construct, in order from 5' to 3', a nucleotide sequence that is SEQ ID NO: 22 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, a nucleotide sequence that is SEQ ID NO: 23 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, a nucleotide sequence that is SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is SEQ ID NO: 17 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 17, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0223] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 18 and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 including.
[0224] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 24 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 19, which encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 25 is included.
[0225] In some embodiments, the expression construct, in the order from 5' to 3', a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 22, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 23, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 24, a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 20, which encodes a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 25 is included.
[0226] In some embodiments, the expression construct, in the order from 5' to 3', a nucleotide sequence that is SEQ ID NO: 28 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, a nucleotide sequence that is SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, a nucleotide sequence that is SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or an allelic variant thereof or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and a nucleotide sequence that is SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0227] In some embodiments, the expression construct, in the order from 5' to 3', a nucleotide sequence that is SEQ ID NO: 28 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, a nucleotide sequence that is SEQ ID NO: 29 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, A nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof, or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 25 is included.
[0228] In some embodiments, the expression construct, in the 5' to 3' order, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 28, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 24, a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as hSMN1 of SEQ ID NO: 21 or an allelic variant thereof, or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more activity of hSMN1 of SEQ ID NO: 21, and a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 30 is included.
[0229] In some embodiments, the expression construct, in the 5' to 3' order, The nucleotide sequence of SEQ ID NO: 28 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 28, The nucleotide sequence of SEQ ID NO: 29 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, The nucleotide sequence of SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% activity of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 30 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0230] In some embodiments, the expression construct, in the order from 5' to 3', The nucleotide sequence of SEQ ID NO: 31 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, The nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, The nucleotide sequence of SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, encoding a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or its allelic variant or having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% activity of the hSMN1 of SEQ ID NO: 21, and The nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0231] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 31 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, the nucleotide sequence of SEQ ID NO: 29 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, the nucleotide sequence of SEQ ID NO: 11 or at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, which encodes a functional hSMN1 polypeptide such as the hSMN1 of SEQ ID NO: 21 or its allelic variant or the hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of the hSMN1 of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 25 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 is included.
[0232] In some embodiments, the expression construct, in the order from 5' to 3', the nucleotide sequence of SEQ ID NO: 31 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, the nucleotide sequence of SEQ ID NO: 24 or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24, A nucleotide sequence that is SEQ ID NO: 11 or is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof, or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of SEQ ID NO: 21, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0233] In some embodiments, the expression construct, in order from 5' to 3', SEQ ID NO: 31 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 31, SEQ ID NO: 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 29, SEQ ID NO: 11 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 11, and encodes a functional hSMN1 polypeptide such as the hSMN1 polypeptide of SEQ ID NO: 21 or an allelic variant thereof, or an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the activity of SEQ ID NO: 21 of GLA, and SEQ ID NO: 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 30 is included.
[0234] The present invention also provides a method for preparing rAAV. In some embodiments, rAAV is prepared by a system containing a transgene plasmid containing the rAAV genome, a packaging plasmid encoding REP and / or CAP proteins, and a host cell such as a mammalian cell containing a helper plasmid, for example, a transgene plasmid containing the rAAV genome, and the packaging plasmid encodes REP and / or CAP proteins and a helper plasmid. Accordingly, the present invention also provides a vector such as a plasmid containing the genome of the rAAV of the present invention.
[0235] In some embodiments, rAAV can be packaged as described in Crosson SM et al. (Crosson SM, Dib P, Smith JK, Zolotukhin S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Mol Ther Methods Clin Dev. 2018;10:1-7).
[0236] The present invention further provides a vector containing the genome of rAAV, and the genome of rAAV contains the expression construct of the present invention adjacent to the 5' and 3' ITRs. In some embodiments, the vector is a transgene plasmid for packaging rAAV.
[0237] In some embodiments, the genome of rAAV is a self-complementary vector genome (scAAV).
[0238] In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25, and a 3' ITR. In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25, and a 3' ITR. In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30, and a 3' ITR. In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30, and a 3' ITR.
