Nucleic acids based on adenovirus and methods thereof

A modified adenovirus-based nucleic acid for rAAV production, excluding certain regions and proteins, improves efficiency and safety by optimizing DNA delivery, leading to higher rAAV titers and reduced costs.

JP2025523458APending Publication Date: 2025-07-23ASKLEPIOS BIOPHARMACEUTICAL INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024573968
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-22
Filing Date
2023-06-22
Publication Date
2025-07-23

AI Technical Summary

Technical Problem

The production of recombinant adeno-associated vectors (rAAV) is inefficient and costly due to the need for delivering multiple plasmids to a cell, which increases DNA requirements and production costs, and existing helper viruses like adenovirus contain components that complicate the process.

Method used

A human adenovirus 5 (hAd)-based nucleic acid is designed to exclude certain regions and proteins, such as E4-ORF6/7, VA RNA, E2A, and structural proteins, while including essential elements like E4-ORF6/7, VA RNA, and E2A regions, optimized for efficient rAAV production.

Benefits of technology

This approach enhances rAAV production efficiency, resulting in higher titers of rAAV with safer production conditions by minimizing infectious virus exposure and reducing the need for excessive DNA delivery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025523458000001_ABST
    Figure 2025523458000001_ABST
Patent Text Reader

Abstract

Methods are disclosed for producing high-titer recombinant adeno-associated virus (rAAV) using a modified adenovirus-based helper nucleic acid. One aspect provided herein is a human adenovirus 5 (hAd)-based nucleic acid that does not contain one or more of (a) an E4 region having E4-ORF6 / 7, (b) a viral associated (VA) RNA region, (c) an E2A region having L4-22K and L4-33K, (d) at least one packaging protein, (e) at least one structural protein, (f) a major late promoter (MLP), (g) an E1 region, and / or (h) an E3 region.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of priority under 35 U.S.C.§119 to U.S. Provisional Application No. 63 / 354,304, filed on June 22, 2022, the entire content of which is incorporated herein by reference.

[0002] Sequence Listing This application includes a sequence listing submitted in XML format via Patent Center, the entire content of which is incorporated herein by reference. The XML copy created on June 22, 2023, is named "046192 - 191450WOPT_SL.xml" and has a size of 215,688 bytes.

[0003] Technical Field The technology described herein relates to the field of adeno - virus - based nucleic acids.

Background Art

[0004] Background The production of recombinant adeno - associated vectors (rAAV) needs to consider both efficiency and safety. The production of rAAV usually requires the expression and / or infection by both the desired vector and additional components necessary for robust production. In some cases, this can require the integration and expression of up to three large plasmids into a single cell. Delivering three plasmids successfully to one cell is a relatively inefficient process. For large - scale manufacturing efforts, transient delivery of plasmids requires an excessive amount of DNA, increasing the overall cost of production and purification.

[0005] In addition to plasmid delivery, plasmid efficiency can also be considered. Helper viruses such as adenovirus, herpesvirus, or vaccinia, as well as adenovirus helper nucleic acid (Ad helper), contain components that assist in the production of rAAV. Ad helper may contain proteins used in rAAV production. Efficient production of these proteins enables the production of higher titers of rAAV.

[0006] Since Ad helper produces only the proteins for rAAV production rather than infectious virus, it has been regarded as a safer alternative to helper adenovirus infection. Minimizing exposure to infectious virus is considered in rAAV production. Since this is a safer alternative, optimizing the delivery of Ad helper can contribute to the production of high-titer rAAV.

Summary of the Invention

Means for Solving the Problems

[0007] Summary One aspect provided herein describes a human adenovirus 5 (hAd)-based nucleic acid that includes (a) an E4 region having E4-ORF6 / 7, (b) a viral associated (VA) RNA region, and (c) an E2A region having L4-22K and L4-33K, and does not include one or more of (d) at least one packaging protein, (e) at least one structural protein, (f) a major late promoter (MLP), (g) an E1 region, and / or (h) an E3 region.

[0008] One aspect provided herein describes a human adenovirus 5 (hAd)-based nucleic acid that does not contain one or more of (a) an E4 region having E4-ORF6 / 7, (b) a virus-associated (VA) RNA region, and (c) an E2A region having L4-22K, L4-33K, and L4-100K, and does not contain (d) at least one packaging protein, (e) at least one structural protein, (f) a major late promoter (MLP), (g) an E1 region, and / or (h) an E3 region.

[0009] In one embodiment of any of the aspects described herein, the nucleic acid contains, in the 5'→3' direction, an E4 region containing E4-ORF6 / 7, a VA RNA region, and an E2A region.

[0010] In one embodiment of any of the aspects described herein, the nucleic acid does not contain an adenovirus inverted terminal repeat sequence, such as a left ITR, a right ITR, or any segment thereof.

[0011] In one embodiment of any of the aspects described herein, the nucleic acid contains GGCAGC at positions 4279 to 4284 (SEQ ID NO: 1).

[0012] In one embodiment of any of the aspects described herein, the E2A region contains an E2 early promoter (SEQ ID NO: 2), an E2 late promoter (SEQ ID NO: 3), an E2A protein (SEQ ID NO: 4), L4-22K (SEQ ID NO: 5), L4-33K (SEQ ID NO: 6), and / or an intermediate-phase L4 promoter (L4P) (SEQ ID NO: 7), and optionally L4-100K (SEQ ID NO: 8).

[0013] In one embodiment of any of the aspects described herein, the E2A protein is operably linked to an E2 early promoter and / or an E2 late promoter.

[0014] In one embodiment of any of the aspects described herein, L4-22K, L4-33K, and optionally L4-100K are operably linked to L4P.

[0015] In one embodiment of any of the aspects described herein, the hAD5-based nucleic acid of the present invention does not contain an adenovirus inverted terminal repeat (ITR).

[0016] In one embodiment of any of the aspects described herein, the E2A region is flanked by two type II restriction endonuclease recognition sites.

[0017] In one embodiment of any of the aspects described herein, the two type II restriction endonuclease recognition sites are selected from the group consisting of PacI, SpeI, AscI, PmeI, and NotI and / or their corresponding isoschizomers.

[0018] In one embodiment of any of the aspects described herein, the recognition sites enable the manipulation of the nucleic acid as a module.

[0019] In one embodiment of any of the aspects described herein, the E2A region is flanked by a PacI restriction endonuclease recognition site and a NotI restriction endonuclease recognition site.

[0020] In one embodiment of any of the aspects described herein, the E2A region is flanked by two SpeI restriction endonuclease recognition sites.

[0021] In one embodiment of any of the aspects described herein, the nucleic acid does not contain mutations that interfere with the expression of L4-22K (SEQ ID NO: 5) and / or L4-33K (SEQ ID NO: 6).

[0022] In one embodiment of any of the aspects described herein, the E2A region contains an E2 early promoter (SEQ ID NO: 2), an E2 late promoter (SEQ ID NO: 3), an E2A protein (SEQ ID NO: 4), L4-22K (SEQ ID NO: 5), L4-33K (SEQ ID NO: 6), and / or an intermediate phase L4 promoter (L4P) (SEQ ID NO: 7).

[0023] In one embodiment of any of the aspects described herein, the E2A region, in the 5'-3' direction, includes an E2 early promoter, L4-33K, L4-22K, L4P, an E2 late promoter, L4-100K, and E2A.

[0024] In one embodiment of any of the aspects described herein, the E2A region, in the 5'-3' direction, includes an E2 early promoter, L4-33K, L4-22K, L4P, an E2 late promoter, and E2A.

[0025] In one embodiment of any of the aspects described herein, the E2A section includes an E2 early promoter, an E2 late promoter, and E2A.

[0026] In one embodiment of any of the aspects described herein, the L4 section includes L4-33K, L4-22K, and L4P.

[0027] In one embodiment of any of the aspects described herein, the L4 element is in the reverse complement relative to the E2A region, E4 region, and VA RNA region.

[0028] In one embodiment of any of the aspects described herein, E2A is codon-optimized relative to its wild-type sequence.

[0029] In one embodiment of any of the aspects described herein, the E4 region includes an E4 promoter (SEQ ID NO: 9), E4-ORF1 (SEQ ID NO: 10), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0030] In one embodiment of any of the aspects described herein, E4-ORF1, E4-ORF2, E4-ORF3, E4-ORF4, E4-ORF6, and / or E4-ORF6 / 7 are operably linked to the E4 promoter.

[0031] In one embodiment of any of the aspects described herein, the E4 region comprises an E4 promoter (SEQ ID NO: 9), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0032] In one embodiment of any of the aspects described herein, E4-ORF2, E4-ORF3, E4-ORF4, E4-ORF6, and / or E4-ORF6 / 7 are operably linked to an E4 promoter.

[0033] In one embodiment of any of the aspects described herein, the nucleic acid does not contain E4-ORF1 (SEQ ID NO: 10).

[0034] In one embodiment of any of the aspects described herein, the amino acid residue position 9 of E4-ORF1 shown in SEQ ID NO: 10 is mutated to a stop codon, or the nucleic acid contains a variant of SEQ ID NO: 10 and the amino acid residue position 9 of SEQ ID NO: 10 is substituted with a stop codon.

[0035] In one embodiment of any of the aspects described herein, the E4 region is between two type II restriction endonuclease recognition sites.

[0036] In one embodiment of any of the aspects described herein, the E4 region is flanked by an AscI restriction endonuclease recognition site and a PmcI restriction endonuclease recognition site.

[0037] In one embodiment of any of the aspects described herein, the two type II restriction endonuclease recognition sites are selected from the group consisting of PacI, SpeI, AscI, PmeI, and NotI and / or their corresponding isoschizomers.

[0038] In one embodiment of any of the aspects described herein, at least one of the two type II restriction endonuclease sites enables manipulation of nucleic acids as a module.

[0039] In one embodiment of any of the aspects described herein, the E4 region, in the 5'-3' direction, comprises an E4 promoter (SEQ ID NO: 9), E4-ORF1 (SEQ ID NO: 10), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0040] In one embodiment of any of the aspects described herein, the E4 region, in the 5'-3' direction, comprises an E4 promoter (SEQ ID NO: 9), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0041] In one embodiment of any of the aspects described herein, the E4 region comprises E4-ORF6 / 7 (SEQ ID NO: 15).

[0042] In one embodiment of any of the aspects described herein, the VA RNA region comprises VA RNA I (SEQ ID NO: 16) and / or VA RNA II (SEQ ID NO: 17).

[0043] In one embodiment of any of the aspects described herein, VA RNA I and / or VA RNA II are directly positioned between splicing sites.

[0044] In one embodiment of any of the aspects described herein, the splicing site is a donor or acceptor splicing site.

[0045] In one embodiment of any of the aspects described herein, the VA RNA region is flanked by two type II restriction endonuclease recognition sites.

[0046] In one embodiment of any of the aspects described herein, the VA RNA region is between a PmeI restriction endonuclease recognition site and a PacI restriction endonuclease recognition site.

[0047] In one embodiment of any of the aspects described herein, the two type II restriction endonuclease recognition sites are selected from the group consisting of PacI, SpeI, AscI, PmeI, and NotI and / or their corresponding isoschizomers.

[0048] In one embodiment of any of the aspects described herein, the restriction sites enable manipulation of nucleic acids as modules.

[0049] In one embodiment of any of the aspects described herein, the VA RNA region contains, in the 5'-3' direction, a restriction endonuclease recognition site, a splicing site, VA RNA I, VA RNA II, a splicing site, and a restriction endonuclease recognition site.

[0050] In one embodiment of any of the aspects described herein, the splicing site is a donor or acceptor splicing site.

[0051] In one embodiment of any of the aspects described herein, VA RNA I and / or VA RNA II is operably linked to a Pol II promoter.

[0052] In one embodiment of any of the aspects described herein, VA RNA I and / or VA RNA II is located within the E4 region.

[0053] In one embodiment of any of the aspects described herein, VA RNA I and / or VA RNA II is located within the E2A region.

[0054] In one embodiment of any of the aspects described herein, VA RNA I and / or VA RNA II are operably linked to an E2 early promoter and / or an E2 late promoter.

[0055] In one embodiment of any of the aspects described herein, VA RNA I and / or VA RNA II are operably linked to an L4P promoter.

[0056] In one embodiment of any of the aspects described herein, the nucleic acid further comprises a backbone region.

[0057] In one embodiment of any of the aspects described herein, the backbone region comprises a pLDB backbone.

[0058] In one embodiment of any of the aspects described herein, the hAd5 nucleic acid does not contain at least one structural protein, and the at least one structural protein comprises a fiber protein (SEQ ID NO: 18, SEQ ID NO: 32), a hexon protein (SEQ ID NO: 19, SEQ ID NO: 33), and / or a penton protein (SEQ ID NO: 20, SEQ ID NO: 34).

[0059] In one embodiment of any of the aspects described herein, the hAd5 nucleic acid does not contain at least one packaging protein, and the at least one packaging protein comprises a 23K endoprotease (SEQ ID NO: 21, SEQ ID NO: 35), a peripentonal hexon-related protein (SEQ ID NO: 22, SEQ ID NO: 36), and / or a packaging protein 3 (SEQ ID NO: 23, SEQ ID NO: 37).

[0060] In one embodiment of any of the aspects described herein, the hAd5 nucleic acid does not contain an E1 region, and the E1 region comprises an E1A protein (SEQ ID NO: 24-28, 38-42) and / or an E1B protein (SEQ ID NO: 29-30, 43-44).

[0061] In one embodiment of any of the aspects described herein, the hAd5 nucleic acid does not contain the E3 region, and the E3 region contains at least one of SEQ ID NOs: 68-81.

[0062] In one embodiment of any of the aspects described herein, the nucleic acid contains SEQ ID NO: 1 (e.g., xx85 plasmid DNA) and / or SEQ ID NO: 31 (e.g., xx85 clDNA).

[0063] In one embodiment of any of the aspects described herein, the nucleic acid contains, in the 5'-3' direction, the E4 region, the VA RNA region, the E2A region, and / or the backbone region.

[0064] In one embodiment of any of the aspects described herein, the nucleic acid contains, in the 5'-3' direction, the E4 region, the VA RNA region, and / or the E2A region.

[0065] In one embodiment of any of the aspects described herein, the E2A region of the Ad5-based nucleic acid of the present invention contains a nucleic acid encoding a single-stranded DNA-binding protein [DBP] (SEQ ID NO: 4), and lacks essential adenovirus structures (e.g., fiber, hexon, penton, core protein, etc.) and replication (e.g., DNA polymerase) genes.

[0066] In one embodiment of any of the aspects described herein, the nucleic acid does not exceed 18,932 nucleotides.

[0067] In one embodiment of any of the aspects described herein, the nucleic acid does not exceed 12,130 nucleotides.

[0068] In one embodiment of any of the aspects described herein, the nucleic acid does not exceed 10,609 nucleotides.

[0069] In one embodiment of any of the aspects described herein, the nucleic acid does not exceed 8,659 nucleotides.

[0070] In one embodiment of any of the aspects described herein, the nucleic acid comprises a plasmid.

[0071] In one embodiment of any of the aspects described herein, the nucleic acid is plasmid DNA.

[0072] In one embodiment of any of the aspects described herein, the plasmid DNA can be linear or circular.

[0073] In one embodiment of any of the aspects described herein, the nucleic acid comprises closed-ended linear double-stranded DNA (clDNA).

[0074] In one embodiment of any of the aspects described herein, the nucleic acid is closed-ended linear double-stranded DNA (clDNA) or neDNA.

[0075] In one embodiment of any of the embodiments discussed herein, the clDNA or neDNA further comprises a telomerase binding site (TelRL). Examples of clDNA or neDNA are dbDNA or dbDNA precursor plasmids that contain a telomerase binding site.

[0076] Another aspect provided herein describes an adenovirus comprising a nucleic acid of any one of the embodiments.

[0077] Another aspect provided herein describes a recombinant adeno-associated virus (rAAV) combined with an adenovirus of one embodiment.

[0078] Another aspect provided herein describes a human adenovirus 5 (hAd)-based nucleic acid comprising L4-22K.

[0079] Another aspect provided herein describes a human adenovirus 5 (hAd)-based nucleic acid comprising L4-33K.

[0080] Another aspect provided herein describes human adenovirus 5 (hAd)-based nucleic acids comprising L4-22K, L4-33K, and L4P.

[0081] Another aspect provided herein describes a cell comprising a nucleic acid, an adenovirus, or a recombinant adeno-associated virus (rAAV) of any one of the embodiments described herein.

[0082] In one embodiment of any of the aspects described herein, a nucleic acid of any of the embodiments for use in the production of recombinant adeno-associated virus (rAAV), comprising: i) a nucleic acid of any of the embodiments, ii) an rAAV genome, and iii) transfection of cells with an AAV capsid and non-structural replication genes, and giving the cells sufficient time to produce rAAV particles, the nucleic acid in a method for producing a clarified lysate containing rAAV capsid particles.

[0083] In one embodiment of any of the aspects described herein, the rAAV capsid particles in the clarified lysate contain at least about 25% to at least about 30% full capsid particles.

[0084] In one embodiment of any of the aspects described herein, the rAAV capsid particles in the clarified lysate contain at least about 25% to at least about 30% full capsid particles, and the rAAV is produced using the hAd5-based nucleic acid (SEQ ID NO: 1 or SEQ ID NO: 31) of the present invention.

[0085] In one embodiment of any of the aspects described herein, the rAAV in the clarified lysate contains at least about 1.5-fold higher full capsid particles when compared to the rAAV in the clarified lysate produced with the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0086] In one embodiment of any of the aspects described herein, the rAAV in the clarified lysate contains at least about 1.5 times higher intact capsid particles produced with the hAd5-based nucleic acid (SEQ ID NO: 1 or SEQ ID NO: 31) of the present invention, when compared to the rAAV in the clarified lysate produced with the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0087] Another aspect provided herein is a method for producing recombinant adeno-associated virus (rAAV), comprising: i) any nucleic acid of the embodiments described herein, ii) an rAAV genome, and iii) transfecting a cell with an AAV capsid and non-structural replication genes, and giving the cell sufficient time to produce rAAV particles.

[0088] In one embodiment of any of the aspects described herein, the method further comprises generating a clarified lysate from the bioreactor.

[0089] In one embodiment of any of the aspects described herein, the clarified lysate contains rAAV having at least about 30% intact capsid particles.

[0090] In one embodiment of any of the aspects described herein, the clarified lysate contains rAAV having at least about 1.5 times higher amount or percentage of intact capsid particles, when compared to the rAAV in the clarified lysate produced with the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0091] In one embodiment of any of the aspects described herein, the rAAV genome contains a transgene.

[0092] In one embodiment of any of the aspects described herein, the rAAV genome and / or the AAV capsid and non-structural replication genes are in the form of a plasmid and / or a clDNA sequence.

[0093] In one embodiment of any of the aspects described herein, the cell is a suspension cell.

[0094] In one embodiment of any of the aspects described herein, the cell is a mammalian cell.

[0095] In one embodiment of any of the aspects described herein, the cell is HEK293.

[0096] In one embodiment of any of the aspects described herein, the method further comprises expanding the cells to produce a cell mass sufficient to seed a bioreactor.

[0097] In one embodiment of any of the aspects described herein, the method further comprising a bioreactor is at least 25L scale.

[0098] In one embodiment of any of the aspects described herein, the bioreactor is a stirred production bioreactor.

[0099] In one embodiment of any of the aspects described herein, the cells are expanded to produce a sufficient cell mass.

[0100] In one embodiment of any of the aspects described herein, the method further comprises a stirred production bioreactor at least 250L scale.

[0101] In one embodiment of any of the aspects described herein, the step of transfecting comprises using polyethyleneimine.

[0102] In one embodiment of any of the aspects described herein, the step of harvesting comprises harvesting suspension cells.

[0103] In one embodiment of any of the aspects described herein, the suspension cells are harvested at least 72 hours after the step of transfecting.

[0104] In one embodiment of any of the aspects described herein, harvesting comprises lysing suspension cells and purifying rAAV virions.

[0105] In one embodiment of any of the aspects described herein, the lysing step comprises chemical lysis.

[0106] In one embodiment of any of the aspects described herein, the purifying step comprises a purification method selected from the group consisting of affinity capture chromatography, iodixanol density gradient centrifugation, and quaternary amine chromatography resin.

[0107] Another aspect provided herein is a method of producing recombinant adeno-associated virus (rAAV), comprising: i) transfecting a cell with SEQ ID NO: 1 or SEQ ID NO: 31, ii) an rAAV genome, and iii) an AAV capsid (cap) gene and a non-structural replication (rep) gene, and giving the cell sufficient time to produce rAAV particles.

[0108] In one embodiment of any of the aspects described herein, the cells are cultured for a sufficient time and under conditions such that at least the polypeptide encoded by SEQ ID NO: 5 or the polypeptide encoded by SEQ ID NO: 6 is expressed.

[0109] In one embodiment of any of the aspects described herein, the cells are cultured for a sufficient time and under conditions such that at least one polypeptide encoded by SEQ ID NO: 1 or SEQ ID NO: 31 is expressed.

[0110] Another aspect provided herein is a method of producing viral particles, comprising: a) providing a cell according to claim 67; b) expressing at least the polypeptide encoded by SEQ ID NO: 5 or the polypeptide encoded by SEQ ID NO: 6, or expressing at least one polypeptide encoded by SEQ ID NO: 1 or SEQ ID NO: 31, in the cell for a sufficient time and under conditions such that; c) culturing the cell under conditions under which viral particles are produced; and d) isolating the viral particles, if desired.

[0111] In one embodiment of any of the aspects described herein, the hAd5-based nucleic acid further comprises a sequence having at least 85% sequence identity with SEQ ID NO: 93 and / or a sequence having at least 85% sequence identity with SEQ ID NO: 94.

[0112] In one embodiment of any of the aspects described herein, SEQ ID NO: 93 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region.

[0113] In one embodiment of any of the aspects described herein, SEQ ID NO: 94 is downstream of the 3' end of the nucleic acid sequence encoding the E2A region.

[0114] In one embodiment of any of the aspects described herein, SEQ ID NO: 94 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region.

[0115] In one embodiment of any of the aspects described herein, SEQ ID NO: 93 is downstream of the 3' end of the nucleic acid sequence encoding the E2A region.

[0116] In one embodiment of any of the aspects described herein, SEQ ID NO: 94 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region and SEQ ID NO: 93 is not located at the 3' end of the nucleic acid sequence encoding the E2A region.

[0117] In one embodiment of any of the aspects described herein, the hAd5-based nucleic acid is clDNA.

[0118] In one embodiment of any of the aspects described herein, the clDNA further comprises a telomerase binding site.

[0119] In one embodiment of any of the aspects described herein, SEQ ID NO: 93 is located between the telomerase binding site (TelRL) and the 5'-end of the E4 region, and SEQ ID NO: 94 is located between the telomerase binding site (TelRL) and the 3'-end of the E2A region.

[0120] In one embodiment of any of the aspects described herein, SEQ ID NO: 94 is located between the telomerase binding site (TelRL) and the 5'-end of the E4 region, and SEQ ID NO: 93 is located between the telomerase binding site (TelRL) and the 3'-end of the E2A region.

[0121] In one embodiment of any of the aspects described herein, SEQ ID NO: 94 is located between the telomerase binding site and upstream of the 5'-end of the E4 region, and SEQ ID NO: 93 is not located between the telomerase binding site and the 3'-end of the E2A region.

[0122] Another aspect described herein includes a helper nucleic acid that includes an E2A region, an E4 region, and a VA RNA region and does not include one or more of at least one packaging protein, at least one structural protein, a major late promoter (MLP), an E1 region, and / or an E3 region.

[0123] In one embodiment of any of the aspects described herein, the nucleic acid comprises the sequence of SEQ ID NO: 95.

[0124] Another aspect described herein includes an E2A region, an E4 region, and a VA RNA region, and is a helper nucleic acid that does not include one or more of at least one packaging protein, at least one structural protein, a major late promoter (MLP), an E1 region, and / or an E3 region.

[0125] In one embodiment of any of the aspects described herein, the nucleic acid includes the sequence of SEQ ID NO: 96. BRIEF DESCRIPTION OF THE DRAWINGS

[0126]

Figure 1

[0127]

Figure 2-1

Figure 2-2

Figure 2-3

[0128]

Figure 3-1

Figure 3-2

Figure 3-3

[0129]

Figure 4-1

Figure 4-2

[0130]

Figure 5

[0131]

Figure 6

[0132]

Figure 7-1

Figure 7-2

[0133]

Figure 8

[0134]

Figure 9-1

Figure 9-2

Figure 9-3

[0135]

Figure 10-1

Figure 10-2

[0136]

Figure 11-1

Figure 11-2

[0137]

Figure 12

Mode for Carrying Out the Invention

[0138] The above figures illustrate aspects of the technology in at least one of its exemplary embodiments, which are further defined in more detail in the following description.

