Nanoimprint lithography resin composition

The incorporation of a fluorinated monomer with limited miscibility in nanoimprint lithography resins addresses surface migration issues, improving pattern replication fidelity and device cleanliness, thus extending the lifespan of imprint devices.

JP2025522670APending Publication Date: 2025-07-17ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024563983
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-30
Filing Date
2023-06-28
Publication Date
2025-07-17

AI Technical Summary

Technical Problem

Fluorinated monomers in nanoimprint lithography resins tend to migrate to the surface, reducing surface energy and causing deposits on imprint devices, which can lead to device contamination and reduced lifespan.

Method used

Incorporating a fluorinated monomer with limited miscibility into the resin composition, allowing it to migrate to the surface and reduce surface energy, facilitating easy removal from the imprint device while maintaining high-pattern replication fidelity.

Benefits of technology

The fluorinated monomer enhances the ability to replicate patterns with high reproducibility and prevents device contamination, extending the lifespan of imprint devices by ensuring easy resin removal.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025522670000055
    Figure 2025522670000055
  • Figure 2025522670000056
    Figure 2025522670000056
  • Figure 2025522670000057
    Figure 2025522670000057
Patent Text Reader

Abstract

An exemplary nanoimprint lithography (NIL) resin composition contains a total of three monomers, two of the three monomers being selected from the group consisting of two different epoxy-substituted silsesquioxane monomers, two different epoxy-substituted cyclotrisiloxane monomers, and two different non-organosilicon epoxy monomers. The third of the three monomers is a fluorinated monomer present in an amount in the range of about 0.5 wt% to about 4 wt% based on the total solids of the NIL resin composition. The NIL resin also contains a photoinitiator and a solvent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] (Cross - Reference to Related Applications) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 357,501, filed on June 30, 2022, the content of which is incorporated herein by reference in its entirety.

[0002] Reference to Sequence Listing The sequence listing submitted herewith and attached to this specification is incorporated herein by reference in its entirety. The file name is ILI248BPCT_IP - 2374 - PCT_Sequence_Listing.xml, the file size is 13,697 bytes, and the file creation date is June 17, 2023.

Background Art

[0003] Nanoimprint technology enables the economic and efficient production of nanostructures. Nanoimprint lithography uses direct mechanical deformation of a material by a stamp having a nanostructure. The material is cured while the stamp is in a predetermined position to fix the shape of the nanostructure in the material. Nanoimprint lithography has been used to fabricate patterned substrates, and in many cases, the nanoimprinted material becomes a permanent feature or component of the patterned substrate.

Summary of the Invention

[0004] The nanoimprint lithography resin disclosed in this specification contains a fluorinated monomer. The fluorinated monomer has limited miscibility with other monomers in the resin composition (e.g., silsesquioxane monomer, cyclosiloxane monomer, or non-organosilicon epoxy monomer), and thus, the fluorinated monomer tends to migrate to the surface of the resin when the fluorinated monomer is in a solid state, for example, when the solvent is removed after coating it. The presence of the fluorinated monomer on the surface of the coated resin reduces its surface energy. The lower surface energy contributes to i) the ability of the resin to replicate the pattern of an imprint device (e.g., a working stamp, mold, or die) with high-performance reproducibility, and ii) the ability of the resin to be easily removed from the imprint device and thus avoid deposits on the imprint device. By maintaining a clean and deposit-free imprint device, the lifespan of the imprint device should be extended.

[0005] The fluorinated monomer is also unexpectedly compatible with polymer hydrogel attachment, primer grafting, clustering, and sequencing. In particular, the fluorinated monomer binds strongly to the polymer hydrogel and can withstand multiple sequencing cycles.

Brief Description of the Drawings

[0006] The features of the examples of the present disclosure will become apparent by referring to the following detailed description and the drawings, in which like reference numerals, though they may not be the same, correspond to similar components. For the sake of brevity, reference numerals or features having the aforementioned functions may or may not be described in connection with other drawings in which they appear.

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 1E

Figure 2

Figure 3

Figure 4

Figure 5A

Figure 5B

Figure 6A

Figure 6B

Mode for Carrying Out the Invention

[0007] In nanoimprint lithography, a resin composition (including a polymerizable polyfunctional monomer) is deposited on a substrate. The deposited resin composition is pattern-formed by an imprint apparatus, and the imprint apparatus is pressed against the resin surface. The resin composition deforms to fill the imprint apparatus pattern. While the imprint apparatus is still in contact with the resin composition, polymerization of the resin composition is initiated by exposure to light or heat, and the resin cures. After the resin composition is sufficiently crosslinked and can no longer flow, the imprint apparatus is peeled from the surface, leaving the imprinted resin surface. When nanoimprinting is successful, the features of the imprint apparatus are transferred to the cured resin. In some examples, the features (e.g., recesses or trenches) can then be functionalized with surface chemistries that enable fluorescence-based sequencing, analyte detection, etc.

[0008] In the examples disclosed herein, the resin composition includes a fluorinated monomer that has limited miscibility with other monomers in the resin composition and can thus function as a surface additive. In particular, the fluorinated monomer has a tendency to migrate to the surface of the resin when the fluorinated monomer is in a solid state, reducing its surface energy. The lower surface energy contributes to i) the resin's ability to replicate the imprint apparatus pattern with high performance reproducibility, and ii) the resin's ability to be easily removed from, and thus keep clean, the imprint apparatus.

[0009] Definitions The terms used herein are to be understood as having their ordinary meaning in the relevant art, unless otherwise specified. Several other terms are used herein. The meanings of these additional terms are described below.

[0010] The singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

[0011] The terms "comprising", "including", "containing", and various forms of these terms are synonymous with each other and are meant to be equally broad.

[0012] To describe the flow cell and / or various components of the flow cell, the terms "top", "bottom", "lower", "upper", "on", "adjacent", etc. are used herein. It should be understood that these terms indicating directions do not mean to indicate a specific orientation, but are used to specify the relative orientation between components. The use of terms indicating directions is not to be construed as limiting the examples disclosed herein to any specific orientation.

[0013] Terms such as "first", "second", etc. also do not mean to indicate a specific orientation or order, but rather are used to distinguish one component from another.

[0014] It should be understood that the ranges provided herein include the recited range and any value or sub-range within the recited range as if such values or sub-ranges were expressly recited. For example, the range of about 400 nm to about 1 μm (1000 nm) includes not only the expressly recited limitation of about 400 nm to about 1 μm, but also individual values such as about 708 nm, about 945.5 nm, etc., and sub-ranges such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Further, when "about" and / or "substantially" are used to describe a value, they are meant to encompass minor variations (up to ±10%) of the recited value.

[0015] "Acrylamide" has the structure

[0016]

Chemical Formula

[0017]

Chem.

[0018]

Chem.

[0019] As used herein, the term "acrylate" refers to the "CH2=CHCOO-" functional group (i.e.,

[0020]

Chem.

[0021] As used herein, "aldehyde" is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) having a carbon atom bonded to hydrogen and an R group such as alkyl or other side chains. The general structure of an aldehyde is

[0022]

Chem.

[0023] As used herein, "alkyl" refers to a straight-chain or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). An alkyl group may have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. By way of example, the notation "C1-C4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl. Alkyl may be either substituted or unsubstituted. An example of a substituted alkyl is haloalkyl, or alkyl substituted with halogen.

[0024] As used herein, "alkylamino" refers to an alkyl group in which one or more of the hydrogen atoms are replaced by an amino group, and the amino group refers to a -NR a R b group, where R a and R b are each independently selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 carbocycle, C6-C10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle.

[0025] As used herein, "alkylamide" refers to an alkyl group in which one or more of the hydrogen atoms are replaced by a C-amide group or an N-amide group. The "C-amide" group refers to a "-C(=O)N(R a R b )" group, where R a and R b are independently selected from the group consisting of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicycle, aralkyl, or (heteroalicyclic)alkyl. The "N-amide" group refers to an "RC(=O)N(R a )-" group, where R and R amay independently be selected from the group consisting of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicycle, aralkyl, or (heteroalicyclic)alkyl. Any alkylamide may be substituted or unsubstituted.

[0026] As used herein, "alkylthio" refers to RS-, where R is alkyl. Alkylthio may be substituted or unsubstituted.

[0027] As used herein, "alkene" or "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group may have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0028] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group may have 2 to 20 carbon atoms.

[0029] The "amine" or "amino" functional group refers to the -NR a R b group, where R a and R b are each independently selected from hydrogen (e.g.,

[0030]

Chemical formula

[0031] As used herein, "aralkyl" and "aryl(alkyl)" refer to an aryl group bonded as a substituent via a lower alkylene group. The lower alkylene group and the aryl group of the aralkyl may be substituted or unsubstituted. Examples include, but are not limited to, benzyl, 2-phenylalkyl, 3-phenylalkyl, and naphthylalkyl.

[0032] The term "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent carbon atoms) containing only carbon in the ring skeleton. When the aryl is a ring system, all rings within the system are aromatic. An aryl group can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl. Any aryl can be a heteroaryl having at least one heteroatom, i.e., an element other than carbon (e.g., nitrogen, oxygen, sulfur, etc.) in the ring skeleton.

[0033] As used herein, the term "attached" refers to a state in which two things are joined, fastened, adhered, connected, or coupled to each other either directly or indirectly. For example, a nucleic acid strand can be attached to a polymer hydrogel by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a physical bond without the sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0034] The "azide" or "azido" functional group refers to -N3.

[0035] As used herein, "carbocyclic ring" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocyclic ring is a ring system, two or more rings can be joined together in a fused, bridged, or spiro linkage fashion. The carbocyclic ring can have any degree of saturation, provided that at least one ring within the ring system is not aromatic. Thus, carbocyclic rings include cycloalkyl, cycloalkenyl, and cycloalkynyl. The carbocyclic group can have 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl. Any of the carbocyclic rings can be a heterocyclic ring having at least one heteroatom in the ring backbone.

[0036] As used herein, "cycloalkyl" refers to a monocyclic or polycyclic hydrocarbon ring system that is completely saturated (has no double or triple bonds). When composed of two or more rings, the rings can be joined together in a fused fashion. The cycloalkyl group can contain 3 to 10 atoms in the ring. In some examples, the cycloalkyl group can contain 3 to 8 atoms in the ring. The cycloalkyl group can be unsubstituted or substituted. Exemplary cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

[0037] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, and none of the rings within the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene.

[0038] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclic ring or ring system having at least one triple bond, and none of the rings within the ring system are aromatic. One example is cyclooctyne. Another example is bicyclononyne. Yet another example is dibenzocyclooctyne (DBCO).