[0239] In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25, and a 3' ITR. In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25, and a 3' ITR. In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30, and a 3' ITR. In some embodiments, the rAAV genome comprises, in order from 5' to 3', a 5' ITR, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30, and a 3' ITR.
[0240] In some embodiments, the 5' ITR comprises SEQ ID NO: 26. In some embodiments, the 3' ITR comprises SEQ ID NO: 27.
[0241] In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30, and SEQ ID NO: 27. In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30, and SEQ ID NO: 27.
[0242] In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30, and SEQ ID NO: 27. In some embodiments, the rAAV genome comprises, in order from 5' to 3', SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30, and SEQ ID NO: 27.
[0243] The present invention also provides a pharmaceutical composition comprising rAAV. The pharmaceutical composition containing AAV of the present invention can be formulated in any conventional manner by mixing a selected amount of rAAV with one or more pharmaceutically acceptable carriers or excipients.
[0244] The selection of a carrier or excipient is within the skill of the art of administration and can depend on a number of parameters. These include, for example, the mode of administration (i.e., systemic, oral, topical, local or any other mode) and the disease being treated. Suitable pharmaceutical carriers or vehicles for administration of the rAAV provided herein include any such carrier known to those skilled in the art to be suitable for a particular mode of administration.
[0245] In some embodiments, the pharmaceutical composition is formulated for parenteral administration, such as intravenous, intramuscular or subcutaneous injection. In some embodiments, the pharmaceutical composition is formulated for topical administration.
[0246] The inventors have discovered that the desired safety can be achieved when the pharmaceutical composition of the present invention is administered, for example, by intravenous injection. For example, safety can be evaluated by the expression level of hSMN1 in tissues such as the liver and heart other than the spinal cord.
[0247] The present invention further provides a host cell comprising a polynucleotide, expression construct and / or vector of the present invention. In some embodiments, the host cell is a mammalian cell, such as a human cell. In some embodiments, the host cell is a HEK293T cell.
[0248] 4. Treatment of Diseases The present invention provides a method for treating a disease associated with a deficiency of SMN1, the method comprising administering the rAAV or pharmaceutical composition of the present invention to a subject in need thereof. In some embodiments, the disease is SMA, particularly type I SMA. In some embodiments, the rAAV or pharmaceutical composition is administered by intravenous injection.
[0249] The present invention further provides the use of the polynucleotides, expression constructs, rAAVs, pharmaceutical compositions, vectors or host cells of the present invention in the preparation of a medicament for treating a disease associated with a deficiency of SMN1 in a subject in need thereof. In some embodiments, the disease is SMA, particularly type I SMA. In some embodiments, the medicament is administered by intravenous injection.
[0250] There is provided an rAAV and / or pharmaceutical composition of the present invention for use in treating a disease associated with a deficiency of SMN1 in a subject in need thereof. In some embodiments, the disease is SMA, particularly type I SMA. In some embodiments, the rAAV and / or pharmaceutical composition is administered by intravenous injection.
[0251] In some embodiments, the treatment increases hSMN1 activity in the subject. In some embodiments, the treatment increases hSMN1 activity in the spinal cord. In some embodiments, the treatment reduces neuron death in the anterior horn of the spinal cord, thereby reducing atrophy. In some embodiments, the subject is human.
[0252] In some embodiments, the treatment cures, ameliorates, reduces, blocks or partially blocks the symptoms of SMA.
[0253] Embodiments Clause 1. A polynucleotide comprising a nucleotide sequence encoding SMN1, preferably a polynucleotide comprising a human SMN1 (hSMN1) polypeptide, wherein the nucleotide sequence is codon-optimized to improve expression.
[0254] Clause 2. The polynucleotide according to Clause 1, wherein the nucleotide sequence is as set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or a variant thereof.
[0255] Clause 3. The variant is a polynucleotide according to Clause 2, which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
[0256] Clause 4. The SMN1 polypeptide is an hSMN1 polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% of the activity of the polypeptide of SEQ ID NO: 21, and is a polynucleotide according to any one of Clauses 1 to 3.