[0139] Detailed Description The various aspects described herein are based in part on the discovery that the adenovirus helper (ad helper) nucleic acids described herein can use a minimal number of protein regions to produce rAAV. One aspect provided herein describes a human adenovirus 5 (hAd)-based nucleic acid comprising (a) an E4 region having E4-ORF6 / 7, (b) a viral associated (VA) RNA region, and (c) an E2A region having L4-22K and L4-33K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not include one or more of (d) at least one packaging protein, (e) at least one structural protein (e.g., hexon), (f) a major late promoter (MLP), (g) an E1 region, and / or (h) an E3 region.

[0140] In some embodiments, the E2A region in the ad helper produces the L4-100K protein. The L4-100K protein is involved not only in the assembly of hexon and the transport of the hexon structure to the nucleus, but also in other proteins that interact with hexon in the final formation of the capsid. In some embodiments, the E2A region includes a nucleic acid encoding a single-stranded DNA binding protein (DBP) (SEQ ID NO: 4). The terms E2A and DBP can be used interchangeably.

[0141] In some embodiments, the E2A region produces adenovirus L4-22K and adenovirus L4-33K. L4-22K is a multifunctional protein that is involved in the transient switch from the early to the late stages of infection by regulating both the packaging of the viral genome into empty capsids and early and late gene expression. L4-33K functions as an alternative splicing factor involved in genome packaging. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises and / or expresses L4-100K, L4-22K, and / or L4-33K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-100K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-22K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-33K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-100K and L4-22K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-100K and / or L4-33K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-22K and / or L4-33K. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid comprises L4-100K, L4-22K, and L4-33K. In some embodiments, the nucleic acid comprises GGCAGC (SEQ ID NO: 1) at positions 4279-4284.

[0142] In some embodiments, the E2A region can be codon-optimized. In some embodiments, the E2A region can comprise a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 2-8 or a sequence of one of SEQ ID NOs: 2-8 that maintains the same function.

[0143] In some embodiments, the E2A region can encode a polypeptide selected from SEQ ID NOs: 82-85, or a sequence that maintains the same function and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of the sequences of SEQ ID NOs: 82-85.

[0144] In some embodiments, the E4 region can be codon-optimized. In some embodiments, the E4 region can include a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 9-15, or a sequence that maintains the same function.

[0145] In some embodiments, the E4 region can encode a polypeptide selected from SEQ ID NOs: 86-91, or a sequence that maintains the same function and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of the sequences of SEQ ID NOs: 86-91.

[0146] In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain at least one structural protein. The structural protein may include a fiber protein, a hexon protein, or a penton protein. The fiber protein, hexon protein, and penton protein are the main components of the adenovirus capsid. These capsids cover the produced rAAV. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a fiber protein, a hexon protein, and / or a penton protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a fiber protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a hexon protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a penton protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a fiber protein and a hexon protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a fiber protein and a penton protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a hexon protein and a penton protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain a fiber protein, a hexon protein, and a penton protein.

[0147] In some embodiments, the nucleic acid encoding a structural protein (e.g., a fiber protein, a hexon protein, or a penton protein) may include a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 32-34 or a sequence of one of SEQ ID NOs: 32-34 that maintains the same function.

[0148] In some embodiments, the structural protein (e.g., a fiber protein, a hexon protein, or a penton protein) may comprise one of SEQ ID NOs: 18-20, or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 18-20 and maintains the same function.

[0149] In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain at least one packaging protein. The packaging proteins can include the 23K endoprotease, the peripenton hexon-related protein, and packaging protein 3. The 23K endoprotease not only increases host-adenovirus membrane interaction but also has the role of cleaving capsid proteins upon entry. The 23K endoprotease is involved in cell entry by the produced rAAV. The peripenton hexon-related protein helps in capsid stabilization during formation. Packaging protein 3 is involved in viral genome packaging and is removed from the virion once the capsid is formed. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the 23K endoprotease, the peripenton hexon-related protein, and / or packaging protein 3. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the 23K endoprotease. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the peripenton hexon-related protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain packaging protein 3. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the 23K endoprotease and the peripenton hexon-related protein. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the 23K endoprotease and packaging protein 3. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the peripenton hexon-related protein and packaging protein 3. In some embodiments, the human adenovirus 5 (hAd)-based nucleic acid does not contain the 23K endoprotease, the peripenton hexon-related protein, and packaging protein 3.

[0150] In some embodiments, the nucleic acid encoding the packaging protein (e.g., 23K endoprotease, peripenton hexon-related protein, and / or packaging protein 3) is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 35-37, or a sequence of one of SEQ ID NOs: 35-37 that maintains the same function.

[0151] In some embodiments, the packaging protein (e.g., 23K endoprotease, peripenton hexon-related protein, and / or packaging protein 3) is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 21-23, or a sequence of one of SEQ ID NOs: 21-23 that maintains the same function.

[0152] In a further embodiment, the hAD5-based nucleic acid of the present invention does not include the adenovirus inverted terminal repeat (ITR), e.g., the left ITR, or the right ITR, or any segment thereof.

[0153] In one embodiment, the hAd5-based nucleic acid of the present invention has a 5'→3' orientation different from that of wild-type Ad5. For example, in the present invention, in the 5'→3' direction, the E4 region is located upstream of the E2A region.

[0154] In some embodiments, the Ad helper described herein can effectively express L4-22K and L4-33K, do not express any structural and packaging proteins, but can still produce high-titer rAAV. This smaller-sized nucleic acid not only represents a safer approach for rAAV production but also enables effective integration into cells.

[0155] The E4 region contributes to the expression of early and late genes in virion packaging. Early genes support viral replication within the host cell; late genes support host cell lysis, viral assembly, and virion release. In some embodiments, the E4 region includes E4-ORF6 / 7. In some embodiments, the E4 region lacks E4-ORF1. In some embodiments, the E4 region includes E4-ORF6 / 7 and lacks E4-ORF1. In some embodiments, the E4 region enhances early gene expression. In some embodiments, the E4 region enhances late gene expression. In some embodiments, the E4 promoter can be replaced by a different promoter (e.g., a cancer-specific promoter). In some embodiments, the E4 region can be codon-optimized.

[0156] The virus-associated (VA) RNA region is a type of non-coding RNA found in adenovirus. It has a role in regulating the translation of both early and late genes. In some embodiments, there is at least one copy of VA RNA. In some embodiments, there are at least two copies of VA RNA. In some embodiments, the VA RNA region is transcriptionally regulated by the E4 promoter. In some embodiments, the VA RNA region is transcriptionally regulated by the E2 early promoter. In some embodiments, the VA RNA region is transcriptionally regulated by the E2 late promoter. In some embodiments, the VA RNA region is transcriptionally regulated by L4P. In some embodiments, the VA RNA region can be inserted anywhere in the helper genome through the use of restriction enzyme recognition sites. In some embodiments, the VA RNA region of SEQ ID NO: 1 or SEQ ID NO: 31 can be the same as the VA RNA region of SEQ ID NO: 16 or SEQ ID NO: 17.

[0157] In some embodiments, VA RNAI and / or VA RNAII can contain a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 16-17 or a sequence of one of SEQ ID NOs: 16-17 that maintains the same function.

[0158] In some embodiments, the E1 region is not expressed in the nucleic acids of the invention as described herein. The E1 region can be expressed in a host cell line or on a separate nucleic acid transfected into the host cell. The E1 region can include the following genes: E1A 13S (SEQ ID NO: 24, 38); E1A 12S (SEQ ID NO: 25, 39); E1A 11S (SEQ ID NO: 26, 40); E1A 10S (SEQ ID NO: 27, 41); E1A 9S (SEQ ID NO: 28, 42); E1B 19K (SEQ ID NO: 29, 43); and / or E1B 55K (SEQ ID NO: 30, 44).

[0159] In some embodiments, the E1 region comprises a nucleic acid sequence that is one of SEQ ID NOs: 38 - 44, or is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of the sequences of SEQ ID NOs: 38 - 44.

[0160] In some embodiments, the E1 region encodes a polypeptide selected from SEQ ID NOs: 24 - 30, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of the sequences of SEQ ID NOs: 24 - 30.

[0161] In some embodiments, the E3 region is not expressed in the nucleic acid as described herein. The E3 region contains genes encoding proteins that modulate the immune response after wild-type adenovirus infection and includes at least one of SEQ ID NOs: 68-81. The E3 function is activated only when the E1 region is functional. The E3 region may include the following genes: 12.K (SEQ ID NOs: 68, 75); CR1-alpha (SEQ ID NOs: 69, 76); gp19K (SEQ ID NOs: 70, 77); CR1-beta (SEQ ID NOs: 71, 78); RID-alpha (SEQ ID NOs: 72, 79); RID-beta (SEQ ID NOs: 73, 80); and / or 14.7K (SEQ ID NOs: 74, 81).

[0162] In some embodiments, the E3 region comprises a nucleic acid sequence that is one of SEQ ID NOs: 68-74, or is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of the sequences of SEQ ID NOs: 68-74.

[0163] In some embodiments, the E3 region comprises an amino acid sequence that is one of SEQ ID NOs: 75-81, or is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of the sequences of SEQ ID NOs: 75-81.

[0164] In some embodiments, an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and / or any chimeras thereof is produced using an hAd5-based helper nucleic acid as described herein. In some embodiments, a recombinant AAV comprising at least one of the viral structural proteins VP1, VP2, or VP3 from an AAV serotype listed in Table 1 is produced using a helper nucleic acid as described herein.

[0165]

Table 1-1

Table 1-2

Table 1-3

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Table 1-8

Table 1-9

Table 1-10

Table 1-11

Table 1-12

Table 1-13

Table 1-14

Table 1-15

Table 1-16

Table 1-17

Table 1-18

Table 1-19

Table 1-20

Table 1-21

Table 1-22

[0166] In some embodiments, helper nucleic acids as described herein are used to produce, for example, haploid AAV, rational haploid AAV, or rational multiple AAV as described in U.S. Patent No. 10,550,405, International Patent Application No. PCT / US2018 / 022725, International Patent Application No. PCT / US2018 / 044632, all of which are hereby incorporated by reference in their entirety. In some embodiments, the helper nucleic acid (used to produce AAV and / or recombinant AAV) is plasmid DNA or closed-ended linear double-stranded DNA (clDNA). An alternative term for clDNA is DNA without ends (neDNA). In some exemplary embodiments, the clDNA or neDNA described herein is dogbone DNA (dbDNA). In some embodiments, the helper nucleic acid is derived from or related to adenovirus serotype Ad5. In some embodiments, recombinant AAVs are produced using helper nucleic acids as described herein that include one or both ITRs that are 145 nucleotides in length or less than 145 nucleotides in length. In some embodiments, recombinant AAVs are produced using helper nucleic acids as described herein that include one or both ITRs that are 140 nucleotides in length, 135 nucleotides in length, 130 nucleotides in length, 125 nucleotides in length, or less than 125 nucleotides in length.

[0167] In some embodiments, the hAd5-based helper nucleic acid as described herein produces recombinant AAV (rAAV) by: i) transfecting a cell with the Ad helper nucleic acid of the invention, ii) an rAAV genome (e.g., from AAV ITR to ITR encompassing a transgene), and iii) an AAV capsid and non-structural replication genes (e.g., a nucleic acid encoding an AAV helper Rep-Cap); giving the cell sufficient time to produce rAAV particles; and producing a clarified lysate containing rAAV capsid particles, wherein the rAAV capsid particles in the clarified lysate contain at least about 15% full capsid particles. In certain embodiments, the rAAV in the clarified lysate contains at least about 15% full capsid particles, at least about 18% full capsid particles, at least about 20% full capsid particles, at least about 22% full capsid particles, at least about 25% full capsid particles, at least about 30% full capsid particles, at least about 35% full capsid particles, or a higher percentage of full capsid particles.

[0168] In certain aspects of the invention, rAAV is produced using two nucleic acids instead of three nucleic acids. In some embodiments of the invention, one single nucleic acid encodes the AAV helper Rep-Cap gene of the invention and the hAd5-based helper nucleic acid. In this case, rAAV is produced using: i) one single nucleic acid encoding the Ad helper function (encoded by the hAd5-based nucleic acid of the invention) and the AAV helper Rep-Cap gene, and ii) an rAAV genome (e.g., from AAV ITR to ITR encompassing a transgene).

[0169] In certain embodiments, the copy number of the nucleic acids as described herein used to produce rAAV is at least about 2,000 copies per cell to at least about 20,000 copies per cell. In some embodiments, the copy number of the Ad5-based helper nucleic acids as described herein is at least about 1,000 copies per cell, at least about 1,500 copies per cell, at least about 2,000 copies per cell, at least about 2,500 copies per cell, at least about 3,000 copies per cell, at least about 3,500 copies per cell, at least about 4,000 copies per cell, at least about 4,500 copies per cell, at least about 5,000 copies per cell, at least about 5,500 copies per cell, at least about 6,000 copies per cell, at least about 6,500 copies per cell, at least about 7,000 copies per cell, at least about 7,500 copies per cell, at least about 8,000 copies per cell, at least about 8,500 copies per cell, at least about 9,000 copies per cell, at least about 9,500 copies per cell, at least about 10,000 copies per cell, at least about 12,000 copies per cell, at least about 14,000 copies per cell, at least about 16,000 copies per cell, at least about 18,000 copies per cell, at least about 20,000 copies per cell or higher.

[0170] In some embodiments, the copy number of the Ad5-based nucleic acid as described herein is at least about 5000 copies per cell to at least about 12000 copies per cell. In some embodiments, rAAV particles comprising at least about 20% to at least about 35% full capsid particles are produced using the Ad5-based nucleic acid as described herein. In an exemplary method of producing recombinant AAV, the method comprises: A) first, (i) transfecting a cell with a helper nucleic acid as described herein, (ii) a recombinant AAV genome comprising an AAV endogenous genome flanked by left inverted terminal repeats (L-ITRs), or a recombinant AAV genome comprising a nucleic acid encoding any transgene flanked by left and right ITRs, and (iii) an AAV capsid and a non-structural replication (AAVRep-Cap) nucleic acid; B) producing a clarified lysate from the bioreactor, wherein the clarified lysate contains rAAV particles; C) enriching (or purifying) the rAAV in the clarified lysate (e.g., by a chromatographic purification method).

[0171] In some embodiments, the enriching step increases the percentage of full virus particles (e.g., by removing at least a portion of the partially full or empty virus particles). Without wishing to be bound by theory, an enriched solution containing full virus particles (e.g., as measured by % full AAV particles, % full rAAV particles) may still contain partially full virus particles and / or empty virus particles. However, the percentage of partially full virus particles and / or empty virus particles is substantially reduced compared to the unenriched clarified lysate.

[0172] In some embodiments, the hAd5-based helper nucleic acid of the invention as described herein produces purified recombinant AAV (rAAV) particles by a method comprising: A) transfecting cells with i) an Ad helper nucleic acid as described herein, ii) an rAAV genome (e.g., from AAV ITR to ITR encompassing a transgene), and iii) an AAV capsid and non-structural replication genes (e.g., a nucleic acid encoding an AAV helper Rep-Cap gene); B) allowing the cells sufficient time to produce rAAV particles; C) producing a clarified lysate; and D) purifying (or enriching) the clarified lysate (e.g., by using a chromatographic purification method), thereby producing enriched or purified rAAV particles. In some embodiments, the purified or enriched rAAV particles comprise at least about 65% full capsid particles. In certain embodiments, the purified or enriched rAAV particles comprise at least about 70% full capsid particles, at least about 75% full capsid particles, at least about 80% full capsid particles, at least about 85% full capsid particles, at least about 90% full capsid particles, at least about 95% full capsid particles, at least about 98% full capsid particles, at least about 99% full capsid particles, or at least about 99.5% or higher full capsid particles. In certain embodiments, the purified or enriched rAAV particles comprise 100% full capsid particles.In certain embodiments, the purified or enriched rAAV particles comprise less than about 10% empty capsid particles, less than about 8% empty capsid particles, less than about 6% empty capsid particles, less than about 5% empty capsid particles, less than about 5% empty capsid particles, less than about 3% empty capsid particles, less than about 2% empty capsid particles, less than about 1% empty capsid particles, less than about 0.8% empty capsid particles, less than about 0.6% empty capsid particles, less than about 0.5% empty capsid particles, less than about 0.4% empty capsid particles, less than about 0.3% empty capsid particles, less than about 0.2% empty capsid particles, less than about 0.1% empty capsid particles, less than about 0.08% empty capsid particles, less than about 0.06% empty capsid particles, less than about 0.05% empty capsid particles, less than about 0.03% empty capsid particles, less than about 0.02% empty capsid particles, less than about 0.01% or less % empty capsid particles. In some embodiments, the purified or enriched rAAV is substantially devoid of empty capsid particles.

[0173] As described herein, the hAd5-based nucleic acid is XX85 and can be described as SEQ ID NO: 1 and / or SEQ ID NO: 31.

[0174] In some embodiments, the hAd5-based nucleic acids of the invention as described herein produce recombinant adeno-associated virus (rAAV) in a clarified lysate that contains at least about 1.5-fold more amount or percentage of full capsids as compared to rAAV in a clarified lysate produced with an xx-680 nucleic acid (such as shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92). In certain embodiments, the nucleic acids as described herein produce recombinant adeno-associated virus (rAAV) particles in a clarified lysate that contain at least about 1.1-fold higher, at least about 1.2-fold higher, at least about 1.3-fold higher, at least about 1.4-fold higher, at least about 1.5-fold higher, at least about 1.6-fold higher, at least about 1.7-fold higher, at least about 1.8-fold higher, at least about 2-fold higher, at least about 2.2-fold higher, at least about 2.5-fold higher, at least about 2.8-fold higher, at least about 3-fold higher full capsid particles or higher full capsid particles in a greater fold as compared to rAAV in a clarified lysate produced with an xx-680 nucleic acid (such as shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92). Thereby, the Ad helper nucleic acids as described herein produce rAAV with a higher full capsid % than rAAV produced with an xx680 nucleic acid, and thus, show a higher packaging efficiency with the helper nucleic acids as described herein than with that of the xx680 nucleic acid.In certain embodiments, an Ad5-based helper nucleic acid as described herein produces a recombinant adeno-associated virus (rAAV) in a clarified lysate that has a packaging efficiency that is at least about 1.1-fold higher, at least about 1.2-fold higher, at least about 1.3-fold higher, at least about 1.4-fold higher, at least about 1.5-fold higher, at least about 1.6-fold higher, at least about 1.7-fold higher, at least about 1.8-fold higher, at least about 2-fold higher, at least about 2.2-fold higher, at least about 2.5-fold higher, at least about 2.8-fold higher, at least about 3-fold higher or greater than about 3-fold higher compared to rAAV in a clarified lysate produced with an xx-680 nucleic acid (such as that shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92). In some embodiments, an hAd5-based helper nucleic acid as described herein produces a purified or enriched rAAV, where the purified or enriched rAAV contains at least about 1.1-fold more full capsid particles, at least about 1.2-fold more, at least about 1.3-fold more, at least about 1.4-fold more, at least about 1.5-fold more, at least about 1.6-fold more, at least about 1.7-fold more, at least about 1.8-fold more, at least about 2-fold more, at least about 2.2-fold more, at least about 2.5-fold more, at least about 2.8-fold more, at least about 3-fold more or greater than about 3-fold more full capsid particles compared to a purified or enriched rAAV produced with an xx-680 nucleic acid (such as that shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92).

[0175] In one embodiment, recombinant adeno-associated virus (rAAV) is produced using an AAV Rep-Cap plasmid with an hAd5-based helper nucleic acid as described herein. In some embodiments, the AAV Rep-Cap plasmid utilizes a recombinant or modified P5 promoter. An example of a modified or recombinant p5 promoter is one in which a spacer sequence is inserted between the p5 TATA and the YY1 box, as described, for example, in International PCT publication no. WO 2021 / 242664 (A1).

[0176] In some embodiments, the hAd5-based helper construct or helper nucleic acid of the invention (e.g., helper plasmid and / or helper clDNA) can be utilized with different viruses that require additional helper components to promote growth and expression, including but not limited to adenovirus, lentivirus, and baculovirus.

[0177] In some embodiments, the helper construct or helper nucleic acid (e.g., helper plasmid and / or helper clDNA) of the present invention is at most 5001, at most 5101, at most 5201, at most 5301, at most 5401, at most 5501, at most 5601, at most 5701, at most 5801, at most 5901, at most 6001, at most 6101, at most 6201, at most 6301, at most 6401, at most 6501, at most 6601, at most 6701, at most 6801, at most 6901, at most 7001, at most 7101, at most 7201, at most 7301, at most 7401, at most 7501, at most 7601, at most 7701, at most 7801, at most 7901, at most 8001, at most 8101, at most 8201, at most 8301, at most 8401, at most 8501, at most 8601, at most 8701, at most 8801, at most 8901, at most 9001, at most 9101, at most 9201, at most 9301, at most 9401, at most 9501, at most 9601, at most 9701, at most 9801, at most 9901, at most 10001, at most 10101, at most 10201, at most 10301, at most 10401, at most 10501, at most 10601, at most 10701, at most 10801, at most 10901, at most 11001, at most 11101, at most 11201, at most 11301, at most 11401, at most 11501, at most 11601, at most 11701, at most 11801, at most 11901, at most 12001, at most 12101, at most 12201, at most 12301, at most 12401, at most 12501, at most 12601, at most 12701, at most 12801, at most 12901, at most 13001, at most 13101, at most 13201, at most 13301, at most 13401, at most 13501, at most 13601, at most 13701, at most 13801, at most 13901, at most 14001, at most 14101, at most 14201, at most 14301, at most 14401, at most 14501, at most 14601, at most 14701,It can be at most 14801, at most 14901, at most 15001, at most 15101, at most 15201, at most 15301, at most 15401, at most 15501, at most 15601, at most 15701, at most 15801, at most 15901, at most 16001, at most 16101, at most 16201, at most 16301, at most 16401, at most 16501, at most 16601, at most 16701, at most 16801, at most 16901, at most 17001, at most 17101, at most 17201, at most 17301, at most 17401, at most 17501, at most 17601, at most 17701, at most 17801, at most 17901, at most 18001, at most 18101, at most 18201, at most 18301, at most 18401, at most 18501, at most 18601, at most 18701, at most 18801, at most 18901, or at most 18932 nucleotides in length.,

[0178] Unless otherwise defined specifically, technical terms used in this specification have the ordinary meanings as understood in the relevant technical field. The following terms are specifically defined with examples for clarity. When used in this specification, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, as long as the terms "including", "includes", "having", "has", "with", or their variants are used in either the detailed description and / or any of the claims, such terms are intended to be as inclusive as the term "comprising". It should be noted that when used in this specification and the appended claims, the singular forms "a", "an", and "the" include multiple references unless the context clearly indicates otherwise. Thus, for example, a reference to "protein" is a reference to one or more proteins and includes its equivalents known to those skilled in the art.,

[0179] As used herein, the terms "comprising," "comprise," or "comprised" and variations thereof mean inclusive or open-ended with respect to the defined or recited elements of an item, composition, apparatus, method, process, system, etc., allowing for additional elements, such that the defined or recited item, composition, apparatus, method, process, system, etc. includes those specified elements, or their equivalents as appropriate, and may include other elements and still be within the scope / definition of the defined item, composition, apparatus, method, process, system, etc.

[0180] As used herein, the term "clDNA" or "closed-ended linear double-stranded DNA" refers to a closed linear nucleic acid construct that excludes the need for bacterial cells and thus excludes bacterial sequences (e.g., antibiotic resistance genes) necessary for large-scale growth of bacteria. An alternative term for clDNA is DNA without ends (neDNA).

[0181] Closed-ended linear double-stranded DNA molecules or neDNA molecules typically contain covalently closed ends, also described as hairpin loops, where there is no base pairing between complementary DNA strands. The hairpin loop joins the ends of the complementary DNA strands. This type of structure is typically formed at the telomeric ends of chromosomes to protect against loss or damage of chromosomal DNA by sequestering the terminal nucleotides in a closed structure. In the examples of closed linear DNA molecules described herein, the hairpin loop is adjacent to complementary base-paired DNA strands and forms a closed linear (cl) DNA-shaped structure. Non-limiting examples of closed-ended linear double-stranded DNA (clDNA) or DNA without ends (neDNA) molecules include dogbone DNA (dbDNA) and / or dumbbell-shaped DNA. clDNA may further include at least one telomerase binding site.