[0039] As used herein, the term "deposition" can be manual or automatic and, in some instances, refers to any suitable application technique that results in modification of surface properties. Deposition can be carried out using vapor deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0040] As used herein, the term "recess" refers to a discontinuous concave feature in a patterned resin having a surface opening at least partially surrounded by a gap region of the cured resin. The recess can have any of a variety of shapes at the opening of the surface, including, by way of example, circular, elliptical, square, polygonal, star-shaped (having any number of vertices). The cross-section of the recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angled, etc. The recess can also have a more complex architecture such as ridges, step features, etc. A recess is an example of a feature that can be formed using nanoimprint lithography. Another example of such a feature is a trench / trough.

[0041] When used with reference to a set of items, the term "each" is intended to identify individual items within the set, but does not necessarily refer to all items within the set. Exceptions can occur where an explicit disclosure or context clearly indicates otherwise.

[0042] As used herein, the term "epoxy" refers to

[0043] [Chemical formula] .

[0044] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can occur, an inlet for delivering a reagent to the flow channel, and an outlet for removing the reagent from the flow channel. In some examples, the flow cell enables detection of a reaction occurring within the flow channel. For example, the flow cell can include one or more transparent surfaces that enable optical detection, such as an array or optically labeled molecules, within the flow channel.

[0045] As used herein, "flow channel" or "channel" can be a region defined between two joined components that can selectively receive a liquid sample. In the examples disclosed herein, the flow channel can be defined between a patterned substrate and a lid and, thus, can be in fluid communication with one or more recesses defined in the patterned substrate or resin. The flow channel can also be defined between two joined patterned substrate surfaces.

[0046] As used herein, "heteroalicyclic" or "heteroalicyclic ring" refers to monocyclic, bicyclic, and tricyclic ring systems of 3, 4, 5, 6, 7, 8, 9, 10, up to 18 members, wherein the carbon atoms together with 1 to 5 heteroatoms constitute the ring system. However, the heteroalicyclic ring system may optionally contain one or more unsaturated bonds positioned in such a manner that a completely delocalized π-electron system does not occur throughout all of the rings. The heteroatoms are independently selected from oxygen, sulfur, and nitrogen. The heteroalicyclic ring system may further contain one or more carbonyl or thiocarbonyl functional groups such that its definition includes oxo- and thio-based systems such as lactams, lactones, cyclic imides, cyclic thioimides, and cyclic carbamates. The rings may be joined together in a fused manner. Additionally, any nitrogen in the heteroalicyclic may be quaternized. The heteroalicyclic or heteroalicyclic group may be unsubstituted or substituted. Examples of such "heteroalicyclic" or "heteroalicyclic" groups include 1,3-dioxin, 1,3-dioxane, 1,4-dioxane, 1,2-dioxolane, 1,3-dioxolane, 1,4-dioxolane, 1,3-oxathiane, 1,4-oxathiin, 1,3-oxathiolane, 1,3-dithiol, 1,3-dithiolane, 1,4-oxathiane, tetrahydro-1,4-thiazine, 2H-1,2-oxazine, maleimide, succinimide, barbituric acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro-1,3,5-triazine, imidazoline, imidazolidine, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, oxirane, piperidine N-oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidione, 4-piperidone, pyrazoline, pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran, thiamorpholine, thiamorpholine sulfoxide, thiamorpholine sulfone, and their benzofused analogs (e.g., benzimidazolidinone, tetrahydroquinoline, 3,4-methylenedioxyphenyl).

[0047] "(Heteroalicyclic)alkyl" refers to a heterocyclic or heteroalicyclic group bonded as a substituent via a lower alkylene group. The lower alkylene and heterocyclic ring, or heterocyclic rings, of (heteroalicyclic)alkyl may be substituted or unsubstituted. Examples include, but are not limited to, (tetrahydro-2H-pyran-4-yl)methyl, (piperidin-4-yl)ethyl, (piperidin-4-yl)propyl, (tetrahydro-2H-thiopyran-4-yl)methyl, and (1,3-thiazinan-4-yl)methyl.

[0048] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms, i.e., elements other than carbon, including but not limited to nitrogen (N), oxygen (O), and sulfur (S) in the ring skeleton. When heteroaryl is a ring system, all rings within the system are aromatic. The heteroaryl group may have 5 to 18 ring members.

[0049] As used herein, "heterocyclic" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring skeleton. The heterocyclic rings may be joined together in a fused, bridged, or spiro linkage fashion. The heterocyclic rings may have any degree of saturation, provided that at least one ring within the ring system is not aromatic. Within the ring system, the heteroatoms may be present in either non-aromatic or aromatic rings. The heterocyclic group may have 3 to 20 ring members (i.e., the number of atoms forming the ring skeleton, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N, or S.

[0050] As used herein, the term "hydrazine" or "hydrazinyl" refers to the -NHNH2 group.

[0051] As used herein, the term "hydrazone" or "hydrazonyl" as used herein

[0052] [Chemical formula] refers to a group, wherein R a and R b are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocyclic, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclic as defined herein.

[0053] As used herein, "hydroxy" or "hydroxyl" refers to an -OH group.

[0054] As used herein, an "initiator" is a molecule that undergoes a reaction upon absorption of radiation or heat or upon exposure to free radicals, thereby generating reactive species. An initiator can initiate or catalyze a chemical reaction that results in a change in the solubility and / or physical properties of a formulation. A "cationic initiator" or "photoacid generator" (PAG) is a molecule that becomes acidic upon exposure to radiation or free radicals. A PAG generally undergoes irreversible photodissociation of a proton. A "free radical initiator" is a molecule that generates radical species upon exposure to radiation or heat and promotes radical reactions.

[0055] As used herein, the term "gap region" refers to an area on a surface (e.g., of a cured and patterned resin) that separates recesses or other features. For example, a gap region can separate one feature of an array from another feature of the array. Two features that are separated from each other can be discontinuous, i.e., not physically in contact with each other. In another example, a gap region can separate a first feature portion from a second feature portion. In many examples, the gap region is continuous, but the features are discontinuous, as in the case of a plurality of recesses defined on a surface that is otherwise continuous. In other examples, the gap region and the features are discontinuous, as in the case of a plurality of trenches separated by respective gap regions. The separation provided by the gap region can be partial or complete. The gap region can have a surface material different from that of the feature's surface material. For example, the features of an array can have an amount or concentration of a polymer hydrogel and a primer that exceeds the amount or concentration present in the gap region. In some examples, the polymer hydrogel and the primer may not be present in the gap region.

[0056] As used herein, the phrase "limited miscibility" means that a fluorinated monomer and other monomers do not completely mix at least to some extent. Limited miscibility can be evaluated qualitatively. For example, R-ray photoelectron spectroscopy (XPS), energy-dispersive spectroscopy (EDS), or time-of-flight secondary ion mass spectroscopy (TOF-SIMS) can be used to evaluate the accumulation of fluorinated compounds in coatings at different depths. The more significant the accumulation, the more limited the miscibility.

[0057] "Nitrile oxide", as used herein,

[0058] "R a C≡N + O- "] means a group, in which R a is defined herein. Examples of the preparation of nitrile oxides include in-situ generation from aldoximes by treatment with chloramine-T, or by base action on imidoyl chlorides [RC(Cl)=NOH], or by reaction of hydroxylamine with aldehydes.

[0059] "Nitrone", when used herein,

[0060]

Chemical formula

[0061] When used herein, "nucleotide" contains a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In RNA (ribonucleic acid), the sugar is ribose, and in DNA (deoxyribonucleic acid), the sugar is deoxyribose, that is, a sugar lacking the hydroxyl group present at the 2'-position of ribose. The nitrogen-containing heterocyclic base (i.e., nucleic acid base) can be a purine base or a pyrimidine base. Examples of purine bases include adenine (A) and guanine (G), as well as their modified derivatives or analogs. Examples of pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to N-1 of pyrimidine or N-9 of purine. Nucleic acid analogs can have changes in any of the phosphate backbone, sugar, or nucleic acid base. Examples of nucleic acid analogs include universal bases or phosphate-sugar backbone analogs such as, for example, peptide nucleic acid (PNA).

[0062] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers, which may be referred to as amplification primers, function as starting points for template amplification and cluster generation. The 5' ends of these primers can be modified to enable a coupling reaction with functional groups of the polymer hydrogel. Other primers, which may be referred to as sequencing primers, function as starting points for DNA synthesis. The length of the primer can be any number of bases and can include various unnatural nucleotides. In one example, the sequencing primer is a short strand in the range of 10 to 60 bases, or 20 to 40 bases.

[0063] The term "resin composition" refers to any of the monomer mixtures described herein. The resin composition can also include one or more initiators and solvents as defined herein.

[0064] As used herein, "spacer layer" refers to a material that binds two components together. In some examples, the spacer layer can be a radiation-absorbing material that aids in the binding or can be in contact with a radiation-absorbing material that aids in the binding. The spacer layer can be present in a binding region, e.g., a region on a substrate that is bound to another material, which can be, by way of example, a spacer layer, a lid, another substrate, etc., or a combination thereof (e.g., a spacer layer and a lid). The bond formed at the binding region can be a chemical bond (as described above) or a mechanical bond (e.g., using a fastener, etc.).

[0065] The term "thiol" functional group refers to -SH.

[0066] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a 6-membered heteroaryl group containing four nitrogen atoms. Tetrazine can be optionally substituted.

[0067] As used herein, "tetrazole" refers to a 5-membered heterocyclic group containing four nitrogen atoms. Tetrazole can be optionally substituted.

[0068] The term "ultraviolet curable" means that the polymerization or polymerization and crosslinking of the resin composition is initiated by exposure to ultraviolet light, i.e., radiation having a wavelength in the range of about 280 nm to about 400 nm.

[0069] Resin composition The nanoimprint lithography (NIL) resin composition disclosed herein comprises a total of three monomers, two of the three monomers being selected from the group consisting of two different epoxy-substituted silsesquioxane monomers, two different epoxy-substituted cyclotrisiloxane monomers, and two different non-organic silicon epoxy monomers, and the third of the three monomers being a fluorinated monomer present in an amount in the range of about 0.5 wt% to about 4 wt% based on the total solids of the NIL resin composition, a total of three monomers, a photoinitiator, and a solvent.

[0070] Each of the NIL resin compositions disclosed herein comprises a total of three monomers. "A total of three monomers" means that the monomers in the resin composition consist of two different epoxy-substituted silsesquioxane monomers or two different epoxy-substituted cyclotrisiloxane monomers or two different non-organic silicon epoxy monomers, and a fluorinated monomer. It should be understood that the fluorinated monomer is a class of organic monomers containing fluorine, and any single fluorinated monomer or any combination of fluorinated monomers may constitute the third of the three monomers. The NIL resin does not contain monomers other than two different epoxy-substituted silsesquioxane monomers or two different epoxy-substituted cyclotrisiloxane monomers or two different non-organic silicon epoxy monomers, and a fluorinated monomer.