[0257] Clause 5. The SMN1 polypeptide is a polynucleotide according to any one of Clauses 1 to 4, which comprises SEQ ID NO: 21 or an allelic variant thereof.
[0258] Clause 6. The nucleotide sequence is a polynucleotide according to any one of Clauses 1 to 5, which is set forth in SEQ ID NO: 3, 4, 5, 6, 7, 8, 11, 16 or 19.
[0259] Clause 7. The nucleotide sequence is a polynucleotide according to any one of Clauses 1 to 6, which is set forth in SEQ ID NO: 3, 6, 8 or 11.
[0260] Clause 8. The nucleotide sequence is a polynucleotide according to any one of Clauses 1 to 7, which is set forth in SEQ ID NO: 11.
[0261] Clause 9. An expression construct comprising a polynucleotide according to any one of Clauses 1 to 8, which is operably linked to a promoter.
[0262] Clause 10. The promoter is a nucleotide sequence of SEQ ID NO: 23, 28 or 31, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 23, 28 or 31, and is an expression construct according to Clause 9.
[0263] Clause 11. The expression construct according to Clause 9 or 10, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 31.
[0264] Clause 12. The expression construct according to any one of Clauses 9 to 11, preferably further comprising an enhancer upstream of the promoter.
[0265] Clause 13. The expression construct according to Clause 12, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 22.
[0266] Clause 14. The expression construct according to any one of Clauses 9 to 13, preferably further comprising an intron downstream of the promoter and upstream of the nucleotide sequence encoding the SMN1 polypeptide.
[0267] Clause 15. The expression construct according to Clause 14, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 24 or 29 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 24 or 29.
[0268] Clause 16. The expression construct according to any one of Clauses 9 to 15, further comprising a polyadenylation signal downstream of the nucleotide sequence encoding the SMN1 polypeptide.
[0269] Clause 17. The expression construct according to Clause 16, wherein the polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 25 or 30 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 25 or 30.
[0270] Clause 18. The expression construct according to any one of Clauses 9 to 17, comprising, in order from 5' to 3', an enhancer, a promoter, an intron, the polynucleotide encoding the target hSMN1, and a polyadenylation signal.
[0271] In the order from item 19.5' to 3', i) SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25; ii) SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25; iii) SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30; iv) SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30; v) SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25; vi) SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25; vii) SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30; or viii) SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30 An expression construct according to any one of items 9 to 18, comprising
[0272] A recombinant adeno-associated virus (rAAV) comprising a genome comprising an expression construct according to any one of items 9 to 19, adjacent to the 5' and 3' ITRs of item 20.
[0273] Item 21. The rAAV according to item 20, selected from human serotype 1 AAV (hAAV1), hAAV2, hAAV3, hAAV4, hAAV5, hAAV6, hAAV7, hAAV8, hAAV9, hAAV10 and hAAV11, preferably hAAV9.
[0274] Item 22. The rAAV according to item 20 or 21, wherein the genome of the rAAV is about 4,700 nucleotides in length from the 5' end of the 5' ITR to the 3' end of the 3' ITR, such as 4,600 - 4,800, 4,620 - 4,780, 4,640 - 4,760, 4,650 - 4,750, 4,660 - 4,740, 4,670 - 4,730, 4,680 - 4,720 or 4,690 - 4,710 nucleotides.
[0275] Clause 23. The rAAV genome preferably contains a stuffer fragment downstream of the polyadenylation signal, and is the rAAV described in any one of Clauses 20 to 22.
[0276] Clause 24. The 5’ ITR is the rAAV described in any one of Clauses 20 to 23 and contains SEQ ID NO: 26.
[0277] Clause 25. The 3’ ITR is the rAAV described in any one of Clauses 20 to 24 and contains SEQ ID NO: 27.