[0182] In some embodiments, one or more nucleic acids can be present on a closed-ended linear double-stranded nucleic acid. Such nucleic acids can be generated by a variety of known methods including in vitro cell-free synthesis and in vivo methods.

[0183] In certain embodiments, one or more nucleic acid sequences are amplified linear open-ended DNAs having blunt ends or overhangs, and the synthesized hairpin molecules are ligated to one or both ends to form a closed-ended linear double-stranded DNA containing one or more of the nucleic acids as described herein. Unligated hairpins are purified using means well known to those skilled in the art. The DNA can be amplified by PCR and ligated in double-stranded form.

[0184] One method for generating a covalently closed-ended linear double-stranded nucleic acid is by incorporating a telomerase binding site into a precursor molecule such that the telomerase binding site is adjacent to the nucleic acid of interest. The nucleic acid of interest can be exposed to telomerase, thereby cleaving and ligating the DNA at that site. Non-limiting examples of cell-free in vitro synthesis are, for example, U.S. Patent No. 9,109,250; U.S. Patent No. 6,451,563; Nucleic Acids Res. 2015 Oct 15;43(18):e120; U.S. Patent No. 9,499,847; 15 / 508,766; PCT / GB2017 / 052413; and Antisense & nucleic acid drug development 11:149-153 (2001), which are hereby incorporated by reference in their entirety. DNA from cell-free in vitro synthesis lacks any prokaryotic DNA modifications.

[0185] The recombinant AAV vector genome can be designed to have at least one of a wild-type ITR, a synthetic ITR, or a DD ITR, or a combination thereof, flanked by an imperfect palindromic structure containing a telomerase site such as telRL. When cleaved by telomerase to form covalently closed ends, a closed linear double-stranded nucleic acid vector is generated using a template. In one embodiment, the vector contains two DD ITRs and an expression cassette, and a telomerase target site flanks each side of the DD ITRs, which can be cleaved by telomerase to covalently close the ends. The closed linear DNA contains half of the telomerase binding site.

[0186] Furthermore, prokaryotic systems can be used. In lysogenic bacteria, bacteriophage N15 exists as a linear extrachromosomal DNA with covalently closed ends (see Rybchin VN, Svarchevsky AN (1999) The plasmid prophage N15: a linear DNA with covalently closed ends. Mol Microbiol 33:895-903). This DNA is generated by a cleavage-ligation reaction exerted by a single enzyme, protelomerase, such as TelN (prokaryotic telomerase) [Deneke J, Ziegelin G, Lurz R, Lanka E (2000) The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc Natl Acad Sci USA 97:7721-7726]. Protelomerases, such as TelN, recognize target sequences in double-stranded DNA. The target site is an imperfect palindrome structure called telRL, which is formed by two halves, telR and telL, corresponding to the covalently closed ends of the linear prophage. The enzyme cleaves both DNA strands and ligates the resulting ends to form a covalently closed hairpin structure. The resulting DNA molecule has two hairpin loops. TelN can linearize recombinant plasmids carrying the telRL site [Deneke J et al., (2000). Proc Natl Acad Sci USA 97:7721-7726]. Therefore, this enzyme can be used on plasmid DNA for expression in higher organisms.

[0187] In certain embodiments, an in vivo cell system is used to produce a closed-ended linear double-stranded nucleic acid. The method includes using cells that express a telomerase, such as TelN, or other telomerase, where the telomerase gene is under the control of a regulatable promoter. For example, an inducible promoter such as a small molecule regulatable promoter or a temperature sensitive promoter, such as a heat shock promoter. After sufficient production of the nucleic acid of interest or combinations thereof, the telomerase can be expressed to excise the nucleic acid of interest from the template.

[0188] In certain embodiments, an in vivo cell system is used to produce a non-viral DNA vector construct for delivery of a predetermined nucleic acid sequence to target cells for persistent expression. The non-viral DNA vector includes two DD-ITRs, each having inverted terminal repeat sequences with A, A', B, B', C, C' and D regions; D' region (where the D and D' regions are complementary palindromic sequences of about 5-20 nt in length and are positioned in the A and A' regions); a predetermined nucleic acid sequence (e.g., a heterologous gene for expression), where the two DD-ITRs are adjacent to the nucleic acid in the context of covalently closed non-viral DNA, and the closed linear vector includes a 1 / 2 telomerase binding site at each end.

[0189] Using the TelN / telRL system described herein, a closed linear DNA fragment containing a polyadenylation signal can be produced from a parental plasmid having two adjacent ITRs with two telRL sites flanking each segment of a promoter, gene of interest, by either linearizing a parental plasmid containing one telRL site or excising a DNA fragment or non-viral vector fragment. In one embodiment, at least one double "D" ITR is present. The resulting linear covalently closed DNA molecule is functional in vivo.

[0190] The system includes recombinant host cells. Host cells suitable for use in the present production system include microbial cells, such as bacterial cells like E. coli cells, and yeast cells such as S. cerevisiae. For example, K1 strain (ATCC CCL 61) Chinese hamster ovary (CHO) cells including Pro5 variant (ATCC CRL 1281); fibroblast-like cells derived from SV40-transformed African green monkey kidney of CV-1 strain (ATCC CCL 70), COS-1 strain (ATCC CRL 1650) and COS-7 strain (ATCC CRL 1651); mouse L cells, mouse 3T3 cells (ATCC CRL 1658), mouse C127 cells, human fetal kidney cells of 293 strain (ATCC CRL 1573), human cancer cells including those of HeLa strain (ATCC CCL 2), and mammalian host cells including neuroblastoma cells of IMR-32 strain (ATCC CCL 127), neuroblastoma cells of SK-N-MC strain (ATCC HTB 10) and neuroblastoma cells of SK-N-SH strain (ATCC HTB 11) can also be used.

[0191] The host cells are designed to encode at least one recombinase. The host cells can also be designed to encode two or more recombinases. The term "recombinase" refers to an enzyme that catalyzes DNA exchange at specific target sites, such as palindromic sequences, by excision / insertion, inversion, translocation and exchange. Examples of recombinases suitable for use in the present system include, but are not limited to, TelN, Tel, Tel (gp26 K02 phage) Cre, Flp, phiC31, Int and other lambdoid phage integrases, such as phi 80, HK022 and HP1 recombinases. The target sequences for each of these recombinases are as follows:

[0192] telRL site: tatcagcacacaattgcccattatacgcgcgtataatggactattgtgtgctgata

[0193] (SEQ ID NO: 45);

[0194] pal site: ACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGGT (SEQ ID NO: 46);

[0195] φK02 telRL site: CCATTATACGCGCGTATAATGG (SEQ ID NO: 47);

[0196] loxP site: TAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 48);

[0197] FRT site: GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC (SEQ ID NO: 49)

[0198] phiC31 attP site: CCCAGGTCAGAAGCGGTTTTCGGGAGTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTT GGGGGCGTAGGGTCGCCGACAYGACACAAGGGGTT (SEQ ID NO: 50); and

[0199] λ attP site: TGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAA AAAAGCTGAACGAGAAACGTAAAATGATATAAA (SEQ ID NO: 51)

[0200] Expression of the recombinase is under the control of any regulatory or inducible promoter, i.e., a promoter that is activated under specific physical or chemical conditions or stimuli. Examples of suitable promoters include heat-regulated promoters such as the λ pL promoter, the IPTG-regulated lac promoter, the glucose-regulated ara promoter, the T7 polymerase-regulated promoter, the cold shock-inducible cspA promoter, pH-inducible promoters, or combinations thereof such as the tac (T7 and lac) dual-regulated promoter.

[0201] Alternative methods for generating covalently closed linear double-stranded DNA lacking bacterial sequences are known in the art, for example, by forming minicircle DNA from plasmids (e.g., as described in U.S. Patent No. 8,828,726 and U.S. Patent No. 7,897,380, the entire contents of each of which are incorporated by reference). For example, one method of cell-free synthesis combines the use of two enzymes - Phi29 DNA polymerase and protelomerase - to generate a high-fidelity covalently closed linear DNA construct. The construct does not contain antibiotic resistance markers and thus eliminates the packaging of these sequences. This process can amplify AAV genomic DNA in a two-week process on a commercial scale and maintain the ITR sequences required for virus production.

[0202] Amplifying double-stranded DNA by rolling circle amplification using Phi29 DNA polymerase, generating covalently closed linear double-stranded DNA using protelomerase, and combining this with a reasonable purification process results in a pure DNA product containing only the sequence of interest. Phi29 DNA polymerase has high fidelity (1×10 6 ~1×10 7 ) and high processivity (about 70 kbp). These characteristics make this polymerase particularly suitable for the large-scale production of GMP DNA. Protelomerase (also known as telomere resolvase) catalyzes the formation of covalently closed hairpin ends on linear DNA and has been identified in several phages, bacterial plasmids, and bacterial chromosomes. A pair of protelomerases recognizes an inverted palindromic DNA recognition sequence and catalyzes strand cleavage, strand exchange, and DNA ligation to generate closed linear hairpin ends. The formation of these closed-end structures makes the DNA resistant to exonuclease activity, allows for simple purification, and can improve the stability and duration of expression.

[0203] In one embodiment, the DNA construct includes a telomerase binding site and the covalently closed end is formed by telomerase enzyme activity (e.g., in vitro). The telomerase binding site and corresponding telomerase for use in the present invention are provided in U.S. Patent No. 9,499,847, the entire content of which is incorporated herein by reference. The telomerase target sequence used in the present invention preferably includes a double-stranded palindrome (perfect inverted repeat) sequence that is at least 14 base pairs in length. Preferred perfect inverted repeat sequences include the sequences of SEQ ID NOs: 52-57 and variants thereof. SEQ ID NO: 52 (NCATNNTANNCGNNTANNATGN) is a 22-base consensus sequence of a mesophilic bacteriophage perfect inverted repeat sequence. The base pairs of the perfect inverted repeat sequence are conserved at certain positions between different bacteriophages, but sequence flexibility is possible at other positions. Thus, SEQ ID NO: 52 is the minimum consensus sequence of the perfect inverted repeat sequence for use with bacteriophage telomerase in the process of the present invention.

[0204] Within the consensus defined by SEQ ID NO: 52, SEQ ID NO: 53 (CCATTATACGCGCGTATAATGG) is a perfect inverted repeat sequence for use with Escherichia coli phage N15 and Klebsiella phage Phi KO2 prote telomerases. Also, within the consensus range defined by (SEQ ID NO: 52) and / or (SEQ ID NOs: 54 - 57): SEQ ID NO: 54 (GCATACTACGCGCGTAGTATGC), SEQ ID NO: 55 (CCATACTATACGTATAGTATGG), SEQ ID NO: 56 (GCATACTATACGTATAGTATGC) are particularly preferred perfect inverted repeat sequences for use with prote telomerases from Yersinia phage PY54, Halomonas phage phiHAP-1, and Vibrio phage VP882, respectively. SEQ ID NO: 57 (ATTATATATATAAT) is a particularly preferred perfect inverted repeat sequence for use with Borrelia burgdorferi prote telomerase. This perfect inverted repeat sequence is from lpB31.16, a linear covalently closed plasmid contained in Borrelia burgdorferi. This 14-base sequence is shorter than the 22bp consensus perfect inverted repeat sequence (SEQ ID NO: 52) in the case of bacteriophage, indicating that bacterial prote telomerases may have different specific target sequence requirements than bacteriophage prote telomerases. However, all prote telomerase target sequences share a common structural motif of perfect inverted repeats.

[0205] The perfect inverted repeat array can be longer than 22 bp depending on the requirements of the specific telomerase used in the processes as described herein. Thus, in some embodiments, the perfect inverted repeat can be at least 30, at least 40, at least 60, at least 80, or at least 100 base pairs in length. Examples of such perfect inverted repeat arrays include SEQ ID NOs: 58 - 60 and their variants. SEQ ID NO: 58 (GGCATACTATACGTATAGTATGCC); SEQ ID NO: 59 (ACCTATTTCAGCATACTACGCGCG - TAGTATGCTGAAATAGGT); SEQ ID NO: 60 (CCTATATTGGGCCACCTATGTATG - CACAGTTCGCCCATACTATACGTATAGTATGGGCGAACTGTGCATACATAGGTGGCCCAATATAGG). SEQ ID NOs: 58 - 60 and their variants are particularly preferred for use with telomerases from Vibrio phage VP882, Yersinia phage PY54, and Halomonas phage phi HAP - 1, respectively.

[0206] The perfect inverted repeat can be flanked by additional inverted repeat arrays. The adjacent inverted repeat arrays can be perfect or imperfect repeat arrays, i.e., can be completely symmetric or partially symmetric. The adjacent inverted repeat arrays may be in proximity to or not in proximity to the central palindrome. The telomerase target sequence can include an imperfect inverted repeat array that includes a perfect inverted repeat array at least 14 base pairs in length. One example is SEQ ID NO: 65. The imperfect inverted repeat array can include a perfect inverted repeat array at least 22 base pairs in length. One example is SEQ ID NO: 61.

[0207] In certain embodiments, the telomerase target sequence comprises the sequences of SEQ ID NOs: 61-65 or variants thereof. SEQ ID NO: 61 (TATCAGCACACAATTGCCCATTATACG-CGCGTATAATGGACTATTG TGTGCTGATA); SEQ ID NO: 62 (ATGCGCGCATCCATTATACGCGCGTATAATGGCGATAATACA); SEQ ID NO: 63 (TAGTCACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGG TTACTG); SEQ ID NO: 64 (GGGATCCCGTTCCATACATACATGTATCCATGTGGCATACTATACG TATAGTATGCCGATGTTACATATGGTATCATTCGGGATCCCGTT); SEQ ID NO: 65 (TACTAAATAAATATTATATATATAATTTTTTATTAGTA).

[0208] The sequences of SEQ ID NOs: 61-65 contain perfect inverted repeat sequences as described above and further contain adjacent sequences from related organisms. The telomerase target sequence containing the sequence of SEQ ID NO: 61 or a variant thereof is preferably used in combination with Escherichia coli N15 TelN telomerase and variants thereof. The telomerase target sequence containing the sequence of SEQ ID NO: 62 or a variant thereof is preferably used in combination with Klebsiella phage Phi K02 telomerase and variants thereof. The telomerase target sequence containing the sequence of SEQ ID NO: 63 or a variant thereof is preferably used in combination with Yersinia phage PY54 telomerase and variants thereof. The telomerase target sequence containing the sequence of SEQ ID NO: 64 or a variant thereof is preferably used in combination with Vibrio phage VP882 telomerase and variants thereof. The telomerase target sequence containing the sequence of SEQ ID NO: 65 or a variant thereof is preferably used in combination with Borrelia burgdorferi telomerase.

[0209] Any variant of the above palindrome or telomerase target sequence includes its homolog or mutant. Mutants include cleavage, substitution, or deletion relative to the native sequence. A variant sequence is any sequence that, by virtue of its presence in a DNA template, enables conversion to closed-ended linear double-stranded DNA by the enzymatic activity of telomerase. This can be readily determined by use of an appropriate assay for the formation of closed linear DNA. Any suitable assay described in the art can be used. An example of a suitable assay is described in Deneke et al., PNAS (2000) 97, 7721-7726. In certain embodiments, the variant enables telomerase binding and activity equivalent to that observed with the native sequence. Examples of preferred variants of the palindrome sequences described herein include truncated palindrome sequences that preserve the perfect repeat structure and maintain the ability to enable the formation of closed linear DNA. However, variant telomerase target sequences can be modified such that they no longer preserve the perfect palindrome, provided that they can act as a substrate for telomerase activity.

[0210] One of ordinary skill in the art will appreciate that, based on the structural principles outlined above, suitable telomerase target sequences for use in the present invention can be readily identified. Candidate telomerase target sequences can be screened for their ability to promote the formation of closed linear DNA using the assays described above.

[0211] The covalently closed vectors described herein can be generated in vitro or in vivo. The vector is a covalently closed linear double-stranded vector capable of expressing a transgene in a target cell. For example, an example of an in vitro process for producing a closed linear expression cassette DNA containing an ITR as described herein is: a) contacting a DNA template comprising at least one expression cassette flanked on both sides by a telomerase target sequence with at least one DNA polymerase and in the presence of one or more primers under conditions that promote amplification of the template; and b) contacting the amplified DNA produced in a) with at least one telomerase under conditions that promote formation of the closed linear expression cassette DNA. The closed linear expression cassette DNA product can comprise, consist of, or consist essentially of a eukaryotic promoter operably linked to a coding sequence of interest and, optionally, a eukaryotic transcription termination sequence. The closed linear expression cassette DNA product typically further lacks one or more bacterial or vector sequences selected from the group consisting of: (i) a bacterial origin of replication; (ii) a bacterial selectable marker (typically an antibiotic resistance gene); and (iii) an unmethylated CpG motif.

[0212] As outlined above, any DNA template containing at least one telomerase target sequence can be amplified according to the processes described herein. Thus, for example, the production of therapeutic DNA molecules for DNA vaccines or other therapeutic proteins and nucleic acids is preferred, but any type of closed circular DNA can be produced using the methods described herein. The DNA template can be double-stranded (ds) or single-stranded (ss) DNA. The double-stranded DNA template can be open circular double-stranded DNA, closed circular double-stranded DNA, open linear double-stranded DNA or closed linear double-stranded DNA. Preferably, the template is closed circular double-stranded DNA. The closed circular dsDNA template is particularly preferred for use with RCA (rolling circle amplification) DNA polymerase. The circular dsDNA template can be in the form of a plasmid or other vector typically used to contain genes for bacterial propagation. Thus, using the processes described herein, any commercially available plasmid or other vector, such as a commercially available DNA drug, can be amplified and then the amplified vector DNA can be converted to closed circular DNA.

[0213] Open circular dsDNA can be used as a template when the DNA polymerase is a strand-displacing polymerase that can initiate amplification from the nicked DNA strand. In this embodiment, the template may be pre-incubated with one or more enzymes that nick the DNA strand in the template at one or more sites. Closed linear dsDNA can be used as a template. The closed linear dsDNA template (starting material) can be identical to the closed linear DNA product. When using closed linear DNA as a template, it can be incubated under denaturing conditions to form single-stranded circular DNA before or during the conditions that promote amplification of the template DNA. In one embodiment, the closed-ended linear double-stranded DNA is produced in eukaryotic cells, such as insect cells, as described in PCT publications WO2019032102 and WO2019169233. In one embodiment, the DNA is not produced in eukaryotic cells and the DNA lacks eukaryotic sequences. In one embodiment, the closed-ended linear double-stranded DNA vector is produced as described in PCT publication WO 2019143885.

[0214] As outlined above, the DNA template typically comprises, consists of, or consists essentially of an expression cassette as described above, i.e., a eukaryotic promoter operably linked to a sequence encoding the protein of interest and, optionally, a eukaryotic transcription termination sequence. Optionally, the expression cassette may lack one or more bacterial or vector sequences selected from the group consisting of a minimal expression cassette as defined above, i.e., typically (i) a bacterial origin of replication; (ii) a bacterial selectable marker (typically an antibiotic resistance gene) and (iii) an unmethylated CpG motif.

[0215] As used herein, the terms "non-adherent cell line" or "suspension cell line" refer to cell lines that can survive in suspension culture without attaching to a surface (e.g., a tissue culture plastic carrier or a microcarrier). Adaptation to a non-adherent cell line is a long-term process that requires subculturing while reducing the amount of serum, whereby a cell population that has been irreversibly modified is selected. The cell line can be grown to a higher density than is possible under adherent conditions and is thus more suitable for culturing on an industrial scale, for example, in a bioreactor environment or in agitated culture.

[0216] As used in this specification and the appended claims, the term "or" is generally used in the sense of "and / or" unless the context clearly dictates otherwise.

[0217] As used herein, the terms "recombinant AAV (rAAV) vector" or "gene delivery vector" refer to viral particles that function as nucleic acid delivery vehicles and contain a vector genome (e.g., viral DNA [vDNA]) packaged within an AAV capsid. Alternatively, in some contexts, the term "vector" may be used to refer to the vector genome / vDNA only.

[0218] The "rAAV vector genome" or "rAAV genome" is an AAV genome (i.e., vDNA) containing one or more heterologous nucleotide sequences. rAAV vectors typically require only the cis 145-base terminal repeat sequence (TR) to generate the virus. All other viral sequences are not essential and may be supplied in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). Typically, the rAAV vector genome retains only the minimal TR sequences to maximize the size of the transgene that can be efficiently packaged by the vector. The structural and non-structural protein coding sequences can be provided in trans (e.g., from a vector such as a plasmid or by stably integrating the sequences into the packaging cell). The rAAV vector genome contains at least one TR sequence (e.g., an AAV TR sequence, a synthetic or other parvovirus TR sequence), and optionally two TRs (e.g., two AAV TRs), which are typically at the 5' and 3' termini of the heterologous nucleotide sequence(s), but need not be adjacent thereto. The TRs may be the same as or different from each other.

[0219] rAAV can further contain and be capable of expressing a transgene. As used herein, a "transgene" refers to a polynucleotide or nucleic acid that is intended to be introduced into a cell or organism or has been introduced. A transgene can include any nucleic acid, such as a gene encoding a polypeptide or protein. For example, transgenes suitable for use in gene therapy are well known to those of skill in the art. For example, the vectors described herein can deliver and use transgenes including, but not limited to, those described in U.S. Patent Nos. 6,547,099; 6,506,559; and 4,766,072; published U.S. Application Nos. 20020006664; 20030153519; 20030139363; as well as published PCT applications WO01 / 68836 and WO03 / 010180, and for example, miRNAs and other transgenes of WO2017 / 152149 (each of which is hereby incorporated by reference in its entirety).

[0220] The term "variant", when used in the context of a polynucleotide sequence, can encompass a polynucleotide sequence associated with a wild-type gene. This definition can also include, for example, "allelic", "splice", "species" or "polymorphic" variants. Splice variants can have significant identity to a reference molecule, but typically have a greater or lesser number of polynucleotides due to alternative splicing of exons during mRNA processing. The corresponding polypeptide can have additional functional domains or the absence of domains. Species variants are polynucleotide sequences that differ from species to species. Particularly useful in the art are variants of wild-type gene products. A variant can arise from at least one mutation in a nucleic acid sequence, resulting in an altered mRNA or a polypeptide whose structure or function may or may not be altered. Any given natural or recombinant gene may not have an allelic form, or may have one or many allelic forms. Common mutational changes that give rise to variants typically result from natural deletions, additions, or substitutions of nucleotides. Each of these types of changes can occur alone or in combination with others, one or more times in a given sequence.

[0221] As used herein, the term "nucleic acid" typically refers to any length of oligomer or polymer (preferably a linear polymer) essentially composed of nucleotides. Nucleotide units generally contain at least one, such as one, two, or three phosphate groups, including a heterocyclic base, a sugar group, and a modified or substituted phosphate group. Heterocyclic bases include, among others, purine and pyrimidine bases, such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U) widely present in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated), unnatural or derivatized bases. Sugar groups can include, among others, pentose (pentofuranose) groups, such as preferably ribose and / or 2-deoxyribose common to naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, as well as modified or substituted sugar groups. Nucleic acids as contemplated herein can include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides can include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modifications to the phosphate group or sugar can be introduced to improve stability, resistance to enzymatic degradation, or some other useful property. The term "nucleic acid" further preferably encompasses DNA, RNA, and DNA / RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA / RNA hybrids. In some embodiments, the nucleic acid is viral DNA or viral RNA. Nucleic acids can be naturally occurring, e.g., may occur naturally or be isolated from nature, or may not be naturally occurring, e.g., recombinant, i.e., produced by recombinant DNA technology, and / or be partially or completely chemically or biochemically synthesized. "Nucleic acid" can be double-stranded, partially double-stranded, or single-stranded.In the case of a single strand, the nucleic acid can be a sense strand or an antisense strand. Further, the nucleic acid can be circular or linear.

[0222] Variant amino acid or DNA sequences can be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the native or reference sequence. The degree of homology (percent identity) between the native and variant sequences can be determined, for example, by comparing the two sequences using freely available computer programs commonly used for this purpose on the World Wide Web (e.g., BLASTp or BLASTn with default settings).

[0223] Terms such as "identity" and "identical" refer to sequence similarity between two polymer molecules, e.g., between two nucleic acid molecules, e.g., between two DNA molecules. Determination of sequence alignment and sequence identity can be performed, for example, using the Basic Local Alignment Search Tool (BLAST) first described by Altschul et al., 1990 (J Mol Biol 215:403-10), or the "Blast 2 sequences" algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174:247-250).

[0224] Methods for aligning arrays for comparison are well known in the art. A variety of programs and alignment algorithms are described, for example, in Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. A detailed discussion of sequence alignment methods and homology calculations can be found, for example, in Altschul et al. (1990) J. Mol. Biol. 215:403-10.