[0071] In one example of the NIL resin composition, two different epoxy-substituted polyhedral oligomeric silsesquioxane monomers are used. As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate (e.g., RSiO 1.5 ) between silica (SiO2) and silicone (R2SiO). Some polyhedral oligomeric silsesquioxanes are commercially available as POSS (registered trademark) from Hybrid Plastics. An example of a polyhedral oligomeric silsesquioxane can be that described in Kehagias et al., Microelectronic Engineering 86(2009), pp.776-778, which is incorporated herein by reference in its entirety. In the examples disclosed herein, the composition is an organosilicon compound having the chemical formula [RSiO 3 / 2 n , wherein the R groups may be the same or different as long as one of the R groups is epoxy. Other exemplary R groups include azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups.

[0072] In one example, two of the three monomers are two different epoxy-substituted silsesquioxane monomers, and the two different epoxy-substituted silsesquioxane monomers are epoxycyclohexylethyl polysilsesquioxane,

[0073]

Chemical formula

[0074]

Chemical formula

[0075] ​Two different epoxy-substituted silsesquioxane monomers may be present in a mass ratio in the range of about 3:7 to about 7:3. In one specific example, the mass ratio of epoxycyclohexylethyl polysilsesquioxane to glycidyl polysilsesquioxane is 1.5:1.

[0076] In another example of the NIL resin composition, two different epoxy-substituted cyclopolysiloxane monomers are used. As used herein, the term "epoxy-substituted cyclopolysiloxane" refers to a monomer having three or more repeating units of silicon and oxygen in a closed loop or ring, and the ring is functionalized with an epoxy-containing functional group. Within the ring, the Si:O ratio is 1:1.

[0077] In one specific example, two of the three monomers are two different epoxy-substituted cyclopolysiloxane monomers, and the two different epoxy-substituted cyclopolysiloxane monomers are epoxycyclohexyltetramethylcyclotetrasiloxane:

[0078]

Chemical formula

[0079]

Chemical formula

[0080]

Chemical formula

[0081] In yet another example of the NIL resin composition, two different non-organosilicon epoxy monomers are used. A non-organosilicon epoxy monomer is an epoxy monomer that does not contain an O-Si-O bond.

[0082] In one specific example, two of the three monomers are two different non-organosilicon epoxy monomers, and the two different non-organosilicon epoxy monomers are independently i) Trimethylolpropane triglycidyl ether:

[0083]

Chem.

[0084]

Chem.

[0085]

Chem.

[0086]

Chem.

[0087]

Chem.

[0088]

Chem.

[0089] [Chemical formula] viii) Poly(ethylene glycol) diglycidyl ether:

[0090] [Chemical formula] (where n ranges from 1 to 100); ix) Pentaerythritol glycidyl ether:

[0091] [Chemical formula] x) Diglycidyl 1,2-cyclohexanedicarboxylate:

[0092] [Chemical formula] xi) Tetrahydrophthalic acid diglycidyl ester:

[0093] [Chemical formula] xii) 1,2-Epoxy-3-phenoxypropane:

[0094] [Chemical formula] and xiii) Glycidyl methacrylate:

[0095] [Chemical formula] It is selected from the group consisting of. In one example, the two different non-organic silicon epoxy monomers are trimethylolpropane triglycidyl ether and 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate. The two different non-organic silicon epoxy monomers can be present in a mass ratio in the range of about 4:1 to about 1:4. In one specific example, the mass ratio of the first non-organic silicon epoxy monomer to the second non-organic silicon epoxy monomer is 1:1.

[0096] In any of the NIL resin compositions, the total amount of two different epoxy-substituted silsesquioxane monomers or two different epoxy-substituted cyclosiloxane monomers or two different non-organic silicon epoxy monomers is in the range of about 61% to less than 100% by mass based on the total solids in the resin composition. The total amount of the two different monomers depends on other solids present in the NIL resin composition, such as fluorinated monomers and initiators. In one example, the two different monomers together constitute about 67% to about 90% by mass of the total solids in the resin composition.

[0097] The third monomer of the three monomers is a fluorinated monomer. Any fluorinated organic monomer having limited miscibility with the epoxy-containing monomer can be used. As described above, the limited miscibility contributes to the migration of the fluorinated monomer to the surface of the resin composition when the fluorinated monomer is in the solid state, which reduces the surface energy of the cured resin composition. Additionally, a part of the fluorinated monomer has a reactive group (e.g., an epoxy group) that polymerizes when exposed to ultraviolet (UV) light. Thus, in addition to being able to migrate to the surface of the resin composition, the reactive groups of the fluorinated monomer can react with each other or with the reactive groups of other monomers at or near the surface of the resin composition. The ability of the fluorinated monomer to participate in polymerization and crosslinking increases the robustness of the cured resin composition.

[0098] The fluorinated monomer is 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(oxirane):

[0099] [Chem.] Glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether:

[0100] [Chem.] Glycidyl 2,2,3,3-tetrafluoropropyl ether:

[0101] [Chem.] (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)oxirane:

[0102] [Chem.] (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)oxirane:

[0103] [Chem.] 2,2,3,3,4,4,5,5,6,7,7,7-dodeca-fluoro-6-(trifluoromethyl)heptyl]oxirane:

[0104] [Chem.] 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecafluoro-8-(trifluoromethyl)nonyl]oxirane:

[0105] [Chem.] (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11 - Henicosafluoroundecyl)oxirane:

[0106] [Chemical formula] and is selected from the group consisting of those combinations.

[0107] Regardless of whether one fluorinated monomer or a combination of fluorinated monomers is selected as the third monomer, the total amount of the fluorinated monomer ranges from about 0.5% by mass to about 4% by mass based on the total solids of the NIL resin composition. In one example, the total amount of the fluorinated monomer is about 1.6% by mass based on the total solids of the NIL resin composition.

[0108] The NIL resin composition also contains a photoinitiator. The photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof. Examples of free radical initiators are 1,1,2,2 - tetraphenyl - 1,2 - ethanediol:

[0109] [Chemical formula] Ethyl pyruvate:

[0110] [Chemical formula] 4 - Cyano - 4 - (phenylcarbonothioylthio)pentanoic acid:

[0111] [Chemical formula] Ethyl - 3 - methyl - 2 - oxobutanoate:

[0112] [Chemical formula] selected from the group consisting of and combinations thereof. Examples of cationic initiators are bis-(4-methylphenyl)iodonium hexafluorophosphate:

[0113]

Chemical formula

[0114]

Chemical formula

[0115]

Chemical formula

[0116]

Chemical formula

[0117] In one example of the NIL resin composition, the photoinitiator (or each photoinitiator if a combination is used) is present in an amount in the range of about 1% to about 26% by mass based on the total solids of the resin composition.

[0118] When a combination of a free radical initiator and a cationic initiator is used, the free radicals generated by the free radical initiator react with the cationic initiator / photoacid generator, which decomposes to generate a superacid, which in turn initiates the polymerization and crosslinking of the epoxy group-containing monomer. An example of a combination of a free radical initiator and a cationic initiator is ethyl pyruvate and bis-(4-methylphenyl)iodonium hexafluorophosphate. In this particular example, the amount of ethyl pyruvate ranges from about 1% to about 5% by weight, and the amount of bis-(4-methylphenyl)iodonium hexafluorophosphate ranges from about 3% to about 7% by weight.

[0119] In some examples, combinations of different cationic initiators are used. In these examples, it is believed that either or both of the cationic initiators behave as both a photoacid generator and a radical initiator. An example of a combination of cationic initiators is bis-(4-methylphenyl)iodonium hexafluorophosphate and PAG290. In this particular example, the amount of bis-(4-methylphenyl)iodonium hexafluorophosphate ranges from about 3% to about 7% by weight, and the amount of PAG290 ranges from about 1% to about 2% by weight.

[0120] Any example of the NIL resin composition disclosed herein may also include a solvent. The solvent can be added to the NIL resin composition to achieve the desired viscosity for the deposition technique used to apply the resin composition. Examples of suitable solvents include propylene glycol monomethyl ether acetate (PGMEA), toluene, dimethyl sulfoxide (DMSO), tetrahydrofuran (THF), and the like. In some examples, the solvent is PGMEA.

[0121] When a solvent is added, the total solid concentration of the NIL resin composition can range from about 15% to about 60% by mass (based on the total mass of the resin composition), and the amount of the solvent can range from about 40% to about 85% by mass (based on the mass of the resin composition). The upper limit of the total solids may be higher depending on the solubility of each of the solid components in the selected solvent. In some examples, the solid content is about 30% or less.

[0122] The NIL resin composition is ultraviolet curable. In one example, a 365 nm UV light source can be used to cure the NIL resin composition.

[0123] To produce the NIL resin, various components can be mixed together in any desired order. An example of a method for preparing any example of the NIL resin composition disclosed herein includes mixing monomers (i.e., two different epoxy silsesquioxane monomers, or two different epoxy cyclopolysiloxane monomers, or two different non-organosilicon epoxy monomers, and a fluorinated monomer), adding an initiator to the monomer mixture, and dissolving the mixture in a solvent. Another example of a method for preparing any example of the NIL resin composition disclosed herein includes mixing monomers (i.e., two different epoxy silsesquioxane monomers, or two different epoxy cyclopolysiloxane monomers, or two different non-organosilicon epoxy monomers, a fluorinated monomer) and an initiator to produce a mixture, and dissolving the mixture in a solvent. Yet another example of a method for preparing any example of the NIL resin composition disclosed herein includes mixing a fluorinated monomer and an initiator to produce a mixture, adding other monomers (i.e., two different epoxy silsesquioxane monomers, or two different epoxy cyclopolysiloxane monomers, or two different non-organosilicon epoxy monomers) to the mixture, and dissolving the mixture in a solvent.

[0124] Flow Cell and Method Any example of the NIL resin composition disclosed herein can be used for the formation of a flow cell. The NIL resin composition can be pattern-formed using nanoimprint lithography to generate the characteristics of the flow cell. An example of the patterning method is schematically shown in FIGS. 1A to 1C. The obtained flow cell surface (shown in FIG. 2) includes a substrate and a cured and pattern-formed resin on the substrate. The cured and pattern-formed resin includes recesses separated by gap regions, and the cured and pattern-formed resin includes a cured form of the NIL resin composition disclosed herein. In other words, the cured and pattern-formed resin is formed from an example of the NIL resin composition disclosed herein. Some examples of the method further include functionalizing the recesses for specific applications such as sequencing. An example of the functionalization of the recesses is shown in FIGS. 1D to 1E.