[0278] Clause 26. The rAAV genome, in the order from 5’ to 3’, i) SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27; ii) SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27; iii) SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30, SEQ ID NO: 27, v) SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27; vi) SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27; vii) SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 24, SEQ ID NO: 11, SEQ ID NO: 30, SEQ ID NO: 27; or viii) SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 30, SEQ ID NO: 27 and is the rAAV described in any one of Clauses 20 to 25.
[0279] Clause 27. A vector containing the rAAV genome described in any one of Clauses 20 to 26.
[0280] Clause 28. The vector described in Clause 27, which is a transgene plasmid for packaging rAAV.
[0281] A host cell comprising the polynucleotide according to any one of Items 1 to 8, the expression construct according to any one of Items 9 to 19, the rAAV according to any one of Items 20 to 26, or the vector according to Item 27 or 28.
[0282] Item 30. The host cell according to Item 29, which is a mammalian cell such as a human cell.
[0283] Item 31. The host cell according to Item 29 or 30, which is HEK293T cell.
[0284] Item 32. A pharmaceutical composition comprising the rAAV according to any one of Items 20 to 26.
[0285] Item 33. The pharmaceutical composition according to Item 32, further comprising a pharmaceutically acceptable carrier or excipient.
[0286] Item 34. The pharmaceutical composition according to Item 32 or 33, formulated for parenteral administration, such as intravenous, intramuscular or subcutaneous injection.
[0287] Item 35. The pharmaceutical composition according to any one of Items 32 to 34, formulated for topical administration.
[0288] Item 36. The rAAV according to any one of Items 20 to 26 or the pharmaceutical composition according to any one of Items 32 to 35, used for treating a disease associated with the deficiency of SMN1 in a subject in need thereof.
[0289] Item 37. A method for treating a disease associated with the deficiency of SMN1, the method comprising administering to a subject in need thereof the rAAV according to any one of Items 20 to 26 or the pharmaceutical composition according to any one of Items 32 to 35.
[0290] Use of the polynucleotide according to any one of clauses 1 to 8, the expression construct according to clauses 9 to 19, the rAAV according to any one of clauses 20 to 26, the vector according to clause 27 or 28, the host cell according to any one of clauses 29 to 31, or the pharmaceutical composition according to any one of clauses 32 to 35, in the preparation of a medicament for treating a disease associated with a deficiency of SMN1 in a subject in need thereof.
[0291] Clause 39. The rAAV or pharmaceutical composition for the use according to clause 36, the method according to clause 37, or the use according to clause 38, wherein the disease is SMA, especially type I SMA.
[0292] Clause 40. The rAAV or pharmaceutical composition for the use according to clause 36, the method according to clause 37, or the use according to clause 38, wherein the subject is human.
[0293] Clause 41. The polynucleotide according to any one of clauses 1 to 9, the expression construct according to any one of clauses 10 to 19, or the rAAV according to any one of clauses 20 to 26, which achieves high expression of SMN1 polypeptide and / or mRNA in the spinal cord and / or low expression of SMN1 polypeptide and / or mRNA in non-spinal cord tissues such as the heart and / or liver, as compared with the polynucleotide, expression construct, or rAAV comprising the nucleotide sequence of SEQ ID NO: 1.
Example
[0294] The following examples do not limit the present application in any way and are provided merely for illustration.
[0295] Example 1. Expression of hSMN1 in 293T cells 1.1. Construction of the transgene plasmid Twenty constructs containing the rAAV genome comprising the codon-optimized coding sequence for hSMN1 (CoSMN) or the coding sequence for GFP were prepared by Gibson assembly of the pGCB108 plasmid containing the cytomegalovirus immediate early (CMVen) enhancer (SEQ ID NO: 22) and the chicken β-actin core (CB) promoter (SEQ ID NO: 23) with the PCI intron (SEQ ID NO: 24) and the coding sequence (SEQ ID NOs: 2-20 or 36). The Zolgensma construct (see WO 2020 / 113034) was introduced into the pGCB108 plasmid by Gibson assembly. The structure of the constructs is shown in Figure 1. The transgene plasmids were called plasmid 2-20 (each containing SEQ ID NOs: 2-20), plasmid Zol (containing the Zolgensma construct), and plasmid GFP (containing the GFP coding sequence).