[0225] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST™; Altschul et al. (1990)) is available for use in connection with several sequence analysis programs from several sources, including the National Center for Biotechnology Information (Bethesda, Maryland), and on the Internet. An explanation of how to use this program to determine sequence identity is available on the Internet under the "Help" section of BLAST™. For comparison of nucleic acid sequences, the "Blast 2 sequences" function of the BLAST™ (Blastn) program can be used with default parameters. Nucleic acid sequences having greater similarity to the reference sequence, when evaluated by this method, show an increase in the percentage of identity. Typically, the percent sequence identity is calculated over the full length of the sequence.

[0226] For example, a global optimal alignment is appropriately found by the Needleman-Wunsch algorithm using the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extension 2. The resulting percentage identity of the optimal global alignment is appropriately calculated by multiplying the ratio of the number of aligned bases to the full length of the alignment (in this case, the alignment length includes both matches and mismatches) by 100.

[0227] The adenovirus-based nucleic acids described herein can be synthetic. As used herein, "synthetic" means a nucleic acid molecule that does not occur in nature. The synthetic nucleic acid expression constructs of the invention are typically produced artificially by recombinant techniques. Such synthetic nucleic acids can contain sequences that occur in nature (e.g., promoters, enhancers, introns, and other such regulatory sequences), but these occur in an environment that does not occur in nature. For example, a synthetic gene (or portion of a gene) typically contains one or more nucleic acid sequences that are not naturally adjacent (chimeric sequences) and / or can include substitutions, insertions, and deletions and combinations thereof. As used herein, the term "synthetic promoter" refers to a promoter that does not occur in nature.

[0228] In some embodiments of any of the aspects, the adenovirus-based nucleic acids described herein are exogenous. In some embodiments of any of the aspects, the adenovirus-based nucleic acids described herein are ectopic. In some embodiments of any of the aspects, the adenovirus-based nucleic acids described herein are not endogenous.

[0229] The term "exogenous" refers to a substance that exists in a cell other than its natural source. As used herein, the term "exogenous" can refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or a polypeptide that has been introduced into a biological system, such as a cell or organism that is not normally found, by a process involving human hand, and it is desired to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" can refer to a nucleic acid or polypeptide that has been introduced into a biological system, such as a cell or organism, by a process involving human hand, where it is found in relatively small amounts and it is desired to increase the amount of the nucleic acid or polypeptide in the cell or organism, for example, to create ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is inherently present in a biological system or cell. As used herein, "ectopic" refers to a substance that is found at a location and / or in an amount different from normal. An ectopic substance can be one that is normally found in a given cell but in much smaller amounts and / or at different times. Ectopic also includes substances, such as polypeptides or nucleic acids, that are not naturally found or expressed in a given cell in its natural environment.

[0230] As used herein, "complementary" or "complementarity" refers to Watson-Crick base pairing of two nucleic acid sequences. For example, the sequence 5'-AGT-3' binds to the complementary sequence 3'-TCA-5'. Complementarity between two nucleic acid sequences can be "partial", where only some of the bases bind to their complements, or complete, as when all bases of the sequence bind to their complementary bases. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between the nucleic acid strands.

[0231] As used herein, the term "amino acid" includes any naturally occurring amino acid, its modified forms, and synthetic amino acids.

[0232] "Vector" refers to a compound used as a vehicle to carry foreign genetic material into another cell, in which case it can be replicated and / or expressed. A cloning vector containing foreign nucleic acid is called a recombinant vector. Examples of nucleic acid vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. A recombinant vector typically contains an origin of replication, a multiple cloning site, and a selectable marker. A nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that functions as the "backbone" of the vector. The purpose of a vector that transfers genetic information to another cell is typically to isolate, multiply, or express the insert in the target cell. An expression vector (expression construct) is for the expression of an exogenous gene in a target cell and usually has a promoter sequence that drives the expression of the exogenous gene / ORF. The insertion of a vector into a target cell is called transformation or transfection for bacteria and eukaryotic cells, while the insertion of a viral vector is often called transduction. The term "vector" can also be generally used to describe items that help carry foreign genetic material into another cell, such as, but not limited to, transformed cells or nanoparticles.

[0233] As used herein, "transfection" refers to the insertion of nucleic acid into a target cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the target cell is a HEK293 cell suspension. There are two different types of transfection: stable transfection and transient transfection. Stable transfection integrates exogenous nucleic acid into the genome within the transfected cell, whereas in transient transfection, the exogenous nucleic acid only exists in the cell for a limited time and does not integrate with the genome of the transfected cell. In some embodiments, the transfection method used is transient transfection. In some embodiments, the transfection method used is stable transfection. Transfection can be performed by a variety of methods including, but not limited to, calcium phosphate, electroporation, and / or cationic lipid-mediated methods (e.g., Lipofectamine, polyethyleneimine (PEI)). In some embodiments, the transfection method uses polyethyleneimine. Transfection may require an optimal cell density based on cell type, application, and / or transfection technique.

[0234] As used herein, "sufficient cell mass" refers to a cell density that is optimal for transfection. In some embodiments, the HEK293 cell suspension is increased to produce a sufficient cell mass to seed a bioreactor from at least a 25 L scale.To achieve maximum production of the desired rAAV virions, the cells may require at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 25 hours, at least 26 hours, at least 27 hours, at least 28 hours, at least 29 hours, at least 30 hours, at least 31 hours, at least 32 hours, at least 33 hours, at least 34 hours, at least 35 hours, at least 36 hours, at least 37 hours, at least 38 hours, at least 39 hours, at least 40 hours, at least 41 hours, at least 42 hours, at least 43 hours, at least 44 hours, at least 45 hours, at least 46 hours, at least 47 hours, at least 48 hours, at least 49 hours, at least 50 hours, at least 51 hours, at least 52 hours, at least 53 hours, at least 54 hours, at least 55 hours, at least 56 hours, at least 57 hours, at least 58 hours, at least 59 hours, at least 60 hours, at least 61 hours, at least 62 hours, at least 63 hours, at least 64 hours, at least 65 hours, at least 66 hours, at least 67 hours, at least 68 hours, at least 69 hours, at least 70 hours, at least 71 hours, at least 72 hours, at least 73 hours, at least 74 hours, at least 75 hours, at least 76 hours, at least 77 hours, at least 78 hours, at least 79 hours, at least 80 hours, at least 81 hours, at least 82 hours, at least 83 hours, at least 84 hours, at least 85 hours, at least 86 hours, at least 87 hours, at least 88 hours, at least 89 hours, at least 90 hours, at least 91 hours, at least 92 hours, at least 93 hours, at least 94 hours, at least 95 hours, at least 96 hours, at least 97 hours, at least 98 hours, at least 99 hours, at least 100 hours or longer after transfection before harvesting the virions from the transfected cells.

[0235] The transfection of multiple nucleic acids into the same cell can occur simultaneously or within 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 60 minutes, 65 minutes, 70 minutes, 75 minutes, 80 minutes, 85 minutes, 90 minutes, 95 minutes, 100 minutes, 110 minutes, 120 minutes, 130 minutes, 140 minutes, 150 minutes, 160 minutes, 170 minutes, 180 minutes, 190 minutes, 200 minutes, 210 minutes, 220 minutes, 230 minutes, 240 minutes, 250 minutes, 260 minutes, 270 minutes, 280 minutes, 290 minutes, 300 minutes, 310 minutes, 320 minutes, 330 minutes, 340 minutes, 350 minutes, 360 minutes or longer between the transfection of the first nucleic acid and the transfection of subsequent nucleic acids.

[0236] "Delivery vectors" are typically used to deliver their nucleic acid cargo into cells in order to express the nucleic acids in the cells. In one embodiment, the delivery vectors of the invention include, but are not limited to, viral vectors. A variety of viral vectors are known in the art (e.g., herpes virus, Epstein-Barr virus, retrovirus, baculovirus, adenovirus, or parvovirus, such as those derived from adeno-associated virus). Non-viral delivery vectors are also known in the art and their use is also encompassed by the invention. In one embodiment, the viral vector is a recombinant adeno-associated virus (AAV). Such viral vectors can include an AAV capsid and can package an AAV or rAAV genome or any other nucleic acid containing viral nucleic acid. Alternatively, in some contexts, the terms "vector", "viral vector", "delivery vector" (and similar terms) can be used to refer to a viral capsid that acts as a transporter for delivering a vector genome (e.g., vDNA) in the absence of virions and / or a molecule linked to or packaged within the capsid.

[0237] The viral vectors described herein may further be double-stranded parvovirus particles as described in International Patent Publication WO 01 / 92551, the disclosure of which is incorporated herein by reference in its entirety. Thus, in some embodiments, a double-stranded (ds) genome can be packaged.

[0238] As used herein, the terms “virus vector,” “viral vector,” “vector,” or “gene delivery vector” refer to a virus (e.g., AAV) particle that functions as a nucleic acid delivery vehicle and contains a vector genome (e.g., viral DNA [vDNA]) packaged within a virion.

[0239] Furthermore, the viral capsid or genomic element may contain other modifications, including insertions, deletions, and / or substitutions.

[0240] As used herein, a “chimeric” capsid protein means an AAV capsid protein that has been modified by one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residue substitutions in the amino acid sequence of the capsid protein as compared to the wild type, and one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residue insertions and / or deletions in the amino acid sequence as compared to the wild type. In some embodiments, a complete or partial domain, functional region, epitope, etc. from one AAV serotype can be replaced with the corresponding wild-type domain, functional region, epitope, etc. of a different AAV serotype in any combination to produce the chimeric capsid proteins of the present invention. The production of chimeric capsid proteins can be carried out according to protocols well known in the art, and a significant number of chimeric capsid proteins that can be included in the capsids of the present invention are described in the literature as well as herein.

[0241] As used herein, the terms “monomeric AAV,” “multimeric AAV,” or “rational multimeric AAV” mean, for example, as described in International Applications PCT / US2018 / 022725, PCT / US2018 / 044632, and U.S. Patent No. 10,550,405, AAV having at least one of the three structural proteins VP1, VP2, and VP3 that is different from at least one other AAV serotype, or having the other two structural proteins, and all of these documents are hereby incorporated by reference in their entirety. The Ad5-based nucleic acids of the present invention (e.g., XX85 or XX85 hybrid as described herein) are used to produce monomeric AAV, or multimeric AAV, or rational multimeric AAV as described in the above references.

[0242] The term “hybrid” AAV vector or parvovirus refers to an rAAV vector in which the viral TR or ITR and the viral capsid are from different parvoviruses or adenoviruses. Hybrid vectors are described in International Patent Publication WO00 / 28004 and Chao et al., (2000) Molecular Therapy 2:619. For example, a hybrid AAV vector typically includes adenovirus 5’ and 3’ cis ITR sequences (i.e., adenovirus terminal repeat sequences and PAC sequences) sufficient for adenovirus replication and packaging. Examples of hybrid AAV vectors include SEQ ID NO: 95 and SEQ ID NO: 96. SEQ ID NO: 95 contains the E2A region from human adenovirus 12 (hAd12), and the other genes are from hAd5. SEQ ID NO: 96 contains the E4 region from hAd12, and the other genes are from hAd5.

[0243] The term “multimeric AAV” refers to, for example, an AAV vector composed of capsids from two or more AAV serotypes, and the advantages of individual serotypes can be obtained for higher transduction, but in certain embodiments, the tropism from the parent cannot be eliminated.

[0244] As used herein, the terms "helper construct", "Ad helper", "helper virus", "helper plasmid", or "helper DNA" refer to the nucleic acid sequences of the present invention that are used to produce copies of helper virus-dependent viral vectors, such as recombinant adeno-associated virus, which do not have the ability to replicate themselves. Helper constructs are used to co-infect cells with viral vectors and provide the proteins necessary for replication of the viral vector genome. This term encompasses intact virus particles, empty capsids, viral DNA, and the like. Helper viruses commonly used to produce rAAV particles include adenovirus, herpes simplex virus, cytomegalovirus, Epstein-Barr virus, and vaccinia virus.

[0245] As used herein, the phrase "promoter" refers to the region of DNA that is required for transcription to occur, i.e., that is typically located upstream of the nucleic acid sequence to be transcribed and initiates transcription. Promoters allow for the proper activation or repression of transcription of coding sequences under their control. Promoters typically contain specific sequences that are recognized and bound by multiple TFs. TFs bind to the promoter sequence and effect the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of a gene. A very large number of promoters are known in the art.

[0246] As used herein, "isoschizomer" is a pair of restriction enzymes that recognize the same restriction sequence. Isoschizomers do not necessarily cut at exactly the same location. Isoschizomers may require different environmental conditions to function effectively.

[0247] As used herein, "harvesting" refers to subjecting the transfected cells (e.g., suspension cells) to lysis and purification to collect AAV virions. Lysis can refer to mechanical lysis (e.g., use of an ultrasonic processor, homogenizer, bead mill, and / or mortar and pestle to shear the cells) or chemical lysis. In some embodiments, the suspension cells are subjected to chemical lysis to release the viral vector. Methods of chemical lysis of suspension cells include, but are not limited to, osmotic lysis (i.e., a cell lysis buffer that disrupts the cell membrane). Chemical lysis utilizes detergents and / or solutions to solubilize proteins, disrupt not only the cell membrane, but also lipid-lipid, protein-protein, and lipid-protein interactions. Those skilled in the art are familiar with different types of cell lysis buffers that can disrupt different types of cells. Examples of cell lysis buffers include, but are not limited to, NP-40 cell lysis buffer, RIPA lysis buffer, IP lysis buffer, and M-PER mammalian protein extraction reagent.

[0248] As used herein, "bioreactor" refers to a device in which a biological reaction or process is carried out. Bioreactors are designed to provide optimal conditions for organisms with limited generation of impurities. Bioreactors can include a stirrer, baffles, sparger, and / or jacket. Organisms growing within the bioreactor may be immersed in a liquid medium or attached to the surface of a solid medium. In some embodiments, the suspension cells are immersed in the liquid medium within the bioreactor. The bioreactor device can be of pilot-scale or industrial-scale. In some embodiments, the bioreactor uses at least a 25 L scale, 30 L scale, 35 L scale, 40 L scale, 45 L scale, 50 L scale or larger scale. Those skilled in the art are familiar with the design and operation of this type of machine.

[0249] As used herein, "stirring production bioreactor" refers to a bioreactor that includes a cylindrical vessel and a motor-driven central shaft that supports one or more agitators. A biological agent, such as a cell, enzyme, or antibody, can be cultured using a stirring production bioreactor. A stirring production bioreactor has the ability to mix fluids and mimic growth conditions (e.g., heat, nutrients, etc.). In some embodiments, the stirring production bioreactor is carried out on a large scale. In some embodiments, the stirring production bioreactor uses at least a 250 L scale, 300 L scale, 350 L scale, 400 L scale, 450 L scale, 500 L scale or larger scale. Those skilled in the art are proficient in the operation of this type of machine.

[0250] As used herein, the terms "isolate," "collect," "concentrate," "enrich," "purify," and "extract" are used interchangeably and refer to a process by which a target component (e.g., an AAV virion) is removed from a source such as a fluid (e.g., a culture medium or any cellular debris or unintended peptides, virions, and / or proteins, e.g., partially complete virus particles or empty virus particles). In some embodiments, purification is performed after lysis of the transfected suspension cells. In some embodiments of any of the aspects, the methods of isolation, collection, concentration, purification, and / or extraction include a reduction in the amount of at least one heterologous element (e.g., a protein, nucleic acid, partially complete or empty virus particle; i.e., an impurity). In some embodiments of any of the aspects, the methods of isolation, collection, concentration, purification, and / or extraction reduce the amount of a heterologous element that may be present in a sample containing the virion of interest, e.g., a biopolymer such as a protein, DNA, etc. or a partially complete or empty virus particle by 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% or more. The presence of heterologous proteins can be assayed by any suitable method including high performance liquid chromatography (HPLC), gel electrophoresis and staining and / or ELISA assays. The presence of DNA and other nucleic acids can be assayed by any suitable method including assays using gel electrophoresis and staining and / or polymerase chain reaction.

[0251] Purification methods include, but are not limited to, affinity capture chromatography, iodixanol density gradient centrifugation, and / or quaternary amine chromatography resins. Those skilled in the art are familiar with these purification methods.

[0252] Affinity capture chromatography resin is a resin that captures a target based on the binding affinity of a ligand. Ligands include, but are not limited to, substrate analogs, antibodies, lectins, nucleic acids, hormones, avidin, calmodulin, glutathione, protein A and G, and / or metal ions. The ligand can be of one type or a combination of different types of ligands. The ligand can be conjugated to the resin. In some embodiments, the ligand has a strong affinity for rAAV virions.

[0253] Iodixanol density gradient centrifugation is a separation method that uses a density gradient medium such as iodixanol and centrifugal force to separate and purify biological materials based on their buoyant density. Iodixanol is an iodine-containing nonionic radiopaque contrast agent and is commercially available as OPTIPREP (Catalog number D1556, SIGMA ALDRICH, St. Louis, Missouri). Iodixanol allows for faster speeds during centrifugation while still causing less damage to biological materials and having a high recovery rate. Iodixanol density gradient centrifugation is commonly used in the art to separate rAAV virions from contaminants (see, for example, AAV Purification by Iodixanol Gradient Ultracentrifugation, 2018, Addgene Protocols, available on the World Wide Web at addgene.org / protocols / aav-purification-iodixanol-gradient-ultracentrifugation / ). In some embodiments, iodixanol density gradient centrifugation separates and purifies rAAV virions.

[0254] Quaternary amine chromatography resin is a type of ion exchange chromatography in which a resin containing a quaternary ammonium chloride moiety can separate biomolecules using a quaternary ammonium compound. The synthesis of quaternary amine chromatography resin is known in the art (see, for example, Atia, A., (2006), Journal of Hazardous Materials, 137(2), 1049-1055), and it is commercially available (see, for example, ANX Sepharose 4 Fast Flow, catalog number 17128760, Cytiva Life Sciences, Westborough, Massachusetts, USA; Capto Q ion exchange chromatography resin, catalog number 17531603, Cytiva Life Sciences, Westborough, Massachusetts, USA).

[0255] Size exclusion chromatography (SEC) is a chromatographic method in which molecules in solution are separated by their size and molecular weight using fine porous beads, and the pore size of the beads is used to estimate the dimensions of the macromolecules. SEC may also be known as molecular sieve chromatography, gel filtration chromatography, or gel permeation chromatography, depending on the type of sample passing through the column. Those skilled in the art are familiar with this type of purification method. In some embodiments, the rAAV final vector and in-process samples are separated from potential aggregates and impurities.

[0256] Enzyme-linked immunosorbent assay, also called enzyme immunoassay or EIA, is a biochemical technique used to detect the presence of antibodies or antigens in a sample.

[0257] There are other different forms of ELISA, which are well known to those skilled in the art. Standard techniques known in the art for ELISA are described in "Methods in Immunodiagnosis", 2nd Edition, Rose and Bigazzi, eds. John Wiley & Sons, 1980; and Oellerich, M. 1984, J. Clin. Chem. Clin. Biochem. 22: 895 - 904. These references are hereby incorporated by reference in their entirety.

[0258] In certain embodiments, a nucleic acid or its gene expression product as described herein can be quantified by determining the level of messenger RNA (mRNA) expression of a gene described herein (e.g., an AAV gene; e.g., an AAV ITR). Such molecules can be isolated, derived, or amplified from biological samples such as cell cultures (e.g., HEK293 cells). Nucleic acid quantification can be performed using polymerase chain reaction (PCR) such as quantitative PCR (qPCR).

[0259] Generally, the PCR procedure describes a method of gene amplification consisting of: (i) sequence - specific hybridization of primers to a specific gene or sequence within a nucleic acid sample or library, (ii) subsequent amplification involving multiple rounds of annealing, extension, and denaturation using a heat - stable DNA polymerase, and (iii) screening the PCR products for bands of the correct size. The primers used are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e., each primer is specifically designed to be complementary to the strand of the genomic locus to be amplified. In alternative embodiments, the mRNA levels of the gene expression products described herein can be determined by reverse transcription (RT) - PCR and quantitative RT - PCR (QRT - PCR) or real - time PCR methods. The methods of RT - PCR and QRT - PCR are well known in the art.

[0260] The hydrolysis probe assay includes a sequence-specific fluorescently labeled oligonucleotide probe in addition to sequence-specific PCR primers. The hydrolysis assay utilizes the 5’→3’ exonuclease activity of certain thermostable polymerases such as Taq or Tth. Hydrolysis probes can be labeled with a fluorescent reporter at the 5’ end and a quencher at the 3’ end. When the hydrolysis probe is intact, the fluorescence of the reporter is quenched due to proximity to the quencher. The amplification reaction includes an annealing and extension combination step in which the probe hybridizes to the target and the dsDNA-specific 5’→3’ exonuclease activity of Taq or Tth cleaves the reporter. Here, the reporter is separated from the quencher, resulting in a fluorescent signal proportional to the amount of amplification product in the sample. The advantages of using hydrolysis are its high specificity and ability to perform multiplex reactions. Exemplary examples of hydrolysis assays include the TaqMan assay or the 5’ nuclease assay. Those skilled in the art are proficient in this method.

[0261] In some aspects provided herein, a population of recombinant adeno-associated virus (rAAV) is produced using the Ad5-based helper nucleic acid of the invention as described herein, and the population of purified recombinant adeno-associated virus (rAAV) is optionally devoid of prokaryotic sequences, and the purified virus has a ratio of particles to infectivity (vg / TCID50) of less than about 2×10 4 vg / TCID50. In some embodiments, the purified virus is obtained by a method comprising transfecting a suspension mammalian cell line, wherein the cells are transfected in suspension. In some embodiments of aspects provided herein, the purified rAAV produced using an Ad5-based helper nucleic acid (e.g., plasmid DNA or clDNA) as described herein has a vg / TCID50 of less than about 1.5×10 4 vg / TCID50, less than about (bout) 1×10 4 vg / TCID50, less than about 9×10 3 vg / TCID50, less than about 8×10 3 vg / TCID50, less than about 6×103 less than vg / TCID50, about 5×10 3 less than vg / TCID50, about 4×10 3 less than vg / TCID50, about 3×10 3 less than vg / TCID50, about 2×10 3 less than vg / TCID50, about 9×10 2 less than vg / TCID50, about 8×10 2 less than vg / TCID50, about 7×10 2 less than vg / TCID50, about 6×10 2 less than vg / TCID50, about 5×10 2 less than vg / TCID50, about 4×10 2 less than vg / TCID50, about 3×10 2 less than vg / TCID50, about 2×10 2 vg / TCID50, or about 1×10 2 less than vg / TCID50, or about 0.5×10 2 less than vg / TCID50, about 0.1×10 2 or has a ratio of particles to infectivity that is even less. In some embodiments, the ratio of particles to infectivity of recombinant virus particles (e.g., rAAV) is about 10 2 ~ about 10 5 vg / TCID50, or about 10 2 ~ about 5×10 4 vg / TCID50, or about 10 2 ~ about 10 4 vg / TCID50. In certain embodiments, the ratio of particles to infectivity is 10 2 ~ about 10 3 vg / TCID50. In yet another embodiment, the ratio of particles to infectivity is less than 10 2 vg / TCID50. Note that "vector genome" can be used interchangeably with "viral genome".