[0125] FIG. 1A depicts a substrate 12, and FIG. 1B depicts an example of the NIL resin composition 10 deposited on the substrate 12.

[0126] Examples of suitable substrates 12 include epoxy siloxane, glass, modified or functionalized glass (e.g., silanized glass), plastics (acrylic, polystyrene, and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (e.g., TEFLON® manufactured by Chemours), cyclo-olefin polymer (COP) (e.g., ZEONOR® manufactured by Zeon), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon, silanized silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5), or other tantalum oxides (TaO x )), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc. The substrate 12 can be glass or silicon having a coating layer of tantalum oxide or another ceramic oxide on the surface.

[0127] Some examples of the substrate 12 may have surface - bound silanes attached to the substrate 12, and the silanes can react with the cured resin composition components to attach the cured resin composition 20 to the substrate 12. An example of an epoxy adhesion promoter is a norbornene silane such as [(5 - bicyclo[2.2.1]hept - 2 - enyl)ethyl]trimethoxysilane.

[0128] In one example, the substrate 12 can be a circular sheet, panel, wafer, die, etc. having a diameter in the range of about 2 mm to about 300 mm, such as about 200 mm to about 300 mm, or a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). As an example, the die can have a width in the range of about 0.1 mm to about 10 mm. Although exemplary dimensions are provided, it should be understood that the substrate 12 can have any suitable dimensions.

[0129] The NIL resin composition 10 can be any of the examples described herein. The NIL resin composition 10 can be deposited on the substrate 12 using any suitable application technique, which can be manual or automatic. As an example, the deposition of the NIL resin composition 10 can be carried out using vapor deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, droplet dispensing, aerosol printing, screen printing, microcontact printing, inkjet printing, etc. In one example, spin coating is used.

[0130] Next, the deposited NIL resin composition 10 is patterned using any suitable patterning technique. In the example shown in FIG. 1B, nanoimprint lithography is used to pattern the NIL resin composition 10. After the NIL resin composition 10 is deposited, the NIL resin composition 10 may be soft-baked to remove excess solvent and / or improve resin composition / substrate adhesion. When performed, the soft bake may be performed at a relatively low temperature in the range of about 50° C. to about 150° C. for more than 0 seconds to about 3 minutes after the NIL resin composition 10 is deposited and before the working stamp 14 is positioned within the NIL resin composition 10. In one example, the soft bake time ranges from about 30 seconds to about 2.5 minutes.

[0131] As illustrated in FIG. 1B, an imprint apparatus 14 (e.g., a mold or working stamp) for nanoimprint lithography is pressed or rolled onto the layer of the NIL resin composition 10 to create an imprint on the NIL resin composition 10. The imprint apparatus 14 includes a mold of the desired pattern to be transferred to the NIL resin composition 10. Thus, the resin composition 10 is indented or perforated by the protrusions 16 of the working stamp 14. The protrusions 16 are replicas of the reversals of the recesses or other features formed in the NIL resin composition 10. Next, the NIL resin composition 10 may be cured with the working stamp 14 in place.

[0132] For the NIL resin composition 10 disclosed herein, curing can be achieved by exposing the nanoimprinted and deposited NIL resin composition 10 to incident light at a suitable energy dose (e.g., in the range of about 0.5 J to about 10 J) for 60 seconds or less. The incident light can be actinic radiation, such as ultraviolet (UV) radiation. In one example, most of the emitted UV radiation can have a wavelength of about 365 nm. More specifically, the curing can be performed with a 365 nm ultraviolet (UV) light source, and the deposited NIL resin composition 10 is exposed to UV light for a time in the range of about 3 seconds to about 30 seconds. In this example, the 365 nm UV light source is 330 mW / cm 2It can be a light emitting diode (LED) having a power output (measured at the sample level).

[0133] In the examples disclosed herein, light energy exposure initiates the polymerization and crosslinking of the monomers in the resin composition 10. For an effective degree of curing of the NIL resin composition 10 described herein, the exposure time of the incident light can be 60 seconds or less. In some cases, the exposure time of the incident light can be 30 seconds or less. In still other cases, the exposure time of the incident light can be about 20 seconds. The curing process can include a single UV exposure step or a single heating event.

[0134] After curing, the imprint device 14 can be removed. After removal of the imprint device 14, topographical features, such as recesses 18, are defined in the cured resin composition 10'. As shown in FIG. 1C, the resin composition 10 in which the recesses 18 are defined is referred to as the cured and pattern-formed resin 10'.

[0135] At least in part, due to the efficient photopolymerization of the resin composition 10 disclosed herein, the method disclosed herein may not involve a post-cure hardbake step to obtain a fully cured film. In some cases, it may be desirable to perform a post-cure hardbake. For example, (if performed), it should be understood that the working stamp 14 is removed / released prior to hardbake so that the working stamp 14 does not adhere to the cured and pattern-formed resin composition 10'. The duration of the hardbake can be continued for about 5 seconds to about 10 minutes at a temperature in the range of about 100°C to about 300°C. The hardbake can be performed, for example, to remove residual solvent from the cured and pattern-formed resin composition 10', to further polymerize a portion of the resin composition material (and thus enhance the degree of cure), to improve adhesion and / or mechanical properties, and / or to further reduce autofluorescence. Any of the heating devices described herein can be used for the hardbake.

[0136] The chemical composition of the cured and pattern-formed resin 10’ depends on the NIL resin composition 10 used.

[0137] As shown in FIG. 1C, the cured and pattern-formed resin 10’ includes a recess 18 defined therein and a gap region 20 separating adjacent recesses 18. In the examples disclosed herein, the recess 18 is functionalized with a polymer hydrogel 22 (FIGS. 1D and 1E) and primers 24, 26 (FIGS. 1E and 2), while portions of the gap region 20 can be used for bonding but will not have the polymer hydrogel 22 or primers 24, 26 thereon.

[0138] Many different layouts of the recesses 18 can be envisioned, including regular, repetitive, and irregular patterns. In one example, the recesses 18 are arranged in a hexagonal lattice to be densely packed to improve density. Other layouts can include, for example, a rectangular layout (e.g., lines or trenches), a triangular layout, etc. In some examples, the layout or pattern can be in an x-y format of recesses 18 in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of recesses 18 and / or gap regions 20. In yet other examples, the layout or pattern can be a random arrangement of recesses 18 and / or gap regions 20. The pattern can include stripes, spirals, lines, triangles, rectangles, circles, arcs, alignment marks, lattice stripes, diagonals, arrows, squares, and / or skew parallels. In one example, the recesses 18 are wells arranged in rows and columns as shown in FIG. 1C.

[0139] The layout or pattern of the recesses 18 can be characterized in terms of the density of the recesses 18 (i.e., the number of recesses 18) within a defined area. For example, the recesses 18 can be present at a density of about 2 million per 1 mm 2 . The density can be, for example, at least about 100 per 1 mm 2 , about 1,000 per 1 mm 2 , about 100,000 per 1 mm 2 , about 1 million per 1 mm 2 , or about 2 million per 1 mm.2 Approximately 2 million per mm 2 Approximately 5 million per mm 2 Approximately 10 million per mm 2 It can be adjusted to different densities, including approximately 50 million per mm or more or less. It should be further understood that the density of the recesses 18 in the cured and pattern-formed resin 10' can be between one of the lower limit values and one of the upper limit values selected from the above ranges. As an example, a high-density array can be characterized as having recesses 18 separated by less than about 100 nm, a medium-density array can be characterized as having recesses 18 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having recesses 18 separated by more than about 1 μm. Although examples of densities have been provided, it should be understood that substrates having any suitable density can be used.

[0140] The layout or pattern of the recesses 18 can be further or alternatively characterized in terms of the average pitch, i.e., the distance between the centers of adjacent recesses 18 (center-to-center spacing), or the distance between the right end of one recess 18 and the left end of the adjacent recess 18 (end-to-end spacing). The pattern may be regular such that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch can be, for example, at least about 10 nm, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm, or more or less. The average pitch of a particular pattern of recesses 18 can be between one of the lower limit values and one of the upper limit values selected from the above ranges. In one example, the recesses 18 have a pitch (center-to-center spacing) of about 1.5 μm. Although examples of average pitch values have been provided, it should be understood that other average pitch values can be used.

[0141] The size of each recess 18 can be characterized by its volume, opening area, depth, and / or diameter, or length and width.

[0142] Each recess 18 may have any volume capable of confining a fluid. The minimum or maximum volume may be selected, for example, to correspond to the throughput (e.g., multiplicity), resolution, nucleotide, or analyte reactivity expected for use downstream of the flow cell. For example, the volume may be at least about 1×10 -3 μm 3 、 about 1×10 -2 μm 3 、 about 0.1 μm 3 、 about 1 μm 3 、 about 10 μm 3 、 about 100 μm 3 、 or more or less thereof. It should be understood that the polymeric hydrogel 22 can fill all or part of the volume of the recess 18.

[0143] The area occupied by the opening of each recess can be selected based on the same criteria as the well volume described above. For example, the area of each recess opening can be at least about 1×10 -3 μm 2 、 about 1×10 -2 μm 2 、 about 0.1 μm 2 、 about 1 μm 2 、 about 10 μm 2 、 about 100 μm 2 、 or more or less thereof. The area occupied by the opening of each recess can be greater than, less than, or between the values specified above.

[0144] The depth of each recess 18 can be large enough to accommodate a portion of the polymeric hydrogel 22. In one example, the depth can be about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more or less thereof. In some examples, the depth is about 0.4 μm. The depth of each recess 18 can be greater than, less than, or between the values specified above.

[0145] In some cases, the diameter or length and width of each recess 18 can be about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more or less than that. The diameter or length and width of each recess 18 can be greater than, less than, or between the values specified above.

[0146] After the resin composition 10 is pattern-formed and cured, the cured and pattern-formed resin 10' can be treated to prepare a surface for the application of the polymer hydrogel 22.

[0147] In one example, the cured and pattern-formed resin 10' can be exposed to silanization, thereby attaching a silane or silane derivative to the cured and pattern-formed resin 10'. Silanization introduces the silane or silane derivative over the surface, such as within the recess 18 (e.g., on the bottom surface and along the sidewalls), as well as on the gap region 20.