[0296] As an example, the map of the transgene plasmid containing the coding sequence optimized for hSMN1 of SEQ ID NO: 2 is shown in Figure 2A, and the sequence is shown in SEQ ID NO: 37.
[0297] 1.2. Transfection of 293T cells 293T cells (ATCC CRL-3216™) were cultured at 37°C and 5% CO2 according to the manufacturer's protocol. One day before transfection, 293T cells were seeded in a 12-well tissue culture plate at a density of 5×10 5 cells / well and transfected using the transgene plasmids constructed in Example 1.1 according to the manufacturer's protocol (FuGENE® HD transfection reagent, Promega). Cell pellets were collected 72 hours after transfection. When performing transfection, one-tenth the amount of the fLuc2 plasmid (see Figure 2D) was added as a transfection efficiency control.
[0298] 1.3. Western blotting The infected cells were lysed with M-PER (trademark) mammalian protein extraction reagent (Thermo Fisher, catalog number: 78501). Equal amounts of lysate (10 μg) were loaded onto a NuPAGE 4-12% Bis-Tris gel (1 μl of reducing agent + 9 μl of 4X Li-Cor protein loading buffer + 30 μl of supernatant, 200 V, 22 minutes) for PAGE. According to the manufacturer's instructions, the protein was transferred to a nitrocellulose membrane using an iBlot (registered trademark) 2 gel transfer device (Thermo Fisher Scientific) and an iBlot (registered trademark) 2 transfer stack (nitrocellulose, regular size). The membrane was incubated with blocking buffer (8% milk in 1X TBS-T) for 1 hour, washed for 3 minutes (1 minute / wash), and then probed with primary antibodies (SMN1 monoclonal antibody (2F1), Thermo MA5-15857 and Thermo alpha-tubulin polyclonal antibody, PA1-38814) at 1:2000 in the same buffer at 4 °C overnight. After washing three times (1 minute / wash), it was incubated with donkey anti-mouse (HRP) (Thermo Fisher, catalog number A16011) (1:5000) for 2 hours at room temperature. The immune reaction was visualized using a Biorad ChemiDoc imaging system. The Western blot image for hSMN1 is shown in Figure 3. Quantification was performed on the scanned image using ImageJ software.
[0299] 1.4. Luciferase assay The fLuc2 activity was detected using the Promega Steady-Glo® Luciferase Assay System. Equal amounts of transfected cell lysates (10 μg) (10 μl) were diluted in 90 μl of OptiMEM medium, and 100 μl of Steady-Glo® Luciferase substrate was added to a black 96-well plate (Corning® 3991, Corning® 96-well, flat-bottom polystyrene NBS microplate without lid). The plate was shaken at R / T for at least 5 minutes for mixing, and then luminescence was detected with a softmax luminometer (Molecular Devices SpectraMax i3x multimode detection platform, manufacturer: Molecular Devices, model: SpectraMax I3x). The luminescence of each transfected cell sample is shown in Figure 4.
[0300] The Western blot data was normalized according to luciferase activity, and the normalized data is shown in Figure 5. Eight of the codon-optimized sequences (CoSMN4, CoSMN5, CoSMN6, CoSMN7, CoSMN8, CoSMN11, CoSMN16, and CoSMN19) showed 1.5 - 4-fold higher expression of hSMN1 than Zolgensma, while six of the codon-optimized sequences (CoSMN2, CoSMN9, CoSMN12, CoSMN13, CoSMN17, and CoSMN20) showed relatively poor expression of hSMN1.