[0262] In some embodiments provided herein, a population of recombinant adeno-associated virus (rAAV) is produced using an Ad5-based helper nucleic acid as described herein, and the population of purified recombinant adeno-associated virus (rAAV) optionally lacks prokaryotic sequences, and the purified virus has a ratio of particles to infectivity (vg / TCID50) of at least about 1.2-fold less than that of a population of rAAV produced with the nucleic acid set forth in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92. In some embodiments of the aspects provided herein, the purified rAAV produced using an Ad5-based helper nucleic acid (e.g., plasmid DNA or clDNA) as described herein has at least about 1.3-fold less, at least about 1.4-fold less, at least about 1.5-fold less, at least about 1.6-fold less, at least about 1.7-fold less, at least about 1.8-fold less, at least about 2-fold less, at least about 2.2-fold less, at least about 2.4-fold less, at least about 2.5-fold less, at least about 2.6-fold less, at least about 2.8-fold less, at least about 3-fold less, at least about 3.2-fold less, at least about 3.4-fold less, at least about 3.6-fold less, at least about 3.8-fold less, at least about 4-fold less, at least about 4.2-fold less, at least about 4.4-fold less, at least about 4.6-fold less, at least about 4.8-fold less, at least about 5-fold less, at least about 5.5-fold less, at least about 6-fold less, or even further less than that of a population of rAAV produced with the nucleic acid set forth in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0263] In some embodiments provided herein, a population of recombinant adeno-associated virus (rAAV) is produced using an Ad5-based helper nucleic acid as described herein, and the population of purified recombinant adeno-associated virus (rAAV) optionally lacks prokaryotic sequences, and the purified virus is about 2×10 4The population of purified rAAV has a ratio of particles to infectivity below vg / TCID50 and contains less than about 10% empty viral capsids. In some embodiments provided herein, the population of recombinant adeno-associated virus (rAAV) is produced using an Ad5-based helper nucleic acid as described herein, the population of purified recombinant adeno-associated virus (rAAV) is optionally lacking prokaryotic sequences, and the purified virus has a ratio of particles to infectivity (vg / TCID50) of at least about 1.2-fold less than that of a population of rAAV produced with the nucleic acid set forth in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92, and the population of rAAV purified using the helper nucleic acids described herein contains less than about 10% empty viral capsids. Some embodiments described herein provide a population of purified recombinant adeno-associated virus (rAAV), the population of purified rAAV contains less than about 50% empty viral capsids, for example, the population of purified rAAV contains about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, or 10% or less empty viral capsids. In some embodiments, the purified virus is obtained by a method comprising transfecting a suspension mammalian cell line, wherein the cells are transfected in suspension. In some embodiments, the population of purified rAAV contains less than about 9.5%, less than about 9%, less than about 8.5%, less than about 8%, less than about 7.5%, less than about 7%, less than about 6.5%, less than about 6%, less than about 5.5%, less than about 5%, less than about 4.5%, less than about 4%, less than about 3.5%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 0.75%, less than about 0.5%, less than about 0.25%, less than about 0.2%, less than about 0.15%, less than about 0.1%, less than about 0.05%, less than about 0.03%, less than about 0.02%, or less than about 0.01% empty viral capsids. In some embodiments of the aspects provided herein, the population of purified rAAV is substantially free of empty capsids.

[0264] In some embodiments of any one of the aspects described herein, a population of recombinant adeno-associated virus (rAAV) is produced using an Ad5-based helper nucleic acid as described herein, and the population of purified recombinant adeno-associated virus (rAAV) is optionally devoid of prokaryotic sequences, and the population of purified recombinant adeno-associated virus (rAAV) is about 1×10 5 TCID50 / ml (median tissue culture infective dose) to about 1×10 11 It has an infective particle titer of TCID50 / ml. In certain embodiments, the infective particle titer is at least about 3×10 9 TCID50 / ml. In some embodiments, the infective particle titer is at least about 2×10 5 TCID50 / ml, at least about 5×10 5 TCID50 / ml, at least about 7.5×10 5 TCID50 / ml, at least about 8×10 5 TCID50 / ml, at least about 8.5×10 5 TCID50 / ml, at least about 9×10 5 TCID50 / ml, at least about 9.5×10 5 TCID50 / ml, at least about 1×10 6 TCID50 / ml, at least about 2×10 6 TCID50 / ml, at least about 5×10 6 TCID50 / ml, at least about 7.5×10 6 TCID50 / ml, at least about 8×10 6 TCID50 / ml, at least about 8.5×10 6 TCID50 / ml, at least about 9×10 6 TCID50 / ml, at least about 9.5×10 6 TCID50 / ml, at least about 1×10 7 TCID50 / ml, at least about 2×10 7 TCID50 / ml, at least about 5×10 7 TCID50 / ml, at least about 7.5×10 7 TCID50 / ml, at least about 8×10 7TCID50 / ml, at least about 9×10 7 TCID50 / ml, at least about 1×10 8 TCID50 / ml, at least about 2.5×10 8 TCID50 / ml, at least about 5×10 8 TCID50 / ml, at least about 7.5×10 8 TCID50 / ml, at least about 8×10 8 TCID50 / ml, at least about 8.5×10 8 TCID50 / ml, at least about 9×10 8 TCID50 / ml, at least about 9.5×10 8 TCID50 / ml, at least about 0.5×10 9 TCID50 / ml, at least about 1×10 9 TCID50 / ml, at least about 1.5×10 9 TCID50 / ml, at least about 2×10 9 TCID50 / ml, at least about 2.5×10 9 TCID50 / ml, at least about 3×10 9 TCID50 / ml, at least about 3.5×10 9 TCID50 / ml, at least about 4×10 9 TCID50 / ml, at least about 4.5×10 9 TCID50 / ml, at least about 5×10 9 TCID50 / ml, at least about 5.5×10 9 TCID50 / ml, at least about 6×10 9 TCID50 / ml, at least about 6.5×10 9 TCID50 / ml, at least about 7×10 9 TCID50 / ml, at least about 7.5×10 9 TCID50 / ml, at least about 8×10 9 TCID50 / ml, at least about 8.5×10 9 TCID50 / ml, at least about 9×10 9 TCID50 / ml, at least about 9.5×10 9 TCID50 / ml, at least about 1×10 10TCID50 / ml, at least about 2×10 10 TCID50 / ml, at least about 5×10 10 TCID50 / ml, at least about 7.5×10 10 TCID50 / ml, at least about 8×10 10 TCID50 / ml, at least about 8.5×10 10 TCID50 / ml, at least about 9×10 10 TCID50 / ml, at least about 9.5×10 10 TCID50 / ml, or at least about 10 11 TCID50 / ml. In some embodiments, the infectivity titer TCID50 / ml is preferably normalized to vg / ml.

[0265] In some embodiments provided herein, a population of recombinant adeno-associated virus (rAAV) is produced using an Ad5-based helper nucleic acid as described herein, where the population of purified recombinant adeno-associated virus (rAAV) is optionally devoid of prokaryotic sequences and the purified virus has an infectivity titer (TCID50 / ml) that is at least about 1.2-fold higher than a population of rAAV produced with the nucleic acid set forth in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92. In some embodiments of the embodiments provided herein, purified rAAV produced using an Ad5-based helper nucleic acid (e.g., plasmid DNA or clDNA) as described herein has an infectivity titer (TCID50 / ml) that is at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 2-fold, at least about 2.2-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 2.6-fold, at least about 2.8-fold, at least about 3-fold, at least about 3.2-fold, at least about 3.4-fold, at least about 3.6-fold, at least about 3.8-fold, at least about 4-fold, at least about 4.2-fold, at least about 4.4-fold, at least about 4.6-fold, at least about 4.8-fold, at least about 5-fold, at least about 5.5-fold, at least about 6-fold higher than or equal to a population of rAAV produced with the nucleic acid set forth in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0266] TCID50 assay: The in vitro AAV infectivity of the drug in HeLa RC32 cells is evaluated using the infectious titer (TCID50) method. In this assay, HeLa RC32 cells are transduced with adenovirus type 5 helper virus and serial dilutions of the drug. Three days after infection, the cells are treated with proteinase K to digest the proteins, and the replicated AAV vector DNA is quantified by qPCR technology. This method utilizes a detection system based on DNA primers and fluorescent dyes. The absolute amount of the ITR target sequence from the vector DNA is interpolated from a standard curve prepared with a plasmid. Samples containing the ITR are prepared as test samples and used as assay controls. The results are expressed as infectious units per milliliter (IU / mL). Note that in order to compare TCID50 / ml between different preparations, TCID50 / ml is preferably normalized to vg / ml.

[0267] For the purposes of this specification and the appended claims, unless otherwise indicated, all numbers expressing quantities, sizes, dimensions, ratios, shapes, compositions, parameters, percentages, parameters, amounts, properties, and other numerical values used in this specification and the claims are to be understood as being modified in all instances by the term "about" even when that term does not explicitly appear with the value, amount, or range. Thus, unless indicated to the contrary, the numerical parameters set forth in the following specification and the appended claims are not and need not be exact, but reflect, among other things, tolerances, conversion factors, rounding, measurement error, etc., and other factors known to those of ordinary skill in the art in light of the desired properties to be obtained by the subject matter of this disclosure, and may be approximated and / or greater or less as desired. For example, the term "about" when referring to a value can mean, in some embodiments, a variation of ±100%, in some embodiments ±50%, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the particular amount, such variations being appropriate for carrying out the disclosed methods or using the disclosed compositions.

[0268] Furthermore, when the term "about" is used in connection with one or more numbers or numerical ranges, it is to be understood to refer to all such numbers including all numbers within the range and modifying that range by extending the boundaries above and below the recited numerical values. The recitation of numerical ranges by endpoints includes all numbers within that range (e.g., the recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as fractions thereof, such as 1.5, 2.25, 3.75, 4.1, etc.) and all numbers within any range subsumed within that range, e.g., all whole integers including fractions thereof).

[0269] Scope: Throughout this disclosure, various aspects as described herein can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as a rigid limitation lacking flexibility. Thus, a description of a range should be considered to specifically disclose all possible sub-ranges as well as the individual numerical values within that range. For example, a description of a range such as 1 - 6 should be considered to specifically disclose sub-ranges such as 1 - 3, 1 - 4, 1 - 5, 2 - 4, 2 - 6, 3 - 6, as well as the individual numbers within that range, such as 1, 2, 2.1, 2.2, 2.7, 3, 4, 5, 5.5, 5.75, 5.8, 5.85, 5.9, 5.95, 5.99, and 6. This applies regardless of the width of the range.

[0270] In some embodiments, the vector is a DNA or RNA virus. Non-limiting examples of viral vectors of the present invention include AAV vectors, adenovirus vectors, lentivirus vectors, retrovirus vectors, herpesvirus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

[0271] Any virus vector known in the art can be used in the present invention. Such virus vectors include, but are not limited to, vectors derived from Adenoviridae; Birnaviridae; Bunyaviridae; Caliciviridae, Kapivirus group; Carlavirus group; Carmovirus virus group; Potyvirus group; Closterovirus group; Tenuivirus group, Comovirus virus group, Coronaviridae, PM2 phage group, Comoviridae, Cryptic virus group, Cryptovirus group, Cucumovirus virus group, Secoviridae, Carnation ringspot group, Geminivirus virus group, Soybean dwarf virus group, Fabavirus virus group, Filoviridae, Flaviviridae, Florivirus group, Geminivirus group, Dianthovirus group, Hepadnaviridae, Herpesviridae, Hordeivirus virus group, Ilavirus group, Inoviridae, Iridoviridae, Rhabdoviridae, Lipothrixvirus family, Luteovirus group, Marafivirus virus group, Maize chlorotic dwarf virus group, Iflaviridae, Myoviridae, Necrovirus group, Nepovirus virus group, Nodaviridae, Orthomyxoviridae, Papovaviridae, Paramyxoviridae, Parsnip yellow fleck virus group, Partitiviridae, Parvoviridae, Peanut mosaic virus group, Phycodnaviridae, Picornaviridae, Plasmaviridae, Prodoviridae, Polydnaviridae, Potexvirus group, Potyvirus, Poxviridae, Reoviridae, Retroviridae, Rhabdoviridae, Rigidovirus group, Sobemovirus family, SSV1 type phage, Tectiviridae, Tenuivirus, Tetraviridae, Tobamovirus group Tobravirus group, Togaviridae, Tombusvirus group, Torovirus group, Totiivirus family, Timovirus group, and plant virus satellites.

[0272] The generated viral vector can contain part or all of a naturally occurring and / or recombinant viral vector nucleotide sequence (e.g., AAV, adenovirus, lentivirus, etc.) or a variant genome. A viral vector variant has genomic sequences with significant homology at the nucleic acid and amino acid levels, produces viral vectors that are typically physical and functional equivalents, can replicate by similar mechanisms, and can assemble by similar mechanisms.

[0273] Protocols for producing recombinant viral vectors and for using viral vectors for nucleic acid delivery can be found, for example, in Current Protocols in Molecular Biology, Ausubel, F.M. et al. (eds.) Greene Publishing Associates, (1989) and other standard laboratory manuals (e.g., Vectors for Gene Therapy. In: Current Protocols in Human Genetics. John Wiley and Sons, Inc.: 1997). Further, the production of AAV vectors is further described, for example, in U.S. Patent No. 9,441,206, the entire contents of which are incorporated herein by reference.

[0274] Viral vectors produced in a viral expression system can be released using any standard technique (i.e., to remove the cells that produced the vector). For example, viral vectors can be released by mechanical methods such as microfluidization, centrifugation, or sonication, or by chemical methods such as lysis buffers and detergents. The released viral vectors are then recovered (i.e., collected) and purified using standard methods in the art to obtain a pure population. For example, viral vectors can be recovered from the buffer in which they were released by a purification method that includes a clarification step using depth filtration or tangential flow filtration (TFF). As described herein in the examples, viral vectors can be released from cells by sonication and recovered by purification of the clarified lysate using column chromatography.

[0275] Variant viral vector sequences can be used to produce viral vectors in the viral expression systems described herein. For example, one or more sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or more nucleotide and / or amino acid sequence identity (e.g., a sequence having about 75-99% nucleotide sequence identity) to a given vector (e.g., AAV, adenovirus, lentivirus, etc.).

[0276] It should be understood that the viral expression system can be further modified to include any necessary elements required to complement a given viral vector during its production using the methods described herein. For example, in certain embodiments, AAV or rAAV nucleic acids are flanked by terminal repeats. In one embodiment, for the production of an rAAV vector, the AAV expression system can further include at least one of a recombinant AAV nucleic acid, a nucleic acid expressing Rep, a nucleic acid expressing Cap, and / or an adenovirus helper nucleic acid. In another embodiment, for the production of an rAAV vector, the AAV expression system can further include at least one of a recombinant AAV nucleic acid, a nucleic acid expressing both Rep and Cap, and / or an adenovirus helper nucleic acid as described herein. Complementary elements for a given viral vector are well known in the art, and one of ordinary skill in the art can modify the viral expression systems described herein accordingly.

[0277] In one embodiment, the viral expression system can be a host cell such as a mammalian cell (e.g., HEK293) or an insect cell. Cell lines for propagating viral vectors are known in the art and include, but are not limited to, the exemplary cell lines shown in Table 2. In one embodiment, the cell line for viral propagation is selected from Table 2. In one embodiment, the cell line for viral propagation is derived from a cell line selected from Table 2. In one embodiment, the Ad5-based helper nucleic acid of the invention is transfected into any of the cell lines listed in Table 2 to produce the exemplary viruses listed in Table 2.

Table 2-1

Table 2-2

Table 2-3

[0278] To increase viral titer, helper construct functions that promote productive AAV infection (e.g., adenovirus or herpesvirus) can be provided to the cells. Helper construct sequences necessary for AAV replication are described herein and are known in the art. Typically, these sequences are provided by helper adenovirus vectors or herpesvirus vectors. Alternatively, adenovirus or herpesvirus sequences can be provided by another non-viral vector or viral vector, e.g., as a non-infectious adenovirus miniplasmid carrying all the helper genes that promote efficient AAV production, as described in Ferrari et al., Nature Med. 3:1295 (1997), and U.S. Pat. Nos. 6,040,183 and 6,093,570, which are incorporated herein by reference.

[0279] Furthermore, the helper plasmid function can be provided by packaging cells having helper sequences integrated into the chromosome or can be maintained as a stable extrachromosomal element. Typically, helper plasmid sequences cannot be packaged into AAV virions, e.g., are not flanked by TR.

[0280] One of ordinary skill in the art will understand that it may be advantageous to provide the AAV cap and rep sequences and the helper plasmid sequences (e.g., adenovirus sequences) on a single helper construct. In one embodiment, the expression of at least one gene product encoded by a single helper construct is controlled by an inducible promoter. This helper construct can be a non-viral or viral construct. As one non-limiting exemplary example, the helper construct can be a hybrid adenovirus or hybrid herpesvirus that includes the AAV rep and / or cap genes.

[0281] The recombinant AAV vectors and helper constructs described herein can be produced by any method known in the art. By way of example and not limitation, one such method for producing adeno-associated virus (AAV) particles involves (a) transduction with a helper construct(s), growth in a stable mammalian cell line (e.g., HEK293), and (c) isolation of AAV particles, if desired.

[0282] In one embodiment, the cells are cultured in suspension. In another embodiment, the cells are cultured under conditions that are free of animal components. The animal component-free medium can be any animal component-free medium (e.g., serum-free medium) that is compatible with a given cell line, such as HEK293 cells. Examples include, but are not limited to, SFM4Transfx-293 (HYCLONE), Ex-Cell293 (JRH BIOSCIENCES), LC-SFM (INVITROGEN), and Pro293-S (LONZA), Pro-10 cells (described in U.S. Patent Application No. 9,441,206, which is incorporated by reference in its entirety).

[0283] Conditions sufficient for replication and packaging of AAV particles can be, for example, the presence of AAV sequences sufficient for replication of the AAV template and encapsidation of AAV capsids (e.g., AAV rep and AAV cap sequences) and helper sequences from adenovirus and / or herpesvirus.

[0284] The rAAV template and rAAV rep and / or cap sequences and helper sequences are provided under conditions such that a viral vector containing the rAAV template packaged within the rAAV capsid is produced intracellularly. This method can further include the step of collecting the viral vector from the culture. In one embodiment, the viral vector can be collected by lysing the cells, for example, after removing the cells from the culture medium, for example, by pelleting the cells. In another embodiment, the viral vector can be collected from the culture medium in which the cells are cultured, for example, to isolate the vector secreted from the cells. A portion or all of the medium can be removed from the culture one or more times at regular intervals (e.g., every 12, 18, 24, or 36 hours, or for longer extended times compatible with cell viability and vector production), starting, for example, about 48 hours after transfection, during the culture step for collecting rAAV. After removing the medium, fresh medium with or without additional nutrient supplements can be added to the culture. In one embodiment, the cells can be cultured in a perfusion system such that the medium continuously flows over the cells and is collected to isolate the secreted rAAV. Collection of rAAV from the medium can continue, for example, 48, 72, 96, or 120 hours or more after transfection, as long as the transfected cells remain viable. In certain embodiments, collection of the secreted rAAV is performed using AAV serotypes (such as AAV8 and AAV9) that do not bind or only weakly bind to the producer cells. In other embodiments, collection of the secreted rAAV is performed using heparin-binding serotypes of AAV (e.g., AAV2) that have been modified so that they do not bind to the cells in which they are produced. Examples of suitable modifications, as well as rAAV collection techniques, are disclosed in U.S. Patent Application Publication No. 2009 / 0275107, which is hereby incorporated by reference in its entirety.

[0285] AAV templates can be provided to cells using any method known in the art. For example, the template can be supplied by a non-viral vector (e.g., plasmid or clDNA) or a viral vector. In certain embodiments, the AAV template is supplied by a herpesvirus or adenovirus vector (e.g., inserted into the E1A or E3 region of a deleted adenovirus). As another example, Palombo et al., J. Virol. 72:5025 (1998) describes a baculovirus vector having a reporter gene flanked by AAV TR. As described above with respect to the rep / cap genes, EBV vectors can also be used to deliver the template.

[0286] In another representative embodiment, the AAV template is provided by a replication-competent rAAV virus. In yet other embodiments, the AAV provirus containing the AAV template is stably integrated into the chromosome of the cell.

[0287] In various embodiments, the methods for producing the AAV viral vectors described herein can be scaled up, and thus can be performed in any desired volume of culture medium, e.g., 10 ml (e.g., in a shake flask) to 10 L, 50 L, 100 L, or more (e.g., in a bioreactor such as a wave bioreactor system and a stirred tank). In one embodiment, rAAV is produced using a blunt-ended linear double-stranded nucleic acid. In other embodiments, rAAV is produced using other forms of nucleic acids, e.g., plasmid DNA or blunt-ended linear double-stranded DNA, e.g., dumbbell-shaped DNA.

[0288] The method is suitable for the production of any rAAV in which all serotypes and chimeras of AAV, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and any chimeras thereof, and / or at least one of the VP1, VP2, and VP3 viral structural proteins is from the capsid protein of an AAV serotype listed in Table 1.

[0289] In certain embodiments, the method provides at least about 1×10 4 vector genome-containing particles per cell prior to purification, such as at least about 2×10 4 per cell, 3×10 4 per cell, 4×10 4 per cell, 5×10 4 per cell, 6×10 4 per cell, 7×10 4 per cell, 8×10 4 per cell, 9×10 4 per cell or 1×10 5 per cell or more vector genome-containing particles. In other embodiments, the method provides at least about 1×10 12 purified vector genome-containing particles per liter of cell culture, such as at least about 5×10 12 per liter, 1×10 13 per liter, 5×10 13 per liter or 1×10 14 per liter or more purified vector genome-containing particles.

[0290] Further aspects described herein relate to cells comprising synthetic nucleic acids as described herein and / or vectors (e.g., isolated cells, transformed cells, recombinant cells, etc.) comprising synthetic nucleic acids as described herein. Accordingly, various embodiments relate to recombinant host cells comprising vectors (e.g., expression cassettes) comprising synthetic nucleic acids as described herein. Such cells can be isolated and / or present in animals, such as transgenic animals. Transformation of cells is further described below.

[0291] In some embodiments, the pharmaceutical composition comprises a recombinant AAV vector and a helper plasmid in a buffer (e.g., an additive) having a pH of about 7.0 to about 8.0. In some embodiments, the pH of the buffer is from about 7.0 to about 7.5. In a preferred embodiment, the pH of the buffer is less than 7.5. In some embodiments, the buffer is phosphate buffered saline (PBS). In certain embodiments, the buffer or additive comprises ions selected from the group consisting of sodium, potassium, phosphate, chloride, calcium, magnesium, sulfate, citrate, and any combination thereof. The pharmaceutical composition further comprises a polyol, a sugar, or the like. In some embodiments, the pharmaceutical composition comprises glycerol or propylene glycol, or polyethylene glycol, or sorbitol, or mannitol. In some embodiments, the sorbitol concentration ranges from about 1% (w / v) to about 10% (w / v). In some embodiments, the sorbitol concentration ranges from about 2% (w / v) to about 8% (w / v). In a preferred embodiment, the sorbitol concentration ranges from about 3% (w / v) to about 6% (w / v). In certain embodiments, the sorbitol concentration is 1% (w / v), 2% (w / v), 3% (w / v), 4% (w / v), 5% (w / v), 6% (w / v), 7% (w / v), 8% (w / v), 9% (w / v), or 10% (w / v). The pharmaceutical composition further comprises a nonionic surfactant. In some embodiments, the nonionic surfactant is selected from the group consisting of polyoxyethylene-polyoxypropylene block copolymers, alkyl glucosides, alkylphenol ethoxylates, polysorbates, polyoxyethylene alkyl phenyl ethers, and any combination thereof. In some embodiments, the nonionic surfactant is poloxamer 188 or Ecosurf SA-15.In certain embodiments, the concentration of poloxamer 188 or Ecosurf SA-15 is 0.0005% (w / v), 0.0008% (w / v), 0.0009% (w / v), 0.001% (w / v), 0.002% (w / v), 0.0025% (w / v), 0.003% (w / v), 0.0035% (w / v), 0.004% (w / v), 0.0045% (w / v), 0.005% (w / v), 0.006% (w / v), 0.007% (w / v), 0.008% (w / v), 0.009% (w / v), or 0.01% (w / v).

[0292] In the rAAV purification process, after transfecting host cells, such as mammalian cells in suspension, such as Pro10 or HEK293 cells in suspension, with nucleic acids, such as AAV Rep-Cap nucleic acids and the Ad helper nucleic acids of the present invention together with the rAAV genome, the cells are given sufficient time to produce rAAV. The cells are then harvested after transfection and chemically lysed to release the viral vector. The cell debris is then clarified by filtration, and intact rAAV particles are recovered in the filtrate, herein referred to as "clarified lysate" or "clarified cell lysate".

[0293] "Intact virus particles" refers to virus particles containing complete structural components (e.g., complete capsids). For AAV, a complete capsid refers to the capsid assembly of VP1, VP2, and / or VP3. Intact virus particles can be purified from cell lysates using purification methods such as filtration (e.g., by depth filtration and / or membrane filtration). Intact virus particles do not include secreted proteins, degraded virions, and extracellular vesicles (EVs) containing viral proteins. Intact virus particles do not necessarily contain a genome and can include filled particles, partially filled particles, and / or empty particles.

[0294] "Filled particles" or "complete particles" (also interchangeably referred to as "complete AAV particles", "complete AAV capsid particles", or "complete rAAV capsid particles") refer to virus particles containing intact virus particles (e.g., complete capsids) containing a genome (e.g., a viral genome or recombinant genome that can contain a heterologous polynucleotide such as a transgene, i.e., a polynucleotide other than the wild-type virus genome). "Filled" or "complete" particles may also be interchangeably referred to as "packaged particles", "packaged virus", "packaged AAV", or "recombinant expressed AAV". Note that the terms "particle" and "capsid" can be used interchangeably and / or redundantly herein.