[0148] Silanization can be achieved using any silane or silane derivative. Since it may be desirable to form a covalent bond between the silane or silane derivative and the polymer hydrogel 22, the choice of silane or silane derivative can depend, in part, on the functionalized molecules used to form the polymer hydrogel 22 (as shown in FIG. 2). The method used to attach the silane or silane derivative to the cured and pattern-formed resin 10' can vary depending on the silane or silane derivative used. Some examples are described herein.

[0149] Examples of suitable silanization methods include vapor deposition, spin coating, or other deposition methods. Although some examples of methods and materials that can be used to silanize the cured and pattern-formed resin 10' are described herein, it should be understood that other methods and materials may be used.

[0150] The attachment of the silane or silane derivative forms a pretreated (e.g., silanized) cured and pattern-formed resin 10', which includes silanized recesses and a silanized gap region.

[0151] In other examples, the cured and patterned resin 10' may not be exposed to silanization. Rather, the cured and patterned resin 10' may be exposed to plasma ashing, and then the polymer hydrogel 22 may be spin-coated (or otherwise deposited) directly onto the plasma-ashed, cured and patterned resin 10'. In this example, plasma ashing may generate a surfactant (e.g., hydroxyl (C-OH or Si-OH, and / or carboxyl groups)) that enables the polymer hydrogel 22 to adhere to the cured and patterned resin 10'. In these examples, the polymer hydrogel 22 is selected to react with the surface groups generated by plasma ashing.

[0152] In still other examples, the cured and patterned resin 10' may contain unreacted epoxy groups, and thus may not be exposed to silanization. This is because the unreacted epoxy groups can react directly with the amino functional groups of the polymer hydrogel 22. In this example, plasma ashing may be performed, for example, if it is desirable to clean the surface of potential contaminants.

[0153] The polymer hydrogel 22 can then be applied to the pretreated cured and patterned resin 10' (as shown in FIG. 1D). The polymer hydrogel 22 can be any gel material that can swell when a liquid is absorbed and contract, for example, when the liquid is removed by drying. In one example, the polymer hydrogel 22 includes an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0154]

Chemical formula

[0155] One specific example of the acrylamide copolymer represented by Structure (I) is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide, PAZAM).

[0156] Those skilled in the art will recognize that the arrangement of the repeated "n" and "m" features in Structure (I) is representative, and that the monomer subunits can be present in any order in the polymer structure (e.g., random, block, patterning, or combinations thereof).

[0157] The molecular weight of the acrylamide copolymer can range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or in a specific example, can be about 312 kDa.

[0158] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a mildly crosslinked polymer.

[0159] In another example, the polymeric hydrogel 22 can be a modification of structure (I). In one example, the acrylamide units can be replaced with N,N-dimethylacrylamide

[0160]

Chemical formula

[0161]

Chemical formula

[0162]

Chemical formula

[0163] As another example of the polymeric hydrogel 22, the repeating "n" features in structure (I) can be replaced with a monomer containing a heterocyclic azide group having structure (II),

[0164]

Chemical formula

[0165] As yet another example, the gel material may contain repeating units of each of structures (III) and (IV):

[0166]

Chemical formula

[0167] In yet another example, the acrylamide copolymer is formed using nitroxide-mediated polymerization, and thus at least a portion of the copolymer chains have alkoxyamine end groups. In the copolymer chain, the term "alkoxyamine end group" refers to the dormant species -ONR1R2, where each of R1 and R2 may be the same or different and independently may be linear or branched alkyl, or a cyclic structure, and the oxygen atom is attached to the remainder of the copolymer chain. In some examples, the alkoxyamine may also be introduced into a portion of the repeating acrylamide monomer, for example, at the R A position of structure (I). Thus, in one example, structure (I) contains an alkoxyamine end group, and in another example, structure (I) contains an alkoxyamine end group and an alkoxyamine group in at least a portion of the side chain.

[0168] It should be understood that other molecules may be used as the polymer hydrogel 22 as long as they can be functionalized with the desired chemical substances, for example, primers 24, 26. Some examples of materials suitable for the polymer hydrogel 22 include functionalized silanes such as norbornenesilane, azidosilane, alkyne-functionalized silane, amine-functionalized silane, maleimidosilane, or any other silane having a functional group to which the desired chemical substance can be attached respectively. Still other examples of materials suitable for the polymer hydrogel 22 include colloidal structures such as agarose, or polymer mesh structures such as gelatin, or cross-linked polymer structures such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or an azide-decomposed version of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing a vinyl group, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of materials suitable for the polymer hydrogel 22 include mixed copolymers of acrylamide and acrylate. In the examples disclosed herein, various polymer structures containing acrylic monomers (such as acrylamide, acrylate, etc.), such as branched polymers including dendrimers (e.g., multi-arm or star-shaped polymers), can be utilized. For example, the monomer (such as acrylamide) can be incorporated into the branches (arms) of the dendrimer randomly or in blocks.

[0169] The polymer hydrogel 22 can be deposited on the surface of the pretreated, cured, and pattern-formed resin 10' using spin coating, or dipping or dip coating, or the flow of functionalized molecules under positive or negative pressure, or another suitable technique. The polymer hydrogel 22 can be present in a mixture. In one example, the mixture contains PAZAM in water or in a mixture of ethanol and water.

[0170] After coating, the polymeric hydrogel 22 is also exposed to a curing process to form a coating of the polymeric hydrogel 22 across the patterned substrate (i.e., within the recesses 18 and in the gap regions 20). In one example, the curing of the polymeric hydrogel 22 can be carried out at a temperature in the range of room temperature (e.g., about 25 °C) to about 95 °C for a time in the range of about 1 millisecond to about several days. In another example, the time can be in the range of 10 seconds to at least 24 hours. In yet another example, the time can be in the range of about 5 minutes to about 2 hours.

[0171] The attachment of the polymeric hydrogel 22 to the recesses 18 and the gap regions 20 can be by covalent bonds. The covalent bonds of the polymeric hydrogel 22 to the silanized or plasma-ashed recesses are useful for maintaining the polymeric hydrogel 22 in the recesses 18 over the lifetime of the ultimately formed flow cell during various uses. The following are some examples of reactions that can occur between a silane or silane derivative and the polymeric hydrogel 22.

[0172] When the silane or silane derivative contains norbornene or a norbornene derivative as an unsaturated moiety, the norbornene or norbornene derivative can undergo i) a 1,3-dipolar cycloaddition reaction with the azide / azido groups of PAZAM, ii) a coupling reaction with the tetrazine group attached to PAZAM, a cycloaddition reaction with the hydrazone group attached to PAZAM, a photo-click reaction with the tetrazole group attached to PAZAM, or a cycloaddition with the nitrile oxide group attached to PAZAM.

[0173] When the silane or silane derivative contains cyclooctyne or a cyclooctyne derivative as an unsaturated moiety, the cyclooctyne or cyclooctyne derivative can undergo either i) a strain-promoted azide-alkyne 1,3-cycloaddition (SPAAC) with the azide / azido of PAZAM, or ii) a strain-promoted alkyne-nitrile oxide cycloaddition reaction with a nitrile oxide group attached to PAZAM.

[0174] When the silane or silane derivative contains bicyclononine as an unsaturated moiety, the bicyclononine can undergo a similar SPAAC alkyne cycloaddition with an azide or nitrile oxide attached to PAZAM due to the strain in the bicyclic system.

[0175] Instead of forming the polymer hydrogel 22 on the gap region 20 of the cured and pattern-formed resin 10', the polymer hydrogel 22 can be polished from the gap region 20 to form the polymer hydrogel 22 in the recess 18. The polishing process can be carried out with a chemical slurry (e.g., containing an abrasive, a buffer, a chelating agent, a surfactant, and / or a dispersant) that can remove the polymer hydrogel 22 from the gap region 20 without adversely affecting the underlying cured and pattern-formed resin 10' and / or the substrate 12 in these regions. Alternatively, the polishing can be carried out with a solution that does not contain abrasive particles. The chemical slurry can be used in a chemical mechanical polishing system. In this example, a polishing head / pad, or other polishing tool, can polish the polymer hydrogel 22 from the gap region 20 while leaving the polymer hydrogel 22 in the recess 18 and keeping the underlying cured and pattern-formed resin 10' at least substantially intact. As an example, the polishing head can be a Strasbaugh ViPRR II polishing head. In another example, the polishing can be carried out with a solution that does not contain a polishing pad and any abrasive. For example, the polishing pad can be used with a solution that does not contain abrasive particles (e.g., a solution that does not contain abrasive particles).

[0176] Figure 1D depicts the polymer hydrogel 22 in the recess 18. Subsequently, a cleaning process can be performed. This process can utilize a water bath and sonication. The water bath can be maintained at a relatively low temperature in the range of about 22°C to about 30°C. The silanized, coated, polished, and patterned substrate can also be spin-dried or dried via another suitable technique.

[0177] As shown in Figure 1E, a grafting process is performed to graft the primers 24, 26 to the polymer hydrogel 22 in the recess 18. The primers 24, 26 can be any forward amplification primer and / or reverse amplification primer. In this example, the primers 24, 26 are two different primers.

[0178] It is desirable for the primers 24, 26 to be immobilized on the polymer hydrogel 22. In some examples, the immobilization can be by a point covalent attachment to the polymer hydrogel 22 at the 5' end of each primer 24, 26. Any suitable covalent attachment means known in the art may be used. In some examples, the immobilization can be by strong non-covalent attachment (e.g., biotin-streptavidin).

[0179] Each of the primers 24, 26 has a universal sequence for capture and / or amplification purposes. By way of example, the primers 24, 26 can include the P5 and P7 primers, the P15 and P7 primers, or any combination of the PA primers, PB primers, PC primers, and PD primers described herein. By way of example, the primers 24, 26 can include any two of the PA, PB, PC, and PD primers, or any combination of one PA primer and one of the PB, PC, or PD primers, or any combination of one PB primer and one of the PC or PD primers, or any combination of one PC primer and one PD primer.

[0180] Examples of P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on, for example, HiSeq™, HiSeqX™, MiSeq™, MiSeqDX™, MiNISeq™, NextSeq™, NextSeqDX™, NovaSeq™, iSEQ™, Genome Analyzer™ and other instrument platforms. The P5 primer is as follows. P5: 5’→3’ AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 1)

[0181] The P7 primer can be any of the following. P7 Number 1: 5’→3’ CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 2) P7 Number 2: 5’→3’ CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 3) Wherein, "n" is 8-oxoguanine in each of the sequences.

[0182] The P15 primer is as follows. P15: 5’→3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 4) Wherein, "n" is allyl-T (a thymine nucleotide analog having an allyl functional group).