[0301] Example 2. Preparation of rAAV The rAAV vector was prepared in a manner similar to that described in Crosson SM et al. 2018. Briefly, 293VPC cells (Thermo, Catalog A35347) at 3E6 cells / ml were transfected in three ways in serum-free virus production medium OPM-293 CD05 (Shanghai OPM Biosciences Co., Ltd. catalog: 81075-001) using polyethyleneimine together with the following helper plasmid, packaging plasmid encoding rep / cap, and transgene plasmid: - Helper plasmid ("pHelper" containing the Ad E2A, E4 and VA RNA helper genes described in Crosson Sm et al., the map of which is shown in Figure 2B); - Packaging plasmid, where "AAV9 Cap" is the nucleotide sequence encoding the Cap polypeptide of AAV9 (SEQ ID NO: 34) and "AAV2 Rep" is the nucleotide sequence encoding the Rep polypeptide of AAV2 (SEQ ID NO: 35), the map of which is shown in Figure 2C; - Transgene plasmid, plasmids 3, 4, 5, 6, 7, 8, 10, 11, 14, 15, 16, 18 and 19, and plasmid Zol constructed in Example 1.1.
[0302] After incubation at 37 °C for 72 hours, the cells were harvested and the viral particles were purified through an iodixanol gradient (see Crosson SM et al.).
[0303] The resulting rAAVs were named SMN3, SMN4, SMN5, SMN6, SMN7, SMN8, SMN10, SMN11, SMN14, SMN15, SMN16, SMN18, SMN19 and Zolgensma, and when their titers were tested by ddPCR, all were at a level of 10 13 viral genomes (vg) / mL. In particular, ddPCR was performed using a QXDx AutoDG ddPCR system manufactured by Bio-Rad and a QXDx universal kit for the AutoDG ddPCR system according to the manufacturer's instructions.
[0304] The primers and probe for ddPCR are as follows: Forward primer: CCCACTTGGCAGTACATCAA (SEQ ID NO: 38) Reverse primer: GCCAAGTAGGAAAGTCCCATAA (SEQ ID NO: 39) Probe: CATAATGCCAGGCGGGCCATTTAC (SEQ ID NO: 40).
[0305] Example 3. Expression of hSMN1 by rAAV This example was carried out to verify the expression of hSMN1 contained in the rAAV prepared in Example 2, and the results showed an increase in the expression of hSMN1 with rAAV containing the codon-optimized coding sequence for hSMN1 of the present invention.
[0306] The rAAV prepared in Example 2 was transfected into HEK293T cells at an MOI of 1E6 at 37°C for 48 hours.
[0307] The infected cells were lysed with M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher, Catalog No.: 78501). Equal amounts of lysate (10 μg) were loaded onto an SDS-PAGE gel and electrophoresed at 200 V for 22 minutes. According to the manufacturer's instructions, the protein was transferred to a PVDF membrane using an iBlot® 2 Gel Transfer Device (Thermo Fisher Scientific) and an iBlot® 2 Transfer Stack (PVDF, Regular Size). After incubation with blocking buffer (8% milk in 1XTBST) for 1 hour and washing for 3 minutes (1 minute / wash), the membrane was probed with a primary antibody (Invitrogen MAS-15857 (2B1) SMN1 antibody (1:2,000)) in the same buffer at 4°C, then washed 3 times (1 minute / wash), and then incubated with IRDye® 800CW Donkey anti-Mouse IgG (Licor; P / N: 926-32212), (1:10,000) for 2 hours at room temperature. β-Actin serves as a housekeeping control for quantifying the relative expression of hSMN1. The immunoreaction was visualized using a Licor Odyssey® DLx imaging system. Image collection, organization, and analysis were performed on scanned images using Empiria Studio® software paired with the Odyssey DLx Imager.
[0308] As shown in Figure 6, codon optimization was effective, and rAAV SMN4, 7, 11, 16, and 19 had 3- to 5-fold higher relative expression than Zolgensma in in vitro infection studies.
[0309] Example 4. In Vivo Expression of hSMN1 by rAAV in WT Mice This example was carried out to evaluate the in vivo expression of hSMN1 by the rAAV prepared in Example 2.