[0295] "Empty particles", also interchangeably referred to as "empty AAV particles", refer to virus particles that contain at least one viral protein but lack all of a genome, e.g., a viral genome or recombinant genome. Empty particles do not include, for example, intact virus particles containing a heterologous polynucleotide.

[0296] "Partially complete particles", also interchangeably referred to as "partially filled AAV particles" or "partially complete AAV particles", refer to virus particles that contain at least one viral protein but lack at least a portion of a genome, e.g., a viral genome or recombinant genome. As used herein, "partially complete particles" also include particles containing DNA from a host cell or pDNA used for transfection.

[0297] The percentage of complete AAV particles in a clarified lysate produced using a nucleic acid as described herein ("% AAV complete" or "% complete") can be expressed as the number of "complete" AAV particles relative to the total number of AAV particles (including "complete", "partially complete", and "empty" AAV particles).

[0298] Aspects described herein relate to increasing the amount of functional E2A, E4, VA RNAI, VA RNAII and / or the backbone region (SEQ ID NO: 1) in cells or in cells and tissues using synthetic nucleic acids comprising SEQ ID NO: 1, and vectors and compositions comprising the synthetic nucleic acids, in cells of a subject in need thereof. In one aspect, the synthetic nucleic acids, vectors and compositions encoding E2A, E4, VA RNAI, VA RNAII and the backbone region (SEQ ID NO: 1) are delivered to cells under conditions appropriate for the expression of E2A, E4, VA RNAI, VA RNAII and the backbone region (SEQ ID NO: 1), thereby increasing the amount of E2A, E4, VA RNAI, VA RNAII and the backbone region (SEQ ID NO: 1) in the cell. In one embodiment, the cells are in vitro.

[0299] Some embodiments of the compositions and methods of the technology disclosed herein can be defined by the following numbered paragraphs:

[0300] Paragraph 1: a human adenovirus 5 (hAd)-based nucleic acid that does not contain one or more of: a) an E4 region having E4-ORF6 / 7, b) a virus-associated (VA) RNA region, c) an E2A region having L4-22K and L4-33K, d) at least one packaging protein, e) at least one structural protein, f) a major late promoter (MLP), g) an E1 region, and / or h) an E3 region.

[0301] Paragraph 2: A human adenovirus 5 (hAd)-based nucleic acid that does not contain one or more of a) an E4 region having E4-ORF6 / 7, b) a virus-associated (VA) RNA region, and c) an E2A region having L4-22K, L4-33K, and L4-100K, and d) at least one packaging protein, e) at least one structural protein, f) a major late promoter (MLP), g) an E1 region, and / or h) an E3 region.

[0302] Paragraph 3: The nucleic acid according to paragraph 1 or 2, wherein the nucleic acid comprises, in the 5'→3' direction, an E4 region containing E4-ORF6 / 7, a VA RNA region, and an E2A region.

[0303] Paragraph 4: The nucleic acid according to paragraph 1 or 2, wherein the nucleic acid does not contain an adenovirus inverted terminal repeat sequence.

[0304] Paragraph 5: The nucleic acid according to paragraph 1 or 2, wherein the nucleic acid contains GGCAGC at positions 57-62 of L4-22K (e.g., 4279-4284 of SEQ ID NO: 1).

[0305] Paragraph 6: The nucleic acid according to paragraph 1, wherein the E2A region comprises an E2 early promoter (SEQ ID NO: 2) or a sequence having at least 85% sequence identity with SEQ ID NO: 2, an E2 late promoter (SEQ ID NO: 3) or a sequence having at least 85% sequence identity with SEQ ID NO: 3, an E2A protein (SEQ ID NO: 4) or a sequence having at least 85% sequence identity with SEQ ID NO: 4, an L4-22K (SEQ ID NO: 5) or a sequence having at least 85% sequence identity with SEQ ID NO: 5, an L4-33K (SEQ ID NO: 6) or a sequence having at least 85% sequence identity with SEQ ID NO: 6, and / or an intermediate phase L4 promoter (L4P) (SEQ ID NO: 7) or a sequence having at least 85% sequence identity with SEQ ID NO: 7, and optionally an L4-100K (SEQ ID NO: 8) or a sequence having at least 85% sequence identity with SEQ ID NO: 8.

[0306] Paragraph 7: The nucleic acid according to any one of paragraphs 3 to 6, wherein the E2A protein is operably linked to an E2 early promoter and / or an E2 late promoter.

[0307] Paragraph 8: The nucleic acid according to any one of paragraphs 3 to 6, wherein L4-22K, L4-33K, and optionally L4-100K are operably linked to L4P.

[0308] Paragraph 9: The nucleic acid according to any one of paragraphs 3 to 8, wherein the E2A region is flanked by two type II restriction endonuclease recognition sites.

[0309] Paragraph 10: The nucleic acid according to paragraph 9, wherein the two type II restriction endonuclease recognition sites are independently selected from the group consisting of PacI; SpeI; AscI; PmeI; NotI; and corresponding isoschizomers of any of the foregoing.

[0310] Paragraph 11: The nucleic acid according to any one of paragraphs 9 to 10, wherein at least one of the two type II recognition sites enables manipulation of the nucleic acid as a module.

[0311] Paragraph 12: The nucleic acid according to any one of paragraphs 9 to 11, wherein the E2A region is flanked by a PacI restriction endonuclease recognition site and a NotI restriction endonuclease recognition site.

[0312] Paragraph 13: The nucleic acid according to any one of paragraphs 9 to 12, wherein the E2A region is flanked by two SpeI restriction endonuclease recognition sites.

[0313] Paragraph 14: The nucleic acid according to any one of paragraphs 1 to 13, wherein the nucleic acid does not contain a mutation that interferes with the expression of L4-22K (SEQ ID NO: 5) and / or L4-33K (SEQ ID NO: 6).

[0314] Paragraph 15: The nucleic acid according to any one of paragraphs 1 to 14, wherein the E2A region contains the E2 early promoter (SEQ ID NO: 2), the E2 late promoter (SEQ ID NO: 3), the E2A protein (SEQ ID NO: 4), L4-22K (SEQ ID NO: 5), L4-33K (SEQ ID NO: 6), and / or the intermediate phase L4 promoter (L4P) (SEQ ID NO: 7).

[0315] Paragraph 16: The nucleic acid according to any one of paragraphs 1 to 15, wherein the E2A region contains, in the 5'-3' direction, the E2 early promoter, L4-33K, L4-22K, L4P, the E2 late promoter, L4-100K, and E2A.

[0316] Paragraph 17: The nucleic acid according to any one of paragraphs 1 to 16, wherein the E2A region contains, in the 5'-3' direction, the E2 early promoter, L4-33K, L4-22K, L4P, the E2 late promoter, and E2A.

[0317] Paragraph 18: The nucleic acid according to any one of paragraphs 16 and 17, wherein the E2A section contains the E2 early promoter, the E2 late promoter, and E2A.

[0318] Paragraph 19: The E2A region of the Ad5-based nucleic acid of the present invention contains a nucleic acid encoding a single-stranded DNA-binding protein [DBP], and lacks essential adenovirus structures (e.g., fiber, hexon, penton, core protein) and replication (e.g., DNA polymerase) genes, and is the nucleic acid according to any one of paragraphs 1 to 18.

[0319] Paragraph 20: The nucleic acid according to any one of paragraphs 16 to 19, wherein the L4 section contains L4-33K, L4-22K, and L4P.

[0320] Paragraph 21: The nucleic acid according to any one of paragraphs 16 to 20, wherein the L4 element is in an inverse orientation compared to the E2A region, the E4 region, and the VA RNA region.

[0321] Paragraph 22: The nucleic acid according to any one of paragraphs 16 to 21, wherein E2A is codon-optimized with respect to its wild-type sequence.

[0322] Paragraph 23: The nucleic acid according to any one of paragraphs 1 to 22, wherein the E4 region contains the E4 promoter (SEQ ID NO: 9), E4-ORF1 (SEQ ID NO: 10), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0323] Paragraph 24: The nucleic acid according to paragraph 23, wherein E4-ORF1, E4-ORF2, E4-ORF3, E4-ORF4, E4-ORF6, and / or E4-ORF6 / 7 are operably linked to the E4 promoter.

[0324] Paragraph 25: The nucleic acid according to any one of paragraphs 1 to 24, wherein the E4 region contains the E4 promoter (SEQ ID NO: 9), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0325] Paragraph 26: The nucleic acid according to paragraph 25, wherein E4-ORF2, E4-ORF3, E4-ORF4, E4-ORF6, and / or E4-ORF6 / 7 are operably linked to the E4 promoter.

[0326] Paragraph 27: The nucleic acid according to paragraphs 25 to 26, wherein the nucleic acid does not contain E4-ORF1 (SEQ ID NO: 10).

[0327] Paragraph 28: The nucleic acid according to any one of paragraphs 25 to 27, wherein the amino acid residue position 9 of E4-ORF1 shown in SEQ ID NO: 10 is mutated to a stop codon, or the nucleic acid contains a variant of SEQ ID NO: 10 and the amino acid residue position 9 of SEQ ID NO: 10 is substituted with a stop codon.

[0328] Paragraph 29: The nucleic acid according to any one of paragraphs 23 to 28, wherein the E4 region is sandwiched between two type II restriction endonuclease recognition sites.

[0329] Paragraph 30: The nucleic acid according to paragraph 29, wherein the E4 region is sandwiched between an AscI restriction endonuclease recognition site and a PmcI restriction endonuclease recognition site.

[0330] Paragraph 31: The nucleic acid according to paragraph 29, wherein the two type II restriction endonuclease recognition sites are selected from the group consisting of PacI; SpeI; AscI; PmeI; NotI; and corresponding isoschizomers of any of the foregoing.

[0331] Paragraph 32: The nucleic acid according to any one of paragraphs 29 to 31, wherein at least one of the two type II restriction endonuclease sites enables manipulation of the nucleic acid as a module.

[0332] Paragraph 33: The nucleic acid according to any one of paragraphs 1 to 32, wherein the E4 region contains, in the 5'-3' direction, an E4 promoter (SEQ ID NO: 9), E4-ORF1 (SEQ ID NO: 10), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0333] Paragraph 34: The nucleic acid according to any one of paragraphs 1 to 33, wherein the E4 region contains, in the 5'-3' direction, an E4 promoter (SEQ ID NO: 9), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

[0334] Paragraph 35: The nucleic acid according to any one of paragraphs 1 to 34, wherein the E4 region contains E4-ORF6 / 7 (SEQ ID NO: 15).

[0335] Paragraph 36: The nucleic acid according to any one of paragraphs 1 to 35, wherein the VA RNA region contains VA RNA I (SEQ ID NO: 16) and / or VA RNA II (SEQ ID NO: 17).

[0336] Paragraph 37: The nucleic acid according to paragraph 36, wherein VA RNA I and / or VA RNA II are directly arranged between splicing sites.

[0337] Paragraph 38: The nucleic acid according to paragraph 37, wherein the splicing site is a donor or acceptor splicing site.

[0338] Paragraph 39: The nucleic acid according to paragraph 36, wherein the VA RNA region is sandwiched between two type II restriction endonuclease recognition sites.

[0339] Paragraph 40: The nucleic acid according to paragraph 39, wherein the VA RNA region is between a PmeI restriction endonuclease recognition site and a PacI restriction endonuclease recognition site.

[0340] Paragraph 41: The nucleic acid according to paragraph 40, wherein the two type II restriction endonuclease recognition sites are selected from the group consisting of PacI, SpeI, AscI, PmeI, and NotI and / or their corresponding isoschizomers.

[0341] Paragraph 42: The nucleic acid according to paragraph 40, wherein the restriction site enables the manipulation of the nucleic acid as a module.

[0342] Paragraph 43: The nucleic acid according to any one of paragraphs 1 to 42, wherein the VA RNA region contains, in the 5'-3' direction, a restriction endonuclease recognition site, a splicing site, VA RNA I, VA RNA II, a splicing site, and a restriction endonuclease recognition site.

[0343] Paragraph 44: The nucleic acid according to Paragraph 43, wherein the splicing site is a donor or acceptor splicing site.

[0344] Paragraph 45: The nucleic acid according to Paragraph 43, wherein VA RNA I and / or VA RNA II is operably linked to a Pol II promoter.

[0345] Paragraph 46: The nucleic acid according to Paragraph 36, wherein VA RNA I and / or VA RNA II is located within the E4 region.

[0346] Paragraph 47: The nucleic acid according to Paragraph 36, wherein VA RNA I and / or VA RNA II is located within the E2A region.

[0347] Paragraph 48: The nucleic acid according to Paragraph 47, wherein VA RNA I and / or VA RNA II is operably linked to an E2 early promoter and / or an E2 late promoter.

[0348] Paragraph 49: The nucleic acid according to Paragraph 47, wherein VA RNA I and / or VA RNA II is operably linked to an L4P promoter.

[0349] Paragraph 50: The nucleic acid according to any one of Paragraphs 1 to 49, wherein the nucleic acid further comprises a backbone region.

[0350] Paragraph 51: The nucleic acid according to Paragraph 50, wherein the backbone region comprises a pLDB backbone.

[0351] Paragraph 52: The nucleic acid according to any one of Paragraphs 1 to 51, wherein the hAd5 nucleic acid does not contain at least one structural protein, and the at least one structural protein comprises a fiber protein (SEQ ID NO: 18, SEQ ID NO: 32), a hexon protein (SEQ ID NO: 19, SEQ ID NO: 33), and / or a penton protein (SEQ ID NO: 20, SEQ ID NO: 34).

[0352] Paragraph 53: The hAd5 nucleic acid does not contain at least one packaging protein, and the at least one packaging protein includes a 23K endoprotease (SEQ ID NO: 21, SEQ ID NO: 35), a peripenton hexon-related protein (SEQ ID NO: 22, SEQ ID NO: 36), and / or a packaging protein 3 (SEQ ID NO: 23, SEQ ID NO: 37), and the nucleic acid according to any one of Paragraphs 1 to 52.

[0353] Paragraph 54: The hAd5 nucleic acid does not contain an E1 region, and the E1 region includes an E1A protein (SEQ ID NO: 24-28, 38-42) and / or an E1B protein (SEQ ID NO: 29-30, 43-44), and the nucleic acid according to any one of Paragraphs 1 to 53.

[0354] Paragraph 55: The hAd5 nucleic acid does not contain an E3 region, and the E3 region includes at least one of SEQ ID NOs: 68-81, and the nucleic acid according to any one of Paragraphs 1 to 54.

[0355] Paragraph 56: The nucleic acid according to any one of Paragraphs 1 to 55, including SEQ ID NO: 1 and / or SEQ ID NO: 31.

[0356] Paragraph 57: The nucleic acid according to any one of Paragraphs 1 to 56 includes an E4 region, a VA RNA region, an E2A region, and / or a backbone region in the 5'-3' direction.

[0357] Paragraph 58: The nucleic acid according to any one of Paragraphs 1 to 56 includes an E4 region, a VA RNA region, and / or an E2A region in the 5'-3' direction.

[0358] Paragraph 59: The nucleic acid according to any one of Paragraphs 1 to 58 does not exceed 18,932 nucleotides.

[0359] Paragraph 60: The nucleic acid according to any one of Paragraphs 1 to 59 does not exceed 12,130 nucleotides.

[0360] Paragraph 61: The nucleic acid according to any one of Paragraphs 1 to 60, wherein the nucleic acid does not exceed 10,609 nucleotides.

[0361] Paragraph 62: The nucleic acid according to any one of Paragraphs 1 to 61, wherein the nucleic acid does not exceed 8,659 nucleotides.

[0362] Paragraph 63: The nucleic acid according to any one of Paragraphs 1 to 62, wherein the nucleic acid contains a plasmid.

[0363] Paragraph 64: The nucleic acid according to any one of Paragraphs 1 to 63, wherein the nucleic acid is plasmid DNA.

[0364] Paragraph 65: The nucleic acid according to Paragraph 64, wherein the plasmid DNA can be linear or circular.

[0365] Paragraph 66: The nucleic acid according to any one of Paragraphs 1 to 62, wherein the nucleic acid contains closed-ended linear double-stranded DNA (clDNA).

[0366] Paragraph 67: The nucleic acid according to any one of Paragraphs 1 to 62, wherein the nucleic acid is closed-ended linear double-stranded DNA (clDNA).

[0367] Paragraph 68: The nucleic acid according to any one of Paragraphs 1 to 67, further comprising at least one stuffer sequence containing a sequence having at least 85% sequence identity with SEQ ID NO: 93 or 94.

[0368] Paragraph 69: The nucleic acid according to any one of Paragraphs 1 to 68, wherein the clDNA further contains at least one telomerase binding site.

[0369] Paragraph 70: An adenovirus containing the nucleic acid according to any one of Paragraphs 1 to 69.

[0370] Paragraph 71: A recombinant adeno-associated virus (rAAV) combined with the adenovirus according to Paragraph 70.

[0371] Paragraph 72: A human adenovirus 5 (hAd)-based nucleic acid containing L4-22K.

[0372] Paragraph 73: A human adenovirus 5 (hAd)-based nucleic acid containing L4-33K.

[0373] Paragraph 74: A human adenovirus 5 (hAd)-based nucleic acid containing L4-22K, L4-33K, and L4P.

[0374] Paragraph 75: A cell comprising the nucleic acid according to any one of paragraphs 1 to 69, the adenovirus according to paragraph 70, or the recombinant adeno-associated virus (rAAV) according to paragraph 71.

[0375] Paragraph 76: For use in the production of recombinant adeno-associated virus (rAAV), i) a nucleic acid according to any one of claims 62 to 69, ii) an rAAV genome, and iii) transfection of a cell with an AAV capsid (cap) gene and a non-structural replication (rep) gene, giving the cell sufficient time to produce rAAV particles, the cell according to paragraph 75 in a method for producing a clarified lysate containing rAAV capsid particles.

[0376] Paragraph 77: The cell according to paragraph 76, wherein the rAAV particles in the clarified lysate contain at least about 25% to at least about 30% full capsid particles.

[0377] Paragraph 78: The cell according to paragraph 76, wherein the rAAV capsid particles in the clarified lysate contain at least about 25% to at least about 30% full capsid particles, and the rAAV is produced using the hAd5-based nucleic acid (SEQ ID NO: 1 or SEQ ID NO: 31) of the present invention.

[0378] Paragraph 79: The cells described in paragraph 76, which contain full capsid particles having SEQ ID NO: 1 or SEQ ID NO: 31 that are at least about 1.5-fold higher when the rAAV in the clarified lysate is compared to the rAAV in the clarified lysate produced with the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0379] Paragraph 80: A method for producing recombinant adeno-associated virus (rAAV), comprising: i) transfecting a cell with a nucleic acid described in any of paragraphs 1-69, ii) an rAAV genome containing a transgene, and iii) an AAV helper Rep-Cap gene encoding an AAV capsid and non-structural replication genes, and giving the cell sufficient time to produce rAAV particles.

[0380] Paragraph 81: The method according to paragraph 80, wherein the method further comprises generating a clarified lysate from a bioreactor.

[0381] Paragraph 82: The method according to paragraph 81, wherein the clarified lysate contains rAAV having at least about 30% full capsid particles.

[0382] Paragraph 83: The method according to any one of paragraphs 80-82, wherein the clarified lysate contains rAAV having at least about 1.5-fold more amount or percentage of full capsid particles when compared to the rAAV in the clarified lysate produced using the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO: 92.

[0383] Paragraph 84: The method according to paragraph 80, wherein the rAAV genome contains a transgene.

[0384] Paragraph 85: The method according to paragraph 80, wherein the rAAV genome and / or the AAV capsid and non-structural replication genes are in the form of a plasmid and / or a clDNA sequence.

[0385] Paragraph 86: The method according to Paragraph 80, wherein the cells are suspension cells.

[0386] Paragraph 87: The method according to Paragraph 86, wherein the suspension cells are mammalian cells.

[0387] Paragraph 88: The method according to Paragraph 87, wherein the cells are HEK293.

[0388] Paragraph 89: The method according to Paragraph 88, further comprising expanding the cells to produce a cell mass sufficient for seeding in a bioreactor.

[0389] Paragraph 90: The method according to any one of Paragraphs 80 to 89, wherein the bioreactor is at least 25 L scale.

[0390] Paragraph 91: The method according to any one of Paragraphs 80 to 90, wherein the bioreactor is a stirred production bioreactor.

[0391] Paragraph 92: The method according to any one of Paragraphs 80 to 91, wherein the cells are expanded to produce a cell mass sufficient for seeding in a stirred production bioreactor.

[0392] Paragraph 93: The method according to any one of Paragraphs 80 to 92, wherein the stirred production bioreactor is at least 250 L scale.

[0393] Paragraph 94: The method according to Paragraph 80, wherein the step of transfection comprises using polyethyleneimine.

[0394] Paragraph 95: The method according to Paragraph 80, wherein the step of harvesting comprises harvesting suspension cells.

[0395] Paragraph 96: The method according to Paragraph 89, wherein the cells are harvested at least 72 hours after the step of transfection.

[0396] Paragraph 97: The method according to paragraph 96, which comprises lysing suspension cells and purifying rAAV virions.

[0397] Paragraph 98: The method according to paragraph 97, wherein the lysing step comprises chemical lysis.

[0398] Paragraph 99: The method according to paragraph 97, wherein the purifying step comprises a purification method selected from the group consisting of affinity capture chromatography, iodixanol density gradient centrifugation, and quaternary amine chromatography resin.

[0399] Paragraph 100: A method for producing recombinant adeno-associated virus (rAAV), comprising: i) SEQ ID NO: 1 or SEQ ID NO: 31; ii) an rAAV genome containing a transgene; and iii) transfecting a cell with an AAV helper Rep-Cap gene encoding an AAV capsid and non-structural replication genes, and giving the cell sufficient time to produce rAAV particles.

[0400] Paragraph 101: The method according to paragraph 100, wherein the cells are cultured for a sufficient time and under conditions such that at least the polypeptide encoded by SEQ ID NO: 5 or the polypeptide encoded by SEQ ID NO: 6 is expressed.

[0401] Paragraph 102: The method according to paragraph 100, wherein the cells are cultured for a sufficient time and under conditions such that at least one polypeptide encoded by SEQ ID NO: 1 or SEQ ID NO: 31 is expressed.

[0402] Paragraph 103: A method for producing virus particles, comprising: a) providing the cell according to claim 77; b) culturing the cell for a sufficient time and under conditions such that at least the polypeptide encoded by SEQ ID NO: 5 or the polypeptide encoded by SEQ ID NO: 6 is expressed, or at least one polypeptide encoded by SEQ ID NO: 1 or SEQ ID NO: 31 is expressed; c) culturing the cell under conditions such that virus particles are produced; and d) isolating the virus particles, if necessary.

[0403] Paragraph 104: The method according to paragraph 103, further comprising a sequence having at least 85% sequence identity with SEQ ID NO: 93 and / or a sequence having at least 85% sequence identity with SEQ ID NO: 94.

[0404] Paragraph 105: The method according to claim 104, wherein SEQ ID NO: 93 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region.

[0405] Paragraph 106: The method according to claim 104, wherein SEQ ID NO: 94 is downstream of the 3' end of the nucleic acid sequence encoding the E2A region.

[0406] Paragraph 107: The method according to claim 104, wherein SEQ ID NO: 94 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region.

[0407] Paragraph 108: The method according to claim 104, wherein SEQ ID NO: 93 is downstream of the 3' end of the nucleic acid sequence encoding the E2A region.

[0408] Paragraph 109: The method according to paragraphs 104 to 108, wherein SEQ ID NO: 94 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region and SEQ ID NO: 93 is not located at the 3' end of the nucleic acid sequence encoding the E2A region.

[0409] Paragraph 110: The method according to paragraphs 104 to 109, wherein the hAd5-based nucleic acid is clDNA.

[0410] Paragraph 111: The method according to paragraph 110, wherein the clDNA further comprises a telomerase binding site.

[0411] Paragraph 112: The method according to paragraphs 104 to 111, wherein SEQ ID NO: 93 is located between the telomerase binding site (TelRL) and the 5' end of the E4 region, and SEQ ID NO: 94 is located between the telomerase binding site (TelRL) and the 3' end of the E2A region.

[0412] Paragraph 113: The method according to paragraphs 104 to 111, wherein SEQ ID NO: 94 is located between the telomerase binding site (TelRL) and the 5' end of the E4 region, and SEQ ID NO: 93 is located between the telomerase binding site (TelRL) and the 3' end of the E2A region.

[0413] Paragraph 114: The method according to paragraphs 104 to 111, wherein SEQ ID NO: 94 is located between the telomerase binding site and upstream of the 5' end of the E4 region, and the nucleic acid does not contain SEQ ID NO: 93.