[0183] The other primers (PA-PD) described above include the following. PA 5’→3’ GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 5) cPA (PA’) 5’→3’ CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC (SEQ ID NO: 6) PB 5’→3’ CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 7) cPB (PB’) 5’→3’ AGTTCATATCCACCGAAGCGCCATGGCAGACGACG (SEQ ID NO: 8) PC 5’→3’ ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 9) cPC (PC’) 5’→3’ AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT (SEQ ID NO: 10) PD 5’→3’ GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 11) cPD (PD’) 5’→3’ GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ ID NO: 12)

[0184] The P5 and P7 sequences illustrate cleavage sites (e.g., U or "n"). Although not shown in the exemplary sequences for PA - PD, it should be understood that any of these primers may contain a cleavage site (e.g., uracil, 8 - oxoguanine, allyl - T, etc.) at any point in the strand. In any of the examples, the cleavage sites of primers 24 and 26 should be different from each other so that the cleavage of primers 24 and 26 does not occur simultaneously. Examples of suitable cleavage sites include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., linkers between nucleobases). Enzymatically cleavable nucleobases may be susceptible to cleavage by reaction with glycosylases and endonucleases, or by reaction with exonucleases. One specific example of a cleavable nucleobase is deoxyuracil (dU), which can be targeted by the USER enzyme. Other abasic sites may be used. Examples of chemically cleavable nucleobases, modified nucleobases, or linkers include 8 - oxoguanine, vicinal diol, disulfide, silane, azobenzene, photocleavable groups, allyl T (a thymine nucleotide analog having an allyl functional group), allyl ether, or azide - functionalized ether.

[0185] Each of primers 24 and 26 disclosed herein may also contain a poly - T sequence at the 5' end of the primer sequence. In some examples, the poly - T region contains from 2 to 20 T bases. As a specific example, the poly - T region may contain 3, 4, 5, 6, 7, or 10 T bases.

[0186] The 5' ends of each of the primers 24, 26 may also include a linker. Any linker containing a terminal alkyne group or another suitable terminal functional group that can attach to the surface functional groups of the polymer hydrogel 22 may be used. Examples of suitable terminal functional groups include tetrazine, azide, amino, epoxy or glycidyl, thiophosphate, thiol, aldehyde, hydrazine, phosphoramidite, triazolinedione, or biotin. In one example, the primers 24, 26 are terminated with hexynyl. In some specific examples, a succinimidyl (NHS) ester-terminated primer can be reacted with an amine on the surface of the polymer hydrogel 22, an aldehyde-terminated primer can be reacted with hydrazine on the surface of the polymer hydrogel 22, or an alkyne-terminated primer can be reacted with an azide on the surface of the polymer hydrogel 22, or an azide-terminated primer can be reacted with an alkyne or DBCO (dibenzocyclooctyne) on the surface of the polymer hydrogel 22, or an amino-terminated primer can be reacted with an activated carboxylate group or NHS ester on the surface of the polymer hydrogel 22, or a thiol-terminated primer can be reacted with an alkylating reactant (e.g., iodoacetamide or maleimide) on the surface of the polymer hydrogel 22, a phosphoramidite-terminated primer can be reacted with a thioether on the surface of the polymer hydrogel 22, or a biotin-modified primer can be reacted with streptavidin on the surface of the polymer hydrogel 22.

[0187] In one example, the grafting of the primers 24, 26 can be achieved by flow-through deposition (e.g., using a temporarily attached lid), dunk coating, spray coating, droplet dispensing, or another suitable method of attaching the primers 24, 26 to the polymer hydrogel 22. Each of these exemplary techniques can utilize a primer solution or mixture, which can include the primers 24, 26, water, buffer, and a catalyst.

[0188] The dunk coating can involve immersing the flow cell precursor (shown in Figure 1D) in a series of temperature-controlled baths. The baths can also be flow-controlled and / or covered with a nitrogen blanket. The baths can contain a primer solution or mixture. Through the various baths, the primers 24, 26 will attach to the primer graft functional groups of the polymer hydrogel 22 in at least some of the recesses 18. In one example, the flow cell precursor is introduced into a first bath containing a primer solution or mixture, where a reaction occurs to attach the primers 24, 26, and then it will be transferred to a further bath for washing. The transfer from bath to bath can involve a robotic arm or can be performed manually. A drying system can also be used with the dunk coating.

[0189] Spray coating can be achieved by spraying a primer solution or mixture directly onto the flow cell precursor. The spray-coated wafer can be incubated at a temperature in the range of about 0 °C to about 70 °C for a time in the range of about 4 minutes to about 60 minutes. After incubation, the primer solution or mixture can be diluted and removed, for example, using a spin coater.

[0190] Droplet dispensing can be performed according to the pool and spin-off method and can thus be achieved by a spin coater. The primer solution or mixture can be applied to the flow cell precursor (manually or by an automated process). The applied primer solution or mixture can be applied over the entire surface of the flow cell precursor or can be diffused over the entire surface. The primer-coated flow cell precursor can be incubated at a temperature in the range of about 0 °C to about 80 °C for a time in the range of about 2 minutes to about 60 minutes. After incubation, the primer solution or mixture can be diluted and removed, for example, using a spin coater.

[0191] In other examples, the primers 24, 26 can be pre-grafted onto the polymer hydrogel 22 and can thus be present in the recesses 18 when the polymer hydrogel 22 is applied.

[0192] Figures 1E and 2 illustrate an example of the flow cell surface after grafting of primers 24, 26, or after application of a pre-grafted polymer hydrogel and removal from the gap region 20.

[0193] The examples shown in Figures 1E and 2 are examples of the flow cell surface without a lid or other flow cell attached thereto. In one example, the lid can be attached to at least a portion of the cured and patterned resin 10' in, for example, a part of the gap region 20. The bond formed between the lid and the cured and patterned resin 10' can be a chemical bond or a mechanical bond (e.g., using a fastener, etc.).

[0194] The lid can be any material that is transparent to the excitation light directed towards the substrate 12 and the cured and patterned resin 10'. By way of example, the lid can be glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D 263® available from Schott North America, Inc. A commercially available example of a suitable plastic material, i.e., a cycloolefin polymer, is a ZEONOR® product available from Zeon Chemicals L.P.

[0195] The lid can be attached to the cured and patterned resin 10' using any suitable technique such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activation bonding, glass frit bonding, or other methods known in the art. In one example, a spacer layer can be used to attach the lid to the cured and patterned resin 10'. The spacer layer can be any material that seals together at least a portion of the cured and patterned resin 10' and the lid. In some examples, the spacer layer can be a radiation-absorbing material that aids in the bonding of the cured and patterned resin 10' and the lid.

[0196] In other examples, two of the flow cell surfaces (one of which is shown in FIGS. 1E and 2) can be joined together such that the recess 18 faces a flow channel formed therebetween. The flow cell can be joined to the gap region 20 using similar techniques and materials described herein for joining the lid.

[0197] The flow cell can include a single flow channel or any desired number of flow channels that are fluidly separated from each other. This allows each flow channel to receive and process different samples at different times. In an example having multiple flow channels, it should be understood that each flow channel includes a functionalized recess and respective inlets and outlets for introducing and removing reagents from the flow channel.

[0198] Method of using the flow cell The flow cells disclosed herein can be used in various sequencing approaches or techniques, including those often referred to as sequencing-by-synthesis (SBS), circular array sequencing, sequencing-by-ligation, pyrosequencing, and the like. Using any of these techniques, the polymer hydrogel 22 and the attached primers 24, 26 are present in the recess 18 rather than on the gap region 20, and amplification is limited to the recess 18.

[0199] As an example, a synthesis-based sequencing (SBS) reaction can be performed on a system such as a HiSeq™, HiSeqX™, MiSeq™, MiSeqDX™, MiniSeq™, NovaSeq™, iSeq™, NextSeqDX™, or NextSeq™ sequencer system manufactured by Illumina (San Diego, CA). In SBS, the extension of a nucleic acid primer (e.g., a sequencing primer) along a nucleic acid template (e.g., a sequencing template) is monitored to determine the nucleotide sequence in the template. The underlying chemical process can be polymerization (e.g., catalyzed by a polymerase enzyme) or ligation (e.g., catalyzed by a ligase enzyme). In certain polymerase-based SBS processes, fluorescently labeled nucleotides are added to the sequencing primer in a template-dependent manner (thereby extending the sequencing primer) so that the sequence of the template can be determined using detection of the order and type of nucleotides added to the sequencing primer.

[0200] Prior to sequencing, capture and amplification primers 24, 26 can be exposed to the sequencing library, which is amplified using any suitable method such as cluster generation.

[0201] In one example of cluster generation, library fragments are copied from hybridized primers 24, 26 by 3' extension using a high-fidelity DNA polymerase. The original library fragments are denatured, while the copies remain immobilized. Isothermal bridge amplification can be used to amplify the immobilized copies. For example, the copied template loops over and hybridizes to adjacent complementary primers 24, 26, and the polymerase copies the copied template to form a double-stranded bridge structure, which denatures to form two single strands. These two strands loop over, hybridize to adjacent complementary primers 24, 26, and are extended again to form two new double-stranded loops. This process is repeated for each template copy by cycles of isothermal denaturation and amplification to create a dense clone cluster. Each cluster of double-stranded bridge structures is denatured. In one example, the reverse strand is removed by specific base cleavage, leaving the forward template polynucleotide strand. Clustering results in the formation of several template polynucleotide strands in each of the recesses 18. This example of clustering involves bridge amplification, which is one example of amplification that can be performed. It should be understood that other amplification techniques, such as the exclusion amplification (Examp) workflow (Illumina Inc.), can be used.

[0202] Sequencing primers that hybridize to complementary sequences on the template polynucleotide strand may be introduced. This sequencing primer renders the template polynucleotide strand in a state that can be sequenced. The 3' ends of the template and any flow cell binding primers 24, 26 (not attached to the copies) can be blocked to prevent interference with the sequencing reaction, and in particular, to prevent unwanted priming.

[0203] To initiate array determination, an incorporation mix can be added to the flow cell. In one example, the incorporation mix includes a liquid carrier, polymerase, and fluorescently labeled nucleotides. The fluorescently labeled nucleotides can include a 3’OH blocking group. When the incorporation mix is introduced into the flow cell, fluid enters the flow channel and flows into recess 18 where the template polynucleotide strand is present.

[0204] The fluorescently labeled nucleotides are added to the sequencing primer in a template-dependent manner (thereby extending the sequencing primer) so that the sequence of the template can be determined using detection of the order and type of nucleotides added to the sequencing primer. More specifically, one of the nucleotides is incorporated by each polymerase into a nascent strand that extends the sequencing primer and is complementary to the template polynucleotide strand. In other words, in at least a portion of the template polynucleotide strand across the flow cell, each polymerase extends the hybridized sequencing primer with one of the nucleotides in the incorporation mix.