[0310] rAAV SMN3, SMN5, SMN6, SMN8, SMN10, SMN11, SMN14, SMN15, SMN16, SMN18, SMN19, and Zolgensma were injected into FVB mice at postnatal day (PND) 1-2 (https: / / www.jax.org / strain / 005025) at a single IV dose of 5e10 vg / mouse (n = 5 in PBS). To evaluate the hSMN1 protein level, heart, liver, and spinal cord tissues were collected 28 days after injection.
[0311] Tissues were lysed with T-PER™ Tissue Protein Extraction Reagent (Thermo, catalog number: 78510), and 100 μl of T-per containing a protease inhibitor (Pierce™ Protease Inhibitor Mini Tablets, EDTA-free, catalog number: A32955) was added to the frozen tissues, and then followed the instructions of catalog number: 78510. 50 μg of tissue lysate was loaded for SDS-PAGE and subsequent Western blot analysis as described in Example 3.
[0312] As shown in Figure 7, rAAV SMN3 and SMN11 showed the lowest expression in the heart (Figure 7A), the hSMN1 expression of rAAV containing the codon-optimized construct in the liver was similar to that of Zolgensma (Figure 7B), and rAAV SMN11 showed the highest expression in the spinal cord (Figure 7C).
[0313] Example 5. In Vivo Expression of hSMN1 by rAAV in an SMA Model This example was carried out to investigate the expression level of hSMN1 by rAAV in the SMNΔ7 mouse model, which is a widely used SMA disease model.
[0314] At PND1 - 2 (n = 7), neonatal SMNΔ7 mice (https: / / www.jax.org / strain / 005025) were injected with rAAV SMN6, SMN8, and SMN11 and the Zolgensma construct at a single IV dose of 5e10 vg / mouse (in PBS).
[0315] Fourteen days after injection, heart, liver, and spinal cord tissues were collected from the injected mice, and the hSMN1 protein level was evaluated by Western blot as described in Example 4.
[0316] As shown in Figure 8, rAAV SMN6, SMN8, and SMN11 achieved higher hSMN1 expression in the spinal cord than Zolgensma and significantly lower hSMN1 expression in both the liver and heart. rAAV SMN11 achieved the highest hSMN1 expression in the spinal cord. Since overexpression of SMN1 in the liver and heart can cause undesirable effects, SMN11 was designated as the most codon - optimized hSMN1 construct for further development.
[0317] Example 6. Optimization of other elements of the rAAV genome This example was carried out to achieve an improved rAAV for the treatment of SMA based on rAAV SMN11.
[0318] 6.1. Construction of modified transgene plasmids Modified transgene plasmids were constructed by replacing elements such as the promoter, intron, and polyA signal in plasmid 11 by Gibson assembly. The elements in plasmid 11 and the modified transgene plasmids are shown in Table 1.
[0319]
Table 1
[0320] 6.2. Preparation of rAAV Using the rAAV vector as the transgene plasmid, plasmids 11-1, 11-2, 11-3 and 11-4 were prepared in the same manner as described in Example 2, and the obtained rAAVs were named SMN11-1, SMN11-2, SMN11-3 and SMN11-4, respectively.
[0321] 6.3. In vivo expression of hSMN1 by rAAV rAAVSMN11-1, SMN11-2, SMN11-3 and SMN11-4 and Zolgensma were IV injected (single dose) into neonatal FVB mice at PND1-2. The dosing regimen is shown in Table 2 (n = 6).