[0414] Paragraph 115: A helper nucleic acid comprising the E2A region, the E4 region, and the VA RNA region, and not containing one or more of at least one packaging protein, at least one structural protein, the major late promoter (MLP), the E1 region, and / or the E3 region.

[0415] Paragraph 116: The nucleic acid according to paragraph 115, wherein the nucleic acid contains SEQ ID NO: 95.

[0416] Paragraph 117: A helper nucleic acid comprising the E2A region, the E4 region, and the VA RNA region, and not containing one or more of at least one packaging protein, at least one structural protein, the major late promoter (MLP), the E1 region, and / or the E3 region.

[0417] Paragraph 118: The nucleic acid according to paragraph 117, wherein the nucleic acid contains SEQ ID NO: 96.

[0418] Helper nucleic acids used in AAV production may contain a stuffer sequence so as to be able to detect residual nucleic acids, e.g., residual DNA from an Ad helper construct in an AAV preparation, e.g., rAAV in a clarified lysate, or enriched or purified rAAV. As used herein, a "stuffer" sequence refers to a non-coding sequence. The stuffer sequence preferably has no or minimal regulatory effect on the coding sequence within the same nucleic acid molecule.

[0419] An Ad5-based helper nucleic acid further comprising two novel sequences (e.g., stuffer sequences), SEQ ID NOs: 93 and 94, is described herein. In one aspect of any of the embodiments, the nucleic acid of the invention as described herein further comprises at least one stuffer sequence comprising a sequence having at least 85% sequence identity, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO: 93 or 94.

[0420] In some embodiments, the sequence having at least 85% sequence identity, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO: 93 or 94 is located at the AscI or Not1 site of a sequence having at least 80% sequence identity, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO: 1. In some embodiments, the sequence having at least 85% sequence identity, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO: 93 or 94 is located at the AscI or Not1 site of SEQ ID NO: 1.

[0421] In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 85% sequence identity with SEQ ID NO: 93. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 90% sequence identity with SEQ ID NO: 93. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 95% sequence identity with SEQ ID NO: 93. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 98% sequence identity with SEQ ID NO: 93. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 99% sequence identity with SEQ ID NO: 93. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of the sequence of SEQ ID NO: 93.

[0422] In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 85% sequence identity with SEQ ID NO: 94. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 90% sequence identity with SEQ ID NO: 94. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 95% sequence identity with SEQ ID NO: 94. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 98% sequence identity with SEQ ID NO: 94. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of a sequence having at least 99% sequence identity with SEQ ID NO: 94. In some embodiments of any of the aspects, the stuffer sequence comprises or consists of the sequence of SEQ ID NO: 94.

[0423] In some embodiments of any of the aspects, the nucleic acid comprises or consists of only a stuffer sequence having at least 85% sequence identity with SEQ ID NO: 93 and does not comprise a sequence having at least 85% sequence identity with SEQ ID NO: 94. In some embodiments of any of the aspects, the nucleic acid comprises or consists of only a stuffer sequence having at least 85% sequence identity with SEQ ID NO: 94 and does not comprise a sequence having at least 85% sequence identity with SEQ ID NO: 93.

[0424] In some embodiments of any of the aspects, the hAd5-based nucleic acid of the invention (e.g., XX85) further comprises SEQ ID NO: 93 or SEQ ID NO: 94 at the 5' end of the E4 region and / or at the 3' end of the E2A region. In some embodiments of any of the aspects, the nucleic acid of the invention is clDNA or neDNA. In one embodiment, the clDNA or neDNA further comprises at least one telomerase binding site. In one embodiment, the clDNA or neDNA is dbDNA or a dbDNA precursor plasmid. In one embodiment, the Ad5-based nucleic acid of the invention comprises SEQ ID NO: 93 or SEQ ID NO: 94 located between the 5' end of the E4 region and the 3' end of the telomerase site. In some embodiments of any of the aspects, the nucleic acid of the invention further comprises SEQ ID NO: 93 or SEQ ID NO: 94 at the 3' end of the E2A region. In some embodiments of any of the aspects, the nucleic acid comprises a stuffer sequence 3' of the E4 and E2A elements and 5' of the telomerase site found 3' of the E2A element. In some embodiments of any of the aspects, the hAd5-based nucleic acid of the invention further comprises SEQ ID NO: 93 or SEQ ID NO: 94 at the 5' end of the E4 element and SEQ ID NO: 93 or SEQ ID NO: 94 at the 3' end of the E2A element. In some embodiments of any of the aspects, the hAd5 nucleic acid of the invention further comprises SEQ ID NO: 93 or SEQ ID NO: 94 at the 5' end of the E4 region and does not comprise SEQ ID NO: 93 or SEQ ID NO: 94 at the 3' end of the E2A region.

[0425] In some embodiments of any of the aspects, the nucleic acid of the present invention further comprises a stuffer sequence having at least 85% sequence identity with SEQ ID NO: 93 located at the 5' end of the E4 region, and does not contain a stuffer sequence at the 3' end of the E2A region. In some embodiments of any of the aspects, the nucleic acid of the present invention further comprises a stuffer sequence having at least 85% sequence identity with SEQ ID NO: 94 located at the 5' end of the E4 region, and does not contain a stuffer sequence at the 3' end of the E2A element.

[0426] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which is defined only by the claims. Definitions of common terms in cell biology, immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition (ISBN 0911910190, 978-0911910421) published by Merck Sharp & Dohme Corp., 2018; Robert S. Porter (ed.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine (ISBN 9783527600908) published by Blackwell Science Ltd., 1999 - 2012; Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference (ISBN 1-56081-569-8) published by VCH Publishers, Inc., 1995; Immunology by Werner Luttmann (ISBN 0815345054, 978-0815345053) published by Elsevier, 2006; Janeway’s Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016; Lewin’s Genes XI (ISBN-1449659055) published by Jones & Bartlett Publishers, 2014; Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.), Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the entire contents of which are hereby incorporated by reference in their entirety.

[0427] Unless otherwise required by context in this specification, the singular terms shall include the plural and the plural terms shall include the singular.

[0428] In some embodiments of any of the aspects, the disclosure described herein is not directed to processes for cloning humans, processes for modifying the genetic identity of the human germ line, the use of human embryos for industrial or commercial purposes, or animals that may cause pain to them without substantial medical benefit to humans or animals, and processes for modifying the genetic identity of animals resulting from such processes.

[0429] The grouping of alternative elements or embodiments disclosed herein should not be construed as limiting. Each group member can be referenced and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group may be included in or deleted from the group for reasons of convenience and / or patentability. When such inclusion or deletion occurs, this specification is considered to include the modified group and thus to satisfy the description of all Markush groups used in the appended claims.

[0430] The abbreviation "e.g." is derived from the Latin exempli gratia and is used herein to indicate non-limiting examples. Thus, the abbreviation "e.g." is synonymous with the translation "for example".

[0431] Any particular element of any of the above embodiments can be combined with or replaced by elements of other embodiments. Further, while the advantages associated with particular embodiments of the present disclosure have been described in the context of these embodiments, other embodiments can also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages for all embodiments to be within the scope of the present disclosure.

[0432] It should be understood that the present invention is not limited to the specific methodologies, protocols, reagents, etc. described herein and can therefore vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which is defined only by the claims.

[0433] Except in the operating examples or where otherwise indicated, all numbers expressing amounts of ingredients or reaction conditions used in this specification are to be understood as being modified in all instances by the term "about." The term "about," when used to describe the present invention in relation to percentages, means ±1%.

[0434] In one aspect, the present invention relates to the compositions, methods, and respective components (one or more) described herein, which are essential to the present invention but can include unspecified elements, whether essential or not ("comprising"). In some embodiments, other elements included in the description of the composition, method, or their respective components are limited to those that do not substantially affect the basic and novel features (one or more) of the present invention ("consisting essentially of"). This applies equally to the steps within the described methods and the compositions and components therein. In other embodiments, the present invention, compositions, methods, and their respective components described herein are intended to exclude any element that is not considered an essential element for the component, composition, or method ("consisting of").

[0435] All patents, patent applications, and publications specified are hereby expressly incorporated by reference herein for the purpose of, for example, explaining and disclosing the methodologies described in such publications that may be used in connection with the present invention. These publications are provided only for their disclosure prior to the filing date of the present application. Nothing in this regard shall be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or otherwise. All statements as to the date or content of these documents are based on the information available to the applicant and do not admit the accuracy of the dates or content of these documents.

Examples

[0436] All documents referred to in this specification are hereby incorporated by reference into this specification. The contents of all references, patents, and published patent applications cited throughout this application, as well as the drawings and sequence listings, are hereby incorporated by reference into this specification for all purposes to the same extent as if each individual publication or patent document were specifically and individually indicated as such. By the citation of various references in this document, the applicant does not admit that any particular reference is "prior art" with respect to the present invention. Embodiments of the compositions and methods of the present invention are shown in the following examples.

[0437] The following non-limiting examples are provided for illustrative purposes only to facilitate a more complete understanding of representative embodiments currently contemplated.

[0438] Example 1 In some embodiments of any of the aspects, the human adenovirus 5 (hAd)-based nucleic acid comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 1-17 or 31, or a sequence of one of SEQ ID NOs: 1-17 or 31 that maintains the same function as one of SEQ ID NOs: 1-17 or 31. Any of these sequences as described herein can be used to produce AAV, rAAV, lentivirus, adenovirus, and / or baculovirus.

[0439] In some embodiments of any of the aspects, the human adenovirus 5 (hAd)-based nucleic acid comprises a sequence that is at least 95% identical to one of SEQ ID NOs: 1-17 or 31, or a sequence of one of SEQ ID NOs: 1-17 or 31 that maintains the same function as one of SEQ ID NOs: 1-17 or 31.

[0440] In some embodiments of any of the aspects, the human adenovirus 5 (hAd)-based nucleic acid encodes at least one polypeptide selected from a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of SEQ ID NOs: 82-91, or a sequence of SEQ ID NOs: 82-91 that maintains the same function as one of SEQ ID NOs: 82-91.

[0441] In some embodiments of any of the aspects, the human adenovirus 5 (hAd)-based nucleic acid does not include a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least one of SEQ ID NOs: 32-44, SEQ ID NOs: 68-74, or a sequence of SEQ ID NOs: 32-44 or SEQ ID NOs: 68-74 that maintains the same function as one of SEQ ID NOs: 32-44 or SEQ ID NOs: 68-74.

[0442] In some embodiments of any of the aspects, the human adenovirus 5 (hAd)-based nucleic acid does not include a sequence that is at least 95% identical to at least one of SEQ ID NOs: 32-44, SEQ ID NOs: 68-74, or a sequence of SEQ ID NOs: 32-44 or SEQ ID NOs: 68-74 that maintains the same function as one of SEQ ID NOs: 32-44 or SEQ ID NOs: 68-74.

[0443] In some embodiments of any of the aspects, the human adenovirus 5 (hAd)-based nucleic acid is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of SEQ ID NOs: 18-30, SEQ ID NOs: 75-81, or one of SEQ ID NOs: 18-30 or SEQ ID NOs: 75-81, and does not encode at least one polypeptide selected from sequences that maintain the same function as one of SEQ ID NOs: 18-30 or SEQ ID NOs: 75-81.

[0444] In some embodiments, the hAd5 nucleic acid (e.g., XX85) includes an E4 region having E4-ORF6 / 7, a viral associated (VA) RNA region, and an E2A region. The hAd5 nucleic acid includes SEQ ID NOs: 2-17. In some preferred embodiments, the hAd5 nucleic acid (e.g., XX85) does not include at least one packaging protein, at least one structural protein, a major late promoter (MLP), an E1 region, and / or an E3 region. In some embodiments, the hAd5 nucleic acid (e.g., XX85) does not include SEQ ID NOs: 18-30 and SEQ ID NOs: 68-81. In some embodiments, the hAd5 nucleic acid includes the elements described in Table 4. 1. SEQ ID NO: 1 Full-length xx85 plasmid DNA 2. SEQ ID NO: 2 E2 early promoter 3. SEQ ID NO: 3 E2 late promoter 4. SEQ ID NO: 4 E2A protein / DBP DNA sequence 5. SEQ ID NO: 5 L4-22K DNA sequence 6. SEQ ID NO: 6 L4-33K DNA sequence 7. SEQ ID NO: 7 L4-100K DNA sequence 8. SEQ ID NO: 8 L4 promoter (L4P) 9. SEQ ID NO: 9 E4 promoter 10. SEQ ID NO: 10 E4-ORF1 DNA sequence 11. SEQ ID NO:11 E4-ORF2 DNA sequence 12. SEQ ID NO:12 E4-ORF3 DNA sequence 13. SEQ ID NO:13 E4-ORF4 DNA sequence 14. SEQ ID NO:14 E4-ORF6 DNA sequence 15. SEQ ID NO:15 E4-ORF6 / 7 DNA sequence 16. SEQ ID NO:16 VA RNA I DNA sequence 17. SEQ ID NO:17 VA RNA II DNA sequence 18. SEQ ID NO:18 Fiber protein (AP_000226.1) 19. SEQ ID NO:19 Hexon protein 20. SEQ ID NO:20 Penton protein 21. SEQ ID NO:21 23K endoprotease 22. SEQ ID NO:22 Peripenton-hexon related protein 23. SEQ ID NO:23 Packaging protein 3 24. SEQ ID NO:24 E1A protein 13S 25. SEQ ID NO:25 E1A protein 12S 26. SEQ ID NO:26 E1A protein 11S 27. SEQ ID NO:27 E1A protein 10S 28. SEQ ID NO:28 E1A protein 9S 29. SEQ ID NO:29 E1B protein 19K 30. SEQ ID NO:30 E1B protein 55K 31. SEQ ID NO:31 xx85 closed-ended linear double-stranded DNA (clDNA) 32. SEQ ID NO:32 Fiber protein DNA sequence 33. SEQ ID NO:33 Hexon protein DNA sequence 34. SEQ ID NO:34 Penton protein DNA sequence 35. SEQ ID NO:35 23K endoprotease DNA sequence 36. SEQ ID NO:36 Peripentonal-hexon related protein DNA sequence 37. SEQ ID NO:37 DNA sequence of packaging protein 3 38. DNA sequence of E1A protein 13S, SEQ ID NO: 38 39. DNA sequence of E1A protein 12S, SEQ ID NO: 39 40. DNA sequence of E1A protein 11S, SEQ ID NO: 40 41. DNA sequence of E1A protein 10S, SEQ ID NO: 41 42. DNA sequence of E1A protein 9S, SEQ ID NO: 42 43. DNA sequence of E1B protein 19K, SEQ ID NO: 43 44. DNA sequence of E1B protein 55K, SEQ ID NO: 44 45. telRL site, SEQ ID NO: 45 46. pal site, SEQ ID NO: 46 47. telRL site of φK02, SEQ ID NO: 47 48. loxP site, SEQ ID NO: 48 49. FRT site, SEQ ID NO: 49 50. attP site of phiC31, SEQ ID NO: 50 51. λattP site, SEQ ID NO: 51 52. Inverted terminal repeat sequence consensus sequence, SEQ ID NO: 52 53. Inverted terminal repeat sequence for use with Escherichia coli phage N15 and Klebsiella phage Phi KO2 prote telomerase, SEQ ID NO: 53 54. Inverted terminal repeat sequence for use with Yersinia phage PY54, SEQ ID NO: 54 55. Inverted terminal repeat sequence for use with Halomonas phage phiHAP-1, SEQ ID NO: 55 56. Inverted terminal repeat sequence for use with Vibrio phage VP882, SEQ ID NO: 56 57. Inverted terminal repeat sequence for use with Borrelia burgdorferi prote telomerase, SEQ ID NO: 57 58. Perfect inverted repeat sequence, SEQ ID NO: 58 59. Perfect inverted repeat sequence, SEQ ID NO: 59 60. Perfect inverted repeat sequence, SEQ ID NO: 60 61. Telomerase target sequence of Escherichia coli N15 TelN telomerase, SEQ ID NO: 61 62. Sequence number 62 Telomerase target sequence, Klebsiella phage PhiK02 63. Sequence number 63 Telomerase target sequence, Yersinia phage PY54 64. Sequence number 64 Telomerase target sequence, Vibrio phage VP882 65. Sequence number 65 Telomerase target sequence, Borrelia burgdorferi 66. Sequence number 66 xx6 - 80 plasmid DNA sequence 67. Sequence number 67 xx6 - 80 clDNA sequence 68. Sequence number 68 E3 protein 12.K DNA sequence 69. Sequence number 69 E3 protein CR1 alpha DNA sequence 70. Sequence number 70 E3 protein gp19K DNA sequence 71. Sequence number 71 E3 protein CR1 beta DNA sequence 72. Sequence number 72 E3 protein RID - alpha DNA sequence 73. Sequence number 73 E3 protein RID - beta DNA sequence 74. Sequence number 74 E3 protein 14.7K DNA sequence 75. Sequence number 75 E3 protein 12.K 76. Sequence number 76 E3 protein CR1 - alpha 77. Sequence number 77 E3 protein gp19K 78. Sequence number 78 E3 protein CR1 - beta 79. Sequence number 79 E3 protein RID - alpha 80. Sequence number 80 E3 protein RID - beta 81. Sequence number 81 E3 protein 14.7K 82. Sequence number 82 E2A protein 83. Sequence number 83 L4 - 22K protein 84. Sequence number 84 L4 - 33K protein 85. Sequence number 85 L4 - 100K protein 86. Protein E4-ORF1 with Accession Number 86 87. Protein E4-ORF2 with Accession Number 87 88. Protein E4-ORF3 with Accession Number 88 89. Protein E4-ORF4 with Accession Number 89 90. Protein E4-ORF6 with Accession Number 90 91. Protein E4-ORF6 / 7 with Accession Number 91 92. XX680 neDNA Precursor Plasmid with Accession Number 92 93. Stuffing Sequence Number 2 with Accession Number 93 94. Stuffing Sequence Number 7 with Accession Number 94 95. pLS_212 with Accession Number 95 96. pLS_412 with Accession Number 96

[0445]

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 3-23

Table 3-24

Table 3-25

Table 3-26

Table 3-27

Table 3-28

Table 3-29

Table 3-30

Table 3-31

Table 3-32

Table 3-33

Table 3-34

Table 3-35

Table 3-36

Table 3-37

Table 3-38

Table 3-39

Table 3-40

Table 3-41

Table 3-42

Table 3-43

Table 3-44

Table 3-45

Table 3-46

Table 3-47

[0446]

Table 4-1

Table 4-2

Table 4-3

[0447] Example 2: Production of recombinant AAV (rAAV) using a helper nucleic acid as described herein, such as helper clDNA.

[0448] The production of rAAV vectors was achieved by transient transfection based on triple clDNA of suspension HEK293 cell lines. The upstream process started with the thawing of a single vial, which was expanded in a series of shaking flasks to produce cell masses sufficient to seed a bioreactor at 25L or 50L scale, and then sequentially seeded into stirred production bioreactors of 250L or 500L respectively. After the cells were expanded to the target production volume, the cells were transfected with a cocktail consisting of adenovirus helper clDNA (XX85 or XX85 hybrid as described in the present invention (XX680 (SEQ ID NO: 67)), AAV Rep-Cap helper clDNA (rep2 / cap8), and AAV transgene-containing clDNA) mixed with the transfection reagent polyethyleneimine. The cells were harvested during approximately 72 hours after transfection. The products used in cell culture are chemically defined and do not utilize animal-derived materials in either the production process or the purification process. The downstream purification process includes chemical lysis to release the viral vector. Cellular DNA and RNA were aggregated in the presence of specific reagents. Cell debris was clarified by depth filtration and membrane filtration, and intact rAAV particles were further purified by affinity capture chromatography. Full capsids were selected from empty capsids by iodixanol density gradient centrifugation. The purified bulk virus from the iodixanol centrifugation step was captured, further purified, and concentrated using a quaternary amine chromatography resin (anion exchange column). Contaminant proteins that did not bind to the column were removed in the flow-through and from the column wash steps. The column eluate containing the purified rAAV vector was concentrated or diluted to the target concentration (if necessary) and diafiltered into the formulation buffer. The formulated and purified rAAV solution was filtered into a sterile container.

[0449] Prior to proceeding to the downstream chromatographic purification process, the downstream purification process initiates the chemical lysis of HEK293 cells in suspension to release the viral vector. The cell debris is then clarified by filtration and the intact rAAV particles are recovered in the filtrate, herein referred to as the "clarified lysate" or "clarified cell lysate". The clarified lysate then undergoes a downstream chromatographic purification process to produce purified or enriched rAAV.

[0450] rAAV using the Ad5-based helper nucleic acid of the present invention is produced using the methods described in PCT / US2022 / 013279, published as WO2022159679, and / or the methods described in PCT / US2021 / 013689, published as WO2021 / 146591, which are hereby incorporated by reference in their entirety.

[0451] As shown in Figure 5, the rAAV particle titer (vp / ml), vector genome titer (vg / ml), and SEC260 / 280 were determined in clarified lysates that had exited the bioreactor and had not undergone the downstream chromatographic purification process. In this process, Ad helper xx85clDNA (SEQ ID NO: 31) and Ad helper xx680 clDNA (SEQ ID NO: 67) were used to transfect a 3-liter HEK293 cell culture with a cell density of 4E6 cells / ml, where each helper construct was used at 7500 copies per cell. The results showed that xx85 yielded a population of rAAV with 32% fully capsidated particles, whereas xx680 yielded a population of rAAV with only 17% fully capsidated particles, and all experimental conditions (including cell density and copy number of the construct) for testing these two different Ad helper constructs remained the same. This clearly shows that an Ad helper nucleic acid as described herein, such as the xx85 nucleic acid, resulted in a higher packaging efficiency compared to the xx-680 nucleic acid. In this experiment, the packaging efficiency with xx85 clDNA was approximately 1.9-fold higher than that with xx680 clDNA. Furthermore, size exclusion chromatography (SEC260 / 280) demonstrated a higher packaging with a higher % fully rAAV as the xx85 SEC260 / 280 value was higher (1.15) than the value at xx680 (1.0).

[0452] Figure 6 shows three experiments that directly compare plasmid XX85 with plasmid XX680. The aim was to examine the differences between XX85 and XX680 and keep the total DNA amount (mass) identical or keep the total number of transfected plasmid copies per cell the same. XX85 generally yields an equivalent or better (1 - 1.5-fold) viral genome titer (vg / mL), with a slight decrease in viral capsid titer (about 75%), which results in a better packaging (higher 260 / 280 ratio).

[0453] The experiments shown in Figure 7 are two experiments using the Pompe disease M1 plasmid as the transgene, and one experiment in Figure 8 using the Lux-2A-eGFP plasmid as the transgene. The purpose of Figure 7 is to examine the difference between XX85 and XX680 in three different serotypes (AAV2, AAV8, and AAV9) while using the same transgene. The purpose of Figure 8 is to examine the difference between XX85 and XX680 when using a transgene different from the previous two experiments in Figure 7. In the previous experiment, 0.5 μg / 1×10 6 Since it has been shown that this cell is optimal for this transgene, the total DNA per cell is reduced in this experiment. The results of Figures 7 and 8 show that XX85 is superior to XX680 in packaging efficiency in multiple capsids (AAV2, AAV8, and AAV9), indicating that XX85 yields more complete capsids with the same total viral genome.

[0454] Example 3: Explanation of the method ELISA (vp / ml) - AAV8 ELISA was used to quantify the total capsids (vp / ml). The AAV8 titration ELISA is a sandwich ELISA-based method used for the quantitative determination of rAAV serotype 8 virus particles. The method was performed using a commercially available kit (PRAAV8, PROGEN). The assay was based on the sandwich ELISA technique that coated the plate with a monoclonal antibody specific for a conformational epitope on the assembled AAV capsid and used to capture AAV particles from the sample.

[0455] ITR-qPCR (vg / ml) -- The viral genome (VG) was quantified using qPCR. This method consisted of an extraction procedure based on DNase I and proteinase K digestion, followed by PCR amplification and real-time fluorescence-based detection of the genomic target region (ITR). The rAAV sample was treated with DNase I enzyme to remove non-capsidated DNA, followed by a second treatment with proteinase K enzyme to digest the proteinaceous viral capsid. The exposed viral vector DNA was diluted using sample dilution buffer (SDB). The diluted DNA reaction was assayed by qPCR using a fluorescence dye-based detection system with a primer pair and a probe targeting the ITR or the transgene sequence in the rAAV genome. The hydrolysis probe assay (e.g., TaqMan assay) included a sequence-specific fluorescently labeled oligonucleotide probe in addition to a pair of sequence-specific PCR primers. When the hydrolysis probe was intact, the fluorescence of the reporter was quenched due to its proximity to the quencher. The amplification reaction included an annealing and extension step where the probe hybridized to the target and the dsDNA-specific 5’→3’ exonuclease activity of Taq polymerase cleaved the reporter. Releasing the reporter from the quencher resulted in a fluorescence signal that was proportional to the amount of amplification product during the reaction. The absolute amount of the target sequence was interpolated from a plasmid standard curve containing the ITR or the transgene sequence. After mathematically correcting for the dilution of the method, the titer results were reported as viral genome / milliliter (VG / mL).