[0205] Incorporation of the nucleotides can be detected through an imaging event. During the imaging event, an illumination system (not shown) can provide excitation light to the flow cell surface.

[0206] In some examples, the nucleotides can further include reversible termination properties (e.g., a 3’OH blocking group) that terminate further primer extension when the nucleotide is added to the sequencing primer. For example, a nucleotide analog having a reversible terminus is added to the sequencing primer, and subsequent extension cannot occur until a deblocking agent is delivered to remove the portion. Thus, in examples using reversible termination, a deblocking reagent can be delivered to the flow cell after detection has occurred.

[0207] Washing can be performed between various fluid delivery steps. Then, the SBS cycle can be repeated n times to extend the sequencing primer by n nucleotides, thereby enabling detection of an array of length n.

[0208] In some examples, the forward strand can be sequenced, removed, and then the reverse strand can be constructed and sequenced as described herein.

[0209] Although SBS has been described in detail, it should be understood that the flow cells described herein can be used for genotyping or other chemical and / or biological applications, together with other sequencing protocols.

[0210] The examples described in FIGS. 1A-1E and FIG. 2 illustrate the use of the exemplary NIL resin composition 10 in the form of the flow cell surface, but it should be understood that the NIL resin composition 10 disclosed herein can be used in other applications. As an example, the NIL resin compositions 10, 10' can be used in any optically based sequencing technique. As another example, the NIL resin compositions 10, 10' can be used in planar waveguides such as complementary metal-oxide semiconductors (CMOS).

[0211] To further illustrate the present disclosure, examples are presented herein. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

[0212] Non-limiting working examples Example 1 Three example resin compositions and two comparative resin compositions were prepared with an epoxy-substituted cyclosiloxane monomer. The solids of each resin are shown in Table 1, and the amounts are shown as mass % per total mass of the solids.

[0213] TIFF2025522670000050.tif64170

[0214] Examples Resins 1 to 3 contained different amounts of a fluorinated monomer, glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether. Comparative Example Resin 4 contained no surface additive, and Comparative Example Resin 5 contained a polyacrylate surface additive (BYK®-350, available from BYK).

[0215] Propylene glycol methyl ether acetate (PGMEA) was added to each of the resin solids. The final concentration of each Example resin and each Comparative Example resin was about 18% by mass.

[0216] Each of Example resin compositions 1 to 3 and Comparative resin compositions 4 to 5 was spin-coated onto its respective glass wafer. The working stamp used (previously used 25 times) was manually rolled on each of the coated wafers. The center-to-center pitch of the working stamp was 624 nm, and the feature height was 350 nm. The resin composition was then measured at the sample level and exposed to UV curing under a 365 nm UV LED light source having an output of 330 mW / cm 2 for 30 seconds. After curing, the working stamp was removed.

[0217] The quality of the imprint was investigated by measuring the depth of each recess using Atomic Force Microscopy (AFM). The target recess depth was 350 nm. The AFM results are shown in Table 2.

[0218] TIFF2025522670000051.tif36170

[0219] These results demonstrate that the fluorinated monomer is compatible with the nanoimprint process and that the fluorinated monomer functions similarly to the comparative polyacrylate surface additive.

[0220] Example 2 One example resin composition and two comparative resin compositions were prepared with each of i) an epoxy-substituted cyclosiloxane monomer and ii) a non-organosilicon epoxy monomer. The solids of the resin produced with the epoxy-substituted cyclosiloxane monomer are shown in Table 3A, and the solids of the resin produced with the non-organosilicon epoxy monomer are shown in Table 3B. The amounts in each of these tables are shown as mass % per total mass of the solids.

[0221] TIFF2025522670000052.tif65170

[0222] TIFF2025522670000053.tif76156

[0223] Example resins 6 and 9 contained 1.6 mass % of a fluorinated monomer, glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether. Comparative resins 8 and 11 contained no surface additives, and comparative resins 7 and 10 contained a polyacrylate surface additive (BYK®-350, available from BYK).

[0224] Propylene glycol methyl ether acetate (PGMEA) was added to each of the resin solids. The final concentration of each example resin and each comparative resin was about 18 mass %.

[0225] Each of example resin compositions 6 and 9 and comparative resin compositions 7, 8, 10, and 11 was spin-coated onto its respective glass wafer. A working stamp was manually rolled onto each of the coated wafers. The center-to-center pitch of the working stamp was 624 nm. The resin composition was then exposed to UV curing under a 365 nm UV LED light source having an output of 330 mW / cm 2 at the sample level. Curing was carried out for 30 seconds. After curing, the working stamp was removed.

[0226] The water contact angle of the imprinted resin was measured using a goniometer (which measures the static water contact angle of a sessile water droplet on the surface in air), and the results are shown in Fig. 3 (each imprint is identified by the resin used to produce it). As illustrated in Fig. 3, the fluorinated monomers (of Example Resins 6 and 9) increased the water contact angle of both of the Example imprints, similar to the polyacrylate surface additives (of Comparative Resins 7 and 10). These results demonstrate that the fluorinated monomers function in a similar manner to the comparative polyacrylate surface additives with respect to reducing the surface energy. From these results, it is considered that the fluorinated compounds may also be useful for extending the life of the working stamp.

[0227] Example 3 In this example, Example Resin 6 was used. Example Resin 6 was spin-coated onto a non-patterned glass die and exposed to UV curing under a 365 nm UV LED light source having an output of 330 mW / cm 2 measured at the sample level. The curing was carried out for 30 seconds.

[0228] The coated glass die was ashed in air plasma for 30 seconds at 595 W of RF power. The surface-activated die was exposed to the pure chemical vapor of [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane at 60 °C overnight to silanize the surface.

[0229] The silanized and coated glass die was bonded to a coverslip having fluid channels etched therein. Norland Optical Adhesive 81 was used for the bonding, and the adhesive was UV cured for 9 minutes under a UV lamp having a wide-spectrum emission and an output of 3 mW measured at the sample level.

[0230] An aqueous solution of 0.175 mass% N,N-dimethylacrylamide was introduced into a flow cell and incubated at 70 °C for 75 minutes. As a result, a hydrogel layer adhered to the silanized surface of the coated glass die. Subsequently, P5 and P7 primers were grafted onto the hydrogel layer from an 18 μM aqueous solution (incubated at 60 °C for 30 minutes).

[0231] Subsequently, the attached flow cell was exposed to clustering using a 0.67 pM PhiX library. The resulting templates were sequenced with purple and blue illumination, and the optical settings are shown in Table 4.

[0232] TIFF2025522670000054.tif30156

[0233] Following the array determination (SBS) cycles by 12 syntheses, in the 13th cycle, the fluorescent dye was removed from the 3'-blocking group. The 14th cycle consisted of an additional washing step by flowing the modified incorporation mix into the flow cell, which did not contain fully functional nucleotides (ffN). In the 15th cycle, the complementary strand was dehybridized from the clusters. After clustering on the unpatterned flow cell, the regions of the polymer hydrogel may remain unclustered. Cycles 13-15 were included as a control experiment to determine whether ffN binds to these unclustered regions of the substrate. Figure 4 is a graph illustrating the signal intensity (Y-axis) against the cycle number (X-axis). The results in Figure 4 demonstrate that ffN does not bind to the surface (data for cycles 13-15) and is detected on the clusters (data for cycles 1-12). This data illustrates the unexpected result that the fluorinated monomer did not interfere with polymer hydrogel attachment, primer grafting, template generation, or sequencing. The images taken on tile 3 of the flow cell in cycle 2 of the sequencing are reproduced in Figures 5A and 5B (editing of the highlighted region in Figure 5A) when using blue illumination, and in Figures 6A and 6B (editing of the highlighted region in Figure 6A) when using purple illumination. These results further demonstrate the unexpected compatibility of the fluorinated monomer with sequencing and, overall, its feasibility as a leveling agent in the resin compositions disclosed herein.