[0322]
Table 2
[0323] Twenty-eight days after injection, tissues (heart, liver, and spinal cord) were collected and the expression levels of human SMN1 were analyzed. In particular, hSMN1 mRNA levels were detected. Using samples from major peripheral and CNS tissues, an RT-qPCR method has been developed and validated. Total RNA was isolated using the QIAGEN RNeasy Mini kit with minor modifications using Qiazol and chloroform. The concentration of total RNA was measured by Nanodrop. For RT-qPCR analysis, 1 μg of total RNA was used with the QuantiTect Reverse Transcription kit 400 (Catalog number 205314) including a genomic DNA removal step, and rapid RT-PCR was performed. To perform qPCR, cDNA was combined with a qPCR reaction mixture (TaqMan Gene Expression Master Mix, 4369016), a codon-optimized hSMN1 transgene sequence (CosMN11), and primers and probes corresponding to the housekeeping gene GAPDH (see Table 3). Briefly, using 120 ng of total cDNA, qPCR was performed in triplicate in a 10 μl reaction volume in a 384-well plate with TaqMan Gene Expression Master Mix (Thermos Fisher Scientific) and 900 nM of each primer and 450 nM of the probe. The reaction was carried out using a QuantStudio™ Real-Time PCR System. The relative mRNA expression of hSMN1 normalized to the housekeeping gene GAPDH was reported.
[0324]
Table 3
[0325] As shown in FIG. 9, the results actually suggested that the combinations had a substantial impact on the expression of hSMN1 in various tissues. In particular, rAAV containing promoter 2 achieved the highest hSMN1 expression in the spinal cord, and among these, rAAV containing promoter 2 and intron 2 achieved the highest expression, which was approximately 2 to 3 times greater than that of Zolgensma. rAAV containing promoter 1 achieved a higher expression than Zolgensma but a lower expression than rAAV containing promoter 2 (FIG. 9C). With regard to liver and heart expression, the rAAV of the present invention showed lower (but significant) levels than Zolgensma (FIGS. 9A and 9B).
[0326] Overexpression of hSMN1 in the heart and liver may cause undesirable effects. Therefore, although the low but functional expression may be safer, it may still be effective in rescuing the SMA phenotype in the heart and liver.
[0327] In addition, the expression level of hSMN1 mRNA is dose-dependent, and the fact that the expression level is higher than that of Zolgensma at the same dose suggests that it is possible to transduce motor neurons in the spinal cord using a low dose, reducing their degeneration and death, thereby delaying the onset of the disease or even curing the disease.
[0328] Based on the above results, the combination of CoSMN11 (SEQ ID NO: 11), promoter 2 (SEQ ID NO: 31) and intron 2 (SEQ ID NO: 29) was designated as the lead transgene.
[0329] Sequence SEQ ID NO: 1 WT hSMN1
Chemical Structure
Chemical Structure
Chemical Structure
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Claims
1. A recombinant adeno-associated virus (rAAV) comprising a genome that includes an expression construct comprising a polynucleotide of interest that contains a nucleotide sequence selected from SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 and is operably linked to a promoter.
2. The rAAV according to claim 1, wherein the construct further comprises an intron.
3. The rAAV according to claim 2, wherein the intron is between the promoter and the polynucleotide of interest.
4. The rAAV according to claim 2 or 3, wherein the intron contains a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24 and 29.
5. The rAAV according to any one of claims 1 to 4, wherein the construct further comprises an enhancer.
6. The rAAV according to claim 5, wherein the enhancer is upstream of the promoter.
7. The rAAV according to claim 5 or 6, wherein the enhancer contains the nucleotide sequence of SEQ ID NO:
22.
8. The rAAV according to any one of claims 1 to 7, wherein the promoter contains a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 28, and 31.
9. A pharmaceutical composition comprising the rAAV according to any one of claims 1 to 8.
10. The rAAV according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 for use in the treatment of a disease associated with a deficiency of the SMN1 gene.
11. The rAAV or pharmaceutical composition according to claim 10, wherein the disease is spinal muscular atrophy (SMA).
Citation Information
Patent Citations
Recombinant adeno-associated virus vectors for gene delivery
JP2022515338A
Viral vector constructs for delivery of nucleic acids encoding cytokines and uses thereof for treating cancer
US20220162638A1
Recombinant adeno-associated viruses encoding serpin peptides and uses thereof
WO2019173707A1
Producer viruses for generation of retroviruses in situ
WO2021076998A1
Recombinant CDKL5 proteins, gene therapy and production methods
WO2021087282A1