[0456] SEC 260 / 280--SEC-exclusion HPLC uses a porous matrix to separate proteins based on size. Larger species are excluded from the matrix pores and thus have a smaller accessible volume, eluting faster, while smaller species have a greater accessible volume from the matrix pores and elute more slowly. Based on these principles, a size-exclusion HPLC method was developed to separate potential aggregates and impurities from the rAAV final vector and in-process samples. Additionally, this method was used to quantify the capsid protein titer by using serotype-specific standard curves. Further, by integrating the areas under the main peaks at 280 nm and 260 nm and calculating the ratio of both wavelengths, this ratio provides insights into the fullness of the viral vector, with larger numbers indicating higher fullness of the capsid or viral particle.

[0457] Example 4 - Stuffing Sequences The stuffing sequences of SEQ ID NO: 93 and SEQ ID NO: 94 can be included in nucleic acids as described herein, such as the pxx85 sequences as described herein. When Stuffers 2 and 7 are included in such sequences, they do not, for example, induce gene expression of the E2 or E4 proteins.

[0458] The hAd5-based nucleic acids described herein, such as XX85, further comprising stuffer 2 and / or 7 (SEQ ID NO: 93 and 94), can be hydrodynamically injected into mice, and the expression of E2 and / or E4 in the liver can be measured. A plasmid containing any one of the stuffer sequences can be administered to 7-week-old C57BL / 6JOlaHsd male mice by hydrodynamic tail vein injection. Twenty-four hours after injection, the animals can be euthanized and gene expression in the liver can be quantified (mRNA level and protein level). The plasmid copy number (PCN) can also be determined in the liver to normalize the expression levels. The levels of gene expression and protein expression from plasmids containing one or both of the stuffers are similar to the levels observed with control constructs that do not contain the stuffer.

[0459] SEQ ID NO: 93 and / or SEQ ID NO: 94 can be included in the nucleic acid sequences described herein, such as XX85, which further comprises a protelomerase site. In particular, stuffer sequences 2 and / or 7 (SEQ ID NO: 93 and 94) can be included upstream of the 5' end of the E4 region (i.e., 5' stuffer) and / or downstream of the 3' end of the E2A region (i.e., 3' stuffer). Further, the 5' stuffer can be located 5' of the AscI site of the E4 region and / or the 3' stuffer can be located 3' of the NotI site of the E2A region. These positions are schematically shown in Figure 9. Nucleic acids containing one or both of the stuffers at the 5' and / or 3' positions can be tested, for example, as shown in the following table. Nucleic acids containing only the 5' stuffer can exhibit excellent performance, and nucleic acids containing only the 5' stuffer 7 can exhibit particularly excellent performance. For example, the XX85 Ad helper nucleic acid further comprising stuffer 7 at the 5' end produces rAAV with a higher titer when compared to rAAV produced with stuffer 7 at the 5' end and stuffer 2 at the 3' end.

[0460]

Table 5

[0461]

Table 6

[0462] Example 5: rAAV Production Data Using XX85 Hybrid LS212 and LS412 These experiments directly compare plasmid XX85 with hybrid plasmids LS212 and LS412, as shown in Figure 12. The purpose is to examine the differences among XX85, LS212, and LS412 while keeping the same total DNA amount (mass) per cell.

[0463] The experimental design is found in Table 7 below.

Table 7

Claims

1. a) an E4 region having E4-ORF6 / 7, and b) a virus-associated (VA) RNA region, and c) an E2A region having L4-22K and L4-33K comprising d) at least one packaging protein, e) at least one structural protein, f) a major late promoter (MLP), g) an E1 region, and / or h) an E3 region and not comprising one or more of a human adenovirus 5 (hAd)-based nucleic acid.

2. (a) an E4 region having E4-ORF6 / 7, (b) a virus-associated (VA) RNA region, and (c) an E2A region having L4-22K, L4-33K, and L4-100K comprising (d) at least one packaging protein, (e) at least one structural protein, (f) a major late promoter (MLP), (g) an E1 region, and / or (h) an E3 region and not comprising one or more of a human adenovirus 5 (hAd)-based nucleic acid.

3. The nucleic acid according to claim 1 or claim 2, wherein the nucleic acid comprises, in the 5'→3' direction, the E4 region containing E4-ORF 6 / 7, the VA RNA region, and the E2A region.

4. The nucleic acid according to claim 1 or claim 2, wherein the nucleic acid does not contain adenovirus inverted terminal repeat sequences.

5. The nucleic acid according to claim 1 or claim 2, wherein the nucleic acid contains GG CAG C at positions 57 to 62 of L4-22K (for example, 4279 to 4284 of SEQ ID NO: 1).

6. The nucleic acid according to claim 1, wherein the E2A region comprises an E2 early promoter (SEQ ID NO: 2) or a sequence having at least 85% sequence identity with SEQ ID NO: 2, an E2 late promoter (SEQ ID NO: 3) or a sequence having at least 85% sequence identity with SEQ ID NO: 3, an E2A protein (SEQ ID NO: 4) or a sequence having at least 85% sequence identity with SEQ ID NO: 4, L4-22K (SEQ ID NO: 5) or a sequence having at least 85% sequence identity with SEQ ID NO: 5, L4-33K (SEQ ID NO: 6) or a sequence having at least 85% sequence identity with SEQ ID NO: 6, and / or an intermediate phase L4 promoter (L4P) (SEQ ID NO: 7) or a sequence having at least 85% sequence identity with SEQ ID NO: 7, and optionally L4-100K (SEQ ID NO: 8) or a sequence having at least 85% sequence identity with SEQ ID NO:

8.

7. The nucleic acid according to any one of claims 3 to 6, wherein the E2A protein is functionally linked to the E2 early promoter and / or the E2 late promoter.

8. The nucleic acid according to any one of claims 3 to 6, wherein the L4-22K, the L4-33K, and optionally the L4-100K are functionally linked to the L4P.

9. The nucleic acid according to any one of claims 3 to 8, wherein the E2A region is flanked by two type II restriction endonuclease recognition sites.

10. The two type II restriction endonuclease recognition sites are independently selected from the group consisting of PacI; SpeI; AscI; PmeI; NotI; and corresponding isoschizomers of any of the foregoing The nucleic acid according to claim 9.

11. The nucleic acid according to any one of claims 9 to 10, wherein at least one of the two type II recognition sites enables manipulation of the nucleic acid as a module.

12. The nucleic acid according to any one of claims 9 to 11, wherein the E2A region is flanked by a PacI restriction endonuclease recognition site and a NotI restriction endonuclease recognition site.

13. The nucleic acid according to any one of claims 9 to 12, wherein the E2A region is flanked by two SpeI restriction endonuclease recognition sites.

14. The nucleic acid according to any one of claims 1 to 13, wherein the nucleic acid does not contain a mutation that inhibits the expression of L4-22K (SEQ ID NO: 5) and / or L4-33K (SEQ ID NO: 6).

15. The nucleic acid according to any one of claims 1 to 14, wherein the E2A region comprises an E2 early promoter (SEQ ID NO: 2), an E2 late promoter (SEQ ID NO: 3), an E2A protein (SEQ ID NO: 4), L4-22K (SEQ ID NO: 5), L4-33K (SEQ ID NO: 6), and / or an intermediate phase L4 promoter (L4P) (SEQ ID NO: 7).

16. The nucleic acid according to any one of claims 1 to 15, wherein the E2A region comprises, in the 5'-3' direction, an E2 early promoter, L4-33K, L4-22K, L4P, an E2 late promoter, L4-100K, and E2A.

17. The nucleic acid according to any one of claims 1 to 16, wherein the E2A region contains, in the 5'-3' direction, an E2 early promoter, L4-33K, L4-22K, L4P, an E2 late promoter, and E2A.

18. The nucleic acid according to any one of claims 16 and 17, wherein the E2A section contains an E2 early promoter, an E2 late promoter, and E2A.

19. The E2A region of the Ad5-based nucleic acid of the present invention contains a nucleic acid encoding a single-stranded DNA-binding protein [DBP], and lacks essential adenovirus structures (e.g., fiber, hexon, penton, core protein) and replication (e.g., DNA polymerase) genes. The nucleic acid according to any one of claims 1 to 18.

20. The nucleic acid according to any one of claims 16 to 19, wherein the L4 section contains L4-33K, L4-22K, and L4P.

21. The nucleic acid according to any one of claims 16 to 20, wherein the L4 element is in an inverse orientation compared to the E2A region, E4 region, and VA RNA region.

22. The nucleic acid according to any one of claims 16 to 21, wherein the E2A is codon-optimized with respect to its wild-type sequence.

23. The nucleic acid according to any one of claims 1 to 22, wherein the E4 region contains an E4 promoter (SEQ ID NO: 9), E4-ORF1 (SEQ ID NO: 10), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

24. The nucleic acid according to claim 23, wherein the E4-ORF1, the E4-ORF2, the E4-ORF3, the E4-ORF4, the E4-ORF6, and / or the E4-ORF6 / 7 are operably linked to the E4 promoter.

25. The nucleic acid according to any one of claims 1 to 24, wherein the E4 region contains an E4 promoter (SEQ ID NO: 9), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

26. The nucleic acid according to claim 25, wherein the E4-ORF2, the E4-ORF3, the E4-ORF4, the E4-ORF6, and / or the E4-ORF6 / 7 are operably linked to the E4 promoter.

27. The nucleic acid according to claims 25 to 26, wherein the nucleic acid does not contain E4-ORF1 (SEQ ID NO: 10).

28. The nucleic acid according to any one of claims 25 to 27, wherein amino acid residue position 9 of E4-ORF1 shown in SEQ ID NO: 10 is mutated to a stop codon, or the nucleic acid contains a variant of SEQ ID NO: 10 and amino acid residue position 9 of SEQ ID NO: 10 is substituted with a stop codon.

29. The nucleic acid according to any one of claims 23 to 28, wherein the E4 region is flanked by two type II restriction endonuclease recognition sites.

30. The nucleic acid according to claim 29, wherein the E4 region is flanked by an AscI restriction endonuclease recognition site and a PmcI restriction endonuclease recognition site.

31. The two type II restriction endonuclease recognition sites are selected from the group consisting of PacI; SpeI; AscI; PmeI; NotI; and corresponding isoschizomers of any of the foregoing The nucleic acid according to claim 29.

32. The nucleic acid according to any one of claims 29 to 31, wherein at least one of the two type II restriction endonuclease sites enables manipulation of the nucleic acid as a module.

33. The nucleic acid according to any one of claims 1 to 32, wherein the E4 region contains, in the 5'-3' direction, an E4 promoter (SEQ ID NO: 9), E4-ORF1 (SEQ ID NO: 10), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

34. The nucleic acid according to any one of claims 1 to 33, wherein the E4 region contains, in the 5'-3' direction, an E4 promoter (SEQ ID NO: 9), E4-ORF2 (SEQ ID NO: 11), E4-ORF3 (SEQ ID NO: 12), E4-ORF4 (SEQ ID NO: 13), E4-ORF6 (SEQ ID NO: 14), and / or E4-ORF6 / 7 (SEQ ID NO: 15).

35. The nucleic acid according to any one of claims 1 to 34, wherein the E4 region contains E4-ORF6 / 7 (SEQ ID NO: 15).

36. The nucleic acid according to any one of claims 1 to 35, wherein the VA RNA region comprises VA RNA I (SEQ ID NO: 16) and / or VA RNA II (SEQ ID NO: 17). [

37. ] The nucleic acid according to claim 36, wherein VA RNA I and / or VA RNA II are directly disposed between splicing sites. [

38. ] The nucleic acid according to claim 37, wherein the splicing site is a donor or acceptor splicing site. [

39. ] The nucleic acid according to claim 36, wherein the VA RNA region is sandwiched between two type II restriction endonuclease recognition sites. [

40. ] The nucleic acid according to claim 39, wherein the VA RNA region is between a PmeI restriction endonuclease recognition site and a PacI restriction endonuclease recognition site. [

41. ] The nucleic acid according to claim 40, wherein the two type II restriction endonuclease recognition sites are selected from the group consisting of PacI, SpeI, AscI, PmeI, and NotI and / or their corresponding isoschizomers. [

42. ] The nucleic acid according to claim 40, wherein the restriction site enables manipulation of the nucleic acid as a module. [

43. ] The nucleic acid according to any one of claims 1 to 42, wherein the VA RNA region comprises, in the 5'-3' direction, a restriction endonuclease recognition site, a splicing site, VA RNA I, VA RNA II, a splicing site, and a restriction endonuclease recognition site. [

44. ] The nucleic acid according to claim 43, wherein the splicing site is a donor or acceptor splicing site. [

45. ] The nucleic acid according to claim 43, wherein VA RNA I and / or VA RNA II are operably linked to a Pol II promoter. [

46. ] The nucleic acid according to claim 36, wherein VA RNA I and / or VA RNA II are located within the E4 region. [

47. ] The nucleic acid according to claim 36, wherein VA RNA I and / or VA RNA II are located within the E2A region. [

48. ] The nucleic acid according to claim 47, wherein VA RNA I and / or VA RNA II are operably linked to the E2 early promoter and / or the E2 late promoter. [

49. ] The nucleic acid according to claim 47, wherein VA RNA I and / or VA RNA II is operably linked to the L4P promoter.

50. The nucleic acid according to any one of claims 1 to 49, wherein the nucleic acid further comprises a backbone region.

51. The nucleic acid according to claim 50, wherein the backbone region comprises a pLDB backbone.

52. The nucleic acid according to any one of claims 1 to 51, wherein the hAd5 nucleic acid does not contain at least one structural protein, and the at least one structural protein comprises a fiber protein (SEQ ID NO: 18, SEQ ID NO: 32), a hexon protein (SEQ ID NO: 19, SEQ ID NO: 33), and / or a penton protein (SEQ ID NO: 20, SEQ ID NO: 34).

53. The nucleic acid according to any one of claims 1 to 52, wherein the hAd5 nucleic acid does not contain at least one packaging protein, and the at least one packaging protein comprises a 23K endoprotease (SEQ ID NO: 21, SEQ ID NO: 35), a peripenton hexon-related protein (SEQ ID NO: 22, SEQ ID NO: 36), and / or a packaging protein 3 (SEQ ID NO: 23, SEQ ID NO: 37).

54. The nucleic acid according to any one of claims 1 to 53, wherein the hAd5 nucleic acid does not contain the E1 region, and the E1 region comprises an E1A protein (SEQ ID NO: 24-28, 38-42) and / or an E1B protein (SEQ ID NO: 29-30, 43-44).

55. The nucleic acid according to any one of claims 1 to 54, wherein the hAd5 nucleic acid does not contain the E3 region, and the E3 region comprises at least one of SEQ ID NOs: 68-81.

56. The nucleic acid according to any one of claims 1 to 55, comprising SEQ ID NO: 1 and / or SEQ ID NO:

31.

57. The nucleic acid according to any one of claims 1 to 56 comprises the E4 region, the VA RNA region, the E2A region, and / or the backbone region in the 5'-3' direction.

58. Any one of the nucleic acids according to claims 1 to 56 comprises the E4 region, the VA RNA region, and / or the E2A region in the 5'-3' direction.

59. The nucleic acid according to any one of claims 1 to 58, wherein the nucleic acid does not exceed 18,932 nucleotides.

60. The nucleic acid according to any one of claims 1 to 59, wherein the nucleic acid does not exceed 12,130 nucleotides.

61. The nucleic acid according to any one of claims 1 to 60, wherein the nucleic acid does not exceed 10,609 nucleotides.

62. The nucleic acid according to any one of claims 1 to 61, wherein the nucleic acid does not exceed 8,659 nucleotides.

63. The nucleic acid according to any one of claims 1 to 62, wherein the nucleic acid comprises a plasmid.

64. The nucleic acid according to any one of claims 1 to 63, wherein the nucleic acid is plasmid DNA.

65. The nucleic acid according to claim 64, wherein the plasmid DNA can be linear or circular.

66. The nucleic acid according to any one of claims 1 to 62, wherein the nucleic acid comprises closed-ended linear double-stranded DNA (clDNA).

67. The nucleic acid according to any one of claims 1 to 62, wherein the nucleic acid is closed-ended linear double-stranded DNA (clDNA).

68. The nucleic acid according to any one of claims 1 to 67, further comprising at least one stuffer sequence comprising a sequence having at least 85% sequence identity with SEQ ID NO: 93 or 94.

69. The nucleic acid according to any one of claims 1 to 68, wherein the clDNA further comprises at least one telomerase binding site.

70. An adenovirus comprising the nucleic acid according to any one of claims 1 to 69.

71. A recombinant adeno-associated virus (rAAV) combined with the adenovirus according to claim 70.

72. A human adenovirus 5 (hAd)-based nucleic acid comprising L4-22K.

73. A human adenovirus 5 (hAd)-based nucleic acid comprising L4-33K.

74. A human adenovirus 5 (hAd)-based nucleic acid comprising L4-22K, L4-33K and L4P.

75. A cell comprising the nucleic acid according to any one of claims 1 to 69, the adenovirus according to claim 70, or the recombinant adeno-associated virus (rAAV) according to claim 71.

76. For use in the production of recombinant adeno-associated virus (rAAV), i) the nucleic acid according to any of claims 62 to 69, ii) an rAAV genome, and iii) transfection of a cell with an AAV capsid (cap) gene and a non-structural replication (rep) gene, giving the cell sufficient time to produce rAAV particles and producing a clarified lysate containing rAAV capsid particles. The cell according to claim 75 in a method comprising.

77. The cell according to claim 76, wherein the rAAV particles in the clarified lysate comprise at least about 25% to at least about 30% full capsid particles.

78. The cell according to claim 76, wherein the rAAV capsid particles in the clarified lysate comprise at least about 25% to at least about 30% full capsid particles, and the rAAV is produced using the hAd5-based nucleic acid (SEQ ID NO: 1 or SEQ ID NO: 31) of the present invention.

79. The cell according to claim 76, wherein the rAAV in the clarified lysate comprises at least about 1.5-fold higher full capsid particles having SEQ ID NO: 1 or SEQ ID NO: 31 when compared to the rAAV in the clarified lysate produced with the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO:

92.

80. A method for producing recombinant adeno-associated virus (rAAV), comprising: i) the nucleic acid according to any one of claims 1 to 69; ii) an rAAV genome comprising a transgene; and iii) transfecting a cell with an AAV helper Rep-Cap gene encoding an AAV capsid and non-structural replication genes, and giving the cell sufficient time to produce rAAV particles.

81. The method according to claim 80, further comprising generating a clarified lysate from a bioreactor.

82. The method according to claim 81, wherein the clarified lysate comprises rAAV having at least about 30% full capsid particles.

83. The method according to any one of claims 80 to 82, wherein the clarified lysate comprises rAAV having at least about 1.5-fold more amount or percentage of full capsid particles when compared to the rAAV in the clarified lysate produced using the nucleic acid shown in SEQ ID NO: 66, SEQ ID NO: 67, or SEQ ID NO:

92.

84. The method according to claim 80, wherein the rAAV genome comprises a transgene.

85. The method according to claim 80, wherein the rAAV genome and / or AAV capsid and non-structural replication genes are in the form of a plasmid and / or a cDNA sequence.

86. The method according to claim 80, wherein the cell is a suspension cell.

87. The method according to claim 86, wherein the suspended cells are mammalian cells.

88. The method according to claim 87, wherein the cells are HEK293.

89. The method according to claim 88, further comprising expanding the cells to produce a cell mass sufficient for seeding the bioreactor.

90. The method according to any one of claims 80 to 89, wherein the bioreactor is at least 25 L scale.

91. The method according to any one of claims 80 to 90, wherein the bioreactor is a stirred production bioreactor.

92. The method according to any one of claims 80 to 91, wherein the cells are expanded to produce a cell mass sufficient for seeding the stirred production bioreactor.

93. The method according to any one of claims 80 to 92, wherein the stirred production bioreactor is at least 250 L scale.

94. The method according to claim 80, wherein the step of transfecting comprises using polyethyleneimine.

95. The method according to claim 80, wherein the step of harvesting comprises harvesting the suspended cells.

96. The method according to claim 89, wherein the cells are harvested at least 72 hours after the step of transfecting.

97. The method according to claim 96, wherein the harvesting comprises lysing the suspended cells and purifying the rAAV virions.

98. The method according to claim 97, wherein the step of lysing comprises chemical lysis.

99. The method according to claim 97, wherein the step of purifying comprises a purification method selected from the group consisting of affinity capture chromatography, iodixanol density gradient centrifugation, and quaternary amine chromatography resin.

100. A method for producing recombinant adeno-associated virus (rAAV), comprising: i) SEQ ID NO: 1 or SEQ ID NO: 31, ii) an rAAV genome containing a transgene, and iii) transfecting a cell with an AAV helper Rep-Cap gene encoding an AAV capsid and non-structural replication genes, and giving the cell sufficient time to produce rAAV particles.

101. The method according to claim 100, wherein the cells are cultured for a sufficient time and under conditions such that at least the polypeptide encoded by SEQ ID NO: 5 or the polypeptide encoded by SEQ ID NO: 6 is expressed.

102. The method according to claim 100, wherein the cells are cultured for a sufficient time and under conditions such that at least one polypeptide encoded by SEQ ID NO: 1 or SEQ ID NO: 31 is expressed.

103. A method for producing virus particles, comprising: a) providing the cells according to claim 77; b) culturing the cells for a sufficient time and under conditions such that at least the polypeptide encoded by SEQ ID NO: 5 or the polypeptide encoded by SEQ ID NO: 6 is expressed, or at least one polypeptide encoded by SEQ ID NO: 1 or SEQ ID NO: 31 is expressed; c) culturing the cells under conditions under which virus particles are produced; d) isolating the virus particles, if necessary and a method comprising the steps of:

104. The method according to claim 103, further comprising a sequence having at least 85% sequence identity with SEQ ID NO: 93 and / or a sequence having at least 85% sequence identity with SEQ ID NO:

94.

105. The method according to claim 104, wherein SEQ ID NO: 93 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region.

106. The method according to claim 104, wherein SEQ ID NO: 94 is downstream of the 3' end of the nucleic acid sequence encoding the E2A region.

107. The method according to claim 104, wherein SEQ ID NO: 94 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region.

108. The method according to claim 104, wherein SEQ ID NO: 93 is downstream of the 3' end of the nucleic acid sequence encoding the E2A region.

109. The method according to claims 104 to 108, wherein SEQ ID NO: 94 is upstream of the 5' end of the nucleic acid sequence encoding the E4 region and SEQ ID NO: 93 is not located at the 3' end of the nucleic acid sequence encoding the E2A region.

110. The method according to claims 104 to 109, wherein the hAd5-based nucleic acid is clDNA.

111. The method according to claim 110, wherein the clDNA further comprises a telomerase binding site.

112. The method according to claims 104 to 111, wherein SEQ ID NO: 93 is located between the telomerase binding site (TelRL) and the 5' end of the E4 region, and SEQ ID NO: 94 is located between the telomerase binding site (TelRL) and the 3' end of the E2A region.

113. The method according to claims 104 to 111, wherein SEQ ID NO: 94 is located between the telomerase binding site (TelRL) and the 5' end of the E4 region, and SEQ ID NO: 93 is located between the telomerase binding site (TelRL) and the 3' end of the E2A region.

114. The method according to claims 104 to 111, wherein SEQ ID NO: 94 is located between the telomerase binding site and upstream of the 5' end of the E4 region, and the nucleic acid does not contain SEQ ID NO:

93.

115. A helper nucleic acid comprising an E2A region, an E4 region, and a VA RNA region, and not containing one or more of at least one packaging protein, at least one structural protein, a major late promoter (MLP), an E1 region, and / or an E3 region.

116. The nucleic acid according to claim 115, wherein the nucleic acid contains SEQ ID NO:

95.

117. A helper nucleic acid comprising an E2A region, an E4 region, and a VA RNA region, and not containing one or more of at least one packaging protein, at least one structural protein, a major late promoter (MLP), an E1 region, and / or an E3 region.

118. The nucleic acid according to claim 117, wherein the nucleic acid contains SEQ ID NO: 96.