[0234] Supplementary Note Article 1. A nanoimprint lithography (NIL) resin composition, comprising a total of three monomers, wherein two of the three monomers are selected from the group consisting of two different epoxy-substituted silsesquioxane monomers, two different epoxy-substituted cyclotrisiloxane monomers, and two different non-organosilicon epoxy monomers. The third monomer of the three monomers is a fluorinated monomer present in an amount in the range of about 0.5% by mass to about 4% by mass based on the total solids of the NIL resin composition, the total of three monomers, a photoinitiator, a solvent, and a NIL resin composition containing the same. 2. The fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(oxirane), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)oxirane, 2,2,3,3,4,4,5,5,6,7,7,7-dodeca-fluoro-6-(trifluoromethyl)heptyl]oxirane, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecafluoro-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosafluoroundecyl)oxirane, and combinations thereof, the NIL resin composition according to item 1. 3. Two of the three monomers are two different epoxy-substituted silsesquioxane monomers, The two different epoxy-substituted silsesquioxane monomers are epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane, the NIL resin composition according to item 1 or 2. 4. The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3, the NIL resin composition according to item 3. 5. Two of the three monomers are two different epoxy-substituted cyclopolysiloxane monomers, The NIL resin composition according to clause 1 or 2, wherein two different epoxy-substituted cyclopolysiloxane monomers are composed of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane. 6. The NIL resin composition according to clause 5, wherein two different epoxy-substituted cyclopolysiloxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3. 7. Two of the three monomers are two different non-organosilicon epoxy monomers. The NIL resin composition according to clause 1 or 2, wherein the two different non-organosilicon epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl) adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, diglycidyl 1,2-cyclohexanedicarboxylate, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate. 8. The NIL resin composition according to clause 7, wherein the two different non-organosilicon epoxy monomers are present in a mass ratio in the range of about 4:1 to about 1:4. 9. The NIL resin composition according to any one of clauses 1 to 8, wherein the photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof. 10. A flow cell comprising: a substrate; a cured and pattern-formed resin positioned on the substrate, the cured and pattern-formed resin including imprinted recesses separated by gap regions, the cured and pattern-formed resin being a cured form of a nanoimprint lithography (NIL) resin composition. A total of three monomers, where two of the three monomers are selected from the group consisting of two different epoxy silsesquioxane monomers, two different epoxy cyclotrisiloxane monomers, and two different non - organosilicon epoxy monomers, and the third monomer of the three monomers is a fluorinated monomer present in an amount in the range of about 0.5 wt% to about 4 wt% based on the total solids of the NIL resin composition, a photoinitiator, a solvent, and a cured and pattern - formed resin comprising a NIL resin composition, a polymer hydrogel positioned in each of the recesses, and a primer set attached to the hydrogel, and a flow cell. 11. The flow cell according to clause 10, wherein the substrate is silanized glass or silanized silicon. 12. The flow cell according to clause 10 or 11, wherein the fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5 - octafluorohexane - 1,6 - diyl) bis(oxirane), glycidyl 2,2,3,3,4,4,5,5 - octafluoropentyl ether, glycidyl 2,2,3,3 - tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9 - heptadecafluorononyl) oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,7 - tridecafluoroheptyl) oxirane, 2,2,3,3,4,4,5,5,6,7,7,7 - dodeca - fluoro - 6 - (trifluoromethyl) heptyl] oxirane, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9 - hexadecafluoro - 8 - (trifluoromethyl) nonyl] oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11 - heneicosapentafluoroundecyl) oxirane, and combinations thereof. 13. Two of the three monomers are two different epoxy-substituted silsesquioxane monomers, The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethylpolysilsesquioxane and glycidylpolysilsesquioxane, The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3, and the flow cell according to any one of clauses 10 to 12. 14. Two of the three monomers are two different epoxy-substituted cyclotrisiloxane monomers, The two different epoxy-substituted cyclotrisiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane, The two different epoxy-substituted cyclotrisiloxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3, and the flow cell according to any one of clauses 10 to 12. 15. Two of the three monomers are two different non-organosilicon epoxy monomers, The two different non-organosilicon epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl) adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, diglycidyl 1,2-cyclohexanedicarboxylate, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate, The flow cell according to any one of clauses 10 to 12, wherein two different non-organic silicon epoxy monomers are present in a mass ratio in the range of about 4:1 to about 1:4. 16. A method comprising: A nanoimprint lithography (NIL) resin composition, wherein the NIL resin composition comprises: A total of three monomers, Two of the three monomers are Two different epoxy silsesquioxane monomers, Two different epoxy cyclopolysiloxane monomers, and Selected from the group consisting of two different non-organic silicon epoxy monomers, A total of three monomers, wherein the third monomer of the three monomers is a fluorinated monomer present in an amount in the range of about 0.5% by mass to about 4% by mass based on the total solids of the NIL resin composition, A photoinitiator, A solvent, and depositing the NIL resin composition on a substrate, Using a working stamp to nanoimprint the deposited NIL resin composition, Curing the deposited NIL resin composition to form a cured and pattern-formed resin, the method comprising. 17. The method according to clause 16, wherein the fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl) bis(oxirane), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl) oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl) oxirane, 2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl) heptyl] oxirane, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecafluoro-8-(trifluoromethyl) nonyl] oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosapentafluoroundecyl) oxirane, and combinations thereof. 18. Two of the three monomers are two different epoxy-substituted silsesquioxane monomers, The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane, The method according to clause 16 or 17, wherein the two different epoxy-substituted silsesquioxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3. 19. Two of the three monomers are two different epoxy-substituted cyclopolysiloxane monomers, The two different epoxy-substituted cyclopolysiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidyl cyclotetrasiloxane, The method according to clause 16 or 17, wherein the two different epoxy-substituted cyclopolysiloxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3. 20. Two of the three monomers are two different non-organic silicon epoxy monomers, Two different non-organic silicon epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl) adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, diglycidyl 1,2-cyclohexanedicarboxylate, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate, The method according to any one of clauses 16 or 17, wherein two different non-organic silicon epoxy monomers are present in a mass ratio in the range of about 4:1 to about 1:4. 21. The curing is performed with a 365 nm ultraviolet light source, The method according to any one of clauses 16 to 20, wherein the deposited NIL resin composition is exposed to UV light for a time in the range of about 3 seconds to about 30 seconds.

[0235] It should be understood that all combinations of the foregoing concepts and further concepts, to be considered in more detail below, are intended to be part of the subject matter of the invention disclosed herein (provided such concepts are not mutually inconsistent). Specifically, all combinations of the claimed subject matter that appear at the end of this disclosure are intended to be part of the subject matter of the invention disclosed herein. It should also be understood that any term that appears in any disclosure explicitly used herein and incorporated by reference should be given the meaning that most closely matches the particular concepts disclosed herein.

[0236] References throughout this specification to "one example", "another example", "an example", etc. mean that a particular element (e.g., a feature, a structure, and / or a property) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that elements described with respect to any example can be combined in any suitable manner in various examples, unless the context clearly dictates otherwise.

[0237] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified. Therefore, the foregoing description should be considered non-limiting.

Claims

1. A nanoimprint lithography (NIL) resin composition comprising: A total of three monomers, Two of the three monomers are Selected from the group consisting of two different epoxy-substituted silsesquioxane monomers, Two different epoxy-substituted cyclopolysiloxane monomers, and Two different non-organosilicon epoxy monomers, The third monomer of the three monomers is a fluorinated monomer present in an amount in the range of about 0.5% to about 4% by mass based on the total solids of the NIL resin composition, A photoinitiator, A solvent, and an NIL resin composition.

2. The fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(oxirane), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)oxirane, 2,2,3,3,4,4,5,5,6,7,7,7-dodeca-fluoro-6-(trifluoromethyl)heptyl]oxirane, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecafluoro-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosafluoroundecyl)oxirane, and combinations thereof. The NIL resin composition according to Claim 1.

3. Two of the three monomers are the two different epoxy-substituted silsesquioxane monomers, The two different epoxy-substituted silsesquioxane monomers are composed of epoxycyclohexylethylpolysilsesquioxane and glycidylpolysilsesquioxane. The NIL resin composition according to Claim 1.

4. The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio in the range of about 3:7 to about 7:

3. The NIL resin composition according to Claim 3.

5. Two of the three monomers are the two different epoxy-substituted cyclotetrasiloxane monomers, The two different epoxy-substituted cyclotetrasiloxane monomers are composed of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane, and the NIL resin composition according to claim 1. **Claim 6** The two different epoxy-substituted cyclotetrasiloxane monomers are present in a mass ratio in the range of about 3:7 to about 7:3, and the NIL resin composition according to claim 5. **Claim 7** Two of the three monomers are the two different non-organosilicon epoxy monomers, The two different non-organosilicon epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl) adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, diglycidyl 1,2-cyclohexanedicarboxylate, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate, and the NIL resin composition according to claim 1. **Claim 8** The two different non-organosilicon epoxy monomers are present in a mass ratio in the range of about 4:1 to about 1:4, and the NIL resin composition according to claim 7. **Claim 9** The photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof, and the NIL resin composition according to claim 1. **Claim 10** A flow cell, A substrate, A cured and pattern-formed resin positioned on the substrate, the cured and pattern-formed resin including imprinted recesses separated by gap regions, and the cured and pattern-formed resin being a cured form of a nanoimprint lithography (NIL) resin composition, A total of three monomers, Two of the three monomers are two different epoxy silsesquioxane monomers, two different epoxy cyclopolysiloxane monomers, and selected from the group consisting of two different non-organosilicon epoxy monomers, a third monomer of the three monomers is a fluorinated monomer present in an amount in the range of about 0.5% to about 4% by weight based on the total solids of the NIL resin composition, and three monomers in total, a photoinitiator, a solvent, and a cured and pattern-formed resin comprising a NIL resin composition, a polymer hydrogel positioned in each of the recesses, a flow cell comprising a primer set attached to the hydrogel.

11. The flow cell according to claim 10, wherein the substrate is silylated glass or silylated silicon.

12. The flow cell according to claim 10, wherein the fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(oxirane), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)oxirane, 2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]oxirane, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecafluoro-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-henicosapentafluoroundecyl)oxirane, and combinations thereof.

13. Two of the three monomers are the two different epoxy-substituted silsesquioxane monomers, the two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane, The flow cell according to claim 10, wherein the two different epoxy-substituted silsesquioxane monomers are present in a mass ratio in the range of about 3:7 to about 7:

3.

14. Two of the three monomers are the two different epoxy-substituted cyclotrisiloxane monomers, The two different epoxy-substituted cyclotrisiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane, The flow cell according to claim 10, wherein the two different epoxy-substituted cyclotrisiloxane monomers are present in a mass ratio in the range of about 3:7 to about 7:

3.

15. Two of the three monomers are the two different non-silicon-containing epoxy monomers, The two different non-silicon-containing epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl) adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, diglycidyl 1,2-cyclohexanedicarboxylate, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate, The flow cell according to claim 10, wherein the two different non-silicon-containing epoxy monomers are present in a mass ratio in the range of about 4:1 to about 1:

4.

16. A method, A nanoimprint lithography (NIL) resin composition, wherein the NIL resin composition Comprises a total of three monomers, Two of the three monomers Are two different epoxy silsesquioxane monomers, Two different epoxycyclotrisiloxane monomers, and Are selected from the group consisting of two different non-silicon-containing epoxy monomers. A fluorinated monomer in which the third monomer of the three monomers is present in an amount in the range of about 0.5% by mass to about 4% by mass based on the total solid content of the NIL resin composition, and a total of three monomers, a photoinitiator, a solvent, and depositing the NIL resin composition containing the same on a substrate, nanoimprinting the deposited NIL resin composition using a working stamp, and curing the deposited NIL resin composition to form a cured and pattern-formed resin. A method comprising:

17. The method according to claim 16, wherein the fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl) bis(oxirane), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl) oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl) oxirane, 2,2,3,3,4,4,5,5,6,7,7,7-dodeca-fluoro-6-(trifluoromethyl) heptyl] oxirane, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecafluoro-8-(trifluoromethyl) nonyl] oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosapentafluoroundecyl) oxirane, and combinations thereof.

18. Two of the three monomers are the two different epoxy-substituted silsesquioxane monomers, the two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane, The method according to claim 16, wherein the two different epoxy-substituted silsesquioxane monomers are present in a mass ratio in the range of about 3:7 to about 7:

3.

19. Two of the three monomers are the two different epoxy-substituted cyclopolysiloxane monomers, The two different epoxy-substituted cyclotetrasiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane, The method according to claim 16, wherein the two different epoxy-substituted cyclotetrasiloxane monomers are present in a mass ratio in the range of about 3:7 to about 7:

3.

20. Two of the three monomers are the two different non-organosilicon epoxy monomers, The two different non-organosilicon epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, diglycidyl 1,2-cyclohexanedicarboxylate, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate, The method according to claim 16, wherein the two different non-organosilicon epoxy monomers are present in a mass ratio in the range of about 4:1 to about 1:

4.

21. The curing is carried out with a 365 nm ultraviolet light source, The method according to claim 16, wherein the deposited NIL resin composition is exposed to UV light for a time in the range of about 3 seconds to about 30 seconds.